Sample records for activation dna fragmentation

  1. Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tully, D.B.; Cidlowski, J.A.

    1989-03-07

    Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins priormore » to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.« less

  2. Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

    2016-03-01

    We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

  3. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    PubMed

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  4. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    PubMed

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  5. A selective plasmin inhibitor, trans-aminomethylcyclohexanecarbonyl-L-(O-picolyl)tyrosine-octylamide (YO-2), induces thymocyte apoptosis.

    PubMed

    Lee, Eibai; Enomoto, Riyo; Takemura, Kazu; Tsuda, Yuko; Okada, Yoshio

    2002-04-01

    The treatment of rat thymocytes with YO-2, a novel inhibitor of plasmin, resulted in an increase in DNA fragmentation. DNA fragmentation was also induced by another YO compounds such as YO-0, -3, -4 and -5. These YO compounds are the inhibitor of plasmin activity. On the other hand, YO-1, -6 and -8 that hardly inhibit plasmin activity had no effect on DNA fragmentation. Analysis of fragmented DNA from thymocytes treated with YO-2 by agarose gel electrophoresis revealed that the compound caused internucleosomal DNA fragmentation. In addition, judging from a laser scanning microscopy, annexin V-positive and propidium iodide-negative cells were increased by the treatment of the cells with the compound. Moreover, chromatin condensation was observed in thymocytes treated with the compound. These results demonstrated that YO-2 induces thymocyte apoptosis. There seemed to be some correlation between the apoptosis induced by YO compounds and their plasmin inhibitory effect. However, because the other protease inhibitors including pepstatin A, leupeptin, AEBSF, DFP and E-64-d did not affect DNA fragmentation, YO compounds are likely to have unique mechanism on plasmin or to show the effect on the other plasmin-like proteases. The plasmin inhibitory activity may have an important role in YO-2-induced apoptosis. Furthermore, the stimulations of caspase-8, -9 and -3-like activities were observed in thymocytes treated with YO-2. These results suggest that YO-2 induces thymocyte apoptosis via activation of caspase cascade.

  6. Chromatin Collapse during Caspase-dependent Apoptotic Cell Death Requires DNA Fragmentation Factor, 40-kDa Subunit-/Caspase-activated Deoxyribonuclease-mediated 3′-OH Single-strand DNA Breaks*

    PubMed Central

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Sánchez-Osuna, María; Casanelles, Elisenda; García-Belinchón, Mercè; Comella, Joan X.; Yuste, Victor J.

    2013-01-01

    Apoptotic nuclear morphology and oligonucleosomal double-strand DNA fragments (also known as DNA ladder) are considered the hallmarks of apoptotic cell death. From a classic point of view, these two processes occur concomitantly. Once activated, DNA fragmentation factor, 40-kDa subunit (DFF40)/caspase-activated DNase (CAD) endonuclease hydrolyzes the DNA into oligonucleosomal-size pieces, facilitating the chromatin package. However, the dogma that the apoptotic nuclear morphology depends on DNA fragmentation has been questioned. Here, we use different cellular models, including MEF CAD−/− cells, to unravel the mechanism by which DFF40/CAD influences chromatin condensation and nuclear collapse during apoptosis. Upon apoptotic insult, SK-N-AS cells display caspase-dependent apoptotic nuclear alterations in the absence of internucleosomal DNA degradation. The overexpression of a wild-type form of DFF40/CAD endonuclease, but not of different catalytic-null mutants, restores the cellular ability to degrade the chromatin into oligonucleosomal-length fragments. We show that apoptotic nuclear collapse requires a 3′-OH endonucleolytic activity even though the internucleosomal DNA degradation is impaired. Moreover, alkaline unwinding electrophoresis and In Situ End-Labeling (ISEL)/In Situ Nick Translation (ISNT) assays reveal that the apoptotic DNA damage observed in the DNA ladder-deficient SK-N-AS cells is characterized by the presence of single-strand nicks/breaks. Apoptotic single-strand breaks can be impaired by DFF40/CAD knockdown, abrogating nuclear collapse and disassembly. In conclusion, the highest order of chromatin compaction observed in the later steps of caspase-dependent apoptosis relies on DFF40/CAD-mediated DNA damage by generating 3′-OH ends in single-strand rather than double-strand DNA nicks/breaks. PMID:23430749

  7. [Microbial community structure in bio-ceramics and biological activated carbon analyzed by PCR-SSCP technique].

    PubMed

    Liu, Xiao-Lin; Liu, Wen-Jun

    2007-04-01

    Analyses of microbial community structure in bio-ceramics (BC) and biological activated carbon (BAC), which widely used in drinking water treatment were performed by polymerase-chain-reaction-single-strand-conformation-polymorphism (PCR-SSCP) targeted eubacterial 16S ribosomal RNA gene. Microorganisms on bio-ceramics and biological activated carbon were detached by ultrasonic, culturing on R2A and LB agar, respectively, followed by genome DNA extracting. Results show that larger than 10 kb genome DNA could be extracted from all the samples except the BAC samples processed by ultrasonic. However, quantities of the extracted DNA were different. 408 bp gene fragments were observed after PCR using the extracted genome DNA as templates. These gene fragments were digested with lambda exonuclease followed by SSCP electrophoresis. Same SSCP profiles were observed between ultrasonic eluting, R2A and LB agar culturing. The identity of the segment from bio-ceramics with uncultured Pseudomonas sp. Clone FTL201 16S rDNA (GenBank, AF509293.1) fragment was 92%, and identities of the two segments from BAC with Bacillus sp. JH19 16S rDNA (GenBank , DQ232748.1) fragment and Bacterium VA-S-11 16S rDNA (GenBank, AY395279.1) fragment were 100% and 99%, respectively.

  8. Metronidazole activation and isolation of Clostridium acetobutylicum electron transport genes.

    PubMed Central

    Santangelo, J D; Jones, D T; Woods, D R

    1991-01-01

    An Escherichia coli F19 recA, nitrate reductase-deficient mutant was constructed by transposon mutagenesis and shown to be resistant to metronidazole. This mutant was a most suitable host for the isolation of Clostridium acetobutylicum genes on recombinant plasmids, which activated metronidazole and rendered the E. coli F19 strain sensitive to metronidazole. Twenty-five E. coli F19 clones containing different recombinant plasmids were isolated and classified into five groups on the basis of their sensitivity to metronidazole. The clones were tested for nitrate reductase, pyruvate-ferredoxin oxidoreductase, and hydrogenase activities. DNA hybridization and restriction endonuclease mapping revealed that four of the C. acetobutylicum insert DNA fragments on recombinant plasmids were linked in an 11.1-kb chromosomal fragment. DNA sequencing and amino acid homology studies indicated that this DNA fragment contained a flavodoxin gene which encoded a protein of 160 amino acids that activated metronidazole and made the E. coli F19 mutant very sensitive to metronidazole. The flavodoxin and hydrogenase genes which are involved in electron transfer systems were linked on the 11.1-kb DNA fragment from C. acetobutylicum. Images PMID:1991710

  9. Methods of introducing nucleic acids into cellular DNA

    DOEpatents

    Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

    2017-06-27

    A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

  10. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    PubMed

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  11. E1B and E4 oncoproteins of adenovirus antagonize the effect of apoptosis inducing factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Turner, Roberta L.; Wilkinson, John C., E-mail: john.wilkinson@ndsu.edu; Ornelles, David A., E-mail: ornelles@wakehealth.edu

    2014-05-15

    Adenovirus inundates the productively infected cell with linear, double-stranded DNA and an abundance of single-stranded DNA. The cellular response to this stimulus is antagonized by the adenoviral E1B and E4 early genes. A mutant group C adenovirus that fails to express the E1B-55K and E4ORF3 genes is unable to suppress the DNA-damage response. Cells infected with this double-mutant virus display significant morphological heterogeneity at late times of infection and frequently contain fragmented nuclei. Nuclear fragmentation was due to the translocation of apoptosis inducing factor (AIF) from the mitochondria into the nucleus. The release of AIF was dependent on active poly(ADP-ribose)more » polymerase-1 (PARP-1), which appeared to be activated by viral DNA replication. Nuclear fragmentation did not occur in AIF-deficient cells or in cells treated with a PARP-1 inhibitor. The E1B-55K or E4ORF3 proteins independently prevented nuclear fragmentation subsequent to PARP-1 activation, possibly by altering the intracellular distribution of PAR-modified proteins. - Highlights: • E1B-55K or E4orf3 prevents nuclear fragmentation. • Nuclear fragmentation requires AIF and PARP-1 activity. • Adenovirus DNA replication activates PARP-1. • E1B-55K or E4orf3 proteins alter the distribution of PAR.« less

  12. The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes

    NASA Astrophysics Data System (ADS)

    Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan

    2016-07-01

    Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.

  13. Microtubule antagonists activate programmed cell death (apoptosis) in cultured rat hepatocytes.

    PubMed Central

    Tsukidate, K.; Yamamoto, K.; Snyder, J. W.; Farber, J. L.

    1993-01-01

    We investigated the mechanism of lethal injury following the disruption of microtubules in cultured hepatocytes treated with vinblastine (VBL) or colchicine (COL). These agents kill hepatocytes by a process readily distinguished from two well-known pathways that lead to a loss of viability, namely, oxidative stress and inhibition of mitochondrial electron transport. Cell killing with VBL and COL was accompanied by fragmentation of DNA. Both the loss of viability and the fragmentation of DNA were prevented by the inhibition of protein synthesis within 6 hours following exposure to VBL or COL. Cell death and the fragmentation of DNA were also prevented when Ca2+ was removed from the culture medium. By contrast, the inhibition of protein kinase C prevented cell killing by VBL or COL, but did not alter the extent of DNA fragmentation. The requirements here for protein synthesis, extracellular Ca2+, and protein kinase C activity define a model of apoptosis, or programmed cell death, that seems to involve mechanisms that can be dissociated from the fragmentation of DNA. Images Figure 2 PMID:8362985

  14. Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently

    PubMed Central

    Yu, Chuanhe; Gan, Haiyun

    2017-01-01

    ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720

  15. Oxidative stress negatively affects human sperm mitochondrial respiration.

    PubMed

    Ferramosca, Alessandra; Pinto Provenzano, Sara; Montagna, Daniela Domenica; Coppola, Lamberto; Zara, Vincenzo

    2013-07-01

    To correlate the level of oxidative stress in serum and seminal fluid and the level of sperm deoxyribonucleic acid (DNA) fragmentation with sperm mitochondrial respiratory efficiency. Sperm mitochondrial respiratory activity was evaluated with a polarographic assay of oxygen consumption carried out in hypotonically treated sperm cells. A possible relationship between sperm mitochondrial respiratory efficiency, the level of oxidative stress, and the level of sperm DNA fragmentation was investigated. Sperm motility was positively correlated with mitochondrial respiration but negatively correlated with oxidative stress and DNA fragmentation. Interestingly, sperm mitochondrial respiratory activity was negatively affected by oxidative stress and DNA fragmentation. Our data indicate that sperm mitochondrial respiration is decreased in patients with high levels of reactive oxygen species by an uncoupling between electron transport and adenosine triphosphate synthesis. This reduction in mitochondrial functionality might be 1 of the reasons responsible for the decrease in spermatozoa motility. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Identifying sites of replication initiation in yeast chromosomes: looking for origins in all the right places.

    PubMed

    van Brabant, A J; Hunt, S Y; Fangman, W L; Brewer, B J

    1998-06-01

    DNA fragments that contain an active origin of replication generate bubble-shaped replication intermediates with diverging forks. We describe two methods that use two-dimensional (2-D) agarose gel electrophoresis along with DNA sequence information to identify replication origins in natural and artificial Saccharomyces cerevisiae chromosomes. The first method uses 2-D gels of overlapping DNA fragments to locate an active chromosomal replication origin within a region known to confer autonomous replication on a plasmid. A variant form of 2-D gels can be used to determine the direction of fork movement, and the second method uses this technique to find restriction fragments that are replicated by diverging forks, indicating that a bidirectional replication origin is located between the two fragments. Either of these two methods can be applied to the analysis of any genomic region for which there is DNA sequence information or an adequate restriction map.

  17. High-Efficiency Ligation and Recombination of DNA Fragments by Vertebrate Cells

    NASA Astrophysics Data System (ADS)

    Miller, Cynthia K.; Temin, Howard M.

    1983-05-01

    DNA-mediated gene transfer (transfection) is used to introduce specific genes into vertebrate cells. Events soon after transfection were quantitatively analyzed by determining the infectivity of the DNA from an avian retrovirus and of mixtures of subgenomic fragments of this DNA. The limiting step of transfection with two DNA molecules is the uptake by a single cell of both DNA's in a biologically active state. Transfected cells mediate ligation and recombination of physically unlinked DNA's at nearly 100 percent efficiency.

  18. Synchronization of DNA array replication kinetics

    NASA Astrophysics Data System (ADS)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2016-04-01

    In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

  19. Regulation of apoptosis of interleukin 2-dependent mouse T-cell line by protein tyrosine phosphorylation and polyamines.

    PubMed

    Min, A; Hasuma, T; Yano, Y; Matsui-Yuasa, I; Otani, S

    1995-12-01

    We examined the effect of inhibitors of tyrosine kinase and tyrosine phosphatase on DNA fragmentation, protein tyrosine phosphorylation, and polyamine metabolism in the murine T-cell line CTLL-2. When cells were exposed to herbimycin A, a specific inhibitor of tyrosine kinase (Uehara et al., 1989, Biochem. Biophys. Res. Commun., 163:803-809), in the presence of interleukin 2 (IL-2), DNA was degraded into oligonucleosomal fragments in a dose-dependent fashion. Genistein, another inhibitor of tyrosine kinase (Akiyama et al., 1987, J. Biol. Chem., 262:5592-5596), had similar effects. Exposure of CTLL-2 cells to vanadate, a tyrosine phosphatase inhibitor, blocked with the DNA fragmentation induced by herbimycin A. Tyrosine phosphorylation of 55 Kd protein was inhibited by herbimycin A, and the inhibition was reduced by vanadate. Ornithine decarboxylase (ODC) activity decreased rapidly after herbimycin A was added to CTLL-2 cell cultures, while vanadate increased ODC activity. The exogenous addition of putrescine or spermine, but not that of spermidine, attenuated herbimycin A-induced DNA fragmentation. These findings suggest that phosphorylation of tyrosine residues of 55 Kd protein prevents DNA fragmentation and that polyamines are involved in regulation of apoptosis.

  20. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    PubMed

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  1. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma

    PubMed Central

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-01-01

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mϕ) direct trauma-induced inflammation, and Mϕ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mϕ and the subsequent regulation of Mϕ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)–TLR4–MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mϕ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mϕ. However, autophagy activation also suppressed Mϕ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mϕ homeostasis in response to trauma. PMID:28492546

  2. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  3. Sulfolobus chromatin proteins modulate strand displacement by DNA polymerase B1

    PubMed Central

    Sun, Fei; Huang, Li

    2013-01-01

    Strand displacement by a DNA polymerase serves a key role in Okazaki fragment maturation, which involves displacement of the RNA primer of the preexisting Okazaki fragment into a flap structure, and subsequent flap removal and fragment ligation. We investigated the role of Sulfolobus chromatin proteins Sso7d and Cren7 in strand displacement by DNA polymerase B1 (PolB1) from the hyperthermophilic archaeon Sulfolobus solfataricus. PolB1 showed a robust strand displacement activity and was capable of synthesizing thousands of nucleotides on a DNA-primed 72-nt single-stranded circular DNA template. This activity was inhibited by both Sso7d and Cren7, which limited the flap length to 3–4 nt at saturating concentrations. However, neither protein inhibited RNA displacement on an RNA-primed single-stranded DNA minicircle by PolB1. Strand displacement remained sensitive to modulation by the chromatin proteins when PolB1 was in association with proliferating cell nuclear antigen. Inhibition of DNA instead of RNA strand displacement by the chromatin proteins is consistent with the finding that double-stranded DNA was more efficiently bound and stabilized than an RNA:DNA duplex by these proteins. Our results suggest that Sulfolobus chromatin proteins modulate strand displacement by PolB1, permitting efficient removal of the RNA primer while inhibiting excessive displacement of the newly synthesized DNA strand during Okazaki fragment maturation. PMID:23821667

  4. In vitro effect of cell phone radiation on motility, DNA fragmentation and clusterin gene expression in human sperm.

    PubMed

    Zalata, Adel; El-Samanoudy, Ayman Z; Shaalan, Dalia; El-Baiomy, Youssef; Mostafa, Taymour

    2015-01-01

    Use of cellular phones emitting radiofrequency electromagnetic field (RF-EMF) has been increased exponentially and become a part of everyday life. This study aimed to investigate the effects of in vitro RF-EMF exposure emitted from cellular phones on sperm motility index, sperm DNA fragmentation and seminal clusterin (CLU) gene expression. In this prospective study, a total of 124 semen samples were grouped into the following main categories: i. normozoospermia (N, n=26), ii. asthenozoospermia (A, n=32), iii. asthenoteratozoospermia (AT, n=31) and iv. oligoasthenoteratozoospermia (OAT, n=35). The same semen samples were then divided into two portions non-exposed and exposed samples to cell phone radiation for 1 hour. Before and immediately after exposure, both aliquots were subjected to different assessments for sperm motility, acrosin activity, sperm DNA fragmentation and CLU gene expression. Statistical differences were analyzed using paired t student test for comparisons between two sub-groups where p<0.05 was set as significant. There was a significant decrease in sperm motility, sperm linear velocity, sperm linearity index, and sperm acrosin activity, whereas there was a significant increase in sperm DNA fragmentation percent, CLU gene expression and CLU protein levels in the exposed semen samples to RF-EMF compared with non-exposed samples in OAT>AT>A>N groups, respectively (p<0.05). Cell phone emissions have a negative impact on exposed sperm motility index, sperm acrosin activity, sperm DNA fragmentation and seminal CLU gene expression, especially in OAT cases.

  5. Structures of minimal catalytic fragments of topoisomerase V reveals conformational changes relevant for DNA binding

    PubMed Central

    Rajan, Rakhi; Taneja, Bhupesh; Mondragón, Alfonso

    2010-01-01

    Summary Topoisomerase V is an archaeal type I topoisomerase that is unique among topoisomerases due to presence of both topoisomerase and DNA repair activities in the same protein. It is organized as an N-terminal topoisomerase domain followed by 24 tandem helix hairpin helix (HhH) motifs. Structural studies have shown that the active site is buried by the (HhH) motifs. Here we show that the N-terminal domain can relax DNA in the absence of any HhH motifs and that the HhH motifs are required for stable protein-DNA complex formation. Crystal structures of various topoisomerase V fragments show changes in the relative orientation of the domains mediated by a long bent linker helix, and these movements are essential for the DNA to enter the active site. Phosphate ions bound to the protein near the active site helped model DNA in the topoisomerase domain and shows how topoisomerase V may interact with DNA. PMID:20637419

  6. p53 and c-myc activation by Pasteurella haemolytica leukotoxin is correlated with bovine mononuclear cells apoptosis.

    PubMed

    Marcatili, A; D'Isanto, M; Vitiello, M; Galdiero, R; Galdiero, M

    2002-04-01

    To analyse the role of Pasteurella haemolytica Leukotoxin (LKT) in the mechanism of apoptotic cell death of bovine lymphocytes, we evaluated DNA fragmentation and p53 and c-myc expression. P. haemolytica strain ATCC 14003 was cultivated for LKT production. DNA fragmentation was analysed by electrophoresis on Agarose gel. DNA strand breaks in individual apoptotic cells were also detected by an in situ Terminal deoxy nucleotidyl Transferase (TdT). The Polymerase Chain Reaction (PCR) procedure was used for verified p53 and c-myc activation by P. haemolytica LKT. LKT was able to induce DNA fragmentation in a dose and time-dependent fashion. The greatest apoptotic effect was obtained using LKT at a concentration of 0.25 U. The results show that p53 and c-myc activation by LKT is correlated with apoptosis of bovine lymphocytes and monocytes. Our data suggest that LKT may have an important role in the bacterial virulence of Pasteurella haemolytica.

  7. Targeting different pathophysiological events after traumatic brain injury in mice: Role of melatonin and memantine.

    PubMed

    Kelestemur, Taha; Yulug, Burak; Caglayan, Ahmet Burak; Beker, Mustafa Caglar; Kilic, Ulkan; Caglayan, Berrak; Yalcin, Esra; Gundogdu, Reyhan Zeynep; Kilic, Ertugrul

    2016-01-26

    The tissue damage that emerges during traumatic brain injury (TBI) is a consequence of a variety of pathophysiological events, including free radical generation and over-activation of N-methyl-d-aspartate-type glutamate receptors (NMDAR). Considering the complex pathophysiology of TBI, we hypothesized that combination of neuroprotective compounds, targeting different events which appear during injury, may be a more promising approach for patients. In this context, both NMDAR antagonist memantine and free radical scavenger melatonin are safe in humans and promising agents for the treatment of TBI. Herein, we examined the effects of melatonin administered alone or in combination with memantine on the activation of signaling pathways, injury development and DNA fragmentation. Both compounds reduced brain injury moderately and the density of DNA fragmentation significantly. Notably, melatonin/memantine combination decreased brain injury and DNA fragmentation significantly, which was associated with reduced p38 and ERK-1/2 phosphorylation. As compared with melatonin and memantine groups, SAPK/JNK-1/2 phosphorylation was also reduced in melatonin/memantine combined animals. In addition, melatonin, memantine and their combination decreased iNOS activity significantly. Here, we provide evidence that melatonin/memantine combination protects brain from traumatic injury, which was associated with decreased DNA fragmentation, p38 phosphorylation and iNOS activity. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. DNA fragment sizing and sorting by laser-induced fluorescence

    DOEpatents

    Hammond, Mark L.; Jett, James H.; Keller, Richard A.; Marrone, Babetta L.; Martin, John C.

    1996-01-01

    A method is provided for sizing DNA fragments using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA piece or the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is linearly related to the fragment length. The distribution of DNA fragment sizes forms a characterization of the DNA piece for use in forensic and research applications.

  9. Extracellular self-DNA as a damage-associated molecular pattern (DAMP) that triggers self-specific immunity induction in plants.

    PubMed

    Duran-Flores, Dalia; Heil, Martin

    2017-10-16

    Mammals sense self or non-self extracellular or extranuclear DNA fragments (hereinafter collectively termed eDNA) as indicators of injury or infection and respond with immunity. We hypothesised that eDNA acts as a damage-associated molecular pattern (DAMP) also in plants and that it contributes to self versus non-self discrimination. Treating plants and suspension-cultured cells of common bean (Phaseolus vulgaris) with fragmented self eDNA (obtained from other plants of the same species) induced early, immunity-related signalling responses such as H 2 O 2 generation and MAPK activation, decreased the infection by a bacterial pathogen (Pseudomonas syringae) and increased an indirect defence to herbivores (extrafloral nectar secretion). By contrast, non-self DNA (obtained from lima bean, Phaseolus lunatus, and Acacia farnesiana) had significantly lower or no detectable effects. Only fragments below a size of 700 bp were active, and treating the eDNA preparation DNAse abolished its inducing effects, whereas treatment with RNAse or proteinase had no detectable effect. These findings indicate that DNA fragments, rather than small RNAs, single nucleotides or proteins, accounted for the observed effects. We suggest that eDNA functions a DAMP in plants and that plants discriminate self from non-self at a species-specific level. The immune systems of plants and mammals share multiple central elements, but further work will be required to understand the mechanisms and the selective benefits of an immunity response that is triggered by eDNA in a species-specific manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Influence of backwashing on the microbial community in a biofilm developed on biological activated carbon used in a drinking water treatment plant.

    PubMed

    Kasuga, I; Shimazaki, D; Kunikane, S

    2007-01-01

    The influence of backwashing on the biofilm community developed on biological activated carbon (BAC) used in a drinking water treatment plant was investigated by means of bacterial cell enumeration and terminal-restriction fragment length polymorphism (T-RFLP) fingerprinting analysis of bacterial and eukaryotic ribosomal RNA genes (rDNA). After backwashing, the attached bacterial abundance in the top layer of the BAC bed decreased to 64% of that before backwashing. The community level changes caused by backwashing were examined through the T-RFLP profiles. In the bacterial 16S rDNA analysis, the relative abundances of some terminal-restriction fragments (T-RFs) including the Planctomycetes-derived fragment increased; however, the relative abundances of some T-RFs including the Betaproteobacteria-derived fragments decreased. In the eukaryotic 18S rDNA analysis, the relative abundances of some T-RFs including the protozoan Cercozoa-derived fragments increased; however, the relative abundances of some T-RFs including the metazoan Chaetonotus- and Paratripyla-derived fragments decreased. The T-RFLP analysis suggests that backwashing can cause changes in the relative compositions of microorganisms in a BAC biofilm in the top layer of the bed.

  11. Physical and functional interactions of Caenorhabditis elegans WRN-1 helicase with RPA-1.

    PubMed

    Hyun, Moonjung; Park, Sojin; Kim, Eunsun; Kim, Do-Hyung; Lee, Se-Jin; Koo, Hyeon-Sook; Seo, Yeon-Soo; Ahn, Byungchan

    2012-02-21

    The Caenorhabditis elegans Werner syndrome protein, WRN-1, a member of the RecQ helicase family, has a 3'-5' DNA helicase activity. Worms with defective wrn-1 exhibit premature aging phenotypes and an increased level of genome instability. In response to DNA damage, WRN-1 participates in the initial stages of checkpoint activation in concert with C. elegans replication protein A (RPA-1). WRN-1 helicase is stimulated by RPA-1 on long DNA duplex substrates. However, the mechanism by which RPA-1 stimulates DNA unwinding and the function of the WRN-1-RPA-1 interaction are not clearly understood. We have found that WRN-1 physically interacts with two RPA-1 subunits, CeRPA73 and CeRPA32; however, full-length WRN-1 helicase activity is stimulated by only the CeRPA73 subunit, while the WRN-1(162-1056) fragment that harbors the helicase activity requires both the CeRPA73 and CeRPA32 subunits for the stimulation. We also found that the CeRPA73(1-464) fragment can stimulate WRN-1 helicase activity and that residues 335-464 of CeRPA73 are important for physical interaction with WRN-1. Because CeRPA73 and the CeRPA73(1-464) fragment are able to bind single-stranded DNA (ssDNA), the stimulation of WRN-1 helicase by RPA-1 is most likely due to the ssDNA binding activity of CeRPA73 and the direct interaction of WRN-1 and CeRPA73.

  12. Linear mtDNA fragments and unusual mtDNA rearrangements associated with pathological deficiency of MGME1 exonuclease

    PubMed Central

    Nicholls, Thomas J.; Zsurka, Gábor; Peeva, Viktoriya; Schöler, Susanne; Szczesny, Roman J.; Cysewski, Dominik; Reyes, Aurelio; Kornblum, Cornelia; Sciacco, Monica; Moggio, Maurizio; Dziembowski, Andrzej; Kunz, Wolfram S.; Minczuk, Michal

    2014-01-01

    MGME1, also known as Ddk1 or C20orf72, is a mitochondrial exonuclease found to be involved in the processing of mitochondrial DNA (mtDNA) during replication. Here, we present detailed insights on the role of MGME1 in mtDNA maintenance. Upon loss of MGME1, elongated 7S DNA species accumulate owing to incomplete processing of 5′ ends. Moreover, an 11-kb linear mtDNA fragment spanning the entire major arc of the mitochondrial genome is generated. In contrast to control cells, where linear mtDNA molecules are detectable only after nuclease S1 treatment, the 11-kb fragment persists in MGME1-deficient cells. In parallel, we observed characteristic mtDNA duplications in the absence of MGME1. The fact that the breakpoints of these mtDNA rearrangements do not correspond to either classical deletions or the ends of the linear 11-kb fragment points to a role of MGME1 in processing mtDNA ends, possibly enabling their repair by homologous recombination. In agreement with its functional involvement in mtDNA maintenance, we show that MGME1 interacts with the mitochondrial replicase PolgA, suggesting that it is a constituent of the mitochondrial replisome, to which it provides an additional exonuclease activity. Thus, our results support the viewpoint that MGME1-mediated mtDNA processing is essential for faithful mitochondrial genome replication and might be required for intramolecular recombination of mtDNA. PMID:24986917

  13. A simple method for semi-random DNA amplicon fragmentation using the methylation-dependent restriction enzyme MspJI.

    PubMed

    Shinozuka, Hiroshi; Cogan, Noel O I; Shinozuka, Maiko; Marshall, Alexis; Kay, Pippa; Lin, Yi-Han; Spangenberg, German C; Forster, John W

    2015-04-11

    Fragmentation at random nucleotide locations is an essential process for preparation of DNA libraries to be used on massively parallel short-read DNA sequencing platforms. Although instruments for physical shearing, such as the Covaris S2 focused-ultrasonicator system, and products for enzymatic shearing, such as the Nextera technology and NEBNext dsDNA Fragmentase kit, are commercially available, a simple and inexpensive method is desirable for high-throughput sequencing library preparation. MspJI is a recently characterised restriction enzyme which recognises the sequence motif CNNR (where R = G or A) when the first base is modified to 5-methylcytosine or 5-hydroxymethylcytosine. A semi-random enzymatic DNA amplicon fragmentation method was developed based on the unique cleavage properties of MspJI. In this method, random incorporation of 5-methyl-2'-deoxycytidine-5'-triphosphate is achieved through DNA amplification with DNA polymerase, followed by DNA digestion with MspJI. Due to the recognition sequence of the enzyme, DNA amplicons are fragmented in a relatively sequence-independent manner. The size range of the resulting fragments was capable of control through optimisation of 5-methyl-2'-deoxycytidine-5'-triphosphate concentration in the reaction mixture. A library suitable for sequencing using the Illumina MiSeq platform was prepared and processed using the proposed method. Alignment of generated short reads to a reference sequence demonstrated a relatively high level of random fragmentation. The proposed method may be performed with standard laboratory equipment. Although the uniformity of coverage was slightly inferior to the Covaris physical shearing procedure, due to efficiencies of cost and labour, the method may be more suitable than existing approaches for implementation in large-scale sequencing activities, such as bacterial artificial chromosome (BAC)-based genome sequence assembly, pan-genomic studies and locus-targeted genotyping-by-sequencing.

  14. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

    PubMed Central

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

    2012-01-01

    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  15. Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pröpper, Kevin; Instituto de Biologia Molecular de Barcelona; Meindl, Kathrin

    2014-06-01

    The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite themore » fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.« less

  16. What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?

    NASA Astrophysics Data System (ADS)

    Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan

    2017-12-01

    Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.

  17. Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

    NASA Astrophysics Data System (ADS)

    Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

    2016-11-01

    The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

  18. A glass fiber/diethylaminoethyl double filter binding assay that measures apoptotic internucleosomal DNA fragmentation.

    PubMed

    Erusalimsky, J D; John, J; Hong, Y; Moore, M

    1996-11-15

    A filter binding assay that measures internucleosomal DNA fragmentation associated with apoptosis is described. The assay is based on a novel principle that consists of using simultaneously two kinds of glass fiber filters to harvest [3H]thymidine-prelabeled cells following their incubation with inducers of apoptosis. One filter, which is neutral, traps intact chromatin and high-molecular-weight DNA. The other filter, which is positively charged with DEAE active groups, traps low-molecular-weight DNA fragments. DNA fragmentation is quantified by measuring the radioactivity retained by each of the filters. The assay was evaluated with the histiocytic lymphoma cell line U937 and the topoisomerase inhibitors camptothecin, etoposide, and doxorubicin. These agents caused a dose-dependent decrease of radioactivity in the neutral filter and a parallel increase of radioactivity in the DEAE filter. Irradiation-induced single strand breaks and topoisomerase-mediated primary DNA damage were not detected by this method. Consistent with the detection of internucleosomal DNA fragmentation, the effects measured by this assay were prevented by the endonuclease inhibitor zinc acetate and by the metabolic inhibitor sodium azide. Results obtained using this assay were validated by observation of DNA ladders on agarose gels and by morphologic examination of apoptotic features. Evaluation of the assay in a mock screen demonstrated that the introduction of the DEAE filter increases the assay sensitivity and eliminates false positives. Thus, this assay may be used in high-throughput screening approaches to discover novel modulators of apoptosis.

  19. Investigation on the Origin of Sperm DNA Fragmentation: Role of Apoptosis, Immaturity and Oxidative Stress

    PubMed Central

    Muratori, Monica; Tamburrino, Lara; Marchiani, Sara; Cambi, Marta; Olivito, Biagio; Azzari, Chiara; Forti, Gianni; Baldi, Elisabetta

    2015-01-01

    Sperm DNA fragmentation (sDF) represents a threat to male fertility, human reproduction and the health of the offspring. The causes of sDF are still unclear, even if apoptosis, oxidative assault and defects in chromatin maturation are hypothesized. Using multicolor flow cytometry and sperm sorting, we challenged the three hypothesized mechanisms by simultaneously evaluating sDF and signs of oxidative damage (8-hydroxy, 2′-deoxyguanosine [8-OHdG] and malondialdehyde [MDA]), apoptosis (caspase activity and cleaved poly[ADP-ribose] polymerase [cPARP]) and sperm immaturity (creatine phosphokinase [CK] and excess of residual histones). Active caspases and c-PARP were concomitant with sDF in a high percentage of spermatozoa (82.6% ± 9.1% and 53.5% ± 16.4%, respectively). Excess of residual histones was significantly higher in DNA-fragmented sperm versus sperm without DNA fragmentation (74.8% ± 17.5% and 37.3% ± 16.6%, respectively, p < 0.005), and largely concomitant with active caspases. Conversely, oxidative damage was scarcely concomitant with sDF in the total sperm population, at variance with live sperm, where 8-OHdG and MDA were clearly associated to sDF. In addition, most live cells with active caspase also showed 8-OHdG, suggesting activation of apoptotic pathways in oxidative-injured live cells. This is the first investigation on the origin of sDF directly evaluating the simultaneous presence of the signs of the hypothesized mechanisms with DNA breaks at the single cell level. The results indicate that the main pathway leading to sperm DNA breaks is a process of apoptosis, likely triggered by an impairment of chromatin maturation in the testis and by oxidative stress during the transit in the male genital tract. These findings are highly relevant for clinical studies on the effects of drugs on sDF and oxidative stress in infertile men and for the development of new therapeutic strategies. PMID:25786204

  20. Micronuclear DNA of Oxytricha nova contains sequences with autonomously replicating activity in Saccharomyces cerevisiae.

    PubMed Central

    Colombo, M M; Swanton, M T; Donini, P; Prescott, D M

    1984-01-01

    Oxytricha nova is a hypotrichous ciliate with micronuclei and macronuclei. Micronuclei, which contain large, chromosomal-sized DNA, are genetically inert but undergo meiosis and exchange during cell mating. Macronuclei, which contain only small, gene-sized DNA molecules, provide all of the nuclear RNA needed to run the cell. After cell mating the macronucleus is derived from a micronucleus, a derivation that includes excision of the genes from chromosomes and elimination of the remaining DNA. The eliminated DNA includes all of the repetitious sequences and approximately 95% of the unique sequences. We cloned large restriction fragments from the micronucleus that confer replication ability on a replication-deficient plasmid in Saccharomyces cerevisiae. Sequences that confer replication ability are called autonomously replicating sequences. The frequency and effectiveness of autonomously replicating sequences in micronuclear DNA are similar to those reported for DNAs of other organisms introduced into yeast cells. Of the 12 micronuclear fragments with autonomously replicating sequence activity, 9 also showed homology to macronuclear DNA, indicating that they contain a macronuclear gene sequence. We conclude from this that autonomously replicating sequence activity is nonrandomly distributed throughout micronuclear DNA and is preferentially associated with those regions of micronuclear DNA that contain genes. Images PMID:6092934

  1. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    PubMed Central

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  2. 20 years since the introduction of DNA barcoding: from theory to application.

    PubMed

    Fišer Pečnikar, Živa; Buzan, Elena V

    2014-02-01

    Traditionally, taxonomic identification has relied upon morphological characters. In the last two decades, molecular tools based on DNA sequences of short standardised gene fragments, termed DNA barcodes, have been developed for species discrimination. The most common DNA barcode used in animals is a fragment of the cytochrome c oxidase (COI) mitochondrial gene, while for plants, two chloroplast gene fragments from the RuBisCo large subunit (rbcL) and maturase K (matK) genes are widely used. Information gathered from DNA barcodes can be used beyond taxonomic studies and will have far-reaching implications across many fields of biology, including ecology (rapid biodiversity assessment and food chain analysis), conservation biology (monitoring of protected species), biosecurity (early identification of invasive pest species), medicine (identification of medically important pathogens and their vectors) and pharmacology (identification of active compounds). However, it is important that the limitations of DNA barcoding are understood and techniques continually adapted and improved as this young science matures.

  3. Use of DNA markers in forest tree improvement research

    Treesearch

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  4. Mouse Spermatozoa Contain a Nuclease that Is Activated by Pretreatment with EGTA and Subsequent Calcium Incubation

    PubMed Central

    Boaz, Segal M.; Dominguez, Kenneth; Shaman, Jeffrey A.; Ward, W. Steven

    2009-01-01

    We demonstrated that mouse spermatozoa cleave their DNA into ~50 kb loop-sized fragments with topoisomerase IIB when treated with MnCl2 and CaCl2 in a process we term sperm chromatin fragmentation (SCF). SCF can be reversed by EDTA. A nuclease then further degrades the DNA in a process we term sperm DNA degradation (SDD). MnCl2 alone could elicit this activity, but CaCl2 had no effect. Here, we demonstrate the existence of a nuclease in the vas deferens that can be activated by EGTA to digest the sperm DNA by SDD. Spermatozoa were extracted with salt and dithiothreitol to remove protamines and then incubated with EGTA. Next, the EGTA was removed and divalent cations were added. We found that Mn+2, Ca+2, or Zn+2 could each activate SDD in spermatozoa but Mg+2 could not. When the reaction was slowed by incubation on ice, EGTA pretreatment followed by incubation in Ca+2 elicited the reversible fragmentation of sperm DNA evident in SCF. When the reactions were then incubated at 37°C they progressed to the more complete degradation of DNA by SDD. EDTA could also be used to activate the nuclease, but required a higher concentration than EGTA. This EGTA-activatable nuclease activity was found in each fraction of the vas deferens plasma: in the spermatozoa, in the surrounding fluid, and in the insoluble components in the fluid. These results suggest that this sperm nuclease is regulated by a mechanism that is sensitive to EGTA, possibly by removing inhibition of a calcium binding protein. PMID:17879959

  5. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    PubMed

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Scar-less multi-part DNA assembly design automation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hillson, Nathan J.

    The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

  7. Rad52/Rad59-dependent Recombination as a Means to Rectify Faulty Okazaki Fragment Processing*

    PubMed Central

    Lee, Miju; Lee, Chul-Hwan; Demin, Annie Albert; Munashingha, Palinda Ruvan; Amangyeld, Tamir; Kwon, Buki; Formosa, Tim; Seo, Yeon-Soo

    2014-01-01

    The correct removal of 5′-flap structures by Rad27 and Dna2 during Okazaki fragment maturation is crucial for the stable maintenance of genetic materials and cell viability. In this study, we identified RAD52, a key recombination protein, as a multicopy suppressor of dna2-K1080E, a lethal helicase-negative mutant allele of DNA2 in yeasts. In contrast, the overexpression of Rad51, which works conjointly with Rad52 in canonical homologous recombination, failed to suppress the growth defect of the dna2-K1080E mutation, indicating that Rad52 plays a unique and distinct role in Okazaki fragment metabolism. We found that the recombination-defective Rad52-QDDD/AAAA mutant did not rescue dna2-K1080E, suggesting that Rad52-mediated recombination is important for suppression. The Rad52-mediated enzymatic stimulation of Dna2 or Rad27 is not a direct cause of suppression observed in vivo, as both Rad52 and Rad52-QDDD/AAAA proteins stimulated the endonuclease activities of both Dna2 and Rad27 to a similar extent. The recombination mediator activity of Rad52 was dispensable for the suppression, whereas both the DNA annealing activity and its ability to interact with Rad59 were essential. In addition, we found that several cohesion establishment factors, including Rsc2 and Elg1, were required for the Rad52-dependent suppression of dna2-K1080E. Our findings suggest a novel Rad52/Rad59-dependent, but Rad51-independent recombination pathway that could ultimately lead to the removal of faulty flaps in conjunction with cohesion establishment factors. PMID:24711454

  8. A comparison of DNA fragmentation methods - Applications for the biochip technology.

    PubMed

    Sapojnikova, Nelly; Asatiani, Nino; Kartvelishvili, Tamar; Asanishvili, Lali; Zinkevich, Vitaly; Bogdarina, Irina; Mitchell, Julian; Al-Humam, Abdulmohsen

    2017-08-20

    The efficiency of hybridization signal detection in a biochip is affected by the method used for test DNA preparation, such as fragmentation, amplification and fluorescent labelling. DNA fragmentation is the commonest methods used and it is recognised as a critical step in biochip analysis. Currently methods used for DNA fragmentation are based either on sonication or on the enzymatic digestion. In this study, we compared the effect of different types of enzymatic DNA fragmentations, using DNase I to generate ssDNA breaks, NEBNext dsDNA fragmentase and SaqAI restrictase, on DNA labelling. DNA from different Desulfovibrio species was used as a substrate for these enzymes. Of the methods used, DNA fragmented by NEBNext dsDNA Fragmentase digestion was subsequently labelled with the greatest efficiency. As a result of this, the use of this enzyme to fragment target DNA increases the sensitivity of biochip-based detection significantly, and this is an important consideration when determining the presence of targeted DNA in ecological and medical samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    PubMed

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  10. Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies

    DOE PAGES

    Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.; ...

    2015-09-08

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less

  11. Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less

  12. Chromatin Constrains the Initiation and Elongation of DNA Replication.

    PubMed

    Devbhandari, Sujan; Jiang, Jieqing; Kumar, Charanya; Whitehouse, Iestyn; Remus, Dirk

    2017-01-05

    Eukaryotic chromosomal DNA is faithfully replicated in a complex series of cell-cycle-regulated events that are incompletely understood. Here we report the reconstitution of DNA replication free in solution with purified proteins from the budding yeast Saccharomyces cerevisiae. The system recapitulates regulated bidirectional origin activation; synthesis of leading and lagging strands by the three replicative DNA polymerases Pol α, Pol δ, and Pol ε; and canonical maturation of Okazaki fragments into continuous daughter strands. We uncover a dual regulatory role for chromatin during DNA replication: promoting origin dependence and determining Okazaki fragment length by restricting Pol δ progression. This system thus provides a functional platform for the detailed mechanistic analysis of eukaryotic chromosome replication. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Fragment Length of Circulating Tumor DNA.

    PubMed

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  14. Reassembly of a bioluminescent protein Renilla luciferase directed through DNA hybridization.

    PubMed

    Cissell, Kyle A; Rahimi, Yasmeen; Shrestha, Suresh; Deo, Sapna K

    2009-01-01

    Reassembly of split reporter proteins, also referred to as protein complementation, is utilized in the detection of protein-protein or protein-nucleic acid interactions. In this strategy, a reporter protein is fragmented into two inactive polypeptides to which interacting/binding partners are fused. The interaction between fused partners leads to the formation of a reassembled, active reporter. In this Communication, we have presented a proof-of-concept for the detection of a target nucleic acid sequence based on the reassembly of the bioluminescent reporter Renilla luciferase (Rluc), which is driven by DNA hybridization. Although, reassembly of Rluc though protein interactions has been demonstrated by others, the Rluc reassembly through DNA hybridization has not been shown yet, which is the novelty of this work. It is well established that bioluminescence detection offers significant advantages due to the absence of any background signal. In our study, two rationally designed fragments of Rluc were conjugated to complementary oligonucleotide probes. Hybridization of the two probes with fused Rluc fragments resulted in the reassembly of the fragments, generating active Rluc, measurable by the intensity of light given off upon addition of coelenterazine. Our study also shows that the reassembly of Rluc can be inhibited by an oligonucleotide probe that competes to bind to the hybridized probe-Rluc fragment complex, indicating a potential strategy for the quantitative detection of target nucleic acid. We were able to achieve the reassembly of Rluc fused to oligonucleotide probes using femtomole amounts of the probe-fragment protein conjugate. This concentration is approximately 4 orders of magnitude less than that reported using green fluorescent protein (GFP) as the reporter. A DNA-driven Rluc reassembly study performed in a cellular matrix did not show any interference from the matrix.

  15. The role of the DNA sliding clamp in Okazaki fragment maturation in archaea and eukaryotes.

    PubMed

    Beattie, Thomas R; Bell, Stephen D

    2011-01-01

    Efficient processing of Okazaki fragments generated during discontinuous lagging-strand DNA replication is critical for the maintenance of genome integrity. In eukaryotes, a number of enzymes co-ordinate to ensure the removal of initiating primers from the 5'-end of each fragment and the generation of a covalently linked daughter strand. Studies in eukaryotic systems have revealed that the co-ordination of DNA polymerase δ and FEN-1 (Flap Endonuclease 1) is sufficient to remove the majority of primers. Other pathways such as that involving Dna2 also operate under certain conditions, although, notably, Dna2 is not universally conserved between eukaryotes and archaea, unlike the other core factors. In addition to the catalytic components, the DNA sliding clamp, PCNA (proliferating-cell nuclear antigen), plays a pivotal role in binding and co-ordinating these enzymes at sites of lagging-strand replication. Structural studies in eukaryotic and archaeal systems have revealed that PCNA-binding proteins can adopt different conformations when binding PCNA. This conformational malleability may be key to the co-ordination of these enzymes' activities.

  16. Structure and DNA-binding of meiosis-specific protein Hop2

    NASA Astrophysics Data System (ADS)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  17. PAK2 is cleaved and activated during hyperosmotic shock-induced apoptosis via a caspase-dependent mechanism: evidence for the involvement of oxidative stress.

    PubMed

    Chan, W H; Yu, J S; Yang, S D

    1999-03-01

    Hyperosmotic shock elicits a stress response in mammalian cells and can lead to apoptotic cell death. In the present study, we report that hyperosmotic shock can induce activation of a 36 kDa kinase detected by an in-gel kinase assay in several cell types, including mouse Balb/c 3T3 fibroblasts, and human Hep 3B and A431 cells. This 36 kDa kinase can be recognized by an antibody against the C-terminal region of a family of p21Cdc42/Rac-activated kinases (PAKs) on immunoblot. Further studies with this antibody and a PAK2-specific antibody against the N-terminal region of PAK2 demonstrate that hyperosmotic shock can induce cleavage of PAK2 to generate a 36 kDa C-terminal catalytic fragment in cells. The cleavage and activation of PAK2 was found to be closely associated with both DNA fragmentation and activation of an ICE/CED-3 family cysteine protease termed caspase-3 in hyperosmotically shocked cells. Furthermore, pretreating the cells with two caspase inhibitors (Ac-DEVD-cho and Ac-YVAD-cmk) could inhibit both cleavage/activation of PAK2 and DNA fragmentation induced by hyperosmotic shock. Moreover, all these hyperosmotic shock-induced changes (i.e., activation of caspase-3, cleavage/activation of PAK2, and DNA fragmentation) in cells could be blocked by antioxidants such as ascorbic acid (vitamine C), alpha-tocopherol (vitamine E), dithiothreitol, beta-mercaptoethanol, and glutathione. Taken together, our results show that PAK2 is cleaved and activated via a caspase-dependent mechanism during hyperosmotic shock-induced apoptosis and suggest the involvement of antioxidant-preventable oxidative stress in inducing this process.

  18. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com; Cheah, Yew-Hoong; Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action ofmore » xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.« less

  19. Fragment Length of Circulating Tumor DNA

    PubMed Central

    Underhill, Hunter R.; Kitzman, Jacob O.; Hellwig, Sabine; Welker, Noah C.; Daza, Riza; Gligorich, Keith M.; Rostomily, Robert C.; Shendure, Jay

    2016-01-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134–144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132–145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA. PMID:27428049

  20. Helix–hairpin–helix motifs confer salt resistance and processivity on chimeric DNA polymerases

    PubMed Central

    Pavlov, Andrey R.; Belova, Galina I.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

    2002-01-01

    Helix–hairpin–helix (HhH) is a widespread motif involved in sequence-nonspecific DNA binding. The majority of HhH motifs function as DNA-binding modules with typical occurrence of one HhH motif or one or two (HhH)2 domains in proteins. We recently identified 24 HhH motifs in DNA topoisomerase V (Topo V). Although these motifs are dispensable for the topoisomerase activity of Topo V, their removal narrows the salt concentration range for topoisomerase activity tenfold. Here, we demonstrate the utility of Topo V's HhH motifs for modulating DNA-binding properties of the Stoffel fragment of TaqDNA polymerase and Pfu DNA polymerase. Different HhH cassettes fused with either NH2 terminus or COOH terminus of DNA polymerases broaden the salt concentration range of the polymerase activity significantly (up to 0.5 M NaCl or 1.8 M potassium glutamate). We found that anions play a major role in the inhibition of DNA polymerase activity. The resistance of initial extension rates and the processivity of chimeric polymerases to salts depend on the structure of added HhH motifs. Regardless of the type of the construct, the thermal stability of chimeric Taq polymerases increases under the optimal ionic conditions, as compared with that of TaqDNA polymerase or its Stoffel fragment. Our approach to raise the salt tolerance, processivity, and thermostability of Taq and Pfu DNA polymerases may be applied to all pol1- and polB-type polymerases, as well as to other DNA processing enzymes. PMID:12368475

  1. Copper(II) oxide nanoparticles augment antifilarial activity of Albendazole: In vitro synergistic apoptotic impact against filarial parasite Setaria cervi.

    PubMed

    Zafar, Atif; Ahmad, Irshad; Ahmad, Ajaz; Ahmad, Masood

    2016-03-30

    Mass treatment of lymphatic filariasis with Albendazole (ABZ), a therapeutic benzimidazole, is fraught with serious limitations such as possible drug resistance and poor macrofilaricidal activity. Therefore, we need to develop new ABZ-based formulations to improve its antifilarial effectiveness. CuO nanoparticles were used as an adjuvant with ABZ to form ABZ-CuO nanocomposite, which was characterized by UV-vis spectroscopy, FT-IR, AFM and SEM. Antifilarial activity of nanocomposite was evaluated using relative motility assay and dye exclusion test in dark and under UV light. ROS generation, antioxidant levels, lipid peroxidation and DNA fragmentation in nanocomposite treated parasites were estimated. Biophysical techniques were employed to ascertain the mode of binding of nanocomposite to parasitic DNA. Nanocomposite increases parasite mortality as compared to ABZ in dark, and its antifilarial effect was increased further under UV light. Elevated ROS production and decline of parasitic-GST and GSH levels were observed in nanocomposite treated worms in dark, and these effects were pronounced further under UV light. Nanocomposite leads to higher DNA fragmentation as compared to ABZ alone. Further, we found that nanocomposite binds parasitic DNA in an intercalative manner where it generates ROS to induce DNA damage. Thus, oxidative stress production due to ROS generation and consequent DNA fragmentation leads to apoptosis in worms. This is the first report supporting CuO nanoparticles as a potential adjuvant with ABZ against filariasis along with enhanced antifilarial activity of nanocomposite under UV light. These findings, thus, indicate that development of ABZ-loaded nanoparticle compounds may serve as promising leads for filariasis treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Optical selection and collection of DNA fragments

    DOEpatents

    Roslaniec, Mary C.; Martin, John C.; Jett, James H.; Cram, L. Scott

    1998-01-01

    Optical selection and collection of DNA fragments. The present invention includes the optical selection and collection of large (>.mu.g) quantities of clonable, chromosome-specific DNA from a sample of chromosomes. Chromosome selection is based on selective, irreversible photoinactivation of unwanted chromosomal DNA. Although more general procedures may be envisioned, the invention is demonstrated by processing chromosomes in a conventional flow cytometry apparatus, but where no droplets are generated. All chromosomes in the sample are first stained with at least one fluorescent analytic dye and bonded to a photochemically active species which can render chromosomal DNA unclonable if activated. After passing through analyzing light beam(s), unwanted chromosomes are irradiated using light which is absorbed by the photochemically active species, thereby causing photoinactivation. As desired chromosomes pass this photoinactivation point, the inactivating light source is deflected by an optical modulator; hence, desired chromosomes are not photoinactivated and remain clonable. The selection and photoinactivation processes take place on a microsecond timescale. By eliminating droplet formation, chromosome selection rates 50 times greater than those possible with conventional chromosome sorters may be obtained. Thus, usable quantities of clonable DNA from any source thereof may be collected.

  3. In situ end labeling of fragmented DNA in induced ovarian atresia.

    PubMed

    D'Herde, K; De Pestel, G; Roels, F

    1994-01-01

    Apoptosis is studied in a model of induced follicular atresia in the ovary of Japanese quail (Coturnix coturnix japonica) by in situ end labeling of DNA fragments in granulosa cells using two different techniques (incorporation of labeled nucleotides by DNA polymerase I or terminal deoxynucleotidyl transferase). The most remarkable observation related to apoptosis in this model is the predominant cytoplasmic localization of labeled DNA fragments, while DNA fragmentation appears to be absent from compacted chromatin masses of apoptotic nuclei and apoptotic nuclear fragments. Unstained apoptotic bodies are present adjacent to stained ones, so that their detection rate on hematoxylin + eosin stained sections is better than on the in situ end-labeled sections. This suggests that DNA fragmentation is a late even or not obligatory in apoptotic granulosa cell death. In contrast to similar studies on atretic granulosa in mammalian models, the process of apoptosis is asynchronous in the granulosal epithelium, with a majority of nuclei with normal chromatin configuration remaining negative for DNA fragmentation. Finally it is shown that the techniques used are not specific for apoptosis, as DNA fragmentation in necrotic granulosa cells is detected as well.

  4. Platinum Nanoparticles Induce Apoptosis on Raw 264.7 Macrophage Cells.

    PubMed

    Loan, Ta Thi; Do, Le Thanh; Yoo, Hoon

    2018-02-01

    The cellular effects of platinum nanoparticles (PNP05, average size of 5 nm, and PNP30, average size of 30 nm) were investigated on murine leukemia Raw 264.7 cells. Cells treated with various concentrations of PNPs showed size-dependent cytotoxicity in an MTT assay with PNP5 of smaller nanoparticles higher toxicity than PNP30. Investigations on cell morphology, Annexin V assay, DNA fragmentation and the activity of caspase-3/-7 showed that PNPs induced apoptosis on Raw 264.7 cells by changing cell morphology and density, increasing cell population in apoptosis and causing nucleus fragmentation. Further study on caspase activity by Western blotting revealed that the apoptosis was induced by the activation of caspase-3 and -7. In addition, PNPs inactivated DNA repair system, generating dose-dependent DNA ladder bands on agarose gel electrophoresis. Taken together, PNPs triggered cytotoxicity on Raw 264.7 cells by suppressing cell growth/survival and inducing apoptosis.

  5. Sperm DNA fragmentation: mechanisms of origin, impact on reproductive outcome, and analysis.

    PubMed

    Sakkas, Denny; Alvarez, Juan G

    2010-03-01

    To review the mechanisms responsible for DNA fragmentation in human sperm, including those occurring during spermatogenesis and transport through the reproductive tract. The mechanisms examined include: apoptosis in the seminiferous tubule epithelium, defects in chromatin remodeling during the process of spermiogenesis, oxygen radical-induced DNA damage during sperm migration from the seminiferous tubules to the epididymis, the activation of sperm caspases and endonucleases, damage induced by chemotherapy and radiotherapy, and the effect of environmental toxicants. The different tests currently used for sperm DNA fragmentation analysis and the factors that determine the predictive value of sperm DNA fragmentation testing and their implications in the diagnosis and treatment of infertility are also discussed. Finally, we also scrutinize how the presence in the embryonic genome of DNA strand breaks or modifications of DNA nucleotides inherited from the paternal genome could impact the embryo and offspring. In particular we discuss how abnormal sperm could be dealt with by the oocyte and how sperm DNA abnormalities, which have not been satisfactorily repaired by the oocyte after fertilization, may interfere with normal embryo and fetal development. Sperm DNA can be modified through various mechanisms. The integrity of the paternal genome is therefore of paramount importance in the initiation and maintenance of a viable pregnancy both in a natural conception and in assisted reproduction. The need to diagnose sperm at a nuclear level is an area that needs further understanding so that we can improve treatment of the infertile couple. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  6. Relationships between human sperm protamines, DNA damage and assisted reproduction outcomes.

    PubMed

    Simon, Luke; Castillo, Judit; Oliva, Rafael; Lewis, Sheena E M

    2011-12-01

    The exchange of histones with protamines in sperm DNA results in sperm chromatin compaction and protection. Variations in sperm protamine expression are associated with male infertility. The aim of this study was to investigate relationships between DNA fragmentation, sperm protamines and assisted reproduction treatment. Semen and spermatozoa prepared by density-gradient centrifugation (DGC) from 73 men undergoing IVF and 24 men undergoing intracytoplasmic sperm injection (ICSI) were included in the study. Nuclear DNA fragmentation was assessed using the alkaline Comet assay and protamines were separated by acid-urea polyacrylamide gels. Sperm DNA fragmentation and protamine content (P1-DNA, P2-DNA, P1+P2-DNA) decreased in spermatozoa after DGC. Abnormally high and low P1/P2 ratios were associated with increased sperm DNA fragmentation. Couples with idiopathic infertility had abnormally high P1/P2 ratios. Fertilization rates and embryo quality decreased as sperm DNA fragmentation or protamines increased. Sperm DNA fragmentation was lower in couples achieving pregnancies after IVF, but not after ICSI. There was no correlation between protamine content (P1-DNA, P2-DNA, P1+P2-DNA) or P1/P2 ratios and IVF or ICSI pregnancies. Increased sperm DNA fragmentation was associated with abnormal protamination and resulted in lower fertilization rates, poorer embryo quality and reduced pregnancy rates. Copyright © 2011 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  7. Cloning of hydrogenase genes and fine structure analysis of an operon essential for H/sub 2/ metabolism in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sankar, P.; Lee, J.H.; Shanmugam, K.T.

    1985-04-01

    Escherichia coli has two unlinked genes that code for hydrogenase synthesis and activity. The DNA fragments containing the two genes (hydA and hydB) were cloned into a plasmid vector, pBR322. The plasmids containing the hyd genes (pSE-290 and pSE-111 carrying the hydA and hydB genes, respectively) were used to genetically map a total of 51 mutant strains with defects in hydrogenase activity. A total of 37 mutants carried a mutation in the hydB gene, whereas the remaining 14 hyd were hydA. This complementation analysis also established the presence of two new genes, so far unidentified, one coding for formate dehydrogenase-2more » (fdv) and another producing an electron transport protein (fhl) coupling formate dehydrogenase-2 to hydrogenase. Three of the four genes, hydB, fhl, and fdv, may constitute a single operon, and all three genes are carried by a 5.6-kilobase-pair chromosomal DNA insert in plasmid pSE-128. Plasmids carrying a part of this 5.6-kilobase-pair DNA (pSE-130) or fragments derived from this DNA in different orientations (pSE-126 and pSE-129) inhibited the production of active formate hydrogenlyase. This inhibition occurred even in a prototrophic E. coli, strain K-10, but only during an early induction period. These results, based on complementation analysis with cloned DNA fragments, show that both hydA and hydB genes are essential for the production of active hydrogenase. For the expression of active formate hydrogenlyase, two other gene products, fhl and fdv are also needed. All four genes map between 58 and 59 min in the E. coli chromosome.« less

  8. Transcriptionally active PCR for antigen identification and vaccine development: in vitro genome-wide screening and in vivo immunogenicity

    PubMed Central

    Regis, David P.; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L.; Stefaniak, Maureen E.; Campo, Joseph J.; Carucci, Daniel J.; Roth, David A.; He, Huaping; Felgner, Philip L.; Doolan, Denise L.

    2009-01-01

    We have evaluated a technology called Transcriptionally Active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data. PMID:18164079

  9. Transcriptionally active PCR for antigen identification and vaccine development: in vitro genome-wide screening and in vivo immunogenicity.

    PubMed

    Regis, David P; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L; Stefaniak, Maureen E; Campo, Joseph J; Carucci, Daniel J; Roth, David A; He, Huaping; Felgner, Philip L; Doolan, Denise L

    2008-03-01

    We have evaluated a technology called transcriptionally active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data.

  10. Identification of one of the apurinic/apyrimidinic lyase active sites of topoisomerase V by structural and functional studies

    PubMed Central

    Rajan, Rakhi; Prasad, Rajendra; Taneja, Bhupesh; Wilson, Samuel H.; Mondragón, Alfonso

    2013-01-01

    Topoisomerase V (Topo-V) is the only member of a novel topoisomerase subtype. Topo-V is unique because it is a bifunctional enzyme carrying both topoisomerase and DNA repair lyase activities within the same protein. Previous studies had shown that the topoisomerase domain spans the N-terminus of the protein and is followed by 12 tandem helix–hairpin–helix [(HhH)2] domains. There are at least two DNA repair lyase active sites for apurinic/apyrimidinic (AP) site processing, one within the N-terminal region and the second within the C-terminal domain of Topo-V, but their exact locations and characteristics are unknown. In the present study, the N-terminal 78-kDa fragment of Topo-V (Topo-78), containing the topoisomerase domain and one of the lyase DNA repair domains, was characterized by structural and biochemical studies. The results show that an N-terminal 69-kDa fragment is the minimal fragment with both topoisomerase and AP lyase activities. The lyase active site of Topo-78 is at the junction of the fifth and sixth (HhH)2 domains. From the biochemical and structural data, it appears that Lys571 is the most probable nucleophile responsible for the lyase activity. Our experiments also suggest that Topo-V most likely acts as a Class I AP endonuclease in vivo. PMID:23125368

  11. Epstein-Barr virus recombinants from overlapping cosmid fragments.

    PubMed

    Tomkinson, B; Robertson, E; Yalamanchili, R; Longnecker, R; Kieff, E

    1993-12-01

    Five overlapping type 1 Epstein-Barr virus (EBV) DNA fragments constituting a complete replication- and transformation-competent genome were cloned into cosmids and transfected together into P3HR-1 cells, along with a plasmid encoding the Z immediate-early activator of EBV replication. P3HR-1 cells harbor a type 2 EBV which is unable to transform primary B lymphocytes because of a deletion of DNA encoding EBNA LP and EBNA 2, but the P3HR-1 EBV can provide replication functions in trans and can recombine with the transfected cosmids. EBV recombinants which have the type 1 EBNA LP and 2 genes from the transfected EcoRI-A cosmid DNA were selectively and clonally recovered by exploiting the unique ability of the recombinants to transform primary B lymphocytes into lymphoblastoid cell lines. PCR and immunoblot analyses for seven distinguishing markers of the type 1 transfected DNAs identified cell lines infected with EBV recombinants which had incorporated EBV DNA fragments beyond the transformation marker-rescuing EcoRI-A fragment. Approximately 10% of the transforming virus recombinants had markers mapping at 7, 46 to 52, 93 to 100, 108 to 110, 122, and 152 kbp from the 172-kbp transfected genome. These recombinants probably result from recombination among the transfected cosmid-cloned EBV DNA fragments. The one recombinant virus examined in detail by Southern blot analysis has all the polymorphisms characteristic of the transfected type 1 cosmid DNA and none characteristic of the type 2 P3HR-1 EBV DNA. This recombinant was wild type in primary B-lymphocyte infection, growth transformation, and lytic replication. Overall, the type 1 EBNA 3A gene was incorporated into 26% of the transformation marker-rescued recombinants, a frequency which was considerably higher than that observed in previous experiments with two-cosmid EBV DNA cotransfections into P3HR-1 cells (B. Tomkinson and E. Kieff, J. Virol. 66:780-789, 1992). Of the recombinants which had incorporated the marker-rescuing cosmid DNA fragment and the fragment encoding the type 1 EBNA 3A gene, most had incorporated markers from at least two other transfected cosmid DNA fragments, indicating a propensity for multiple homologous recombinations. The frequency of incorporation of the nonselected transfected type 1 EBNA 3C gene, which is near the end of two of the transfected cosmids, was 26% overall, versus 3% in previous experiments using transfections with two EBV DNA cosmids. In contrast, the frequency of incorporation of a 12-kb EBV DNA deletion which was near the end of two of the transfected cosmids was only 13%.(ABSTRACT TRUNCATED AT 400 WORDS)

  12. Methods for producing partially digested restriction DNA fragments and for producing a partially modified PCR product

    DOEpatents

    Wong, Kwong-Kwok

    2000-01-01

    The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.

  13. Extending the spectrum of DNA sequences retrieved from ancient bones and teeth

    PubMed Central

    Glocke, Isabelle; Meyer, Matthias

    2017-01-01

    The number of DNA fragments surviving in ancient bones and teeth is known to decrease with fragment length. Recent genetic analyses of Middle Pleistocene remains have shown that the recovery of extremely short fragments can prove critical for successful retrieval of sequence information from particularly degraded ancient biological material. Current sample preparation techniques, however, are not optimized to recover DNA sequences from fragments shorter than ∼35 base pairs (bp). Here, we show that much shorter DNA fragments are present in ancient skeletal remains but lost during DNA extraction. We present a refined silica-based DNA extraction method that not only enables efficient recovery of molecules as short as 25 bp but also doubles the yield of sequences from longer fragments due to improved recovery of molecules with single-strand breaks. Furthermore, we present strategies for monitoring inefficiencies in library preparation that may result from co-extraction of inhibitory substances during DNA extraction. The combination of DNA extraction and library preparation techniques described here substantially increases the yield of DNA sequences from ancient remains and provides access to a yet unexploited source of highly degraded DNA fragments. Our work may thus open the door for genetic analyses on even older material. PMID:28408382

  14. Mitochondrial dysfunction is responsible for the intestinal calcium absorption inhibition induced by menadione.

    PubMed

    Marchionatti, Ana M; Perez, Adriana V; Diaz de Barboza, Gabriela E; Pereira, Beatriz M; Tolosa de Talamoni, Nori G

    2008-02-01

    Menadione (MEN) inhibits intestinal calcium absorption by a mechanism not completely understood. The aim of this work was to find out the role of mitochondria in this inhibitory mechanism. Hence, normal chicks treated with one i.p. dose of MEN were studied in comparison with controls. Intestinal calcium absorption was measured by the in situ ligated intestinal segment technique. GSH, oxidoreductase activities from the Krebs cycle and enzymes of the antioxidant system were measured in isolated mitochondria. Mitochondrial membrane potential was measured by a flow cytometer technique. DNA fragmentation and cytochrome c localization were determined by immunocytochemistry. Data indicate that in 30 min, MEN decreases intestinal Ca(2+) absorption, which returns to the control values after 10 h. GSH was only decreased for half an hour, while the activity of malate dehydrogenase and alpha-ketoglutarate dehydrogenase was diminished for 48 h. Mn(2+)-superoxide dismutase activity was increased in 30 min, whereas the activity of catalase and glutathione peroxidase remained unaltered. DNA fragmentation and cytochrome c release were maximal in 30 min, but were recovered after 15 h. In conclusion, MEN inhibits intestinal Ca(2+) absorption by mitochondrial dysfunction as revealed by GSH depletion and alteration of the permeability triggering the release of cytochrome c and DNA fragmentation.

  15. Method for identifying mutagenic agents which induce large, multilocus deletions in DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bradley, W.E.C.; Belouchi, A.; Dewyse, P.

    1993-07-13

    A method of identifying a mutagenic agent is described which includes a large, multilocus deletions in DNA in mammalian cells comprising: (i) exposing a class III heterozygous CHO cell line to a potential mutagenic agent under investigation, and allowing any mutation of the cell line to proceed, said cell line being characterized in that a restriction fragment length variation exists in on mutation it becomes resistant to 2,6-diaminopurine and in that the DNA sequence adjacent to the two alleles of the APRT gene such that the DNA sequence adjacent to one of the two alleles can be digested with themore » enzyme BclI but the DNA sequence variation adjacent to the other of the two alleles cannot be digested with BclI, (ii) isolating induced mutations of the cell line deficient in APRT function, (iii) isolating DNA from the induced mutants, (iv) digesting the isolated DNA with BclI enzyme to produce digested fragments including a 19 kb fragment and any 2 kb fragment, which fragments hybridize with the labeled probe derived from DNA fragment PDI, (v) separating any digested fragments, (vi) transferring the separated fragments of (v) to a solid support, (vii) hybridizing the supported separated fragments with a labeled probe derived from the clone DNA fragment PD 1, (viii) determining fragments having undergone loss of the 2 kb band identified by the probe, as an identification of parent mutants in which the loss occurred, and (ix) evaluating the mutating ability of the potential mutagenic agent.« less

  16. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy

    PubMed Central

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog

    2016-01-01

    Abstract Aims: Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. Results: We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. Innovation: This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. Conclusion: MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072–1083. PMID:26935406

  17. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

    PubMed

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

    2016-06-20

    Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

  18. Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

    PubMed

    Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

    2008-10-13

    cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

  19. Novel strategies to construct complex synthetic vectors to produce DNA molecular weight standards.

    PubMed

    Chen, Zhe; Wu, Jianbing; Li, Xiaojuan; Ye, Chunjiang; Wenxing, He

    2009-05-01

    DNA molecular weight standards (DNA markers, nucleic acid ladders) are commonly used in molecular biology laboratories as references to estimate the size of various DNA samples in electrophoresis process. One method of DNA marker production is digestion of synthetic vectors harboring multiple DNA fragments of known sizes by restriction enzymes. In this article, we described three novel strategies-sequential DNA fragment ligation, screening of ligation products by polymerase chain reaction (PCR) with end primers, and "small fragment accumulation"-for constructing complex synthetic vectors and minimizing the mass differences between DNA fragments produced from restrictive digestion of synthetic vectors. The strategy could be applied to construct various complex synthetic vectors to produce any type of low-range DNA markers, usually available commercially. In addition, the strategy is useful for single-step ligation of multiple DNA fragments for construction of complex synthetic vectors and other applications in molecular biology field.

  20. Sizing of single fluorescently stained DNA fragments by scanning microscopy

    PubMed Central

    Laib, Stephan; Rankl, Michael; Ruckstuhl, Thomas; Seeger, Stefan

    2003-01-01

    We describe an approach to determine DNA fragment sizes based on the fluorescence detection of single adsorbed fragments on specifically coated glass cover slips. The brightness of single fragments stained with the DNA bisintercalation dye TOTO-1 is determined by scanning the surface with a confocal microscope. The brightness of adsorbed fragments is found to be proportional to the fragment length. The method needs only minute amount of DNA, beyond inexpensive and easily available surface coatings, like poly-l-lysine, 3-aminoproyltriethoxysilane and polyornithine, are utilizable. We performed DNA-sizing of fragment lengths between 2 and 14 kb. Further, we resolved the size distribution before and after an enzymatic restriction digest. At this a separation of buffers or enzymes was unnecessary. DNA sizes were determined within an uncertainty of 7–14%. The proposed method is straightforward and can be applied to standardized microtiter plates. PMID:14602931

  1. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    NASA Astrophysics Data System (ADS)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  2. DNA fragmentation status in patients with necrozoospermia.

    PubMed

    Brahem, Sonia; Jellad, Sonia; Ibala, Samira; Saad, Ali; Mehdi, Meriem

    2012-12-01

    The aim of this study was to determine if a relationship exists between the levels of sperm DNA fragmentation and necrospermia in infertile men. Semen samples obtained from 70 men consulting for infertility evaluation were analyzed according to World Health Organization (WHO) guidelines. Patients were subdivided into three groups according to the percentage of necrotic spermatozoa: normozoospermia (<30%; n = 20), moderate necrozoospermia (50-80%; n = 30), and severe necrozoospermia (>80%; n = 20). DNA fragmentation was detected by the terminal desoxynucleotidyl transferase-mediated deoxyuridine triphosphate biotin nick-end labeling (TUNEL) assay. The sperm DNA fragmentation index (DFI) was 9.28 ± 2.98% in patients with a normal level of necrotic spermatozoa, 20.25 ± 3.21% in patients with moderate necrozoospermia, and 35.31 ± 5.25% in patients with severe necrozoospermia. There was a statistically significant increase of DNA fragmentation in the necrozoospermic group (P < 0.01). A strong correlation was found between the degree of necrozoospermia and sperm DNA fragmentation. We concluded that patients with necrozoospermia showed a high level of DNA fragmentation compared to normozoospermic men. Severe necrozoospermia (>80%) is a predictive factor for increased sperm DNA damage.

  3. Cavitation Enhancing Nanodroplets Mediate Efficient DNA Fragmentation in a Bench Top Ultrasonic Water Bath

    PubMed Central

    Malc, Ewa P.; Jayakody, Chatura N.; Tsuruta, James K.; Mieczkowski, Piotr A.; Janzen, William P.; Dayton, Paul A.

    2015-01-01

    A perfluorocarbon nanodroplet formulation is shown to be an effective cavitation enhancement agent, enabling rapid and consistent fragmentation of genomic DNA in a standard ultrasonic water bath. This nanodroplet-enhanced method produces genomic DNA libraries and next-generation sequencing results indistinguishable from DNA samples fragmented in dedicated commercial acoustic sonication equipment, and with higher throughput. This technique thus enables widespread access to fast bench-top genomic DNA fragmentation. PMID:26186461

  4. Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tully, D.B.; Hillman, D.; Herbert, E.

    1986-05-01

    Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

  5. DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

    PubMed Central

    Palzkill, T G; Oliver, S G; Newlon, C S

    1986-01-01

    Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

  6. DNA sequences, recombinant DNA molecules and processes for producing the A and B subunits of cholera toxin and preparations containing so-obtained subunit or subunits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harford, N.; De Wilde, M.

    1987-05-19

    A recombinant DNA molecule is described comprising at least a portion coding for subunits A and B of cholera toxin, or a fragment or derivative of the portion wherein the fragment or derivative codes for a polypeptide have an activity which can induce an immune response to subunit A; can induce an immune response to subunit A and cause epithelial cell penetration and the enzymatic effect leading to net loss of fluid into the gut lumen; can bind to the membrane receptor for the B subunit of cholera toxin; can induce an immune response to subunit B; can induce anmore » immune response to subunit B and bind to the membrane receptor; or has a combination of the activities.« less

  7. Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

    PubMed

    Jorgez, Carolina J; Bischoff, Farideh Z

    2009-01-01

    Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

  8. An accurate algorithm for the detection of DNA fragments from dilution pool sequencing experiments.

    PubMed

    Bansal, Vikas

    2018-01-01

    The short read lengths of current high-throughput sequencing technologies limit the ability to recover long-range haplotype information. Dilution pool methods for preparing DNA sequencing libraries from high molecular weight DNA fragments enable the recovery of long DNA fragments from short sequence reads. These approaches require computational methods for identifying the DNA fragments using aligned sequence reads and assembling the fragments into long haplotypes. Although a number of computational methods have been developed for haplotype assembly, the problem of identifying DNA fragments from dilution pool sequence data has not received much attention. We formulate the problem of detecting DNA fragments from dilution pool sequencing experiments as a genome segmentation problem and develop an algorithm that uses dynamic programming to optimize a likelihood function derived from a generative model for the sequence reads. This algorithm uses an iterative approach to automatically infer the mean background read depth and the number of fragments in each pool. Using simulated data, we demonstrate that our method, FragmentCut, has 25-30% greater sensitivity compared with an HMM based method for fragment detection and can also detect overlapping fragments. On a whole-genome human fosmid pool dataset, the haplotypes assembled using the fragments identified by FragmentCut had greater N50 length, 16.2% lower switch error rate and 35.8% lower mismatch error rate compared with two existing methods. We further demonstrate the greater accuracy of our method using two additional dilution pool datasets. FragmentCut is available from https://bansal-lab.github.io/software/FragmentCut. vibansal@ucsd.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  9. Built-in adjuvanticity of genetically and protein-engineered chimeric molecules for targeting of influenza A peptide epitopes.

    PubMed

    Kerekov, Nikola S; Ivanova, Iva I; Mihaylova, Nikolina M; Nikolova, Maria; Prechl, Jozsef; Tchorbanov, Andrey I

    2014-10-01

    Highly purified, subunit, or synthetic viral antigens are known to be weakly immunogenic and potentate only the antibody, rather than cell-mediated immune responses. An alternative approach for inducing protective immunity with small viral peptides would be the direct targeting of viral epitopes to the immunocompetent cells by DNA vaccines encoding antibody fragments specific to activating cell surface co-receptor molecules. Here, we are exploring as a new genetic vaccine, a DNA chimeric molecule encoding a T and B cell epitope-containing influenza A virus hemagglutinin peptide joined to sequences encoding a single-chain variable fragment antibody fragment specific for the costimulatory B cell complement receptors 1 and 2. This recombinant DNA molecule was inserted into eukaryotic expression vector and used as a naked DNA vaccine in WT and CR1/2 KO mice. The intramuscular administration of the DNA construct resulted in the in vivo expression of an immunogenic chimeric protein, which cross-links cell surface receptors on influenza-specific B cells. The DNA vaccination was followed by prime-boosting with the protein-engineered replica of the DNA construct, thus delivering an activation intracellular signal. Immunization with an expression vector containing the described construct and boosting with the protein chimera induced a strong anti-influenza cytotoxic response, modulation of cytokine profile, and a weak antibody response in Balb/c mice. The same immunization scheme did not result in generation of influenza-specific response in mice lacking the target receptor, underlining the molecular adjuvant effect of receptor targeting.

  10. In vitro DNA fragmentation of mitochondrial DNA caused by single-stranded breakage related to macroplasmodial senescence of the true slime mold, Physarum polycephalum.

    PubMed

    Abe, T; Takano, H; Sasaki, N; Mori, K; Kawano, S

    2000-02-01

    We found that mitochondrial DNA (mtDNA) isolated from Physarum polycephalum fragmented itself in weak ionic solutions. The mtDNA was dissolved in STE (saline Tris-EDTA: 150 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA), TE (10 mM Tris-HCl, 1 mM EDTA) and DW, and then electrophoresed in an agarose gel. The intact 86-kbp mtDNA band was seen in STE, but several novel bands appeared in TE and DW. In TE, two discrete bands appeared at 6.7-kbp (alpha-band) and 5.0-kbp (beta-band), whereas at least 17 discrete bands were observed in distilled water (DW). These fragmentation patterns were not stoichiometric, as seen when using restriction endonucleases, but were clearly different from the degradation of DNA caused by a physical shearing force or a contaminating nuclease. In this paper, we characterize this in vitro fragmentation of mtDNA from P. polycephalum. We located 19 fragments, including the alpha and beta fragments, on a mtDNA restriction map, and demonstrated that these cleavage sites were S1 nuclease-sensitive regions, which are single-stranded DNA regions such as nicks and gaps in the mtDNA. The alpha and beta fragments are derived from the region encoding ribosomal RNAs (rRNAs) and the ATP synthase (atpA) gene, while the other 17 fragments are not derived from any specific region, but the cleavage sites are located throughout the mtDNA molecule. In P. polycephalum, it is well known that the growth rate of macroplasmodia decreases with aging. Equal amounts of mtDNA from juvenile and aged macroplasmodia were electrophoresed and the frequency of the beta fragment in each sample was measured. The ratio of the beta band to the total signal including background was estimated to be 3.3-4.0% in juvenile macroplasmodia, whereas it increased to 8.3-28.2% in aged macroplasmodia. This result suggests that the in vitro fragmentation of mtDNA is associated with macroplasmodial senescence. The single-stranded breakage of mtDNA of P. polycephalum may accumulate with age.

  11. Radiation-Induced Chromosomal Aberrations and Immunotherapy: Micronuclei, Cytosolic DNA, and Interferon-Production Pathway.

    PubMed

    Durante, Marco; Formenti, Silvia C

    2018-01-01

    Radiation-induced chromosomal aberrations represent an early marker of late effects, including cell killing and transformation. The measurement of cytogenetic damage in tissues, generally in blood lymphocytes, from patients treated with radiotherapy has been studied for many years to predict individual sensitivity and late morbidity. Acentric fragments are lost during mitosis and create micronuclei (MN), which are well correlated to cell killing. Immunotherapy is rapidly becoming a most promising new strategy for metastatic tumors, and combination with radiotherapy is explored in several pre-clinical studies and clinical trials. Recent evidence has shown that the presence of cytosolic DNA activates immune response via the cyclic GMP-AMP synthase/stimulator of interferon genes pathway, which induces type I interferon transcription. Cytosolic DNA can be found after exposure to ionizing radiation either as MN or as small fragments leaking through nuclear envelope ruptures. The study of the dependence of cytosolic DNA and MN on dose and radiation quality can guide the optimal combination of radiotherapy and immunotherapy. The role of densely ionizing charged particles is under active investigation to define their impact on the activation of the interferon pathway.

  12. Cell death during Drosophila melanogaster early oogenesis is mediated through autophagy.

    PubMed

    Nezis, Ioannis P; Lamark, Trond; Velentzas, Athanassios D; Rusten, Tor Erik; Bjørkøy, Geir; Johansen, Terje; Papassideri, Issidora S; Stravopodis, Dimitrios J; Margaritis, Lukas H; Stenmark, Harald; Brech, Andreas

    2009-04-01

    Autophagy is a physiological and evolutionarily conserved process maintaining homeostatic functions, such as protein degradation and organelle turnover. Accumulating data provide evidence that autophagy also contributes to cell death under certain circumstances, but how this is achieved is not well known. Herein, we report that autophagy occurs during developmentally-induced cell death in the female germline, observed in the germarium and during middle developmental stages of oogenesis in Drosophila melanogaster. Degenerating germline cells exhibit caspase activation, chromatin condensation, DNA fragmentation and punctate staining of mCherry-DrAtg8a, a novel marker for monitoring autophagy in Drosophila. Genetic inhibition of autophagy, by removing atg1 or atg7 function, results in significant reduction of DNA fragmentation, suggesting that autophagy acts genetically upstream of DNA fragmentation in this tissue. This study provides new insights into the mechanisms that regulate cell death in vivo during development.

  13. Linkage map of the fragments of herpesvirus papio DNA.

    PubMed Central

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  14. Supramolecular gel electrophoresis of large DNA fragments.

    PubMed

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    PubMed

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  16. Markers of Developmentally Regulated Programmed Cell Death and Their Analysis in Cereal Seeds.

    PubMed

    Domínguez, Fernando; Cejudo, Francisco Javier

    2018-01-01

    Programmed cell death (PCD) is a key process for the development and differentiation of multicellular organisms, which is characterized by well-defined morphological and biochemical features. These include chromatin condensation, DNA degradation and nuclear fragmentation, with nucleases and proteases playing a relevant function in these processes. In this chapter we describe methods routinely used for the analysis of hallmarks of developmentally regulated PCD in cereal seed tissues, which are based on agarose and polyacrylamide gel electrophoresis, in situ staining of DNA fragmentation, and cell-free assays of relevant enzymatic activities.

  17. Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

    PubMed

    Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

    2017-12-01

    Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

  18. Insulin-like growth factor-1 (IGF-1) promotes primordial follicle growth and reduces DNA fragmentation through the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) signalling pathway.

    PubMed

    Bezerra, Maria É S; Barberino, Ricássio S; Menezes, Vanúzia G; Gouveia, Bruna B; Macedo, Taís J S; Santos, Jamile M S; Monte, Alane P O; Barros, Vanessa R P; Matos, Maria H T

    2018-05-30

    We investigated the effects of insulin-like growth factor 1 (IGF-1) on the morphology and follicular activation of ovine preantral follicles cultured in situ and whether the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway is involved in IGF-1 action in the sheep ovary. Ovine ovarian fragments were fixed for histological and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) analyses (fresh control) or cultured in supplemented alpha-minimum essential medium (α-MEM+; control) or α-MEM+ with IGF-1 (1, 10, 50, 100 or 200ngmL-1) for 7 days. Follicles were classified as normal or atretic, primordial or growing and the oocyte and follicle diameters were measured. DNA fragmentation was evaluated by TUNEL assay. Proliferating cell nuclear antigen (PCNA) immunohistochemistry was performed on the fresh control, α-MEM+ and 100ngmL-1 IGF-1 samples. Inhibition of PI3K activity was performed through pretreatment with the PI3K inhibitor LY294002 and phosphorylated AKT (pAKT) expression was analysed after culture in the absence or presence of LY294002. IGF-1 at 100ngmL-1 increased (P<0.05) follicular activation compared with α-MEM+ and decreased TUNEL-positive cells (P<0.05) compared with other treatments. PCNA-positive cells also increased (P<0.05) in 100ngmL-1 IGF-1. LY294002 significantly inhibited follicular activation stimulated by α-MEM+ and 100ngmL-1 IGF-1 and reduced pAKT expression in follicles. Overall, IGF-1 at 100ngmL-1 promoted primordial follicle activation, cell proliferation and reduced DNA fragmentation after in situ culture through the PI3K/AKT pathway.

  19. AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

    PubMed

    Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

    2017-11-14

    Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

  20. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    PubMed

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  1. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    PubMed Central

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  2. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    PubMed Central

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  3. Identification of a nuclear-localized nuclease from wheat cells undergoing programmed cell death that is able to trigger DNA fragmentation and apoptotic morphology on nuclei from human cells

    PubMed Central

    Domínguez, Fernando; Cejudo, Francisco J.

    2006-01-01

    PCD (programmed cell death) in plants presents important morphological and biochemical differences compared with apoptosis in animal cells. This raises the question of whether PCD arose independently or from a common ancestor in plants and animals. In the present study we describe a cell-free system, using wheat grain nucellar cells undergoing PCD, to analyse nucleus dismantling, the final stage of PCD. We have identified a Ca2+/Mg2+ nuclease and a serine protease localized to the nucleus of dying nucellar cells. Nuclear extracts from nucellar cells undergoing PCD triggered DNA fragmentation and other apoptotic morphology in nuclei from different plant tissues. Inhibition of the serine protease did not affect DNA laddering. Furthermore, we show that the nuclear extracts from plant cells triggered DNA fragmentation and apoptotic morphology in nuclei from human cells. The inhibition of the nucleolytic activity with Zn2+ or EDTA blocked the morphological changes of the nucleus. Moreover, nuclear extracts from apoptotic human cells triggered DNA fragmentation and apoptotic morphology in nuclei from plant cells. These results show that degradation of the nucleus is morphologically and biochemically similar in plant and animal cells. The implication of this finding on the origin of PCD in plants and animals is discussed. PMID:16613587

  4. Adaptation of the neutral bacterial comet assay to assess antimicrobial-mediated DNA double-strand breaks in Escherichia coli

    PubMed Central

    SOLANKY, DIPESH; HAYDEL, SHELLEY E.

    2012-01-01

    This study aimed to determine the mechanism of action of a natural antibacterial clay mineral mixture, designated CB, by investigating the induction of DNA double-strand breaks (DSBs) in Escherichia coli. To quantify DNA damage upon exposure to soluble antimicrobial compounds, we modified a bacterial neutral comet assay, which primarily associates the general length of an electrophoresed chromosome, or comet, with the degree of DSB-associated DNA damage. To appropriately account for antimicrobial-mediated strand fragmentation, suitable control reactions consisting of exposures to water, ethanol, kanamycin, and bleomycin were developed and optimized for the assay. Bacterial exposure to the CB clay resulted in significantly longer comet lengths, compared to water and kanamycin exposures, suggesting that the induction of DNA DSBs contributes to the killing activity of this antibacterial clay mineral mixture. The comet assay protocol described herein provides a general technique for evaluating soluble antimicrobial-derived DNA damage and for comparing DNA fragmentation between experimental and control assays. PMID:22940101

  5. Restriction/modification polypeptides, polynucleotides, and methods

    DOEpatents

    Westpheling, Janet; Chung, DaeHwan; Huddleston, Jennifer; Farkas, Joel A

    2015-02-24

    The present invention relates to the discovery of a novel restriction/modification system in Caldicellulosiruptor bescii. The discovered restriction enzyme is a HaeIII-like restriction enzyme that possesses a thermophilic activity profile. The restriction/modification system also includes a methyltransferase, M.CbeI, that methylates at least one cytosine residue in the CbeI recognition sequence to m.sup.4C. Thus, the invention provides, in various aspects, isolated CbeI or M.CbeI polypeptides, or biologically active fragments thereof; isolated polynucleotides that encode the CbeI or M.CbeI polypeptides or biologically active fragments thereof, including expression vectors that include such polynucleotide sequences; methods of digesting DNA using a CbeI polypeptide; methods of treating a DNA molecule using a M.CbeI polypeptide; and methods of transforming a Caldicellulosiruptor cell.

  6. Molecular cloning and expression in Saccharomyces cerevisiae and Neurospora crassa of the invertase gene from Neurospora crassa.

    PubMed

    Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A

    1989-10-01

    A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.

  7. Molecular dynamics simulations demonstrate the regulation of DNA-DNA attraction by H4 histone tail acetylations and mutations.

    PubMed

    Korolev, Nikolay; Yu, Hang; Lyubartsev, Alexander P; Nordenskiöld, Lars

    2014-10-01

    The positively charged N-terminal histone tails play a crucial role in chromatin compaction and are important modulators of DNA transcription, recombination, and repair. The detailed mechanism of the interaction of histone tails with DNA remains elusive. To model the unspecific interaction of histone tails with DNA, all-atom molecular dynamics (MD) simulations were carried out for systems of four DNA 22-mers in the presence of 20 or 16 short fragments of the H4 histone tail (variations of the 16-23 a. a. KRHRKVLR sequence, as well as the unmodified fragment a. a.13-20, GGAKRHRK). This setup with high DNA concentration, explicit presence of DNA-DNA contacts, presence of unstructured cationic peptides (histone tails) and K(+) mimics the conditions of eukaryotic chromatin. A detailed account of the DNA interactions with the histone tail fragments, K(+) and water is presented. Furthermore, DNA structure and dynamics and its interplay with the histone tail fragments binding are analysed. The charged side chains of the lysines and arginines play major roles in the tail-mediated DNA-DNA attraction by forming bridges and by coordinating to the phosphate groups and to the electronegative sites in the minor groove. Binding of all species to DNA is dynamic. The structure of the unmodified fully-charged H4 16-23 a.a. fragment KRHRKVLR is dominated by a stretched conformation. The H4 tail a. a. fragment GGAKRHRK as well as the H4 Lys16 acetylated fragment are highly flexible. The present work allows capturing typical features of the histone tail-counterion-DNA structure, interaction and dynamics. © 2014 Wiley Periodicals, Inc.

  8. Methanol extract from Vietnamese Caesalpinia sappan induces apoptosis in HeLa cells.

    PubMed

    Hung, Tran Manh; Dang, Nguyen Hai; Dat, Nguyen Tien

    2014-05-27

    This study evaluated the cytotoxic activity of extracts from Caesalpinia sappan heartwood against multiple cancer cell lines using an MTT cell viability assay. The cell death though induction of apoptosis was as indicated by DNA fragmentation and caspase-3 enzyme activation. A methanol extract from C. sappan (MECS) showed cytotoxic activity against several of the cancer cell lines. The most potent activity exhibited by the MECS was against HeLa cells with an IC50 value of 26.5 ± 3.2 μg/mL. Treatment of HeLa cells with various MECS concentrations resulted in growth inhibition and induction of apoptosis, as indicated by DNA fragmentation and caspase-3 enzyme activation. This study is the first report of the anticancer properties of the heartwood of C. sappan native to Vietnam. Our findings demonstrate that C. sappan heartwood may have beneficial applications in the field of anticancer drug discovery.

  9. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

    1987-10-07

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

  10. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.

    1990-10-09

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.

  11. Method for rapid base sequencing in DNA and RNA

    DOEpatents

    Jett, James H.; Keller, Richard A.; Martin, John C.; Moyzis, Robert K.; Ratliff, Robert L.; Shera, E. Brooks; Stewart, Carleton C.

    1990-01-01

    A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed.

  12. Phylogenomics of caspase-activated DNA fragmentation factor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eckhart, Leopold; Fischer, Heinz; Tschachler, Erwin

    2007-04-27

    The degradation of nuclear DNA by DNA fragmentation factor (DFF) is a key step in apoptosis of mammalian cells. Using comparative genomics, we have here determined the evolutionary history of the genes encoding the two DFF subunits, DFFA (also known as ICAD) and DFFB (CAD). Orthologs of DFFA and DFFB were identified in Nematostella vectensis, a representative of the primitive metazoan clade cnidarians, and in various vertebrates and insects, but not in representatives of urochordates, echinoderms, and nematodes. The domains mediating the interaction of DFFA and DFFB, a caspase cleavage site in DFFA, and the amino acid residues critical formore » endonuclease activity of DFFB were conserved in Nematostella. These findings suggest that DFF has been a part of the primordial apoptosis system of the eumetazoan common ancestor and that the ancient cell death machinery has degenerated in several evolutionary lineages, including the one leading to the prototypical apoptosis model, Caenorhabditis elegans.« less

  13. Crystal structure of an Okazaki fragment at 2-A resolution

    NASA Technical Reports Server (NTRS)

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  14. Apoptosis in human unfertilized oocytes after intracytoplasmic sperm injection.

    PubMed

    Bosco, Liana; Ruvolo, Giovanni; Morici, Giovanni; Manno, Maurizio; Cittadini, Ettore; Roccheri, Maria C

    2005-11-01

    To investigate the presence of programmed cell death in unfertilized oocytes after intracytoplasmic sperm injection (ICSI), assuming that previous apoptotic events could be correlated with the fertilization failure. Comparison of the rate of DNA fragmentation in human oocytes at different stages of maturation soon after pick-up (control) and in unfertilized oocytes after ICSI treatment. In vitro fertilization (IVF) laboratory with extensive ICSI experience. Sixty-three patients undergoing assisted fertilization by ICSI. Terminal deoxynucleotidyl transferase-mediated digoxigenin-dUTP nick-end labeling (TUNEL) assay and anticaspase-3 cleaved immunoassay to detect apoptosis in control and ICSI-treated oocytes. Differences in the percentage of oocytes demonstrating DNA fragmentation between control oocytes and unfertilized ICSI treated oocytes at different stages of maturation. The DNA fragmentation, by TUNEL assay, appeared in all the immature control oocytes, but only 37% of mature oocytes showed DNA fragmentation. This DNA fragmentation was observed in 88.8% of the oocytes unfertilized after ICSI; furthermore, DNA fragmentation appeared as well in the sperm injected into the cytoplasm. The study has shown DNA fragmentation in human oocytes unfertilized after ICSI. The evidence is confirmed as well in control oocytes, free from in vitro culture or manipulation stress. Caspase-3 immunoassay suggests the presence of apoptosis. The high percentage of oocytes demonstrating DNA fragmentation in the unfertilized oocytes could be correlated with fertilization failure.

  15. Bacterial DNA in water and dialysate: detection and significance for patient outcomes.

    PubMed

    Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K

    2009-01-01

    The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.

  16. Separation efficiency of free-solution conjugated electrophoresis with drag-tags incorporating a synthetic amino acid.

    PubMed

    Seo, Kyung-Ho; Chu, Hun-Su; Yoo, Tae Hyeon; Lee, Sun-Gu; Won, Jong-In

    2016-03-01

    DNA sequencing or separation by conventional capillary electrophoresis with a polymer matrix has some inherent drawbacks, such as the expense of polymer matrix and limitations in sequencing read length. As DNA fragments have a linear charge-to-friction ratio in free solution, DNA fragments cannot be separated by size. However, size-based separation of DNA is possible in free-solution conjugate electrophoresis (FSCE) if a "drag-tag" is attached to DNA fragments because the tag breaks the linear charge-to-friction scaling. Although several previous studies have demonstrated the feasibility of DNA separation by free-solution conjugated electrophoresis, generation of a monodisperse drag-tag and identification of a strong, site-specific conjugation method between a DNA fragment and a drag-tag are challenges that still remain. In this study, we demonstrate an efficient FSCE method by conjugating a biologically synthesized elastin-like polypeptide (ELP) and green fluorescent protein (GFP) to DNA fragments. In addition, to produce strong and site-specific conjugation, a methionine residue in drag-tags is replaced with homopropargylglycine (Hpg), which can be conjugated specifically to a DNA fragment with an azide site. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Evenson, Donald P.; Wixon, Regina

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to {approx}1-2 x 106 sperm/ml,more » treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated sperm DNA fragmentation. Extensive DNA fragmentation probably cannot be repaired by the egg and the spontaneous abortion rate is {approx}2x higher if a man has more than 30% of sperm showing DNA fragmentation. DNA fragmentation is an excellent marker for exposure to potential reproductive toxicants and a diagnostic/prognostic tool for potential male infertility.« less

  18. Influence of volcanic activity on the population genetic structure of Hawaiian Tetragnatha spiders: Fragmentation, rapid population growth and the potential for accelerated evolution

    USGS Publications Warehouse

    Vandergast, A.G.; Gillespie, R.G.; Roderick, G.K.

    2004-01-01

    Volcanic activity on the island of Hawaii results in a cyclical pattern of habitat destruction and fragmentation by lava, followed by habitat regeneration on newly formed substrates. While this pattern has been hypothesized to promote the diversification of Hawaiian lineages, there have been few attempts to link geological processes to measurable changes in population structure. We investigated the genetic structure of three species of Hawaiian spiders in forests fragmented by a 150-year-old lava flow on Mauna Loa Volcano, island of Hawaii: Tetragnatha quasimodo (forest and lava flow generalist), T. anuenue and T. brevignatha (forest specialists). To estimate fragmentation effects on population subdivision in each species, we examined variation in mitochondrial and nuclear genomes (DNA sequences and allozymes, respectively). Population subdivision was higher for forest specialists than for the generalist in fragments separated by lava. Patterns of mtDNA sequence evolution also revealed that forest specialists have undergone rapid expansion, while the generalist has experienced more gradual population growth. Results confirm that patterns of neutral genetic variation reflect patterns of volcanic activity in some Tetragnatha species. Our study further suggests that population subdivision and expansion can occur across small spatial and temporal scales, which may facilitate the rapid spread of new character states, leading to speciation as hypothesized by H. L. Carson 30 years ago.

  19. Hamamelitannin from Hamamelis virginiana inhibits the tumour necrosis factor-alpha (TNF)-induced endothelial cell death in vitro.

    PubMed

    Habtemariam, Solomon

    2002-01-01

    The tumour necrosis factor-alpha (TNF) inhibitory activity of hamamelitannin from Hamamelis virginiana was investigated by assessing the TNF-mediated EAhy926 endothelial cell death and adhesiveness to monocytes. Treatment of the cells by TNF (25 ng/ml) and actinomycin D (0.1ng/ml) resulted in significant DNA fragmentation (34+/-0.6, n=4) and cytotoxicity (97+/-4.5%, n=6) following treatment for 8 and 24h, respectively. One to 100 microM concentrations of hamamelitannin inhibited the TNF-mediated endothelial cell death and DNA fragmentation in a dose-dependent manner. One hundred % protection against TNF-induced DNA fragmentation and cytotoxicity was obtained for hamamelitannin concentrations higher than 10 microM. The protective effect of hamamelitannin was comparable with that of a related compound epigallocatechin gallate while gallic acid was a weak protective agent (<40% protection). EAhy926 endothelial cells upregulated (by 4- to 7-fold) the surface expression of intercellular adhesion molecule-1 (ICAM-1) and adhesiveness to monocytic U937 cells after treatment with TNF (0.5ng/ml) for 6 or 24h. Concentrations (1-100 microM) of hamamelitannin that inhibited the TNF-mediated cell death and DNA fragmentation, however, failed to inhibit the TNF-induced ICAM-1 expression and EAhy926 cell adhesiveness to U937 cells. Thus, hamamelitannin inhibits the TNF-mediated endothelial cell death without altering the TNF-induced upregulation of endothelial adhesiveness. The observed anti-TNF activity of hamamelitannin may explain the antihamorrhaegic use of H. virginiana in traditional medicine and its claimed use as a protective agent for UV radiation.

  20. A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

    PubMed

    Santangelo, G M; Tornow, J

    1997-12-01

    As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

  1. Sperm DNA oxidative damage and DNA adducts

    PubMed Central

    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

    2015-01-01

    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps = 0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps = 0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps = 0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on sperm. PMID:26653986

  2. Escherichia coli STb toxin induces apoptosis in intestinal epithelial cell lines.

    PubMed

    Syed, H Claudia; Dubreuil, J Daniel

    2012-09-01

    A previous study conducted in our laboratory demonstrated that cells having internalized Escherichia coli STb toxin display apoptotic-like morphology. We therefore investigated if STb could induce programmed cell death in both a human and an animal intestinal epithelial cell lines. HRT-18 (Human Colon Tumor) and IEC-18 (Rat Ileum Epithelial Cells) cell lines were used. As STb is frequently tested in a rat model, the IEC-18 cell line was most relevant to our work. The cell lines were treated with various amounts of purified STb (nanomole range) for a period of 24 h after which cells were harvested and examined for apoptotic characteristics. Caspase-9, the initiator of mitochondrion-mediated apoptosis, and caspase-3, an effector of caspase-9, were both activated following STb intoxication of HRT-18 and IEC-18 cells whereas caspase-8, the initiator caspase of the extrinsic pathway, was not activated. For both cell lines, agarose gel electrophoresis of the cell DNA content reveals laddering of DNA, resulting from DNA fragmentation, a characteristic of apoptosis. Hoechst 33342-stained DNA of STb-treated cell lines, observed using fluorescence microscopy, revealed condensation and fragmentation of the nuclei. Apoptotic indexes calculated from fragmented nuclei of Hoechst 33342-stained DNA for HRT-18 and IEC-18 cells showed an STb dose-dependent response. Overall, these data indicate that STb toxin induces a mitochondrion-mediated caspase-dependent apoptotic pathway. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. DNA sequencing using fluorescence background electroblotting membrane

    DOEpatents

    Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.

    1992-01-01

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

  4. DNA sequencing using fluorescence background electroblotting membrane

    DOEpatents

    Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

    1992-05-12

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

  5. Sperm DNA damage or progressive motility: which one is the better predictor of fertilization in vitro?

    PubMed

    Simon, Luke; Lewis, Sheena E M

    2011-06-01

    Sperm progressive motility has been reported to be one of the key factors influencing in vitro fertilization rates. However, recent studies have shown that sperm DNA fragmentation is a more robust predictor of assisted reproductive outcomes including reduced fertilization rates, embryo quality, and pregnancy rates. This study aimed to compare the usefulness of sperm progressive motility and DNA damage as predictive tools of in vitro fertilization rates. Here, 136 couples provided 1,767 eggs with an overall fertilization rate of 64.2%. The fertilization rate in vitro correlated with both sperm progressive motility (r² = 0.236; P = 0.002) and DNA fragmentation (r² = -0.318; P < 0.001). The relative risk of a poor fertilization rate was 9.5 times higher in sperm of men with high DNA fragmentation (>40%) compared with 2.6 times in sperm with poor motility (<40%). Further, sperm DNA fragmentation gave a higher specificity (93.3%) in predicting the fertilization rate than progressive motility (77.8%). Finally, the odds ratio to determine fertilization rate (>70%) was 4.81 (1.89-12.65) using progressive motility compared with 24.18 (5.21-154.51) using DNA fragmentation. This study shows that fertilization rates are directly dependent upon both sperm progressive motility and DNA fragmentation, but sperm DNA fragmentation is a much stronger test.

  6. Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

    DTIC Science & Technology

    2005-10-01

    1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

  7. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System

    PubMed Central

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C. T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1–10 Kbp fragment lengths with a yield of 75.30–91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future. PMID:28098208

  8. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    PubMed

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  9. Cloning of the active thymidine kinase gene of herpes simplex virus type 1 in Escherichia coli K-12.

    PubMed

    Colbere-Garapin, F; Chousterman, S; Horodniceanu, F; Kourilsky, P; Garapin, A C

    1979-08-01

    A herpes simplex virus DNA fragment that is produced by digestion with BamHI endonuclease and carries the thymidine kinase (TK; ATP:thymidine 5'-phosphotransferase, EC 2.7.1.21) gene has been cloned in Escherichia coli. A recombinat plasmid, pFG5, has been analyzed extensively and a detailed restriction map is presented. pFG5 DNA efficiently transforms TK- mouse L cells. The TK coding sequence in the cloned fragment has been localized and a smaller recombinant plasmid, pAG0, also carrying an active TK gene, has been constructed to serve as a more convenient vector for transfer, into TK- cells, of genes previously cloned in E. coli.

  10. Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

    The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component ofmore » oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication.« less

  11. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    PubMed

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p<0.05), but we found a significant reduction in patients with high basal DFI values (>15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  12. RNA primer–primase complexes serve as the signal for polymerase recycling and Okazaki fragment initiation in T4 phage DNA replication

    PubMed Central

    Spiering, Michelle M.; Hanoian, Philip; Gannavaram, Swathi; Benkovic, Stephen J.

    2017-01-01

    The opposite strand polarity of duplex DNA necessitates that the leading strand is replicated continuously whereas the lagging strand is replicated in discrete segments known as Okazaki fragments. The lagging-strand polymerase sometimes recycles to begin the synthesis of a new Okazaki fragment before finishing the previous fragment, creating a gap between the Okazaki fragments. The mechanism and signal that initiate this behavior—that is, the signaling mechanism—have not been definitively identified. We examined the role of RNA primer–primase complexes left on the lagging ssDNA from primer synthesis in initiating early lagging-strand polymerase recycling. We show for the T4 bacteriophage DNA replication system that primer–primase complexes have a residence time similar to the timescale of Okazaki fragment synthesis and the ability to block a holoenzyme synthesizing DNA and stimulate the dissociation of the holoenzyme to trigger polymerase recycling. The collision with primer–primase complexes triggering the early termination of Okazaki fragment synthesis has distinct advantages over those previously proposed because this signal requires no transmission to the lagging-strand polymerase through protein or DNA interactions, the mechanism for rapid dissociation of the holoenzyme is always collision, and no unique characteristics need to be assigned to either identical polymerase in the replisome. We have modeled repeated cycles of Okazaki fragment initiation using a collision with a completed Okazaki fragment or primer–primase complexes as the recycling mechanism. The results reproduce experimental data, providing insights into events related to Okazaki fragment initiation and the overall functioning of DNA replisomes. PMID:28507156

  13. RNA primer-primase complexes serve as the signal for polymerase recycling and Okazaki fragment initiation in T4 phage DNA replication.

    PubMed

    Spiering, Michelle M; Hanoian, Philip; Gannavaram, Swathi; Benkovic, Stephen J

    2017-05-30

    The opposite strand polarity of duplex DNA necessitates that the leading strand is replicated continuously whereas the lagging strand is replicated in discrete segments known as Okazaki fragments. The lagging-strand polymerase sometimes recycles to begin the synthesis of a new Okazaki fragment before finishing the previous fragment, creating a gap between the Okazaki fragments. The mechanism and signal that initiate this behavior-that is, the signaling mechanism-have not been definitively identified. We examined the role of RNA primer-primase complexes left on the lagging ssDNA from primer synthesis in initiating early lagging-strand polymerase recycling. We show for the T4 bacteriophage DNA replication system that primer-primase complexes have a residence time similar to the timescale of Okazaki fragment synthesis and the ability to block a holoenzyme synthesizing DNA and stimulate the dissociation of the holoenzyme to trigger polymerase recycling. The collision with primer-primase complexes triggering the early termination of Okazaki fragment synthesis has distinct advantages over those previously proposed because this signal requires no transmission to the lagging-strand polymerase through protein or DNA interactions, the mechanism for rapid dissociation of the holoenzyme is always collision, and no unique characteristics need to be assigned to either identical polymerase in the replisome. We have modeled repeated cycles of Okazaki fragment initiation using a collision with a completed Okazaki fragment or primer-primase complexes as the recycling mechanism. The results reproduce experimental data, providing insights into events related to Okazaki fragment initiation and the overall functioning of DNA replisomes.

  14. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    PubMed

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. Effects of semen storage and separation techniques on sperm DNA fragmentation.

    PubMed

    Jackson, Robert E; Bormann, Charles L; Hassun, Pericles A; Rocha, André M; Motta, Eduardo L A; Serafini, Paulo C; Smith, Gary D

    2010-12-01

    To determine the effect of semen storage and separation techniques on sperm DNA fragmentation. Controlled clinical study. An assisted reproductive technology laboratory. Thirty normoozospermic semen samples obtained from patients undergoing infertility evaluation. One aliquot from each sample was immediately prepared (control) for the sperm chromatin dispersion assay (SCD). Aliquots used to assess storage techniques were treated in the following ways: snap frozen by liquid nitrogen immersion, slow frozen with Tris-yolk buffer and glycerol, kept on ice for 24 hours or maintained at room temperature for 4 and 24 hours. Aliquots used to assess separation techniques were processed by the following methods: washed and centrifuged in media, swim-up from washed sperm pellet, density gradient separation, density gradient followed by swim-up. DNA integrity was then measured by SCD. DNA fragmentation as measured by SCD. There was no significant difference in fragmentation among the snap frozen, slow frozen, and wet-ice groups. Compared to other storage methods short-term storage at room temperature did not impact DNA fragmentation yet 24 hours storage significantly increased fragmentation. Swim-up, density gradient and density gradient/swim-up had significantly reduced DNA fragmentation levels compared with washed semen. Postincubation, density gradient/swim-up showed the lowest fragmentation levels. The effect of sperm processing methods on DNA fragmentation should be considered when selecting storage or separation techniques for clinical use. Copyright © 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  16. Herpes Simplex Virus 1 DNA Polymerase RNase H Activity Acts in a 3'-to-5' Direction and Is Dependent on the 3'-to-5' Exonuclease Active Site.

    PubMed

    Lawler, Jessica L; Mukherjee, Purba; Coen, Donald M

    2018-03-01

    The catalytic subunit (Pol) of herpes simplex virus 1 (HSV-1) DNA polymerase has been extensively studied both as a model for other family B DNA polymerases and for its differences from these enzymes as an antiviral target. Among the activities of HSV-1 Pol is an intrinsic RNase H activity that cleaves RNA from RNA-DNA hybrids. There has long been a controversy regarding whether this activity is due to the 3'-to-5' exonuclease of Pol or whether it is a separate activity, possibly acting on 5' RNA termini. To investigate this issue, we compared wild-type HSV-1 Pol and a 3'-to-5' exonuclease-deficient mutant, D368A Pol, for DNA polymerase activity, 3'-to-5' exonuclease activity, and RNase H activity in vitro Additionally, we assessed the RNase H activity using differentially end-labeled templates with 5' or 3' RNA termini. The mutant enzyme was at most modestly impaired for DNA polymerase activity but was drastically impaired for 3'-to-5' exonuclease activity, with no activity detected even at high enzyme-to-DNA substrate ratios. Importantly, the mutant showed no detectable ability to excise RNA with either a 3' or 5' terminus, while the wild-type HSV-1 Pol was able to cleave RNA from the annealed RNA-DNA hairpin template, but only detectably with a 3' RNA terminus in a 3'-to-5' direction and at a rate lower than that of the exonuclease activity. These results suggest that HSV-1 Pol does not have an RNase H separable from its 3'-to-5' exonuclease activity and that this activity prefers DNA degradation over degradation of RNA from RNA-DNA hybrids. IMPORTANCE Herpes simplex virus 1 (HSV-1) is a member of the Herpesviridae family of DNA viruses, several of which cause morbidity and mortality in humans. Although the HSV-1 DNA polymerase has been studied for decades and is a crucial target for antivirals against HSV-1 infection, several of its functions remain to be elucidated. A hypothesis suggesting the existence of a 5'-to-3' RNase H activity intrinsic to this enzyme that could remove RNA primers from Okazaki fragments has been particularly controversial. In this study, we were unable to identify RNase H activity of HSV-1 DNA polymerase on RNA-DNA hybrids with 5' RNA termini. We detected RNase H activity on hybrids with 3' termini, but this was due to the 3'-to-5' exonuclease. Thus, HSV-1 is unlikely to use this method to remove RNA primers during DNA replication but may use pathways similar to those used in eukaryotic Okazaki fragment maturation. Copyright © 2018 American Society for Microbiology.

  17. Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

    PubMed

    Qian, Yong; Wang, Chunyan; Gao, Fenglei

    2015-01-15

    A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  19. Scarless assembly of unphosphorylated DNA fragments with a simplified DATEL method.

    PubMed

    Ding, Wenwen; Weng, Huanjiao; Jin, Peng; Du, Guocheng; Chen, Jian; Kang, Zhen

    2017-05-04

    Efficient assembly of multiple DNA fragments is a pivotal technology for synthetic biology. A scarless and sequence-independent DNA assembly method (DATEL) using thermal exonucleases has been developed recently. Here, we present a simplified DATEL (sDATEL) for efficient assembly of unphosphorylated DNA fragments with low cost. The sDATEL method is only dependent on Taq DNA polymerase and Taq DNA ligase. After optimizing the committed parameters of the reaction system such as pH and the concentration of Mg 2+ and NAD+, the assembly efficiency was increased by 32-fold. To further improve the assembly capacity, the number of thermal cycles was optimized, resulting in successful assembly 4 unphosphorylated DNA fragments with an accuracy of 75%. sDATEL could be a desirable method for routine manual and automated assembly.

  20. A pro-apoptotic 15-kDa protein from Bacopa monnieri activates caspase-3 and downregulates Bcl-2 gene expression in mouse mammary carcinoma cells.

    PubMed

    Kalyani, Manjula Ishwara; Lingaraju, Sheela Mysore; Salimath, Bharathi P

    2013-01-01

    In diseases such as cancer, induction of apoptosis has been a new target for mechanism-based drug discovery. The central component of the process of apoptosis is a proteolytic system involving a family of proteases called caspases. Apoptosis involves characteristic morphological and biochemical events ultimately leading to cell demise. Apoptotic induction is evidently central to the mechanism of action of plant-derived anticancer drugs. Extract of the medicinal plant, Bacopa monnieri, inhibits tumor cell proliferation and accumulation of malignant ascites fluid. The crude sample when subjected to Soxhlet extraction yielded different solvent extracts of which the aqueous extract showed biological activity of apoptosis in Ehrlich ascites tumor cell lines (EAT). Bacopa monnieri water extract (BMWE) treatment of EAT cells produced apoptotic morphological characteristics and in-vivo DNA fragmentation, which is due to the activity of an endogenous endonuclease. The endonuclease responsible for DNA fragmentation acts downstream of caspase-3 activity and is also referred to as caspase-activated DNase (CAD). The CAD constitutively expressed in the cell cytoplasm is translocated into the nucleus upon BMWE treatment, as verified by Western blotting, leading to DNA fragmentation and to programmed cell death. The expression of the pro-apoptotic gene Bax was increased and the expression of the anti-apoptotic gene Bcl-2 was decreased by BMWE treatment. Considering the above results, BMWE was able induce apoptosis in EAT cells via Bax-related caspase-3 activation. This may provide experimental data for the further clinical use of BMWE in cancer.

  1. Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

    PubMed

    Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

    2014-01-01

    DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic DNA digestion.

  2. A novel label-free fluorescence strategy for methyltransferase activity assay based on dsDNA-templated copper nanoparticles coupled with an endonuclease-assisted signal transduction system.

    PubMed

    Lai, Q Q; Liu, M D; Gu, C C; Nie, H G; Xu, X J; Li, Z H; Yang, Z; Huang, S M

    2016-02-21

    Evaluating DNA methyltransferase (MTase) activity has received considerable attention due to its significance in the fields of early cancer clinical diagnostics and drug discovery. Herein, we proposed a novel label-free fluorescence method for MTase activity assay by coupling double-stranded DNA (dsDNA)-templated copper nanoparticles (CuNPs) with an endonuclease-assisted signal transduction system. In this strategy, dsDNA molecules were first methylated by DNA adenine methylation (Dam) MTase and then cleaved by the methylation-sensitive restriction endonuclease DpnI. The cleaved DNA fragments could not act as efficient templates for the formation of fluorescent CuNPs and thus no fluorescence signal was produced. Under optimized experimental conditions, the developed strategy exhibited a sensitive fluorescence response to Dam MTase activity. This strategy was also demonstrated to provide an excellent platform to the inhibitor screening for Dam MTase. These results demonstrated the great potential for the practical applications of the proposed strategy for Dam MTase activity assay.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rajan, Rakhi; Taneja, Bhupesh; Mondragón, Alfonso

    Topoisomerase V is an archaeal type I topoisomerase that is unique among topoisomerases due to presence of both topoisomerase and DNA repair activities in the same protein. It is organized as an N-terminal topoisomerase domain followed by 24 tandem helix-hairpin-helix (HhH) motifs. Structural studies have shown that the active site is buried by the (HhH) motifs. Here we show that the N-terminal domain can relax DNA in the absence of any HhH motifs and that the HhH motifs are required for stable protein-DNA complex formation. Crystal structures of various topoisomerase V fragments show changes in the relative orientation of themore » domains mediated by a long bent linker helix, and these movements are essential for the DNA to enter the active site. Phosphate ions bound to the protein near the active site helped model DNA in the topoisomerase domain and show how topoisomerase V may interact with DNA.« less

  4. Effect of different doses of nandrolone decanoate on lipid peroxidation, DNA fragmentation, sperm abnormality and histopathology of testes of male Wister rats.

    PubMed

    Mohamed, Hanaa Mahmoud; Mohamed, Manal Abdul-Hamid

    2015-01-01

    The present study aims of to investigate the effects of low and high doses of nandrolone decanoate (ND) on histopathology and apoptosis of the spermatogenic cells as well as lipid peroxidation, antioxidant enzyme activities, sperm abnormality and DNA fragmentation. Eighteen animals were divided into three groups each group contain six animals. The rats were divided into three groups as following: Group 1 was administered saline (control). Group 2, received nandrolone decanoate (3 mg/kg/weekly) (low dose) with intramuscular injection. Group 3, received intramuscular injection dose of nandrolone decanoate (10 mg/kg/weekly) (high dose). After 8 weeks, caspase-3 assay was used to determine the apoptotic cells. The sperm parameters, lipid peroxidation, antioxidant enzyme activities and testosterone concentration were also investigated in the experimental groups of both low and high dose compared to the control groups. Treated group with high dose showed degenerated germinal epithelial cells sloughed in the lumina of seminiferous tubules, where almost seminiferous tubules were devoid of spermatids and spermatozoa compared to control and group treated with low dose. Also, a significant increase of lipid peroxidation levels and heat shock proteins was observed in two groups administrated with two different doses of ND while, antioxidant enzyme activities, and testosterone concentration was significantly decreased in two treated group when compared with control. Administration of ND at high and low doses leads to deteriorated sperm parameters, DNA fragmentation and testicular apoptosis. In conclusion, the administration ND at high doses more effective on lipid peroxidation, antioxidant enzyme activities, sperm abnormality, histopathology, apoptotic and DNA changes compared to low dose group and to control group. Published by Elsevier GmbH.

  5. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    PubMed Central

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  6. Activation of cathepsins B and L in mouse lymphosarcoma tissue under the effect of cyclophosphamide is associated with apoptosis induction and infiltration by mononuclear phagocytes.

    PubMed

    Zhanaeva, S Ya; Mel'nikova, E V; Trufakin, V A; Korolenko, T A

    2013-11-01

    We analyzed activities of lysosomal cystein cathepsins B and L in mouse LS lymphosarcoma and its drug-resistant RLS 40 strain and their correlations with the dynamics of the percentage of cells with fragmented DNA and CD14 (+) phagocytes over 3 days after cyclophosphamide injection. LS regression and inhibition of RLS 40 growth after cyclophosphamide injection were paralleled by an increase in cathepsins B and L activities in tumor tissues. The antitumor effect of cyclophosphamide associated with apoptosis intensity and protease activities were significantly higher in LS. Positive correlations between activities of cathepsins B and L and the LS tissue content of cells with fragmented DNA and CD14 (+) phagocytes and negative correlations thereof with tumor weight were detected. It seems that the increase in cathepsins B and L activities in LS tissues was caused by cyclophosphamide induction of apoptosis and depended on the level of tumor cell infiltration with mononuclear phagocytes.

  7. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    PubMed

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect against antigenotoxicity and precancerous lesions.

  8. DNA fragmentation by charged particle tracks.

    PubMed

    Stenerlow, B; Hoglund, E; Carlsson, J

    2002-01-01

    High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons (60Co) or 125 keV/micrometers nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome. c2002 COSPAR. Published by Elsevier Science Ltd. All rights reserved.

  9. The interaction of E. coli integration host factor and lambda cos DNA: multiple complex formation and protein-induced bending.

    PubMed Central

    Kosturko, L D; Daub, E; Murialdo, H

    1989-01-01

    The interaction of E. coli's integration Host Factor (IHF) with fragments of lambda DNA containing the cos site has been studied by gel-mobility retardation and electron microscopy. The cos fragment used in the mobility assays is 398 bp and spans a region from 48,298 to 194 on the lambda chromosome. Several different complexes of IHF with this fragment can be distinguished by their differential mobility on polyacrylamide gels. Relative band intensities indicate that the formation of a complex between IHF and this DNA fragment has an equilibrium binding constant of the same magnitude as DNA fragments containing lambda's attP site. Gel-mobility retardation and electron microscopy have been employed to show that IHF sharply bends DNA near cos and to map the bending site. The protein-induced bend is near an intrinsic bend due to DNA sequence. The position of the bend suggests that IHF's role in lambda DNA packaging may be the enhancement of terminase binding/cos cutting by manipulating DNA structure. Images PMID:2521383

  10. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    PubMed

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  11. Citric acid effects on brain and liver oxidative stress in lipopolysaccharide-treated mice.

    PubMed

    Abdel-Salam, Omar M E; Youness, Eman R; Mohammed, Nadia A; Morsy, Safaa M Youssef; Omara, Enayat A; Sleem, Amany A

    2014-05-01

    Citric acid is a weak organic acid found in the greatest amounts in citrus fruits. This study examined the effect of citric acid on endotoxin-induced oxidative stress of the brain and liver. Mice were challenged with a single intraperitoneal dose of lipopolysaccharide (LPS; 200 μg/kg). Citric acid was given orally at 1, 2, or 4 g/kg at time of endotoxin injection and mice were euthanized 4 h later. LPS induced oxidative stress in the brain and liver tissue, resulting in marked increase in lipid peroxidation (malondialdehyde [MDA]) and nitrite, while significantly decreasing reduced glutathione, glutathione peroxidase (GPx), and paraoxonase 1 (PON1) activity. Tumor necrosis factor-alpha (TNF-α) showed a pronounced increase in brain tissue after endotoxin injection. The administration of citric acid (1-2 g/kg) attenuated LPS-induced elevations in brain MDA, nitrite, TNF-α, GPx, and PON1 activity. In the liver, nitrite was decreased by 1 g/kg citric acid. GPx activity was increased, while PON1 activity was decreased by citric acid. The LPS-induced liver injury, DNA fragmentation, serum transaminase elevations, caspase-3, and inducible nitric oxide synthase expression were attenuated by 1-2 g/kg citric acid. DNA fragmentation, however, increased after 4 g/kg citric acid. Thus in this model of systemic inflammation, citric acid (1-2 g/kg) decreased brain lipid peroxidation and inflammation, liver damage, and DNA fragmentation.

  12. Citric Acid Effects on Brain and Liver Oxidative Stress in Lipopolysaccharide-Treated Mice

    PubMed Central

    Youness, Eman R.; Mohammed, Nadia A.; Morsy, Safaa M. Youssef; Omara, Enayat A.; Sleem, Amany A.

    2014-01-01

    Abstract Citric acid is a weak organic acid found in the greatest amounts in citrus fruits. This study examined the effect of citric acid on endotoxin-induced oxidative stress of the brain and liver. Mice were challenged with a single intraperitoneal dose of lipopolysaccharide (LPS; 200 μg/kg). Citric acid was given orally at 1, 2, or 4 g/kg at time of endotoxin injection and mice were euthanized 4 h later. LPS induced oxidative stress in the brain and liver tissue, resulting in marked increase in lipid peroxidation (malondialdehyde [MDA]) and nitrite, while significantly decreasing reduced glutathione, glutathione peroxidase (GPx), and paraoxonase 1 (PON1) activity. Tumor necrosis factor-alpha (TNF-α) showed a pronounced increase in brain tissue after endotoxin injection. The administration of citric acid (1–2 g/kg) attenuated LPS-induced elevations in brain MDA, nitrite, TNF-α, GPx, and PON1 activity. In the liver, nitrite was decreased by 1 g/kg citric acid. GPx activity was increased, while PON1 activity was decreased by citric acid. The LPS-induced liver injury, DNA fragmentation, serum transaminase elevations, caspase-3, and inducible nitric oxide synthase expression were attenuated by 1–2 g/kg citric acid. DNA fragmentation, however, increased after 4 g/kg citric acid. Thus in this model of systemic inflammation, citric acid (1–2 g/kg) decreased brain lipid peroxidation and inflammation, liver damage, and DNA fragmentation. PMID:24433072

  13. Induction of Apoptosis and Antiproliferative Activity of Naringenin in Human Epidermoid Carcinoma Cell through ROS Generation and Cell Cycle Arrest

    PubMed Central

    Jafri, Asif; Ahmad, Sheeba; Afzal, Mohammad; Arshad, Md

    2014-01-01

    A natural predominant flavanone naringenin, especially abundant in citrus fruits, has a wide range of pharmacological activities. The search for antiproliferative agents that reduce skin carcinoma is a task of great importance. The objective of this study was to analyze the anti-proliferative and apoptotic mechanism of naringenin using MTT assay, DNA fragmentation, nuclear condensation, change in mitochondrial membrane potential, cell cycle kinetics and caspase-3 as biomarkers and to investigate the ability to induce reactive oxygen species (ROS) initiating apoptotic cascade in human epidermoid carcinoma A431 cells. Results showed that naringenin exposure significantly reduced the cell viability of A431 cells (p<0.01) with a concomitant increase in nuclear condensation and DNA fragmentation in a dose dependent manner. The intracellular ROS generation assay showed statistically significant (p<0.001) dose-related increment in ROS production for naringenin. It also caused naringenin-mediated epidermoid carcinoma apoptosis by inducing mitochondrial depolarization. Cell cycle study showed that naringenin induced cell cycle arrest in G0/G1 phase of cell cycle and caspase-3 analysis revealed a dose dependent increment in caspase-3 activity which led to cell apoptosis. This study confirms the efficacy of naringenin that lead to cell death in epidermoid carcinoma cells via inducing ROS generation, mitochondrial depolarization, nuclear condensation, DNA fragmentation, cell cycle arrest in G0/G1 phase and caspase-3 activation. PMID:25330158

  14. Sperm DNA damage has a negative association with live-birth rates after IVF.

    PubMed

    Simon, L; Proutski, I; Stevenson, M; Jennings, D; McManus, J; Lutton, D; Lewis, S E M

    2013-01-01

    Sperm DNA damage has a negative impact on pregnancy rates following assisted reproduction treatment (ART). The aim of the present study was to examine the relationship between sperm DNA fragmentation and live-birth rates after IVF and intracytoplasmic sperm injection (ICSI). The alkaline Comet assay was employed to measure sperm DNA fragmentation in native semen and in spermatozoa following density-gradient centrifugation in semen samples from 203 couples undergoing IVF and 136 couples undergoing ICSI. Men were divided into groups according to sperm DNA damage. Following IVF, couples with <25% sperm DNA fragmentation had a live-birth rate of 33%; in contrast, couples with >50% sperm DNA fragmentation had a much lower live-birth rate of 13%. Following ICSI, no significant differences in sperm DNA damage were found between any groups of patients. Sperm DNA damage was also associated with low live-birth rates following IVF in both men and couples with idiopathic infertility: 39% of couples and 41% of men with idiopathic infertility have high sperm DNA damage. Sperm DNA damage assessed by the Comet assay has a close inverse relationship with live-birth rates after IVF. Sperm DNA damage has a negative impact on assisted reproduction treatment outcome, in particular, on pregnancy rates. The aim of the present study was to examine the relationship between sperm DNA fragmentation and live-birth rates after IVF and intracytoplasmic sperm injection (ICSI). The alkaline Comet assay was employed to measure sperm DNA fragmentation in native semen and in spermatozoa following density-gradient centrifugation in semen samples from 203 couples undergoing IVF and 136 couples undergoing ICSI. Men were divided into groups according to sperm DNA damage and treatment outcome. Following IVF, couples with <25% sperm DNA fragmentation had a live birth rate of 33%. In contrast, couples with >50% sperm DNA fragmentation had a much lower live-birth rate of 13% following IVF. Following ICSI, there were no significant differences in levels of sperm DNA damage between any groups of patients. Sperm DNA damage was also associated with the very low live-birth rates following IVF in both men and couples with idiopathic infertility: 39% of couples and 41% of men have high level of sperm DNA damage. Sperm DNA damage assessed by the Comet assay has a close inverse relationship with live-birth rates after IVF. Copyright © 2012 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  15. Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

    PubMed

    Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

    2013-10-01

    Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The approach we are proposing may provide a novel, non-invasive, objective tool for embryo quality grading. The correlation between a high mtDNA concentration and the fragmentation rate of embryos is suggestive that fragments are mainly anuclear cytoplasmatic debris arising during cleavage. Therefore, blastomere shaping as an early event during in vitro development may play a homeostatic role and be related to embryo competence. This project was funded by Merck Serono (Grant for Fertility Innovation 2011). The sponsor had no role in study design, data collection, data analysis, data interpretation and writing of the paper. Authors declare no conflicts of interest. ClinicalTrials.gov Identifier: NCT01397136.

  16. Quantitative, non-invasive imaging of radiation-induced DNA double strand breaks in vivo

    PubMed Central

    Li, Wenrong; Li, Fang; Huang, Qian; Shen, Jingping; Wolf, Frank; He, Yujun; Liu, Xinjian; Hu, Y. Angela; Bedford, Joel. S.; Li, Chuan-Yuan

    2011-01-01

    DNA double strand breaks is a major form of DNA damage and a key mechanism through which radiotherapy and some chemotherapeutic agents kill cancer cells. Despite its importance, measuring DNA double strand breaks is still a tedious task that is normally carried out by gel electrophoresis or immunofluorescence staining. Here we report a novel approach to image and quantify DNA double strand breaks in live mammalian cells through bi-fragment luciferase reconstitution. N- and C- terminal fragments of firefly luciferase gene were fused with H2AX and MDC1 genes, respectively. Our strategy was based on the established fact that at the sites of DNA double strand breaks, H2AX protein is phosphoryated and physically associates with the MDC1 protein, thus bringing together N- and C- luciferase fragments and reconstituting luciferase activity. Our strategy allowed serial, non-invasive quantification of DNA double strand breaks in cells irradiated with x-rays and 56Fe ions. Furthermore, it allowed for the evaluation of DNA double strand breaks (DSBs) non-invasively in vivo in irradiated tumors over two weeks. Surprisingly, we detected a second wave of DSB induction in irradiated tumor cells days after radiation exposure in addition to the initial rapid induction of DSBs. We conclude that our new split-luciferase based method for imaging γ-H2AX-MDC1 interaction is a powerful new tool to study DNA double strand break repair kinetics in vivo with considerable advantage for experiments requiring observations over an extended period of time. PMID:21527553

  17. Processes involved in assisted reproduction technologies significantly increase sperm DNA fragmentation and phosphatidylserine translocation.

    PubMed

    Balasuriya, A; Serhal, P; Doshi, A; Harper, J C

    2014-03-01

    Sperm preparation techniques in assisted reproduction technologies (ART) are potential generators of exogenous stresses that cause additional DNA damage. DNA fragmentation tests, such as the sperm chromatin structure assay, involve freezing sperm samples in the absence of cryoprotectant. Thermal, oxidative stress (OS) and freezing are detrimental to sperm DNA fragmentation and phosphatidylserine (PS) translocation. The primary aim of this study was to subject mature sperm to environmental insults that normally occur during ART. We tested the hypotheses that OS, thermal stress and freeze-thawing caused sperm nuclear and membrane damage and that a positive correlation exists between PS translocation and DNA fragmentation. Sperm DNA integrity deteriorates in semen samples from men with advancing age and a sperm concentration of <15 m ml(-1) . The significant increase in sperm DNA fragmentation at 37 °C after merely 1 h is important clinically as semen liquefaction and short-term sperm storage in an ART cycle involve incubating samples at this temperature. Freezing without a cryoprotectant significantly increases the level of sperm nuclear damage, so it is important not to freeze neat semen prior to DNA fragmentation testing. This study highlights the importance of minimising the production of exogenous stresses during sperm preparation in ART. © 2012 Blackwell Verlag GmbH.

  18. The association of DNA-dependent protein kinase activity of peripheral blood lymphocytes with prognosis of cancer

    PubMed Central

    Someya, M; Sakata, K-i; Matsumoto, Y; Kamdar, R P; Kai, M; Toyota, M; Hareyama, M

    2011-01-01

    Background: Repair of various types of DNA damages is critical for genomic stability. DNA-dependent protein kinase (DNA-PK) has an important role in DNA double-strand break repair. We examined whether there may be a correlation between DNA-PK activity in peripheral blood lymphocytes (PBLs) and survival percentages in various cancer patients. We also investigated the changes of DNA-PK activity in PBLs after radiotherapy. Methods: A total of 167 of untreated cancer patients participated in this study. Peripheral blood was collected, separated, and centrifuged. DNA-PK activity was measured by DNA-pull-down assay. Chromosomal aberrations were examined by cytogenetic methods. Results: DNA-PK activity of PBLs in advanced cancer patients was significantly lower than that in early stage. The patients with lower DNA-PK activity in PBLs tended to have the lower disease-specific survivals and distant metastasis-free survivals than those with higher DNA-PK activity in advanced stages. There was also a tendency of inverse correlation between DNA-PK activity and excess fragments. The DNA-PK activity of PBLs in most patients decreased in response to radiation as the equivalent whole-body dose increased. Conclusion: Cancer patients in advanced stage, with lower DNA-PK activity of PBLs might have higher distant metastasis and exhibit poorer prognosis. Therefore, DNA-PK activity in PBLs could be used as a marker to predict the chromosomal instability and poorer prognosis. PMID:21559021

  19. High-resolution hydrodynamic chromatographic separation of large DNA using narrow, bare open capillaries: a rapid and economical alternative technology to pulsed-field gel electrophoresis?

    PubMed

    Liu, Lei; Veerappan, Vijaykumar; Pu, Qiaosheng; Cheng, Chang; Wang, Xiayan; Lu, Liping; Allen, Randy D; Guo, Guangsheng

    2014-01-07

    A high-resolution, rapid, and economical hydrodynamic chromatographic (HDC) method for large DNA separations in free solution was developed using narrow (5 μm diameter), bare open capillaries. Size-based separation was achieved in a chromatographic format with larger DNA molecules being eluting faster than smaller ones. Lambda DNA Mono Cut Mix was baseline-separated with the percentage resolutions generally less than 9.0% for all DNA fragments (1.5 to 48.5 kbp) tested in this work. High efficiencies were achieved for large DNA from this chromatographic technique, and the number of theoretical plates reached 3.6 × 10(5) plates for the longest (48.5 kbp) and 3.7 × 10(5) plates for the shortest (1.5 kbp) fragments. HDC parameters and performances were also discussed. The method was further applied for fractionating large DNA fragments from real-world samples (SacII digested Arabidopsis plant bacterial artificial chromosome (BAC) DNA and PmeI digested Rice BAC DNA) to demonstrate its feasibility for BAC DNA finger printing. Rapid separation of PmeI digested Rice BAC DNA covering from 0.44 to 119.041 kbp was achieved in less than 26 min. All DNA fragments of these samples were baseline separated in narrow bare open capillaries, while the smallest fragment (0.44 kbp) was missing in pulsed-field gel electrophoresis (PFGE) separation mode. It is demonstrated that narrow bare open capillary chromatography can realize a rapid separation for a wide size range of DNA mixtures that contain both small and large DNA fragments in a single run.

  20. Epigallocatechin-3-gallate reduces DNA damage induced by benzo[a]pyrene diol epoxide and cigarette smoke condensate in human mucosa tissue cultures.

    PubMed

    Baumeister, Philipp; Reiter, Maximilian; Kleinsasser, Norbert; Matthias, Christoph; Harréus, Ulrich

    2009-06-01

    Although epidemiological studies indicate cancer preventive effects of diets rich in fruit and vegetables, large clinical intervention studies conducted to evaluate dietary supplementation with micronutrients, mostly vitamins, showed disappointing results in large parts. In contrast, there is encouraging epidemiologic data indicating great chemopreventive potential of a large group of phytochemicals, namely polyphenols. This study shows the DNA protective effect epigallocatechin-3-gallate, a tea catechin, and one of the best-studied substances within this group, on carcinogen-induced DNA fragmentation in upper aerodigestive tract cells. Cell cultures from fresh oropharyngeal mucosa biopsies were preincubated with epigallocatechin-3-gallate in different concentrations before DNA damage was introduced with the metabolically activated carcinogen benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide or cigarette smoke condensate. Effects on resulting DNA fragmentation were measured using the alkaline single-cell microgel electrophoresis (comet assay). Epigallocatechin-3-gallate significantly reduced benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide-induced DNA damage by up to 51% (P<0.001). Fragmentation induced by cigarette smoke condensate could be lowered by 47% (P<0.001). Data suggest a cancer preventive potential of epigallocatechin-3-gallate as demonstrated on a subcellular level. An additional mechanism of tea catechin action is revealed by using a primary mucosa culture model.

  1. Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

    PubMed

    Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

    1996-01-01

    The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

  2. Human scFv antibody fragments specific for hepatocellular carcinoma selected from a phage display library.

    PubMed

    Yu, Bing; Ni, Ming; Li, Wen-Han; Lei, Ping; Xing, Wei; Xiao, Dai-Wen; Huang, Yu; Tang, Zhen-Jie; Zhu, Hui-Fen; Shen, Guan-Xin

    2005-07-14

    To identify the scFv antibody fragments specific for hepatocellular carcinoma by biopanning from a large human naive scFv phage display library. A large human naive scFv phage library was used to search for the specific targets by biopanning with the hepatocellular carcinoma cell line HepG2 for the positive-selecting and the normal liver cell line L02 for the counter-selecting. After three rounds of biopanning, individual scFv phages binding selectively to HepG2 cells were picked out. PCR was carried out for identification of the clones containing scFv gene sequence. The specific scFv phages were selected by ELISA and flow cytometry. DNA sequences of positive clones were analyzed by using Applied Biosystem Automated DNA sequencers 3 730. The expression proteins of the specific scFv antibody fragments in E.coli HB2151 were purified by the affinity chromatography and detected by SDS-PAGE, Western blot and ELISA. The biological effect of the soluble antibody fragments on the HepG2 cells was investigated by observing the cell proliferation. Two different positive clones were obtained and the functional variable sequences were identified. Their DNA sequences of the scFv antibody fragments were submitted to GenBank (accession nos: AY686498 and AY686499). The soluble scFv antibody fragments were successfully expressed in E.coli HB2151. The relative molecular mass of the expression products was about 36 ku, according to its predicted M(r) value. The two soluble scFv antibody fragments also had specific binding activity and obvious growth inhibition properties to HepG2 cells. The phage library biopanning permits identification of specific antibody fragments for hepatocellular carcinoma and affords experiment evidence for its immunotherapy study.

  3. Comparison of DNA fragmentation and color thresholding for objective quantitation of apoptotic cells

    NASA Technical Reports Server (NTRS)

    Plymale, D. R.; Ng Tang, D. S.; Fermin, C. D.; Lewis, D. E.; Martin, D. S.; Garry, R. F.

    1995-01-01

    Apoptosis is a process of cell death characterized by distinctive morphological changes and fragmentation of cellular DNA. Using video imaging and color thresholding techniques, we objectively quantitated the number of cultured CD4+ T-lymphoblastoid cells (HUT78 cells, RH9 subclone) displaying morphological signs of apoptosis before and after exposure to gamma-irradiation. The numbers of apoptotic cells measured by objective video imaging techniques were compared to numbers of apoptotic cells measured in the same samples by sensitive apoptotic assays that quantitate DNA fragmentation. DNA fragmentation assays gave consistently higher values compared with the video imaging assays that measured morphological changes associated with apoptosis. These results suggest that substantial DNA fragmentation can precede or occur in the absence of the morphological changes which are associated with apoptosis in gamma-irradiated RH9 cells.

  4. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    PubMed

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  5. Spontaneous apoptotic DNA fragmentation in cultured guinea pig gastric mucosal cells.

    PubMed

    Tsutsumi, S; Rokutan, K; Tsuchiya, T; Mizushima, T

    2000-02-01

    The purpose of this study was to elucidate the mechanism of spontaneous and rapid cell death of cultured gastric pit cells. Gastric pit cells have a rapid cell turnover rate in vivo. We here show that guinea pig gastric pit cells in culture undergo spontaneous and rapid apoptotic DNA fragmentation, which may represent the rapid cell turnover cycle of gastric pit cells in vivo. This spontaneous apoptotic DNA fragmentation required the presence of fetal calf serum in the culture media. Furthermore, the spontaneous apoptotic DNA fragmentation was prevented by protein synthesis and caspase inhibitors.

  6. DNA fragmentation and sperm head morphometry in cat epididymal spermatozoa.

    PubMed

    Vernocchi, Valentina; Morselli, Maria Giorgia; Lange Consiglio, Anna; Faustini, Massimo; Luvoni, Gaia Cecilia

    2014-10-15

    Sperm DNA fragmentation is an important parameter to assess sperm quality and can be a putative fertility predictor. Because the sperm head consists almost entirely of DNA, subtle differences in sperm head morphometry might be related to DNA status. Several techniques are available to analyze sperm DNA fragmentation, but they are labor-intensive and require expensive instrumentations. Recently, a kit (Sperm-Halomax) based on the sperm chromatin dispersion test and developed for spermatozoa of different species, but not for cat spermatozoa, became commercially available. The first aim of the present study was to verify the suitability of Sperm-Halomax assay, specifically developed for canine semen, for the evaluation of DNA fragmentation of epididymal cat spermatozoa. For this purpose, DNA fragmentation indexes (DFIs) obtained with Sperm-Halomax and terminal deoxynucleotidyl transferase-mediated nick-end labeling (TUNEL) were compared. The second aim was to investigate whether a correlation between DNA status, sperm head morphology, and morphometry assessed by computer-assisted semen analysis exists in cat epididymal spermatozoa. No differences were observed in DFIs obtained with Sperm-Halomax and TUNEL. This result indicates that Sperm-Halomax assay provides a reliable evaluation of DNA fragmentation of epididymal feline spermatozoa. The DFI seems to be independent from all the measured variables of sperm head morphology and morphometry. Thus, the evaluation of the DNA status of spermatozoa could effectively contribute to the completion of the standard analysis of fresh or frozen semen used in assisted reproductive technologies. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Crocin, the main active saffron constituent, mitigates dichlorvos-induced oxidative stress and apoptosis in HCT-116 cells.

    PubMed

    Ben Salem, Intidhar; Boussabbeh, Manel; Kantaoui, Hiba; Bacha, Hassen; Abid-Essefi, Salwa

    2016-08-01

    The protective effects of Crocin (CRO), a carotenoid with wide spectrum of pharmacological effects, against the cytotoxicity and the apoptosis produced by exposure to Dichlorvos (DDVP) in HCT116 cells were investigated in this work. The cytotoxicity was monitored by cell viability, ROS generation, antioxidant enzymes activities, malondialdehyde (MDA) production and DNA fragmentation. The apoptosis was assessed through the measurement of the mitochondrial transmembrane potential (ΔΨm) and caspases activation. The results indicated that pretreatment of HCT116 cells with CRO, 2h prior to DDVP exposure, significantly increased the survival of cells, inhibited the ROS generation, modulated the activities of catalase (CAT) and superoxide dismutase (SOD) and reduced the MDA level. The reduction in mitochondrial membrane potential, DNA fragmentation and caspases activation were also inhibited by CRO. These findings suggest that CRO can protect HCT116 cells from DDVP-induced oxidative stress and apoptosis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. Mannose Induces an Endonuclease Responsible for DNA Laddering in Plant Cells

    PubMed Central

    Stein, Joshua C.; Hansen, Geneviève

    1999-01-01

    The effect of d-mannose (Man) on plant cells was studied in two different systems: Arabidopsis roots and maize (Zea mays) suspension-cultured cells. In both systems, exposure to d-Man was associated with a subset of features characteristic of apoptosis, as assessed by oligonucleosomal fragmentation and microscopy analysis. Furthermore, d-Man induced the release of cytochrome c from mitochondria. The specificity of d-Man was evaluated by comparing the effects of diastereomers such as l-Man, d-glucose, and d-galactose. Of these treatments, only d-Man caused a reduction in final fresh weight with concomitant oligonucleosomal fragmentation. Man-induced DNA laddering coincided with the activation of a DNase in maize cytosolic extracts and with the appearance of single 35-kD band detected using an in-gel DNase assay. The DNase activity was further confirmed by using covalently closed circular plasmid DNA as a substrate. It appears that d-Man, a safe and readily accessible compound, offers remarkable features for the study of apoptosis in plant cells. PMID:10482662

  9. The potential of vitamin K3 as an anticancer agent against breast cancer that acts via the mitochondria-related apoptotic pathway.

    PubMed

    Akiyoshi, Takeshi; Matzno, Sumio; Sakai, Mika; Okamura, Noboru; Matsuyama, Kenji

    2009-12-01

    We tried to clarify the cytotoxic mechanism of VK(3) using the breast cancer cell line MCF-7. Cytotoxicity was measured via intracellular esterase activity. DNA fragmentation was assessed by agarose gel electrophoresis. JC-1 staining was applied to measure mitochondrial dysfunction. Caspase activation and reactive oxidative species (ROS) generation were also measured. VK(3) exhibited cytotoxicity that caused DNA fragmentation in MCF-7 cells with an IC(50) of 14.2 microM. JC-1 staining revealed that VK(3) caused mitochondrial dysfunction including a disappearance of mitochondrial membrane potential. Additional investigation showed that the mitochondrial damage was induced by the generation of ROS and the subsequent activation of caspase-7 and -9. Our findings demonstrate that VK(3)-induced apoptosis is selectively initiated by the mitochondria-related pathway and might be useful in breast cancer chemotherapy.

  10. The MluI cell cycle box (MCB) motifs, but not damage-responsive elements (DREs), are responsible for the transcriptional induction of the rhp51+ gene in response to DNA replication stress.

    PubMed

    Sartagul, Wugangerile; Zhou, Xin; Yamada, Yuki; Ma, Ning; Tanaka, Katsunori; Furuyashiki, Tomoyuki; Ma, Yan

    2014-01-01

    DNA replication stress induces the transcriptional activation of rhp51+, a fission yeast recA homolog required for repair of DNA double strand breaks. However, the mechanism by which DNA replication stress activates rhp51+ transcription is not understood. The promoter region of rhp51+ contains two damage-responsive elements (DREs) and two MluI cell cycle box (MCB) motifs. Using luciferase reporter assays, we examined the role of these elements in rhp51+ transcription. The full-length rhp51+ promoter and a promoter fragment containing MCB motifs only, but not a fragment containing DREs, mediated transcriptional activation upon DNA replication stress. Removal of the MCB motifs from the rhp51+ promoter abolished the induction of rhp51+ transcription by DNA replication stress. Consistent with a role for MCB motifs in rhp51+ transcription activation, deletion of the MBF (MCB-binding factor) co-repressors Nrm1 and Yox1 precluded rhp51+ transcriptional induction in response to DNA replication stress. Using cells deficient in checkpoint signaling molecules, we found that the Rad3-Cds1/Chk1 pathway partially mediated rhp51+ transcription in response to DNA replication stress, suggesting the involvement of unidentified checkpoint signaling pathways. Because MBF is critical for G1/S transcription, we examined how the cell cycle affected rhp51+ transcription. The transcription of rhp51+ and cdc18+, an MBF-dependent G1/S gene, peaked simultaneously in synchronized cdc25-22 cells. Furthermore, DNA replication stress maintained transcription of rhp51+ similarly to cdc18+. Collectively, these results suggest that MBF and its regulators mediate rhp51+ transcription in response to DNA replication stress, and underlie rhp51+ transcription at the G1/S transition.

  11. A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

    ERIC Educational Resources Information Center

    Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

    2012-01-01

    We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

  12. Comparison of three methods of DNA extraction from peripheral blood mononuclear cells and lung fragments of equines.

    PubMed

    Santos, E M; Paula, J F R; Motta, P M C; Heinemann, M B; Leite, R C; Haddad, J P A; Del Puerto, H L; Reis, J K P

    2010-08-17

    We compared three different protocols for DNA extraction from horse peripheral blood mononuclear cells (PBMC) and lung fragments, determining average final DNA concentration, purity, percentage of PCR amplification using beta-actin, and cost. Thirty-four samples from PBMC, and 33 samples from lung fragments were submitted to DNA extraction by three different protocols. Protocol A consisted of a phenol-chloroform and isoamylic alcohol extraction, Protocol B used alkaline extraction with NaOH, and Protocol C used the DNAzol((R)) reagent kit. Protocol A was the best option for DNA extraction from lung fragments, producing high DNA concentrations, with high sensitivity in PCR amplification (100%), followed by Protocols C and B. On the other hand, for PBMC samples, Protocol B gave the highest sensitivity in PCR amplification (100%), followed by Protocols C and A. We conclude that Protocol A should be used for PCR diagnosis from lung fragment samples, while Protocol B should be used for PBMC.

  13. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    PubMed

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Biologically active protein fragments containing specific binding regions of serum albumin or related proteins

    NASA Technical Reports Server (NTRS)

    Carter, Daniel C. (Inventor)

    1998-01-01

    In accordance with the present invention, biologically active protein fragments can be constructed which contain only those specific portions of the serum albumin family of proteins such as regions known as subdomains IIA and IIIA which are primarily responsible for the binding properties of the serum albumins. The artificial serums that can be prepared from these biologically active protein fragments are advantageous in that they can be produced much more easily than serums containing the whole albumin, yet still retain all or most of the original binding potential of the full albumin proteins. In addition, since the protein fragment serums of the present invention can be made from non-natural sources using conventional recombinant DNA techniques, they are far safer than serums containing natural albumin because they do not carry the potentially harmful viruses and other contaminants that will be found in the natural substances.

  15. Trapping and breaking of in vivo nicked DNA during pulsed-field gel electrophoresis

    PubMed Central

    Khan, Sharik R.; Kuzminov, Andrei

    2013-01-01

    Pulsed field gel electrophoresis (PFGE) offers a high-resolution approach to quantify chromosomal fragmentation in bacteria, measured as percent of chromosomal DNA entering the gel. The degree of separation in PFG depends upon the size of DNA, as well as various conditions of electrophoresis, such as electric field strength (FS), time of electrophoresis, switch time and buffer composition. Here we describe a new parameter, the structural integrity of the sample DNA itself, that influences its migration through PFGs. We show that sub-chromosomal fragments containing both spontaneous and DNA damage-induced nicks are prone to breakage during PFGE. Such breakage at single strand interruptions results in artefactual decrease in molecular weight of linear DNA making accurate determination of the number of double strand breaks difficult. While breakage of nicked sub-chromosomal fragments is FS-independent, some high molecular weight sub-chromosomal fragments are also trapped within wells under the standard PFGE conditions. This trapping can be minimized by lowering the field strength and increasing the time of electrophoresis. We discuss how breakage of nicked DNA may be mechanistically linked to trapping. Our results suggest how to optimize conditions for PFGE when quantifying chromosomal fragmentation induced by DNA damage. PMID:23770235

  16. Preparation of next-generation sequencing libraries using Nextera™ technology: simultaneous DNA fragmentation and adaptor tagging by in vitro transposition.

    PubMed

    Caruccio, Nicholas

    2011-01-01

    DNA library preparation is a common entry point and bottleneck for next-generation sequencing. Current methods generally consist of distinct steps that often involve significant sample loss and hands-on time: DNA fragmentation, end-polishing, and adaptor-ligation. In vitro transposition with Nextera™ Transposomes simultaneously fragments and covalently tags the target DNA, thereby combining these three distinct steps into a single reaction. Platform-specific sequencing adaptors can be added, and the sample can be enriched and bar-coded using limited-cycle PCR to prepare di-tagged DNA fragment libraries. Nextera technology offers a streamlined, efficient, and high-throughput method for generating bar-coded libraries compatible with multiple next-generation sequencing platforms.

  17. Screening of Israeli Holstein-Friesian cattle for restriction fragment length polymorphisms using homologous and heterologous deoxyribonucleic acid probes.

    PubMed

    Hallerman, E M; Nave, A; Soller, M; Beckmann, J S

    1988-12-01

    Genomic DNA of Israeli Holstein-Friesian dairy cattle were screened with a battery of 17 cloned or subcloned DNA probes in an attempt to document restriction fragment length polymorphisms at a number of genetic loci. Restriction fragment length polymorphisms were observed at the chymosin, oxytocin-neurophysin I, lutropin beta, keratin III, keratin VI, keratin VII, prolactin, and dihydrofolate reductase loci. Use of certain genomic DNA fragments as probes produced hybridization patterns indicative of satellite DNA at the respective loci. Means for distinguishing hybridizations to coding sequences for unique genes from those to satellite DNA were developed. Results of this study are discussed in terms of strategy for the systematic development of large numbers of bovine genomic polymorphisms.

  18. Spacer-length DNA intermediates are associated with Cas1 in cells undergoing primed CRISPR adaptation.

    PubMed

    Musharova, Olga; Klimuk, Evgeny; Datsenko, Kirill A; Metlitskaya, Anastasia; Logacheva, Maria; Semenova, Ekaterina; Severinov, Konstantin; Savitskaya, Ekaterina

    2017-04-07

    During primed CRISPR adaptation spacers are preferentially selected from DNA recognized by CRISPR interference machinery, which in the case of Type I CRISPR-Cas systems consists of CRISPR RNA (crRNA) bound effector Cascade complex that locates complementary targets, and Cas3 executor nuclease/helicase. A complex of Cas1 and Cas2 proteins is capable of inserting new spacers in the CRISPR array. Here, we show that in Escherichia coli cells undergoing primed adaptation, spacer-sized fragments of foreign DNA are associated with Cas1. Based on sensitivity to digestion with nucleases, the associated DNA is not in a standard double-stranded state. Spacer-sized fragments are cut from one strand of foreign DNA in Cas1- and Cas3-dependent manner. These fragments are generated from much longer S1-nuclease sensitive fragments of foreign DNA that require Cas3 for their production. We propose that in the course of CRISPR interference Cas3 generates fragments of foreign DNA that are recognized by the Cas1-Cas2 adaptation complex, which excises spacer-sized fragments and channels them for insertion into CRISPR array. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*

    PubMed Central

    Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang

    2015-01-01

    The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683

  20. [Experimental study on TCRbeta idiotypic antigenic determinants DNA vaccine to induce anti-lymphoma antibodies].

    PubMed

    Zhang, Yeping; Zhu, Ping; Shi, Yongjin; Liu, Jihua; Pu, Dingfang; Cao, Xianghong; Zhu, Qiang; Wang, Yijia; Ma, Mingxin; Yu, Jiren

    2002-02-01

    To investigate the anti-human CEM lymphoma cell activities induced by TCR idiotypic DNA vaccine containing different antigen determinants in BALB/c mice. The specific rearranged gene fragment encoding TCRVbeta region of CEM cell line was obtained by RT-PCR technique. The PCR product was cloned into eukaryocytic expression vector pcDNA3, which was used as DNA vaccine and template for PCR amplifying different antigen determinant. Gene fragments encoding different antigen determinant were amplified and cloned into pcDNA3, separately. The experimental mice were immunized by intramuscular injection of the DNA vaccines. The specific anti-idiotype antibodies were detected by indirect immunofluorescence assay. TCRbetaV of CEM cell line contains five antigen determinants. Specific anti-idiotype antibody was detected in all of the six mice immunized with DNA vaccine containing all the five determinants (the highest titer was 1:480). Although the antibody could also be detected in four of the six mice immunized with DNA vaccine containing four of the five antigen determinants, the antibody titer was lower (the highest titer was 1:80). DNA vaccine containing two of the five determinants could not induce the specific antibody. The idiotypic DNA vaccine containing the whole TCRbetaV five antigen determinants could induce the specific anti-lymphoma idiotypic antibody in BALB/c mice.

  1. The N-terminal Region of the DNA-dependent Protein Kinase Catalytic Subunit Is Required for Its DNA Double-stranded Break-mediated Activation*

    PubMed Central

    Davis, Anthony J.; Lee, Kyung-Jong; Chen, David J.

    2013-01-01

    DNA-dependent protein kinase (DNA-PK) plays an essential role in the repair of DNA double-stranded breaks (DSBs) mediated by the nonhomologous end-joining pathway. DNA-PK is a holoenzyme consisting of a DNA-binding (Ku70/Ku80) and catalytic (DNA-PKcs) subunit. DNA-PKcs is a serine/threonine protein kinase that is recruited to DSBs via Ku70/80 and is activated once the kinase is bound to the DSB ends. In this study, two large, distinct fragments of DNA-PKcs, consisting of the N terminus (amino acids 1–2713), termed N-PKcs, and the C terminus (amino acids 2714–4128), termed C-PKcs, were produced to determine the role of each terminal region in regulating the activity of DNA-PKcs. N-PKcs but not C-PKcs interacts with the Ku-DNA complex and is required for the ability of DNA-PKcs to localize to DSBs. C-PKcs has increased basal kinase activity compared with DNA-PKcs, suggesting that the N-terminal region of DNA-PKcs keeps basal activity low. The kinase activity of C-PKcs is not stimulated by Ku70/80 and DNA, further supporting that the N-terminal region is required for binding to the Ku-DNA complex and full activation of kinase activity. Collectively, the results show the N-terminal region mediates the interaction between DNA-PKcs and the Ku-DNA complex and is required for its DSB-induced enzymatic activity. PMID:23322783

  2. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.

    PubMed

    Weiß, Clemens L; Schuenemann, Verena J; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A; Stinchcombe, John R; Krause, Johannes; Burbano, Hernán A

    2016-06-01

    Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10(-4) per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens.

  3. Fingerprinting of near-homogeneous DNA ligase I and II from human cells. Similarity of their AMP-binding domains.

    PubMed

    Yang, S W; Becker, F F; Chan, J Y

    1990-10-25

    DNA ligases play obligatory roles during replication, repair, and recombination. Multiple forms of DNA ligase have been reported in mammalian cells including DNA ligase I, the high molecular mass species which functions during replication, and DNA ligase II, the low molecular mass species which is associated with repair. In addition, alterations in DNA ligase activities have been reported in acute lymphocytic leukemia cells, Bloom's syndrome cells, and cells undergoing differentiation and development. To better distinguish the biochemical and molecular properties of the various DNA ligases from human cells, we have developed a method of purifying multiple species of DNA ligase from HeLa cells by chromatography through DEAE-Bio-Gel, CM-Bio-Gel, hydroxylapatite, Sephacryl S-300, Mono P, and DNA-cellulose. DNA-cellulose chromatography of the partially purified enzymes resolved multiple species of DNA ligase after labeling the enzyme with [alpha-32P]ATP to form the ligase-[32P]AMP adduct. The early eluting enzyme activity (0.25 M NaCl) contained a major 67-kDa-labeled protein, while the late eluting activity (0.48 M NaCl) contained two major labeled proteins of 90 and 78 kDa. Neutralization experiments with antiligase I antibodies indicated that the early and late eluting activity peaks were DNA ligase II and I, respectively. The three major ligase-[32P]AMP polypeptides (90, 78, and 67 kDa) were subsequently purified to near homogeneity by elution from preparative sodium dodecyl sulfate-polyacrylamide gels. All three polypeptides retained DNA ligase activities after gel elution and renaturation. To further reveal the relationship between these enzymes, partial digestion by V8-protease was performed. All three purified polypeptides gave rise to a common 22-kDa-labeled fragment for their AMP-binding domains, indicating that the catalytic sites of ligase I and II are quite similar, if not identical. Similar findings were obtained from the two-dimensional gel electrophoresis of their AMP-binding domains in the trypsin-digested protein fragments. The results also suggested that these isozymes have been derived from the same primordial DNA sequence or from the same precursor protein. The purification scheme and the data obtained will be instrumental for the further elucidation of the biological roles of various DNA ligases from human cells.

  4. Molecularly Imprinted Polymers with DNA Aptamer Fragments as Macromonomers.

    PubMed

    Zhang, Zijie; Liu, Juewen

    2016-03-01

    Molecularly imprinted polymers (MIPs) are produced in the presence of a template molecule. After removing the template, the cavity can selectively rebind the template. MIPs are attractive functional materials with a low cost and high stability, but traditional MIPs often suffer from low binding affinity. This study employs DNA aptamer fragments as macromonomers to improve MIPs. The DNA aptamer for adenosine was first split into two halves, fluorescently labeled, and copolymerized into MIPs. With a fluorescence quenching assay, the importance of imprinting was confirmed. Further studies were carried out using isothermal titration calorimetry (ITC). Compared to the mixture of the free aptamer fragments, their MIPs doubled the binding affinity. Each free aptamer fragment alone cannot bind adenosine, whereas MIPs containing each fragment are effective binders. We further shortened one of the aptamer fragments, and the DNA length was pushed to as short as six nucleotides, yielding MIPs with a dissociation constant of 27 μM adenosine. This study provides a new method for preparing functional MIP materials by combining high-affinity biopolymer fragments with low-cost synthetic monomers, allowing higher binding affinity and providing a method for signaling binding based on DNA chemistry.

  5. Friedreich's Ataxia (FA)

    MedlinePlus

    ... success- ful people with FA — business leaders, outstanding students, engineers, active teens and bright kids, parents, even ... tory experiments have shown that it’s possible to design short fragments of DNA that prevent abnormal folding ...

  6. Longitudinal study of sperm DNA fragmentation as measured by terminal uridine nick end-labelling assay.

    PubMed

    Sergerie, M; Laforest, G; Boulanger, K; Bissonnette, F; Bleau, G

    2005-07-01

    One major limitation in the use of sperm DNA fragmentation as measured by the TdT (terminal deoxynucleotidyl transferase)-mediated dUTP nick-end labelling (TUNEL) assay is the paucity of solid data on the stability of this parameter. The objective of our study was to evaluate variations in the degree of sperm DNA fragmentation, as measured by the TUNEL assay, over a 6 month period. Five donors provided semen samples (total 107) on the average three times per month, and 10 infertility patients provided semen samples every 4 weeks (total 58). The mean percentage of sperm DNA fragmentation for donors was 13.18%, the within-donor standard deviation (SD(W) = 3.79%) was small compared to between-donor (SD(B) = 17.56%). For the group of patients, the mean percentage of sperm DNA fragmentation was 22.44%, with SD(W) of 4.43% within patients and SD(B) of 29.48% between patients. No seasonal rhythm was observed during the study. The intra-class correlation coefficient for all subjects combined was 0.83. Compared to sperm concentration, individual coefficients of variation for sperm DNA fragmentation indicated less variability in four subjects, but were similar in the others. This longitudinal study shows that sperm DNA fragmentation is a parameter with good stability (repeatability) over time; it can be taken as a baseline both in healthy fertile men and in patients from infertility couples.

  7. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    PubMed

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  8. Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

    PubMed

    Schnitzler, P; Darai, G

    1989-09-01

    The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

  9. Measuring Sperm DNA Fragmentation and Clinical Outcomes of Medically Assisted Reproduction: A Systematic Review and Meta-Analysis.

    PubMed

    Cissen, Maartje; Wely, Madelon van; Scholten, Irma; Mansell, Steven; Bruin, Jan Peter de; Mol, Ben Willem; Braat, Didi; Repping, Sjoerd; Hamer, Geert

    2016-01-01

    Sperm DNA fragmentation has been associated with reduced fertilization rates, embryo quality, pregnancy rates and increased miscarriage rates. Various methods exist to test sperm DNA fragmentation such as the sperm chromatin structure assay (SCSA), the sperm chromatin dispersion (SCD) test, the terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick end labelling (TUNEL) assay and the single cell gel electrophoresis (Comet) assay. We performed a systematic review and meta-analysis to assess the value of measuring sperm DNA fragmentation in predicting chance of ongoing pregnancy with IVF or ICSI. Out of 658 unique studies, 30 had extractable data and were thus included in the meta-analysis. Overall, the sperm DNA fragmentation tests had a reasonable to good sensitivity. A wide variety of other factors may also affect the IVF/ICSI outcome, reflected by limited to very low specificity. The constructed hierarchical summary receiver operating characteristic (HSROC) curve indicated a fair discriminatory capacity of the TUNEL assay (area under the curve (AUC) of 0.71; 95% CI 0.66 to 0.74) and Comet assay (AUC of 0.73; 95% CI 0.19 to 0.97). The SCSA and the SCD test had poor predictive capacity. Importantly, for the TUNEL assay, SCD test and Comet assay, meta-regression showed no differences in predictive value between IVF and ICSI. For the SCSA meta-regression indicated the predictive values for IVF and ICSI were different. The present review suggests that current sperm DNA fragmentation tests have limited capacity to predict the chance of pregnancy in the context of MAR. Furthermore, sperm DNA fragmentation tests have little or no difference in predictive value between IVF and ICSI. At this moment, there is insufficient evidence to recommend the routine use of sperm DNA fragmentation tests in couples undergoing MAR both for the prediction of pregnancy and for the choice of treatment. Given the significant limitations of the evidence and the methodological weakness and design of the included studies, we do urge for further research on the predictive value of sperm DNA fragmentation for the chance of pregnancy after MAR, also in comparison with other predictors of pregnancy after MAR.

  10. Effects of physical activity on systemic oxidative/DNA status in breast cancer survivors.

    PubMed

    Tomasello, Barbara; Malfa, Giuseppe Antonio; Strazzanti, Angela; Gangi, Santi; Di Giacomo, Claudia; Basile, Francesco; Renis, Marcella

    2017-01-01

    Physical activity offers a paradoxical hormetic effect and a health benefit to cancer survivors; however, the biochemical mechanisms have not been entirely elucidated. Despite the well-documented evidence implicating oxidative stress in breast cancer, the association between health benefits and redox status has not been investigated in survivors who participate in dragon boating. The present study investigated the plasmatic systemic oxidative status (SOS) in breast cancer survivors involved in two distinct physical training exercises. A total of 75 breast cancer survivors were allocated to one of three groups: Control (resting), dragon boat racing and walking group; the latter is a type of aerobic conditioning exercise often advised to cancer patients. Various biochemical oxidative stress markers were examined, including oxidant status (hydroperoxide levels, lipid oxidation) and antioxidant status (enzymatic activities of superoxide dismutase and glutathione peroxidase, reduced glutathione levels and antioxidant capability). In addition, the individual DNA fragmentation and DNA repair capability of nucleotide excision repair (NER) systems were examined by comet assays. According to the results, all patients exhibited high levels of oxidative stress. Physical activity maintained this oxidative stress condition but simultaneously had a positive influence on the antioxidant component of the SOS, particularly in the dragon boat racing group. DNA fragmentation, according to the levels of single- and double-strand breaks, were within the normal range in the two survivor groups that were involved in training activities. Radiation-induced damage was not completely recognised or repaired by NER systems in any of the patients, probably leading to radiosensitivity and/or susceptibility of patients to cancer. These findings suggest that physical activity, particularly dragon boat racing, that modulates SOS and DNA repair capability could represent a strategy for enhancing the quality of life and improving the long-term health benefits for breast cancer survivors.

  11. Effects of physical activity on systemic oxidative/DNA status in breast cancer survivors

    PubMed Central

    Tomasello, Barbara; Malfa, Giuseppe Antonio; Strazzanti, Angela; Gangi, Santi; Di Giacomo, Claudia; Basile, Francesco; Renis, Marcella

    2017-01-01

    Physical activity offers a paradoxical hormetic effect and a health benefit to cancer survivors; however, the biochemical mechanisms have not been entirely elucidated. Despite the well-documented evidence implicating oxidative stress in breast cancer, the association between health benefits and redox status has not been investigated in survivors who participate in dragon boating. The present study investigated the plasmatic systemic oxidative status (SOS) in breast cancer survivors involved in two distinct physical training exercises. A total of 75 breast cancer survivors were allocated to one of three groups: Control (resting), dragon boat racing and walking group; the latter is a type of aerobic conditioning exercise often advised to cancer patients. Various biochemical oxidative stress markers were examined, including oxidant status (hydroperoxide levels, lipid oxidation) and antioxidant status (enzymatic activities of superoxide dismutase and glutathione peroxidase, reduced glutathione levels and antioxidant capability). In addition, the individual DNA fragmentation and DNA repair capability of nucleotide excision repair (NER) systems were examined by comet assays. According to the results, all patients exhibited high levels of oxidative stress. Physical activity maintained this oxidative stress condition but simultaneously had a positive influence on the antioxidant component of the SOS, particularly in the dragon boat racing group. DNA fragmentation, according to the levels of single- and double-strand breaks, were within the normal range in the two survivor groups that were involved in training activities. Radiation-induced damage was not completely recognised or repaired by NER systems in any of the patients, probably leading to radiosensitivity and/or susceptibility of patients to cancer. These findings suggest that physical activity, particularly dragon boat racing, that modulates SOS and DNA repair capability could represent a strategy for enhancing the quality of life and improving the long-term health benefits for breast cancer survivors. PMID:28123580

  12. Chromosome demise in the wake of ligase-deficient replication.

    PubMed

    Kouzminova, Elena A; Kuzminov, Andrei

    2012-06-01

    Bacterial DNA ligases, NAD⁺-dependent enzymes, are distinct from eukaryotic ATP-dependent ligases, representing promising targets for broad-spectrum antimicrobials. Yet, the chromosomal consequences of ligase-deficient DNA replication, during which Okazaki fragments accumulate, are still unclear. Using ligA251(Ts), the strongest ligase mutant of Escherichia coli, we studied ligase-deficient DNA replication by genetic and physical approaches. Here we show that replication without ligase kills after a short resistance period. We found that double-strand break repair via RecA, RecBCD, RuvABC and RecG explains the transient resistance, whereas irreparable chromosomal fragmentation explains subsequent cell death. Remarkably, death is mostly prevented by elimination of linear DNA degradation activity of ExoV, suggesting that non-allelic double-strand breaks behind replication forks precipitate DNA degradation that enlarge them into allelic double-strand gaps. Marker frequency profiling of synchronized replication reveals stalling of ligase-deficient forks with subsequent degradation of the DNA synthesized without ligase. The mechanism that converts unsealed nicks behind replication forks first into repairable double-strand breaks and then into irreparable double-strand gaps may be behind lethality of any DNA damaging treatment. © 2012 Blackwell Publishing Ltd.

  13. Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, W.M.; Sylvester, J.E.

    1994-09-01

    In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less

  14. Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

    PubMed

    Lam, Kathy N; Charles, Trevor C

    2015-01-01

    Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

  15. Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

    PubMed

    Hu, B; Li, J; Yu, W; Fang, J

    1993-01-01

    Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

  16. Sperm DNA fragmentation in the total and vital fractions before and after density gradient centrifugation: Significance in male fertility diagnosis.

    PubMed

    Punjabi, U; Van Mulders, H; Goovaerts, I; Peeters, K; Clasen, K; Janssens, P; Zemtsova, O; De Neubourg, D

    2018-05-21

    Sperm DNA fragmentation measured by different techniques make comparisons impossible due to lack of standardization. Induction of DNA damage after sperm preparation in the entire fraction has been observed on independent occasions but findings are not consistent. Men presenting at a University hospital setup for infertility treatment. DNA damage via TUNEL assay was validated on fresh semen samples, as conventional semen parameters, to reduce variability of results. Sperm motility in neat semen inversely correlated with sperm DNA fragmentation in the total fraction, but, total count, leukocytes and immature germ cells significantly affected the vital fraction. Sperm DNA fragmentation was observed both in normal and subnormal semen samples, but was significantly different in the total fraction of astheno-, asthenoterato- and oligoteratozoospermic men. After density gradient centrifugation, sperm DNA fragmentation increased significantly in the total but decreased in the vital fraction. Advancing male age significantly influenced damage in the total but not in the vital population. These findings provide opportunities to investigate the significance of the total and the vital fractions both in natural conception and after different assisted reproductive technologies. Copyright © 2018 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  17. DNA damage in spermatozoa from infertile men with varicocele evaluated by sperm chromatin dispersion and DBD-FISH.

    PubMed

    Cortés-Gutiérrez, Elva I; Dávila-Rodríguez, Martha I; Fernández, José Luis; López-Fernández, Carmen; Aragón-Tovar, Anel R; Urbina-Bernal, Luis C; Gosálvez, Jaime

    2016-01-01

    Evaluation of DNA integrity is an important test, possessing greater diagnostic and prognostic significance for couples requiring assisted reproduction. In this study, we evaluate the levels of DNA damage in infertile patients with varicocele with respect to fertile males by the sperm chromatin dispersion (SCD) test. The presence of DNA breaks in spermatozoa was confirmed by DNA breakage detection-fluorescence in situ hybridization (DBD-FISH). In this study, the frequency of sperm cells with fragmented DNA was studied in a group of 20 infertile patients with varicocele and compared with 20 fertile males. The spermatozoa were processed to classify different levels of DNA fragmentation using the Halosperm(®) kit, an improved SCD test, and DBD-FISH. Patients with varicocele showed 25.54 ± 28.17 % of spermatozoa with fragmented DNA, significantly higher than those of the group of fertile subjects (11.54 ± 3.88 %). The proportion of degraded cells in total sperm cells with fragmented DNA was sixfold higher in the case of patients with varicocele. The presence of DNA breaks in spermatozoa was confirmed by DBD-FISH. 5-bp Classical satellite-2 regions showed greater sensitivity to damage or "breakage" than alphoid satellite regions. Our finding preliminary demonstrated an increase of DNA fragmentation associated to severe sperm damage, in infertile patients with varicocele with respect to fertile males. 5-bp Classical satellite-2 regions showed greater sensitivity to damage or "breakage" than alphoid satellite regions.

  18. An innovative platform for quick and flexible joining of assorted DNA fragments

    DOE PAGES

    De Paoli, Henrique Cestari; Tuskan, Gerald A.; Yang, Xiaohan

    2016-01-13

    Successful synthetic biology efforts rely on conceptual and experimental designs in combination with testing of multi-gene constructs. Despite recent progresses, several limitations still hinder the ability to flexibly assemble and collectively share different types of DNA segments. We describe an advanced system for joining DNA fragments from a universal library that automatically maintains open reading frames (ORFs) and does not require linkers, adaptors, sequence homology, amplification or mutation (domestication) of fragments in order to work properly. Moreover, we find that this system, which is enhanced by a unique buffer formulation, provides unforeseen capabilities for testing, and sharing, complex multi-gene circuitrymore » assembled from different DNA fragments.« less

  19. Pushing the limits for amplifying BrdU-labeled DNA encoding 16S rRNA: DNA polymerase as the determining factor.

    PubMed

    Roux-Michollet, Dad D; Schimel, Joshua P; Holden, Patricia A

    2010-12-01

    Identifying microorganisms that are active under specific conditions in ecosystems is a challenge in microbial ecology. Recently, the bromodeoxyuridine (BrdU) technique was developed to label actively growing cells. BrdU, a thymidine analog, is incorporated into newly synthesized DNA, and the BrdU-labeled DNA is then isolated from total extractable DNA by immunocapture using a BrdU-specific antibody. Analyzing the BrdU-labeled DNA allows for assessing the actively growing community, which can then be compared to the unlabeled DNA that represents the total community. However, applying the BrdU approach to study soils has been problematic due to low DNA amounts and soil contaminants. To address these challenges, we developed a protocol, optimizing specificity and reproducibility, to amplify BrdU-labeled gene fragments encoding 16S rRNA. We found that the determining factor was the DNA polymerase: among the 13 different polymerases we tested, only 3 provided adequate yields with minimal contamination, and only two of those three produced similar amplification patterns of community DNA. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. DNA fragmentation of normal spermatozoa negatively impacts embryo quality and intracytoplasmic sperm injection outcome.

    PubMed

    Avendaño, Conrado; Franchi, Anahí; Duran, Hakan; Oehninger, Sergio

    2010-07-01

    To evaluate DNA fragmentation in morphologically normal sperm recovered from the same sample used for intracytoplasmic sperm injection (ICSI) and to correlate DNA damage with embryo quality and pregnancy outcome. Prospective study. Academic center. 36 infertile men participating in the ICSI program. Terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate-fluorescein nick end labeling (TUNEL) assay and morphologic assessment by phase contrast. Simultaneous assessment of sperm morphology and DNA fragmentation by TUNEL assay was performed in the same cell, then the percentage of normal sperm with fragmented DNA (normal SFD) was correlated with embryo quality and pregnancy outcomes. A highly statistically significant negative correlation was found between the percentage of normal SFD and embryo quality. This association was confirmed for the transferred embryos and for the total embryo cohort. The receiver operating characteristics curve analysis demonstrated that the percentage of normal SFD and embryo quality were statistically significant predictors of pregnancy. When the percentage of normal SFD was

  1. Aqueous trifluorethanol solutions simulate the environment of DNA in the crystalline state.

    PubMed

    Kypr, J; Chládková, J; Zimulová, M; Vorlícková, M

    1999-09-01

    We took 28 fragments of DNA whose crystal structures were known and used CD spectroscopy to search for conditions stabilising the crystal structures in solution. All 28 fragments switched into their crystal structures in 60-80% aqueous trifluorethanol (TFE) to indicate that the crystals affected the conformation of DNA like the concentrated TFE. The fragments crystallising in the B-form also underwent cooperative TFE-induced changes that took place within the wide family of B-form structures, suggesting that the aqueous and crystal B-forms differed as well. Spermine and magnesium or calcium cations, which were contained in the crystallisation buffers, promoted or suppressed the TFE-induced changes of several fragments to indicate that the crystallisation agents can decide which of the possible structures is adopted by the DNA fragment in the crystal.

  2. [Cloning of human CD45 gene and its expression in Hela cells].

    PubMed

    Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

    2015-11-01

    To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

  3. Resveratrol-induced apoptosis is enhanced in low pH environments associated with cancer.

    PubMed

    Shamim, Uzma; Hanif, Sarmad; Albanyan, Abdulmajeed; Beck, Frances W J; Bao, Bin; Wang, Zhiwei; Banerjee, Sanjeev; Sarkar, Fazlul H; Mohammad, Ramzi M; Hadi, Sheikh M; Azmi, Asfar S

    2012-04-01

    Many critical factors such as hypoxia, nutrient deficiency, activation of glycolytic pathway/Warburg effect contribute to the observed low pH in tumors compared to normal tissue. Studies suggest that such tumor specific acidic environment can be exploited for the development of therapeutic strategies against cancer. Independent observations show reduction in pH of mammalian cells undergoing internucleosomal DNA fragmentation and apoptosis. As such, our group has extensively demonstrated that anticancer mechanisms of different plant polyphenols involve mobilization of endogenous copper and consequent internucleosomal DNA breakage. Copper is redox active metal, an essential component of chromatin and is sensitive to subtle pH changes in its microenvironment. Here we explored whether, acidic pH promotes growth inhibition, apoptosis, and DNA damaging capacity of chemopreventive agent resveratrol. Our results reveal that growth inhibition and internucleosomal DNA fragmentation induced apoptosis in Capan-2 and Panc-28 pancreatic cancer cell lines (and not in normal HPDE cells) by resveratrol is enhanced at lower pH. Using comet assay, we further demonstrate that DNA breakage by resveratrol is enhanced with acidification. Membrane permeable copper specific chelator neocuproine (and not iron chelator orthophenanthroline) abrogated growth inhibition and apoptosis by resveratrol. Western blot results show enhanced activation of DNA laddering marker H2.aX by resveratrol at acidic pH that was reversed by neocuproine and not by orthophenanthroline. Our findings provide irrevocable proof that low pH environment can be turned into tumor weakness and assist in eradication of cancer cells by resveratrol. Copyright © 2011 Wiley Periodicals, Inc.

  4. FragIdent--automatic identification and characterisation of cDNA-fragments.

    PubMed

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  5. Phenoxyacetic acid degradation by the 2,4-dichlorophenoxyacetic acid (TFD) pathway of plasmid pJP4: mapping and characterization of the TFD regulatory gene, tfdR.

    PubMed Central

    Harker, A R; Olsen, R H; Seidler, R J

    1989-01-01

    Plasmid pJP4 enables Alcaligenes eutrophus JMP134 to degrade 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid (TFD). Plasmid pRO101 is a derivative of pJP4 obtained by insertion of Tn1721 into a nonessential region of pJP4. Plasmid pRO101 was transferred by conjugation to several Pseudomonas strains and to A. eutrophus AEO106, a cured isolate of JMP134. AEO106(pRO101) and some Pseudomonas transconjugants grew on TFD. Transconjugants with a chromosomally encoded phenol hydroxylase also degraded phenoxyacetic acid (PAA) in the presence of an inducer of the TFD pathway, namely, TFD or 3-chlorobenzoate. A mutant of one such phenol-degrading strain, Pseudomonas putida PPO300(pRO101), grew on PAA as the sole carbon source in the absence of inducer. This isolate carried a mutant plasmid, designated pRO103, derived from pRO101 through the deletion of a 3.9-kilobase DNA fragment. Plasmid pRO103 constitutively expressed the TFD pathway, and this allowed the metabolism of PAA in the absence of the inducer, TFD. Complementation of pRO103 in trans by a DNA fragment corresponding to the fragment deleted in pRO101 indicates that a negative control-regulatory gene (tfdR) is located on the BamHI E fragment of pRO101. Other subcloning experiments resulted in the cloning of the tfdA monooxygenase gene on a 3.5-kilobase fragment derived from pRO101. This subclone, in the absence of other pRO101 DNA, constitutively expressed the tfdA gene and allowed PPO300 to grow on PAA. Preliminary evidence suggests that the monooxygenase activity encoded by this DNA fragment is feedback-inhibited by phenols. Images PMID:2914848

  6. Agarose gel electrophoresis for the separation of DNA fragments.

    PubMed

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate concentration for their needs Prepare an agarose gel for electrophoresis of DNA samples Set up the gel electrophoresis apparatus and power supply Select an appropriate voltage for the separation of DNA fragments Understand the mechanism by which ethidium bromide allows for the visualization of DNA bands Determine the sizes of separated DNA fragments.

  7. Raman-based system for DNA sequencing-mapping and other separations

    DOEpatents

    Vo-Dinh, Tuan

    1994-01-01

    DNA sequencing and mapping are performed by using a Raman spectrometer with a surface enhanced Raman scattering (SERS) substrate to enhance the Raman signal. A SERS label is attached to a DNA fragment and then analyzed with the Raman spectrometer to identify the DNA fragment according to characteristics of the Raman spectrum generated.

  8. Identification of a transcription factor like protein at the TOR locus in Leishmania mexicana amazonensis.

    PubMed

    Detke, S

    1997-12-15

    The TOR gene (TOxic nucleoside Resistance gene) was mapped to a 2.3 kb fragment on the amplified DNA from tubercidin resistant Leishmania (TUB). This DNA fragment conferred upon wild type cells resistance to tubercidin, inosine dialdehyde, formycin A and B and allopurinol riboside and a reduced ability to accumulate purine nucleobases and nucleosides. These properties were characteristic of the parental TUB cells which carried the intact amplified DNA and have been hypothesized to be caused by a reduction in the activity of the multiple purine transporters within this organism. The TOR gene was found to be partially homologous to the rodent and human Oct-6/SCIP/Tst-1 gene. It lacked, however, the POU specific domain of this class of transcription factors and contained only the first two helices of the POU homeodomain. This truncated homeodomain was not required to confer resistance upon wild type cells to toxic nucleosides, suggesting that TOR was not a repressor with independent DNA binding capability.

  9. Improved methods of DNA extraction from human spermatozoa that mitigate experimentally-induced oxidative DNA damage.

    PubMed

    Xavier, Miguel J; Nixon, Brett; Roman, Shaun D; Aitken, Robert John

    2018-01-01

    Current approaches for DNA extraction and fragmentation from mammalian spermatozoa provide several challenges for the investigation of the oxidative stress burden carried in the genome of male gametes. Indeed, the potential introduction of oxidative DNA damage induced by reactive oxygen species, reducing agents (dithiothreitol or beta-mercaptoethanol), and DNA shearing techniques used in the preparation of samples for chromatin immunoprecipitation and next-generation sequencing serve to cofound the reliability and accuracy of the results obtained. Here we report optimised methodology that minimises, or completely eliminates, exposure to DNA damaging compounds during extraction and fragmentation procedures. Specifically, we show that Micrococcal nuclease (MNase) digestion prior to cellular lysis generates a greater DNA yield with minimal collateral oxidation while randomly fragmenting the entire paternal genome. This modified methodology represents a significant improvement over traditional fragmentation achieved via sonication in the preparation of genomic DNA from human spermatozoa for downstream applications, such as next-generation sequencing. We also present a redesigned bioinformatic pipeline framework adjusted to correctly analyse this form of data and detect statistically relevant targets of oxidation.

  10. Stronger enhancer II/core promoter activities of hepatitis B virus isolates of B2 subgenotype than those of C2 subgenotype

    PubMed Central

    Qin, Yanli; Zhou, Xueshi; Jia, Haodi; Chen, Chaoyang; Zhao, Weifeng; Zhang, Jiming; Tong, Shuping

    2016-01-01

    Hepatitis B virus (HBV) genotype C causes prolonged chronic infection and increased risk for liver cancer than genotype B. Our previous work revealed lower replication capacity of wild-type genotype C2 than B2 isolates. HBV DNA replication is driven by pregenomic RNA, which is controlled by core promoter (CP) and further augmented by enhancer I (ENI) and enhancer II (ENII). DNA fragments covering these regulatory elements were amplified from B2 and C2 isolates to generate luciferase reporter constructs. As ENII is fully embedded in CP, we inserted HBV DNA fragments in the sense orientation to determine their combined activities, and in the antisense orientation to measure enhancer activities alone. Genotype B2 isolates displayed higher ENI+ENII+CP, ENII+CP, and ENII activities, but not ENI or ENI+ENII activity, than C2 isolates. The higher ENII+CP activity was partly attributable to 4 positions displaying genotype-specific variability. Exchanging CP region was sufficient to revert the replication phenotypes of several B2 and C2 clones tested. These results suggest that a weaker ENII and/or CP at least partly accounts for the lower replication capacities of wild-type C2 isolates, which could drive the subsequent acquisition of CP mutations. Such mutations increase genome replication and are implicated in liver cancer development. PMID:27461034

  11. Stronger enhancer II/core promoter activities of hepatitis B virus isolates of B2 subgenotype than those of C2 subgenotype.

    PubMed

    Qin, Yanli; Zhou, Xueshi; Jia, Haodi; Chen, Chaoyang; Zhao, Weifeng; Zhang, Jiming; Tong, Shuping

    2016-07-27

    Hepatitis B virus (HBV) genotype C causes prolonged chronic infection and increased risk for liver cancer than genotype B. Our previous work revealed lower replication capacity of wild-type genotype C2 than B2 isolates. HBV DNA replication is driven by pregenomic RNA, which is controlled by core promoter (CP) and further augmented by enhancer I (ENI) and enhancer II (ENII). DNA fragments covering these regulatory elements were amplified from B2 and C2 isolates to generate luciferase reporter constructs. As ENII is fully embedded in CP, we inserted HBV DNA fragments in the sense orientation to determine their combined activities, and in the antisense orientation to measure enhancer activities alone. Genotype B2 isolates displayed higher ENI+ENII+CP, ENII+CP, and ENII activities, but not ENI or ENI+ENII activity, than C2 isolates. The higher ENII+CP activity was partly attributable to 4 positions displaying genotype-specific variability. Exchanging CP region was sufficient to revert the replication phenotypes of several B2 and C2 clones tested. These results suggest that a weaker ENII and/or CP at least partly accounts for the lower replication capacities of wild-type C2 isolates, which could drive the subsequent acquisition of CP mutations. Such mutations increase genome replication and are implicated in liver cancer development.

  12. Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis.

    PubMed Central

    Winnacker, E L

    1975-01-01

    Isolated nuclei from adenovirus type 2-infected HeLa cells catalyze the incorporation of all four deoxyribonucleoside triphosphates into viral DNA. The observed DNA synthesis occurs via a transient formation of DNA fragments with a sedimentation coefficient of 10S. The fragments are precursors to unit-length viral DNA, they are self-complementary to an extent of at least 70%, and they are distributed along most of the viral chromosome. In addition, accumulation of 10S DNA fragments is observed either in intact, virus-infected HeLa cells under conditions where viral DNA synthesis is inhibited by hydroxyurea or in isolated nuclei from virus-infected HeLa cells at low concentrations of deoxyribonucleotides. Under these suboptimal conditions for DNA synthesis in isolated nuclei, ribonucleoside triphosphates determine the size distribution of DNA intermediates. The evidence presented suggests that a ribonucleoside-dependent initiation step as well at two DNA polymerase catalyzed reactions are involved in the discontinuous replication of adenovirus type 2 DNA. PMID:1117487

  13. Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.

    1989-01-01

    Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less

  14. Simvastatin induces caspase-independent apoptosis in LPS-activated RAW264.7 macrophage cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Yong Chan; Song, Seok Bean; Lee, Mi Hee

    Macrophages participate in several inflammatory pathologies such as sepsis and arthritis. We examined the effect of simvastatin on the LPS-induced proinflammatory macrophage RAW264.7 cells. Co-treatment of LPS and a non-toxic dose of simvastatin induced cell death in RAW264.7 cells. The cell death was accompanied by disruption of mitochondrial membrane potential (MMP), genomic DNA fragmentation, and caspase-3 activation. Surprisingly, despite caspase-dependent apoptotic cascade being completely blocked by Z-VAD-fmk, a pan-caspase inhibitor, the cell death was only partially repressed. In the presence of Z-VAD-fmk, DNA fragmentation was blocked, but DNA condensation, disruption of MMP, and nuclear translocation of apoptosis inducing factor weremore » obvious. The cell death by simvastatin and LPS was effectively decreased by both the FPP and GGPP treatments as well as mevalonate. Our findings indicate that simvastatin triggers the cell death of LPS-treated RAW264.7 cells through both caspase-dependent and -independent apoptotic pathways, suggesting a novel mechanism of statins for the severe inflammatory disease therapy.« less

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  16. The interaction of the Eco R1 restriction enzyme E.coli with nucleotides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hollis, Donald F.

    1979-11-01

    The Eco R1 restriction enzyme can be shown to be inhibited by nucleotides which correspond to any part of its known site of phosphodiesterase activity. A series of di-, tetra-, and hexa-nucleotide fragments were synthesized and their effect on the activity of the enzyme upon superhelical Co1 E1 DNA studied. The inhibition caused by the individual mononucleotides were also studied. In general all the nucleotide fragments showed some form of interaction with the enzyme system. Tetranucleotides were stronger inhibitors than dinucleotides, which in turn were stronger inhibitors than the mononucleotides. Within each category of inhibitors, those containing the phosphodiester bondmore » which is acted upon by the enzyme were the strongest inhibitors. Only those fragments which were consistent with the enzymes site of activity showed competitive inhibition kinetics. Nucleotides which do not fit within the site of phosphodiesterase activity show non-competitive inhibition kinetics.« less

  17. Resistance of Spiroplasma citri Lines to the Virus SVTS2 Is Associated with Integration of Viral DNA Sequences into Host Chromosomal and Extrachromosomal DNA.

    PubMed

    Sha, Y; Melcher, U; Davis, R E; Fletcher, J

    1995-11-01

    Spiroplasmavirus SVTS2, isolated from Spiroplasma melliferum TS2, produces plaques when inoculated onto lawns of Spiroplasma citri M200H, a derivative of the type strain Maroc R8A2. S. citri strains MR2 and MR3, originally selected as colonies growing within plaques on a lawn of M200H inoculated with SVTS2, were resistant to SVTS2. Genomic DNA fingerprints and electrophoretic protein profiles of M200H, MR2, and MR3 were similar, but three proteins present in M200H were missing or significantly reduced in both resistant lines. None of these three polypeptides reacted with antiserum against S. citri membrane proteins, indicating that they probably are not surface-located virus receptors. Electroporation with SVTS2 DNA produced 1.5 x 10(sup5) transfectants per (mu)g of DNA in M200H but none in MR2 or MR3, suggesting that resistance may result from inhibition of viral replication. The digestion patterns of the extrachromosomal double-stranded (ds) DNA of these lines were similar. Three TaqI fragments of MR2 extrachromosomal DNA that were not present in M200H extrachromosomal DNA hybridized strongly to an SVTS2 probe, and two of these fragments plus an additional one hybridized with the MR3 extrachromosomal DNA, indicating that a fragment of SVTS2 DNA was present in the extrachromosomal ds DNA of MR2 and MR3 but not of M200H. When the restricted genomes of all three lines were probed with SVTS2 DNA, strong hybridization to two EcoRI fragments of chromosomal MR2 and MR3 DNA but not M200H DNA indicated that SVTS2 DNA had integrated into the genomes of MR2 and MR3 but not of M200H. When MR3 extrachromosomal ds DNA containing a 2.1-kb SVTS2 DNA fragment was transfected into M200H, the transformed spiroplasmas were resistant to SVTS2. These results suggest that SVTS2 DNA fragments, possibly integrated into the chromosomal or extrachromosomal DNA of a previously susceptible spiroplasma, may function as viral incompatibility elements, providing resistance to superinfection by SVTS2.

  18. Nuclease-mediated double-strand break (DSB) enhancement of small fragment homologous recombination (SFHR) gene modification in human-induced pluripotent stem cells (hiPSCs).

    PubMed

    Sargent, R Geoffrey; Suzuki, Shingo; Gruenert, Dieter C

    2014-01-01

    Recent developments in methods to specifically modify genomic DNA using sequence-specific endonucleases and donor DNA have opened the door to a new therapeutic paradigm for cell and gene therapy of inherited diseases. Sequence-specific endonucleases, in particular transcription activator-like (TAL) effector nucleases (TALENs), have been coupled with polynucleotide small/short DNA fragments (SDFs) to correct the most common mutation in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene, a 3-base-pair deletion at codon 508 (delF508), in induced pluripotent stem (iPS) cells. The studies presented here describe the generation of candidate TALENs and their co-transfection with wild-type (wt) CFTR-SDFs into CF-iPS cells homozygous for the delF508 mutation. Using an allele-specific PCR (AS-PCR)-based cyclic enrichment protocol, clonal populations of corrected CF-iPS cells were isolated and expanded.

  19. A novel gene: sawD related to the differentiation of streptomyces ansochromogenes.

    PubMed

    Gang, L; Wei, C; Yuqing, T; Huarong, T; Chater, K F; Buttner, M J

    1999-01-01

    A 1.3 kb DNA fragment was cloned from a total DNA library of Streptomyces ansochromogenes using Southern hybridization. Nucleotide sequencing analysis indicated that the 1320 bp DNA fragment contained a complete open reading frame (ORF). In search of databases, the deduced product of ORF containing 213 amino acids is homologous to the serine protease of Caulobacter cresceatus, and a conserved serine-catalytic active site (GPSAG) exists. The gene was designated as sawD. The function of this gene was studied with the strategy of gene disruption, and the result showed that the sawD may be related to sporulation and especially to the spore septation in Streptomyces ansochromogenes. The preliminary result indicated that sawD mutant could produce abundant pigment in contrast with the wild type, it seems that sawD gene may be involved in pigment biosynthesis, and this gene is also dispensable for biosynthesis of nikkomycin in Streptomyces ansochromogenes.

  20. An efficient approach for cloning the dNDP-glucose synthase gene from actinomycetes and its application in Streptomyces spectabilis, a spectinomycin producer.

    PubMed

    Hyun, C; Kim, S S; Sohng, J K; Hahn, J; Kim, J; Suh, J

    2000-02-01

    Specifically designed PCR primers were applied to amplify a segment of dTDP-glucose synthase gene from six actinomycete strains. About 300-bp or 580-bp DNA fragments were obtained from all the organisms tested. By DNA sequence analysis, seven amplified fragments showed high homology with dTDP-glucose synthase genes that participate in the biosynthesis of secondary metabolites or in deoxy-sugar moieties in lipopolysaccharides. In addition, we have cloned a 45-kb region of DNA from Streptomyces spectabilis ATCC27741, a spectinomycin producer which contained the dTDP-glucose synthase and dTDP-glucose 4,6-dehydratase genes named spcD and spcE, respectively. The spcE gene was expressed in Escherichia coli and the activity was assayed in cell extracts. The enzyme showed substrate specificity only to dTDP-glucose.

  1. Leaf extracts from Moricandia arvensis promote antiproliferation of human cancer cells, induce apoptosis, and enhance antioxidant activity.

    PubMed

    Skandrani, Ines; Boubaker, Jihed; Bhouri, Wissem; Limem, Ilef; Kilani, Soumaya; Ben Sghaier, Mohamed; Neffati, Aicha; Bouhlel, Ines; Ghedira, Kamel; Chekir-Ghedira, Leila

    2010-01-01

    The in vitro antiproliferative, apoptotic, and antioxidant activities from leaf extracts of Moricandia arvensis, which are used in traditional cooking and medicines, were investigated. The MTT assay revealed that only TOF (total oligomer flavonoids), ethyl acetate (EA), chloroform (Chl), and petroleum ether (PE) extracts inhibited the proliferation of K562 cells. Apoptosis plays a very important role in the treatment of cancer by promoting the apoptosis of cancer cells and limiting the concurrent death of normal cells. Thus, the possible effects of M. arvensis extracts on the induction of apoptosis in human leukemic cells (K562 cells) were investigated. The electrophoretic analysis of DNA fragmentation confirms that TOF, Chl, PE, and EA extracts provoke DNA fragmentation. Using the lipid peroxidation inhibitory assay, the antioxidant capacity of M. arvensis extracts was evaluated by the ability of each extract to inhibit malondialdehyde formation. It was revealed that EA and TOF extracts are the most active in scavenging the hydroxyl radicals.

  2. Raman-based system for DNA sequencing-mapping and other separations

    DOEpatents

    Vo-Dinh, T.

    1994-04-26

    DNA sequencing and mapping are performed by using a Raman spectrometer with a surface enhanced Raman scattering (SERS) substrate to enhance the Raman signal. A SERS label is attached to a DNA fragment and then analyzed with the Raman spectrometer to identify the DNA fragment according to characteristics of the Raman spectrum generated. 11 figures.

  3. An anti-DNA antibody prefers damaged dsDNA over native.

    PubMed

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2017-01-01

    DNA-protein interactions, including DNA-antibody complexes, have both fundamental and practical significance. In particular, antibodies against double-stranded DNA play an important role in the pathogenesis of autoimmune diseases. Elucidation of structural mechanisms of an antigen recognition and interaction of anti-DNA antibodies provides a basis for understanding the role of DNA-containing immune complexes in human pathologies and for new treatments. Here we used Molecular Dynamic simulations of bimolecular complexes of a segment of dsDNA with a monoclonal anti-DNA antibody's Fab-fragment to obtain detailed structural and physical characteristics of the dynamic intermolecular interactions. Using a computationally modified crystal structure of a Fab-DNA complex (PDB: 3VW3), we studied in silico equilibrium Molecular Dynamics of the Fab-fragment associated with two homologous dsDNA fragments, containing or not containing dimerized thymine, a product of DNA photodamage. The Fab-fragment interactions with the thymine dimer-containing DNA was thermodynamically more stable than with the native DNA. The amino acid residues constituting a paratope and the complementary nucleotide epitopes for both Fab-DNA constructs were identified. Stacking and electrostatic interactions were shown to play the main role in the antibody-dsDNA contacts, while hydrogen bonds were less significant. The aggregate of data show that the chemically modified dsDNA (containing a covalent thymine dimer) has a higher affinity toward the antibody and forms a stronger immune complex. These findings provide a mechanistic insight into formation and properties of the pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus, associated with skin photosensibilization and DNA photodamage.

  4. Variation in ribosomal and mitochondrial DNA sequences demonstrates the existence of intraspecific groups in Paramecium multimicronucleatum (Ciliophora, Oligohymenophorea).

    PubMed

    Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa

    2012-05-01

    This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

    PubMed

    Bille, Todd W; Cromartie, Carter; Farr, Matthew

    2009-09-01

    This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

  6. Mini-midi-mito: adapting the amplification and sequencing strategy of mtDNA to the degradation state of crime scene samples.

    PubMed

    Berger, Cordula; Parson, Walther

    2009-06-01

    The degradation state of some biological traces recovered from the crime scene requires the amplification of very short fragments to attain a useful mitochondrial (mt)DNA sequence. We have previously introduced two mini-multiplex assays that amplify 10 overlapping control region (CR) fragments in two separate multiplex PCRs, which brought successful CR consensus sequences from even highly degraded DNA extracts. This procedure requires a total of 20 sequencing reactions per sample, which is laborious and cost intensive. For only moderately degraded samples that we encounter more frequently with typical mtDNA casework material, we developed two new multiplex assays that use a subset of the mini-amplicon primers but embrace larger fragments (midis) and require only 10 sequencing reactions to build a double-stranded CR consensus sequence. We used a preceding mtDNA quantitation step by real-time PCR with two different target fragments (143 and 283 bp) that roughly correspond to the average fragment sizes of the different multiplex approaches to estimate size-dependent mtDNA quantities and to aid the choice of the appropriate PCR multiplexes with respect to quality of the results and required costs.

  7. Process to Selectively Distinguish Viable from Non-Viable Bacterial Cells

    NASA Technical Reports Server (NTRS)

    LaDuc, Myron T.; Bernardini, Jame N.; Stam, Christina N.

    2010-01-01

    The combination of ethidium monoazide (EMA) and post-fragmentation, randomly primed DNA amplification technologies will enhance the analytical capability to discern viable from non-viable bacterial cells in spacecraft-related samples. Intercalating agents have been widely used since the inception of molecular biology to stain and visualize nucleic acids. Only recently, intercalating agents such as EMA have been exploited to selectively distinguish viable from dead bacterial cells. Intercalating dyes can only penetrate the membranes of dead cells. Once through the membrane and actually inside the cell, they intercalate DNA and, upon photolysis with visible light, produce stable DNA monoadducts. Once the DNA is crosslinked, it becomes insoluble and unable to be fragmented for post-fragmentation, randomly primed DNA library formation. Viable organisms DNA remains unaffected by the intercalating agents, allowing for amplification via post-fragmentation, randomly primed technologies. This results in the ability to carry out downstream nucleic acid-based analyses on viable microbes to the exclusion of all non-viable cells.

  8. High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.

    PubMed

    Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie

    2015-06-17

    High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This sequence structure can be harnessed to improve bioinformatics algorithms, in particular for CNV and structural variant detection. Descriptive measures for cell-free DNA features developed here could also be used in biomarker analysis to monitor the changes that occur during different pathological conditions.

  9. Multiplex analysis of DNA

    DOEpatents

    Church, George M.; Kieffer-Higgins, Stephen

    1992-01-01

    This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

  10. PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates.

    PubMed Central

    Barnes, W M

    1994-01-01

    A target length limitation to PCR amplification of DNA has been identified and addressed. Concomitantly, the base-pair fidelity, the ability to use PCR products as primers, and the maximum yield of target fragment were increased. These improvements were achieved by the combination of a high level of an exonuclease-free, N-terminal deletion mutant of Taq DNA polymerase, Klentaq1, with a very low level of a thermostable DNA polymerase exhibiting a 3'-exonuclease activity (Pfu, Vent, or Deep Vent). At least 35 kb can be amplified to high yields from 1 ng of lambda DNA template. Images PMID:8134376

  11. DNA-incorporated 125I induces more than one double-strand break per decay in mammalian cells.

    PubMed

    Elmroth, Kecke; Stenerlöw, Bo

    2005-04-01

    The Auger-electron emitter 125I releases cascades of 20 electrons per decay that deposit a great amount of local energy, and for DNA-incorporated 125I, approximately one DNA double-strand break (DSB) is produced close to the decay site. To investigate the potential of 125I to induce additional DSBs within adjacent chromatin structures in mammalian cells, we applied DNA fragment-size analysis based on pulsed-field gel electrophoresis (PFGE) of hamster V79-379A cells exposed to DNA-incorporated 125IdU. After accumulation of decays at -70 degrees C in the presence of 10% DMSO, there was a non-random distribution of DNA fragments with an excess of fragments <0.5 Mbp and the measured yield was 1.6 DSBs/decay. However, since these experiments were performed under high scavenging conditions (DMSO) that reduce indirect effects, the yield in cells exposed to 125IdU under physiological conditions would most likely be even higher. In contrast, using a conventional low-resolution assay without measurement of smaller DNA fragments, the yield was close to one DSB/decay. We conclude that a large fraction of the DSBs induced by DNA-incorporated 125I are nonrandomly distributed and that significantly more than one DSB/decay is induced in an intact cell. Thus, in addition to DSBs produced close to the decay site, DSBs may also be induced within neighboring chromatin fibers, releasing smaller DNA fragments that are not detected by conventional DSB assays.

  12. Pulsewidth-dependent nature of laser-induced DNA damage in RPE cells

    NASA Astrophysics Data System (ADS)

    Hall, Rebecca M.; Glickman, Randolph D.; Rockwell, Benjamin A.; Kumar, Neeru; Noojin, Gary D.

    2001-07-01

    Ultrashort pulse laser radiation may produce cellular damage through unique mechanisms. Primary cultures of bovine retinal pigment epithelial (RPE) cells were exposed to the out put of a Ti:Sapphire laser producing 30 fs (mode-locked) pulses, 44 amplified fs pulses, or continuous wave exposures at 800 nm. Laser exposures at and below the damage threshold were studied. DNA damage was detected using single cell gel electrophoresis (comet assay). Unexposed (control) cells produced short tails with low tail moments. In contrast, all laser-exposed cells showed some degree of DNA fragmentation, but the size and shape of the resulting comets differed among the various modalities. CW-exposed cells produced generally light and relatively compact tails, suggesting fewer and larger DNA fragments, while mode-locked laser exposures (30 fs pulses) resulted in large and diffuse comets, indicating the DNA was fragmented into many very small pieces. Work is continuing to define the relationship of laser pulsewidth and intensity with the degree of DNA fragmentation. These results suggest that DNA damage may result from multiple mechanisms of laser-cell interaction, including multiphoton absorption.

  13. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    PubMed

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  14. Extended HSR/CARD domain mediates AIRE binding to DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

  15. Ultrafast, efficient separations of large-sized dsDNA in a blended polymer matrix by microfluidic chip electrophoresis: A Design of Experiments approach

    PubMed Central

    Sun, Mingyun; Lin, Jennifer S.

    2012-01-01

    Double-stranded (ds) DNA fragments over a wide size range were successfully separated in blended polymer matrices by microfluidic chip electrophoresis. Novel blended polymer matrices composed of two types of polymers with three different molar masses were developed to provide improved separations of large dsDNA without negatively impacting the separation of small dsDNA. Hydroxyethyl celluloses (HECs) with average molar masses of ~27 kDa and ~1 MDa were blended with a second class of polymer, high-molar mass (~7 MDa) linear polyacrylamide (LPA). Fast and highly efficient separations of commercially available DNA ladders were achieved on a borosilicate glass microchip. A distinct separation of a 1 Kb DNA extension ladder (200 bp to 40,000 bp) was completed in 2 minutes. An orthogonal Design of Experiments (DOE) was used to optimize experimental parameters for DNA separations over a wide size range. We find that the two dominant factors are the applied electric field strength and the inclusion of a high concentration of low-molar mass polymer in the matrix solution. These two factors exerted different effects on the separations of small dsDNA fragments below 1 kbp, medium dsDNA fragments between 1 kbp and 10 kbp, and large dsDNA fragments above 10 kbp. PMID:22009451

  16. Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

    PubMed

    Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

    2006-12-01

    The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

  17. The influence of direct mobile phone radiation on sperm quality.

    PubMed

    Gorpinchenko, Igor; Nikitin, Oleg; Banyra, Oleg; Shulyak, Alexander

    2014-01-01

    It is impossible to imagine a modern socially-active man who does not use mobile devices and/or computers with Wi-Fi function. The effect of mobile phone radiation on male fertility is the subject of recent interest and investigations. The aim of this study was to investigate the direct in vitro influence of mobile phone radiation on sperm DNA fragmentation and motility parameters in healthy subjects with normozoospermia. 32 healthy men with normal semen parameters were selected for the study. Each sperm sample was divided into two equal portions (A and B). Portions A of all involved men were placed for 5 hours in a thermostat, and portions B were placed into a second thermostat for the same period of time, where a mobile phone in standby/talk mode was placed. After 5 hours of incubation the sperm samples from both thermostats were re-evaluated regarding basic motility parameters. The presence of DNA fragmentation in both A and B portions of each sample was determined each hour using a standard sperm chromatin dispersion test. The number of spermatozoa with progressive movement in the group, influenced by electromagnetic radiation, is statistically lower than the number of spermatozoa with progressive movement in the group under no effect of the mobile phone. The number of non-progressive movement spermatozoa was significantly higher in the group, which was influenced by cell phone radiation. The DNA fragmentation was also significantly higher in this group. A correlation exists between mobile phone radiation exposure, DNA-fragmentation level and decreased sperm motility.

  18. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    PubMed

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  19. Combined therapy with cyclophosphamide and DNA preparation inhibits the tumor growth in mice

    PubMed Central

    Alyamkina, Ekaterina A; Dolgova, Evgenia V; Likhacheva, Anastasia S; Rogachev, Vladimir A; Sebeleva, Tamara E; Nikolin, Valeriy P; Popova, Nelly A; Orishchenko, Konstantin E; Strunkin, Dmitriy N; Chernykh, Elena R; Zagrebelniy, Stanislav N; Bogachev, Sergei S; Shurdov, Mikhail A

    2009-01-01

    Background When cyclophosphamide and preparations of fragmented exogenous genomic double stranded DNA were administered in sequence, the regressive effect on the tumor was synergic: this combined treatment had a more pronounced effect than cyclophosphamide alone. Our further studies demonstrated that exogenous DNA stimulated the maturation and specific activities of dendritic cells. This suggests that cyclophosphamide, combined with DNA, leads to an immune response to the tumors that were grafted into the subjects post treatment. Methods Three-month old CBA/Lac mice were used in the experiments. The mice were injected with cyclosphamide (200 mkg per 1 kg body weight) and genomic DNA (of human, mouse or salmon sperm origin). The DNA was administered intraperitoneally or subcutaneously. After 23 to 60 days, one million tumor cells were intramuscularly grafted into the mice. In the final experiment, the mice were pre-immunized by subcutaneous injections of 20 million repeatedly thawed and frozen tumor cells. Changes in tumor growth were determined by multiplying the three perpendicular diameters (measured by caliper). Students' t-tests were used to determine the difference between tumor growth and average survival rate between the mouse groups and the controls. Results An analysis of varying treatments with cyclophosphamide and exogenous DNA, followed by tumor grafting, provided evidence that this combined treatment had an immunizing effect. This inhibitory effect in mice was analyzed in an experiment with the classical immunization of a tumor homogenate. The strongest inhibitory action on a transplanted graft was created through the following steps: cyclophosphamide at 200 mg/kg of body weight administered as a pretreatment; 6 mg fragmented exogenous DNA administered over the course of 3 days; tumor homogenate grafted 10 days following the final DNA injection. Conclusion Fragmented exogenous DNA injected with cyclophosphamide inhibits the growth of tumors that are grafted to mice after this combined treatment. PMID:19682353

  20. A ‘resource allocator’ for transcription based on a highly fragmented T7 RNA polymerase

    PubMed Central

    Segall-Shapiro, Thomas H; Meyer, Adam J; Ellington, Andrew D; Sontag, Eduardo D; Voigt, Christopher A

    2014-01-01

    Synthetic genetic systems share resources with the host, including machinery for transcription and translation. Phage RNA polymerases (RNAPs) decouple transcription from the host and generate high expression. However, they can exhibit toxicity and lack accessory proteins (σ factors and activators) that enable switching between different promoters and modulation of activity. Here, we show that T7 RNAP (883 amino acids) can be divided into four fragments that have to be co-expressed to function. The DNA-binding loop is encoded in a C-terminal 285-aa ‘σ fragment’, and fragments with different specificity can direct the remaining 601-aa ‘core fragment’ to different promoters. Using these parts, we have built a resource allocator that sets the core fragment concentration, which is then shared by multiple σ fragments. Adjusting the concentration of the core fragment sets the maximum transcriptional capacity available to a synthetic system. Further, positive and negative regulation is implemented using a 67-aa N-terminal ‘α fragment’ and a null (inactivated) σ fragment, respectively. The α fragment can be fused to recombinant proteins to make promoters responsive to their levels. These parts provide a toolbox to allocate transcriptional resources via different schemes, which we demonstrate by building a system which adjusts promoter activity to compensate for the difference in copy number of two plasmids. PMID:25080493

  1. Ultrastructural and DNA damaging effects of lead nitrate in the liver.

    PubMed

    Narayana, K; Al-Bader, Maie

    2011-01-01

    A ubiquitous environmental toxicant - lead is known to affect several organ systems. This study was designed to investigate the effects of lead nitrate exposure on liver structure and DNA fragmentation. Adult male Wistar rats were treated orally with lead nitrate at the dose levels of 0%, 0.5% and 1% for 60 days and sacrificed on the next day. The liver was processed for thick sections and evaluated after toludine blue staining and by electron microscopy after staining with uranyl acetate and lead citrate. The DNA damage was assessed by DNA fragmentation assay. The liver weight was not significantly affected in the experimental groups. Hepatocyte nuclei were not shrunk, instead lead was mitogenic to hepatocytes as indicated by an increase in the number of binucleated hepatocytes (P<0.05). The number of mitochondria per hepatocyte decreased in a dose-dependent manner (P<0.05). Qualitatively, the necrotic changes such as small to large-sized cytoplasmic vacuoles often displacing the organelles, decrease in hepatocyte microvilli, degeneration of mitochondria, and vacuolar encroachment of nuclei and dilatation of sinusoids were observed. The qualitative changes were induced in a dose-dependent manner. Kupffer cells or Ito cells did not present any notable structural changes. Although the electrophoretic flow of DNA fragments was observed in lead-treated groups, these changes were not significantly different from that in control as evaluated by optical density. In conclusion, lead induces necrotic changes with simultaneous mitogenic activity; however, it does not induce significant DNA damage in the liver. Copyright © 2009 Elsevier GmbH. All rights reserved.

  2. Autophagic degradation of dBruce controls DNA fragmentation in nurse cells during late Drosophila melanogaster oogenesis.

    PubMed

    Nezis, Ioannis P; Shravage, Bhupendra V; Sagona, Antonia P; Lamark, Trond; Bjørkøy, Geir; Johansen, Terje; Rusten, Tor Erik; Brech, Andreas; Baehrecke, Eric H; Stenmark, Harald

    2010-08-23

    Autophagy is an evolutionarily conserved pathway responsible for degradation of cytoplasmic material via the lysosome. Although autophagy has been reported to contribute to cell death, the underlying mechanisms remain largely unknown. In this study, we show that autophagy controls DNA fragmentation during late oogenesis in Drosophila melanogaster. Inhibition of autophagy by genetically removing the function of the autophagy genes atg1, atg13, and vps34 resulted in late stage egg chambers that contained persisting nurse cell nuclei without fragmented DNA and attenuation of caspase-3 cleavage. The Drosophila inhibitor of apoptosis (IAP) dBruce was found to colocalize with the autophagic marker GFP-Atg8a and accumulated in autophagy mutants. Nurse cells lacking Atg1 or Vps34 in addition to dBruce contained persisting nurse cell nuclei with fragmented DNA. This indicates that autophagic degradation of dBruce controls DNA fragmentation in nurse cells. Our results reveal autophagic degradation of an IAP as a novel mechanism of triggering cell death and thereby provide a mechanistic link between autophagy and cell death.

  3. Multisegment nanowire sensors for the detection of DNA molecules.

    PubMed

    Wang, Xu; Ozkan, Cengiz S

    2008-02-01

    We describe a novel application for detecting specific single strand DNA sequences using multisegment nanowires via a straightforward surface functionalization method. Nanowires comprising CdTe-Au-CdTe segments are fabricated using electrochemical deposition, and electrical characterization indicates a p-type behavior for the multisegment nanostructures, in a back-to-back Schottky diode configuration. Such nanostructures modified with thiol-terminated probe DNA fragments could function as high fidelity sensors for biomolecules at very low concentration. The gold segment is utilized for functionalization and binding of single strand DNA (ssDNA) fragments while the CdTe segments at both ends serve to modulate the equilibrium Fermi level of the heterojunction device upon hybridization of the complementary DNA fragments (cDNA) to the ssDNA over the Au segment. Employing such multisegment nanowires could lead to the fabrication more sophisticated and high multispecificity biosensors via selective functionalization of individual segments for biowarfare sensing and medical diagnostics applications.

  4. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    PubMed Central

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  5. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    PubMed

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  6. Biophysical modeling of fragment length distributions of DNA plasmids after X and heavy-ion irradiation analyzed by atomic force microscopy.

    PubMed

    Elsässer, Thilo; Brons, Stephan; Psonka, Katarzyna; Scholz, Michael; Gudowska-Nowak, Ewa; Taucher-Scholz, Gisela

    2008-06-01

    The investigation of fragment length distributions of plasmid DNA gives insight into the influence of localized energy distribution on the induction of DNA damage, particularly the clustering of double-strand breaks. We present an approach that determines the fragment length distributions of plasmid DNA after heavy-ion irradiation by using the Local Effect Model. We find a good agreement of our simulations with experimental fragment distributions derived from atomic force microscopy (AFM) studies by including experimental constraints typical for AFM. Our calculations reveal that by comparing the fragmentation in terms of fluence, we can uniquely distinguish the effect of different radiation qualities. For very high-LET irradiation using nickel or uranium ions, no difference between their fragment distributions can be expected for the same dose level. However, for carbon ions with an intermediate LET, the fragmentation pattern differs from the distribution for very high-LET particles. The results of the model calculations can be used to determine the optimal experimental parameters for a demonstration of the influence of track structure on primary radiation damage. Additionally, we compare the results of our model for two different plasmid geometries.

  7. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gindhart, J.G. Jr.; Kaufman, T.C.

    1995-02-01

    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products.more » When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.« less

  8. Telomere Restriction Fragment (TRF) Analysis.

    PubMed

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of restriction enzyme recognition sites within TTAGGG tandem telomeric repeats, therefore digestion of genomic DNA, not telomeric DNA, with a combination of 6 base restriction endonucleases reduces genomic DNA size to less than 800 bp.

  9. Modulation of ceramide metabolism in T-leukemia cell lines potentiates apoptosis induced by the cationic antimicrobial peptide bovine lactoferricin.

    PubMed

    Furlong, Suzanne J; Ridgway, Neale D; Hoskin, David W

    2008-03-01

    Bovine lactoferricin (LfcinB) is a cationic antimicrobial peptide that selectively induces apoptosis in several different types of human cancer cells. However, the potential use of LfcinB as an anticancer agent is presently limited by the need for relatively high concentrations of the peptide to trigger apoptosis. Ceramide is a membrane sphingolipid that is believed to function as a second messenger during apoptosis. In this study, we investigated the role of ceramide in LfcinB-induced apoptosis in CCRF-CEM and Jurkat T-leukemia cell lines. Exposure to LfcinB caused nuclear condensation and fragmentation, poly(ADP-ribose) polymerase (PARP) cleavage, and DNA fragmentation in CCRF-CEM and Jurkat T-cell acute lymphoblastic leukemia cell lines. Treatment with C6 ceramide, a cell-permeable, short-chain ceramide analog, also induced apoptotic nuclear morphology, PARP cleavage, and DNA fragmentation in T-leukemia cells. Although LfcinB treatment did not cause ceramide to accumulate in CCRF-CEM or Jurkat cells, the addition of C6 ceramide to LfcinB-treated T-leukemia cells resulted in increased DNA fragmentation. Furthermore, modulation of cellular ceramide metabolism either by inhibiting ceramidases with D-erythro-2-(N-myristoylamino)-1-phenyl-1-propanol or N-oleoylethanolamine, or by blocking glucosylceramide synthase activity with 1-phenyl-2-palmitoylamino-3-morpholino-1-propanol, enhanced the ability of LfcinB to trigger apoptosis in both Jurkat and CCRF-CEM cells. In addition, LfcinB-induced apoptosis of T-leukemia cells was enhanced in the presence of the antiestrogen tamoxifen, which has multiple effects on cancer cells, including inhibition of glucosylceramide synthase activity. We conclude that manipulation of cellular ceramide levels in combination with LfcinB therapy warrants further investigation as a novel strategy for the treatment of T cell-derived leukemias.

  10. Cytotoxicity and Antineoplastic Activities of Alkylamines and Their Borane Derivatives

    PubMed Central

    Tse, Elaine Y.; Muhammad, Rosallah A.

    1996-01-01

    The alkylamines and their related boron derivatives demonstrated potent cytotoxicity against the growth of murine and human tissue cultured cells. These agents did not necessarily require the boron atom to possess potent cytotoxic action in certain tumor lines. Their ability to suppress tumor cell growth was based on their inhibition of DNA and protein syntheses. DNA synthesis was reduced because purine synthesis was blocked at the enzyme site of IMP dehydrogenase by the agents. In addition ribonucleotide reductase and nucleoside kinase activities were reduced by the agents which would account for the reduced d[NTP] pools. The DNA template or molecule may be a target of the drugs with regard to binding of the drug to nucleoside bases or intercalaction of the drug between DNA base pairs. Only some Of the agents caused DNA fragmentation with reduced DNA viscosity. These effects would contribute to overall cell death afforded by the agents. PMID:18472803

  11. Development of SCAR Markers for the DNA-Based Detection of the Asian Long-Horned Beetle; Anoplophora glabripennis (Motschulsky)

    Treesearch

    Damodar R. Kethidi; David B. Roden; Tim R. Ladd; Peter J. Krell; Arthur Ratnakaran; Qili Feng

    2003-01-01

    DNA markers were identified for the molecular detection of the Asian long-horned beetle (ALB), Anoplophora glabripennis (Mot.), based on sequence charaterized amplified regions (SCARS) derived from random amplified polymorphic DNA (RAPD) fragments. A 2,740-bp DNA fragment that was present only in ALB and not in other Cerambycids was identified after...

  12. Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

    PubMed

    Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

    2003-01-01

    A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

  13. Visualization of DNA in highly processed botanical materials.

    PubMed

    Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary

    2018-04-15

    DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Inviability of a DNA2 deletion mutant is due to the DNA damage checkpoint.

    PubMed

    Budd, Martin E; Antoshechkin, Igor A; Reis, Clara; Wold, Barbara J; Campbell, Judith L

    2011-05-15

    Dna2 is a dual polarity exo/endonuclease, and 5' to 3' DNA helicase involved in Okazaki Fragment Processing (OFP) and Double-Strand Break (DSB) Repair. In yeast, DNA2 is an essential gene, as expected for a DNA replication protein. Suppression of the lethality of dna2Δ mutants has been found to occur by two mechanisms: overexpression of RAD27 (scFEN1) , encoding a 5' to 3' exo/endo nuclease that processes Okazaki fragments (OFs) for ligation, or deletion of PIF1, a 5' to 3' helicase involved in mitochondrial recombination, telomerase inhibition and OFP. Mapping of a novel, spontaneously arising suppressor of dna2Δ now reveals that mutation of rad9 and double mutation of rad9 mrc1 can also suppress the lethality of dna2Δ mutants. Interaction of dna2Δ and DNA damage checkpoint mutations provides insight as to why dna2Δ is lethal but rad27Δ is not, even though evidence shows that Rad27 (ScFEN1) processes most of the Okazaki fragments, while Dna2 processes only a subset.

  15. Construction of a food-grade cloning vector for Lactobacillus plantarum and its utilization in a food model.

    PubMed

    Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

    2012-01-01

    The development of Lactobacillus plantarum to be used in starter cultures in the food industry has been limited because of the lack of a food-grade cloning vector for the bacterium. In this study, the plasmid pFLP1 was constructed by joining 2 DNA fragments derived from food-approved organisms. The 5.2-kb BamHI/KpnI DNA fragment of pRV566 containing the theta-type replicon of Lactobacillus sakei was ligated to the BamHI/KpnI DNA fragment of a 2.9-kb lactococcal cadmium resistance determinant amplified from pND918. The 8.1-kb newly constructed plasmid could transform L. plantarum N014, a bacteriocin-producing bacteria originally isolated from nham, a traditional Thai fermented sausage. The resulting transformant, L. plantarum N014-FLP, and its parent strain were shown to be very similar in growth rate and bacteriocin activity. In addition, the plasmid was very stable in its host bacteria under nonselective pressure for 100 generations in MRS medium and for 5 days in a nham model. These results suggest that pFLP1 is a potential food-grade cloning vector for L. plantarum.

  16. A Genetic Linkage Map of Longleaf Pine (Pinus palustris Mill.) Based on Random Amplified Polymorphic DNAs

    Treesearch

    C.D. Nelson; Thomas L. Kubisiak; M. Stine; W.L. Nance

    1994-01-01

    Eight megagametophyte DNA samples from a single longleaf pine (Pinus palustris Mill.) tree were used to screen 576 oligonucleotide primers for random amplified polymorphic DNA (RAPD) fragments. Primers amplifying repeatable polymorphic fragments were further characterized within a sample of 72 megagametophytes from the same tree. Fragments...

  17. Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

    PubMed Central

    Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

    1974-01-01

    By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

  18. Ameliorative Influence of Green Tea Extract on Copper Nanoparticle-Induced Hepatotoxicity in Rats

    NASA Astrophysics Data System (ADS)

    Ibrahim, Marwa A.; Khalaf, A. A.; Galal, Mona K.; Ogaly, Hanan A.; H. M. Hassan, Azza

    2015-09-01

    The potential toxicity of copper nanoparticles (CNPs) to the human health and environment remains a critical issue. In the present study, we investigated the protective influence of an aqueous extract of green tea leaves (GTE) against CNPs-induced (20-30 nm) hepatotoxicity. Four different groups of rats were used: group I was the control, group II received CNPs (40 mg/kg BW), group III received CNPs plus GTE, and group IV received GTE alone. We highlighted the hepatoprotective effect of GTE against CNPs toxicity through monitoring the alteration of liver enzyme activity, antioxidant defense mechanism, histopathological alterations, and DNA damage evaluation. The rats that were given CNPs only had a highly significant elevation in liver enzymes, alteration in oxidant-antioxidant balance, and severe pathological changes. In addition, we detected a significant elevation of DNA fragmentation percentage, marked DNA laddering, and significance over expression of both caspase-3 and Bax proteins. The findings for group III clarify the efficacy of GTE as a hepatoprotectant on CNPs through improving the liver enzyme activity, antioxidant status, as well as suppressing DNA fragmentation and the expression of the caspase-3 and Bax proteins. In conclusion, GTE was proved to be a potential hepatoprotective additive as it significantly ameliorates the hepatotoxicity and apoptosis induced by CNPs.

  19. The antiproliferative effect of Moringa oleifera crude aqueous leaf extract on cancerous human alveolar epithelial cells

    PubMed Central

    2013-01-01

    Background The incidence of lung cancer is expected to increase due to increases in exposure to airborne pollutants and cigarette smoke. Moringa oleifera (MO), a medicinal plant found mainly in Asia and South Africa is used in the traditional treatment of various ailments including cancer. This study investigated the antiproliferative effect of MO leaf extract (MOE) in cancerous A549 lung cells. Methods A crude aqueous leaf extract was prepared and the cells were treated with 166.7 μg/ml MOE (IC50) for 24 h and assayed for oxidative stress (TBARS and Glutathione assays), DNA fragmentation (comet assay) and caspase (3/7 and 9) activity. In addition, the expression of Nrf2, p53, Smac/DIABLO and PARP-1 was determined by Western blotting. The mRNA expression of Nrf2 and p53 was assessed using qPCR. Results A significant increase in reactive oxygen species with a concomitant decrease in intracellular glutathione levels (p < 0.001) in MOE treated A549 cells was observed. MOE showed a significant reduction in Nrf2 protein expression (1.89-fold, p < 0.05) and mRNA expression (1.44-fold). A higher level of DNA fragmentation (p < 0.0001) was seen in the MOE treated cells. MOE’s pro-apoptotic action was confirmed by the significant increase in p53 protein expression (1.02-fold, p < 0.05), p53 mRNA expression (1.59-fold), caspase-9 (1.28-fold, p < 0.05), caspase-3/7 (1.52-fold) activities and an enhanced expression of Smac/DIABLO. MOE also caused the cleavage and activation of PARP-1 into 89 KDa and 24 KDa fragments (p < 0.0001). Conclusion MOE exerts antiproliferative effects in A549 lung cells by increasing oxidative stress, DNA fragmentation and inducing apoptosis. PMID:24041017

  20. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    PubMed

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  1. Minimum structural requirements for cell membrane leakage-mediated anti-MRSA activity of macrocyclic bis(bibenzyl)s.

    PubMed

    Fujii, Kana; Morita, Daichi; Onoda, Kenji; Kuroda, Teruo; Miyachi, Hiroyuki

    2016-05-01

    Macrocyclic bis(bibenzyl)-type phenolic natural products, found exclusively in bryophytes, exhibit potent antibacterial activity towards methicillin-resistant Staphylococcus aureus (anti-MRSA activity). Here, in order to identify the minimum essential structure for cell membrane leakage-mediated anti-MRSA activity of these compounds, we synthesized acyclic fragment structures and evaluated their anti-MRSA activity. The activities of all of the acyclic fragments tested exhibited similar characteristics to those of the macrocycles, i.e., anti-MRSA bactericidal activity, an enhancing effect on influx and efflux of ethidium bromide (EtBr: fluorescent DNA-binder) in Staphylococcus aureus cells, and bactericidal activity towards a Staphylococcus aureus strain resistant to 2-phenoxyphenol (4). The latter result suggests that they have a different mechanism of action from 4, which is a FabI inhibitor previously proposed to be the minimum active fragment of riccardin-type macrocycles. Thus, cyclic structure is not a necessary condition for cell membrane leakage-mediated anti-MRSA activity of macrocyclic bis(bibenzyl)s. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Comprehensive Study On The Metastable Negative Ion Fragmentation Of Individual Dna Components And Larger Oligonucleotides

    NASA Astrophysics Data System (ADS)

    Ingolfsson, O.; Flosadottir, H. D.; Omarsson, B.; Ilko, B.

    2010-07-01

    Here we present a systematic study on the unimolecular decay pathways of the deprotonated building blocks of DNA and RNA to address the following questions: 1. Are the negative ion fragmentation patterns observed in the metastable decay of individual DNA components still evident when these are combined to larger oligonucleotides? 2. What is the significance of the charge location in determining the fragmentation pathways in the metastable decay process? 3. Are those metastable decay channels relevant in dissociative electron attachment to DNA components? To address these questions we have studied the fragmentation patterns of the deprotonated ribose and ribose 5'-monophosphate, the fragmentation patterns of the individual bases, all nucleosides and all 2'-deoxynucleosides as well as the individual nucleotides and several combinations of hexameric oligonucleotides. Furthermore, to understand the significance of the charge location in determining the fragmentation path in the metastable decay process of these deprotonated ions we have also studied modified uridine and guanosine. These have been modified to block different deprotonation sites and thus to control the initial step in the in the fragmentation process i.e. the site of deprotonation. In addition to our experimental approach we have also simulated the metastable fragmentation of the deprotonated uridine and 2'-deoxyguanosine to clarify the mechanisms and fragmentation patterns observed. Where data is available, the results are compared to dissociative electron attachment to DNA components and discussed in context to the underlying mechanism. Experiments on modified nucleosides where selected deprotonation sites have been blocked are used to verify the predicted reaction paths and imulations on uridine and 2'-deoxyguanosine are compared to the experimental results and used to shed light on the mechanisms involved.

  3. Evaluation of DNA extraction methods for the analysis of microbial community in biological activated carbon.

    PubMed

    Zheng, Lu; Gao, Naiyun; Deng, Yang

    2012-01-01

    It is difficult to isolate DNA from biological activated carbon (BAC) samples used in water treatment plants, owing to the scarcity of microorganisms in BAC samples. The aim of this study was to identify DNA extraction methods suitable for a long-term, comprehensive ecological analysis of BAC microbial communities. To identify a procedure that can produce high molecular weight DNA, maximizes detectable diversity and is relatively free from contaminants, the microwave extraction method, the cetyltrimethylammonium bromide (CTAB) extraction method, a commercial DNA extraction kit, and the ultrasonic extraction method were used for the extraction of DNA from BAC samples. Spectrophotometry, agarose gel electrophoresis and polymerase chain reaction (PCR)-restriction fragment length polymorphisms (RFLP) analysis were conducted to compare the yield and quality of DNA obtained using these methods. The results showed that the CTAB method produce the highest yield and genetic diversity of DNA from BAC samples, but DNA purity was slightly less than that obtained with the DNA extraction-kit method. This study provides a theoretical basis for establishing and selecting DNA extraction methods for BAC samples.

  4. Ultra-low background DNA cloning system.

    PubMed

    Goto, Kenta; Nagano, Yukio

    2013-01-01

    Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

  5. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation.

    PubMed

    Anifandis, George; Katsanaki, Katerina; Lagodonti, Georgia; Messini, Christina; Simopoulou, Mara; Dafopoulos, Konstantinos; Daponte, Alexandros

    2018-05-30

    Glyphosate is the active ingredient of Roundup ® , which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF). Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time) and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm ® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  6. Human Topoisomerase I C-Terminal Domain Fragment Containing the Active Site Tyrosine is a Molten Globule: Implication for the Formation of Competent Productive Complex

    PubMed Central

    Punchihewa, Chandanamali; Dai, Jixun; Carver, Megan; Yang, Danzhou

    2007-01-01

    Human topoisomerase I (topo I) is an essential cellular enzyme that relaxes DNA supercoiling. The 6.3 kDa C-terminal domain of topo I contains the active site tyrosine (Tyr723) but lacks enzymatic activity by itself. Activity can be fully reconstituted when the C-terminal is associated with the 56 kDa core domain. Even though several crystal structures of topo I/DNA complexes are available, crystal structures of the free topo I protein or its individual domain fragments have been difficult to obtain. In this report we analyze the human topo I C-terminal domain structure using a variety of biophysical methods. Our results indicate that this fragment protein (topo6.3) appears to be in a molten globule state. It appears to have a native-like tertiary fold that contains a large population of α-helix secondary structure and extensive surface hydrophobic regions. Topo6.3 is known to be readily activated with the association of the topo I core domain, and the molten globule state of topo6.3 is likely to be an energy-favorable conformation for the free topo I C-terminal domain protein. The structural fluctuation and plasticity may represent an efficient mechanism in the topo I functional pathway, where the flexibility aids in the complementary association with the core domain and in the formation of a fully productive topo I complex. PMID:17434318

  7. Molecular Detection, Isolation, and Physiological Characterization of Functionally Dominant Phenol-Degrading Bacteria in Activated Sludge

    PubMed Central

    Watanabe, Kazuya; Teramoto, Maki; Futamata, Hiroyuki; Harayama, Shigeaki

    1998-01-01

    DNA was isolated from phenol-digesting activated sludge, and partial fragments of the 16S ribosomal DNA (rDNA) and the gene encoding the largest subunit of multicomponent phenol hydroxylase (LmPH) were amplified by PCR. An analysis of the amplified fragments by temperature gradient gel electrophoresis (TGGE) demonstrated that two major 16S rDNA bands (bands R2 and R3) and two major LmPH gene bands (bands P2 and P3) appeared after the activated sludge became acclimated to phenol. The nucleotide sequences of these major bands were determined. In parallel, bacteria were isolated from the activated sludge by direct plating or by plating after enrichment either in batch cultures or in a chemostat culture. The bacteria isolated were classified into 27 distinct groups by a repetitive extragenic palindromic sequence PCR analysis. The partial nucleotide sequences of 16S rDNAs and LmPH genes of members of these 27 groups were then determined. A comparison of these nucleotide sequences with the sequences of the major TGGE bands indicated that the major bacterial populations, R2 and R3, possessed major LmPH genes P2 and P3, respectively. The dominant populations could be isolated either by direct plating or by chemostat culture enrichment but not by batch culture enrichment. One of the dominant strains (R3) which contained a novel type of LmPH (P3), was closely related to Valivorax paradoxus, and the result of a kinetic analysis of its phenol-oxygenating activity suggested that this strain was the principal phenol digester in the activated sludge. PMID:9797297

  8. 2000 Year-old ancient equids: an ancient-DNA lesson from pompeii remains.

    PubMed

    Di Bernardo, Giovanni; Del Gaudio, Stefania; Galderisi, Umberto; Cipollaro, Marilena

    2004-11-15

    Ancient DNA extracted from 2000 year-old equine bones was examined in order to amplify mitochondrial and nuclear DNA fragments. A specific equine satellite-type sequence representing 3.7%-11% of the entire equine genome, proved to be a suitable target to address the question of the presence of aDNA in ancient bones. The PCR strategy designed to investigate this specific target also allowed us to calculate the molecular weight of amplifiable DNA fragments. Sequencing of a 370 bp DNA fragment of mitochondrial control region allowed the comparison of ancient DNA sequences with those of modern horses to assess their genetic relationship. The 16S rRNA mitochondrial gene was also examined to unravel the post-mortem base modification feature and to test the status of Pompeian equids taxon on the basis of a Mae III restriction site polymorphism. Copyright 2004 Wiley-Liss, Inc.

  9. TAO kinases mediate activation of p38 in response to DNA damage

    PubMed Central

    Raman, Malavika; Earnest, Svetlana; Zhang, Kai; Zhao, Yingming; Cobb, Melanie H

    2007-01-01

    Thousand and one amino acid (TAO) kinases are Ste20p-related MAP kinase kinase kinases (MAP3Ks) that activate p38 MAPK. Here we show that the TAO kinases mediate the activation of p38 in response to various genotoxic stimuli. TAO kinases are activated acutely by ionizing radiation, ultraviolet radiation, and hydroxyurea. Full-length and truncated fragments of dominant negative TAOs inhibit the activation of p38 by DNA damage. Inhibition of TAO expression by siRNA also decreases p38 activation by these agents. Cells in which TAO kinases have been knocked down are less capable of engaging the DNA damage-induced G2/M checkpoint and display increased sensitivity to IR. The DNA damage kinase ataxia telangiectasia mutated (ATM) phosphorylates TAOs in vitro; radiation induces phosphorylation of TAO on a consensus site for phosphorylation by the ATM protein kinase in cells; and TAO and p38 activation is compromised in cells from a patient with ataxia telangiectasia that lack ATM. These findings indicate that TAO kinases are regulators of p38-mediated responses to DNA damage and are intermediates in the activation of p38 by ATM. PMID:17396146

  10. Reverse Transcriptase Activity in Mature Spermatozoa of Mouse

    PubMed Central

    Giordano, Roberto; Magnano, Anna Rosa; Zaccagnini, Germana; Pittoggi, Carmine; Moscufo, Nicola; Lorenzini, Rodolfo; Spadafora, Corrado

    2000-01-01

    We show here that a reverse transcriptase (RT) activity is present in murine epididymal spermatozoa. Sperm cells incubated with human poliovirus RNA can take up exogenous RNA molecules and internalize them in nuclei. Direct PCR amplification of DNA extracted from RNA-incubated spermatozoa indicate that poliovirus RNA is reverse-transcribed in cDNA fragments. PCR analysis of two-cell embryos shows that poliovirus RNA-challenged spermatozoa transfer retrotranscribed cDNA molecules into eggs during in vitro fertilization. Finally, RT molecules can be visualized on sperm nuclear scaffolds by immunogold electron microscopy. These results, therefore, reveal a novel metabolic function in spermatozoa, which may play a role during early embryonic development. PMID:10725323

  11. Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, S.S.

    1987-01-01

    In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

  12. A DNA logic gate based on strand displacement reaction and rolling circle amplification, responding to multiple low-abundance DNA fragment input signals, and its application in detecting miRNAs.

    PubMed

    Chen, Yuqi; Song, Yanyan; Wu, Fan; Liu, Wenting; Fu, Boshi; Feng, Bingkun; Zhou, Xiang

    2015-04-25

    A conveniently amplified DNA AND logic gate platform was designed for the highly sensitive detection of low-abundance DNA fragment inputs based on strand displacement reaction and rolling circle amplification strategy. Compared with others, this system can detect miRNAs in biological samples. The success of this strategy demonstrates the potential of DNA logic gates in disease diagnosis.

  13. Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.

    PubMed

    Ponce, M R; Quesada, V; Micol, J L

    1998-05-01

    An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.

  14. Neuroprotective effects of idebenone against pilocarpine-induced seizures: modulation of antioxidant status, DNA damage and Na(+), K (+)-ATPase activity in rat hippocampus.

    PubMed

    Ahmed, Maha Ali Eissa

    2014-02-01

    The current study investigated the neuroprotective activity of idebenone against pilocarpine-induced seizures and hippocampal injury in rats. Idebenone is a ubiquinone analog with antioxidant, and ATP replenishment effects. It is well tolerated and has low toxicity. Previous studies reported the protective effects of idebenone against neurodegenerative diseases such as Friedreich's ataxia and Alzheimer's disease. So far, the efficacy of idebenone in experimental models of seizures has not been tested. To achieve this aim, rats were randomly distributed into six groups. Two groups were treated with either normal saline (0.9 %, i.p., control group) or idebenone (200 mg/kg, i.p., Ideb200 group) for three successive days. Rats of the other four groups (P400, Ideb50 + P400, Ideb100 + P400, and Ideb200 + P400) received either saline or idebenone (50, 100, 200 mg/kg, i.p.) for 3 days, respectively followed by a single dose of pilocarpine (400 mg/kg, i.p.). All rats were observed for 6 h post pilocarpine injection. Latency to the first seizure, and percentages of seizures and survival were recorded. Surviving animals were sacrificed, and the hippocampal tissues were separated and used for the measurement of lipid peroxides, total nitrate/nitrite, glutathione and DNA fragmentation levels, in addition to catalase and Na(+), K(+)-ATPase activities. Results revealed that in a dose-dependent manner, idebenone (100, 200 mg/kg) prolonged the latency to the first seizure, elevated the percentage of survival and diminished the percentage of pilocapine-induced seizures in rats. Significant increases in lipid peroxides, total nitrate/nitrite, DNA fragmentation levels and catalase activity, in addition to a significant reduction in glutathione level and Na(+), K(+)-ATPase activity were observed in pilocarpine group. Pre-administration of idebenone (100, 200 mg/kg, i.p.) to pilocarpine-treated rats, significantly reduced lipid peroxides, total nitrate/nitrite, DNA fragmentation levels, and normalized catalase activity. Moreover, idebenone prevented pilocarpine-induced detrimental effects on brain hippocampal glutathione level, and Na(+), K(+)-ATPase enzyme activity in rats. Data obtained from the current investigation emphasized the critical role of oxidative stress in induction of seizures by pilocarpine and elucidated the prominent neuroprotective and antioxidant activities of idebenone in this model.

  15. Apoptotic cell death and the proliferative capacity of human breast cancers.

    PubMed

    Losa, G A; Graber, R

    1998-01-01

    The proliferative capacity (%S-phase fraction), DNA ploidy, apoptosis frequency (DNA fragmentation) and steroid hormone receptor status (estrogen receptor, ER; progesterone receptor, PR) of 110 samples of human breast tissues with ductal invasive carcinoma were measured using biochemical and cytofluorimetric procedures. The DNA fragmentation had a left-skewed frequency distribution and an overall median value of 1.64%, whilst the median %S-phase fraction was 8%. The median %DNA fragmentation and %S-phase fraction were 1.96% and 16% in hyperdiploid tumours (n = 29; DNA index >1.1) higher than in hypodiploid tumors (n = 10; DNA index <0.96), 0.38% and 7.5%. DNA diploid tumours (n = 71) had median %DNA fragmentation and %S-phase values of 1.68% and 6%, consistently lower than the median values of DNA hyperdiploid tumours. The ER content of hypodiploid tumours was about one half (median: 5.9 fmol/mg) the median values in hyperdiploid (10.6 fmol/mg) and diploid tumours (14.6 fmol/mg). This may correlate with the lowest frequency of apoptosis in hypodiploid tumours, at least when measured by biochemical methods which only detect cells in the late phases of apoptosis. In contrast, the median PR was lowest in hyperdiploid tumours than in hypo and/or diploid tumours. The %S-phase/%fragmented DNA ratio for the hypodiploid tumours was 19.7, significantly higher than the ratios for hyperdiploid (8.2) and diploid tumours (3.6). These findings indicated that there is an imbalance between proliferative capacity and cell death or growth arrest in human breast tumours. This imbalance may well be linked to a loss of steroid hormone control.

  16. Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA

    ERIC Educational Resources Information Center

    Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen

    2010-01-01

    This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…

  17. Microfluidic Gel Electrophoresis in the Undergraduate Laboratory Applied to Food Analysis

    ERIC Educational Resources Information Center

    Chao, Tzu-Chiao; Bhattacharya, Sanchari; Ros, Alexandra

    2012-01-01

    A microfluidics-based laboratory experiment for the analysis of DNA fragments in an analytical undergraduate course is presented. The experiment is set within the context of food species identification via amplified DNA fragments. The students are provided with berry samples from which they extract DNA and perform polymerase chain reaction (PCR)…

  18. Cellular and molecular aspects of quinoa leaf senescence.

    PubMed

    López-Fernández, María Paula; Burrieza, Hernán Pablo; Rizzo, Axel Joel; Martínez-Tosar, Leandro Julián; Maldonado, Sara

    2015-09-01

    During leaf senescence, degradation of chloroplasts precede to changes in nuclei and other cytoplasmic organelles, RuBisCO stability is progressively lost, grana lose their structure, plastidial DNA becomes distorted and degraded, the number of plastoglobuli increases and abundant senescence-associated vesicles containing electronically dense particles emerge from chloroplasts pouring their content into the central vacuole. This study examines quinoa leaf tissues during development and senescence using a range of well-established markers of programmed cell death (PCD), including: morphological changes in nuclei and chloroplasts, degradation of RuBisCO, changes in chlorophyll content, DNA degradation, variations in ploidy levels, and changes in nuclease profiles. TUNEL reaction and DNA electrophoresis demonstrated that DNA fragmentation in nuclei occurs at early senescence, which correlates with induction of specific nucleases. During senescence, metabolic activity is high and nuclei endoreduplicate, peaking at 4C. At this time, TEM images showed some healthy nuclei with condensed chromatin and nucleoli. We have found that DNA fragmentation, induction of senescence-associated nucleases and endoreduplication take place during leaf senescence. This provides a starting point for further research aiming to identify key genes involved in the senescence of quinoa leaves. Published by Elsevier Ireland Ltd.

  19. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    PubMed

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  20. Anhydrobiosis-Associated Nuclear DNA Damage and Repair in the Sleeping Chironomid: Linkage with Radioresistance

    PubMed Central

    Vanyagina, Veronica; Malutina, Ludmila; Cornette, Richard; Sakashita, Tetsuya; Hamada, Nobuyuki; Kikawada, Takahiro; Kobayashi, Yasuhiko; Okuda, Takashi

    2010-01-01

    Anhydrobiotic chironomid larvae can withstand prolonged complete desiccation as well as other external stresses including ionizing radiation. To understand the cross-tolerance mechanism, we have analyzed the structural changes in the nuclear DNA using transmission electron microscopy and DNA comet assays in relation to anhydrobiosis and radiation. We found that dehydration causes alterations in chromatin structure and a severe fragmentation of nuclear DNA in the cells of the larvae despite successful anhydrobiosis. Furthermore, while the larvae had restored physiological activity within an hour following rehydration, nuclear DNA restoration typically took 72 to 96 h. The DNA fragmentation level and the recovery of DNA integrity in the rehydrated larvae after anhydrobiosis were similar to those of hydrated larvae irradiated with 70 Gy of high-linear energy transfer (LET) ions (4He). In contrast, low-LET radiation (gamma-rays) of the same dose caused less initial damage to the larvae, and DNA was completely repaired within within 24 h. The expression of genes encoding the DNA repair enzymes occurred upon entering anhydrobiosis and exposure to high- and low-LET radiations, indicative of DNA damage that includes double-strand breaks and their subsequent repair. The expression of antioxidant enzymes-coding genes was also elevated in the anhydrobiotic and the gamma-ray-irradiated larvae that probably functions to reduce the negative effect of reactive oxygen species upon exposure to these stresses. Indeed the mature antioxidant proteins accumulated in the dry larvae and the total activity of antioxidants increased by a 3–4 fold in association with anhydrobiosis. We conclude that one of the factors explaining the relationship between radioresistance and the ability to undergo anhydrobiosis in the sleeping chironomid could be an adaptation to desiccation-inflicted nuclear DNA damage. There were also similarities in the molecular response of the larvae to damage caused by desiccation and ionizing radiation. PMID:21103355

  1. Pretreatment of low dose radiation reduces radiation-induced apoptosis in mouse lymphoma (EL4) cells.

    PubMed

    Kim, J H; Hyun, S J; Yoon, M Y; Ji, Y H; Cho, C K; Yoo, S Y

    1997-06-01

    Induction of an adaptive response to ionizing radiation in mouse lymphoma (EL4) cells was studied by using cell survival fraction and apoptotic nucleosomal DNA fragmentation as biological end points. Cells in early log phase were pre-exposed to low dose of gamma-rays (0.01 Gy) 4 or 20 hrs prior to high dose gamma-ray (4, 8 and 12 Gy for cell survival fraction analysis; 8 Gy for DNA fragmentation analysis) irradiation. Then cell survival fractions and the extent of DNA fragmentation were measured. Significant adaptive response, increase in cell survival fraction and decrease in the extent of DNA fragmentation were induced when low and high dose gamma-ray irradiation time interval was 4 hr. Addition of protein or RNA synthesis inhibitor, cycloheximide or 5,6-dichloro-1-beta-d-ribofuranosylbenzimidazole (DRFB), respectively during adaptation period, the period from low dose gamma-ray irradiation to high dose gamma-ray irradiation, was able to inhibit the induction of adaptive response, which is the reduction of the extent DNA fragmentation in irradiated EL4 cells. These data suggest that the induction of adaptive response to ionizing radiation in EL4 cells required both protein and RNA synthesis.

  2. Cellular Stress and p53-Associated Apoptosis by Juniperus communis L. Berry Extract Treatment in the Human SH-SY5Y Neuroblastoma Cells.

    PubMed

    Lantto, Tiina A; Laakso, Into; Dorman, H J Damien; Mauriala, Timo; Hiltunen, Raimo; Kõks, Sulev; Raasmaja, Atso

    2016-07-13

    Plant phenolics have shown to activate apoptotic cell death in different tumourigenic cell lines. In this study, we evaluated the effects of juniper berry extract (Juniperus communis L.) on p53 protein, gene expression and DNA fragmentation in human neuroblastoma SH-SY5Y cells. In addition, we analyzed the phenolic composition of the extract. We found that juniper berry extract activated cellular relocalization of p53 and DNA fragmentation-dependent cell death. Differentially expressed genes between treated and non-treated cells were evaluated with the cDNA-RDA (representational difference analysis) method at the early time point of apoptotic process when p53 started to be activated and no caspase activity was detected. Twenty one overexpressed genes related to cellular stress, protein synthesis, cell survival and death were detected. Interestingly, they included endoplasmic reticulum (ER) stress inducer and sensor HSPA5 and other ER stress-related genes CALM2 and YKT6 indicating that ER stress response was involved in juniper berry extract mediated cell death. In composition analysis, we identified and quantified low concentrations of fifteen phenolic compounds. The main groups of them were flavones, flavonols, phenolic acids, flavanol and biflavonoid including glycosides of quercetin, apigenin, isoscutellarein and hypolaetin. It is suggested that juniper berry extract induced the p53-associated apoptosis through the potentiation and synergism by several phenolic compounds.

  3. Fluorescence studies with DNA probes: dynamic aspects of DNA structure and DNA-protein interactions

    NASA Astrophysics Data System (ADS)

    Millar, David P.; Carver, Theodore E.

    1994-08-01

    Time-resolved fluorescence measurements of optical probes incorporated at specific sites in DNA provides a new approach to studies of DNA structure and DNA:protein interactions. This approach can be used to study complex multi-state behavior, such as the folding of DNA into alternative higher order structures or the transfer of DNA between multiple binding sites on a protein. In this study, fluorescence anisotropy decay of an internal dansyl probe attached to 17/27-mer oligonucleotides was used to monitor the distribution of DNA 3' termini bound at either the polymerase of 3' to 5' exonuclease sites of the Klenow fragment of DNA polymerase I. Partitioning of the primer terminus between the two active sites of the enzyme resulted in a heterogeneous probe environment, reflected in the associative behavior of the fluorescence anisotropy decay. Analysis of the anisotropy decay with a two state model of solvent-exposed and protein-associated dansyl probes was used to determine the fraction of DNA bound at each site. We examined complexes of Klenow fragment with DNAs containing various base mismatches. Single mismatches at the primer terminus caused a 3-fold increase in the equilibrium partitioning of DNA into the exonuclease site, while two or more consecutive G:G mismatches caused the DNA to bind exclusively at the exonuclease site, with a partitioning constant at least 250- fold greater than that of the corresponding matched DNA sequence. Internal single mismatches located up to four bases from the primer terminus produced larger effects than the same mismatch at the primer terminus. These results provide insight into the recognition mechanisms that enable DNA polymerases to proofread misincorporated bases during DNA replication.

  4. The absence of oligonucleosomal DNA fragmentation during apoptosis of IMR-5 neuroblastoma cells: disappearance of the caspase-activated DNase.

    PubMed

    Yuste, V J; Bayascas, J R; Llecha, N; Sánchez-López, I; Boix, J; Comella, J X

    2001-06-22

    Caspase-activated DNase is responsible for the oligonucleosomal DNA degradation during apoptosis. DNA degradation is thought to be important for multicellular organisms to prevent oncogenic transformation or as a mechanism of viral defense. It has been reported that certain cells, including some neuroblastoma cell lines such as IMR-5, enter apoptosis without digesting DNA in such a way. We have analyzed the causes for the absence of DNA laddering in staurosporine-treated IMR-5 cells, and we have found that most of the molecular mechanisms controlling apoptosis are well preserved in this cell line. These include degradation of substrates for caspases, blockade of cell death by antiapoptotic genes such as Bcl-2 or Bcl-X(L), or normal levels and adequate activation of caspase-3. Moreover, these cells display normal levels of caspase-activated DNase and its inhibitory protein, inhibitor of caspase-activated DNase, and their cDNA sequences are identical to those reported previously. Nevertheless, IMR-5 cells lose caspase-activated DNase during apoptosis and recover their ability to degrade DNA when human recombinant caspase-activated DNase is overexpressed. Our results lead to the conclusion that caspase-activated DNase is processed during apoptosis of IMR-5 cells, making these cells a good model to study the relevance of this endonuclease in physiological or pathological conditions.

  5. Dna Sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  6. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    PubMed

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  7. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments

    PubMed Central

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-01-01

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp. PMID:24019490

  8. Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing.

    PubMed

    Yu, Stephanie C Y; Chan, K C Allen; Zheng, Yama W L; Jiang, Peiyong; Liao, Gary J W; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y; Go, Attie T J I; van Vugt, John M G; Minekawa, Ryoko; Oudejans, Cees B M; Nicolaides, Kypros H; Chiu, Rossa W K; Lo, Y M Dennis

    2014-06-10

    Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring.

  9. Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing

    PubMed Central

    Yu, Stephanie C. Y.; Chan, K. C. Allen; Zheng, Yama W. L.; Jiang, Peiyong; Liao, Gary J. W.; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y.; Go, Attie T. J. I.; van Vugt, John M. G.; Minekawa, Ryoko; Oudejans, Cees B. M.; Nicolaides, Kypros H.; Chiu, Rossa W. K.; Lo, Y. M. Dennis

    2014-01-01

    Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring. PMID:24843150

  10. Induction of a Cellular DNA Damage Response by Porcine Circovirus Type 2 Facilitates Viral Replication and Mediates Apoptotic Responses

    PubMed Central

    Wei, Li; Zhu, Shanshan; Wang, Jing; Quan, Rong; Yan, Xu; Li, Zixue; Hou, Lei; Wang, Naidong; Yang, Yi; Jiang, Haijun; Liu, Jue

    2016-01-01

    Cellular DNA damage response (DDR) triggered by infection of DNA viruses mediate cell cycle checkpoint activation, DNA repair, or apoptosis induction. In the present study, infection of porcine circovirus type 2 (PCV2), which serves as a major etiological agent of PCV2-associated diseases (PCVAD), was found to elicit a DNA damage response (DDR) as observed by the phosphorylation of H2AX and RPA32 following infection. The response requires active viral replication, and all the ATM (ataxia telangiectasia-mutated kinase), ATR (ATM- and Rad3-related kinase), and DNA-PK (DNA-dependent protein kinase) are the transducers of the DDR signaling events in the PCV2-infected cells as demonstrated by the phosphorylation of ATM, ATR, and DNA-PK signalings as well as reductions in their activations after treatment with specific kinase inhibitors. Inhibitions of ATM, ATR, and DNA-PK activations block viral replication and prevent apoptotic responses as observed by decreases in cleaved poly-ADP ribose polymerase (PARP) and caspase-3 as well as fragmented DNA following PCV2 infection. These results reveal that PCV2 is able to exploit the cellular DNA damage response machinery for its own efficient replication and for apoptosis induction, further extending our understanding for the molecular mechanism of PCV2 infection. PMID:27982097

  11. Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

    PubMed

    Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

    2018-03-12

    Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death mechanisms.

  12. Atomic Force Microscopy Studies on DNA Structural Changes Induced by Vincristine Sulfate and Aspirin

    NASA Astrophysics Data System (ADS)

    Zhu, Yi; Zeng, Hu; Xie, Jianming; Ba, Long; Gao, Xiang; Lu, Zuhong

    2004-04-01

    We report that atomic force microscopy (AFM) studies on structural variations of a linear plasmid DNA interact with various concentrations of vincristine sulfate and aspirin. The different binding images show that vincrinstine sulfate binding DNA chains caused some loops and cleavages of the DNA fragments, whereas aspirin interaction caused the width changes and conformational transition of the DNA fragments. Two different DNA structural alternations could be explained by the different mechanisms of the interactions with these two components. Our work indicates that the AFM is a powerful tool in studying the interaction between DNA and small molecules.

  13. Differential Inflammatory-Response Kinetics of Human Keratinocytes upon Cytosolic RNA- and DNA-Fragment Induction.

    PubMed

    Danis, Judit; Janovák, Luca; Gubán, Barbara; Göblös, Anikó; Szabó, Kornélia; Kemény, Lajos; Bata-Csörgő, Zsuzsanna; Széll, Márta

    2018-03-08

    Keratinocytes are non-professional immune cells contributing actively to innate immune responses partially by reacting to a wide range of molecular patterns by activating pattern recognition receptors. Cytosolic nucleotide fragments as pathogen- or self-derived trigger factors are activating inflammasomes and inducing anti-viral signal transduction pathways as well as inducing expression of inflammatory cytokines. We aimed to compare the induced inflammatory reactions in three keratinocyte cell types-normal human epidermal keratinocytes, the HaCaT cell line and the HPV-KER cell line-upon exposure to the synthetic RNA and DNA analogues poly(I:C) and poly(dA:dT) to reveal the underlying signaling events. Both agents induced the expression of interleukin-6 and tumor necrosis factor α in all cell types; however, notable kinetic and expression level differences were found. Western blot analysis revealed rapid activation of the nuclear factor κB (NF-κB), mitogen activated protein kinase and signal transducers of activator of transcription (STAT) signal transduction pathways in keratinocytes upon poly(I:C) treatment, while poly(dA:dT) induced slower activation. Inhibition of NF-κB, p38, STAT-1 and STAT-3 signaling resulted in decreased cytokine expression, whereas inhibition of mitogen-activated protein kinase kinase 1/2 (MEK1/2) signaling showed a negative feedback role in both poly(I:C)- and poly(dA:dT)-induced cytokine expression. Based on our in vitro results nucleotide fragments are able to induce inflammatory reactions in keratinocytes, but with different rate and kinetics of cytokine expression, explained by faster activation of signaling routes by poly(I:C) than poly(dA:dT).

  14. Differential Inflammatory-Response Kinetics of Human Keratinocytes upon Cytosolic RNA- and DNA-Fragment Induction

    PubMed Central

    Danis, Judit; Janovák, Luca; Gubán, Barbara; Göblös, Anikó; Szabó, Kornélia; Bata-Csörgő, Zsuzsanna; Széll, Márta

    2018-01-01

    Keratinocytes are non-professional immune cells contributing actively to innate immune responses partially by reacting to a wide range of molecular patterns by activating pattern recognition receptors. Cytosolic nucleotide fragments as pathogen- or self-derived trigger factors are activating inflammasomes and inducing anti-viral signal transduction pathways as well as inducing expression of inflammatory cytokines. We aimed to compare the induced inflammatory reactions in three keratinocyte cell types—normal human epidermal keratinocytes, the HaCaT cell line and the HPV-KER cell line—upon exposure to the synthetic RNA and DNA analogues poly(I:C) and poly(dA:dT) to reveal the underlying signaling events. Both agents induced the expression of interleukin-6 and tumor necrosis factor α in all cell types; however, notable kinetic and expression level differences were found. Western blot analysis revealed rapid activation of the nuclear factor κB (NF-κB), mitogen activated protein kinase and signal transducers of activator of transcription (STAT) signal transduction pathways in keratinocytes upon poly(I:C) treatment, while poly(dA:dT) induced slower activation. Inhibition of NF-κB, p38, STAT-1 and STAT-3 signaling resulted in decreased cytokine expression, whereas inhibition of mitogen-activated protein kinase kinase 1/2 (MEK1/2) signaling showed a negative feedback role in both poly(I:C)- and poly(dA:dT)-induced cytokine expression. Based on our in vitro results nucleotide fragments are able to induce inflammatory reactions in keratinocytes, but with different rate and kinetics of cytokine expression, explained by faster activation of signaling routes by poly(I:C) than poly(dA:dT). PMID:29518010

  15. Randomized DNA libraries construction tool: a new 3-bp 'frequent cutter' TthHB27I/sinefungin endonuclease with chemically-induced specificity.

    PubMed

    Krefft, Daria; Papkov, Aliaksei; Prusinowski, Maciej; Zylicz-Stachula, Agnieszka; Skowron, Piotr M

    2018-05-11

    Acoustic or hydrodynamic shearing, sonication and enzymatic digestion are used to fragment DNA. However, these methods have several disadvantages, such as DNA damage, difficulties in fragmentation control, irreproducibility and under-representation of some DNA segments. The DNA fragmentation tool would be a gentle enzymatic method, offering cleavage frequency high enough to eliminate DNA fragments distribution bias and allow for easy control of partial digests. Only three such frequently cleaving natural restriction endonucleases (REases) were discovered: CviJI, SetI and FaiI. Therefore, we have previously developed two artificial enzymatic specificities, cleaving DNA approximately every ~ 3-bp: TspGWI/sinefungin (SIN) and TaqII/SIN. In this paper we present the third developed specificity: TthHB27I/SIN(SAM) - a new genomic tool, based on Type IIS/IIC/IIG Thermus-family REases-methyltransferases (MTases). In the presence of dimethyl sulfoxide (DMSO) and S-adenosyl-L-methionine (SAM) or its analogue SIN, the 6-bp cognate TthHB27I recognition sequence 5'-CAARCA-3' is converted into a combined 3.2-3.0-bp 'site' or its statistical equivalent, while a cleavage distance of 11/9 nt is retained. Protocols for various modes of limited DNA digestions were developed. In the presence of DMSO and SAM or SIN, TthHB27I is transformed from rare 6-bp cutter to a very frequent one, approximately 3-bp. Thus, TthHB27I/SIN(SAM) comprises a new tool in the very low-represented segment of such prototype REases specificities. Moreover, this modified TthHB27I enzyme is uniquely suited for controlled DNA fragmentation, due to partial DNA cleavage, which is an inherent feature of the Thermus-family enzymes. Such tool can be used for quasi-random libraries generation as well as for other DNA manipulations, requiring high frequency cleavage and uniform distribution of cuts along DNA.

  16. The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

    PubMed

    Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

    2018-03-23

    To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p < 0.001 for swim-up; and 41.85 ± 22.04 vs. 38.79 ± 22.30, p = 0.160 for gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p < 0.001 for swim-up and 46.61 ± 19.38 vs. 44.03 ± 20.87, p = 0.470 for gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

  17. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    NASA Astrophysics Data System (ADS)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  18. Abstracts of papers presented at the 8th workshop of the Virology Section of the Deutsche Gesellschaft für Hygiene und Mikro-biologie, Würzburg, March 17-19, 1983.

    PubMed

    1983-09-01

    17 adenovirus strains were found to be antigenically related to prototype Ad 15 by neutralization. No relationship to Ad 15, but to Ad 9 could be detected by hemagglutination-inhibition; we therefore named them Ad 15/H9 intermediate strains. After analysis of the genome by five different restriction enzymes, the fragment patterns obtained deviated widely from the prototype Ad 15, but only slightly from Ad 9. Differences could also be observed among the variants. After digestion by five restriction enzymes, altogether six genome types could be established among the 17 intermediate strains. To map the variations on the genome of the 15/H9 strains, two methods were employed: the double digestion of the DNA and DNA fragments together with the determination of the terminal fragments made it possible to construct a physical map. The second method depends on a particularity of adenoviruses: the DNA is covalently linked with a 55 kD protein at the 5' terminus. After digestion of the DNA, which does contain this protein, the terminal DNA fragments do not migrate into the agarose gel; after an additional digestion with pronase B, they do migrate into the gel. Thus the terminal fragments were determined by comparing the fragment patterns with and without previous pronase B treatment.

  19. Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

    PubMed

    Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

    2017-03-01

    Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

  20. Preparation and Analysis of Positioned Mononucleosomes

    PubMed Central

    Kulaeva, Olga; Studitsky, Vasily M.

    2016-01-01

    Short DNA fragments containing single nucleosomes have been extensively employed as simple model experimental systems for analysis of many intranuclear processes, including binding of proteins to nucleosomes, covalent histone modifications, transcription, DNA repair and ATP-dependent chromatin remodeling. Here we describe several recently developed procedures for obtaining and analysis of mononucleosomes assembled on 200–350-bp DNA fragments. PMID:25827872

  1. [Construction of large fragment metagenome library of natural mangrove soil].

    PubMed

    Jiang, Yun-Xia; Zheng, Tian-Ling

    2007-11-01

    Applying our optimized direct extraction method, the percentage of large fragment DNA in the total extracted mangrove soil DNA was significant increased. The large fragment metagenome library derived from natural mangrove soil over four seasons was successfully constructed by the optimized DNA extraction and electro elution purification method. All of the clones had recombinant Cosmids and each differed in their fragment profiles when Cosmid DNA was extracted from 12 randomly picked colonies and digested with BamHI. The average insert size for this library was larger than 35 kbp. This culturing-independent library at least encompassed 335 Mbp valuable genetic information of mangrove soil microbes. It allowed mining of valuable intertidal microbial resource to become a reality. It is a recommended method for those researchers who have still not circumvented the large insert environmental libraries or for those beginning research in this field, so as to avoid them attempting repetitive, fussy work.

  2. Nucleic acid isolation

    DOEpatents

    Longmire, J.L.; Lewis, A.K.; Hildebrand, C.E.

    1988-01-21

    A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduces the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without effect on the protocol.

  3. Repair of x-ray-induced DNA double-strand breaks in specific Not I restriction fragments in human fibroblasts: joining of correct and incorrect ends

    NASA Technical Reports Server (NTRS)

    Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1995-01-01

    An assay that allows measurement of absolute induction frequencies for DNA double-strand breaks (dsbs) in defined regions of the genome and that quantitates rejoining of correct DNA ends has been used to study repair of dsbs in normal human fibroblasts after x-irradiation. The approach involves hybridization of single-copy DNA probes to Not I restriction fragments separated according to size by pulsed-field gel electrophoresis. Induction of dsbs is quantitated from the decrease in the intensity of the hybridizing restriction fragment and an accumulation of a smear below the band. Rejoining of dsbs results in reconstitution of the intact restriction fragment only if correct DNA ends are joined. By comparing results from this technique with results from a conventional electrophoresis assay that detects all rejoining events, it is possible to quantitate the misrejoining frequency. Three Not I fragments on the long arm of chromosome 21 were investigated with regard to dsb induction, yielding an identical induction rate of 5.8 X 10(-3) break per megabase pair per Gy. Correct dsb rejoining was measured for two of these Not I fragments after initial doses of 80 and 160 Gy. The misrejoining frequency was about 25% for both fragments and was independent of dose. This result appears to be representative for the whole genome as shown by analysis of the entire Not I fragment distribution. The correct rejoining events primarily occurred within the first 2 h, while the misrejoining kinetics included a much slower component, with about half of the events occurring between 2 and 24 h. These misrejoining kinetics are similar to those previously reported for production of exchange aberrations in interphase chromosomes.

  4. Evaluation of a Multiplex PCR Assay for the Identification of Salmonella Serovars Enteritidis and Typhimurium Using Retail and Abattoir Samples.

    PubMed

    Ogunremi, Dele; Nadin-Davis, Susan; Dupras, Andrée Ann; Márquez, Imelda Gálvan; Omidi, Katayoun; Pope, Louise; Devenish, John; Burke, Teresa; Allain, Ray; Leclair, Daniel

    2017-02-01

    A multiplex PCR was developed to identify the two most common serovars of Salmonella causing foodborne illness in Canada, namely, serovars Enteritidis and Typhimurium. The PCR was designed to amplify DNA fragments from four Salmonella genes, namely, invA gene (211-bp fragment), iroB gene (309-bp fragment), Typhimurium STM 4497 (523-bp fragment), and Enteritidis SE147228 (612-bp fragment). In addition, a 1,026-bp ribosomal DNA (rDNA) fragment universally present in bacterial species was included in the assay as an internal control fragment. The detection rate of the PCR was 100% among Salmonella Enteritidis (n = 92) and Salmonella Typhimurium (n = 33) isolates. All tested Salmonella isolates (n = 194) were successfully identified based on the amplification of at least one Salmonella -specific DNA fragment. None of the four Salmonella DNA amplicons were detected in any of the non- Salmonella isolates (n = 126), indicating an exclusivity rate of 100%. When applied to crude extracts of 2,001 field isolates of Salmonella obtained during the course of a national microbiological baseline study in broiler chickens and chicken products sampled from abattoir and retail outlets, 163 isolates, or 8.1%, tested positive for Salmonella Enteritidis and another 80 isolates, or 4.0%, tested as Salmonella Typhimurium. All isolates identified by serological testing as Salmonella Enteritidis in the microbiological study were also identified by using the multiplex PCR. The new test can be used to identify or confirm pure isolates of the two serovars and is also amenable for integration into existing culture procedures for accurate detection of Salmonella colonies.

  5. Towards optimized methods to study viral impacts on soil microbial carbon cycling

    NASA Astrophysics Data System (ADS)

    Trubl, G. G.; Roux, S.; Jang, H. B.; Solonenko, N.; Sullivan, M. B.; Rich, V. I.

    2016-12-01

    Permafrost contains 50% of global soil carbon and is rapidly thawing. While the fate of this carbon is currently unknown, it will undoubtedly be shaped by microbes and their associated viruses, which modulate host activities via mortality and metabolic control. However, little is known about soil viruses generally and their impact on terrestrial biogeochemistry; this is partially due to the presence of inhibitory substances (e.g. humic acids) in soils that interfere with sample processing and sequence-based metagenomics surveys. To address this problem, we examined viral populations in three different peat soils along a permafrost thaw gradient. These samples yielded low viral DNA recoveries, and shallow metagenomic sequencing, but still resulted in the recovery of 40 viral genome fragments. Genome- and network-based classification suggested that these new references represented 11 viral clusters, and ecological patterns (based upon non-redundant fragment recruitment) showed that viral populations were distinct in each habitat. Although only 31% of the genes could be functionally classified, pairwise genome comparisons classified 63% of the viruses taxonomically. Additionally, comparison of the 40 viral genome fragments to 53 previously recovered fragments from the same site showed no overlap, suggesting only a small portion of the resident viral community has been sampled. A follow-up experiment was performed to remove more humics during extraction and thereby obtain better viral metagenomes. Three DNA extraction protocols were tested (CTAB, PowerSoil, and Wizard columns) and the DNA was further purified with an AMPure clean-up. The PowerSoil kit maximized DNA yield (3x CTAB and 6x Wizard), and yielded the purest DNA (based on NanoDrop 260:230 ratio). Given the important roles of viruses in biogeochemical cycles in better-studied systems, further research and humic-removal optimization on these thawing permafrost-associated viral communities is needed to clarify their involvement in carbon cycle feedbacks.

  6. Real-time Tracking of DNA Fragment Separation by Smartphone.

    PubMed

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  7. The anti-human immunodeficiency virus agent 3'-fluorothymidine induces DNA damage and apoptosis in human lymphoblastoid cells.

    PubMed Central

    Sundseth, R; Joyner, S S; Moore, J T; Dornsife, R E; Dev, I K

    1996-01-01

    Patients infected with the human immunodeficiency virus experienced severe hematopoietic toxicity after treatment with the deoxynucleoside analog 3'-fluorothymidine (FLT). Using several methods for the analysis of genome integrity, including histochemical staining of the 3' ends of DNA and both conventional and pulsed-field agarose gel electrophoresis, we demonstrated that FLT caused extensive DNA fragmentation in CEM cells that was not observed when these cells were treated with other, less toxic thymidine analogs. In addition, a distinctive pattern of small DNA fragments that is characteristic of cells in the process of programmed cell death was observed in the genomic DNA of CEM cells treated with FLT. We conclude that FLT induces DNA fragmentation and apoptosis in a human cell line of hematopoietic origin, and we offer this observation as a possible explanation for the severe toxicity of FLT observed in vivo. PMID:8834875

  8. Useful DNA polymorphisms are identified by snapback, a midrepetitive element in Tribolium castaneum.

    PubMed

    Stuart, J J; De Gortari, M J; Hall, P S; Maxwell, M E; Mocelin, G; Brown, S J; Muir, W M

    1996-06-01

    The red flour bettle, Tribolium castaneum, is both a pest of stored grain products and an important experimental organism. To improve its facility as a genetic model, we are developing DNA fingerprinting methods for this insect. A Tribolium DNA fragment, snapback-1 (SBI), identified among sequences that reassociate before a Cot of 0.03 mol.s/L, was found to produce a banding pattern in restriction endonuclease digested genomic DNA that is characteristic of a midrepetitive element. DNA fingerprints of individual beetles demonstrated that unvarying inherited DNA polymorphism is revealed, and that polymorphism is inherited in a dominant Mendelian fashion. Linkage between bands was minimal. The sequence of SBI was determined, and hybridization experiments indicated that SBI is a fragment of a larger midrepetitive element. Fingerprinting individuals with known inbreeding coefficients indicated that SBI loci have relatively high mutation rates. The possibility that SBI is a fragment of a transposable element is discussed.

  9. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa.

    PubMed

    Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P

    2015-11-02

    The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5' end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5' but not 3' end, explaining how Rpa regulates cleavage polarity.

  10. Anethole induces apoptotic cell death accompanied by reactive oxygen species production and DNA fragmentation in Aspergillus fumigatus and Saccharomyces cerevisiae.

    PubMed

    Fujita, Ken-Ichi; Tatsumi, Miki; Ogita, Akira; Kubo, Isao; Tanaka, Toshio

    2014-02-01

    trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum, and antimicrobial activity that is weaker than that of other antibiotics on the market. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to possess significant synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the antifungal mechanism of anethole has not been completely determined. We found that anethole stimulated cell death of a human opportunistic pathogenic fungus, Aspergillus fumigatus, in addition to S. cerevisiae. The anethole-induced cell death was accompanied by reactive oxygen species production, metacaspase activation, and DNA fragmentation. Several mutants of S. cerevisiae, in which genes related to the apoptosis-initiating execution signals from mitochondria were deleted, were resistant to anethole. These results suggest that anethole-induced cell death could be explained by oxidative stress-dependent apoptosis via typical mitochondrial death cascades in fungi, including A. fumigatus and S. cerevisiae. © 2014 FEBS.

  11. The effect of two pre-cryopreservation single layer colloidal centrifugation protocols in combination with different freezing extenders on the fragmentation dynamics of thawed equine sperm DNA

    PubMed Central

    2012-01-01

    Background Variability among stallions in terms of semen cryopreservation quality renders it difficult to arrive at a standardized cryopreservation method. Different extenders and processing techniques (such us colloidal centrifugation) are used in order to optimize post-thaw sperm quality. Sperm chromatin integrity analysis is an effective tool for assessing such quality. The aim of the present study was to compare the effect of two single layer colloidal centrifugation protocols (prior to cryopreservation) in combination with three commercial freezing extenders on the post-thaw chromatin integrity of equine sperm samples at different post-thaw incubation (37°C) times (i.e., their DNA fragmentation dynamics). Results Post-thaw DNA fragmentation levels in semen samples subjected to either of the colloidal centrifugation protocols were significantly lower (p<0.05) immediately after thawing and after 4 h of incubation at 37°C compared to samples that underwent standard (control) centrifugation. The use of InraFreeze® extender was associated with significantly less DNA fragmentation than the use of Botu-Crio® extender at 6 h of incubation, and than the use of either Botu-Crio® or Gent® extender at 24 h of incubation (p<0.05). Conclusions These results suggest that single layer colloidal centrifugation performed with extended or raw semen prior to cryopreservation reduces DNA fragmentation during the first four hours after thawing. Further studies are needed to determine the influence of freezing extenders on equine sperm DNA fragmentation dynamics. PMID:23217215

  12. Sperm deoxyribonucleic acid damage in normozoospermic men is related to age and sperm progressive motility.

    PubMed

    Belloc, Stephanie; Benkhalifa, Moncef; Cohen-Bacrie, Martine; Dalleac, Alain; Amar, Edouard; Zini, Armand

    2014-06-01

    To evaluate sperm DNA fragmentation in normozoospermic male partners of couples undergoing infertility evaluation. Retrospective cohort study. Clinical andrology laboratory. A total of 1,974 consecutive normozoospermic men selected from a larger cohort of 4,345 consecutive, nonazoospermic men presenting for infertility evaluation. None. Clinical parameters, conventional semen parameters, and sperm DNA fragmentation assessed by flow cytometry-based TUNEL assay and reported as percent sperm DNA fragmentation (%SDF). The mean (± SD) %SDF and the proportion of men with high %SDF (>30%) were significantly lower in the normozoospermic compared with the entire cohort of 4,345 evaluable infertile men (17.6% ± 10.1% vs. 20.7% ± 12.4% and 11% vs. 20%, respectively). In the group of 1,974 normozoospermic men, %SDF was positively correlated with paternal age (r = 0.17) and inversely correlated with progressive motility (r = -0.26). In the subset of normozoospermic men with sperm parameters above the 50th percentile (≥ 73 × 10(6) sperm/mL, ≥ 55% progressive motility, and ≥ 14% normal forms, World Health Organization 2010 guidelines), 5% (4 of 83) had elevated %SDF (>30%). In this large cohort of normozoospermic men presenting for infertility evaluation, DNA fragmentation level is related to sperm motility and paternal age, and 11% of these men have high levels of sperm DNA fragmentation. Furthermore, the data indicate that a nonnegligible proportion (5%) of normozoospermic men with high-normal sperm parameters may also have significant sperm DNA fragmentation. Copyright © 2014 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  13. Origin and quantification of circulating DNA in mice with human colorectal cancer xenografts

    PubMed Central

    Thierry, Alain R.; Mouliere, Florent; Gongora, Celine; Ollier, Jeremy; Robert, Bruno; Ychou, Marc; Del Rio, Maguy; Molina, Franck

    2010-01-01

    Although circulating DNA (ctDNA) could be an attractive tool for early cancer detection, diagnosis, prognosis, monitoring or prediction of response to therapies, knowledge on its origin, form and rate of release is poor and often contradictory. Here, we describe an experimental system to systematically examine these aspects. Nude mice were xenografted with human HT29 or SW620 colorectal carcinoma (CRC) cells and ctDNA was analyzed by Q–PCR with highly specific and sensitive primer sets at different times post-graft. We could discriminate ctDNA from normal (murine) cells and from mutated and non-mutated tumor (human) cells by using species-specific KRAS or PSAT1 primers and by assessing the presence of the BRAF V600E mutation. The concentration of human (mutated and non-mutated) ctDNA increased significantly with tumor growth. Conversely, and differently from previous studies, low, constant level of mouse ctDNA was observed, thus facilitating the study of mutated and non-mutated tumor derived ctDNA. Finally, analysis of ctDNA fragmentation confirmed the predominance of low-size fragments among tumor ctDNA from mice with bigger tumors. Higher ctDNA fragmentation was also observed in plasma samples from three metastatic CRC patients in comparison to healthy individuals. Our data confirm the predominance of mononucleosome-derived fragments in plasma from xenografted animals and, as a consequence, of apoptosis as a source of ctDNA, in particular for tumor-derived ctDNA. Altogether, our results suggest that ctDNA features vary during CRC tumor development and our experimental system might be a useful tool to follow such variations. PMID:20494973

  14. i-rDNA: alignment-free algorithm for rapid in silico detection of ribosomal gene fragments from metagenomic sequence data sets.

    PubMed

    Mohammed, Monzoorul Haque; Ghosh, Tarini Shankar; Chadaram, Sudha; Mande, Sharmila S

    2011-11-30

    Obtaining accurate estimates of microbial diversity using rDNA profiling is the first step in most metagenomics projects. Consequently, most metagenomic projects spend considerable amounts of time, money and manpower for experimentally cloning, amplifying and sequencing the rDNA content in a metagenomic sample. In the second step, the entire genomic content of the metagenome is extracted, sequenced and analyzed. Since DNA sequences obtained in this second step also contain rDNA fragments, rapid in silico identification of these rDNA fragments would drastically reduce the cost, time and effort of current metagenomic projects by entirely bypassing the experimental steps of primer based rDNA amplification, cloning and sequencing. In this study, we present an algorithm called i-rDNA that can facilitate the rapid detection of 16S rDNA fragments from amongst millions of sequences in metagenomic data sets with high detection sensitivity. Performance evaluation with data sets/database variants simulating typical metagenomic scenarios indicates the significantly high detection sensitivity of i-rDNA. Moreover, i-rDNA can process a million sequences in less than an hour on a simple desktop with modest hardware specifications. In addition to the speed of execution, high sensitivity and low false positive rate, the utility of the algorithmic approach discussed in this paper is immense given that it would help in bypassing the entire experimental step of primer-based rDNA amplification, cloning and sequencing. Application of this algorithmic approach would thus drastically reduce the cost, time and human efforts invested in all metagenomic projects. A web-server for the i-rDNA algorithm is available at http://metagenomics.atc.tcs.com/i-rDNA/

  15. The chloroplast and mitochondrial DNA type are correlated with the nuclear composition of somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia.

    PubMed

    Wolters, A M; Koornneef, M; Gilissen, L J

    1993-09-01

    This paper describes the analysis of chloroplast (cp) DNA and mitochondrial (mt) DNA in 21 somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia by means of Southern-blot hybridization. Each of these calli contained only one type of cpDNA; 14 had the N. plumbaginifolia (Np) type and seven the S. tuberosum (St) type. N. plumbaginifolia cpDNA was present in hybrids previously shown to contain predominantly N. plumbaginifolia chromosomes whereas hybrids in which S. tuberosum chromosomes predominated possessed cpDNA from potato. We have analyzed the mtDNA of these 21 somatic hybrid calli using four restriction enzyme/probe combinations. Most fusion products had only, or mostly, mtDNA fragments from the parent that predominated in the nucleus. The hybrids containing mtDNA fragments from only one parent (and new fragments) also possessed chloroplasts from the same species. The results suggest the existence of a strong nucleo-cytoplasmic incongruity which affects the genome composition of somatic hybrids between distantly related species.

  16. Role of the hydrophilic channels of simian virus 40 T-antigen helicase in DNA replication.

    PubMed

    Wang, Weiping; Manna, David; Simmons, Daniel T

    2007-05-01

    The simian virus 40 (SV40) hexameric helicase consists of a central channel and six hydrophilic channels located between adjacent large tier domains within each hexamer. To study the function of the hydrophilic channels in SV40 DNA replication, a series of single-point substitutions were introduced at sites not directly involved in protein-protein contacts. The mutants were characterized biochemically in various ways. All mutants oligomerized normally in the absence of DNA. Interestingly, 8 of the 10 mutants failed to unwind an origin-containing DNA fragment and nine of them were totally unable to support SV40 DNA replication in vitro. The mutants fell into four classes based on their biochemical properties. Class A mutants bound DNA normally and had normal ATPase and helicase activities but failed to unwind origin DNA and support SV40 DNA replication. Class B mutants were compromised in single-stranded DNA and origin DNA binding at low protein concentrations. They were defective in helicase activity and unwinding of the origin and in supporting DNA replication. Class C and D mutants possessed higher-than-normal single-stranded DNA binding activity at low protein concentrations. The class C mutants failed to separate origin DNA and support DNA replication. The class D mutants unwound origin DNA normally but were compromised in their ability to support DNA replication. Taken together, these results suggest that the hydrophilic channels have an active role in the unwinding of SV40 DNA from the origin and the placement of the resulting single strands within the helicase.

  17. Two-color, 30 second microwave-accelerated Metal-Enhanced Fluorescence DNA assays: a new Rapid Catch and Signal (RCS) technology.

    PubMed

    Dragan, Anatoliy I; Golberg, Karina; Elbaz, Amit; Marks, Robert; Zhang, Yongxia; Geddes, Chris D

    2011-03-07

    For analyses of DNA fragment sequences in solution we introduce a 2-color DNA assay, utilizing a combination of the Metal-Enhanced Fluorescence (MEF) effect and microwave-accelerated DNA hybridization. The assay is based on a new "Catch and Signal" technology, i.e. the simultaneous specific recognition of two target DNA sequences in one well by complementary anchor-ssDNAs, attached to silver island films (SiFs). It is shown that fluorescent labels (Alexa 488 and Alexa 594), covalently attached to ssDNA fragments, play the role of biosensor recognition probes, demonstrating strong response upon DNA hybridization, locating fluorophores in close proximity to silver NPs, which is ideal for MEF. Subsequently the emission dramatically increases, while the excited state lifetime decreases. It is also shown that 30s microwave irradiation of wells, containing DNA molecules, considerably (~1000-fold) speeds up the highly selective hybridization of DNA fragments at ambient temperature. The 2-color "Catch and Signal" DNA assay platform can radically expedite quantitative analysis of genome DNA sequences, creating a simple and fast bio-medical platform for nucleic acid analysis. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

    PubMed

    Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

    2018-02-01

    Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

  19. Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

    PubMed Central

    2011-01-01

    Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341

  20. Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence.

    PubMed

    Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr

    2011-08-24

    Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.

  1. Biomonitoring of the Genotoxic and Hepatotoxic Effects and Oxidative Stress Potentials of Itraconazole in Pregnant Rats.

    PubMed

    El-Shershaby, Abdel-Fattah; Dakrory, Ahmed I; El-Dakdoky, Mai H; Ibrahim, Jehane; Kassem, Fatma

    2015-04-01

    Pregnant women are more susceptible to both vaginal colonization and infection by yeast. One hundred million fungal infected patients have been treated worldwide with itraconazole (Caputo, 2003. Itraconazole was administrated orally to pregnant rats at doses of 75, 100, or 150 mg/kg during gestational days (GD) 1 to 7 or GD 8 to 14 or GD 14 to 20. The genotoxicity and hepatotoxicity of the antifungal drug itraconazole were assessed during different periods of pregnancy using different methods. It was found that itraconazole was a genotoxic drug for both mothers and fetuses. This finding was observed via significant elevation in the estimated comet assay parameters (percentage of fragmented DNA, tail moment, and olive moment), percentage of fragmented DNA measured by diphenylamine assay and mixed smearing and laddering of DNA fragments of liver samples. In addition, itraconazole caused significant elevation in the level of hepatic malondialdehyde and depletion in the catalase activity and glutathione level. Furthermore, itraconazole induced histopathological alterations in the hepatic tissues of both mothers and fetuses. These findings indicate that itraconazole administration at doses of 75, 100, or 150 mg/kg during pregnancy induced maternal and fetal toxicity that could be induced by the genotoxicity and the oxidative damage. © 2015 Wiley Periodicals, Inc.

  2. Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase.

    PubMed

    Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H

    2014-01-01

    Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%.

  3. Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

    PubMed Central

    Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

    2014-01-01

    Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

  4. Multiple tag labeling method for DNA sequencing

    DOEpatents

    Mathies, Richard A.; Huang, Xiaohua C.; Quesada, Mark A.

    1995-01-01

    A DNA sequencing method described which uses single lane or channel electrophoresis. Sequencing fragments are separated in said lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radio-isotope labels.

  5. Nucleotide exchange and excision technology DNA shuffling and directed evolution.

    PubMed

    Speck, Janina; Stebel, Sabine C; Arndt, Katja M; Müller, Kristian M

    2011-01-01

    Remarkable success in optimizing complex properties within DNA and proteins has been achieved by directed evolution. In contrast to various random mutagenesis methods and high-throughput selection methods, the number of available DNA shuffling procedures is limited, and protocols are often difficult to adjust. The strength of the nucleotide exchange and excision technology (NExT) DNA shuffling described here is the robust, efficient, and easily controllable DNA fragmentation step based on random incorporation of the so-called 'exchange nucleotides' by PCR. The exchange nucleotides are removed enzymatically, followed by chemical cleavage of the DNA backbone. The oligonucleotide pool is reassembled into full-length genes by internal primer extension, and the recombined gene library is amplified by standard PCR. The technique has been demonstrated by shuffling a defined gene library of chloramphenicol acetyltransferase variants using uridine as fragmentation defining exchange nucleotide. Substituting 33% of the dTTP with dUTP in the incorporation PCR resulted in shuffled clones with an average parental fragment size of 86 bases and revealed a mutation rate of only 0.1%. Additionally, a computer program (NExTProg) has been developed that predicts the fragment size distribution depending on the relative amount of the exchange nucleotide.

  6. DNA Extraction from Museum Specimens of Parasitic Hymenoptera

    PubMed Central

    Andersen, Jeremy C.; Mills, Nicholas J.

    2012-01-01

    At the same time that molecular researchers are improving techniques to extract DNA from museum specimens, this increased demand for access to museum specimens has created tension between the need to preserve specimens for maintaining collections and morphological research and the desire to conduct molecular analyses. To address these concerns, we examined the suitability of non-invasive DNA extraction techniques on three species of parasitic Hymenoptera (Braconidae), and test the effects of body size (parasitoid species), age (time since collection), and DNA concentration from each extract on the probability of amplifying meaningful fragments of two commonly used genetic loci. We found that age was a significant factor for determining the probability of success for sequencing both 28S and COI fragments. While the size of the braconid parasitoids significantly affected the total amount of extracted DNA, neither size nor DNA concentration were significant factors for the amplification of either gene region. We also tested several primer combinations of various lengths, but were unable to amplify fragments longer than ∼150 base pairs. These short fragments of 28S and COI were however sufficient for species identification, and for the discovery of within species genetic variation. PMID:23077493

  7. Telomeres, Reproductive Aging, and Genomic Instability During Early Development.

    PubMed

    Keefe, David L

    2016-12-01

    Implantation rate decreases and miscarriage rate increases with advancing maternal age. The oocyte must be the locus of reproductive aging because donation of oocytes from younger to older women abrogates the effects of aging on fecundity. Nuclear transfer experiments in a mouse model of reproductive aging show that the reproductive aging phenotype segregates with the nucleus rather than the cytoplasm. A number of factors within the nucleus have been hypothesized to mediate reproductive aging, including disruption of cohesions, reduced chiasma, aneuploidy, disrupted meiotic spindles, and DNA damage caused by chronic exposure to reactive oxygen species. We have proposed telomere attrition as a parsimonious way to explain these diverse effects of aging on oocyte function. Telomeres are repetitive sequences of DNA and associated proteins, which form a loop (t loop) at chromosome ends. Telomeres prevent the blunt end of DNA from triggering a DNA damage response. Previously, we showed that experimental telomere shortening phenocopies reproductive aging in mice. Telomere shortening causes reduced synapsis and chiasma, chromosome fusions, embryo arrest and fragmentation, and abnormal meiotic spindles. Telomere length of polar bodies predicts the fragmentation of human embryos. Telomerase, the reverse transcriptase capable of reconstituting shortened telomeres, is only minimally active in oocytes and preimplantation embryos. Intriguingly, during the first cell cycles following activation, telomeres robustly elongate via a DNA double-strand break mechanism called alternative lengthening of telomeres (ALTs). Alternative lengthening of telomere takes place even in telomerase-null mice. This mechanism of telomere elongation previously had been found only in cancer cells lacking telomerase activity. We propose that ALT elongates telomeres across generations but does so at the cost of extensive genomic instability in preimplantation embryos. © The Author(s) 2016.

  8. Protective Effect of Thymoquinone against Cyclophosphamide-Induced Hemorrhagic Cystitis through Inhibiting DNA Damage and Upregulation of Nrf2 Expression.

    PubMed

    Gore, Prashant R; Prajapati, Chaitali P; Mahajan, Umesh B; Goyal, Sameer N; Belemkar, Sateesh; Ojha, Shreesh; Patil, Chandragouda R

    2016-01-01

    Cyclophosphamide (CYP) induced hemorrhagic cystitis is a dose-limiting side effect involving increased oxidative stress, inflammatory cytokines and suppressed activity of nuclear factor related erythroid 2-related factor (Nrf2). Thymoquinone (TQ), an active constituent of Nigella sativa seeds, is reported to increase the expression of Nrf2, exert antioxidant action, and anti-inflammatory effects in the experimental animals. The present study was designed to explore the effects of TQ on CYP-induced hemorrhagic cystitis in Balb/c mice. Cystitis was induced by a single intraperitoneal injection of CYP (200 mg/kg). TQ was administered intraperitoneally at 5, 10 and 20 mg/kg doses twice a day, for three days before and three days after the CYP administration. The efficacy of TQ was determined in terms of the protection against the CYP-induced histological perturbations in the bladder tissue, reduction in the oxidative stress, and inhibition of the DNA fragmentation. Immunohistochemistry was performed to examine the expression of Nrf2. TQ protected against CYP-induced oxidative stress was evident from significant reduction in the lipid peroxidation, restoration of the levels of reduced glutathione, catalase and superoxide dismutase activities. TQ treatment significantly reduced the DNA damage evident as reduced DNA fragmentation. A significant decrease in the cellular infiltration, edema, epithelial denudation and hemorrhage were observed in the histological observations. There was restoration and rise in the Nrf2 expression in the bladder tissues of mice treated with TQ. These results confirm that, TQ ameliorates the CYP-induced hemorrhagic cystitis in mice through reduction in the oxidative stress, inhibition of the DNA damage and through increased expression of Nrf2 in the bladder tissues.

  9. Homo-trimerization is essential for the transcription factor function of Myrf for oligodendrocyte differentiation.

    PubMed

    Kim, Dongkyeong; Choi, Jin-Ok; Fan, Chuandong; Shearer, Randall S; Sharif, Mohamed; Busch, Patrick; Park, Yungki

    2017-05-19

    Myrf is a key transcription factor for oligodendrocyte differentiation and central nervous system myelination. We and others have previously shown that Myrf is generated as a membrane protein in the endoplasmic reticulum (ER), and that it undergoes auto-processing to release its N-terminal fragment from the ER, which enters the nucleus to work as a transcription factor. These previous studies allow a glimpse into the unusual complexity behind the biogenesis and function of the transcription factor domain of Myrf. Here, we report that Myrf N-terminal fragments assemble into stable homo-trimers before ER release. Consequently, Myrf N-terminal fragments are released from the ER only as homo-trimers. Our re-analysis of a previous genetic screening result in Caenorhabditis elegans shows that homo-trimerization is essential for the biological functions of Myrf N-terminal fragment, and that the region adjacent to the DNA-binding domain is pivotal to its homo-trimerization. Further, our computational analysis uncovered a novel homo-trimeric DNA motif that mediates the homo-trimeric DNA binding of Myrf N-terminal fragments. Importantly, we found that homo-trimerization defines the DNA binding specificity of Myrf N-terminal fragments. In sum, our study elucidates the molecular mechanism governing the biogenesis and function of Myrf N-terminal fragments and its physiological significance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Methamphetamine induces autophagy and apoptosis in a mesencephalic dopaminergic neuronal culture model: role of cathepsin-D in methamphetamine-induced apoptotic cell death.

    PubMed

    Kanthasamy, Arthi; Anantharam, V; Ali, Syed F; Kanthasamy, A G

    2006-08-01

    Autophagy is a phylogenetically conserved process that plays a critical role in the degradation of oxidatively damaged proteins and organelle turnover. The role of oxidative stress and apoptosis in methamphetamine (METH)-induced neurotoxicity is well known; however, the potential contribution of autophagy to METH-induced oxidative damage in dopaminergic neuronal systems remains unclear. The goals of the present article were twofold: (a) to develop an in vitro dopaminergic cell culture model to study cellular and molecular mechanisms underlying METH-induced autophagy and apoptosis, and (b) to determine whether lysosomal protease cathepsin-D activation, resulting from the loss of lysosomal membrane integrity, contributes to METH-induced apoptosis. To accomplish these goals, we characterized morphological and biochemical changes in an immortalized mesencephalic dopaminergic neuronal cell line (N27 cells) following treatment with METH. Exposure of METH (2 mM) to N27 cells resulted in the appearance of cytoplasmic vacuolar structures reminiscent of autophagic vacuoles within 3 h. In order to ascertain the identity of the vacuolar structures that are formed following METH exposure, immunohistochemical staining for markers of autophagy were performed. LAMP 2, a classical marker of autophagolysosomes, revealed an extensive punctuate pattern of distribution on the vacuolar membrane surface, with exclusive localization in the cytoplasm. Additionally, using DNA fragmentation analysis we showed a dose-dependent increase in fragmented DNA in METH treated N27 cells. Since METH-induced autophagy preceded DNA fragmentation, we tested whether dysfunction of the autophagolysosomal system contributes to nuclear damage. Immunofluorescence studies with cathepsin-d demonstrated a granular pattern of staining in untreated cells, whereas an increased cathepsin- D immunoreactivity with a globular pattern of staining was observed in METH-treated cells. Nevertheless, blockade of cathepsin-D activation by pepstatin-A, cathepsin-D inhibitor, failed to alter METH-induced DNA fragmentation. Collectively, these results demonstrate that N27 dopaminergic neuronal cell model may serve as an excellent in vitro model to study the mechanisms of METH-induced autophagy and apoptosis. Furthermore, it is less likely that cathepsin-D may serve as a trigger for the induction of apoptosis subsequent to exposure of N27 dopaminergic neuronal cells to METH.

  11. Studies on DNA damage: discordant responses of rate of DNA disentanglement (viscosimetrically evaluated) and alkaline elution rate, obtained for several compounds. Possible explanations of the discrepancies.

    PubMed

    Parodi, S; Balbi, C; Abelmoschi, M L; Pala, M; Russo, P; Santi, L

    1983-12-01

    Alkaline elution is a well-known method for detecting DNA damage. Recently we have developed a viscosimetric method that is even more sensitive than alkaline elution. Here we report that the two methods, although apparently both revealing alkaline DNA fragmentation, can give dramatically different results for a significant series of compounds. We suspect that alkaline elution might reveal not only DNA fragmentation but also the extent of disentanglement of chromatin structure, whereas this DNA disentanglement rate, when evaluated viscosimetrically , is more strictly correlated with the initiation of DNA unwinding.

  12. Phytochemical characterization and biological activity evaluation of ethanolic extract of Cinnamomum zeylanicum.

    PubMed

    Husain, Ishrat; Ahmad, Rumana; Chandra, Anu; Raza, Syed Tasleem; Shukla, Yogeshwer; Mahdi, Farzana

    2018-06-12

    India being a multicultural nation, every region of the country offers a distinct culinary flavor and taste. These flavors are attributed to spices and condiments which form the mainstay of Indian cuisine. Most of these spices and condiments are derived from various biodiversity hotspots in India and form the crux of India's multidiverse and multicultural cuisine. Apart from their varying aromas, flavors and tastes, these spices and condiments are known to possess several medicinal properties also. Most of these spices find considerable mention in Ayurveda, the indigenous system of medicine, as panaceas for several aliments. Cinnamomum zeylanicum (CZ), belonging to family Lauraceae and commonly known as cinnamon is one such spice known to have diverse medicinal properties since time immemorial. In the present study, apoptotic and anti-microbial activity of ethanolic extract of CZ was evaluated against human breast cancer cell line MDA-MB-231 and compared for its effect on normal kidney epithelial cell line Vero. Ethanolic extract of tree bark of CZ was used to determine the cytotoxic effect on MDA-MB-231 using Trypan blue dye exclusion method and cytometry. The tested dose of the extract was 10-100 µg/mL. Antibacterial activity was determined using disc diffusion method against Staphylococcus aureus and Escherichia coli in the range 2-10 mg/mL. Apoptotic activity was determined using DNA fragmentation assay. Ethanolic extract of CZ was found to have an IC 50 value of 25 µg/mL against MDA cell line. On the other hand, CZ extract did not have any significant effect on Vero cells even at 100 µg/mL (IC 50 > 100 µg/mL). The ethanolic extract of CZ bark showed significant antibacterial activity against S. aureus at 10 mg/mL while no appreciable activity was detected against E. coli. DNA isolated from extract treated cancer cells showed a fragmentation pattern characteristic of apoptosis. However, no DNA fragmentation was observed in DNA isolated from extract treated Vero cells. Ethanolic bark extract of CZ could be potentially beneficial in treating breast cancer and may be of interest for future studies in developing integrative cancer therapy against proliferation, metastasis, and migration of breast cancer cells. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Freshwater toxic cyanobacteria induced DNA damage in apple (Malus pumila), rape (Brassica napus) and rice (Oryza sativa).

    PubMed

    Chen, J Z; Ye, J Y; Zhang, H Y; Jiang, X J; Zhang, Y X; Liu, Z L

    2011-06-15

    Cyanobacteria in freshwater ecosystems can present a harmful effect on growth and development of plants through irrigation with contaminated water. In this study, the effects of microcystins (MCs)-containing cyanobacteria extract (CE) on DNA damage of apple, rape and rice were investigated to explore the phytotoxic mechanism of MCs through DNA fragmentation and RAPD analysis. Determination of DNA fragmentation by fluorescent dye DAPI showed that significant DNA damage was observed in rice seedlings after exposure to CE while DNA fragmentation in rape seedlings and apple cultures did not differ significantly between treatment and control groups. Qualitative characterization of genomic DNA fragmentation by agarose gel electrophoresis supported the quantitative determination using DAPI. The main changes in RAPD profiles of rape seedlings following exposure of lower doses of CE were variation in band intensity for the primers F03 and S01, while higher doses of CE caused loss of normal bands and appearance of new bands except band intensity changes. The data presented here demonstrate that DNA damage in plants occurs following exposure of microcystins, and the polymorphic RAPDs may be used as an investigation tool for environmental toxicology and as a useful biomarker for the detection of genotoxic effects of microcystins on plants. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  14. Sperm DNA Fragmentation Index and Hyaluronan Binding Ability in Men from Infertile Couples and Men with Testicular Germ Cell Tumor

    PubMed Central

    Filipiak, Eliza; Walczak-Jedrzejowska, Renata; Oszukowska, Elzbieta; Sobkiewicz, Slawomir; Wojt, Malgorzata; Chmiel, Jacek; Kula, Krzysztof; Slowikowska-Hilczer, Jolanta

    2016-01-01

    Objective. To investigate sperm DNA fragmentation and sperm functional maturity in men from infertile couples (IC) and men with testicular germ cell tumor (TGCT). Materials and Methods. Semen samples were collected from 312 IC men and 23 men with TGCT before unilateral orchiectomy and oncological treatment. The sperm chromatin dispersion test was performed to determine DNA fragmentation index (DFI) and the ability of sperm to bind with hyaluronan (HA) was assessed. Results. In comparison with the IC men, the men with TGCT had a higher percentage of sperm with fragmented DNA (median 28% versus 21%; p < 0.01) and a lower percentage of HA-bound sperm (24% versus 66%; p < 0.001). Normal results of both analyses were observed in 24% of IC men and 4% of men with TGCT. Negative Spearman's correlations were found between DFI and the percentage of HA-bound sperm in the whole group and in IC subjects and those with TGCT analyzed separately. Conclusions. Approximately 76% of IC men and 96% with TGCT awaiting orchiectomy demonstrated DNA fragmentation and/or sperm immaturity. We therefore recommend sperm banking after unilateral orchiectomy, but before irradiation and chemotherapy; the use of such a deposit appears to be a better strategy to obtain functionally efficient sperms. PMID:27999814

  15. Architecture and DNA Recognition Elements of the Fanconi Anemia FANCM-FAAP24 Complex

    PubMed Central

    Coulthard, Rachel; Deans, Andrew J.; Swuec, Paolo; Bowles, Maureen; Costa, Alessandro; West, Stephen C.; McDonald, Neil Q.

    2013-01-01

    Summary Fanconi anemia (FA) is a disorder associated with a failure in DNA repair. FANCM (defective in FA complementation group M) and its partner FAAP24 target other FA proteins to sites of DNA damage. FANCM-FAAP24 is related to XPF/MUS81 endonucleases but lacks endonucleolytic activity. We report a structure of an FANCM C-terminal fragment (FANCMCTD) bound to FAAP24 and DNA. This S-shaped structure reveals the FANCM (HhH)2 domain is buried, whereas the FAAP24 (HhH)2 domain engages DNA. We identify a second DNA contact and a metal center within the FANCM pseudo-nuclease domain and demonstrate that mutations in either region impair double-stranded DNA binding in vitro and FANCM-FAAP24 function in vivo. We show the FANCM translocase domain lies in proximity to FANCMCTD by electron microscopy and that binding fork DNA structures stimulate its ATPase activity. This suggests a tracking model for FANCM-FAAP24 until an encounter with a stalled replication fork triggers ATPase-mediated fork remodeling. PMID:23932590

  16. Cloning and characterization of Bacillus subtilis iep, which has positive and negative effects on production of extracellular proteases.

    PubMed

    Tanaka, T; Kawata, M

    1988-08-01

    We have isolated a DNA fragment from Bacillus subtilis 168 which, when present in a high-copy plasmid, inhibited production of extracellular alkaline and neutral proteases. The gene responsible for this activity was referred to as iep. The open reading frame of iep was found to be incomplete in the cloned DNA fragment. When the intact iep gene was reconstructed after the missing part of the iep gene had been cloned, it showed an enhancing effect on the production of the extracellular proteases. The open reading frame encodes a polypeptide of 229 amino acids with a molecular weight of ca. 25,866. Deletion of two amino acids from the N-terminal half of the putative iep protein resulted in dual effects, i.e., a decrease in the inhibitory activity shown by the incomplete iep gene and a slight increase in the enhancing activity shown by the complete iep gene. These results show that the iep gene product is a bifunctional protein, containing inhibitory and enhancing activities for the exoprotease production in the N-terminal and C-terminal regions, respectively. It was found by genetic and functional analyses that iep lies very close to sacU.

  17. Ultra-High-Speed DNA Fragment Separations Using Microfabricated Capillary Array Electrophoresis Chips

    NASA Astrophysics Data System (ADS)

    Woolley, Adam T.; Mathies, Richard A.

    1994-11-01

    Capillary electrophoresis arrays have been fabricated on planar glass substrates by photolithographic masking and chemical etching techniques. The photolithographically defined channel patterns were etched in a glass substrate, and then capillaries were formed by thermally bonding the etched substrate to a second glass slide. High-resolution electrophoretic separations of φX174 Hae III DNA restriction fragments have been performed with these chips using a hydroxyethyl cellulose sieving matrix in the channels. DNA fragments were fluorescently labeled with dye in the running buffer and detected with a laser-excited, confocal fluorescence system. The effects of variations in the electric field, procedures for injection, and sizes of separation and injection channels (ranging from 30 to 120 μm) have been explored. By use of channels with an effective length of only 3.5 cm, separations of φX174 Hae III DNA fragments from ≈70 to 1000 bp are complete in only 120 sec. We have also demonstrated high-speed sizing of PCR-amplified HLA-DQα alleles. This work establishes methods for high-speed, high-throughput DNA separations on capillary array electrophoresis chips.

  18. Evidence for autonomous replication and stabilization of recombinant plasmids in the transformants of yeast Hansenula polymorpha.

    PubMed

    Tikhomirova, L P; Ikonomova, R N; Kuznetsova, E N

    1986-01-01

    For the transformation of the yeast Hansenula polymorpha we have constructed a set of hybrid plasmids carrying the LEU2 gene of Saccharomyces cerevisiae as a selective marker and fragments of mitochondrial DNA of Candida utilis and H. polymorpha or chromosomal DNA fragments of H. polymorpha as replicator sequences. The replication properties of chimeric plasmids in the yeast H. polymorpha were investigated. We showed that for plasmids propagated autonomously in this yeast the plasmid monomers could be detected in the transformants only during the immediate time after the transformation event. Further growth under selective conditions led to the selection of polymeric forms of plasmid DNA as it was clearly shown for transformants carrying cosmid pL2 with mtDNA fragment of C. utilis. Such transformants carrying polymerized plasmids showed a remarkably increased stability of the transformed phenotype. Cosmid pL2 was able to shuttle between Escherichia coli, S. cerevisiae and H. polymorpha, whereas plasmids with DNA fragments from H. polymorpha did not transform S. cerevisiae effectively.

  19. Protection against β-amyloid neurotoxicity by a non-toxic endogenous N-terminal β-amyloid fragment and its active hexapeptide core sequence.

    PubMed

    Forest, Kelly H; Alfulaij, Naghum; Arora, Komal; Taketa, Ruth; Sherrin, Tessi; Todorovic, Cedomir; Lawrence, James L M; Yoshikawa, Gene T; Ng, Ho-Leung; Hruby, Victor J; Nichols, Robert A

    2018-01-01

    High levels (μM) of beta amyloid (Aβ) oligomers are known to trigger neurotoxic effects, leading to synaptic impairment, behavioral deficits, and apoptotic cell death. The hydrophobic C-terminal domain of Aβ, together with sequences critical for oligomer formation, is essential for this neurotoxicity. However, Aβ at low levels (pM-nM) has been shown to function as a positive neuromodulator and this activity resides in the hydrophilic N-terminal domain of Aβ. An N-terminal Aβ fragment (1-15/16), found in cerebrospinal fluid, was also shown to be a highly active neuromodulator and to reverse Aβ-induced impairments of long-term potentiation. Here, we show the impact of this N-terminal Aβ fragment and a shorter hexapeptide core sequence in the Aβ fragment (Aβcore: 10-15) to protect or reverse Aβ-induced neuronal toxicity, fear memory deficits and apoptotic death. The neuroprotective effects of the N-terminal Aβ fragment and Aβcore on Aβ-induced changes in mitochondrial function, oxidative stress, and apoptotic neuronal death were demonstrated via mitochondrial membrane potential, live reactive oxygen species, DNA fragmentation and cell survival assays using a model neuroblastoma cell line (differentiated NG108-15) and mouse hippocampal neuron cultures. The protective action of the N-terminal Aβ fragment and Aβcore against spatial memory processing deficits in amyloid precursor protein/PSEN1 (5XFAD) mice was demonstrated in contextual fear conditioning. Stabilized derivatives of the N-terminal Aβcore were also shown to be fully protective against Aβ-triggered oxidative stress. Together, these findings indicate an endogenous neuroprotective role for the N-terminal Aβ fragment, while active stabilized N-terminal Aβcore derivatives offer the potential for therapeutic application. © 2017 International Society for Neurochemistry.

  20. Nucleic acid isolation process

    DOEpatents

    Longmire, Jonathan L.; Lewis, Annette K.; Hildebrand, Carl E.

    1990-01-01

    A method is provided for isolating DNA from eukaryotic cell and flow sorted chromosomes. When DNA is removed from chromosome and cell structure, detergent and proteolytic digestion products remain with the DNA. These products can be removed with organic extraction, but the process steps associated with organic extraction reduce the size of DNA fragments available for experimental use. The present process removes the waste products by dialyzing a solution containing the DNA against a solution containing polyethylene glycol (PEG). The waste products dialyze into the PEG leaving isolated DNA. The remaining DNA has been prepared with fragments containing more than 160 kb. The isolated DNA has been used in conventional protocols without affect on the protocol.

  1. A simple capillary gel electrophoresis approach for efficient and reproducible DNA separations. Analysis of genetically modified soy and maize.

    PubMed

    Sánchez, Laura; González, Ramón; Crego, Antonio L; Cifuentes, Alejandro

    2007-03-01

    It is generally assumed that in order to achieve suitable separations of DNA fragments, capillary gel electrophoresis (CGE)-coated capillaries should be used. In this work, a new method is presented that allows to obtain reproducible CGE separations of DNA fragments using bare fused-silica capillaries without any previous coating step. The proposed method only requires: (i) a capillary washing with 0.1 M hydrochloric acid between injections and (ii) a running buffer composed of Tris-phosphate-ethylenediamine tetraacetic acid (EDTA) and 4.5% of 2-hydroxyethyl cellulose (HEC) as sieving polymer. The use of this new CGE procedure gives highly resolved and reproducible separations of DNA fragments ranging from 50 to 750 bp. The separation of these DNA fragments is accomplished in less than 30 min with efficiencies up to 1.7 x 10(6) plates/m. Reproducibility values of migration times (given as %RSD) for the analyzed DNA fragments are better than 1.0% (n = 4) for the same day, 2.2% (n = 16) for four different days, and 2.3% (n = 16) for four different capillaries. The usefulness of this separation method is demonstrated by detecting genetically modified maize and genetically modified soy after DNA amplification by PCR. This new CGE procedure together with LIF as detector provides sensitive analysis of 0.9% of Bt11 maize, Mon810 maize, and Roundup Ready soy in flours with S/ N up to 542. These results demonstrate the usefulness of this procedure to fulfill the European regulation on detection of genetically modified organisms in foods.

  2. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    NASA Astrophysics Data System (ADS)

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  3. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    PubMed

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (<5 kb) DNA fragments. In the current study, a novel modification was applied to overcome these problems. A limited amount of cellular DNA was carefully released from intact cells into a mildly heated alkaline agarose solution and mixed thoroughly. The solution was then gently aliquoted and allowed to solidify while maintaining the integrity of the diluted DNA. Exogenously provided Phi29 DNA polymerase was used to perform consistent genomic amplification with random hexameric oligonucleotides within the agarose gels. Simple heat melting of the gel allowed recovery of the amplified materials in a solution of the polymerase chain reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  4. PCR-based detection of a rare linear DNA in cell culture.

    PubMed

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  5. PCR-based detection of a rare linear DNA in cell culture

    PubMed Central

    2002-01-01

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials. PMID:12734566

  6. Involvement of the Extrinsic and Intrinsic Pathways in Ultraviolet B-Induced Apoptosis of Corneal Epithelial Cells

    PubMed Central

    Ubels, John L.; Glupker, Courtney D.; Schotanus, Mark P.; Haarsma, Loren D.

    2015-01-01

    The goal of this study was to elucidate the pathway by which UVB initiates efflux of K+ and subsequently apoptosis in human corneal limbal epithelial (HCLE) cells. The initial focus of the study was on the extrinsic pathway involving Fas. HCLE cells transfected with Fas siRNA were exposed to 80–150 mJ/cm2 UVB and incubated in culture medium with 5.5 mM K+. Knock down of Fas resulted in limited reduction in UVB-induced caspase-8 and -3 activity. Patch-clamp recordings showed no difference in UVB-induced normalized K+ currents between Fas transfected and control cells. Knockdown of caspase-8 had no effect on the activation of caspase-3 following UVB exposure, while a caspase-8 inhibitor completely eliminated UVB activation of caspase-3. This suggests that caspase-8 is a robust enzyme, able to activate caspase-3 via residual caspase-8 present after knockdown, and that caspase-8 is directly involved in the UVB activation of caspase-3. Inhibition of caspase-9 significantly decreased the activation of caspases-8 and -3 in response to UVB. Knockdown of Apaf-1, required for activation of caspase-9, resulted in a significant reduction in UVB-induced activation of caspases-9, -8, and -3. Knockdown of Apaf-1 also inhibited intrinsic and UVB-induced levels of apoptosis, as determined by DNA fragmentation measured by TUNEL assay. In UVB exposed cultures treated with caspase-3 inhibitor, the percentage of apoptotic cells was reduced to control levels, confirming the necessity of caspase-3 activation in DNA fragmentation. The lack of effect of Fas knockdown on K+ channel activation, as well as the limited effect on activation of caspases-8 and -3, strongly suggest that Fas and the extrinsic pathway is not of primary importance in the initiation of apoptosis in response to UVB in HCLE cells. Inhibition of caspase-8 and -3 activation following inhibition of caspase-9, as well as reduction in activation of caspases-9, -8, and -3 and DNA fragmentation in response to Apaf-1 knockdown support the conclusion that the intrinsic pathway is more important in UVB-induced apoptosis in HCLE cells. PMID:26559338

  7. Evaluation of cheetah and leopard spermatozoa developmental capability after interspecific ICSI with domestic cat oocytes.

    PubMed

    Moro, L N; Sestelo, A J; Salamone, D F

    2014-08-01

    The ICSI procedure is potentially of great value for felids, and it has not been extensively studied in these species. The objectives of this work were to determine the best conditions for ICSI in the domestic cat (DC) to generate interspecific embryos by injecting cheetah (Ch) and leopard (Leo) spermatozoa. Firstly, DC oocytes were matured with insulin-transferrin-selenium (ITS) or without it (MM) and cultured using atmospheric (21%) or low (5%) oxygen tension after ICSI. The group ITS-5%O2 showed the highest blastocyst rate (p < 0.05), 20.9% vs 8.7%, 7% and 6.5%, for MM-21%O2 , MM-5%O2 and ITS-21%O2 , respectively. The best conditions were used to generate the interspecific embryos, together with ionomycin activation (Io) after ICSI. Interspecific embryos resulted in high rates of blastocysts that were not positively affected by Io activation: 32.6% vs 21% for Ch and Ch-Io, 9.8% vs 21% for Leo and Leo-Io, and 20% vs 17.4% for DC and DC-Io. We also evaluated DNA-fragmented nuclei of experiment 1 and 2 blastocysts, using TUNEL assay. The fragmented nucleus proportion was higher in the ITS-5%O2 group, 67.6%. Surprisingly, interspecific blastocysts showed the lowest fragmented nucleus proportion: 27% and 29.9% for Ch and Leo, respectively. We concluded that ITS and 5%O2 improve blastocyst formation in DC, although with a concomitant increase in DNA fragmentation. Most importantly, cheetah and leopard spermatozoa were able to generate blastocysts without artificial activation, which suggests that developmental capacity of wild felid spermatozoa can be evaluated by interspecific ICSI. This technique should be used to assist wild felid reproduction. © 2014 Blackwell Verlag GmbH.

  8. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Treesearch

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  9. Multiple tag labeling method for DNA sequencing

    DOEpatents

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  10. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    NASA Astrophysics Data System (ADS)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  11. Method for in vitro recombination

    DOEpatents

    Gibson, Daniel Glenn; Smith, Hamilton O

    2013-05-07

    The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.

  12. DNA sequence-specific dimeric bisbenzimidazoles DBP(n) and DBPA(n) as inhibitors of H-NS silencing in bacterial cells.

    PubMed

    Melkina, Olga E; Koval, Vasilii S; Ivanov, Alexander A; Zhuze, Alexei L; Zavilgelsky, Gennadii B

    2018-03-01

    DNA sequence-specific fluorescent dimeric bisbenzimidazoles DBP(n) and DBPA(n), noncovalently interacting with A-T pairs in the minor groove of double-stranded DNA were used for studying and monitoring the expression of histone-like H-NS-dependent promoters. Histone-like H-NS selectively binds to AT-rich segments of DNA and silences a large number of genes in bacterial chromosomes. The H-NS-dependent promoters of Quorum Sensing (QS)-regulated lux operons of the marine bacteria mesophilic Aliivibrio fischeri, psychrophilic Aliivibrio logei were used. Escherichia coli lux biosensors were constructed by cloning fragments bearing QS-regulated promoters into the vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE genes. It was shown that the dimeric bisbenzimidazoles DBP(n) and DBPA(n) counteract the H-NS silencing activity. Thus, the presence of DBP(n) or DBPA(n) in the medium leads to an approximately 10-100-fold increase in the level of transcription of QS promoters in E. coli hns + . The largest decrease in the level of H-NS repression was observed using ligands containing a linker with a length of ca. 18Å, such as DBP(2) and DBPA(2). Ligands containing linkers with n=1 and 3 are an order of magnitude less active; ligands with n=4 are inactive. DBPA(2) exhibits activity starting with a concentration of 0.5μM; the minimum concentration of DBP(2) is 5-7 times higher. It is suggested that A-T pairs located at five nucleotide pair intervals, which correspond to the linker length in highly active ligands with n=2, play a key role in the structure of H-NS-binding sites in QS-regulated promoters. Copyright © 2017 Elsevier GmbH. All rights reserved.

  13. Ca2+ mobilization during cell death induction by sodium 5, 6-benzylidene-L-ascorbate.

    PubMed

    Takahashi, H; Sakagami, H; Ohata, H; Iida, M; Momose, K; Yamamura, M; Takeda, M

    1996-01-01

    The cytotoxic activity of sodium 5,6-benzylidene-L-ascorbate (SBA) against human KG-1-C glioma and T98G glioblastoma cell lines was augmented by pretreatment of the cells with L-buthionine-[S, R]-sulfoximine (BSO), which reduced the intracellular glutathione concentrations. SBA produced shrunken cells and large DNA fragments, without the induction of nuclear and internucleosomal DNA fragmentation. The rapid elevation of intracellular free Ca2+ concentration observed after SBA treatment was further augmented by BSO pretreatment. A confocal experiment with Fluo-3 fluorescence revealed that SBA markedly elevated the free Ca2+ concentration in the nuclear region, but did not significantly affect that in the cytoplasmic region. The present study suggests that the nuclear accumulation of Ca2+ is an important initial step for cell death induction by SBA.

  14. Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

    PubMed

    Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

    2002-04-01

    We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

  15. [Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

    PubMed

    Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

    2015-08-01

    In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

  16. Monitoring Daily Dynamics of Early Tumor Response to Targeted Therapy by Detecting Circulating Tumor DNA in Urine

    PubMed Central

    Husain, Hatim; Melnikova, Vladislava O.; Kosco, Karena; Woodward, Brian; More, Soham; Pingle, Sandeep C.; Weihe, Elizabeth; Park, Ben Ho; Tewari, Muneesh; Erlander, Mark G.; Cohen, Ezra; Lippman, Scott M.; Kurzrock, Razelle

    2017-01-01

    Purpose Non-invasive drug biomarkers for the early assessment of tumor response can enable adaptive therapeutic decision-making and proof-of-concept studies for investigational drugs. Circulating tumor DNA (ctDNA) is released into the circulation by tumor cell turnover and has been shown to be detectable in urine. Experimental Design We tested the hypothesis that dynamic changes in epidermal growth factor receptor (EGFR) activating (exon 19del and L858R) and resistance (T790M) mutation levels detected in urine could inform tumor response within days of therapy for advanced non-small cell lung cancer (NSCLC) patients receiving osimertinib, a second line third generation anti-EGFR tyrosine kinase inhibitor. Results Eight of nine evaluable NSCLC patients had detectable T790M-mutant DNA fragments in pre-treatment baseline samples. Daily monitoring of mutations in urine indicated a pattern of intermittent spikes throughout week 1 suggesting apoptosis with an overall decrease in fragment numbers between baselines to day 7 preceding radiographic response assessed at 6-12 weeks. Conclusions These findings suggest drug-induced tumor apoptosis within days of initial dosing. Daily sampling of ctDNA may enable early assessment of patient response and proof-of-concept studies for drug development. PMID:28420725

  17. Non-random distribution of DNA double-strand breaks induced by particle irradiation

    NASA Technical Reports Server (NTRS)

    Lobrich, M.; Cooper, P. K.; Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    Induction of DNA double-strand breaks (dsbs) in mammalian cells is dependent on the spatial distribution of energy deposition from the ionizing radiation. For high LET particle radiations the primary ionization sites occur in a correlated manner along the track of the particles, while for X-rays these sites are much more randomly distributed throughout the volume of the cell. It can therefore be expected that the distribution of dsbs linearly along the DNA molecule also varies with the type of radiation and the ionization density. Using pulsed-field gel and conventional gel techniques, we measured the size distribution of DNA molecules from irradiated human fibroblasts in the total range of 0.1 kbp-10 Mbp for X-rays and high LET particles (N ions, 97 keV/microns and Fe ions, 150 keV/microns). On a mega base pair scale we applied conventional pulsed-field gel electrophoresis techniques such as measurement of the fraction of DNA released from the well (FAR) and measurement of breakage within a specific NotI restriction fragment (hybridization assay). The induction rate for widely spaced breaks was found to decrease with LET. However, when the entire distribution of radiation-induced fragments was analysed, we detected an excess of fragments with sizes below about 200 kbp for the particles compared with X-irradiation. X-rays are thus more effective than high LET radiations in producing large DNA fragments but less effective in the production of smaller fragments. We determined the total induction rate of dsbs for the three radiations based on a quantitative analysis of all the measured radiation-induced fragments and found that the high LET particles were more efficient than X-rays at inducing dsbs, indicating an increasing total efficiency with LET. Conventional assays that are based only on the measurement of large fragments are therefore misleading when determining total dsb induction rates of high LET particles. The possible biological significance of this non-randomness for dsb induction is discussed.

  18. Cellular Stress and p53-Associated Apoptosis by Juniperus communis L. Berry Extract Treatment in the Human SH-SY5Y Neuroblastoma Cells

    PubMed Central

    Lantto, Tiina A.; Laakso, Into; Dorman, H. J. Damien; Mauriala, Timo; Hiltunen, Raimo; Kõks, Sulev; Raasmaja, Atso

    2016-01-01

    Plant phenolics have shown to activate apoptotic cell death in different tumourigenic cell lines. In this study, we evaluated the effects of juniper berry extract (Juniperus communis L.) on p53 protein, gene expression and DNA fragmentation in human neuroblastoma SH-SY5Y cells. In addition, we analyzed the phenolic composition of the extract. We found that juniper berry extract activated cellular relocalization of p53 and DNA fragmentation-dependent cell death. Differentially expressed genes between treated and non-treated cells were evaluated with the cDNA-RDA (representational difference analysis) method at the early time point of apoptotic process when p53 started to be activated and no caspase activity was detected. Twenty one overexpressed genes related to cellular stress, protein synthesis, cell survival and death were detected. Interestingly, they included endoplasmic reticulum (ER) stress inducer and sensor HSPA5 and other ER stress-related genes CALM2 and YKT6 indicating that ER stress response was involved in juniper berry extract mediated cell death. In composition analysis, we identified and quantified low concentrations of fifteen phenolic compounds. The main groups of them were flavones, flavonols, phenolic acids, flavanol and biflavonoid including glycosides of quercetin, apigenin, isoscutellarein and hypolaetin. It is suggested that juniper berry extract induced the p53-associated apoptosis through the potentiation and synergism by several phenolic compounds. PMID:27420050

  19. Inhibition of Mdm2 Sensitizes Human Retinal Pigment Epithelial Cells to Apoptosis

    PubMed Central

    Ray, Ramesh M.; Chaum, Edward; Johnson, Dianna A.; Johnson, Leonard R.

    2011-01-01

    Purpose. Because recent studies indicate that blocking the interaction between p53 and Mdm2 results in the nongenotoxic activation of p53, the authors sought to investigate whether the inhibition of p53-Mdm2 binding activates p53 and sensitizes human retinal epithelial cells to apoptosis. Methods. Apoptosis was evaluated by the activation of caspases and DNA fragmentation assays. The Mdm2 antagonist Nutlin-3 was used to dissociate p53 from Mdm2 and, thus, to increase p53 activity. Knockdown of p53 expression was accomplished by using p53 siRNA. Results. ARPE-19 and primary RPE cells expressed high levels of the antiapoptotic proteins Bcl-2 and Bcl-xL. Exposure of these cells to camptothecin (CPT) or TNF-α/ cycloheximide (CHX) failed to induce apoptosis. In contrast, treatment with the Mdm2 antagonist Nutlin-3 in the absence of CPT or TNF-α/CHX increased apoptosis. Activation of p53 in response to Nutlin-3 also increased levels of Noxa, p53-upregulated modulator of apoptosis (PUMA), and Siva-1, decreased expression of Bcl-2 and Bcl-xL, and simultaneously increased caspases-9 and -3 activities and DNA fragmentation. Knockdown of p53 decreased the basal expression of p21Cip1 and Bcl-2, inhibited the Nutlin-3–induced upregulation of Siva-1 and PUMA expression, and consequently inhibited caspase-3 activation. Conclusions. These results indicate that the normally available pool of intracellular p53 is predominantly engaged in the regulation of cell cycle checkpoints by p21Cip1 and does not trigger apoptosis in response to DNA-damaging agents. However, the blockage of p53 binding to Mdm2 frees a pool of p53 that is sufficient, even in the absence of DNA-damaging agents, to increase the expression of proapoptotic targets and to override the resistance of RPE cells to apoptosis. PMID:21345989

  20. The GP(Y/F) Domain of TF1 Integrase Multimerizes when Present in a Fragment, and Substitutions in This Domain Reduce Enzymatic Activity of the Full-length Protein*S⃞

    PubMed Central

    Ebina, Hirotaka; Chatterjee, Atreyi Ghatak; Judson, Robert L.; Levin, Henry L.

    2008-01-01

    Integrases (INs) of retroviruses and long terminal repeat retrotransposons possess a C-terminal domain with DNA binding activity. Other than this binding activity, little is known about how the C-terminal domain contributes to integration. A stretch of conserved amino acids called the GP(Y/F) domain has been identified within the C-terminal IN domains of two distantly related families, the γ-retroviruses and the metavirus retrotransposons. To enhance understanding of the C-terminal domain, we examined the function of the GP(Y/F) domain in the IN of Tf1, a long terminal repeat retrotransposon of Schizosaccharomyces pombe. The activities of recombinant IN were measured with an assay that modeled the reverse of integration called disintegration. Although deletion of the entire C-terminal domain disrupted disintegration activity, an alanine substitution (P365A) in a conserved amino acid of the GP(Y/F) domain did not significantly reduce disintegration. When assayed for the ability to join two molecules of DNA in a reaction that modeled forward integration, the P365A substitution disrupted activity. UV cross-linking experiments detected DNA binding activity in the C-terminal domain and found that this activity was not reduced by substitutions in two conserved amino acids of the GP(Y/F) domain, G364A and P365A. Gel filtration and cross-linking of a 71-amino acid fragment containing the GP(Y/F) domain revealed a surprising ability to form dimers, trimers, and tetramers that was disrupted by the G364A and P365A substitutions. These results suggest that the GP(Y/F) residues may play roles in promoting multimerization and intermolecular strand joining. PMID:18397885

  1. The GP(Y/F) domain of TF1 integrase multimerizes when present in a fragment, and substitutions in this domain reduce enzymatic activity of the full-length protein.

    PubMed

    Ebina, Hirotaka; Chatterjee, Atreyi Ghatak; Judson, Robert L; Levin, Henry L

    2008-06-06

    Integrases (INs) of retroviruses and long terminal repeat retrotransposons possess a C-terminal domain with DNA binding activity. Other than this binding activity, little is known about how the C-terminal domain contributes to integration. A stretch of conserved amino acids called the GP(Y/F) domain has been identified within the C-terminal IN domains of two distantly related families, the gamma-retroviruses and the metavirus retrotransposons. To enhance understanding of the C-terminal domain, we examined the function of the GP(Y/F) domain in the IN of Tf1, a long terminal repeat retrotransposon of Schizosaccharomyces pombe. The activities of recombinant IN were measured with an assay that modeled the reverse of integration called disintegration. Although deletion of the entire C-terminal domain disrupted disintegration activity, an alanine substitution (P365A) in a conserved amino acid of the GP(Y/F) domain did not significantly reduce disintegration. When assayed for the ability to join two molecules of DNA in a reaction that modeled forward integration, the P365A substitution disrupted activity. UV cross-linking experiments detected DNA binding activity in the C-terminal domain and found that this activity was not reduced by substitutions in two conserved amino acids of the GP(Y/F) domain, G364A and P365A. Gel filtration and cross-linking of a 71-amino acid fragment containing the GP(Y/F) domain revealed a surprising ability to form dimers, trimers, and tetramers that was disrupted by the G364A and P365A substitutions. These results suggest that the GP(Y/F) residues may play roles in promoting multimerization and intermolecular strand joining.

  2. Fluorescence resonance energy transfer between green fluorescent protein and doxorubicin enabled by DNA nanotechnology.

    PubMed

    Heger, Zbynek; Kominkova, Marketa; Cernei, Natalia; Krejcova, Ludmila; Kopel, Pavel; Zitka, Ondrej; Adam, Vojtech; Kizek, Rene

    2014-12-01

    DNA nanotechnology is a rapidly growing research area, where DNA may be used for wide range of applications such as construction of nanodevices serving for large scale of diverse purposes. Likewise a panel of various purified fluorescent proteins is investigated for their ability to emit their typical fluorescence spectra under influence of particular excitation. Hence these proteins may form ideal donor molecules for assembly of fluorescence resonance emission transfer (FRET) constructions. To extend the application possibilities of fluorescent proteins, while using DNA nanotechnology, we developed nanoconstruction comprising green fluorescent protein (GFP) bound onto surface of surface active nanomaghemite and functionalized with gold nanoparticles. We took advantage of natural affinity between gold and thiol moieties, which were modified to bind DNA fragment. Finally we enclosed doxorubicin into fullerene cages. Doxorubicin intercalated in DNA fragment bound on the particles and thus we were able to connect these parts together. Because GFP behaved as a donor and doxorubicin as an acceptor using excitation wavelength for GFP (395 nm) in emission wavelength of doxorubicin (590 nm) FRET was observed. This nanoconstruction may serve as a double-labeled transporter of doxorubicin guided by force of external magnetic force owing to the presence of nanomaghemite. Further nanomaghemite offers the possibility of using this technology for thermotherapy. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Studies with infections fragments of phage DNA. Final report, January 1, 1970--June 30, 1976

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schachtele, C. F.

    The minute, virulent and structurally intricate Bacillus subtilis bacteriophage phi 29 was utilized to study in vivo viral development. Purified strands of phi 29 DNA were used to analyze transcription of the viral genome. Early mRNA hybridizes to the light DNA strand which controls DNA replication and other early functions. Late mRNA hybridizes to the heavy DNA strand which codes for phage structural proteins. The temporal sequence of specific viral protein synthesis was analyzed by gel electrophoresis and was shown to directly correlate with the RNA transcription pattern. The genes carried by phi 29 have been marked with ts andmore » sus mutations and mapped by appropriate crosses yielding a linear map of 17 cistrons. Fragments of the phi 29 DNA were shown to retain their biological activity and marker rescue studies indicated that gene transfer could be performed with pieces having a molecular weight of less than 1 million daltons. Mutant infection under nonpermissive conditions and the analysis of precursor structures has allowed the formation of a tentative morphogenetic pathway leading to the formation of infectious particles. Work with phi 29 has established this virus as an advantageous model system for studying a variety of problems in molecular biology and approximately a dozen laboratories in the country and abroad are working with this phage.« less

  4. Study of the family of a patient with male-limited precocious puberty (MPP) due to T1193C transition in exon 11 of LH receptor gene.

    PubMed

    Ignacak, M; Starzyk, J; Dziatkowiak, H; Trzeciak, W H

    2002-03-01

    Molecular diagnostics of the LHR gene was conducted in a 5-year-old boy with clinical symptoms and hormonal profile typical of precocious puberty. His parents and 4 sisters were also diagnosed. Single-strand conformation polymorphism analysis under temperature gradient conditions (Multitemperature SSCP) of 3 overlapping fragments of exon 11 of LHR gene revealed a mutation in the fragment spanning nucleotides 1072 to 1804. This mutation was found in the patient, in his mother and in his 4 sisters, and was confirmed by digestion with the use of restriction enzyme Bbr Cl. Direct sequencing revealed a heterozygous T1193C transition in the DNA fragment of the patient and in one of the alleles of his mother's and sister's DNA. This mutation causes Met398Thr substitution in the second transmembrane helix and results in a constitutive activation of LH receptor. This is the second identical mutation detected in Poland and one of the 7 identified so far in the world population.

  5. Induction of protective neutralizing antibody responses against botulinum neurotoxin serotype C using plasmid carried by PLGA nanoparticles.

    PubMed

    Ruwona, Tinashe B; Xu, Haiyue; Li, Junwei; Diaz-Arévalo, Diana; Kumar, Amit; Zeng, Mingtao; Cui, Zhengrong

    2016-05-03

    Botulinum neurotoxin (BoNT) is a lethal neurotoxin, for which there is currently not an approved vaccine. Recent efforts in developing vaccine candidates against botulism have been directed at the heavy chain fragment of BoNT, because antibodies against this region have been shown to prevent BoNT from binding to its receptor and thus to nerve cell surface, offering protection against BoNT intoxication. In the present study, it was shown that immunization with plasmid DNA that encodes the 50 KDa C-terminal fragment of the heavy chain of BoNT serotype C (i.e., BoNT/C-Hc50) and is carried by cationic poly (lactic-co-glycolic) acid (PLGA) nanoparticles induces stronger BoNT/C-specific antibody responses, as compared to immunization with the plasmid alone. Importantly, the antibodies have BoNT/C-neutralizing activity, protecting the immunized mice from a lethal dose of BoNT/C challenge. A plasmid DNA vaccine encoding the Hc50 fragments of BoNT serotypes that cause human botulism may represent a viable vaccine candidate for protecting against botulinum neurotoxin intoxication.

  6. Enhancement of expression and apparent secretion of Erwinia chrysanthemi endoglucanase (encoded by celZ) in Escherichia coli B

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, S.; Yomano, L.P.; Saleh, A.Z.

    1999-06-01

    Escherichia coli B has been engineered as a biocatalyst for the conversion of lignocellulose into ethanol. Previous research has demonstrated that derivatives of E. coli B can produce high levels of Erwinia chrysanthemi endoglucanase (encoded by celZ) as a periplasmic product and that this enzyme can function with commercial fungal cellulase to increase ethanol production. In this study, the authors have demonstrated two methods that improve celZ expression in E. coli B. Initially, with a low-copy-number vector, two E. coli glycolytic gene promoters (gap and eno) were tested and found to be less effective than the original celZ promoter. Bymore » screening 18,000 random fragments of Zymomonas mobilis DNA, a surrogate promoter was identified which increased celZ expression up to sixfold. With this promoter, large polar inclusion bodies were clearly evident in the periplasmic space. Sequencing revealed that the most active surrogate promoter is derived from five Sau3A1 fragments, one of which was previously sequenced in Z. mobilis. Visual inspection indicated that this DNA fragment contains at least five putative promoter regions, two of which were confirmed by primer extension analysis. Addition of the out genes from E. chrysanthemi EC16 caused a further increase in the production of active enzyme and facilitated secretion or release of over half of the activity into the extracellular environment. With the most active construct, of a total of 13,000 IU of active enzyme per liter of culture, 7,800 IU was in the supernatant. The total active endoglucanase was estimated to represent 4 to 6% of cellular protein.« less

  7. Vector-mediated chromosomal integration of the glutamate decarboxylase gene in streptococcus thermophilus

    USDA-ARS?s Scientific Manuscript database

    The integrative vector pINTRS was used to transfer glutamate decarboxylase (GAD) activity to Streptococcus thermophilus ST128, thus allowing for the production of '-aminobutyric acid (GABA). In pINTRS, the gene encoding glutamate decarboxylase, gadB, was flanked by DNA fragments homologous to a S. ...

  8. Gene expression analysis by cDNA-AFLP highlights a set of new signaling networks and translational control during seed dormancy breaking in Nicotiana plumbaginifolia.

    PubMed

    Bove, Jérôme; Lucas, Philippe; Godin, Béatrice; Ogé, Laurent; Jullien, Marc; Grappin, Philippe

    2005-03-01

    Seed dormancy in Nicotiana plumbaginifolia is characterized by an abscisic acid accumulation linked to a pronounced germination delay. Dormancy can be released by 1 year after-ripening treatment. Using a cDNA-amplified fragment length polymorphism (cDNA-AFLP) approach we compared the gene expression patterns of dormant and after-ripened seeds, air-dry or during one day imbibition and analyzed 15,000 cDNA fragments. Among them 1020 were found to be differentially regulated by dormancy. Of 412 sequenced cDNA fragments, 83 were assigned to a known function by search similarities to public databases. The functional categories of the identified dormancy maintenance and breaking responsive genes, give evidence that after-ripening turns in the air-dry seed to a new developmental program that modulates, at the RNA level, components of translational control, signaling networks, transcriptional control and regulated proteolysis.

  9. Links between nucleolar activity, rDNA stability, aneuploidy and chronological aging in the yeast Saccharomyces cerevisiae.

    PubMed

    Lewinska, Anna; Miedziak, Beata; Kulak, Klaudia; Molon, Mateusz; Wnuk, Maciej

    2014-06-01

    The nucleolus is speculated to be a regulator of cellular senescence in numerous biological systems (Guarente, Genes Dev 11(19):2449-2455, 1997; Johnson et al., Curr Opin Cell Biol 10(3):332-338, 1998). In the budding yeast Saccharomyces cerevisiae, alterations in nucleolar architecture, the redistribution of nucleolar protein and the accumulation of extrachromosomal ribosomal DNA circles (ERCs) during replicative aging have been reported. However, little is known regarding rDNA stability and changes in nucleolar activity during chronological aging (CA), which is another yeast aging model used. In the present study, the impact of aberrant cell cycle checkpoint control (knock-out of BUB1, BUB2, MAD1 and TEL1 genes in haploid and diploid hemizygous states) on CA-mediated changes in the nucleolus was studied. Nucleolus fragmentation, changes in the nucleolus size and the nucleolus/nucleus ratio, ERC accumulation, expression pattern changes and the relocation of protein involved in transcriptional silencing during CA were revealed. All strains examined were affected by oxidative stress, aneuploidy (numerical rather than structural aberrations) and DNA damage. However, the bub1 cells were the most prone to aneuploidy events, which may contribute to observed decrease in chronological lifespan. We postulate that chronological aging may be affected by redox imbalance-mediated chromosome XII instability leading to both rDNA instability and whole chromosome aneuploidy. CA-mediated nucleolus fragmentation may be a consequence of nucleolus enlargement and/or Nop2p upregulation. Moreover, the rDNA content of chronologically aging cells may be a factor determining the subsequent replicative lifespan. Taken together, we demonstrated that the nucleolus state is also affected during CA in yeast.

  10. A Modified Gibson Assembly Method for Cloning Large DNA Fragments with High GC Contents.

    PubMed

    Li, Lei; Jiang, Weihong; Lu, Yinhua

    2018-01-01

    Gibson one-step, isothermal assembly method (Gibson assembly) can be used to efficiently assemble large DNA molecules by in vitro recombination involving a 5'-exonuclease, a DNA polymerase and a DNA ligase. In the past few years, this robust DNA assembly method has been widely applied to seamlessly construct genes, genetic pathways and even entire genomes. Here, we expand this method to clone large DNA fragments with high GC contents, such as antibiotic biosynthetic gene clusters from Streptomyces . Due to the low isothermal condition (50 °C) in the Gibson reaction system, the complementary overlaps with high GC contents are proposed to easily form mismatched linker pairings, which leads to low assembly efficiencies mainly due to vector self-ligation. So, we modified this classic method by the following two steps. First, a pair of universal terminal single-stranded DNA overhangs with high AT contents are added to the ends of the BAC vector. Second, two restriction enzyme sites are introduced into the respective sides of the designed overlaps to achieve the hierarchical assembly of large DNA molecules. The optimized Gibson assembly method facilitates fast acquisition of large DNA fragments with high GC contents from Streptomyces.

  11. Excessive Cytosolic DNA Fragments as a Potential Trigger of Graves’ Disease: An Encrypted Message Sent by Animal Models

    PubMed Central

    Luo, Yuqian; Yoshihara, Aya; Oda, Kenzaburo; Ishido, Yuko; Suzuki, Koichi

    2016-01-01

    Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid-stimulating hormone receptor (TSHR) that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs). “Shimojo’s model” was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC) class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k) mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers. PMID:27895620

  12. The combi-targeting concept: in vitro and in vivo fragmentation of a stable combi-nitrosourea engineered to interact with the epidermal growth factor receptor while remaining DNA reactive.

    PubMed

    Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J

    2007-01-01

    JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.

  13. Resveratrol induces membrane and DNA disruption via pro-oxidant activity against Salmonella typhimurium.

    PubMed

    Lee, Wonjong; Lee, Dong Gun

    2017-07-22

    Resveratrol is a flavonoid found in various plants including grapes, which has been reported to be active against various pathogenic bacteria. However, antibacterial effects and mechanisms via pro-oxidant property of resveratrol remain unknown and speculative. This research investigated antibacterial mechanism of resveratrol against a food-borne human pathogen Salmonella typhimurium, and confirmed the cell death associated oxidative damage. Resveratrol increased outer membrane permeability and membrane depolarization. It also was observed DNA injury responses such as DNA fragmentation, increasing DNA contents and cell division inhibition. Intracellular ROS accumulation, GSH depletion and significant increased malondialdehyde levels were confirmed, which indicated pro-oxidant activity of resveratrol and oxidative stress. Furthermore, the observed lethal damages were reduced by antioxidant N-acetylcysteine treatment supported the view that resveratrol-induced oxidative stress stimulated S. typhimurium cell death. In conclusion, this study expands understanding on role of pro-oxidant property and insight into previously unrecognized oxygen-dependent anti-Salmonella mechanism on resveratrol. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    PubMed Central

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  15. The influence of direct mobile phone radiation on sperm quality

    PubMed Central

    Gorpinchenko, Igor; Nikitin, Oleg; Shulyak, Alexander

    2014-01-01

    Introduction It is impossible to imagine a modern socially–active man who does not use mobile devices and/or computers with Wi–Fi function. The effect of mobile phone radiation on male fertility is the subject of recent interest and investigations. The aim of this study was to investigate the direct in vitro influence of mobile phone radiation on sperm DNA fragmentation and motility parameters in healthy subjects with normozoospermia. Material and methods 32 healthy men with normal semen parameters were selected for the study. Each sperm sample was divided into two equal portions (A and B). Portions A of all involved men were placed for 5 hours in a thermostat, and portions B were placed into a second thermostat for the same period of time, where a mobile phone in standby/talk mode was placed. After 5 hours of incubation the sperm samples from both thermostats were re–evaluated regarding basic motility parameters. The presence of DNA fragmentation in both A and B portions of each sample was determined each hour using a standard sperm chromatin dispersion test. Results The number of spermatozoa with progressive movement in the group, influenced by electromagnetic radiation, is statistically lower than the number of spermatozoa with progressive movement in the group under no effect of the mobile phone. The number of non–progressive movement spermatozoa was significantly higher in the group, which was influenced by cell phone radiation. The DNA fragmentation was also significantly higher in this group. Conclusions A correlation exists between mobile phone radiation exposure, DNA–fragmentation level and decreased sperm motility. PMID:24982785

  16. Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

    PubMed

    Vacek, A T; Bourque, D P

    1980-09-01

    Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

  17. Gamma-irradiation produces active chlorine species (ACS) in physiological solutions: Secoisolariciresinol diglucoside (SDG) scavenges ACS - A novel mechanism of DNA radioprotection

    PubMed Central

    Mishra, Om P.; Popov, Anatoliy V.; Pietrofesa, Ralph A.; Christofidou-Solomidou, Melpo

    2017-01-01

    Background Secoisolariciresinol diglucoside (SDG), the main lignan in whole grain flaxseed, is a potent antioxidant and free radical scavenger with known radioprotective properties. However, the exact mechanism of SDG radioprotection is not well understood. The current study identified a novel mechanism of DNA radioprotection by SDG in physiological solutions by scavenging active chlorine species (ACS) and reducing chlorinated nucleobases. Methods The ACS scavenging activity of SDG was determined using two highly specific fluoroprobes: hypochlorite-specific 3′-(p-aminophenyl) fluorescein (APF) and hydroxyl radical-sensitive 3′-(p-hydroxyphenyl) fluorescein (HPF). Dopamine, an SDG structural analog, was used for proton 1H NMR studies to trap primary ACS radicals. Taurine N-chlorination was determined to demonstrate radiation-induced generation of hypochlorite, a secondary ACS. DNA protection was assessed by determining the extent of DNA fragmentation and plasmid DNA relaxation following exposure to ClO− and radiation. Purine base chlorination by ClO− and γ-radiation was determined by using 2-aminopurine (2-AP), a fluorescent analog of 6-aminopurine. Results: Chloride anions (Cl−) consumed >90% of hydroxyl radicals in physiological solutions produced by γ-radiation resulting in ACS formation, which was detected by 1H NMR. Importantly, SDG scavenged hypochlorite- and γ-radiation-induced ACS. In addition, SDG blunted ACS-induced fragmentation of calf thymus DNA and plasmid DNA relaxation. SDG treatment before or after ACS exposure decreased the ClO− or γ-radiation-induced chlorination of 2-AP. Exposure to γ-radiation resulted in increased taurine chlorination, indicative of ClO− generation. NMR studies revealed formation of primary ACS radicals (chlorine atoms (Cl•) and dichloro radical anions (Cl2−•)), which were trapped by SDG and its structural analog dopamine. Conclusion We demonstrate that γ-radiation induces the generation of ACS in physiological solutions. SDG treatment scavenged ACS and prevented ACS-induced DNA damage and chlorination of 2-aminopurine. This study identified a novel and unique mechanism of SDG radioprotection, through ACS scavenging, and supports the potential usefulness of SDG as a radioprotector and mitigator for radiation exposure as part of cancer therapy or accidental exposure. PMID:27261092

  18. Gamma-irradiation produces active chlorine species (ACS) in physiological solutions: Secoisolariciresinol diglucoside (SDG) scavenges ACS - A novel mechanism of DNA radioprotection.

    PubMed

    Mishra, Om P; Popov, Anatoliy V; Pietrofesa, Ralph A; Christofidou-Solomidou, Melpo

    2016-09-01

    Secoisolariciresinol diglucoside (SDG), the main lignan in whole grain flaxseed, is a potent antioxidant and free radical scavenger with known radioprotective properties. However, the exact mechanism of SDG radioprotection is not well understood. The current study identified a novel mechanism of DNA radioprotection by SDG in physiological solutions by scavenging active chlorine species (ACS) and reducing chlorinated nucleobases. The ACS scavenging activity of SDG was determined using two highly specific fluoroprobes: hypochlorite-specific 3'-(p-aminophenyl) fluorescein (APF) and hydroxyl radical-sensitive 3'-(p-hydroxyphenyl) fluorescein (HPF). Dopamine, an SDG structural analog, was used for proton (1)H NMR studies to trap primary ACS radicals. Taurine N-chlorination was determined to demonstrate radiation-induced generation of hypochlorite, a secondary ACS. DNA protection was assessed by determining the extent of DNA fragmentation and plasmid DNA relaxation following exposure to ClO(-) and radiation. Purine base chlorination by ClO(-) and γ-radiation was determined by using 2-aminopurine (2-AP), a fluorescent analog of 6-aminopurine. Chloride anions (Cl(-)) consumed >90% of hydroxyl radicals in physiological solutions produced by γ-radiation resulting in ACS formation, which was detected by (1)H NMR. Importantly, SDG scavenged hypochlorite- and γ-radiation-induced ACS. In addition, SDG blunted ACS-induced fragmentation of calf thymus DNA and plasmid DNA relaxation. SDG treatment before or after ACS exposure decreased the ClO(-) or γ-radiation-induced chlorination of 2-AP. Exposure to γ-radiation resulted in increased taurine chlorination, indicative of ClO(-) generation. NMR studies revealed formation of primary ACS radicals (chlorine atoms (Cl) and dichloro radical anions (Cl2¯)), which were trapped by SDG and its structural analog dopamine. We demonstrate that γ-radiation induces the generation of ACS in physiological solutions. SDG treatment scavenged ACS and prevented ACS-induced DNA damage and chlorination of 2-aminopurine. This study identified a novel and unique mechanism of SDG radioprotection, through ACS scavenging, and supports the potential usefulness of SDG as a radioprotector and mitigator for radiation exposure as part of cancer therapy or accidental exposure. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Anisotropic Brownian motion in ordered phases of DNA fragments.

    PubMed

    Dobrindt, J; Rodrigo Teixeira da Silva, E; Alves, C; Oliveira, C L P; Nallet, F; Andreoli de Oliveira, E; Navailles, L

    2012-01-01

    Using Fluorescence Recovery After Photobleaching, we investigate the Brownian motion of DNA rod-like fragments in two distinct anisotropic phases with a local nematic symmetry. The height of the measurement volume ensures the averaging of the anisotropy of the in-plane diffusive motion parallel or perpendicular to the local nematic director in aligned domains. Still, as shown in using a model specifically designed to handle such a situation and predicting a non-Gaussian shape for the bleached spot as fluorescence recovery proceeds, the two distinct diffusion coefficients of the DNA particles can be retrieved from data analysis. In the first system investigated (a ternary DNA-lipid lamellar complex), the magnitude and anisotropy of the diffusion coefficient of the DNA fragments confined by the lipid bilayers are obtained for the first time. In the second, binary DNA-solvent system, the magnitude of the diffusion coefficient is found to decrease markedly as DNA concentration is increased from isotropic to cholesteric phase. In addition, the diffusion coefficient anisotropy measured within cholesteric domains in the phase coexistence region increases with concentration, and eventually reaches a high value in the cholesteric phase.

  20. Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.

    PubMed

    Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M

    1985-10-30

    A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.

  1. Isolation of a promoter region in mouse cytochrome P450 3A (Cyp3A16) gene and its transcriptional control.

    PubMed

    Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T

    1997-02-07

    An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.

  2. In vitro anticancer activities of Leonurus heterophyllus sweet (Chinese motherwort herb).

    PubMed

    Chinwala, Maimoona G; Gao, Min; Dai, Jie; Shao, Jun

    2003-08-01

    To investigate the anticancer activities of Chinese motherwort herb (Leonurus heterophyllus Sweet; LHS). Dried LHS was extracted and reconstituted in phosphate-buffered saline. The in vitro antiproliferation activities of the extract were tested against seven human cancer cell lines. The DNA ladder assay and cell morphologic studies were performed to verify the drug's apoptotic activities. The possible pathway by which LHS induced apoptosis was also explored by examining mitochondrial depolarization, cytochrome c release, and caspase-3 activation. The LHS extract was effective in inhibiting the growth of all seven cancer cell lines tested. The IC(50) (50% inhibition concentrations, milligrams of raw material per milliliter) were in the range of 8.0-40.0 when the drug exposure time was 48 hours. The inhibitory action of the herbal extract was time- and dose-dependent. A significant decrease in activity was seen when the drug exposure time was shortened. Microscopic examination of the LN CaP and other cancer cell lines after treatment with LHS revealed morphologic changes that are typical of cells undergoing apoptosis. DNA fragmentation was obvious in the DNA latter assay and this confirmed the induction of apoptosis of the cancer cells by LHS. The mitochondria of the LHS-treated cells were found to undergo depolarization. Cytochrome c was released into the cytosol from the LHS-treated cells but not from the control cells. Cells treated with LHS showed cleavage of the full-length poly[ADP(ribose)] polymerase (PARP; 112 kd) to generate the 85-kd cleaved PARP fragment indicating the activation of caspase-3. LHS was able to induce apoptosis of all the tumor cell lines tested. The antiproliferation effect was dose- and time-dependent. The mitochondrion was found to be involved in the apoptosis induced by the LHS extract.

  3. Cloning and heterologous expression of blasticidin S biosynthetic genes from Streptomyces griseochromogenes.

    PubMed

    Cone, M C; Petrich, A K; Gould, S J; Zabriskie, T M

    1998-06-01

    Two small chromosomal DNA fragments (2.6 and 4.8 kb) from the blasticidin S producer Streptomyces griseochromogenes were cloned in the high copy number vector pIJ702 and shown to confer increased resistance to blasticidin S upon S. lividans TK24. These fragments were used to screen a library of S. griseochromogenes DNA prepared in the cosmid shuttle vector pOJ446. Cosmids containing DNA inserts of at least 23 kb were identified which hybridized to one or the other resistance fragment, but not to both. Transformation of S. lividans TK24 with several cosmids hybridizing with the 4.8 kb resistance fragment resulted in clones that produced cytosylglucuronic acid, the first intermediate of the blasticidin S biosynthetic pathway, and other blasticidin-related metabolites. A strain of S. lividans TK24 harboring both the 4.8 kb-hybridizing cosmid and the 2.6 kb resistance fragment cloned in pIJ702 produced 12.5 times as much demethylblasticidin S as the transformant harboring the cosmid alone.

  4. Dna2 nuclease-helicase structure, mechanism and regulation by Rpa

    PubMed Central

    Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P

    2015-01-01

    The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5’ end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5’ but not 3’ end, explaining how Rpa regulates cleavage polarity. DOI: http://dx.doi.org/10.7554/eLife.09832.001 PMID:26491943

  5. Detection of pork adulteration in processed meat by species-specific PCR-QIAxcel procedure based on D-loop and cytb genes.

    PubMed

    Barakat, Hassan; El-Garhy, Hoda A S; Moustafa, Mahmoud M A

    2014-12-01

    Detection of pork meat adulteration in "halal" meat products is a crucial issue in the fields of modern food inspection according to implementation of very strict procedures for halal food labelling. Present study aims at detecting and quantifying pork adulteration in both raw and cooked manufactured sausages. This is by applying an optimized species-specific PCR procedure followed by QIAxcel capillary electrophoresis system. Manufacturing experiment was designed by incorporating pork with beef meat at 0.01 to 10 % substitution levels beside beef and pork sausages as negative and positive controls, respectively. Subsequently, sausages were divided into raw and cooked sausages then subjected to DNA extraction. Results indicated that PCR amplifications of mitochondrial D-loop and cytochrome b (cytb) genes by porcine-specific primers produced 185 and 117 bp pork-specific DNA fragments in sausages, respectively. No DNA fragments were detected when PCR was applied on beef sausage DNA confirming primers specificity. For internal control, a 141-bp DNA fragment of eukaryotic 18S ribosomal RNA (rRNA) gene was amplified from pork and beef DNA templates. Although PCR followed by either QIAxcel or agarose techniques were efficient for targeted DNA fragments differentiation even as low as 0.01 % (pork/meat: w/w). For proficiency, adequacy, and performance, PCR-QIA procedure is highly sensitive, a time-saver, electronically documented, mutagenic-reagent free, of little manual errors, accurate in measuring PCR fragments length, and quantitative data supplier. In conclusion, it can be suggested that optimized PCR-QAI is considered as a rapid and sensitive method for routine pork detection and quantification in raw or processed meat.

  6. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    PubMed Central

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P < 0.001). Our findings suggest that lysogeny has increased the ability of some S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  7. Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

    PubMed Central

    Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

    2012-01-01

    The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

  8. Apoptosis induced in an early step of African swine fever virus entry into vero cells does not require virus replication.

    PubMed

    Carrascosa, Angel L; Bustos, María J; Nogal, María L; González de Buitrago, Gonzalo; Revilla, Yolanda

    2002-03-15

    Permissive Vero cells develop apoptosis, as characterized by DNA fragmentation, caspases activation, cytosolic release of mitochondrial cytochrome c, and flow cytometric analysis of DNA content, upon infection with African swine fever virus (ASFV). To determine the step in virus replication that triggers apoptosis, we used UV-inactivated virus, inhibitors of protein and nucleic acid synthesis, and lysosomotropic drugs that block virus uncoating. ASFV-induced apoptosis was accompanied by caspase-3 activation, which was detected even in the presence of either cytosine arabinoside or cycloheximide, indicating that viral DNA replication and protein synthesis were not required to activate the apoptotic process. The activation of caspase-3 was released from chloroquine inhibition 2 h after virus absorption, while the infection with UV-inactivated ASFV did not induce the activation of the caspase cascade. We conclude that ASFV induces apoptosis in the infected cell by an intracellular pathway probably triggered during the process of virus uncoating.

  9. Preliminary crystallographic analysis of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-[beta] receptor promoter DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Agarkar, Vinod B.; Babayeva, Nigar D.; Rizzino, Angie

    2010-10-08

    Ets proteins are transcription factors that activate or repress the expression of genes that are involved in various biological processes, including cellular proliferation, differentiation, development, transformation and apoptosis. Like other Ets-family members, Elf3 functions as a sequence-specific DNA-binding transcriptional factor. A mouse Elf3 C-terminal fragment (amino-acid residues 269-371) containing the DNA-binding domain has been crystallized in complex with mouse type II TGF-{beta} receptor promoter (TR-II) DNA. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 42.66, b = 52, c = 99.78 {angstrom}, and diffracted to a resolution of 2.2 {angstrom}.

  10. Palaeoproteomics for human evolution studies

    NASA Astrophysics Data System (ADS)

    Welker, Frido

    2018-06-01

    The commonplace sequencing of Neanderthal, Denisovan and ancient modern human DNA continues to revolutionize our understanding of hominin phylogeny and interaction(s). The challenge with older fossils is that the progressive fragmentation of DNA even under optimal conditions, a function of time and temperature, results in ever shorter fragments of DNA. This process continues until no DNA can be sequenced or reliably aligned. Ancient proteins ultimately suffer a similar fate, but are a potential alternative source of biomolecular sequence data to investigate hominin phylogeny given their slower rate of fragmentation. In addition, ancient proteins have been proposed to potentially provide insights into in vivo biological processes and can be used to provide additional ecological information through large scale ZooMS (Zooarchaeology by Mass Spectrometry) screening of unidentifiable bone fragments. However, as initially with ancient DNA, most ancient protein research has focused on Late Pleistocene or Holocene samples from Europe. In addition, only a limited number of studies on hominin remains have been published. Here, an updated review on ancient protein analysis in human evolutionary contexts is given, including the identification of specific knowledge gaps and existing analytical limits, as well as potential avenues to overcome these.

  11. A transmission imaging spectrograph and microfabricated channel system for DNA analysis.

    PubMed

    Simpson, J W; Ruiz-Martinez, M C; Mulhern, G T; Berka, J; Latimer, D R; Ball, J A; Rothberg, J M; Went, G T

    2000-01-01

    In this paper we present the development of a DNA analysis system using a microfabricated channel device and a novel transmission imaging spectrograph which can be efficiently incorporated into a high throughput genomics facility for both sizing and sequencing of DNA fragments. The device contains 48 channels etched on a glass substrate. The channels are sealed with a flat glass plate which also provides a series of apertures for sample loading and contact with buffer reservoirs. Samples can be easily loaded in volumes up to 640 nL without band broadening because of an efficient electrokinetic stacking at the electrophoresis channel entrance. The system uses a dual laser excitation source and a highly sensitive charge-coupled device (CCD) detector allowing for simultaneous detection of many fluorescent dyes. The sieving matrices for the separation of single-stranded DNA fragments are polymerized in situ in denaturing buffer systems. Examples of separation of single-stranded DNA fragments up to 500 bases in length are shown, including accurate sizing of GeneCalling fragments, and sequencing samples prepared with a reduced amount of dye terminators. An increase in sample throughput has been achieved by color multiplexing.

  12. Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths

    PubMed Central

    Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.

    2016-01-01

    As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011

  13. Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths.

    PubMed

    Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G

    2016-06-24

    As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.

  14. From milk to diet: feed recognition for milk authenticity.

    PubMed

    Ponzoni, E; Gianì, S; Mastromauro, F; Breviario, D

    2009-11-01

    The presence of plastidial DNA fragments of plant origin in animal milk samples has been confirmed. An experimental plan was arranged with 4 groups of goats, each provided with a different monophytic diet: 3 fresh forages (oats, ryegrass, and X-triticosecale) and one 2-wk-old silage (X-triticosecale). Feed-derived rubisco (ribulose bisphosphate carboxylase, rbcL) DNA fragments were detected in 100% of the analyzed goat milk samples, and the nucleotide sequence of the PCR-amplified fragments was found to be 100% identical to the corresponding fragments amplified from the plant species consumed in the diet. Two additional chloroplast-based molecular markers were used to set up an assay for distinctiveness, conveniently based on a simple PCR. In one case, differences in single nucleotides occurring within the gene encoding for plant maturase K (matK) were exploited. In the other, plant species recognition was based on the difference in the length of the intron present within the transfer RNA leucine (trnL) gene. The presence of plastidial plant DNA, ascertained by the PCR-based amplification of the rbcL fragment, was also assessed in raw cow milk samples collected directly from stock farms or taken from milk sold on the commercial market. In this case, the nucleotide sequence of the amplified DNA fragments reflected the multiple forages present in the diet fed to the animals.

  15. Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

    PubMed

    Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

    2017-12-01

    In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

  16. Evaluation of Microbial Diversity in Wetland through Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP)

    DTIC Science & Technology

    2006-06-01

    51 Appendix C. Promega Restriction Digest Protocol ....................................................53...Rsa1 Restriction Digest Results............................................................................180 9. DNA Base Pair Comparison...particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme (Edwards

  17. Pushing the Limit of Infrared Multiphoton Dissociation to Megadalton-Size DNA Ions.

    PubMed

    Doussineau, Tristan; Antoine, Rodolphe; Santacreu, Marion; Dugourd, Philippe

    2012-08-16

    We report the use of infrared multiphoton dissociation (IRMPD) for the determination of relative activation energies for unimolecular dissociation of megadalton DNA ions. Single ions with masses in the megadalton range were stored in an electrostatic ion trap for a few tens of milliseconds and the image current generated by the roundtrips of ions in the trap was recorded. While being trapped, single ions were irradiated by a CO2 laser and fragmented, owing to multiphoton IR activation. The analysis of the single-ion image current during the heating period allows us to measure changes in the charge of the trapped ion. We estimated the activation energy associated with the dissociation of megadalton-size DNA ions in the frame of an Arrhenius-like model by analyzing a large set of individual ions in order to construct a frequency histogram of the dissociation rates for a collection of ions.

  18. DNA methylation polymorphism in a set of elite rice cultivars and its possible contribution to inter-cultivar differential gene expression.

    PubMed

    Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao

    2004-01-01

    RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.

  19. Enzyme-Mediated Individual Nanoparticle Release Assay

    PubMed Central

    Glass, James R.; Dickerson, Janet C.; Schultz, David A.

    2007-01-01

    Numerous methods have been developed to measure the presence of macromolecular species in a sample, however methods that detect functional activity, or modulators of that activity are more limited. To address this limitation, an approach was developed that utilizes the optical detection of nanoparticles as a measure of enzyme activity. Nanoparticles are increasingly being used as biological labels in static binding assays; here we describe their use in a release assay format where the enzyme-mediated liberation of individual nanoparticles from a surface is measured. A double stranded fragment of DNA is used as the initial tether to bind the nanoparticles to a solid surface. The nanoparticle spatial distribution and number are determined using dark-field optical microscopy and digital image capture. Site specific cleavage of the DNA tether results in nanoparticle release. The methodology and validation of this approach for measuring enzyme-mediated, individual DNA cleavage events, rapidly, with high specificity, and in real-time is described. This approach was used to detect and discriminate between non-methylated and methylated DNA, and demonstrates a novel platform for high-throughput screening of modulators of enzyme activity. PMID:16620746

  20. Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

    PubMed Central

    Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

    2016-01-01

    Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

  1. Non-homologous end joining-mediated functional marker selection for DNA cloning in the yeast Kluyveromyces marxianus.

    PubMed

    Hoshida, Hisashi; Murakami, Nobutada; Suzuki, Ayako; Tamura, Ryoko; Asakawa, Jun; Abdel-Banat, Babiker M A; Nonklang, Sanom; Nakamura, Mikiko; Akada, Rinji

    2014-01-01

    The cloning of DNA fragments into vectors or host genomes has traditionally been performed using Escherichia coli with restriction enzymes and DNA ligase or homologous recombination-based reactions. We report here a novel DNA cloning method that does not require DNA end processing or homologous recombination, but that ensures highly accurate cloning. The method exploits the efficient non-homologous end-joining (NHEJ) activity of the yeast Kluyveromyces marxianus and consists of a novel functional marker selection system. First, to demonstrate the applicability of NHEJ to DNA cloning, a C-terminal-truncated non-functional ura3 selection marker and the truncated region were PCR-amplified separately, mixed and directly used for the transformation. URA3(+) transformants appeared on the selection plates, indicating that the two DNA fragments were correctly joined by NHEJ to generate a functional URA3 gene that had inserted into the yeast chromosome. To develop the cloning system, the shortest URA3 C-terminal encoding sequence that could restore the function of a truncated non-functional ura3 was determined by deletion analysis, and was included in the primers to amplify target DNAs for cloning. Transformation with PCR-amplified target DNAs and C-terminal truncated ura3 produced numerous transformant colonies, in which a functional URA3 gene was generated and was integrated into the chromosome with the target DNAs. Several K. marxianus circular plasmids with different selection markers were also developed for NHEJ-based cloning and recombinant DNA construction. The one-step DNA cloning method developed here is a relatively simple and reliable procedure among the DNA cloning systems developed to date. Copyright © 2013 John Wiley & Sons, Ltd.

  2. The GAN Exonuclease or the Flap Endonuclease Fen1 and RNase HII Are Necessary for Viability of Thermococcus kodakarensis.

    PubMed

    Burkhart, Brett W; Cubonova, Lubomira; Heider, Margaret R; Kelman, Zvi; Reeve, John N; Santangelo, Thomas J

    2017-07-01

    Many aspects of and factors required for DNA replication are conserved across all three domains of life, but there are some significant differences surrounding lagging-strand synthesis. In Archaea , a 5'-to-3' exonuclease, related to both bacterial RecJ and eukaryotic Cdc45, that associates with the replisome specifically through interactions with GINS was identified and designated GAN (for G INS- a ssociated n uclease). Despite the presence of a well-characterized flap endonuclease (Fen1), it was hypothesized that GAN might participate in primer removal during Okazaki fragment maturation, and as a Cdc45 homologue, GAN might also be a structural component of an archaeal CMG (Cdc45, MCM, and GINS) replication complex. We demonstrate here that, individually, either Fen1 or GAN can be deleted, with no discernible effects on viability and growth. However, deletion of both Fen1 and GAN was not possible, consistent with both enzymes catalyzing the same step in primer removal from Okazaki fragments in vivo RNase HII has also been proposed to participate in primer processing during Okazaki fragment maturation. Strains with both Fen1 and RNase HII deleted grew well. GAN activity is therefore sufficient for viability in the absence of both RNase HII and Fen1, but it was not possible to construct a strain with both RNase HII and GAN deleted. Fen1 alone is therefore insufficient for viability in the absence of both RNase HII and GAN. The ability to delete GAN demonstrates that GAN is not required for the activation or stability of the archaeal MCM replicative helicase. IMPORTANCE The mechanisms used to remove primer sequences from Okazaki fragments during lagging-strand DNA replication differ in the biological domains. Bacteria use the exonuclease activity of DNA polymerase I, whereas eukaryotes and archaea encode a flap endonuclease (Fen1) that cleaves displaced primer sequences. RNase HII and the GINS-associated exonuclease GAN have also been hypothesized to assist in primer removal in Archaea Here we demonstrate that in Thermococcus kodakarensis , either Fen1 or GAN activity is sufficient for viability. Furthermore, GAN can support growth in the absence of both Fen1 and RNase HII, but Fen1 and RNase HII are required for viability in the absence of GAN. Copyright © 2017 American Society for Microbiology.

  3. Intrinsic anticarcinogenic effects of Piper sarmentosum ethanolic extract on a human hepatoma cell line

    PubMed Central

    Zainal Ariffin, Shahrul Hisham; Wan Omar, Wan Haifa Haryani; Zainal Ariffin, Zaidah; Safian, Muhd Fauzi; Senafi, Sahidan; Megat Abdul Wahab, Rohaya

    2009-01-01

    Background Piper sarmentosum, locally known as kaduk is belonging to the family of Piperaceae. It is our interest to evaluate their effect on human hepatoma cell line (HepG2) for the potential of anticarcinogenic activity. Results The anticarcinogenic activity of an ethanolic extract from Piper sarmentosum in HepG2 and non-malignant Chang's liver cell lines has been previously determined using (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide) (MTT) assays, where the IC50 value was used as a parameter for cytotoxicity. The ethanolic extract that showed anticarcinogenic properties in HepG2 cells had an IC50 of 12.5 μg mL-1, while IC50 values in the non-malignant Chang's liver cell line were greater than 30 μg mL-1. Apoptotic morphological changes in HepG2 cells were observed using an inverted microscope and showed chromatin condensation, cell shrinkage and apoptotic bodies following May-Grunwald-Giemsa's staining. The percentage of apoptotic cells in the overall population (apoptotic index) showed a continuously significant increase (p < 0.05) in 12.5 μg mL-1 ethanolic extract-treated cells at 24, 48 and 72 hours compared to controls (untreated cells). Following acridine orange and ethidium bromide staining, treatment with 10, 12 and 14 μg mL-1 of ethanolic extracts caused typical apoptotic morphological changes in HepG2 cells. Molecular analysis of DNA fragmentation was used to examine intrinsic apoptosis induced by the ethanolic extracts. These results showed a typical intrinsic apoptotic characterisation, which included fragmentation of nuclear DNA in ethanolic extract-treated HepG2 cells. However, the non-malignant Chang's liver cell line produced no DNA fragmentation. In addition, the DNA genome was similarly intact for both the untreated non-malignant Chang's liver and HepG2 cell lines. Conclusion Therefore, our results suggest that the ethanolic extract from P. sarmentosum induced anticarcinogenic activity through an intrinsic apoptosis pathway in HepG2 cells in vitro. PMID:19257877

  4. Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

    PubMed Central

    Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

    1974-01-01

    Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

  5. Endonuclease from Gram-Negative Bacteria Serratia marcescens Is as Effective as Pulmozyme in the Hydrolysis of DNA in Sputum

    PubMed Central

    Vafina, Gulnaz; Zainutdinova, Elmira; Bulatov, Emil; Filimonova, Maria N.

    2018-01-01

    One of the approaches to effective airway cleansing is the degradation of DNA into smaller fragments. For this purpose Pulmozyme® is used with high efficacy because it contains recombinant DNase I as its active component. The aim of the study was to comparatively analyze DNase activity of Pulmozyme® and the nuclease from gram-negative bacteria Serratia marcescens, because at optimal conditions the catalytic efficiency of the nuclease is much higher than the efficiency of DNase I. Highly polymerized DNA and purulent-mucous sputum were used as substrates. The examination showed that both S. marcescens nuclease and Pulmozyme® hydrolyzed DNA in sputum. Also S. marcescens nuclease was found capable of hydrolyzing DNA in conditions that are standard for Pulmozyme® and suitable for its therapeutic application. For manifesting the similar hydrolytic activity the nuclease amount in the assay mixture containing highly polymerized DNA or the sonicated sputum and NaCl together with calcium- or magnesium- cations can be about 10- time lower than that of the recombinant DNase I. In the presence of magnesium cations the DNase activity of both S. marcescens nuclease and Pulmozyme® was higher than in the presence of calcium cations. PMID:29503617

  6. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  7. Scorpion venom (Odontobuthus doriae) induces apoptosis by depolarization of mitochondria and reduces S-phase population in human breast cancer cells (MCF-7).

    PubMed

    Zargan, Jamil; Umar, Sadiq; Sajad, Mir; Naime, M; Ali, Shakir; Khan, Haider A

    2011-12-01

    Venom of some species of scorpions induces apoptosis and arrests proliferation in cancer cells. This is an important property that can be harnessed and can lead to isolation of compounds of therapeutic importance in cancer research. Cytotoxicity was investigated using MTT reduction and confirmed with lactate dehydrogenase release following venom exposure. Apoptosis was evaluated with determination of mitochondrial membrane potential, reactive nitrogen species assay, measurement of Caspase-3 activity and DNA fragmentation analysis. To confirm that venom can inhibit DNA synthesis in proliferating breast cancer cells, immunocytochemical detection of BrdU incorporation was done. Our results demonstrated that venom of Odontobuthus doriae not only induced apoptosis but lead to the inhibition of DNA synthesis in human breast cancer cells (MCF-7). Cell viability decreased with parallel increment of LDH release in dose dependent manner after treatment with varying concentrations of venom. Moreover, venom depleted cellular antioxidants evidenced by depression of GSH and Catalases and concomitantly increased reactive nitrogen intermediates (RNI). These events were related to the depolarization of mitochondria and associated Caspase-3 activation following venom treatment in a concentration dependent manner. Finally, fragmentation of nuclear DNA following venom treatment confirmed the apoptotic property of the said venom. These results suggest that venom of O. doriae can be potential source for the isolation of effective anti-proliferative and apoptotic molecules. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Houttuynia cordata Thunb extract modulates G0/G1 arrest and Fas/CD95-mediated death receptor apoptotic cell death in human lung cancer A549 cells

    PubMed Central

    2013-01-01

    Background Houttuynia cordata Thunb (HCT) is commonly used in Taiwan and other Asian countries as an anti-inflammatory, antibacterial and antiviral herbal medicine. In this study, we investigated the anti-human lung cancer activity and growth inhibition mechanisms of HCT in human lung cancer A549 cells. Results In order to investigate effects of HCT on A549 cells, MTT assay was used to evaluate cell viability. Flow cytometry was employed for cell cycle analysis, DAPI staining, and the Comet assay was used for DNA fragmentation and DNA condensation. Western blot analysis was used to analyze cell cycle and apoptotic related protein levels. HCT induced morphological changes including cell shrinkage and rounding. HCT increased the G0/G1 and Sub-G1 cell (apoptosis) populations and HCT increased DNA fragmentation and DNA condensation as revealed by DAPI staining and the Comet assay. HCT induced activation of caspase-8 and caspase-3. Fas/CD95 protein levels were increased in HCT-treated A549 cells. The G0/G1 phase and apoptotic related protein levels of cyclin D1, cyclin A, CDK 4 and CDK 2 were decreased, and p27, caspase-8 and caspase-3 were increased in A549 cells after HCT treatment. Conclusions The results demonstrated that HCT-induced G0/G1 phase arrest and Fas/CD95-dependent apoptotic cell death in A549 cells PMID:23506616

  9. Cascade DNA nanomachine and exponential amplification biosensing.

    PubMed

    Xu, Jianguo; Wu, Zai-Sheng; Shen, Weiyu; Xu, Huo; Li, Hongling; Jia, Lee

    2015-11-15

    DNA is a versatile scaffold for the assembly of multifunctional nanostructures, and potential applications of various DNA nanodevices have been recently demonstrated for disease diagnosis and treatment. In the current study, a powerful cascade DNA nanomachine was developed that can execute the exponential amplification of p53 tumor suppressor gene. During the operation of the newly-proposed DNA nanomachine, dual-cyclical nucleic acid strand-displacement polymerization (dual-CNDP) was ingeniously introduced, where the target trigger is repeatedly used as the fuel molecule and the nicked fragments are dramatically accumulated. Moreover, each displaced nicked fragment is able to activate the another type of cyclical strand-displacement amplification, increasing exponentially the value of fluorescence intensity. Essentially, one target binding event can induce considerable number of subsequent reactions, and the nanodevice was called cascade DNA nanomachine. It can implement several functions, including recognition element, signaling probe, polymerization primer and template. Using the developed autonomous operation of DNA nanomachine, the p53 gene can be quantified in the wide concentration range from 0.05 to 150 nM with the detection limit of 50 pM. If taking into account the final volume of mixture, the detection limit is calculated as lower as 6.2 pM, achieving an desirable assay ability. More strikingly, the mutant gene can be easily distinguished from the wild-type one. The proof-of-concept demonstrations reported herein is expected to promote the development and application of DNA nanomachine, showing great potential value in basic biology and medical diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Accurate characterization of carcinogenic DNA adducts using MALDI tandem time-of-flight mass spectrometry

    NASA Astrophysics Data System (ADS)

    Barnes, Charles A.; Chiu, Norman H. L.

    2009-01-01

    Many chemical carcinogens and their in vivo activated metabolites react readily with genomic DNA, and form covalently bound carcinogen-DNA adducts. Clinically, carcinogen-DNA adducts have been linked to various cancer diseases. Among the current methods for DNA adduct analysis, mass spectroscopic method allows the direct measurement of unlabeled DNA adducts. The goal of this study is to explore the use of matrix-assisted laser desorption/ionization tandem time-of-flight mass spectrometry (MALDI-TOF/TOF MS) to determine the identity of carcinogen-DNA adducts. Two of the known carcinogenic DNA adducts, namely N-(2'-deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenyl-imidazo [4,5-b] pyridine (dG-C8-PhIP) and N-(2'-deoxyguanosin-8yl)-4-aminobiphenyl (dG-C8-ABP), were selected as our models. In MALDI-TOF MS measurements, the small matrix ion and its cluster ions did not interfere with the measurements of both selected dG adducts. To achieve a higher accuracy for the characterization of selected dG adducts, 1 keV collision energy in MALDI-TOF/TOF MS/MS was used to measure the adducts. In comparison to other MS/MS techniques with lower collision energies, more extensive precursor ion dissociations were observed. The detection of the corresponding fragment ions allowed the identities of guanine, PhIP or ABP, and the position of adduction to be confirmed. Some of the fragment ions of dG-C8-PhIP have not been reported by other MS/MS techniques.

  11. Effect of pyrimido[1,6-a]benzimidazoles, quinolones, and Ca2+ on the DNA gyrase-mediated cleavage reaction.

    PubMed Central

    Gmünder, H; Kuratli, K; Keck, W

    1995-01-01

    The quinolones inhibit the A subunit of DNA gyrase in the presence of Mg2+ by interrupting the DNA breakage and resealing steps, and the latter step is also retarded without quinolones if Mg2+ is replaced by Ca2+. Pyrimido[1,6-a]benzimidazoles have been found to represent a new class of potent DNA gyrase inhibitors which also act at the A subunit. To determine alterations in the DNA sequence specificity of DNA gyrase for cleavage sites in the presence of inhibitors of both classes or in the presence of Ca2+, we used DNA restriction fragments of 164, 85, and 71 bp from the pBR322 plasmid as model substrates. Each contained, at a different position, the 20-bp pBR322 sequence around position 990, where DNA gyrase preferentially cleaves in the presence of quinolones. Our results show that pyrimido[1,6-a]benzimidazoles have a mode of action similar to that of quinolones; they inhibit the resealing step and influence the DNA sequence specificity of DNA gyrase in the same way. Differences between inhibitors of both classes could be observed only in the preferences of DNA gyrase for these cleavage sites. The 20-bp sequence appeared to have some properties that induced DNA gyrase to cleave all three DNA fragments in the presence of inhibitors within this sequence, whereas cleavage in the presence of Ca2+ was in addition dependent on the length of the DNA fragments. PMID:7695300

  12. Fluorescence resonance energy transfer analysis of escherichia coli RNA polymerase and polymerase-DNA complexes.

    PubMed

    Heyduk, T; Niedziela-Majka, A

    Fluorescence resonance energy transfer (FRET) is a technique allowing measurements of atomic-scale distances in diluted solutions of macromolecules under native conditions. This feature makes FRET a powerful tool to study complicated biological assemblies. In this report we review the applications of FRET to studies of transcription initiation by Escherichia coli RNA polymerase. The versatility of FRET for studies of a large macromolecular assembly such as RNA polymerase is illustrated by examples of using FRET to address several different aspects of transcription initiation by polymerase. FRET has been used to determine the architecture of polymerase, its complex with single-stranded DNA, and the conformation of promoter fragment bound to polymerase. FRET has been also used as a binding assay to determine the thermodynamics of promoter DNA fragment binding to the polymerase. Functional conformational changes in the specificity subunit of polymerase responsible for the modulation of the promoter binding activity of the enzyme and the mechanistic aspects of the transition from the initiation to the elongation complex were also investigated. Copyright 2002 Wiley Periodicals, Inc.

  13. Isolation and characterization of the DNA-binding protein (DBP) of the Autographa californica multiple nucleopolyhedrovirus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikhailov, Victor S.; N. K. Koltzov Institute of Developmental Biology, Russian Academy of Sciences, Moscow 117808; Vanarsdall, Adam L.

    2008-01-20

    DNA-binding protein (DBP) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) was expressed as an N-terminal His{sub 6}-tag fusion using a recombinant baculovirus and purified to near homogeneity. Purified DBP formed oligomers that were crosslinked by redox reagents resulting in predominantly protein dimers and tetramers. In gel retardation assays, DBP showed a high affinity for single-stranded oligonucleotides and was able to compete with another baculovirus SSB protein, LEF-3, for binding sites. DBP binding protected ssDNA against hydrolysis by a baculovirus alkaline nuclease AN/LEF-3 complex. Partial proteolysis by trypsin revealed a domain structure of DBP that is required for interaction with DNA andmore » that can be disrupted by thermal treatment. Binding to ssDNA, but not to dsDNA, changed the pattern of proteolytic fragments of DBP indicating adjustments in protein structure upon interaction with ssDNA. DBP was capable of unwinding short DNA duplexes and also promoted the renaturation of long complementary strands of ssDNA into duplexes. The unwinding and renaturation activities of DBP, as well as the DNA binding activity, were sensitive to sulfhydryl reagents and were inhibited by oxidation of thiol groups with diamide or by alkylation with N-ethylmaleimide. A high affinity of DBP for ssDNA and its unwinding and renaturation activities confirmed identification of DBP as a member of the SSB/recombinase family. These activities and a tight association with subnuclear structures suggests that DBP is a component of the virogenic stroma that is involved in the processing of replicative intermediates.« less

  14. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    NASA Astrophysics Data System (ADS)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  15. Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila

    PubMed Central

    Saveliev, Sergei V.; Cox, Michael M.

    2001-01-01

    DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15–16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form. PMID:11406601

  16. Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila.

    PubMed

    Saveliev, S V; Cox, M M

    2001-06-15

    DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15-16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form.

  17. Differentiation of mixed biological traces in sexual assaults using DNA fragment analysis

    PubMed Central

    Apostolov, Аleksandar

    2014-01-01

    During the investigation of sexual abuse, it is not rare that mixed genetic material from two or more persons is detected. In such cases, successful profiling can be achieved using DNA fragment analysis, resulting in individual genetic profiles of offenders and their victims. This has led to an increase in the percentage of identified perpetrators of sexual offenses. The classic and modified genetic models used, allowed us to refine and implement appropriate extraction, polymerase chain reaction and electrophoretic procedures with individual assessment and approach to conducting research. Testing mixed biological traces using DNA fragment analysis appears to be the only opportunity for identifying perpetrators in gang rapes. PMID:26019514

  18. The residual repair capacity of xeroderma pigmentosum complementation group C fibroblasts is highly specific for transcriptionally active DNA.

    PubMed Central

    Venema, J; van Hoffen, A; Natarajan, A T; van Zeeland, A A; Mullenders, L H

    1990-01-01

    We have measured removal of pyrimidine dimers in defined DNA sequences in confluent and actively growing normal human and xeroderma pigmentosum complementation group C (XP-C) fibroblasts exposed to 10 J/m2 UV-irradiation. In normal fibroblasts 45% and 90% of the dimers are removed from the transcriptionally active adenosine deaminase (ADA) gene within 4 and 24 hours after irradiation respectively. Equal repair efficiencies are found in fragments located entirely within the transcription unit or partly in the 3' flanking region of the ADA gene. The rate and extent of dimer removal from the dihydrofolate reductase (DHFR) gene is very similar to that of the ADA gene. Repair of the transcriptionally inactive 754 locus is less efficient: 18% and 52% of the dimers are removed within 4 and 24 hours respectively. In spite of the limited overall repair capacity, confluent XP-C fibroblasts efficiently remove dimers from the ADA and DHFR genes: about 90% and 50% within 24 hours respectively. The 3' end of the ADA gene is repaired as efficiently as in normal human fibroblasts, but less efficient repair occurs in DNA fragments located in the DHFR gene and at the 5' end of the ADA gene. Repair of the inactive 754 locus does not exceed the very slow rate of dimer removal from the genome overall. Confluent and actively growing XP-C cells show similar efficiencies of repair of the ADA, DHFR and 754 genes. Our findings suggest the existence of two independently operating pathways directed towards repair of pyrimidine dimers in either active or inactive chromatin. XP-C cells have lost the capacity to repair inactive chromatin, but are still able to repair active chromatin. Images PMID:2308842

  19. ACTIVE EFFLUX OF ORGANIC SOLVENTS BY PSEUDOMONAS PUTIDA S12 IS INDUCED BY SOLVENTS

    EPA Science Inventory

    Induction of the membrane-associated organic solvent efflux system SrpABC of Pseudomonas putida S12 was examined by cloning a 312-bp DNA fragment, containing the srp promoter, in the broad-host-range reporter vector pKRZ-1. Compounds that are capable of inducing expression of the...

  20. Apoptosis: A Four-Week Laboratory Investigation for Advanced Molecular and Cellular Biology Students

    ERIC Educational Resources Information Center

    DiBartolomeis, Susan M.; Mone, James P.

    2003-01-01

    Over the past decade, apoptosis has emerged as an important field of study central to ongoing research in many diverse fields, from developmental biology to cancer research. Apoptosis proceeds by a highly coordinated series of events that includes enzyme activation, DNA fragmentation, and alterations in plasma membrane permeability. The detection…

  1. Targeting ceramide metabolic pathway induces apoptosis in human breast cancer cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vethakanraj, Helen Shiphrah; Babu, Thabraz Ahmed; Sudarsanan, Ganesh Babu

    2015-08-28

    The sphingolipid ceramide is a pro apoptotic molecule of ceramide metabolic pathway and is hydrolyzed to proliferative metabolite, sphingosine 1 phosphate by the action of acid ceramidase. Being upregulated in the tumors of breast, acid ceramidase acts as a potential target for breast cancer therapy. We aimed at targeting this enzyme with a small molecule acid ceramidase inhibitor, Ceranib 2 in human breast cancer cell lines MCF 7 and MDA MB 231. Ceranib 2 effectively inhibited the growth of both the cell lines in dose and time dependant manner. Morphological apoptotic hallmarks such as chromatin condensation, fragmented chromatin were observedmore » in AO/EtBr staining. Moreover, ladder pattern of fragmented DNA observed in DNA gel electrophoresis proved the apoptotic activity of Ceranib 2 in breast cancer cell lines. The apoptotic events were associated with significant increase in the expression of pro-apoptotic genes (Bad, Bax and Bid) and down regulation of anti-apoptotic gene (Bcl 2). Interestingly, increase in sub G1 population of cell cycle phase analysis and elevated Annexin V positive cells after Ceranib 2 treatment substantiated its apoptotic activity in MCF 7 and MDA MB 231 cell lines. Thus, we report Ceranib 2 as a potent therapeutic agent against both ER{sup +} and ER{sup −} breast cancer cell lines. - Highlights: • Acid Ceramidase inhibitor, Ceranib 2 induced apoptosis in Breast cancer cell lines (MCF 7 and MDA MB 231 cell lines). • Apoptosis is mediated by DNA fragmentation and cell cycle arrest. • Ceranib 2 upregulated the expression of pro-apoptotic genes and down regulated anti-apoptotic gene expression. • More potent compared to the standard drug Tamoxifen.« less

  2. Tributyltin triggers apoptosis in trout hepatocytes: the role of Ca2+, protein kinase C and proteases.

    PubMed

    Reader, S; Moutardier, V; Denizeau, F

    1999-01-11

    The purpose of the present study was to study the mechanisms involved in the induction of apoptosis and by tributyltin (TBT) in rainbow trout hepatocytes, and to examine the role of intracellular Ca2+, protein kinase C (PKC) and proteases in the apoptotic process. The intracellular Ca2+ chelator BAPTA-AM has a suppressive effect on TBT-mediated apoptosis. However, exposure to the ionophore A23187 is not sufficient to induce apoptosis in trout hepatocytes. The results obtained also show that TBT stimulates PKC gamma and delta translocation from cytosol to the plasma membrane in trout hepatocytes after 30 min of exposure. However, PKC gamma translocation is down-regulated after 90 min of treatment. The addition of protein kinase inhibitors (staurosporine and H-7) not only fails to inhibit apoptosis induced by TBT, but also leads to enhancement of DNA fragmentation. These inhibitors also afford a remarkable protection against the loss of plasma membrane integrity caused by TBT exposure. PMA, a direct activator of PKC, fails to stimulate DNA fragmentation. In addition, Z-VAD.FMK is an extremely potent inhibitor of TBT-induced apoptosis in trout hepatocytes, indicating that the activation of ICE-like proteases is a key event in this process. The cysteine protease inhibitor N-ethylmaleimide also prevented TBT-induced DNA fragmentation. Taken together, these data allow for the first time to suggest a mechanistic model of TBT-induced apoptosis. We propose that TBT could trigger apoptosis through a step involving Ca2+ efflux from the endoplasmic reticulum or other intracellular pools and by mechanisms involving cysteine proteases, such as calpains, as well as the phosphorylation status of apoptotic proteins such as Bcl-2 homologues.

  3. Plasma DNA aberrations in systemic lupus erythematosus revealed by genomic and methylomic sequencing

    PubMed Central

    Chan, Rebecca W. Y.; Jiang, Peiyong; Peng, Xianlu; Tam, Lai-Shan; Liao, Gary J. W.; Li, Edmund K. M.; Wong, Priscilla C. H.; Sun, Hao; Chan, K. C. Allen; Chiu, Rossa W. K.; Lo, Y. M. Dennis

    2014-01-01

    We performed a high-resolution analysis of the biological characteristics of plasma DNA in systemic lupus erythematosus (SLE) patients using massively parallel genomic and methylomic sequencing. A number of plasma DNA abnormalities were found. First, aberrations in measured genomic representations (MGRs) were identified in the plasma DNA of SLE patients. The extent of the aberrations in MGRs correlated with anti-double–stranded DNA (anti-dsDNA) antibody level. Second, the plasma DNA of active SLE patients exhibited skewed molecular size-distribution profiles with a significantly increased proportion of short DNA fragments. The extent of plasma DNA shortening in SLE patients correlated with the SLE disease activity index (SLEDAI) and anti-dsDNA antibody level. Third, the plasma DNA of active SLE patients showed decreased methylation densities. The extent of hypomethylation correlated with SLEDAI and anti-dsDNA antibody level. To explore the impact of anti-dsDNA antibody on plasma DNA in SLE, a column-based protein G capture approach was used to fractionate the IgG-bound and non–IgG-bound DNA in plasma. Compared with healthy individuals, SLE patients had higher concentrations of IgG-bound DNA in plasma. More IgG binding occurs at genomic locations showing increased MGRs. Furthermore, the IgG-bound plasma DNA was shorter in size and more hypomethylated than the non–IgG-bound plasma DNA. These observations have enhanced our understanding of the spectrum of plasma DNA aberrations in SLE and may provide new molecular markers for SLE. Our results also suggest that caution should be exercised when interpreting plasma DNA-based noninvasive prenatal testing and cancer testing conducted for SLE patients. PMID:25427797

  4. Characterization of DNA condensates induced by poly(ethylene oxide) and polylysine.

    PubMed Central

    Laemmli, U K

    1975-01-01

    High-molecular-weight DNA is known to collapse into very compact particles in a salt solution containing polymers like poly(ethylene oxide) [(EO)n] or polyacrylate. The biological relevance of this phenomenon is suggested by our recent finding that high concentrations of the highly acidic internal peptides found in the mature T4 bacteriophage head, as well as poly(glutamic acid) and poly(aspartic acid), can collapse DNA in a similar manner. The structure of DNAs collapsed by various methods has been studied with electron microscope. We find (EO)n collapses T4 or T7 bacteriophage DNA into compact particles only slightly larger than the size of the T4 and T7 head, respectively. In contrast, polylysine collapses DNA into different types of structures. Double-stranded DNA collapsed with (EO)n is cut by the single-strand specific Neurospora crassa endonuclease (EC 3.1.4.21) into small fragments. Extensive digestion only occurs above the critical concentration of polymer required for DNA collapse, demonstrating the (EO)n-collapsed DNA contains enzyme-vulnerable regions (probably at each fold), which are preferentially attacked. The size of the DNA fragments produced by limit-digestion with the nuclease ranges between 200 and 400 base pairs when DNA is collapsed by (EO)n. Only fragments of DNA which are larger than 600 base pairs are cut by the endonuclease in (EO)n-containing solution. Images PMID:1060108

  5. Characterization of the Origin of DNA Replication of the Coxiella burnetii Chromosome

    DTIC Science & Technology

    1990-01-26

    chromosomal DNAs (FIG. IB): the 19.4-kb EcoR I fragment of Salmonella typhimurium DNA (lane 4),9 the 17.5-kb Sal I fragment of Enterobacter aerogenes ...IacZYA-argF) U 1694680d IacZAM15 Salmonella typhimurium Wild type WVUd Kiebsiella pneumoniae Wild type WVUd Enterobacter aero genes Wild type WVUd... aerogenes and K. pneumoniae were digested with appropriate restriction enzymes. The restriction fragments were separated on a 0.9% agarose gel, transferred to

  6. Detection of restriction fragment length polymorphisms in clinical isolates and serially passaged Pseudomonas aeruginosa strains.

    PubMed Central

    Hjelm, L N; Branstrom, A A; Warren, R L

    1990-01-01

    An 800-base-pair HindIII-PstI fragment that flanks a hot spot for Tn7 insertion was isolated from the chromosome of Pseudomonas aeruginosa and cloned into pUC12. The fragment was used to probe XhoI digests of genomic DNA from 18 P. aeruginosa isolates collected from sputum samples of seven cystic fibrosis patients. Only two XhoI restriction fragment length polymorphisms (RFLPs), of 3.7 and 7.7 kilobases (kb), were detected. Isolate WSU3531-1 (3.7-kb XhoI fragment) and WSU3860 (7.7-kb XhoI fragment), while isolated from the same patient, showed different RFLPs. Serial passages of isolate WSU3531-1 demonstrated that this strain was phenotypically stable. In contrast, colony and pigment variants were readily isolated at a frequency of 1% from serial passages of isolate WSU3860. When XhoI-digested genomic DNA from phenotypic variants of serially passaged WSU3860 were probed with the 800-base-pair HindIII-PstI fragment, the probe hybridized to a 10.4-kb XhoI fragment from three isolates. Restriction analysis of the genomic DNA digested with a variety of restriction enzymes showed that a 2.7-kb insertion occurred in the same region for all three isolates. There appeared to be no correlation between changes in the RFLP and changes in colony morphology. Images PMID:1977762

  7. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    PubMed

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and reproduction performance.

  8. Fragment length polymorphisms among independent isolates of Epstein-Barr virus from immunocompromised and normal hosts.

    PubMed

    Katz, B Z; Niederman, J C; Olson, B A; Miller, G

    1988-02-01

    DNA restriction fragment length polymorphisms of Epstein-Barr virus (EBV) DNA were used as a molecular epidemiological tool to study multiple isolates of virus from the same and different individuals. We studied 35 EBV isolates: 19 from seven immunocompromised children and 16 from seven college students with mononucleosis. Analysis of the fragment length polymorphisms in this collection of isolates permitted several conclusions. Sites of polymorphism were most often encountered in regions with repetitive DNA. Epidemiologically unrelated patients harbored viruses that could be readily distinguished; by contrast, two infants and their mothers harbored similar viruses. Isolates from different sites in the same patient were similar. Variations between different clinical isolates of EBV mimic those found between different laboratory strains of the virus. Fragment length polymorphisms thus provide a useful marker for studying transmission and pathogenesis of EBV infections.

  9. Construction of promoter-probe shuttle vectors for Escherichia coli and corynebacteria on the basis of promoterless alpha-amylase gene.

    PubMed

    Ugorcáková, J; Bukovská, G; Timko, J

    2000-01-01

    We constructed new promoter-probe vectors for E. coli and corynebacteria based on the promoterless alpha-amylase gene originating from Bacillus subtilis. Vectors pJUPAE1 and pJUPAE2 are suitable for isolation of transcriptionally active fragments from plasmids, phages or genomic DNA. alpha-Amylase activity can be easily visually detected on agar plates containing a chromogenic substrate, or by direct measurement of alpha-amylase activity.

  10. Functional Domains of the TOL Plasmid Transcription Factor XylS

    PubMed Central

    Kaldalu, Niilo; Toots, Urve; de Lorenzo, Victor; Ustav, Mart

    2000-01-01

    The alkylbenzoate degradation genes of Pseudomonas putida TOL plasmid are positively regulated by XylS, an AraC family protein, in a benzoate-dependent manner. In this study, we used deletion mutants and hybrid proteins to identify which parts of XylS are responsible for the DNA binding, transcriptional activation, and benzoate inducibility. We found that a 112-residue C-terminal fragment of XylS binds specifically to the Pm operator in vitro, protects this sequence from DNase I digestion identically to the wild-type (wt) protein, and activates the Pm promoter in vivo. When overexpressed, that C-terminal fragment could activate transcription as efficiently as wt XylS. All the truncations, which incorporated these 112 C-terminal residues, were able to activate transcription at least to some extent when overproduced. Intactness of the 210-residue N-terminal portion was found to be necessary for benzoate responsiveness of XylS. Deletions in the N-terminal and central regions seriously reduced the activity of XylS and caused the loss of effector control, whereas insertions into the putative interdomain region did not change the basic features of the XylS protein. Our results confirm that XylS consists of two parts which probably interact with each other. The C-terminal domain carries DNA-binding and transcriptional activation abilities, while the N-terminal region carries effector-binding and regulatory functions. PMID:10648539

  11. Cloning and characterization of Bacillus subtilis iep, which has positive and negative effects on production of extracellular proteases.

    PubMed Central

    Tanaka, T; Kawata, M

    1988-01-01

    We have isolated a DNA fragment from Bacillus subtilis 168 which, when present in a high-copy plasmid, inhibited production of extracellular alkaline and neutral proteases. The gene responsible for this activity was referred to as iep. The open reading frame of iep was found to be incomplete in the cloned DNA fragment. When the intact iep gene was reconstructed after the missing part of the iep gene had been cloned, it showed an enhancing effect on the production of the extracellular proteases. The open reading frame encodes a polypeptide of 229 amino acids with a molecular weight of ca. 25,866. Deletion of two amino acids from the N-terminal half of the putative iep protein resulted in dual effects, i.e., a decrease in the inhibitory activity shown by the incomplete iep gene and a slight increase in the enhancing activity shown by the complete iep gene. These results show that the iep gene product is a bifunctional protein, containing inhibitory and enhancing activities for the exoprotease production in the N-terminal and C-terminal regions, respectively. It was found by genetic and functional analyses that iep lies very close to sacU. Images PMID:3136143

  12. Evaluation of oxidative DNA damage promoted by storage in sperm from sex-reversed rainbow trout.

    PubMed

    Pérez-Cerezales, S; Martínez-Páramo, S; Cabrita, E; Martínez-Pastor, F; de Paz, P; Herráez, M P

    2009-03-01

    Short-term storage and cryopreservation of sperm are two common procedures in aquaculture, used for routine practices in artificial insemination reproduction and gene banking, respectively. Nevertheless, both procedures cause injuries affecting sperm motility, viability, cell structure and DNA stability, which diminish reproductive success. DNA modification is considered extremely important, especially when sperm storage is carried out with gene banking purposes. DNA damage caused by sperm storage is not well characterized and previous studies have reported simple and double strand breaks that have been attributed to oxidative events promoted by the generation of free radicals during storage. The objective of this study was to reveal DNA fragmentation and to explore the presence of oxidized bases that could be produced by oxidative events during short-term storage and cryopreservation in sex-reversed rainbow trout (Oncorhynchus mykiss) spermatozoa. Sperm from six males was analyzed separately. Different aliquots of the samples were stored 2h (fresh) or 5 days at 4 degrees C or were cryopreserved. Then spermatozoa were analyzed using the Comet assay, as well as combining this method with digestion with two endonucleases from Escherichia coli (Endonuclease III, that cut in oxidized cytosines, and FPG, cutting in oxidized guanosines). Both storage procedures yielded DNA fragmentation, but only short-term storage oxidative events were clearly detected, showing that oxidative processes affect guanosines rather than cytosines. Cryopreservation increases DNA fragmentation but the presence of oxidized bases was not noticed, suggesting that mechanisms other than oxidative stress could be involved in DNA fragmentation promoted by freezing.

  13. Differential DNases are selectively used in neuronal apoptosis depending on the differentiation state.

    PubMed

    Shiokawa, D; Tanuma, S

    2004-10-01

    In this study, we investigate the roles of two apoptotic endonucleases, CAD and DNase gamma, in neuronal apoptosis. High expression of CAD, but not DNase gamma, is detected in proliferating N1E-115 neuroblastoma cells, and apoptotic DNA fragmentation induced by staurosporine under proliferating conditions is abolished by the expression of a caspase-resistant form of ICAD. After the induction of neuronal differentiation, CAD disappearance and the induction of DNase gamma occur simultaneously in N1E-115 cells. Apoptotic DNA fragmentation that occurs under differentiating conditions is suppressed by the downregulation of DNase gamma caused by its antisense RNA. The induction of DNase gamma is also observed during neuronal differentiation of PC12 cells, and apoptotic DNA fragmentation induced by NGF deprivation is inhibited by the antisense-mediated downregulation of DNase gamma. These observations suggest that DNA fragmentation in neuronal apoptosis is catalyzed by either CAD or DNase gamma depending on the differentiation state. Furthermore, DNase gamma is suggested to be involved in naturally occurring apoptosis in developing nervous systems.

  14. Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays

    PubMed Central

    2009-01-01

    Background Identical blood samples tested using different kits can give markedly different hepatitis B virus (HBV) DNA levels, which can cause difficulty in the interpretation of viral load. A universal double-stranded DNA control or standard that can be used in all commercial HBV DNA nucleic acid amplification assay kits is urgently needed. By aligning all HBV genotypes (A-H), we found that the surface antigen gene and precore-core gene regions of HBV are the most conserved regions among the different HBV genotypes. We constructed a chimeric fragment by overlapping extension polymerase chain reaction and obtained a 1,349-bp HBVC+S fragment. We then packaged the fragment into lambda phages using a traditional lambda phage cloning procedure. Results The obtained armored DNA was resistant to DNase I digestion and was stable, noninfectious to humans, and could be easily extracted using commercial kits. More importantly, the armored DNA may be used with all HBV DNA nucleic acid amplification assay kits. Conclusions The lambda phage packaging system can be used as an excellent expression platform for armored DNA. The obtained armored DNA possessed all characteristics of an excellent positive control or standard. In addition, this armored DNA is likely to be appropriate for all commercial HBV DNA nucleic acid amplification detection kits. Thus, the constructed armored DNA can probably be used as a universal positive control or standard in HBV DNA assays. PMID:20025781

  15. Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

    PubMed

    Amarger, V; Mercier, L

    1995-01-01

    We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

  16. Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

    PubMed

    Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

    2014-12-15

    A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Effect of different procedures of ejaculate collection, extenders and packages on DNA integrity of boar spermatozoa following freezing-thawing.

    PubMed

    Fraser, L; Strzezek, J

    2007-06-01

    Whole ejaculate or sperm-rich fraction, collected from four sexually mature boars, was frozen in an extender containing lactose-hen egg yolk with glycerol (lactose-HEY-G) or extender containing lactose, lyophilized lipoprotein fractions isolated from ostrich egg yolk and glycerol (lactose-LPFo-G), and Orvus Es Paste, respectively. The sperm samples were also frozen in a standard boar semen extender (Kortowo-3), without the addition of cryoprotective substances. Sperm DNA integrity was assessed using a modified neutral comet assay. Sperm characteristics such as motility, plasma membrane integrity (SYBR-14/PI), mitochondrial function (rhodamine 123) and acrosome integrity were monitored. Freezing-thawing caused a significant increase (P<0.05) in sperm DNA fragmentation, irrespective of the procedures of ejaculate collection and extender type. Sperm DNA fragmentation was significantly lower (P<0.05) in the whole ejaculate compared with the sperm-rich fraction, indicating that spermatozoa maintained in the whole seminal plasma prior to its removal for freezing-thawing procedure were less vulnerable to cryo-induced DNA fragmentation. Furthermore, spermatozoa frozen in lactose-HEY-G or lactose-LPFo-G extender exhibited lower (P<0.05) DNA fragmentation than those frozen in the absence of cryoprotective substances. The levels of sperm DNA damage, as expressed by comet tail length and tail moment values, were significantly higher (P<0.05) in sperm samples frozen in the absence of cryoprotective substances. The deterioration in post-thaw sperm DNA integrity was concurrent with reduced sperm characteristics. It can be suggested that evaluation of DNA integrity, coupled with different sperm characteristics such as motility, plasma membrane integrity and mitochondrial function, may aid in determining the quality of frozen-thawed boar semen.

  18. An RNA Domain Imparts Specificity and Selectivity to a Viral DNA Packaging Motor

    PubMed Central

    Zhao, Wei; Jardine, Paul J.

    2015-01-01

    ABSTRACT During assembly, double-stranded DNA viruses, including bacteriophages and herpesviruses, utilize a powerful molecular motor to package their genomic DNA into a preformed viral capsid. An integral component of the packaging motor in the Bacillus subtilis bacteriophage ϕ29 is a viral genome-encoded pentameric ring of RNA (prohead RNA [pRNA]). pRNA is a 174-base transcript comprised of two domains, domains I and II. Early studies initially isolated a 120-base form (domain I only) that retains high biological activity in vitro; hence, no function could be assigned to domain II. Here we define a role for this domain in the packaging process. DNA packaging using restriction digests of ϕ29 DNA showed that motors with the 174-base pRNA supported the correct polarity of DNA packaging, selectively packaging the DNA left end. In contrast, motors containing the 120-base pRNA had compromised specificity, packaging both left- and right-end fragments. The presence of domain II also provides selectivity in competition assays with genomes from related phages. Furthermore, motors with the 174-base pRNA were restrictive, in that they packaged only one DNA fragment into the head, whereas motors with the 120-base pRNA packaged several fragments into the head, indicating multiple initiation events. These results show that domain II imparts specificity and stringency to the motor during the packaging initiation events that precede DNA translocation. Heteromeric rings of pRNA demonstrated that one or two copies of domain II were sufficient to impart this selectivity/stringency. Although ϕ29 differs from other double-stranded DNA phages in having an RNA motor component, the function provided by pRNA is carried on the motor protein components in other phages. IMPORTANCE During virus assembly, genome packaging involves the delivery of newly synthesized viral nucleic acid into a protein shell. In the double-stranded DNA phages and herpesviruses, this is accomplished by a powerful molecular motor that translocates the viral DNA into a preformed viral shell. A key event in DNA packaging is recognition of the viral DNA among other nucleic acids in the host cell. Commonly, a DNA-binding protein mediates the interaction of viral DNA with the motor/head shell. Here we show that for the bacteriophage ϕ29, this essential step of genome recognition is mediated by a viral genome-encoded RNA rather than a protein. A domain of the prohead RNA (pRNA) imparts specificity and stringency to the motor by ensuring the correct orientation of DNA packaging and restricting initiation to a single event. Since this assembly step is unique to the virus, DNA packaging is a novel target for the development of antiviral drugs. PMID:26423956

  19. An RNA Domain Imparts Specificity and Selectivity to a Viral DNA Packaging Motor.

    PubMed

    Zhao, Wei; Jardine, Paul J; Grimes, Shelley

    2015-12-01

    During assembly, double-stranded DNA viruses, including bacteriophages and herpesviruses, utilize a powerful molecular motor to package their genomic DNA into a preformed viral capsid. An integral component of the packaging motor in the Bacillus subtilis bacteriophage ϕ29 is a viral genome-encoded pentameric ring of RNA (prohead RNA [pRNA]). pRNA is a 174-base transcript comprised of two domains, domains I and II. Early studies initially isolated a 120-base form (domain I only) that retains high biological activity in vitro; hence, no function could be assigned to domain II. Here we define a role for this domain in the packaging process. DNA packaging using restriction digests of ϕ29 DNA showed that motors with the 174-base pRNA supported the correct polarity of DNA packaging, selectively packaging the DNA left end. In contrast, motors containing the 120-base pRNA had compromised specificity, packaging both left- and right-end fragments. The presence of domain II also provides selectivity in competition assays with genomes from related phages. Furthermore, motors with the 174-base pRNA were restrictive, in that they packaged only one DNA fragment into the head, whereas motors with the 120-base pRNA packaged several fragments into the head, indicating multiple initiation events. These results show that domain II imparts specificity and stringency to the motor during the packaging initiation events that precede DNA translocation. Heteromeric rings of pRNA demonstrated that one or two copies of domain II were sufficient to impart this selectivity/stringency. Although ϕ29 differs from other double-stranded DNA phages in having an RNA motor component, the function provided by pRNA is carried on the motor protein components in other phages. During virus assembly, genome packaging involves the delivery of newly synthesized viral nucleic acid into a protein shell. In the double-stranded DNA phages and herpesviruses, this is accomplished by a powerful molecular motor that translocates the viral DNA into a preformed viral shell. A key event in DNA packaging is recognition of the viral DNA among other nucleic acids in the host cell. Commonly, a DNA-binding protein mediates the interaction of viral DNA with the motor/head shell. Here we show that for the bacteriophage ϕ29, this essential step of genome recognition is mediated by a viral genome-encoded RNA rather than a protein. A domain of the prohead RNA (pRNA) imparts specificity and stringency to the motor by ensuring the correct orientation of DNA packaging and restricting initiation to a single event. Since this assembly step is unique to the virus, DNA packaging is a novel target for the development of antiviral drugs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

    PubMed Central

    Martin, William F.

    2017-01-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

  1. Monte Carlo approach in assessing damage in higher order structures of DNA

    NASA Technical Reports Server (NTRS)

    Chatterjee, A.; Schmidt, J. B.; Holley, W. R.

    1994-01-01

    We have developed a computer monitor of nuclear DNA in the form of chromatin fibre. The fibres are modeled as a ideal solenoid consisting of twenty helical turns with six nucleosomes per turn. The chromatin model, in combination with are Monte Carlo theory of radiation damage induces by charged particles, based on general features of tack structure and stopping power theory, has been used to evaluate the influence of DNA structure on initial damage. An interesting has emerged from our calculations. Our calculated results predict the existence of strong spatial correlations in damage sites associated with the symmetries in the solenoidal model. We have calculated spectra of short fragments of double stranded DNA produced by multiple double strand breaks induced by both high and low LET radiation. The spectra exhibit peaks at multiples of approximately 85 base pairs (the nucleosome periodicity), and approximately 1000 base pairs (solenoid periodicity). Preliminary experiments to investigate the fragment distributions from irradiated DNA, made by B. Rydberg at Lawrence Berkeley Laboratory, confirm the existence of short DNA fragments and are in substantial agreement with the predictions of our theory.

  2. Relationship between sperm aneuploidy, sperm DNA integrity, chromatin packaging, traditional semen parameters, and recurrent pregnancy loss.

    PubMed

    Zidi-Jrah, Ines; Hajlaoui, Amani; Mougou-Zerelli, Soumaya; Kammoun, Molka; Meniaoui, Imene; Sallem, Amira; Brahem, Sonia; Fekih, Meriem; Bibi, Mohammed; Saad, Ali; Ibala-Romdhane, Samira

    2016-01-01

    To study the possible relationship between sperm aneuploidy, sperm DNA integrity, chromatin packaging, traditional semen parameters, and recurrent pregnancy loss (RPL). Descriptive study. University-affiliated tertiary teaching. A total of 22 couples with history of RPL and 20 fertile men. Semen samples from case and control men were examined for differences in semen parameters, DNA fragmentation, chromatin condensation, and sperm aneuploidy. Sperm DNA and chromatin integrity and sperm aneuploidy. Sperm progressive motility (30.2% vs. 51.5%) was significantly lower and abnormal morphology (74.8% vs. 54.2%) was significantly higher in the RPL group versus the control group, respectively. The percentage of fragmented DNA was significantly increased in the RPL group (17.1% vs. 10.2%) as well as the rate of spermatozoa with nuclear chromatin decondensation (23.6% vs. 11.8%). There was a significantly higher sperm aneuploidy rate among the RPL group as well. The increase in abnormal sperm parameters, sperm DNA fragmentation, nuclear chromatin decondensation, and sperm aneuploidy suggest possible causes of unexplained RPL. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  3. Peculiarities of RFLP of highly repetitive DNA in crow genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chelomina, G.N.; Kryukov, A.P.; Ivanov, S.V.

    1995-02-01

    We present a study of the structural organization of highly repetitive DNA in genomes of hooded crow Corvus cornix L., carrion crow C. corone L., and jungle crow C. macrorhynchos Wagl. RFLP and blot-hybridization with {sup 32}P-labeled Msp I fragment from hooded crow nDNA suggest the interspecific structural conservatism of the most repetitive DNA. The family of repeats we studied had tandem organization and the same (210 bp) period of reiteration for a set of restriction enzymes. However, in parallel to the general similarity of restriction patterns, there are species-specific peculiarities. The repetitive family revealed (Alu I, BsuR I, andmore » Msp I fragments) has quantitative RFLP of nDNA and interspecific differences in the extent of the multimer {open_quotes}ladder{close_quotes} pattern of Msp I fragments. The latter is more pronounced in nDNA of carrion crow than in that of phylogenetically distant jungle crow and closely related hooded crow. This suggests a recent amplification event for highly organized homological repeats in crow genomes. 10 refs., 2 figs.« less

  4. 'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

    PubMed

    Eichmann, Cordula; Parson, Walther

    2008-09-01

    The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

  5. DNA-based identification of Brassica vegetable species for the juice industry.

    PubMed

    Etoh, Kazumi; Niijima, Noritaka; Yokoshita, Masahiko; Fukuoka, Shin-Ichi

    2003-10-01

    Since kale (Brassica oleracea var. acephala), a cruciferous vegetable with a high level of vitamins and functional compounds beneficial to health and wellness, has become widely used in the juice industry, a precise method for quality control of vegetable species is necessary. We describe here a DNA-based identification method to distinguish kale from cabbage (Brassica oleracea var. capitata), a closely related species, which can be inadvertently mixed with kale during the manufacturing process. Using genomic DNA from these vegetables and combinatory sets of nucleotide primers, we screened for random amplified polymorphic DNA (RAPD) fragments and found three cabbage-specific fragments. These RAPD fragments, with lengths of 1.4, 0.5, and 1.5 kb, were purified, subcloned, and sequenced. Based on sequence-tagged sites (STS), we designed sets of primers to detect cabbage-specific identification (CAI) DNA markers. Utilizing the CAI markers, we successfully distinguished more than 10 different local cabbage accessions from 20 kale accessions, and identified kale juices experimentally spiked with different amounts of cabbage.

  6. Complete-active-space second-order perturbation theory (CASPT2//CASSCF) study of the dissociative electron attachment in canonical DNA nucleobases caused by low-energy electrons (0-3 eV)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Francés-Monerris, Antonio; Segarra-Martí, Javier; Merchán, Manuela

    Low-energy (0-3 eV) ballistic electrons originated during the irradiation of biological material can interact with DNA/RNA nucleobases yielding transient-anion species which undergo decompositions. Since the discovery that these reactions can eventually lead to strand breaking of the DNA chains, great efforts have been dedicated to their study. The main fragmentation at the 0-3 eV energy range is the ejection of a hydrogen atom from the specific nitrogen positions. In the present study, the methodological approach introduced in a previous work on uracil [I. González-Ramírez et al., J. Chem. Theory Comput. 8, 2769-2776 (2012)] is employed to study the DNA canonicalmore » nucleobases fragmentations of N–H bonds induced by low-energy electrons. The approach is based on minimum energy path and linear interpolation of internal coordinates computations along the N–H dissociation channels carried out at the complete-active-space self-consistent field//complete-active-space second-order perturbation theory level. On the basis of the calculated theoretical quantities, new assignations for the adenine and cytosine anion yield curves are provided. In addition, the π{sub 1}{sup −} and π{sub 2}{sup −} states of the pyrimidine nucleobases are expected to produce the temporary anions at electron energies close to 1 and 2 eV, respectively. Finally, the present theoretical results do not allow to discard neither the dipole-bound nor the valence-bound mechanisms in the range of energies explored, suggesting that both possibilities may coexist in the experiments carried out with the isolated nucleobases.« less

  7. Complete-active-space second-order perturbation theory (CASPT2//CASSCF) study of the dissociative electron attachment in canonical DNA nucleobases caused by low-energy electrons (0-3 eV).

    PubMed

    Francés-Monerris, Antonio; Segarra-Martí, Javier; Merchán, Manuela; Roca-Sanjuán, Daniel

    2015-12-07

    Low-energy (0-3 eV) ballistic electrons originated during the irradiation of biological material can interact with DNA/RNA nucleobases yielding transient-anion species which undergo decompositions. Since the discovery that these reactions can eventually lead to strand breaking of the DNA chains, great efforts have been dedicated to their study. The main fragmentation at the 0-3 eV energy range is the ejection of a hydrogen atom from the specific nitrogen positions. In the present study, the methodological approach introduced in a previous work on uracil [I. González-Ramírez et al., J. Chem. Theory Comput. 8, 2769-2776 (2012)] is employed to study the DNA canonical nucleobases fragmentations of N-H bonds induced by low-energy electrons. The approach is based on minimum energy path and linear interpolation of internal coordinates computations along the N-H dissociation channels carried out at the complete-active-space self-consistent field//complete-active-space second-order perturbation theory level. On the basis of the calculated theoretical quantities, new assignations for the adenine and cytosine anion yield curves are provided. In addition, the π1 (-) and π2 (-) states of the pyrimidine nucleobases are expected to produce the temporary anions at electron energies close to 1 and 2 eV, respectively. Finally, the present theoretical results do not allow to discard neither the dipole-bound nor the valence-bound mechanisms in the range of energies explored, suggesting that both possibilities may coexist in the experiments carried out with the isolated nucleobases.

  8. Complete-active-space second-order perturbation theory (CASPT2//CASSCF) study of the dissociative electron attachment in canonical DNA nucleobases caused by low-energy electrons (0-3 eV)

    NASA Astrophysics Data System (ADS)

    Francés-Monerris, Antonio; Segarra-Martí, Javier; Merchán, Manuela; Roca-Sanjuán, Daniel

    2015-12-01

    Low-energy (0-3 eV) ballistic electrons originated during the irradiation of biological material can interact with DNA/RNA nucleobases yielding transient-anion species which undergo decompositions. Since the discovery that these reactions can eventually lead to strand breaking of the DNA chains, great efforts have been dedicated to their study. The main fragmentation at the 0-3 eV energy range is the ejection of a hydrogen atom from the specific nitrogen positions. In the present study, the methodological approach introduced in a previous work on uracil [I. González-Ramírez et al., J. Chem. Theory Comput. 8, 2769-2776 (2012)] is employed to study the DNA canonical nucleobases fragmentations of N-H bonds induced by low-energy electrons. The approach is based on minimum energy path and linear interpolation of internal coordinates computations along the N-H dissociation channels carried out at the complete-active-space self-consistent field//complete-active-space second-order perturbation theory level. On the basis of the calculated theoretical quantities, new assignations for the adenine and cytosine anion yield curves are provided. In addition, the π1- and π2- states of the pyrimidine nucleobases are expected to produce the temporary anions at electron energies close to 1 and 2 eV, respectively. Finally, the present theoretical results do not allow to discard neither the dipole-bound nor the valence-bound mechanisms in the range of energies explored, suggesting that both possibilities may coexist in the experiments carried out with the isolated nucleobases.

  9. Antioxidant & anticancer activities of isatin (1H-indole-2,3-dione), isolated from the flowers of Couroupita guianensis Aubl

    PubMed Central

    Premanathan, Mariappan; Radhakrishnan, Srinivasan; Kulangiappar, Kumarasamy; Singaravelu, Ganesan; Thirumalaiarasu, Velayutham; Sivakumar, Thangavel; Kathiresan, Kandasamy

    2012-01-01

    Background & objectives: Derivatives of isatin are known to have cytotoxicity against human carcinoma cell lines. This compound therefore, has a potential to be used as a chemotherapeutic agent against cancer. This study was done to investigate the antioxidant and anticancer activities of isatin, extracted from flower of a folklore medicinal plant Couroupita guianensis against human promylocytic leukemia (HL60) cells. Methods: Active fractions demonstrating anticancer and antioxidant activities were isolated from the extracts of shade-dried flowers of C. guianensis by bioassay guided fractionation. The free radical scavenging activity was determined using lipid peroxidation assay. Cytotoxicity against human promylocytic leukemia HL60 cells was determined by MTT assay. Apoptotic activity was analyzed by DNA fragmentation and flowcytometry. Results: Isatin isolated from the active fraction showed antioxidant activity with the EC50 value of 72.80 μg/ml. It also exhibited cytotoxicity against human promylocytic leukemia HL60 cells in dose-dependant manner with the CC50 value of 2.94 μg/ml. The isatin-treated cells underwent apoptosis and DNA fragmentation. Apoptosis was confirmed by the FACS analysis using FITC-annexin V markers. Interpretation & conclusions: Isatin showed antioxidant activity and was cytotoxic to the HL60 cells due to induction of apoptosis. The isatin can be further evaluated to be used as a prophylactic agent to prevent the free radical-induced cancer and as a chemotherapeutic agent to kill the cancer cells. PMID:23287130

  10. Novel 3-Aminothiazolquinolones: Design, Synthesis, Bioactive Evaluation, SARs, and Preliminary Antibacterial Mechanism.

    PubMed

    Cui, Sheng-Feng; Addla, Dinesh; Zhou, Cheng-He

    2016-05-26

    A series of novel 3-aminothiazolquinolones as analogues of quinolone antibacterial agents were designed and synthesized in an effort to circumvent quinolone resistance. Among these 3-aminothiazolquinolones, 3-(2-aminothiazol-4-yl)-7-chloro-6-(pyrrolidin-1-yl) quinolone 12b exhibited potent antibacterial activity, low cytotoxicity to hepatocyte cells, strong inhibitory potency to DNA gyrase, and a broad antimicrobial spectrum including against multidrug-resistant strains. This active molecule 12b also induced bacterial resistance more slowly than norfloxacin. Analysis of structure-activity relationships (SARs) disclosed that the 2-aminothiazole fragment at the 3-position of quinolone plays an important role in exerting antibacterial activity. Molecular modeling and experimental investigation of aminothiazolquinolone 12b with DNA from a sensitive methicillin-resistant Staphylococcus aureus (MRSA) strain revealed that the possible antibacterial mechanism might be related to the formation of a compound 12b-Cu(2+)-DNA ternary complex in which the Cu(2+) ion acts as a bridge between the backbone of 3-aminothiazolquinolone and the phosphate group of the nucleic acid.

  11. A Silent ABC Transporter Isolated from Streptomyces rochei F20 Induces Multidrug Resistance

    PubMed Central

    Fernández-Moreno, Miguel A.; Carbó, Lázaro; Cuesta, Trinidad; Vallín, Carlos; Malpartida, Francisco

    1998-01-01

    In the search for heterologous activators for actinorhodin production in Streptomyces lividans, 3.4 kb of DNA from Streptomyces rochei F20 (a streptothricin producer) were characterized. Subcloning experiments showed that the minimal DNA fragment required for activation was 0.4 kb in size. The activation is mediated by increasing the levels of transcription of the actII-ORF4 gene. Sequencing of the minimal activating fragment did not reveal any clues about its mechanism; nevertheless, it was shown to overlap the 3′ end of two convergent genes, one of whose translated products (ORF2) strongly resembles that of other genes belonging to the ABC transporter superfamily. Computer-assisted analysis of the 3.4-kb DNA sequence showed the 3′ terminus of an open reading frame (ORF), i.e., ORFA, and three complete ORFs (ORF1, ORF2, and ORFB). Searches in the databases with their respective gene products revealed similarities for ORF1 and ORF2 with ATP-binding proteins and transmembrane proteins, respectively, which are found in members of the ABC transporter superfamily. No similarities for ORFA and ORFB were found in the databases. Insertional inactivation of ORF1 and ORF2, their transcription analysis, and their cloning in heterologous hosts suggested that these genes were not expressed under our experimental conditions; however, cloning of ORF1 and ORF2 together (but not separately) under the control of an expressing promoter induced resistance to several chemically different drugs: oleandomycin, erythromycin, spiramycin, doxorubicin, and tetracycline. Thus, this genetic system, named msr, is a new bacterial multidrug ABC transporter. PMID:9696745

  12. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    PubMed

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Multiplex picoliter-droplet digital PCR for quantitative assessment of DNA integrity in clinical samples.

    PubMed

    Didelot, Audrey; Kotsopoulos, Steve K; Lupo, Audrey; Pekin, Deniz; Li, Xinyu; Atochin, Ivan; Srinivasan, Preethi; Zhong, Qun; Olson, Jeff; Link, Darren R; Laurent-Puig, Pierre; Blons, Hélène; Hutchison, J Brian; Taly, Valerie

    2013-05-01

    Assessment of DNA integrity and quantity remains a bottleneck for high-throughput molecular genotyping technologies, including next-generation sequencing. In particular, DNA extracted from paraffin-embedded tissues, a major potential source of tumor DNA, varies widely in quality, leading to unpredictable sequencing data. We describe a picoliter droplet-based digital PCR method that enables simultaneous detection of DNA integrity and the quantity of amplifiable DNA. Using a multiplex assay, we detected 4 different target lengths (78, 159, 197, and 550 bp). Assays were validated with human genomic DNA fragmented to sizes of 170 bp to 3000 bp. The technique was validated with DNA quantities as low as 1 ng. We evaluated 12 DNA samples extracted from paraffin-embedded lung adenocarcinoma tissues. One sample contained no amplifiable DNA. The fractions of amplifiable DNA for the 11 other samples were between 0.05% and 10.1% for 78-bp fragments and ≤1% for longer fragments. Four samples were chosen for enrichment and next-generation sequencing. The quality of the sequencing data was in agreement with the results of the DNA-integrity test. Specifically, DNA with low integrity yielded sequencing results with lower levels of coverage and uniformity and had higher levels of false-positive variants. The development of DNA-quality assays will enable researchers to downselect samples or process more DNA to achieve reliable genome sequencing with the highest possible efficiency of cost and effort, as well as minimize the waste of precious samples. © 2013 American Association for Clinical Chemistry.

  14. DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

    PubMed

    Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

    2009-01-01

    * At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

  15. DNA fingerprinting and analysis of population structure in the chestnut blight fungus, Cryphonectria parasitica.

    PubMed

    Milgroom, M G; Lipari, S E; Powell, W A

    1992-06-01

    We analyzed DNA fingerprints in the chestnut blight fungus, Cryphonectria parasitica, for stability, inheritance, linkage and variability in a natural population. DNA fingerprints resulting from hybridization with a dispersed moderately repetitive DNA sequence of C. parasitica in plasmid pMS5.1 hybridized to 6-17 restriction fragments per individual isolate. In a laboratory cross and from progeny from a single perithecium collected from a field population, the presence/absence of 11 fragments in the laboratory cross and 12 fragments in the field progeny set segregated in 1:1 ratios. Two fragments in each progeny set cosegregated; no other linkage was detected among the segregating fragments. Mutations, identified by missing bands, were detected for only one fragment in which 4 of 43 progeny lacked a band present in both parents; no novel fragments were detected in any progeny. All other fragments appeared to be stably inherited. Hybridization patterns did not change during vegetative growth or sporulation. However, fingerprint patterns of single conidial isolates of strains EP155 and EP67 were found to be heterogenous due to mutations that occurred during culturing in the laboratory since these strains were first isolated in 1976-1977. In a population sample of 39 C. parasitica isolates, we found 33 different fingerprint patterns with pMS5.1. Most isolates differed from all other isolates by the presence or absence of several fragments. Six fingerprint patterns each occurred twice. Isolates with identical fingerprints occurred in cankers on the same chestnut stems three times; isolates within the other three pairs were isolated from cankers more than 5 m apart. The null hypothesis of random mating in this population could not be rejected if the six putative clones were removed from the analysis. Thus, a rough estimate of the clonal fraction of this population is 6 in 39 isolates (15.4%).

  16. Chloroplast and mitochondrial DNA are paternally inherited in Sequoia sempervirens D. Don Endl

    PubMed Central

    Neale, David B.; Marshall, Kimberly A.; Sederoff, Ronald R.

    1989-01-01

    Restriction fragment length polymorphisms in controlled crosses were used to infer the mode of inheritance of chloroplast DNA and mitochondrial DNA in coast redwood (Sequoia sempervirens D. Don Endl.). Chloroplast DNA was paternally inherited, as is true for all other conifers studied thus far. Surprisingly, a restriction fragment length polymorphism detected by a mitochondrial probe was paternally inherited as well. This polymorphism could not be detected in hybridizations with chloroplast probes covering the entire chloroplast genome, thus providing evidence that the mitochondrial probe had not hybridized to chloroplast DNA on the blot. We conclude that mitochondrial DNA is paternally inherited in coast redwood. To our knowledge, paternal inheritance of mitochondrial DNA in sexual crosses of a multicellular eukaryotic organism has not been previously reported. Images PMID:16594091

  17. Highly sensitive sites for guanine-O6 ethylation in rat brain DNA exposed to N-ethyl-N-nitrosourea in vivo.

    PubMed Central

    Nehls, P; Rajewsky, M F; Spiess, E; Werner, D

    1984-01-01

    Brain chromosomal DNA isolated from fetal BDIX-rats 1 h after i.v. administration of the ethylating N-nitroso carcinogen N-ethyl-N-nitrosourea (75 micrograms/g body weight), statistically contained one molecule of O6-ethyl-2'-deoxyguanosine (O6-EtdGuo) per 81 micron of DNA, as determined in enzymatic DNA hydrolysates by competitive radio-immunoassay using a high-affinity anti-(O6-EtdGuo) monoclonal antibody (ER-6). After fragmentation of the DNA by the restriction enzyme AluI (average fragment length, Lav = 0.28 micron = 970 bp; length range, Lr = 1.87-0.02 micron = 6540 - 60 bp), a small (approximately 2%) fraction of DNA enriched in specific polypeptides tightly associated with DNA was separated from the bulk DNA by a glass fiber binding technique. As analyzed by immune electron microscopy, approximately 1% of the DNA molecules in this fraction contained clusters of 2-10 (O6-EtdGuo)-antibody binding sites (ABS). On the cluster-bearing fragments (Lav, 0.85 micron +/- 0.50 micron S.D.; corresponding to 2970 +/- 1760 bp) the average ABS-ABS interspace distance was 110 nm (= 390 bp; range approximately 9-600 nm), indicating a highly non-random distribution of O6-EtdGuo in target cell DNA. Images Fig. 2. PMID:6370677

  18. Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

    PubMed

    Schuetz, J D; Guzelian, P S

    1995-03-14

    We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

  19. Laser desorption mass spectrometry for biomolecule detection and its applications

    NASA Astrophysics Data System (ADS)

    Winston Chen, C. H.; Sammartano, L. J.; Isola, N. R.; Allman, S. L.

    2001-08-01

    During the past few years, we developed and used laser desorption mass spectrometry for biomolecule detections. Matrix-assisted laser desorption/ionization (MALDI) was successfully used to detect DNA fragments with the size larger than 3000 base pairs. It was also successfully used to sequence DNA with both enzymatic and chemical degradation methods to produce DNA ladders. We also developed MALDI with fragmentation for direct DNA sequencing for short DNA probes. Since laser desorption mass spectrometry for DNA detection has the advantages of fast speed and no need of labeling, it has a great potential for molecular diagnosis for disease and person identification by DNA fingerprinting. We applied laser desorption mass spectrometry to succeed in the diagnosis of cystic fibrosis and several other nerve degenerative diseases such as Huntington's disease. We also succeeded in demonstrating DNA typing for forensic applications.

  20. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    PubMed

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  1. A common deletion in two gamma ray induced rat pulmonary tumor cell lines.

    PubMed

    Van Klaveren, P; De Bruijne, J; Van der Winden, H; Kal, H B; Bentvelzen, P

    1994-01-01

    Subtraction hybridization was performed on normal WAG/Rij rat DNA with DNA from a syngeneic Ir-192 induced pulmonary tumor cell line L37. The residual DNA was amplified by means of sequence-independent PCR. This procedure yielded a sequence, of which multiple copies are present in normal rat DNA. In the tumor line L37 two restriction fragments hybridizing with this repeat sequence are lacking. In another Ir-192 induced pulmonary tumor line, L33, one of these fragments was also lacking. This indicates a common deletion in the two tumor lines.

  2. J Genes for Heavy Chain Immunoglobulins of Mouse

    NASA Astrophysics Data System (ADS)

    Newell, Nanette; Richards, Julia E.; Tucker, Philip W.; Blattner, Frederick R.

    1980-09-01

    A 15.8-kilobase pair fragment of BALB/c mouse liver DNA, cloned in the Charon 4Aλ phage vector system, was shown to contain the μ heavy chain constant region (CHμ ) gene for the mouse immunoglobulin M. In addition, this fragment of DNA contains at least two J genes, used to code for the carboxyl terminal portion of heavy chain variable regions. These genes are located in genomic DNA about eight kilobase pairs to the 5' side of the CHμ gene. The complete nucleotide sequence of a 1120-base pair stretch of DNA that includes the two J genes has been determined.

  3. DNA double-strand breaks induced by high-energy neon and iron ions in human fibroblasts. II. Probing individual notI fragments by hybridization.

    PubMed

    Löbrich, M; Rydberg, B; Cooper, P K

    1994-08-01

    The initial yields of DNA double-strand breaks induced by energetic heavy ions (425 MeV/u neon and 250, 400 and 600 MeV/u iron) in comparison to X rays were measured in normal human diploid fibroblast cells within three small areas of the genome, defined by NotI fragments of 3.2, 2.0 and 1.2 Mbp. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated cells, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with probes recognizing single-copy sequences within the three NotI fragments. The gradual disappearance of the full-size NotI fragment with dose and the appearance of a smear of broken DNA molecules are quantified. Assuming Poisson statistics for the number of double-strand breaks induced per NotI fragment of known size, absolute yields of DNA double-strand breaks were calculated and determined to be linear with dose in all cases, with the neon ion (LET 32 keV/microns) producing 4.4 x 10(-3) breaks/Mbp/Gy and all three iron-ion beams (LETs from 190 to 350 keV/microns) producing 2.8 x 10(-3) breaks/Mbp/Gy, giving RBE values for production of double-strand breaks of 0.76 for neon and 0.48 for iron in comparison to our previously determined X-ray induction rate of 5.8 x 10(-3) breaks/Mbp/Gy. These RBE values are in good agreement with results of measurements over the whole genome as reported in the accompanying paper (B. Rydberg, M. Löbrich and P. Cooper, Radiat. Res. 139, 133-141, 1994). The distribution of broken DNA molecules was similar for the various radiations, supporting a random distribution of double-strand breaks induced by the heavy ions over Mbp distances; however, correlated breaks (clusters) over much smaller distances are not ruled out. Reconstitution of the 3.2 Mbp NotI fragment was studied during postirradiation incubation of the cells as a measure of rejoining of correct DNA ends. The proportion of breaks repaired decreased with increasing LET.

  4. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  5. Construction of Biologically Functional Bacterial Plasmids In Vitro

    PubMed Central

    Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

    1973-01-01

    The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

  6. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620more » phred20 bases as part of Joint Genome Institutes Production Process.« less

  7. A new open reading frame in the genome of the cyanobacterium Synechocystis sp. PCC 6803

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lysenko, E.S.; Ogarkova, O.A.; Tarasov, V.A.

    1995-02-01

    A new open reading frame ORF242, coding for a 26.47-kDa polypeptide, was found in a DNA fragment of the cyanobacterium Synechocystis 6803, transforming a photosynthetic mutant to photoautotrophy and having homology with plant chloroplast DNA. In the 5{prime} flanking region of ORF242, consensus sequences characteristic of a functioning gene were found. One copy of ORF242 is present in the Synechocystis 6803 genome. Insertion inactivation of ORF242 does not lead to a decrease in photosynthetic activity in cells of cyanobacteria but may influence the ratio between active complexes of photosystems I and II. 22 refs., 6 figs., 2 tabs.

  8. In vitro excision of adeno-associated virus DNA from recombinant plasmids: Isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gottlieb, J.; Muzyczka, N.

    1988-06-01

    When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less

  9. DR-78, a novel Drosophila melanogaster genomic DNA fragment highly homologous to the DNA-binding domain of thyroid hormone-retinoic acid-vitamin D receptor subfamily.

    PubMed

    Martín-Blanco, E; Kornberg, T B

    1993-11-16

    Degenerate oligodeoxyribonucleotides were designed for both ends of the DNA-binding domain of members of the nuclear receptor superfamily. PCR amplified Drosophila melanogaster DNA was purified and cloned (DR plasmids). Genomic lambda DASH clones were identified at high stringency with an amplified DR-78 plasmid DNA and isolated. The partial sequence shows a very probable open reading frame which would encode a peptide highly homologous to members of the thyroid hormone-retinoic acid-vitamin D receptor subfamily. The fragment corresponds to a single copy gene and was mapped at position 78D of chromosome three by in situ hybridization.

  10. [Expression, purification and activity analysis of GGDEF and EAL domain-containing proteins from Lactobacillus acidophilus].

    PubMed

    He, Jia-Hui; Sun, Jie-Li; Yan, Wen-Juan; Wang, Fang

    2017-05-20

    To identify the functions of the proteins containing the GGDEF or EAL domain in Lactobacillus acidophilus for investigation of the regulatory mechanism of c-di-GMP in this strain. The DNA fragments of NH13_07045-GGDEF, NH13_07050 and NH13_07055 from Lactobacillus acidophilus ATCC4356 were amplified by PCR and cloned into the expression vector pMAL-His-c2. After sequencing, the recombinant plasmids were transformed into competent Escherichia coli cells, which were induced by IPTG to express the recombinant proteins fused with maltose binding protein (MBP). The fusion proteins were purified using amylose resin column for diguanylate cyclase (DGC) or phosphodiesterase (PDE) activity assays in vitro followed by analysis with high-performance liquid chromatography (HPLC). The target DNA fragments were obtained by PCR, and their sequences were all identical to that in GenBank. The purified and concentrated fusion proteins, which were identified by SDS-PAGE and Western blotting, had relative molecular masses of 59 kD, 67 kD and 72 kD. HPLC analysis showed no DGC activity in NH13_07045-GGDEF, while PDE activity was found in NH13_07050 but not in NH13_07055. We obtained the protein encoded by NH13_07050 that possesses PDE activity in vitro. This protein may facilitate the evaluation of the regulatory function of c-di-GMP in Lactobacillus acidophilus.

  11. Momordica charantia Extract Induces Apoptosis in Human Cancer Cells through Caspase- and Mitochondria-Dependent Pathways

    PubMed Central

    Li, Chia-Jung; Tsang, Shih-Fang; Tsai, Chun-Hao; Tsai, Hsin-Yi; Chyuan, Jong-Ho; Hsu, Hsue-Yin

    2012-01-01

    Plants are an invaluable source of potential new anti-cancer drugs. Momordica charantia is one of these plants with both edible and medical value and reported to exhibit anticancer activity. To explore the potential effectiveness of Momordica charantia, methanol extract of Momordica charantia (MCME) was used to evaluate the cytotoxic activity on four human cancer cell lines, Hone-1 nasopharyngeal carcinoma cells, AGS gastric adenocarcinoma cells, HCT-116 colorectal carcinoma cells, and CL1-0 lung adenocarcinoma cells, in this study. MCME showed cytotoxic activity towards all cancer cells tested, with the approximate IC50 ranging from 0.25 to 0.35 mg/mL at 24 h. MCME induced cell death was found to be time-dependent in these cells. Apoptosis was demonstrated by DAPI staining and DNA fragmentation analysis using agarose gel electrophoresis. MCME activated caspase-3 and enhanced the cleavage of downstream DFF45 and PARP, subsequently leading to DNA fragmentation and nuclear condensation. The apoptogenic protein, Bax, was increased, whereas Bcl-2 was decreased after treating for 24 h in all cancer cells, indicating the involvement of mitochondrial pathway in MCME-induced cell death. These findings indicate that MCME has cytotoxic effects on human cancer cells and exhibits promising anti-cancer activity by triggering apoptosis through the regulation of caspases and mitochondria. PMID:23091557

  12. Neutral Porphyrin Derivative Exerts Anticancer Activity by Targeting Cellular Topoisomerase I (Top1) and Promotes Apoptotic Cell Death without Stabilizing Top1-DNA Cleavage Complexes

    PubMed Central

    2017-01-01

    Camptothecin (CPT) selectively traps topoisomerase 1-DNA cleavable complexes (Top1cc) to promote anticancer activity. Here, we report the design and synthesis of a new class of neutral porphyrin derivative 5,10-bis(4-carboxyphenyl)-15, 20-bis(4-dimethylaminophenyl)porphyrin (compound 8) as a potent catalytic inhibitor of human Top1. In contrast to CPT, compound 8 reversibly binds with the free enzyme and inhibits the formation of Top1cc and promotes reversal of the preformed Top1cc with CPT. Compound 8 induced inhibition of Top1cc formation in live cells was substantiated by fluorescence recovery after photobleaching (FRAP) assays. We established that MCF7 cells treated with compound 8 trigger proteasome-mediated Top1 degradation, accumulate higher levels of reactive oxygen species (ROS), PARP1 cleavage, oxidative DNA fragmentation, and stimulate apoptotic cell death without stabilizing apoptotic Top1-DNA cleavage complexes. Finally, compound 8 shows anticancer activity by targeting cellular Top1 and preventing the enzyme from directly participating in the apoptotic process. PMID:29290109

  13. Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

    PubMed

    Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

    1987-12-01

    The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

  14. Assessment of Carbon- and Metal-Based Nanoparticle DNA Damage with Microfluidic Electrophoretic Separation Technology.

    PubMed

    Schrand, Amanda M; Powell, Thomas; Robertson, Tiffany; Hussain, Saber M

    2015-02-01

    In this study, we examined the feasibility of extracting DNA from whole cell lysates exposed to nanoparticles using two different methodologies for evaluation of fragmentation with microfluidic electrophoretic separation. Human lung macrophages were exposed to five different carbon- and metal-based nanoparticles at two different time points (2 h, 24 h) and two different doses (5 µg/ml, 100 µg/ml). The primary difference in the banding patterns after 2 h of nanoparticle exposure is more DNA fragmentation at the higher NP concentration when examining cells exposed to nanoparticles of the same composition. However, higher doses of carbon and silver nanoparticles at both short and long dosing periods can contribute to erroneous or incomplete data with this technique. Also comparing DNA isolation methodologies, we recommend the centrifugation extraction technique, which provides more consistent banding patterns in the control samples compared to the spooling technique. Here we demonstrate that multi-walled carbon nanotubes, 15 nm silver nanoparticles and the positive control cadmium oxide cause similar DNA fragmentation at the short time point of 2 h with the centrifugation extraction technique. Therefore, the results of these studies contribute to elucidating the relationship between nanoparticle physicochemical properties and DNA fragmentation results while providing the pros and cons of altering the DNA isolation methodology. Overall, this technique provides a high throughput way to analyze subcellular alterations in DNA profiles of cells exposed to nanomaterials to aid in understanding the consequences of exposure and mechanistic effects. Future studies in microfluidic electrophoretic separation technologies should be investigated to determine the utility of protein or other assays applicable to cellular systems exposed to nanoparticles.

  15. DNA gel electrophoresis: the reptation model(s).

    PubMed

    Slater, Gary W

    2009-06-01

    DNA gel electrophoresis has been the most important experimental tool to separate DNA fragments for several decades. The introduction of PFGE in the 1980s and capillary gel electrophoresis in the 1990s made it possible to study, map and sequence entire genomes. Explaining how very large DNA molecules move in a gel and why PFGE is needed to separate them has been an active field of research ever since the launch of the journal Electrophoresis. This article presents a personal and historical overview of the development of the theory of gel electrophoresis, focusing on the reptation model, the band broadening mechanisms, and finally the factors that limit the read length and the resolution of electrophoresis-based sequencing systems. I conclude with a short discussion of some of the questions that remain unanswered.

  16. Microfabricated plastic chips by hot embossing methods and their applications for DNA separation and detection

    NASA Astrophysics Data System (ADS)

    Lee, Gwo-Bin; Chen, Shu-Hui; Huang, Guan-Ruey; Lin, Yen-Heng; Sung, Wang-Chou

    2000-08-01

    Design and fabrication of microfluidic devices on polymethylmethacrylate (PMMA) substrates using novel microfabrication methods are described. The image of microfluidic devices is transferred from quartz master templates possessing inverse image of the devices to plastic plates by using hot embossing method. The micro channels on master templates are formed by the combination of metal etch mask and wet chemical etching. The micromachined quartz templates can be used repeatedly to fabricate cheap and disposable plastic devices. The reproducibility of the hot embossing method is evaluated after using 10 channels on different plastics. The relative standard deviation of the plastic channel profile from ones on quartz templates is less than 1%. In this study, the PMMA chips have been demonstrated as a micro capillary electrophoresis ((mu) -CE) device for DNA separation and detection. The capability of the fabricated chip for electrophoretic injection and separation is characterized via the analysis of DNA fragments (phi) X174. Results indicate that all of the 11 DNA fragments of the size marker could be identified in less than 3 minutes with relative standard deviations less than 0.4% and 8% for migration time and peak area, respectively. Moreover, with the use of near IR dye, fluorescence signals of the higher molecular weight fragments ($GTR 603 bp in length) could be detected at total DNA concentrations as low as 0.1 (mu) g/mL. In addition to DNA fragments (phi) X174, DNA sizing of hepatitis C viral (HCV) amplicon is also achieved using microchip electrophoresis fabricated on PMMA substrate.

  17. Topological impact of noncanonical DNA structures on Klenow fragment of DNA polymerase.

    PubMed

    Takahashi, Shuntaro; Brazier, John A; Sugimoto, Naoki

    2017-09-05

    Noncanonical DNA structures that stall DNA replication can cause errors in genomic DNA. Here, we investigated how the noncanonical structures formed by sequences in genes associated with a number of diseases impacted DNA polymerization by the Klenow fragment of DNA polymerase. Replication of a DNA sequence forming an i-motif from a telomere, hypoxia-induced transcription factor, and an insulin-linked polymorphic region was effectively inhibited. On the other hand, replication of a mixed-type G-quadruplex (G4) from a telomere was less inhibited than that of the antiparallel type or parallel type. Interestingly, the i-motif was a better inhibitor of replication than were mixed-type G4s or hairpin structures, even though all had similar thermodynamic stabilities. These results indicate that both the stability and topology of structures formed in DNA templates impact the processivity of a DNA polymerase. This suggests that i-motif formation may trigger genomic instability by stalling the replication of DNA, causing intractable diseases.

  18. Topological impact of noncanonical DNA structures on Klenow fragment of DNA polymerase

    PubMed Central

    Takahashi, Shuntaro; Brazier, John A.; Sugimoto, Naoki

    2017-01-01

    Noncanonical DNA structures that stall DNA replication can cause errors in genomic DNA. Here, we investigated how the noncanonical structures formed by sequences in genes associated with a number of diseases impacted DNA polymerization by the Klenow fragment of DNA polymerase. Replication of a DNA sequence forming an i-motif from a telomere, hypoxia-induced transcription factor, and an insulin-linked polymorphic region was effectively inhibited. On the other hand, replication of a mixed-type G-quadruplex (G4) from a telomere was less inhibited than that of the antiparallel type or parallel type. Interestingly, the i-motif was a better inhibitor of replication than were mixed-type G4s or hairpin structures, even though all had similar thermodynamic stabilities. These results indicate that both the stability and topology of structures formed in DNA templates impact the processivity of a DNA polymerase. This suggests that i-motif formation may trigger genomic instability by stalling the replication of DNA, causing intractable diseases. PMID:28827350

  19. Modified Terminal Restriction Fragment Analysis for Quantifying Telomere Length Using In-gel Hybridization.

    PubMed

    Jenkins, Frank J; Kerr, Charles M; Fouquerel, Elise; Bovbjerg, Dana H; Opresko, Patricia L

    2017-07-10

    There are several different techniques for measuring telomere length, each with their own advantages and disadvantages. The traditional approach, Telomere Restriction Fragment (TRF) analysis, utilizes a DNA hybridization technique whereby genomic DNA samples are digested with restriction enzymes, leaving behind telomere DNA repeats and some sub-telomeric DNA. These are separated by agarose gel electrophoresis, transferred to a filter membrane and hybridized to oligonucleotide probes tagged with either chemiluminescence or radioactivity to visualize telomere restriction fragments. This approach, while requiring a larger quantity of DNA than other techniques such as PCR, can measure the telomere length distribution of a population of cells and allows measurement expressed in absolute kilobases. This manuscript demonstrates a modified DNA hybridization procedure for determining telomere length. Genomic DNA is first digested with restriction enzymes (that do not cut telomeres) and separated by agarose gel electrophoresis. The gel is then dried and the DNA is denatured and hybridized in situ to a radiolabeled oligonucleotide probe. This in situ hybridization avoids loss of telomere DNA and improves signal intensity. Following hybridization, the gels are imaged utilizing phosphor screens and the telomere length is quantified using a graphing program. This procedure was developed by the laboratories of Drs. Woodring Wright and Jerry Shay at the University of Texas Southwestern 1 , 2 . Here, we present a detailed description of this procedure, with some modifications.

  20. Fragman: an R package for fragment analysis.

    PubMed

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  1. Multisubstrate Isotope Labeling and Metagenomic Analysis of Active Soil Bacterial Communities

    PubMed Central

    Verastegui, Y.; Cheng, J.; Engel, K.; Kolczynski, D.; Mortimer, S.; Lavigne, J.; Montalibet, J.; Romantsov, T.; Hall, M.; McConkey, B. J.; Rose, D. R.; Tomashek, J. J.; Scott, B. R.

    2014-01-01

    ABSTRACT Soil microbial diversity represents the largest global reservoir of novel microorganisms and enzymes. In this study, we coupled functional metagenomics and DNA stable-isotope probing (DNA-SIP) using multiple plant-derived carbon substrates and diverse soils to characterize active soil bacterial communities and their glycoside hydrolase genes, which have value for industrial applications. We incubated samples from three disparate Canadian soils (tundra, temperate rainforest, and agricultural) with five native carbon (12C) or stable-isotope-labeled (13C) carbohydrates (glucose, cellobiose, xylose, arabinose, and cellulose). Indicator species analysis revealed high specificity and fidelity for many uncultured and unclassified bacterial taxa in the heavy DNA for all soils and substrates. Among characterized taxa, Actinomycetales (Salinibacterium), Rhizobiales (Devosia), Rhodospirillales (Telmatospirillum), and Caulobacterales (Phenylobacterium and Asticcacaulis) were bacterial indicator species for the heavy substrates and soils tested. Both Actinomycetales and Caulobacterales (Phenylobacterium) were associated with metabolism of cellulose, and Alphaproteobacteria were associated with the metabolism of arabinose; members of the order Rhizobiales were strongly associated with the metabolism of xylose. Annotated metagenomic data suggested diverse glycoside hydrolase gene representation within the pooled heavy DNA. By screening 2,876 cloned fragments derived from the 13C-labeled DNA isolated from soils incubated with cellulose, we demonstrate the power of combining DNA-SIP, multiple-displacement amplification (MDA), and functional metagenomics by efficiently isolating multiple clones with activity on carboxymethyl cellulose and fluorogenic proxy substrates for carbohydrate-active enzymes. PMID:25028422

  2. Induction of apoptosis in human choriocarcinoma cell lines by treatment with 3,4-dihydro-6-[4-(3,4-dimethoxybenzoyl)-1-piperazinyl]-2(1H)-quinolinone (vesnarinone).

    PubMed

    Isaka, Keiichi; Fujito, Atsuya; Sagawa, Yasukazu; Yudate, Tamaki; Nishi, Hirotaka; Ito, Hiroe; Takayama, Masaomi

    2002-01-01

    Induction of apoptosis is an attractive strategy in cancer therapy but it clinical practice is not yet sufficient in choriocarcinoma. The quinolinone derivative, vesnarinone, is a novel inotropic agent used for treating congestive heart failure and may also have a potential anticancer activity. It induces apoptosis and differentiation in some tumor cell lines. We examined the antitumor effect of vesnarinone in eight cell lines established from human choriocarcinoma and hydatidiform mole using MTT assay and also analyzed the nuclear fragmentation of tumor cells by DNA electrophoresis assay. Vesnarinone inhibited the proliferation of choriocarcinoma cell lines in a dose-dependent manner and induced DNA fragmentation in cells. However, the BM cell line prepared by subcultivation from hydatidiform mole showed no growth suppression or DNA fragmentation in response to vesnarinone. On the other hand, PCR-SSCP analysis and direct DNA sequencing have shown that a human choriocarcinoma cell line, SCH, has a mutant p53 gene at codon 249. When SCH cells were treated with vesnarinone cellular proliferation was significantly inhibited. Vesnarinone suppressed the proliferation of all choriocarcinoma cell lines and induced apoptosis, regardless of the existence of p53 mutation. In addition, it has been found by RT-PCR that expression of c-Myc mRNA is upregulated by treating choriocarcinoma cells with vesnarinone. The finding suggests that vesnarinone might induce expression of c-Myc gene in choriocarcinoma cells, the product of which may be associated with the inhibition of cell growth and induce apoptosis. These results suggest that vesnarinone is a useful reagent for the treatment of choriocarcinoma.

  3. Sodium phenylbutyrate ameliorates focal cerebral ischemic/reperfusion injury associated with comorbid type 2 diabetes by reducing endoplasmic reticulum stress and DNA fragmentation.

    PubMed

    Srinivasan, Krishnamoorthy; Sharma, Shyam S

    2011-11-20

    Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Apoptosis-like cell death in Leishmania donovani treated with KalsomeTM10, a new liposomal amphotericin B

    PubMed Central

    Shadab, Md.; Jha, Baijayanti; Asad, Mohammad; Deepthi, Makaraju; Kamran, Mohd.; Ali, Nahid

    2017-01-01

    Objective The present study aimed to elucidate the cell death mechanism in Leishmania donovani upon treatment with KalsomeTM10, a new liposomal amphotericin B. Methodology/Principal findings We studied morphological alterations in promastigotes through phase contrast and scanning electron microscopy. Phosphatidylserine (PS) exposure, loss of mitochondrial membrane potential and disruption of mitochondrial integrity was determined by flow cytometry using annexinV-FITC, JC-1 and mitotraker, respectively. For analysing oxidative stress, generation of H2O2 (bioluminescence kit) and mitochondrial superoxide O2− (mitosox) were measured. DNA fragmentation was evaluated using terminal deoxyribonucleotidyl transferase mediated dUTP nick-end labelling (TUNEL) and DNA laddering assay. We found that KalsomeTM10 is more effective then Ambisome against the promastigote as well as intracellular amastigote forms. The mechanistic study showed that KalsomeTM10 induced several morphological alterations in promastigotes typical of apoptosis. KalsomeTM10 treatment showed a dose- and time-dependent exposure of PS in promastigotes. Further, study on mitochondrial pathway revealed loss of mitochondrial membrane potential as well as disruption in mitochondrial integrity with depletion of intracellular pool of ATP. KalsomeTM10 treated promastigotes showed increased ROS production, diminished GSH levels and increased caspase-like activity. DNA fragmentation and cell cycle arrest was observed in KalsomeTM10 treated promastigotes. Apoptotic DNA fragmentation was also observed in KalsomeTM10 treated intracellular amastigotes. KalsomeTM10 induced generation of ROS and nitric oxide leads to the killing of the intracellular parasites. Moreover, endocytosis is indispensable for KalsomeTM10 mediated anti-leishmanial effect in host macrophage. Conclusions KalsomeTM10 induces apoptotic-like cell death in L. donovani parasites to exhibit its anti-leishmanial function. PMID:28170432

  5. Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae

    PubMed Central

    Chatre, Laurent; Ricchetti, Miria

    2011-01-01

    The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151

  6. Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

    PubMed

    Chatre, Laurent; Ricchetti, Miria

    2011-03-08

    The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

  7. Cell transformation mediated by chromosomal deoxyribonucleic acid of polyoma virus-transformed cells.

    PubMed Central

    Della Valle, G; Fenton, R G; Basilico, C

    1981-01-01

    To study the mechanism of deoxyribonucleic acid (DNA)-mediated gene transfer, normal rat cells were transfected with total cellular DNA extracted from polyoma virus-transformed cells. This resulted in the appearance of the transformed phenotype in 1 X 10(-6) to 3 X 10(-6) of the transfected cells. Transformation was invariably associated with the acquisition of integrated viral DNA sequences characteristic of the donor DNA. This was caused not by the integration of free DNA molecules, but by the transfer of large DNA fragments (10 to 20 kilobases) containing linked cellular and viral sequences. Although Southern blot analysis showed that integration did not appear to occur in a homologous region of the recipient chromosome, the frequency of transformation was rather high when compared with that of purified polyoma DNA, perhaps due to "position" effects or to the high efficiency of recombination of large DNA fragments. Images PMID:6100965

  8. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

    PubMed

    Hazkani-Covo, Einat; Martin, William F

    2017-05-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Specific Detection of Clavibacter michiganensis subsp. sepedonicus by Amplification of Three Unique DNA Sequences Isolated by Subtraction Hybridization.

    PubMed

    Mills, D; Russell, B W; Hanus, J W

    1997-08-01

    ABSTRACT Three single-copy, unique DNA fragments, designated Cms50, Cms72, and Cms85, were isolated from strain CS3 of Clavibacter michiganensis subsp. sepedonicus by subtraction hybridization using driver DNA from C. michiganensis subsp. insidiosus, C. michiganensis subsp. michiganensis, and Rhodococcus facians. Radio-labeled probes made of these fragments and used in Southern blot analysis revealed each to be absolutely specific to all North American C. michiganensis subsp. sepedonicus strains tested, including plasmidless and nonmucoid strains. The probes have no homology with genomic DNA from related C. michiganensis subspecies insidiosus, michiganensis, and tessellarius, nor with DNA from 11 additional bacterial species and three unidentified strains, some of which have been previously reported to display cross-reactivity with C. michiganensis subsp. sepedonicus-specific antisera. The three fragments shared no homology, and they appeared to be separated from each other by at least 20 kbp in the CS3 genome. Internal primer sets permitted amplification of each fragment by the polymerase chain reaction (PCR) only from C. michiganensis subsp. sepedonicus DNA. In a PCR-based sensitivity assay using a primer set that amplifies Cms85, the lowest level of detection of C. michiganensis subsp. sepedonicus was 100 CFU per milliliter when cells were added to potato core fluid. Erroneous results that may arise from PCR artifacts and mutational events are, therefore, minimized by the redundancy of the primer sets, and the products should be verifiable with unique capture probes in sequence-based detection systems.

  10. Effects of Urtica dioica dichloromethane extract on cell apoptosis and related gene expression in human breast cancer cell line (MDA-MB-468).

    PubMed

    Mohammadi, A; Mansoori, B; Goldar, S; Shanehbandi, D; Khaze, V; Mohammadnejad, L; Baghbani, E; Baradaran, B

    2016-02-29

    Breast cancer is the most common cancer among women in worldwide, especially in developing countries. Therefore, a large number of anticancer agents with herbal origins have been reported against this deadly disease. This study is the first to examine the cytotoxic and apoptotic effects of Urtica dioica in MDA-MB-468, human breast adenocarcinoma cells. The 3-(4,5-dimethylethiazol-2 yl)-2,5- diphenyltetrazolium (MTT) reduction and trypan-blue exclusion assay were performed in MDA-MB-468 cells as well as control cell line L929 to analyze the cytotoxic activity of the dichloromethane extract. In addition, Apoptosis induction of Urtica dioica on the MDA-MB-468 cells was assessed using TUNEL (terminal deoxy transferase (TdT)-mediated dUTP nick- end labeling) assay and DNA fragmentation analysis and real-time polymerase chain reaction (PCR). The results showed that the extract significantly inhibited cell growth and viability without inducing damage to normal control cells. Nuclei Staining in TUNEL and DNA fragments in DNA fragmentation assay and increase in the mRNA expression levels of caspase-3, caspase-9, decrease in the bcl2 and no significant change in the caspase-8 mRNA expression level, showed that the induction of apoptosis was the main mechanism of cell death that induce by Urtica dioica extract. Our results suggest that urtica dioica dichloromethane extract may contain potential bioactive compound(s) for the treatment of breast adenocarcinoma.

  11. Random-breakage mapping method applied to human DNA sequences

    NASA Technical Reports Server (NTRS)

    Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The random-breakage mapping method [Game et al. (1990) Nucleic Acids Res., 18, 4453-4461] was applied to DNA sequences in human fibroblasts. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated calls, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with DNA probes recognizing the single copy sequences of interest. The Southern blots show a band for the unbroken restriction fragments and a smear below this band due to radiation induced random breaks. This smear pattern contains two discontinuities in intensity at positions that correspond to the distance of the hybridization site to each end of the restriction fragment. By analyzing the positions of those discontinuities we confirmed the previously mapped position of the probe DXS1327 within a NotI fragment on the X chromosome, thus demonstrating the validity of the technique. We were also able to position the probes D21S1 and D21S15 with respect to the ends of their corresponding NotI fragments on chromosome 21. A third chromosome 21 probe, D21S11, has previously been reported to be close to D21S1, although an uncertainty about a second possible location existed. Since both probes D21S1 and D21S11 hybridized to a single NotI fragment and yielded a similar smear pattern, this uncertainty is removed by the random-breakage mapping method.

  12. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    PubMed

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  13. Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

    PubMed

    Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

    2018-06-29

    The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Novel synthetic (S,S) and (R,R)-secoisolariciresinol diglucosides (SDGs) protect naked plasmid and genomic DNA From gamma radiation damage.

    PubMed

    Mishra, Om P; Pietrofesa, Ralph; Christofidou-Solomidou, Melpo

    2014-07-01

    Secoisolariciresinol diglucoside (SDG) is the major lignan in wholegrain flaxseed. However, extraction methods are complex and are associated with low yield and high costs. Using a novel synthetic pathway, our group succeeded in chemically synthesizing SDG (S,S and R,R enantiomers), which faithfully recapitulates the properties of their natural counterparts, possessing strong antioxidant and free radical scavenging properties. This study further extends initial findings by now investigating the DNA-radioprotective properties of the synthetic SDG enantiomers compared to the commercial SDG. DNA radioprotection was assessed by cell-free systems such as: (a) plasmid relaxation assay to determine the extent of the supercoiled (SC) converted to open-circular (OC) plasmid DNA (pBR322) after exposure of the plasmid to gamma radiation; and (b) determining the extent of genomic DNA fragmentation. Exposure of plasmid DNA to 25 Gy of γ radiation resulted in decreased supercoiled form and increased open-circular form, indicating radiation-induced DNA damage. Synthetic SDG (S,S) and SDG (R,R), and commercial SDG at concentrations of 25-250 μM significantly and equipotently reduced the radiation-induced supercoiled to open-circular plasmid DNA in a dose-dependent conversion. In addition, exposure of calf thymus DNA to 50 Gy of gamma radiation resulted in DNA fragments of low-molecular weight (<6,000 bps), which was prevented in a dose-dependence manner by all synthetic and natural SDG enantomers, at concentrations as low as 0.5 μM. These novel results demonstrated that synthetic SDG (S,S) and SDG (R,R) isomers and commercial SDG possess DNA-radioprotective properties. Such properties along with their antioxidant and free radical scavenging activity, reported earlier, suggest that SDGs are promising candidates for radioprotection for normal tissue damage as a result of accidental exposure during radiation therapy for cancer treatment.

  15. Novel Synthetic (S,S) and (R,R)-Secoisolariciresinol Diglucosides (SDGs) Protect Naked Plasmid and Genomic DNA From Gamma Radiation Damage

    PubMed Central

    Mishra, Om P.; Pietrofesa, Ralph; Christofidou-Solomidou, Melpo

    2014-01-01

    Secoisolariciresinol diglucoside (SDG) is the major lignan in wholegrain flaxseed. However, extraction methods are complex and are associated with low yield and high costs. Using a novel synthetic pathway, our group succeeded in chemically synthesizing SDG (S,S and R,R enantiomers), which faithfully recapitulates the properties of their natural counterparts, possessing strong antioxidant and free radical scavenging properties. This study further extends initial findings by now investigating the DNA-radioprotective properties of the synthetic SDG enantiomers compared to the commercial SDG. DNA radioprotection was assessed by cell-free systems such as: (a) plasmid relaxation assay to determine the extent of the supercoiled (SC) converted to open-circular (OC) plasmid DNA (pBR322) after exposure of the plasmid to gamma radiation; and (b) determining the extent of genomic DNA fragmentation. Exposure of plasmid DNA to 25 Gy of γ radiation resulted in decreased supercoiled form and increased open-circular form, indicating radiation-induced DNA damage. Synthetic SDG (S,S) and SDG (R,R), and commercial SDG at concentrations of 25–250 μM significantly and equipotently reduced the radiation-induced supercoiled to open-circular plasmid DNA in a dose-dependent conversion. In addition, exposure of calf thymus DNA to 50 Gy of gamma radiation resulted in DNA fragments of low-molecular weight (<6,000 bps), which was prevented in a dose-dependence manner by all synthetic and natural SDG enantomers, at concentrations as low as 0.5 μM. These novel results demonstrated that synthetic SDG (S,S) and SDG (R,R) isomers and commercial SDG possess DNA-radioprotective properties. Such properties along with their antioxidant and free radical scavenging activity, reported earlier, suggest that SDGs are promising candidates for radioprotection for normal tissue damage as a result of accidental exposure during radiation therapy for cancer treatment. PMID:24945894

  16. The Escherichia coli supX locus is topA, the structural gene for DNA topoisomerase I.

    PubMed Central

    Margolin, P; Zumstein, L; Sternglanz, R; Wang, J C

    1985-01-01

    Mutations in the supX locus, which result in the absence of DNA topoisomerase I enzyme activity in both Salmonella typhimurium and Escherichia coli, are all selected as suppressors of the leu-500 promoter mutation in S. typhimurium. To determine whether the supX locus is the structural gene topA for the DNA topoisomerase I enzyme or is a positive-acting regulator/activator gene for a nearby topA structural gene, nonsense mutations were selected in the E. coli supX gene carried on an F' episome in S. typhimurium cells. The cysB-topA region of the episomes with nonsense-mutant supX alleles were then cloned onto plasmid pBR322 and transformed into E. coli cells lacking a chromosomal supX gene. Three such E. coli strains, each carrying cloned DNA from episomes with different nonsense-mutant supX alleles, all lacked DNA topoisomerase I activity but expressed antigenic determinants specific to the enzyme; control cells lacked both enzyme activity and antigenic determinants. Maxicell studies of plasmid-coded proteins demonstrated the absence of the DNA topoisomerase I protein (100 kDa) in the three strains but the appearance of a new smaller peptide in each (36, 47, and 64 kDa). These new peptides must represent fragments of the enzyme resulting from translation termination at the supX nonsense codons and confirm the interpretation that the supX gene is topA, the structural gene for DNA topoisomerase I. Images PMID:2991925

  17. Method of inactivation of an end product of energy metabolism in Zymomonas mobilis

    DOEpatents

    Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Lakewood, CO

    2008-05-20

    The present invention briefly provides a method of site-specific insertion in Zymomonas, comprising, providing a Zymomonas gene fragment, interrupting a DNA sequence the fragment, and transforming the Zymomonas through homologous recombination with the interrupted fragment.

  18. MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure

    PubMed Central

    Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris

    2003-01-01

    Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969

  19. Detection of sequence variation in parasite ribosomal DNA by electrophoresis in agarose gels supplemented with a DNA-intercalating agent.

    PubMed

    Zhu, X Q; Chilton, N B; Gasser, R B

    1998-05-01

    This study evaluated the use of a commercially available DNA intercalating agent (Resolver Gold) in agarose gels for the direct detection of sequence variation in ribosomal DNA (rDNA). This agent binds preferentially to AT sequence motifs in DNA. Regions of nuclear rDNA, known to provide genetic markers for the identification of species of parasitic ascarid nematodes (order Ascaridida), were amplified by polymerase chain reaction (PCR) and subjected to electrophoresis in standard agarose gels versus gels supplemented with Resolver Gold. Individual taxa examined could not be distinguished reliably based on the size of their amplicons in standard agarose gels, whereas they could be readily delineated based on mobility using Resolver Gold-supplemented gels. The latter was achieved because of differences (approximately 0.1-8.2%) in the AT content of the fragments among different taxa, which were associated with significant interspecific differences (approximately 11-39%) in the rDNA sequences employed. There was a tendency for fragments with higher AT content to migrate slower in supplemented agarose gels compared with those of lower AT content. The results indicate the usefulness of this electrophoretic approach to rapidly screen for sequence variability within or among PCR-amplified rDNA fragments of similar sizes but differing AT contents. Although evaluated on rDNA of parasites, the approach has potential to be applied to a range of genes of different groups of infectious organisms.

  20. Detection of DNA "fingerprints" of cultivated rice by hybridization with a human minisatellite DNA probe.

    PubMed

    Dallas, J F

    1988-09-01

    A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species.

Top