Science.gov

Sample records for activator proteins saps

  1. SAP family proteins.

    PubMed

    Fujita, A; Kurachi, Y

    2000-03-05

    Thus far, five members including Dlg, SAP97/hDlg, SAP90/PSD-95, SAP102, and PSD-93/chapsyn110 which belong to SAP family have been identified. Recent studies have revealed that these proteins play important roles in the localization and function of glutamate receptors and K(+) channels. Although most of them have been reported to be localized to the synapse, only one member, SAP97, is expressed also in the epithelial cells. In this review, we have summarized structural characters of SAP family proteins and discuss their functions in neurons and epithelial cells.

  2. A non-glycosylated and functionally deficient mutant (N215H) of the sphingolipid activator protein B (SAP-B) in a novel case of metachromatic leukodystrophy (MLD).

    PubMed

    Wrobe, D; Henseler, M; Huettler, S; Pascual Pascual, S I; Chabas, A; Sandhoff, K

    2000-02-01

    The lysosomal degradation of sphingolipids with short oligosaccharide chains depends on small glycosylated non-enzymatic sphingolipid activator proteins (SAPs, saposins). Four of the five known SAPs, SAP-A, -B, -C and -D, are derived by proteolytic processing from a common precursor protein (SAP-precursor) that is encoded by a gene on chromosome 10 consisting of 15 exons and 14 introns. SAP-B is a non-specific glycolipid binding protein that stimulates in vitro the hydrolysis of about 20 glycolipids by different enzymes. In vivo SAP-B stimulates in particular the degradation of sulphatides by arylsulphatase A. So far, four different point mutations have been identified on the SAP-B domain of the SAP-precursor gene. The mutations result in a loss of mature SAP-B, causing the lysosomal accumulation of sulphatides and other sphingolipids, resulting in variant forms of metachromatic leukodystrophy (MLD). Here we report on a patient with SAP-B deficiency that is caused by a new homoallelic point mutation that has been identified by mRNA and DNA analysis. A 643A > C transversion results in the exchange of asparagine 215 to histidine and eliminates the single glycosylation site of SAP-B. Metabolic labelling experiments showed that the mutation had no effect on the intracellular transport of the encoded precursor to the acidic compartments and its maturation in the patient's cells. All four SAPs (SAP-A to SAP-D) were detectable by immunochemical methods. SAP-B in the patient's cells was found to be slightly less stable than the protein in normal cells and corresponded in size to the deglycosylated form of the wild-type SAP-B. Feeding studies with non-glycosylated SAP-precursor, generating non-glycosylated SAP-B, showed that the loss of the carbohydrate chain reduced the intracellular activity of the protein significantly. The additional structural change of the patient's SAP-B, caused by the change of amino acid 215 from asparagine to histidine, presumably resulted in an

  3. Structural and binding studies of SAP-1 protein with heparin.

    PubMed

    Yadav, Vikash K; Mandal, Rahul S; Puniya, Bhanwar L; Kumar, Rahul; Dey, Sharmistha; Singh, Sarman; Yadav, Savita

    2015-03-01

    SAP-1 is a low molecular weight cysteine protease inhibitor (CPI) which belongs to type-2 cystatins family. SAP-1 protein purified from human seminal plasma (HuSP) has been shown to inhibit cysteine and serine proteases and exhibit interesting biological properties, including high temperature and pH stability. Heparin is a naturally occurring glycosaminoglycan (with varied chain length) which interacts with a number of proteins and regulates multiple steps in different biological processes. As an anticoagulant, heparin enhances inhibition of thrombin by the serpin antithrombin III. Therefore, we have employed surface plasmon resonance (SPR) to improve our understanding of the binding interaction between heparin and SAP-1 (protease inhibitor). SPR data suggest that SAP-1 binds to heparin with a significant affinity (KD = 158 nm). SPR solution competition studies using heparin oligosaccharides showed that the binding of SAP-1 to heparin is dependent on chain length. Large oligosaccharides show strong binding affinity for SAP-1. Further to get insight into the structural aspect of interactions between SAP-1 and heparin, we used modelled structure of the SAP-1 and docked with heparin and heparin-derived polysaccharides. The results suggest that a positively charged residue lysine plays important role in these interactions. Such information should improve our understanding of how heparin, present in the reproductive tract, regulates cystatins activity.

  4. Degradation of membrane-bound ganglioside GM1. Stimulation by bis(monoacylglycero)phosphate and the activator proteins SAP-B and GM2-AP.

    PubMed

    Wilkening, G; Linke, T; Uhlhorn-Dierks, G; Sandhoff, K

    2000-11-17

    According to our hypothesis (Fürst, W., and Sandhoff, K. (1992) Biochim. Biophys. Acta 1126, 1-16) glycosphingolipids of the plasma membrane are digested after endocytosis as components of intraendosomal and intralysosomal vesicles and membrane structures. The lysosomal degradation of glycosphingolipids with short oligosaccharide chains by acid exohydrolases requires small, non-enzymatic cofactors, called sphingolipid activator proteins (SAPs). A total of five activator proteins have been identified as follows: namely the saposins SAP-A, -B, -C, and -D, which are derived from the single chain SAP-precursor protein (prosaposin), and the GM2 activator protein. A deficiency of prosaposin results in the storage of ceramide and sphingolipids with short oligosaccharide head groups. The loss of the GM2 activator protein blocks the degradation of the ganglioside GM2. The enzymatic hydrolysis of the ganglioside GM1 is catalyzed by beta-galactosidase, a water-soluble acid exohydrolase. The lack of ganglioside GM1 accumulation in patients suffering from either prosaposin or GM2 activator protein deficiency has led to the hypothesis that SAPs are not needed for the hydrolysis of the ganglioside GM1 in vivo. In this study we demonstrate that an activator protein is required for the enzymatic degradation of membrane-bound ganglioside GM1 and that both SAP-B and the GM2 activator protein significantly enhance the degradation of the ganglioside GM1 by acid beta-galactosidase in a liposomal, detergent-free assay system. These findings offer a possible explanation for the observation that no storage of the ganglioside GM1 has been observed in patients with either isolated prosaposin or isolated GM2 activator deficiency. We also demonstrate that anionic phospholipids such as bis(monoacylglycero)phosphate and phosphatidylinositol, which specifically occur in inner membranes of endosomes and in lysosomes, are essential for the activator-stimulated hydrolysis of the ganglioside GM1

  5. The adaptor molecule signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is essential in mechanisms involving the Fyn tyrosine kinase for induction and progression of collagen-induced arthritis.

    PubMed

    Zhong, Ming-Chao; Veillette, André

    2013-11-01

    Signaling lymphocytic activation molecule-associated protein (SAP) is an Src homology 2 domain-only adaptor involved in multiple immune cell functions. It has also been linked to immunodeficiencies and autoimmune diseases, such as systemic lupus erythematosus. Here, we examined the role and mechanism of action of SAP in autoimmunity using a mouse model of autoimmune arthritis, collagen-induced arthritis (CIA). We found that SAP was essential for development of CIA in response to collagen immunization. It was also required for production of collagen-specific antibodies, which play a key role in disease pathogenesis. These effects required SAP expression in T cells, not in B cells. In mice immunized with a high dose of collagen, the activity of SAP was nearly independent of its ability to bind the protein tyrosine kinase Fyn and correlated with the capacity of SAP to promote full differentiation of follicular T helper (TFH) cells. However, with a lower dose of collagen, the role of SAP was more dependent on Fyn binding, suggesting that additional mechanisms other than TFH cell differentiation were involved. Further studies suggested that this might be due to a role of the SAP-Fyn interaction in natural killer T cell development through the ability of SAP-Fyn to promote Vav-1 activation. We also found that removal of SAP expression during progression of CIA attenuated disease severity. However, it had no effect on disease when CIA was clinically established. Together, these results indicate that SAP plays an essential role in CIA because of Fyn-independent and Fyn-dependent effects on TFH cells and, possibly, other T cell types.

  6. Stress- and mitogen-induced phosphorylation of the synapse-associated protein SAP90/PSD-95 by activation of SAPK3/p38gamma and ERK1/ERK2.

    PubMed Central

    Sabio, Guadalupe; Reuver, Suzana; Feijoo, Carmen; Hasegawa, Masato; Thomas, Gareth M; Centeno, Francisco; Kuhlendahl, Sven; Leal-Ortiz, Sergio; Goedert, Michel; Garner, Craig; Cuenda, Ana

    2004-01-01

    SAPK3 (stress-activated protein kinase-3, also known as p38gamma) is a member of the mitogen-activated protein kinase family; it phosphorylates substrates in response to cellular stress, and has been shown to bind through its C-terminal sequence to the PDZ domain of alpha1-syntrophin. In the present study, we show that SAP90 [(synapse-associated protein 90; also known as PSD-95 (postsynaptic density-95)] is a novel physiological substrate for both SAPK3/p38gamma and the ERK (extracellular-signal-regulated protein kinase). SAPK3/p38gamma binds preferentially to the third PDZ domain of SAP90 and phosphorylates residues Thr287 and Ser290 in vitro, and Ser290 in cells in response to cellular stresses. Phosphorylation of SAP90 is dependent on the binding of SAPK3/p38gamma to the PDZ domain of SAP90. It is not blocked by SB 203580, which inhibits SAPK2a/p38alpha and SAPK2b/p38beta but not SAPK3/p38gamma, or by the ERK pathway inhibitor PD 184352. However, phosphorylation is abolished when cells are treated with a cell-permeant Tat fusion peptide that disrupts the interaction of SAPK3/p38gamma with SAP90. ERK2 also phosphorylates SAP90 at Thr287 and Ser290 in vitro, but this does not require PDZ-dependent binding. SAP90 also becomes phosphorylated in response to mitogens, and this phosphorylation is prevented by pretreatment of the cells with PD 184352, but not with SB 203580. In neurons, SAP90 and SAPK3/p38gamma co-localize and they are co-immunoprecipitated from brain synaptic junctional preparations. These results demonstrate that SAP90 is a novel binding partner for SAPK3/p38gamma, a first physiological substrate described for SAPK3/p38gamma and a novel substrate for ERK1/ERK2, and that phosphorylation of SAP90 may play a role in regulating protein-protein interactions at the synapse in response to adverse stress- or mitogen-related stimuli. PMID:14741046

  7. Structure-function analysis of SAP97, a modular scaffolding protein that drives dendrite growth.

    PubMed

    Zhang, L; Hsu, F-C; Mojsilovic-Petrovic, J; Jablonski, A M; Zhai, J; Coulter, D A; Kalb, R G

    2015-03-01

    Activation of AMPA receptors assembled with the GluA1 subunit can promote dendrite growth in a manner that depends on its direct binding partner, SAP97. SAP97 is a modular scaffolding protein that has at least seven recognizable protein-protein interaction domains. Several complementary approaches were employed to show that the dendrite branching promoting action of full length SAP97 depends on ligand(s) that bind to the PDZ3 domain. Ligand(s) to PDZ1, PDZ2 and I3 domains also contribute to dendrite growth. The ability of PDZ3 ligand(s) to promote dendrite growth depends on localization at the plasma membrane along with GluA1 and SAP97. These results suggest that the assembly of a multi-protein complex at or near synapses is vital for the translation of AMPA-R activity into dendrite growth.

  8. NuSAP modulates the dynamics of kinetochore microtubules by attenuating MCAK depolymerisation activity

    PubMed Central

    Li, Chenyu; Zhang, Yajun; Yang, Qiaoyun; Ye, Fan; Sun, Stella Ying; Chen, Ee Sin; Liou, Yih-Cherng

    2016-01-01

    Nucleolar and spindle-associated protein (NuSAP) is a microtubule-associated protein that functions as a microtubule stabiliser. Depletion of NuSAP leads to severe mitotic defects, however the mechanism by which NuSAP regulates mitosis remains elusive. In this study, we identify the microtubule depolymeriser, mitotic centromere-associated kinesin (MCAK), as a novel binding partner of NuSAP. We show that NuSAP regulates the dynamics and depolymerisation activity of MCAK. Phosphorylation of MCAK by Aurora B kinase, a component of the chromosomal passenger complex, significantly enhances the interaction of NuSAP with MCAK and modulates the effects of NuSAP on the depolymerisation activity of MCAK. Our results reveal an underlying mechanism by which NuSAP controls kinetochore microtubule dynamics spatially and temporally by modulating the depolymerisation function of MCAK in an Aurora B kinase-dependent manner. Hence, this study provides new insights into the function of NuSAP in spindle formation during mitosis. PMID:26733216

  9. Further studies on the reconstitution of glucosylceramidase activity by Sap C and anionic phospholipids.

    PubMed

    Salvioli, R; Tatti, M; Ciaffoni, F; Vaccaro, A M

    2000-04-21

    The reconstitution of the activity of the lysosomal enzyme glucosylceramidase requires anionic phospholipids and, at least, a protein factor, saposin C (Sap C). We have previously proposed a mechanism for the glucosylceramidase activation [Vaccaro et al. (1993) FEBS Lett. 336, 159-162] which implies that Sap C promotes the association of the enzyme with anionic phospholipid-containing membranes, thus favoring the contact between the enzyme and its lipid substrate, glucosylceramide. We have further investigated the properties of Sap C using a fluorescent hydrophobic probe such as 4, 4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS). The binding between bis-ANS and Sap C was pH-dependent, indicating that protonation leads to increased exposure of hydrophobic surfaces of Sap C. The interaction of Sap C with membranes, triggered by the development of hydrophobic properties at low pH values, was affected by the content of anionic phospholipids, such as phosphatidylserine or phosphatidylinositol, suggesting that anionic phospholipids have the potential to modulate the insertion of Sap C in the hydrophobic environment of lysosomal membranes. We previously showed that Sap C and anionic phospholipids are both required for the binding of glucosylceramidase to large vesicles. We have presently observed that Sap C is able to promote the association of glucosylceramidase with the lipid surface only when anionic phospholipids exceed a concentration of 5-10%. This level can be reached by summing lower amounts of individual anionic phospholipids, since they have additive effects. The present data extend and refine our model of the mechanism of glucosylceramidase activation and stress the key role of pH, Sap C and anionic phospholipids in promoting the interaction of the enzyme with membranes.

  10. Antidiarrhoeal Activity of Musa paradisiaca Sap in Wistar Rats

    PubMed Central

    Yakubu, Musa T.; Nurudeen, Quadri O.; Salimon, Saoban S.; Yakubu, Monsurat O.; Jimoh, Rukayat O.; Nafiu, Mikhail O.; Akanji, Musbau A.; Oladiji, Adenike T.; Williams, Felicia E.

    2015-01-01

    The folkloric claim of Musa paradisiaca sap in the management of diarrhoea is yet to be substantiated or refuted with scientific data. Therefore, the aim of the current study was to screen the sap of M. paradisiaca for both its secondary metabolites and antidiarrhoeal activity at 0.25, 0.50, and 1.00 mL in rats. Secondary metabolites were screened using standard methods while the antidiarrhoeal activity was done by adopting the castor oil-induced diarrhoeal, castor oil-induced enteropooling, and gastrointestinal motility models. The sap contained flavonoids, phenolics, saponins, alkaloids, tannins, and steroids while cardiac glycosides, anthraquinones, triterpenes, cardenolides, and dienolides were not detected. In the castor oil-induced diarrhoeal model, the sap significantly (P < 0.05) prolonged the onset time of diarrhoea, decreased the number, fresh weight, and water content of feaces, and increased the inhibition of defecations. Na+-K+-ATPase activity in the small intestine increased significantly whereas nitric oxide content decreased. The decreases in the masses and volumes of intestinal fluid by the sap were accompanied by increase in inhibition of intestinal fluid content in the enteropooling model. The sap decreased the charcoal meal transit in the gastrointestinal motility model. In all the models, the 1.00 mL of the sap produced changes that compared well with the reference drugs. Overall, the antidiarrhoeal activity of Musa paradisiaca sap attributed to the presence of alkaloids, phenolics, flavonoids, and/or saponins which may involve, among others, enhancing fluid and electrolyte absorption through de novo synthesis of the sodium potassium ATPase and/or reduced nitric oxide levels. PMID:25893000

  11. Antidiarrhoeal Activity of Musa paradisiaca Sap in Wistar Rats.

    PubMed

    Yakubu, Musa T; Nurudeen, Quadri O; Salimon, Saoban S; Yakubu, Monsurat O; Jimoh, Rukayat O; Nafiu, Mikhail O; Akanji, Musbau A; Oladiji, Adenike T; Williams, Felicia E

    2015-01-01

    The folkloric claim of Musa paradisiaca sap in the management of diarrhoea is yet to be substantiated or refuted with scientific data. Therefore, the aim of the current study was to screen the sap of M. paradisiaca for both its secondary metabolites and antidiarrhoeal activity at 0.25, 0.50, and 1.00 mL in rats. Secondary metabolites were screened using standard methods while the antidiarrhoeal activity was done by adopting the castor oil-induced diarrhoeal, castor oil-induced enteropooling, and gastrointestinal motility models. The sap contained flavonoids, phenolics, saponins, alkaloids, tannins, and steroids while cardiac glycosides, anthraquinones, triterpenes, cardenolides, and dienolides were not detected. In the castor oil-induced diarrhoeal model, the sap significantly (P < 0.05) prolonged the onset time of diarrhoea, decreased the number, fresh weight, and water content of feaces, and increased the inhibition of defecations. Na(+)-K(+)-ATPase activity in the small intestine increased significantly whereas nitric oxide content decreased. The decreases in the masses and volumes of intestinal fluid by the sap were accompanied by increase in inhibition of intestinal fluid content in the enteropooling model. The sap decreased the charcoal meal transit in the gastrointestinal motility model. In all the models, the 1.00 mL of the sap produced changes that compared well with the reference drugs. Overall, the antidiarrhoeal activity of Musa paradisiaca sap attributed to the presence of alkaloids, phenolics, flavonoids, and/or saponins which may involve, among others, enhancing fluid and electrolyte absorption through de novo synthesis of the sodium potassium ATPase and/or reduced nitric oxide levels.

  12. A Critical Role for the GluA1 Accessory Protein, SAP97, in Cocaine Seeking

    PubMed Central

    White, Samantha L; Ortinski, Pavel I; Friedman, Shayna H; Zhang, Lei; Neve, Rachael L; Kalb, Robert G; Schmidt, Heath D; Pierce, R Christopher

    2016-01-01

    A growing body of evidence indicates that the transport of GluA1 subunit-containing calcium-permeable AMPA receptors (CP-AMPARs) to synapses in subregions of the nucleus accumbens promotes cocaine seeking. Consistent with these findings, the present results show that administration of the CP-AMPAR antagonist, Naspm, into the caudal lateral core or caudal medial shell of the nucleus accumbens attenuated cocaine priming-induced reinstatement of drug seeking. Moreover, viral-mediated overexpression of ‘pore dead' GluA1 subunits (via herpes simplex virus (HSV) GluA1-Q582E) in the lateral core or medial shell attenuated the reinstatement of cocaine seeking. The overexpression of wild-type GluA1 subunits (via HSV GluA1-WT) in the medial shell, but not the lateral core, enhanced the reinstatement of cocaine seeking. These results indicate that activation of GluA1-containing AMPARs in subregions of the nucleus accumbens reinstates cocaine seeking. SAP97 and 4.1N are proteins involved in GluA1 trafficking to and stabilization in synapses; SAP97-GluA1 interactions also influence dendritic growth. We next examined potential roles of SAP97 and 4.1N in cocaine seeking. Viral-mediated expression of a microRNA that reduces SAP97 protein expression (HSV miSAP97) in the medial accumbens shell attenuated cocaine seeking. In contrast, a virus that overexpressed a dominant-negative form of a 4.1N C-terminal domain (HSV 4.1N-CTD), which prevents endogenous 4.1N binding to GluA1 subunits, had no effect on cocaine seeking. These results indicate that the GluA1 subunit accessory protein SAP97 may represent a novel target for pharmacotherapeutic intervention in the treatment of cocaine craving. PMID:26149358

  13. Xylem sap in cotton contains proteins that contribute to environmental stress response and cell wall development.

    PubMed

    Zhang, Zhiyong; Xin, Wanwan; Wang, Sufang; Zhang, Xin; Dai, Haifang; Sun, Runrun; Frazier, Taylor; Zhang, Baohong; Wang, Qinglian

    2015-01-01

    The xylem sap of a plant is primarily responsible for transporting molecules from the underground root system to the aboveground parts of the plant body. In order to understand the role that roots play in cotton growth and development, the components present in xylem sap must be elucidated. In this study, we used a shotgun HPLC-ESI-MS/MS proteomics approach to identify 455 peptides from the xylem sap of field-grown cotton plants at peak blooming stage. Of these peptides, 384 (84.4%) were found to be secreted proteins and 320 (70.3%) had special molecular functions. Based on Gene Ontology (GO) analysis, 348 peptides were annotated in terms of molecular function, biological process, and cellular localization, with 46.9 and 45.1% being related to catalytic activity and binding activity, respectively. Many xylem sap-containing proteins were predicted to be involved in different phases of xylem differentiation including cell wall metabolism, secondary cell wall development and patterning, and programmed cell death. The identification of starch and sucrose hydrolyzing enzymes implicated the interaction between roots and aboveground parts on the aspect of carbohydrate metabolism. Many of the proteins identified in this study are involved in defense mechanisms including pathogen-related proteins, such as peroxidases, chitinases, and germin-like proteins, proteases involved in disease resistance, and phytoalexin phenylpropanoid synthesis-related proteins. The majority of identified signaling proteins were fasciclin-like arabinogalactan proteins and kinases. The results of this study provide useful insight into the communication mechanisms between cotton roots and the rest of the cotton plant.

  14. Protein tyrosine phosphatase SAP-1 protects against colitis through regulation of CEACAM20 in the intestinal epithelium.

    PubMed

    Murata, Yoji; Kotani, Takenori; Supriatna, Yana; Kitamura, Yasuaki; Imada, Shinya; Kawahara, Kohichi; Nishio, Miki; Daniwijaya, Edwin Widyanto; Sadakata, Hisanobu; Kusakari, Shinya; Mori, Munemasa; Kanazawa, Yoshitake; Saito, Yasuyuki; Okawa, Katsuya; Takeda-Morishita, Mariko; Okazawa, Hideki; Ohnishi, Hiroshi; Azuma, Takeshi; Suzuki, Akira; Matozaki, Takashi

    2015-08-04

    Intestinal epithelial cells contribute to regulation of intestinal immunity in mammals, but the detailed molecular mechanisms of such regulation have remained largely unknown. Stomach-cancer-associated protein tyrosine phosphatase 1 (SAP-1, also known as PTPRH) is a receptor-type protein tyrosine phosphatase that is localized specifically at microvilli of the brush border in gastrointestinal epithelial cells. Here we show that SAP-1 ablation in interleukin (IL)-10-deficient mice, a model of inflammatory bowel disease, resulted in a marked increase in the severity of colitis in association with up-regulation of mRNAs for various cytokines and chemokines in the colon. Tyrosine phosphorylation of carcinoembryonic antigen-related cell adhesion molecule (CEACAM) 20, an intestinal microvillus-specific transmembrane protein of the Ig superfamily, was greatly increased in the intestinal epithelium of the SAP-1-deficient animals, suggesting that this protein is a substrate for SAP-1. Tyrosine phosphorylation of CEACAM20 by the protein tyrosine kinase c-Src and the consequent association of CEACAM20 with spleen tyrosine kinase (Syk) promoted the production of IL-8 in cultured cells through the activation of nuclear factor-κB (NF-κB). In addition, SAP-1 and CEACAM20 were found to form a complex through interaction of their ectodomains. SAP-1 and CEACAM20 thus constitute a regulatory system through which the intestinal epithelium contributes to intestinal immunity.

  15. Protein profile of Lupinus texensis phloem sap exudates: searching for Fe- and Zn-containing proteins.

    PubMed

    Lattanzio, Giuseppe; Andaluz, Sofía; Matros, Andrea; Calvete, Juan José; Kehr, Julia; Abadía, Anunciación; Abadía, Javier; López-Millán, Ana-Flor

    2013-08-01

    The aim of this study was to obtain a comprehensive overview of the phloem sap protein profile of Lupinus texensis, with a special focus on proteins binding Fe and Zn. L. texensis was chosen as model plant given the simplicity to obtain exudates from sieve elements. Protein profiling by 2DE revealed 249 spots, and 54 of them were unambiguously identified by MALDI-MS and ESI-MS/MS. The largest number of identified protein species belongs to protein modification/turnover and general metabolism (19-21%), followed by redox homeostasis (9%) and defense and cell structural components (7%). This protein profile is similar to that reported in other plant species, suggesting that the phloem sap proteome is quite conserved. Staining of 2DE gels for Fe-containing proteins and affinity chromatography experiments revealed the presence of two low molecular weight Fe-binding proteins in phloem sap: a metallothionein-like protein type 2B identified in the Fe-affinity chromatography, and a second protein identified with both Fe staining methods. This protein species had a molecular weight of 13.5 kDa, a pI of 5.6 and 51% homology to a phloem-specific protein from Medicago truncatula. Zinc affinity chromatography revealed four Zn-binding proteins in phloem sap, one belonging to the dehydrin family and three Zn finger proteins.

  16. 30 CFR 285.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... approved SAP? 285.614 Section 285.614 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE... Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities approved in your...

  17. 30 CFR 585.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... approved SAP? 585.614 Section 585.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities...

  18. 30 CFR 585.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... approved SAP? 585.614 Section 585.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities...

  19. 30 CFR 585.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... approved SAP? 585.614 Section 585.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting the activities...

  20. Solution structural studies and low-resolution model of the Schizosaccharomyces pombe sap1 protein.

    PubMed

    Bada, M; Walther, D; Arcangioli, B; Doniach, S; Delarue, M

    2000-07-14

    Sap1 is a DNA-binding protein involved in controlling the mating type switch in fission yeast Schizosaccharomyces pombe. In the absence of any significant sequence similarity with any structurally known protein, a variety of biophysical techniques has been used to probe the solution low-resolution structure of the sap1 protein. First, sap1 is demonstrated to be an unusually elongated dimer in solution by measuring the translational diffusion coefficient with two independent techniques: dynamic light-scattering and ultracentrifugation. Second, sequence analysis revealed the existence of a long coiled-coil region, which is responsible for dimerization. The length of the predicted coiled-coil matches estimates drawn from the hydrodynamic experimental behaviour of the molecule. In addition, the same measurements done on a shorter construct with a coiled-coil region shortened by roughly one-half confirmed the localization of the long coiled-coil region. A crude T-shape model incorporating all these information was built. Third, small-angle X-ray scattering (SAXS) of the free molecule provided additional evidence for the model. In particular, the P(r) curve strikingly demonstrates the existence of long intramolecular distances. Using a novel 3D reconstruction algorithm, a low resolution 3D model of the protein has been independently constructed that matches the SAXS experimental data. It also fits the translation diffusion coefficients measurements and agrees with the first T-shaped model. This low-resolution model has clearly biologically relevant new functional implications, suggesting that sap1 is a bifunctional protein, with the two active sites being separated by as much as 120 A; a tetrapeptide repeated four times at the C terminus of the molecule is postulated to be of utmost functional importance.

  1. 30 CFR 285.614 - When may I begin conducting activities under my approved SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... approved SAP? 285.614 Section 285.614 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, REGULATION, AND... OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.614 When may I begin conducting activities under my approved SAP? (a) You may begin conducting...

  2. The adaptor protein SAP regulates type II NKT-cell development, cytokine production, and cytotoxicity against lymphoma.

    PubMed

    Weng, Xiufang; Liao, Chia-Min; Bagchi, Sreya; Cardell, Susanna L; Stein, Paul L; Wang, Chyung-Ru

    2014-12-01

    CD1d-restricted NKT cells represent a unique lineage of immunoregulatory T cells that are divided into two groups, type I and type II, based on their TCR usage. Because there are no specific tools to identify type II NKT cells, little is known about their developmental requirements and functional regulation. In our previous study, we showed that signaling lymphocytic activation molecule associated protein (SAP) is essential for the development of type II NKT cells. Here, using a type II NKT-cell TCR transgenic mouse model, we demonstrated that CD1d-expressing hematopoietic cells, but not thymic epithelial cells, meditate efficient selection of type II NKT cells. Furthermore, we showed that SAP regulates type II NKT-cell development by controlling early growth response 2 protein and promyelocytic leukemia zinc finger expression. SAP-deficient 24αβ transgenic T cells (24αβ T cells) exhibited an immature phenotype with reduced Th2 cytokine-producing capacity and diminished cytotoxicity to CD1d-expressing lymphoma cells. The impaired IL-4 production by SAP-deficient 24αβ T cells was associated with reduced IFN regulatory factor 4 and GATA-3 induction following TCR stimulation. Collectively, these data suggest that SAP is critical for regulating type II NKT cell responses. Aberrant responses of these T cells may contribute to the immune dysregulation observed in X-linked lymphoproliferative disease caused by mutations in SAP.

  3. 30 CFR 285.617 - What activities require a revision to my SAP, and when will MMS approve the revision?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What activities require a revision to my SAP... Activities Under An Approved Sap § 285.617 What activities require a revision to my SAP, and when will MMS... your approved SAP, describing in detail the type of activities you propose to conduct. We...

  4. Effects of antifungal agents in sap activity of Candida albicans isolates.

    PubMed

    Costa, Carolina Rodrigues; Jesuíno, Rosália Santos Amorim; de Aquino Lemos, Janine; de Fátima Lisboa Fernandes, Orionalda; Hasimoto e Souza, Lúcia Kioko; Passos, Xisto Sena; do Rosário Rodrigues Silva, Maria

    2010-02-01

    Some antifungal agents have shown to exert effects on expression of virulent factors of Candida as the production of secretory aspartyl proteinase (Sap). In this study, we sought to determine and to compare the influence of fluconazole and voriconazole in proteinase activity of this microorganism. Thirty-one isolates obtained from oral mucosa of human immunodeficiency virus positive (HIV) patients were used in this study. The minimal inhibitory concentrations (MIC) of fluconazole and voriconazole were determined using the broth microdilution method with RPMI 1640 medium and with yeast carbon base-bovine serum albumin (YCB-BSA) medium. The Sap activity following by digestion of BSA as substrate was determined for four Candida albicans strains arbitrarily chosen according to susceptibility (susceptible or resistant) to fluconazole or voriconazole. Besides, the SAP1 to SAP7 genes were screened by PCR for the same isolates that were determined by the Sap activity. In vitro susceptibility testing using the two media presented similar MIC values. Increased Sap activity was observed in resistant isolates on presence of drugs, but the Sap activity by susceptible isolates to azoles showed different behavior on the presence of drug. We detected the presence of SAP1 to SAP7 genes from all susceptible or resistant C. albicans isolates. The present study provides important data about the proteinase activity and the presence of genes of SAP family in fluconazole and voriconazole susceptible or resistant C. albicans isolates.

  5. Redox‐dependent disulfide bond formation in SAP30L corepressor protein: Implications for structure and function

    PubMed Central

    Laitaoja, Mikko; Tossavainen, Helena; Pihlajamaa, Tero; Valjakka, Jarkko; Viiri, Keijo; Lohi, Olli; Permi, Perttu

    2015-01-01

    Abstract Sin3A‐associated protein 30‐like (SAP30L) is one of the key proteins in a multi‐subunit protein complex involved in transcriptional regulation via histone deacetylation. SAP30L, together with a highly homologous SAP30 as well as other SAP proteins (i.e., SAP25, SAP45, SAP130, and SAP180), is an essential component of the Sin3A corepressor complex, although its actual role has remained elusive. SAP30L is thought to function as an important stabilizing and bridging molecule in the complex and to mediate its interactions with other corepressors. SAP30L has been previously shown to contain an N‐terminal Cys3His type zinc finger (ZnF) motif, which is responsible for the key protein–protein, protein–DNA, and protein–lipid interactions. By using high‐resolution mass spectrometry, we studied a redox‐dependent disulfide bond formation in SAP30L ZnF as a regulatory mechanism for its structure and function. We showed that upon oxidative stress SAP30L undergoes the formation of two specific disulfide bonds, a vicinal Cys29‐Cys30 and Cys38‐Cys74, with a concomitant release of the coordinated zinc ion. The oxidized protein was shown to remain folded in solution and to bind signaling phospholipids. We also determined a solution NMR structure for SAP30L ZnF that showed an overall fold similar to that of SAP30, determined earlier. The NMR titration experiments with lipids and DNA showed that the binding is mediated by the C‐terminal tail as well as both α‐helices of SAP30L ZnF. The implications of these results for the structure and function of SAP30L are discussed. PMID:26609676

  6. DC-SIGN activation mediates the differential effects of SAP and CRP on the innate immune system and inhibits fibrosis in mice.

    PubMed

    Cox, Nehemiah; Pilling, Darrell; Gomer, Richard H

    2015-07-07

    Fibrosis is caused by scar tissue formation in internal organs and is associated with 45% of deaths in the United States. Two closely related human serum proteins, serum amyloid P (SAP) and C-reactive protein (CRP), strongly affect fibrosis. In multiple animal models, and in Phase 1 and Phase 2 clinical trials, SAP affects several aspects of the innate immune system to reduce fibrosis, whereas CRP appears to potentiate fibrosis. However, SAP and CRP bind the same Fcγ receptors (FcγR) with similar affinities, and why SAP and CRP have opposing effects is unknown. Here, we report that SAP but not CRP binds the receptor DC-SIGN (SIGN-R1) to affect the innate immune system, and that FcγR are not necessary for SAP function. A polycyclic aminothiazole DC-SIGN ligand and anti-DC-SIGN antibodies mimic SAP effects in vitro. In mice, the aminothiazole reduces neutrophil accumulation in a model of acute lung inflammation and, at 0.001 mg/kg, alleviates pulmonary fibrosis by increasing levels of the immunosuppressant IL-10. DC-SIGN (SIGN-R1) is present on mouse lung epithelial cells, and SAP and the aminothiazole potentiate IL-10 production from these cells. Our data suggest that SAP activates DC-SIGN to regulate the innate immune system differently from CRP, and that DC-SIGN is a target for antifibrotics.

  7. Cloning, expression and cellular localization of Daphnia pulex senescence-associated protein, DpSAP.

    PubMed

    Liu, Ajing; Kong, Ling; Zhang, Mingqing; Wu, Donglei; Wang, Danli; Zhao, Yunlong

    2014-01-25

    Daphnia (water fleas) are small crustaceans that undergo an unusual switch from asexual to sexual reproduction that is dependent on environmental conditions. In this study, a senescence-associated protein (SAP) from the common freshwater species Daphnia pulex was cloned using primers based on homologous sequences and rapid amplification of cDNA ends (RACE). Real-time PCR was employed to quantify the expression of D. pulex SAP (DpSAP) in individual organisms. The role of DpSAP in the reproductive transformation was further investigated in both parthenogenetic and sexual females by using digoxin-labeled SAP RNA probes and RNA whole-mount in situ hybridization. DpSAP was more highly expressed in sexual females, indicating a role in growth and reproduction. Cellular localization studies using RNA whole-mount in situ hybridization showed specific expression in the second tentacle joints. These expression patterns suggest an important role for DpSAP in the reproductive transformation of D. pulex.

  8. 30 CFR 585.617 - What activities require a revision to my SAP, and when will BOEM approve the revision?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false What activities require a revision to my SAP... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.617 What activities require a revision to my SAP, and when will BOEM approve the revision? (a)...

  9. 30 CFR 585.617 - What activities require a revision to my SAP, and when will BOEM approve the revision?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false What activities require a revision to my SAP... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.617 What activities require a revision to my SAP, and when will BOEM approve the revision? (a)...

  10. 30 CFR 585.617 - What activities require a revision to my SAP, and when will BOEM approve the revision?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false What activities require a revision to my SAP... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.617 What activities require a revision to my SAP, and when will BOEM approve the revision? (a)...

  11. 30 CFR 285.617 - What activities require a revision to my SAP, and when will MMS approve the revision?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What activities require a revision to my SAP... OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.617 What activities require a revision to my SAP, and when will MMS approve the revision? (a) You...

  12. Functional requirement for SAP in 2B4-mediated activation of human natural killer cells as revealed by the X-linked lymphoproliferative syndrome.

    PubMed

    Tangye, S G; Phillips, J H; Lanier, L L; Nichols, K E

    2000-09-15

    X-linked lymphoproliferative syndrome (XLP) is an immunodeficiency characterized by life-threatening infectious mononucleosis and EBV-induced B cell lymphoma. The gene mutated in XLP encodes SLAM (signaling lymphocytic activation molecule-associated protein)-associated protein (SAP), a small SH2 domain-containing protein. SAP associates with 2B4 and SLAM, activating receptors expressed by NK and T cells, and prevents recruitment of SH2 domain-containing protein tyrosine phosphatase-2 SHP-2) to the cytoplasmic domains of these receptors. The phenotype of XLP may therefore result from perturbed signaling through SAP-associating receptors. We have addressed the functional consequence of SAP deficiency on 2B4-mediated NK cell activation. Ligating 2B4 on normal human NK cells with anti-2B4 mAb or interaction with transfectants bearing the 2B4 ligand CD48 induced NK cell cytotoxicity. In contrast, ligation of 2B4 on NK cells from a SAP-deficient XLP patient failed to initiate cytotoxicity. Despite this, CD2 or CD16-induced cytotoxicity of SAP-deficient NK cells was similar to that of normal NK cells. Thus, selective impairment of 2B4-mediated NK cell activation may contribute to the immunopathology of XLP.

  13. SAP-like domain in nucleolar spindle associated protein mediates mitotic chromosome loading as well as interphase chromatin interaction

    SciTech Connect

    Verbakel, Werner; Carmeliet, Geert; Engelborghs, Yves

    2011-08-12

    Highlights: {yields} The SAP-like domain in NuSAP is a functional DNA-binding domain with preference for dsDNA. {yields} This SAP-like domain is essential for chromosome loading during early mitosis. {yields} NuSAP is highly dynamic on mitotic chromatin, as evident from photobleaching experiments. {yields} The SAP-like domain also mediates NuSAP-chromatin interaction in interphase nucleoplasm. -- Abstract: Nucleolar spindle associated protein (NuSAP) is a microtubule-stabilizing protein that localizes to chromosome arms and chromosome-proximal microtubules during mitosis and to the nucleus, with enrichment in the nucleoli, during interphase. The critical function of NuSAP is underscored by the finding that its depletion in HeLa cells results in various mitotic defects. Moreover, NuSAP is found overexpressed in multiple cancers and its expression levels often correlate with the aggressiveness of cancer. Due to its localization on chromosome arms and combination of microtubule-stabilizing and DNA-binding properties, NuSAP takes a special place within the extensive group of spindle assembly factors. In this study, we identify a SAP-like domain that shows DNA binding in vitro with a preference for dsDNA. Deletion of the SAP-like domain abolishes chromosome arm binding of NuSAP during mitosis, but is not sufficient to abrogate its chromosome-proximal localization after anaphase onset. Fluorescence recovery after photobleaching experiments revealed the highly dynamic nature of this NuSAP-chromatin interaction during mitosis. In interphase cells, NuSAP also interacts with chromatin through its SAP-like domain, as evident from its enrichment on dense chromatin regions and intranuclear mobility, measured by fluorescence correlation spectroscopy. The obtained results are in agreement with a model where NuSAP dynamically stabilizes newly formed microtubules on mitotic chromosomes to enhance chromosome positioning without immobilizing these microtubules. Interphase NuSAP

  14. Disruption of each of the secreted aspartyl proteinase genes SAP1, SAP2, and SAP3 of Candida albicans attenuates virulence.

    PubMed Central

    Hube, B; Sanglard, D; Odds, F C; Hess, D; Monod, M; Schäfer, W; Brown, A J; Gow, N A

    1997-01-01

    Secreted aspartyl proteinases (Saps), encoded by a gene family with at least nine members (SAP1 to SAP9), are one of the most discussed virulence factors produced by the human pathogen Candida albicans. In order to study the role of each Sap isoenzyme in pathogenicity, we have constructed strains which harbor mutations at selected SAP genes. SAP1, SAP2, and SAP3, which are regulated differentially in vitro, were mutated by targeted gene disruption. The growth rates of all homozygous null mutants were similar to those of the isogenic wild-type parental strain (SC5314) in complex and defined media. In medium with protein as the sole source of nitrogen, sap1 and sap3 mutants grew with reduced growth rates but reached optical densities similar to those measured for SC5314. In contrast, sap2 null mutants tended to clump, grew poorly in this medium, and produced the lowest proteolytic activity. Addition of ammonium ions reversed such growth defects. These results support the view that Sap2 is the dominant isoenzyme. When sap1, sap2, and sap3 mutants were injected intravenously in guinea pigs and mice, the animals had increased survival rates compared to those of control animals infected with SC5314. However, reduction of proteolytic activity in vitro did not correlate directly with the extent of attenuation of virulence observed for all Sap-deficient mutants. These data suggest that SAP1, SAP2, and SAP3 all contribute to the overall virulence of C. albicans and presumably all play important roles during disseminated infections. PMID:9284116

  15. [Cloning and expression pattern of a zinc finger protein gene ShSAP1 in Saccharum officinarum].

    PubMed

    Li, Xiaojun; Cai, Wenwei; Zhang, Shuzhen; Xu, Liping; Chen, Ping; Wang, Jungang

    2011-06-01

    In plants, proteins with A20/AN1 zinc finger domain are involved in stress responses, named as "Stress Associated Protein" (SAP) gene family. Based on Expressed Sequence Tag (EST) sequences information in Badila Saccharum officinarum mature related cDNA library, we cloned an SAP gene from sugarcane full length cDNA library, named ShSAP1 (GenBank: Accession No. HM991960). To characterize ShSAP1, we analyzed its genome structure and expression pattern. Southern blot analysis showed ShSAP1 was present as one or two copy in the genome of Badila. Comparison of ShSAP1 1 008 bp full length cDNA with a genomic frangment (2 241 bp) generated by PCR amplification and sequencing, revealed the presence of two introns (202 bp and 1 052 bp) located in the 5'UTR region. Semiquantitative RT-PCR analysis found ShSAP1 expressed in leaves, roots and stalk in mature sugarcane. Compared with immature stems, ShSAP1 expressed higher in mature stalk. ShSAP1 was induced by different types of treatments, such as salt (200 mmol/L NaCl), drought (10% PEG 6 000), GA3 (200 mg/L), ABA (100 micromol/L) and ET (1 mmol/L) during sugarcane seedling stage. These results indicated that ShSAP1 may function in sugarcane maturation and abiotic stress response processes.

  16. SCF(SAP) controls organ size by targeting PPD proteins for degradation in Arabidopsis thaliana.

    PubMed

    Wang, Zhibiao; Li, Na; Jiang, Shan; Gonzalez, Nathalie; Huang, Xiahe; Wang, Yingchun; Inzé, Dirk; Li, Yunhai

    2016-04-06

    Control of organ size by cell proliferation and growth is a fundamental process, but the mechanisms that determine the final size of organs are largely elusive in plants. We have previously revealed that the ubiquitin receptor DA1 regulates organ size by repressing cell proliferation in Arabidopsis. Here we report that a mutant allele of STERILE APETALA (SAP) suppresses the da1-1 mutant phenotype. We show that SAP is an F-box protein that forms part of a SKP1/Cullin/F-box E3 ubiquitin ligase complex and controls organ size by promoting the proliferation of meristemoid cells. Genetic analyses suggest that SAP may act in the same pathway with PEAPOD1 and PEAPOD2, which are negative regulators of meristemoid proliferation, to control organ size, but does so independently of DA1. Further results reveal that SAP physically associates with PEAPOD1 and PEAPOD2, and targets them for degradation. These findings define a molecular mechanism by which SAP and PEAPOD control organ size.

  17. Effects of Fe deficiency on the protein profile of Brassica napus phloem sap

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The aim of this work was to study the effect of Fe deficiency on the protein profile of phloem sap exudates from Brassica napus using 2-DE (IEF-SDS PAGE). The experiment was repeated thrice and two technical replicates per treatment were done. Two hundred sixty-three spots were consistently detected...

  18. EAT-2, a SAP-like adaptor, controls NK cell activation through phospholipase Cγ, Ca++, and Erk, leading to granule polarization.

    PubMed

    Pérez-Quintero, Luis-Alberto; Roncagalli, Romain; Guo, Huaijian; Latour, Sylvain; Davidson, Dominique; Veillette, André

    2014-04-07

    Ewing's sarcoma-associated transcript 2 (EAT-2) is an Src homology 2 domain-containing intracellular adaptor related to signaling lymphocytic activation molecule (SLAM)-associated protein (SAP), the X-linked lymphoproliferative gene product. Both EAT-2 and SAP are expressed in natural killer (NK) cells, and their combined expression is essential for NK cells to kill abnormal hematopoietic cells. SAP mediates this function by coupling SLAM family receptors to the protein tyrosine kinase Fyn and the exchange factor Vav, thereby promoting conjugate formation between NK cells and target cells. We used a variety of genetic, biochemical, and imaging approaches to define the molecular and cellular mechanisms by which EAT-2 controls NK cell activation. We found that EAT-2 mediates its effects in NK cells by linking SLAM family receptors to phospholipase Cγ, calcium fluxes, and Erk kinase. These signals are triggered by one or two tyrosines located in the carboxyl-terminal tail of EAT-2 but not found in SAP. Unlike SAP, EAT-2 does not enhance conjugate formation. Rather, it accelerates polarization and exocytosis of cytotoxic granules toward hematopoietic target cells. Hence, EAT-2 promotes NK cell activation by molecular and cellular mechanisms distinct from those of SAP. These findings explain the cooperative and essential function of these two adaptors in NK cell activation.

  19. Comparative Proteomic Analysis of Wild-Type and SAP Domain Mutant Foot-and-Mouth Disease Virus-Infected Porcine Cells Identifies the Ubiquitin-Activating Enzyme UBE1 Required for Virus Replication.

    PubMed

    Zhu, Zixiang; Yang, Fan; Zhang, Keshan; Cao, Weijun; Jin, Ye; Wang, Guoqing; Mao, Ruoqing; Li, Dan; Guo, Jianhong; Liu, Xiangtao; Zheng, Haixue

    2015-10-02

    Leader protein (L(pro)) of foot-and-mouth disease virus (FMDV) manipulates the activities of several host proteins to promote viral replication and pathogenicity. L(pro) has a conserved protein domain SAP that is suggested to subvert interferon (IFN) production to block antiviral responses. However, apart from blocking IFN production, the roles of the SAP domain during FMDV infection in host cells remain unknown. Therefore, we identified host proteins associated with the SAP domain of L(pro) by a high-throughput quantitative proteomic approach [isobaric tags for relative and absolute quantitation (iTRAQ) in conjunction with liquid chromatography/electrospray ionization tandem mass spectrometry]. Comparison of the differentially regulated proteins in rA/FMDVΔmSAP- versus rA/FMDV-infected SK6 cells revealed 45 down-regulated and 32 up-regulated proteins that were mostly associated with metabolic, ribosome, spliceosome, and ubiquitin-proteasome pathways. The results also imply that the SAP domain has a function similar to SAF-A/B besides its potential protein inhibitor of activated signal transducer and activator of transcription (PIAS) function. One of the identified proteins UBE1 was further analyzed and displayed a novel role for the SAP domain of L(pro). Overexpression of UBE1 enhanced the replication of FMDV, and knockdown of UBE1 decreased FMDV replication. This shows that FMDV manipulates UBE1 for increased viral replication, and the SAP domain was involved in this process.

  20. Rice SAPs are responsive to multiple biotic stresses and overexpression of OsSAP1, an A20/AN1 zinc-finger protein, enhances the basal resistance against pathogen infection in tobacco.

    PubMed

    Tyagi, Himani; Jha, Shweta; Sharma, Meenakshi; Giri, Jitender; Tyagi, Akhilesh K

    2014-08-01

    Eukaryotic A20/AN1 zinc-finger proteins (ZFPs) play an important role in the regulation of immune and stress response. After elucidation of the role of first such protein, OsSAP1, in abiotic stress tolerance, 18 rice stress associated protein (SAP) genes have been shown to be regulated by multiple abiotic stresses. In the present study, expression pattern of all the 18 OsSAP genes have been analysed in response to different biotic stress simulators, in order to get insights into their possible involvement in biotic stress tolerance. Our results showed the upregulation of OsSAP1 and OsSAP11 by all biotic stress simulator treatments. Furthermore, the functional role of OsSAP1 in plant defence responses has been explored through overexpression in transgenic plants. Constitutive expression of OsSAP1 in transgenic tobacco resulted into enhanced disease resistance against virulent bacterial pathogen, together with the upregulation of known defence-related genes. Present investigation suggests that rice SAPs are responsive to multiple biotic stresses and OsSAP1 plays a key role in basal resistance against pathogen infection. This strongly supports the involvement of rice SAPs in cross-talk between biotic and abiotic stress signalling pathways, which makes them ideal candidate to design strategies for protecting crop plants against multiple stresses.

  1. Phytoplasma Effector SAP54 Hijacks Plant Reproduction by Degrading MADS-box Proteins and Promotes Insect Colonization in a RAD23-Dependent Manner

    PubMed Central

    MacLean, Allyson M.; Orlovskis, Zigmunds; Kowitwanich, Krissana; Zdziarska, Anna M.; Angenent, Gerco C.; Immink, Richard G. H.; Hogenhout, Saskia A.

    2014-01-01

    Pathogens that rely upon multiple hosts to complete their life cycles often modify behavior and development of these hosts to coerce them into improving pathogen fitness. However, few studies describe mechanisms underlying host coercion. In this study, we elucidate the mechanism by which an insect-transmitted pathogen of plants alters floral development to convert flowers into vegetative tissues. We find that phytoplasma produce a novel effector protein (SAP54) that interacts with members of the MADS-domain transcription factor (MTF) family, including key regulators SEPALLATA3 and APETALA1, that occupy central positions in the regulation of floral development. SAP54 mediates degradation of MTFs by interacting with proteins of the RADIATION SENSITIVE23 (RAD23) family, eukaryotic proteins that shuttle substrates to the proteasome. Arabidopsis rad23 mutants do not show conversion of flowers into leaf-like tissues in the presence of SAP54 and during phytoplasma infection, emphasizing the importance of RAD23 to the activity of SAP54. Remarkably, plants with SAP54-induced leaf-like flowers are more attractive for colonization by phytoplasma leafhopper vectors and this colonization preference is dependent on RAD23. An effector that targets and suppresses flowering while simultaneously promoting insect herbivore colonization is unprecedented. Moreover, RAD23 proteins have, to our knowledge, no known roles in flower development, nor plant defence mechanisms against insects. Thus SAP54 generates a short circuit between two key pathways of the host to alter development, resulting in sterile plants, and promotes attractiveness of these plants to leafhopper vectors helping the obligate phytoplasmas reproduce and propagate (zombie plants). PMID:24714165

  2. Phytoplasma effector SAP54 hijacks plant reproduction by degrading MADS-box proteins and promotes insect colonization in a RAD23-dependent manner.

    PubMed

    MacLean, Allyson M; Orlovskis, Zigmunds; Kowitwanich, Krissana; Zdziarska, Anna M; Angenent, Gerco C; Immink, Richard G H; Hogenhout, Saskia A

    2014-04-01

    Pathogens that rely upon multiple hosts to complete their life cycles often modify behavior and development of these hosts to coerce them into improving pathogen fitness. However, few studies describe mechanisms underlying host coercion. In this study, we elucidate the mechanism by which an insect-transmitted pathogen of plants alters floral development to convert flowers into vegetative tissues. We find that phytoplasma produce a novel effector protein (SAP54) that interacts with members of the MADS-domain transcription factor (MTF) family, including key regulators SEPALLATA3 and APETALA1, that occupy central positions in the regulation of floral development. SAP54 mediates degradation of MTFs by interacting with proteins of the RADIATION SENSITIVE23 (RAD23) family, eukaryotic proteins that shuttle substrates to the proteasome. Arabidopsis rad23 mutants do not show conversion of flowers into leaf-like tissues in the presence of SAP54 and during phytoplasma infection, emphasizing the importance of RAD23 to the activity of SAP54. Remarkably, plants with SAP54-induced leaf-like flowers are more attractive for colonization by phytoplasma leafhopper vectors and this colonization preference is dependent on RAD23. An effector that targets and suppresses flowering while simultaneously promoting insect herbivore colonization is unprecedented. Moreover, RAD23 proteins have, to our knowledge, no known roles in flower development, nor plant defence mechanisms against insects. Thus SAP54 generates a short circuit between two key pathways of the host to alter development, resulting in sterile plants, and promotes attractiveness of these plants to leafhopper vectors helping the obligate phytoplasmas reproduce and propagate (zombie plants).

  3. Effects of Fe deficiency on the protein profile of Brassica napus phloem sap.

    PubMed

    Gutierrez-Carbonell, Elain; Lattanzio, Giuseppe; Albacete, Alfonso; Rios, Juan José; Kehr, Julia; Abadía, Anunciación; Grusak, Michael A; Abadía, Javier; López-Millán, Ana Flor

    2015-11-01

    The aim of this work was to study the effect of Fe deficiency on the protein profile of phloem sap exudates from Brassica napus using 2DE (IEF-SDS-PAGE). The experiment was repeated thrice and two technical replicates per treatment were done. Phloem sap purity was assessed by measuring sugar concentrations. Two hundred sixty-three spots were consistently detected and 15.6% (41) of them showed significant changes in relative abundance (22 decreasing and 19 increasing) as a result of Fe deficiency. Among them, 85% (35 spots), were unambiguously identified. Functional categories containing the largest number of protein species showing changes as a consequence of Fe deficiency were signaling and regulation (32%), and stress and redox homeostasis (17%). The Phloem sap showed a higher oxidative stress and significant changes in the hormonal profile as a result of Fe deficiency. Results indicate that Fe deficiency elicits major changes in signaling pathways involving Ca and hormones, which are generally associated with flowering and developmental processes, causes an alteration in ROS homeostasis processes, and induces decreases in the abundances of proteins involved in sieve element repair, suggesting that Fe-deficient plants may have an impaired capacity to heal sieve elements upon injury.

  4. The correlation of virulence, pathogenicity, and itraconazole resistance with SAP activity in Candida albicans strains.

    PubMed

    Feng, Wenli; Yang, Jing; Pan, Yanwei; Xi, Zhiqin; Qiao, Zusha; Ma, Yan

    2016-02-01

    The relationship between SAP2 activity and drug resistance in Candida albicans was investigated by using itraconazole-resistant and itraconazole-sensitive C. albicans isolates. The precipitation zones were measured to analyze SAP2 activity. Mice were classified into itraconazole-resistant and -sensitive C. albicans isolate groups, and a control group, with their survival and mortality rate being observed over 30 days. The relative expression levels of CDR1, CDR2, MDR1, and SAP2 were measured using RT-PCR. It was found that the secreted aspartyl proteinase activity of itraconazole-resistant C. albicans strains was significantly higher than that of itraconazole-sensitive C. albicans strains (P < 0.001). A significantly higher mortality rate was recorded for mice treated with itraconazole-resistant C. albicans than for mice treated with itraconazole-sensitive C. albicans. In regards to the CDR1, CDR2, and MDR1 genes, there was no significant difference between the 2 groups of mice. Positive correlations between SAP2 and MDR1 and between CDR1 and CDR2 were found. The high expression level of SAP2 may relate to the virulence, pathogenicity, and resistance of C. albicans.

  5. Genetic Evidence for the Involvement of the S-Layer Protein Gene sap and the Sporulation Genes spo0A, spo0B, and spo0F in Phage AP50c Infection of Bacillus anthracis

    PubMed Central

    Beaber, John W.; Zemansky, Jason; Kaur, Ajinder P.; George, Matroner; Biswas, Biswajit; Henry, Matthew; Bishop-Lilly, Kimberly A.; Mokashi, Vishwesh; Hannah, Ryan M.; Pope, Robert K.; Read, Timothy D.; Stibitz, Scott; Calendar, Richard; Sozhamannan, Shanmuga

    2014-01-01

    In order to better characterize the Bacillus anthracis typing phage AP50c, we designed a genetic screen to identify its bacterial receptor. Insertions of the transposon mariner or targeted deletions of the structural gene for the S-layer protein Sap and the sporulation genes spo0A, spo0B, and spo0F in B. anthracis Sterne resulted in phage resistance with concomitant defects in phage adsorption and infectivity. Electron microscopy of bacteria incubated with AP50c revealed phage particles associated with the surface of bacilli of the Sterne strain but not with the surfaces of Δsap, Δspo0A, Δspo0B, or Δspo0F mutants. The amount of Sap in the S layer of each of the spo0 mutant strains was substantially reduced compared to that of the parent strain, and incubation of AP50c with purified recombinant Sap led to a substantial reduction in phage activity. Phylogenetic analysis based on whole-genome sequences of B. cereus sensu lato strains revealed several closely related B. cereus and B. thuringiensis strains that carry sap genes with very high similarities to the sap gene of B. anthracis. Complementation of the Δsap mutant in trans with the wild-type B. anthracis sap or the sap gene from either of two different B. cereus strains that are sensitive to AP50c infection restored phage sensitivity, and electron microscopy confirmed attachment of phage particles to the surface of each of the complemented strains. Based on these data, we postulate that Sap is involved in AP50c infectivity, most likely acting as the phage receptor, and that the spo0 genes may regulate synthesis of Sap and/or formation of the S layer. PMID:24363347

  6. Genetic evidence for the involvement of the S-layer protein gene sap and the sporulation genes spo0A, spo0B, and spo0F in Phage AP50c infection of Bacillus anthracis.

    PubMed

    Plaut, Roger D; Beaber, John W; Zemansky, Jason; Kaur, Ajinder P; George, Matroner; Biswas, Biswajit; Henry, Matthew; Bishop-Lilly, Kimberly A; Mokashi, Vishwesh; Hannah, Ryan M; Pope, Robert K; Read, Timothy D; Stibitz, Scott; Calendar, Richard; Sozhamannan, Shanmuga

    2014-03-01

    In order to better characterize the Bacillus anthracis typing phage AP50c, we designed a genetic screen to identify its bacterial receptor. Insertions of the transposon mariner or targeted deletions of the structural gene for the S-layer protein Sap and the sporulation genes spo0A, spo0B, and spo0F in B. anthracis Sterne resulted in phage resistance with concomitant defects in phage adsorption and infectivity. Electron microscopy of bacteria incubated with AP50c revealed phage particles associated with the surface of bacilli of the Sterne strain but not with the surfaces of Δsap, Δspo0A, Δspo0B, or Δspo0F mutants. The amount of Sap in the S layer of each of the spo0 mutant strains was substantially reduced compared to that of the parent strain, and incubation of AP50c with purified recombinant Sap led to a substantial reduction in phage activity. Phylogenetic analysis based on whole-genome sequences of B. cereus sensu lato strains revealed several closely related B. cereus and B. thuringiensis strains that carry sap genes with very high similarities to the sap gene of B. anthracis. Complementation of the Δsap mutant in trans with the wild-type B. anthracis sap or the sap gene from either of two different B. cereus strains that are sensitive to AP50c infection restored phage sensitivity, and electron microscopy confirmed attachment of phage particles to the surface of each of the complemented strains. Based on these data, we postulate that Sap is involved in AP50c infectivity, most likely acting as the phage receptor, and that the spo0 genes may regulate synthesis of Sap and/or formation of the S layer.

  7. Phylogeny and expression analysis of C-reactive protein (CRP) and serum amyloid-P (SAP) like genes reveal two distinct groups in fish.

    PubMed

    Lee, P T; Bird, S; Zou, J; Martin, S A M

    2017-03-20

    The acute phase response (APR) is an early innate immune function that is initiated by inflammatory signals, leading to the release of acute phase proteins to the bloodstream to re-establish homeostasis following microbial infection. In this study we analysed the Atlantic salmon (Salmo salar) whole-genome database and identified five C-reactive protein (CRP)/serum amyloid P component (SAP) like molecules namely CRP/SAP-1a, CRP/SAP-1b, CRP/SAP-1c, CRP/SAP-2 and CRP/SAP-3. These CRP/SAP genes formed two distinct sub-families, a universal group (group I) present in all vertebrates and a fish/amphibian specific group (group II). Salmon CRP/SAP-1a, CRP/SAP-1b and CRP/SAP-1c and CRP/SAP-2 belong to the group I family whilst salmon CRP/SAP-3 is a member of group II. Gene expression analysis showed that the salmon CRP/SAP-1a as well as serum amyloid A-5 (SAA-5), one of the major acute phase proteins, were significantly up-regulated by recombinant cytokines (rIL-1β and rIFNγ) in primary head kidney cells whilst the other four CRP/SAPs remained refractory. Furthermore, SAA-5 was produced as the main acute phase protein (APP) in Atlantic salmon challenged with Aeromonas salmonicida (aroA(-) strain) whilst salmon CRP/SAPs remained unaltered. Overall, these data illustrate the potential different functions of expanded salmon CRP/SAPs to their mammalian homologues.

  8. Adaptation of aphid stylectomy for analyses of proteins and mRNAs in barley phloem sap.

    PubMed

    Gaupels, Frank; Buhtz, Anja; Knauer, Torsten; Deshmukh, Sachin; Waller, Frank; van Bel, Aart J E; Kogel, Karl-Heinz; Kehr, Julia

    2008-01-01

    Sieve tubes are transport conduits not only for photoassimilates but also for macromolecules and other compounds that are involved in sieve tube maintenance and systemic signalling. In order to gain sufficient amounts of pure phloem exudates from barley plants for analyses of the protein and mRNA composition, a previously described stylectomy set-up was optimized. Aphids were placed in sealed cages, which, immediately after microcauterization of the stylets, were flooded with water-saturated silicon oil. The exuding phloem sap was collected with a capillary connected to a pump. Using up to 30 plants and 600 aphids (Rhopalosiphum padi) in parallel, an average of 10 mul of phloem sap could be obtained within 6 h of sampling. In first analyses of the macromolecular content, eight so far unknown phloem mRNAs were identified by cDNA-amplified fragment length polymorphism. Transcripts in barley phloem exudates are related to metabolism, signalling, and pathogen defence, for example coding for a protein kinase and a pathogen- and insect-responsive WIR1A (wheat-induced resistance 1A)-like protein. Further, one-dimensional gel electrophoresis and subsequent partial sequencing by mass spectrometry led to the identification of seven major proteins with putative functions in stress responses and transport of mRNAs, proteins, and sugars. Two of the discovered proteins probably represent isoforms of a new phloem-mobile sucrose transporter. Notably, two-dimensional electrophoresis confirmed that there are >250 phloem proteins awaiting identification in future studies.

  9. Proteome study of the phloem sap of pumpkin using multidimensional protein identification technology.

    PubMed

    Cho, Won Kyong; Chen, Xiong-Yan; Rim, Yeonggil; Chu, Hyosub; Kim, Suwha; Kim, Seon-Won; Park, Zee-Yong; Kim, Jae-Yean

    2010-07-01

    The phloem is the major transport route for both small substances and large molecules, such as proteins and RNAs, from their sources to sink tissues. To investigate the proteins present in pumpkin phloem sap, proteome analysis using multidimensional protein identification technology was carried out. Pumpkin phloem peptides obtained by liquid chromatography/mass spectrometry/mass spectrometry were searched against pumpkin protein data derived from the National Center for Biotechnology Information. A total of 47 pumpkin phloem proteins were identified. The identified proteins mainly corresponded to enzymes involved in gibberellin biosynthesis, antioxidation processes, or defense mechanisms. Interestingly, seven enzymes required for gibberellin biosynthesis were identified for the first time by this proteomics approach. In summary, the new phloem proteins identified in this study provide strong evidence for stress and defense signaling and new insights regarding the role of gibberellin in the developmental programming of higher plants through the phloem.

  10. Molecular characterization of a novel vegetative insecticidal protein from Bacillus thuringiensis effective against sap-sucking insect pest.

    PubMed

    Sattar, Sampurna; Maiti, Mrinal K

    2011-09-01

    Several isolates of Bacillus thuringiensis (Bt) were screened for the vegetative insecticidal protein (Vip) effective against sap-sucking insect pests. Screening results were based on LC(50) values against cotton aphid (Aphis gossypii), one of the dangerous pests of various crop plants including cotton. Among the isolates, the Bt#BREF24 showed promising results, and upon purification the aphidicidal protein was recognized as a binary toxin. One of the components of this binary toxin was identified by peptide sequencing to be a homolog of Vip2A that has been reported previously in other Bacillus spp. Vip2 belongs to the binary toxin group Vip1-Vip2, and is responsible for the enzymatic activity; and Vip1 is the translocation and receptor binding protein. The two genes encoding the corresponding proteins of the binary toxin, designated as vip2Ae and vip1Ae, were cloned from the Bt#BREF24, sequenced, and heterologously expressed in Escherichia coli. Aphid feeding assay with the recombinant proteins confirmed that these proteins are indeed the two components of the binary toxins, and the presence of both partners is essential for the activity. Aphid specificity of the binary toxin was further verified by ligand blotting experiment, which identified an ~50 kDa receptor in the brush border membrane vesicles of the cotton aphids only, but not in the lepidopteran insects. Our finding holds a promise of its use in future as a candidate gene for developing transgenic crop plants tolerant against sap-sucking insect pests.

  11. Synapse associated protein 102 (SAP102) binds the C-terminal part of the scaffolding protein neurobeachin.

    PubMed

    Lauks, Juliane; Klemmer, Patricia; Farzana, Fatima; Karupothula, Ramesh; Zalm, Robbert; Cooke, Nancy E; Li, Ka Wan; Smit, August B; Toonen, Ruud; Verhage, Matthijs

    2012-01-01

    Neurobeachin (Nbea) is a multidomain scaffold protein abundant in the brain, where it is highly expressed during development. Nbea-null mice have severe defects in neuromuscular synaptic transmission resulting in lethal paralysis of the newborns. Recently, it became clear that Nbea is important also for the functioning of central synapses, where it is suggested to play a role in trafficking membrane proteins to both, the pre- and post-synaptic sites. So far, only few binding partners of Nbea have been found and the precise mechanism of their trafficking remains unclear. Here, we used mass spectrometry to identify SAP102, a MAGUK protein implicated in trafficking of the ionotropic glutamate AMPA- and NMDA-type receptors during synaptogenesis, as a novel Nbea interacting protein in mouse brain. Experiments in heterologous cells confirmed this interaction and revealed that SAP102 binds to the C-terminal part of Nbea that contains the DUF, PH, BEACH and WD40 domains. Furthermore, we discovered that introducing a mutation in Nbea's PH domain, which disrupts its interaction with the BEACH domain, abolishes this binding, thereby creating an excellent starting point to further investigate Nbea-SAP102 function in the central nervous system.

  12. Synapse Associated Protein 102 (SAP102) Binds the C-Terminal Part of the Scaffolding Protein Neurobeachin

    PubMed Central

    Farzana, Fatima; Karupothula, Ramesh; Zalm, Robbert; Cooke, Nancy E.; Li, Ka Wan; Smit, August B.; Toonen, Ruud; Verhage, Matthijs

    2012-01-01

    Neurobeachin (Nbea) is a multidomain scaffold protein abundant in the brain, where it is highly expressed during development. Nbea-null mice have severe defects in neuromuscular synaptic transmission resulting in lethal paralysis of the newborns. Recently, it became clear that Nbea is important also for the functioning of central synapses, where it is suggested to play a role in trafficking membrane proteins to both, the pre- and post-synaptic sites. So far, only few binding partners of Nbea have been found and the precise mechanism of their trafficking remains unclear. Here, we used mass spectrometry to identify SAP102, a MAGUK protein implicated in trafficking of the ionotropic glutamate AMPA- and NMDA-type receptors during synaptogenesis, as a novel Nbea interacting protein in mouse brain. Experiments in heterologous cells confirmed this interaction and revealed that SAP102 binds to the C-terminal part of Nbea that contains the DUF, PH, BEACH and WD40 domains. Furthermore, we discovered that introducing a mutation in Nbea’s PH domain, which disrupts its interaction with the BEACH domain, abolishes this binding, thereby creating an excellent starting point to further investigate Nbea-SAP102 function in the central nervous system. PMID:22745750

  13. Adaptation of aphid stylectomy for analyses of proteins and mRNAs in barley phloem sap

    PubMed Central

    Gaupels, Frank; Buhtz, Anja; Knauer, Torsten; Deshmukh, Sachin; Waller, Frank; van Bel, Aart J. E.; Kogel, Karl-Heinz; Kehr, Julia

    2008-01-01

    Sieve tubes are transport conduits not only for photoassimilates but also for macromolecules and other compounds that are involved in sieve tube maintenance and systemic signalling. In order to gain sufficient amounts of pure phloem exudates from barley plants for analyses of the protein and mRNA composition, a previously described stylectomy set-up was optimized. Aphids were placed in sealed cages, which, immediately after microcauterization of the stylets, were flooded with water-saturated silicon oil. The exuding phloem sap was collected with a capillary connected to a pump. Using up to 30 plants and 600 aphids (Rhopalosiphum padi) in parallel, an average of 10 μl of phloem sap could be obtained within 6 h of sampling. In first analyses of the macromolecular content, eight so far unknown phloem mRNAs were identified by cDNA-amplified fragment length polymorphism. Transcripts in barley phloem exudates are related to metabolism, signalling, and pathogen defence, for example coding for a protein kinase and a pathogen- and insect-responsive WIR1A (wheat-induced resistance 1A)-like protein. Further, one-dimensional gel electrophoresis and subsequent partial sequencing by mass spectrometry led to the identification of seven major proteins with putative functions in stress responses and transport of mRNAs, proteins, and sugars. Two of the discovered proteins probably represent isoforms of a new phloem-mobile sucrose transporter. Notably, two-dimensional electrophoresis confirmed that there are >250 phloem proteins awaiting identification in future studies. PMID:18632729

  14. Xylem sap proteomics.

    PubMed

    de Bernonville, Thomas Dugé; Albenne, Cécile; Arlat, Matthieu; Hoffmann, Laurent; Lauber, Emmanuelle; Jamet, Elisabeth

    2014-01-01

    Proteomic analysis of xylem sap has recently become a major field of interest to understand several biological questions related to plant development and responses to environmental clues. The xylem sap appears as a dynamic fluid undergoing changes in its proteome upon abiotic and biotic stresses. Unlike cell compartments which are amenable to purification in sufficient amount prior to proteomic analysis, the xylem sap has to be collected in particular conditions to avoid contamination by intracellular proteins and to obtain enough material. A model plant like Arabidopsis thaliana is not suitable for such an analysis because efficient harvesting of xylem sap is difficult. The analysis of the xylem sap proteome also requires specific procedures to concentrate proteins and to focus on proteins predicted to be secreted. Indeed, xylem sap proteins appear to be synthesized and secreted in the root stele or to originate from dying differentiated xylem cells. This chapter describes protocols to collect xylem sap from Brassica species and to prepare total and N-glycoprotein extracts for identification of proteins by mass spectrometry analyses and bioinformatics.

  15. Antimicrobial activity of snakin-defensin hybrid protein in tobacco and potato plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To augment plant protection against phytopathogens, we constructed a fusion gene for the simultaneous expression of snakin-1 (SN1) and defensin-1 (PTH1) antimicrobial proteins as a hybrid protein (SAP) in plant cells. Prior to in vivo evaluation of SAP phytoprotective activity, the hybrid protein ex...

  16. Effects of dates pulp extract and palm sap (Phoenix dactylifera L.) on gastrointestinal transit activity in healthy rats.

    PubMed

    Souli, Abdellaziz; Sebai, Hichem; Rtibi, Kaïs; Chehimi, Latifa; Sakly, Mohsen; Amri, Mohamed; El-Benna, Jamel

    2014-07-01

    The current study was performed to measure the chemical composition and the effects of dates pulp extract and palm sap on gastrointestinal transit (GIT) activity in healthy adult rats. In this respect, male Wistar rats fasted for 24 hours were used and received per orally (p.o.) sodium chloride (NaCl) (0,9%) (control group) or various doses of dates pulp extract (150 and 300 mg/kg, body weight [b.w.]) and palm sap (0.4 and 4 mL/kg, b.w.). Two other groups of rats (batch tests) received, respectively, clonidine (an alpha-2 adrenergic agonist, 1 mg/kg, b.w.) and yohimbine (an alpha-2 adrenergic antagonist, 2mg/kg, b.w.). Chemical analysis showed that the dates pulp extract is more rich in sugars and minerals, especially potassium and sucrose, as compared with palm sap composition. On the other hand, in vivo study showed that the aqueous dates pulp extract significantly, and dose dependently, increased the GIT activity while the palm sap slightly increased it. Moreover, a converse effect has been observed using clonidine (decreased 68%) and yohimbine (increased 33%) on the GIT activity. These findings suggest that dates pulp extract and palm sap have a stimulating effect on GIT activity in rats and confirm their use in traditional Tunisian medicine for the treatment of constipation.

  17. Effects of Dates Pulp Extract and Palm Sap (Phoenix dactylifera L.) on Gastrointestinal Transit Activity in Healthy Rats

    PubMed Central

    Souli, Abdellaziz; Rtibi, Kaïs; Chehimi, Latifa; Sakly, Mohsen; Amri, Mohamed; El-Benna, Jamel

    2014-01-01

    Abstract The current study was performed to measure the chemical composition and the effects of dates pulp extract and palm sap on gastrointestinal transit (GIT) activity in healthy adult rats. In this respect, male Wistar rats fasted for 24 hours were used and received per orally (p.o.) sodium chloride (NaCl) (0,9%) (control group) or various doses of dates pulp extract (150 and 300 mg/kg, body weight [b.w.]) and palm sap (0.4 and 4 mL/kg, b.w.). Two other groups of rats (batch tests) received, respectively, clonidine (an alpha-2 adrenergic agonist, 1 mg/kg, b.w.) and yohimbine (an alpha-2 adrenergic antagonist, 2mg/kg, b.w.). Chemical analysis showed that the dates pulp extract is more rich in sugars and minerals, especially potassium and sucrose, as compared with palm sap composition. On the other hand, in vivo study showed that the aqueous dates pulp extract significantly, and dose dependently, increased the GIT activity while the palm sap slightly increased it. Moreover, a converse effect has been observed using clonidine (decreased 68%) and yohimbine (increased 33%) on the GIT activity. These findings suggest that dates pulp extract and palm sap have a stimulating effect on GIT activity in rats and confirm their use in traditional Tunisian medicine for the treatment of constipation. PMID:24611963

  18. Phytoplasma protein effector SAP11 enhances insect vector reproduction by manipulating plant development and defense hormone biosynthesis.

    PubMed

    Sugio, Akiko; Kingdom, Heather N; MacLean, Allyson M; Grieve, Victoria M; Hogenhout, Saskia A

    2011-11-29

    Phytoplasmas are insect-transmitted phytopathogenic bacteria that can alter plant morphology and the longevity and reproduction rates and behavior of their insect vectors. There are various examples of animal and plant parasites that alter the host phenotype to attract insect vectors, but it is unclear how these parasites accomplish this. We hypothesized that phytoplasmas produce effectors that modulate specific targets in their hosts leading to the changes in plant development and insect performance. Previously, we sequenced and mined the genome of Aster Yellows phytoplasma strain Witches' Broom (AY-WB) and identified 56 candidate effectors. Here, we report that the secreted AY-WB protein 11 (SAP11) effector modulates plant defense responses to the advantage of the AY-WB insect vector Macrosteles quadrilineatus. SAP11 binds and destabilizes Arabidopsis CINCINNATA (CIN)-related TEOSINTE BRANCHED1, CYCLOIDEA, PROLIFERATING CELL FACTORS 1 and 2 (TCP) transcription factors, which control plant development and promote the expression of lipoxygenase (LOX) genes involved in jasmonate (JA) synthesis. Both the Arabidopsis SAP11 lines and AY-WB-infected plants produce less JA on wounding. Furthermore, the AY-WB insect vector produces more offspring on AY-WB-infected plants, SAP11 transgenic lines, and plants impaired in CIN-TCP and JA synthesis. Thus, SAP11-mediated destabilization of CIN-TCPs leads to the down-regulation of LOX2 expression and JA synthesis and an increase in M. quadrilineatus progeny. Phytoplasmas are obligate inhabitants of their plant host and insect vectors, in which the latter transmits AY-WB to a diverse range of plant species. This finding demonstrates that pathogen effectors can reach beyond the pathogen-host interface to modulate a third organism in the biological interaction.

  19. Antifungal and cytotoxicity activities of the fresh xylem sap of Hymenaea courbaril L. and its major constituent fisetin

    PubMed Central

    2014-01-01

    Background The great potential of plants as Hymenaea courbaril L (jatoba) has not yet been throughly explored scientifically and therefore it is very important to investigate their pharmacological and toxicological activities to establish their real efficacy and safety. This study investigated the cytotoxicity of xylem sap of Hymenaea courbaril L and its bioactivity against the fungi Cryptococcus neoformans species complex and dermatophytes. Methods The fresh xylem sap of H. courbaril was filtered resulting in an insoluble brown color precipitate and was identified as fisetin. In the filtrate was identified the mixture of fisetinediol, fustin, 3-O-methyl-2,3-trans-fustin and taxifolin, which were evaluated by broth microdilution antifungal susceptibility testing against C. neoformans species complex and dermatophytes. The fresh xylem sap and fisetin were screened for cytotoxicity against the 3T3-A31 cells of Balb/c using neutral red uptake (NRU) assay. Results The fresh xylem sap and the fisetin showed higher in vitro activity than the filtrate. The xylem sap of H. courbaril inhibited the growth of dermatophytes and of C. neoformans with minimal inhibition concentration (MIC) < 256 μg/mL, while the fisetin showed MIC < 128 μg/mL for these fungi. Fisetin showed lower toxicity (IC50 = 158 μg/mL) than the fresh xylem sap (IC50 = 109 μg/mL). Conclusion Naturally occurring fisetin can provide excellent starting points for clinical application and can certainly represent a therapeutic potential against fungal infections, because it showed in vitro antifungal activity and low toxicity on animal cells. PMID:25027026

  20. Effect of Flos carthami on stress-activated protein kinase activity in the isolated reperfused rat heart.

    PubMed

    Siow, Y L; Choy, P C; Leung, W M; O, K

    2000-04-01

    The apoptotic death of cardiomyocytes due to ischemia/reperfusion is one of the major complications of heart disease. Ischemia/reperfusion has been shown to lead to the activation of the stress-activated protein (SAP) kinases and the p38/reactivating kinase (p38/RK). In this study, the direct effect of an aqueous Flos carthami (FC) extract on SAP kinases was investigated. When isolated rat hearts were perfused by Langendorff mode with media containing FC extract prior to the induction of global ischemia and the subsequent reperfusion, SAP kinase activity was inhibited 95%. Untreated ischemic/reperfused hearts showed a 57% elevation in the activity of SAP kinase. The in vitro effect of these FC extracts on SAP kinase was also tested. At a concentration of 10 microg/ml, the aqueous FC extract resulted in 50% inhibition of SAP kinase activity in ischemic heart tissue. Our results showed that FC affected both the interaction of SAP kinase with c-jun as well as the phosphotransferase reaction. These results clearly demonstrate that extracts from Flos carthami exerted inhibitory effects on SAP kinase. The administration of the FC extract may lead to a modulation of the apoptotic effect of SAP kinase activation induced during ischemia/reperfusion.

  1. Antioxidant activity, inhibition of nitric oxide overproduction, and in vitro antiproliferative effect of maple sap and syrup from Acer saccharum.

    PubMed

    Legault, Jean; Girard-Lalancette, Karl; Grenon, Carole; Dussault, Catherine; Pichette, André

    2010-04-01

    Antioxidant activity, inhibition of nitric oxide (NO) overproduction, and antiproliferative effect of ethyl acetate extracts of maple sap and syrup from 30 producers were evaluated in regard to the period of harvest in three different regions of Québec, Canada. Oxygen radical absorbance capacity (ORAC) values of maple sap and syrup extracts are, respectively, 12 +/- 6 and 15 +/- 5 micromol of Trolox equivalents (TE)/mg. The antioxidant activity was also confirmed by a cell-based assay. The period of harvest has no statistically significant incidence on the antioxidant activity of both extracts. The antioxidant activity of pure maple syrup was also determined using the ORAC assay. Results indicate that the ORAC value of pure maple syrup (8 +/- 2 micromol of TE/mL) is lower than the ORAC value of blueberry juice (24 +/- 1 micromol of TE/mL) but comparable to the ORAC values of strawberry (10.7 +/- 0.4 micromol of TE/mL) and orange (10.8 +/- 0.5 micromol of TE/mL) juices. Maple sap and syrup extracts showed to significantly inhibit lipopolysaccharide-induced NO overproduction in RAW264.7 murine macrophages. Maple syrup extract was significantly more active than maple sap extract, suggesting that the transformation of maple sap into syrup increases NO inhibition activity. The highest NO inhibition induced by the maple syrup extracts was observed at the end of the season. Moreover, darker maple syrup was found to be more active than clear maple syrup, suggesting that some colored oxidized compounds could be responsible in part for the activity. Finally, maple syrup extracts (50% inhibitory concentration = 42 +/- 6 microg/mL) and pure maple syrup possess a selective in vitro antiproliferative activity against cancer cells.

  2. The adaptor protein SAP directly associates with PECAM-1 and regulates PECAM-1-mediated-cell adhesion in T-like cell lines.

    PubMed

    Proust, Richard; Crouin, Catherine; Gandji, Leslie Yewakon; Bertoglio, Jacques; Gesbert, Franck

    2014-04-01

    SAP is a small cytosolic adaptor protein expressed in hematopoietic lineages whose main function is to regulate intracellular signaling pathways induced by the triggering of members of the SLAM receptor family. In this paper, we have identified the adhesion molecule PECAM-1 as a new partner for SAP in a conditional yeast two-hybrid screen. PECAM-1 is an immunoglobulin-like molecule expressed by endothelial cells and leukocytes, which possesses both pro- and anti-inflammatory properties. However, little is known about PECAM-1 functions in T cells. We show that SAP directly and specifically interacts with the cytosolic tyrosine 686 of PECAM-1. We generated different T-like cell lines in which SAP or PECAM-1 are expressed or down modulated and we demonstrate that a diminished SAP expression correlates with a diminished PECAM-1-mediated adhesion. Although SAP has mainly been shown to associate with SLAM receptors, we evidence here that SAP is a new actor downstream of PECAM-1.

  3. Dissection of SAP-dependent and SAP-independent SLAM family signaling in NKT cell development and humoral immunity.

    PubMed

    Chen, Shasha; Cai, Chenxu; Li, Zehua; Liu, Guangao; Wang, Yuande; Blonska, Marzenna; Li, Dan; Du, Juan; Lin, Xin; Yang, Meixiang; Dong, Zhongjun

    2017-02-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) mutations in X-linked lymphoproliferative disease (XLP) lead to defective NKT cell development and impaired humoral immunity. Because of the redundancy of SLAM family receptors (SFRs) and the complexity of SAP actions, how SFRs and SAP mediate these processes remains elusive. Here, we examined NKT cell development and humoral immunity in mice completely deficient in SFR. We found that SFR deficiency severely impaired NKT cell development. In contrast to SAP deficiency, SFR deficiency caused no apparent defect in follicular helper T (TFH) cell differentiation. Intriguingly, the deletion of SFRs completely rescued the severe defect in TFH cell generation caused by SAP deficiency, whereas SFR deletion had a minimal effect on the defective NKT cell development in SAP-deficient mice. These findings suggest that SAP-dependent activating SFR signaling is essential for NKT cell selection; however, SFR signaling is inhibitory in SAP-deficient TFH cells. Thus, our current study revises our understanding of the mechanisms underlying T cell defects in patients with XLP.

  4. p53 contributes to T cell homeostasis through the induction of pro-apoptotic SAP.

    PubMed

    Madapura, Harsha S; Salamon, Daniel; Wiman, Klas G; Lain, Sonia; Klein, George; Klein, Eva; Nagy, Noémi

    2012-12-15

    Lack of functional SAP protein, due to gene deletion or mutation, is the cause of X-linked lymphoproliferative disease (XLP), characterized by functionally impaired T and NK cells and a high risk of lymphoma development. We have demonstrated earlier that SAP has a pro-apoptotic function in T and B cells. Deficiency of this function might contribute to the pathogenesis of XLP. We have also shown that SAP is a target of p53 in B cell lines. In the present study, we show that activated primary T cells express p53, which induces SAP expression. p53 is functional as a transcription factor in activated T cells and induces the expression of p21, PUMA and MDM2. PARP cleavage in the late phase of activation indicates that T cells expressing high levels of SAP undergo apoptosis. Modifying p53 levels using Nutlin-3, which specifically dissociates the MDM2-p53 interaction, was sufficient to upregulate SAP expression, indicating that SAP is a target of p53 in T cells. We also demonstrated p53's role as a transcription factor for SAP in activated T cells by ChIP assays. Our result suggests that p53 contributes to T cell homeostasis through the induction of the pro-apoptotic SAP. A high level of SAP is necessary for the activation-induced cell death that is pivotal in termination of the T cell response.

  5. Interfacial regulation of acid ceramidase activity. Stimulation of ceramide degradation by lysosomal lipids and sphingolipid activator proteins.

    PubMed

    Linke, T; Wilkening, G; Sadeghlar, F; Mozcall, H; Bernardo, K; Schuchman, E; Sandhoff, K

    2001-02-23

    The lysosomal degradation of ceramide is catalyzed by acid ceramidase and requires sphingolipid activator proteins (SAP) as cofactors in vivo. The aim of this study was to investigate how ceramide is hydrolyzed by acid ceramidase at the water-membrane interface in the presence of sphingolipid activator proteins in a liposomal assay system. The degradation of membrane-bound ceramide was significantly increased both in the absence and presence of SAP-D when anionic lysosomal phospholipids such as bis(monoacylglycero)phosphate, phosphatidylinositol, and dolichol phosphate were incorporated into substrate-bearing liposomes. Higher ceramide degradation rates were observed in vesicles with increased membrane curvature. Dilution assays indicated that acid ceramidase remained bound to the liposomal surface during catalysis. Not only SAP-D, but also SAP-C and SAP-A, were found to be stimulators of ceramide hydrolysis in the presence of anionic phospholipids. This finding was confirmed by cell culture studies, in which SAP-A, -C, and -D reduced the amount of ceramide storage observed in fibroblasts of a patient suffering from prosaposin deficiency. Strong protein-lipid interactions were observed for both SAP-D and acid ceramidase in surface plasmon resonance experiments. Maximum binding of SAP-D and acid ceramidase to lipid bilayers occurred at pH 4.0. Our results demonstrate that anionic, lysosomal lipids are required for efficient hydrolysis of ceramide by acid ceramidase.

  6. Rice Stress Associated Protein 1 (OsSAP1) Interacts with Aminotransferase (OsAMTR1) and Pathogenesis-Related 1a Protein (OsSCP) and Regulates Abiotic Stress Responses

    PubMed Central

    Kothari, Kamakshi S.; Dansana, Prasant K.; Giri, Jitender; Tyagi, Akhilesh K.

    2016-01-01

    Stress associated proteins (SAPs) are the A20/AN1 zinc-finger containing proteins which can regulate the stress signaling in plants. The rice SAP protein, OsSAP1 has been shown to confer abiotic stress tolerance to plants, when overexpressed, by modulating the expression of endogenous stress-related genes. To further understand the mechanism of OsSAP1-mediated stress signaling, OsSAP1 interacting proteins were identified using yeast two-hybrid analysis. Two novel proteins, aminotransferase (OsAMTR1) and a SCP/TAPS or pathogenesis-related 1 class of protein (OsSCP) were found to interact with OsSAP1. The genes encoding OsAMTR1 and OsSCP were stress-responsive and showed higher expression upon abiotic stress treatments. The role of OsAMTR1 and OsSCP under stress was analyzed by overexpressing them constitutively in Arabidopsis and responses of transgenic plants were assessed under salt and water-deficit stress. The OsAMTR1 and OsSCP overexpressing plants showed higher seed germination, root growth and fresh weight than wild-type plants under stress conditions. Overexpression of OsAMTR1 and OsSCP affected the expression of many known stress-responsive genes which were not affected by the overexpression of OsSAP1. Moreover, the transcript levels of OsSCP and OsAMTR1 were also unaffected by the overexpression of OsSAP1. Hence, it was concluded that OsSAP1 regulates the stress responsive signaling by interacting with these proteins which further regulate the downstream stress responsive gene expression. PMID:27486471

  7. Variability in Saponin Content, Cancer Antiproliferative Activity and Physicochemical Properties of Concentrated Agave Sap.

    PubMed

    Santos-Zea, Liliana; Rosas-Pérez, Aratza Mireya; Leal-Díaz, Ana María; Gutiérrez-Uribe, Janet A

    2016-08-01

    Concentrated agave sap (CAS) has gained popularity as an unrefined sweetener. It is obtained by boiling "aguamiel" that contains phytochemicals with diverse bioactivities. Saponins have been the most widely studied agave phytochemicals due to their cancer antiproliferative effect but their concentration may vary due to maturity of the agave plant and collection site. In this study, 18 CAS samples produced in different states of Mexico were analyzed using multivariate methods to determine which physicochemical or phytochemical parameters were responsible for variation. Additionally, extracts with different saponin profiles were tested to determine possible correlations with antiproliferative activity. Total soluble solids, pH, and water activity were similar to those reported for other agave sweeteners. Antioxidant capacity of samples was correlated to browning index. Eleven steroidal saponins were found in CAS samples and they were the main source of variability. Magueyoside B, a kammogenin tetraglycoside, was the most abundant saponin in all samples. With respect to bioactivity, multivariate analysis indicated that magueyoside B and a gentrogenin tetraglycoside were compounds strongly related with bioactivity. CAS from Hidalgo, Puebla, and Veracruz had higher concentration of magueyoside B than from the other kamogenin tetraglycoside found in the samples from other Mexican states. These results could be used as a first approach to characterize and standardize CAS to validate the potential health benefits derived from its consumption.

  8. SapC-DOPS Nanovesicles as Targeted Therapy for Lung Cancer

    PubMed Central

    Zhao, Shuli; Chu, Zhengtao; Blanco, Victor M.; Nie, Yunzhong; Hou, Yayi; Qi, Xiaoyang

    2014-01-01

    Lung cancer is the deadliest type of cancer for both men and women. In this study, we evaluate the in vitro and in vivo efficacy of a biotherapeutic agent composed of a lysosomal protein (Saposin C, SapC) and a phospholipid (dioleoylphosphatidylserine, DOPS) which can be assembled into nanovesicles (SapC-DOPS) with selective antitumor activity. SapC-DOPS targets phosphatidylserine, an anionic phospholipid preferentially exposed in the surface of cancer cells and tumor-associated vasculature. Since binding of SapC to phosphatidylserine is favored at acidic pHs, and the latter characterizes the milieu of many solid tumors, we tested the effect of pH on the binding capacity of SapC-DOPS to lung tumor cells. Results showed that SapC-DOPS binding to cancer cells was more pronounced at low pH. Viability assays on a panel of human lung tumor cells showed that SapC-DOPS cytotoxicity was positively correlated with cell surface phosphatidylserine levels, whereas mitochondrial membrane potential measurements were consistent with apoptosis-related cell death. Using a fluorescence tracking method in live mice, we show that SapC-DOPS specifically targets human lung cancer xenografts, and that systemic therapy with SapC-DOPS induces tumor apoptosis and significantly inhibits tumor growth. These results suggest that SapC-DOPS nanovesicles are a promising treatment option for lung cancer. PMID:25670331

  9. Signaling lymphocyte activation molecule-associated protein is a negative regulator of the CD8 T cell response in mice.

    PubMed

    Chen, Gang; Tai, Albert K; Lin, Miao; Chang, Francesca; Terhorst, Cox; Huber, Brigitte T

    2005-08-15

    The primary manifestation of X-linked lymphoproliferative syndrome, caused by a dysfunctional adapter protein, signaling lymphocyte activation molecule-associated protein (SAP), is an excessive T cell response upon EBV infection. Using the SAP-/- mouse as a model system for the human disease, we compared the response of CD8+ T cells from wild-type (wt) and mutant mice to various stimuli. First, we observed that CD8+ T cells from SAP-/- mice proliferate more vigorously than those from wt mice upon CD3/CD28 cross-linking in vitro. Second, we analyzed the consequence of SAP deficiency on CTL effector function and homeostasis. For this purpose, SAP-/- and wt mice were infected with the murine gamma-herpesvirus 68 (MHV-68). At 2 wk postinfection, the level of viral-specific CTL was much higher in mutant than in wt mice, measured both ex vivo and in vivo. In addition, we established that throughout 45 days of MHV-68 infection the frequency of virus-specific CD8+ T cells producing IFN-gamma was significantly higher in SAP-/- mice. Consequently, the level of latent infection by MHV-68 was considerably lower in SAP-/- mice, which indicates that SAP-/- CTL control this infection more efficiently than wt CTL. Finally, we found that the Vbeta4-specific CD8+ T cell expansion triggered by MHV-68 infection is also enhanced and prolonged in SAP-/- mice. Taken together, our data indicate that SAP functions as a negative regulator of CD8+ T cell activation.

  10. The adaptor molecule SAP plays essential roles during invariant NKT cell cytotoxicity and lytic synapse formation.

    PubMed

    Das, Rupali; Bassiri, Hamid; Guan, Peng; Wiener, Susan; Banerjee, Pinaki P; Zhong, Ming-Chao; Veillette, André; Orange, Jordan S; Nichols, Kim E

    2013-04-25

    The adaptor molecule signaling lymphocytic activation molecule-associated protein (SAP) plays critical roles during invariant natural killer T (iNKT) cell ontogeny. As a result, SAP-deficient humans and mice lack iNKT cells. The strict developmental requirement for SAP has made it difficult to discern its possible involvement in mature iNKT cell functions. By using temporal Cre recombinase-mediated gene deletion to ablate SAP expression after completion of iNKT cell development, we demonstrate that SAP is essential for T-cell receptor (TCR)-induced iNKT cell cytotoxicity against T-cell and B-cell leukemia targets in vitro and iNKT-cell-mediated control of T-cell leukemia growth in vivo. These findings are not restricted to the murine system: silencing RNA-mediated suppression of SAP expression in human iNKT cells also significantly impairs TCR-induced cytolysis. Mechanistic studies reveal that iNKT cell killing requires the tyrosine kinase Fyn, a known SAP-binding protein. Furthermore, SAP expression is required within iNKT cells to facilitate their interaction with T-cell targets and induce reorientation of the microtubule-organizing center to the immunologic synapse (IS). Collectively, these studies highlight a novel and essential role for SAP during iNKT cell cytotoxicity and formation of a functional IS.

  11. Differential regulation of the mitogen-activated protein and stress-activated protein kinase cascades by adrenergic agonists in quiescent and regenerating adult rat hepatocytes.

    PubMed Central

    Spector, M S; Auer, K L; Jarvis, W D; Ishac, E J; Gao, B; Kunos, G; Dent, P

    1997-01-01

    To study the mechanisms by which catecholamines regulate hepatocyte proliferation after partial hepatectomy (PHX), hepatocytes were isolated from adult male rats 24 h after sham operation or two-thirds PHX and treated with catecholamines and other agonists. In freshly isolated sham cells, p42 mitogen-activated protein (MAP) kinase activity was stimulated by the alpha1-adrenergic agonist phenylephrine (PHE). Activation of p42 MAP kinase by growth factors was blunted by pretreatment of sham hepatocytes with glucagon but not by that with the beta2-adrenergic agonist isoproterenol (ISO). In PHX cells, the ability of PHE to activate p42 MAP kinase was dramatically reduced, whereas ISO became competent to inhibit p42 MAP kinase activation. PHE treatment of sham but not PHX and ISO treatment of PHX but not sham hepatocytes also activated the stress-activated protein (SAP) kinases p46/54 SAP kinase and p38 SAP kinase. These data demonstrate that an alpha1- to beta2-adrenergic receptor switch occurs upon PHX and results in an increase in SAP kinase versus MAP kinase signaling by catecholamines. In primary cultures of hepatocytes, ISO treatment of PHX but not sham cells inhibited [3H]thymidine incorporation. In contrast, PHE treatment of sham but not PHX cells stimulated [3H]thymidine incorporation, which was reduced by approximately 25 and approximately 95% with specific inhibitors of p42 MAP kinase and p38 SAP kinase function, respectively. Inhibition of the p38 SAP kinase also dramatically reduced basal [3H]thymidine incorporation. These data suggest that p38 SAP kinase plays a permissive role in liver regeneration. Alterations in the abilities of catecholamines to modulate the activities of protein kinase A and the MAP and SAP kinase pathways may represent one physiological mechanism by which these agonists can regulate hepatocyte proliferation after PHX. PMID:9199291

  12. A phloem-sap feeder mixes phloem and xylem sap to regulate osmotic potential.

    PubMed

    Pompon, Julien; Quiring, Dan; Goyer, Claudia; Giordanengo, Philippe; Pelletier, Yvan

    2011-09-01

    Phloem-sap feeders (Hemiptera) occasionally consume the dilute sap of xylem, a behaviour that has previously been associated with replenishing water balance following dehydration. However, a recent study reported that non-dehydrated aphids ingested xylem sap. Here, we tested the hypothesis that the consumption of xylem sap, which has a low osmolality, is a general response to osmotic stresses other than dehydration. Alate aphids were subjected to different treatments and subsequently transferred onto a plant, where electrical penetration graph (EPG) was used to estimate durations of passive phloem sap consumption and active sucking of xylem sap. The proportion of time aphids fed on xylem sap (i.e., time spent feeding on xylem sap/total time spent feeding on phloem plus xylem sap) was used as a proxy of the solute concentration of the uptake. The proportion of time alate aphids fed on xylem sap increased: (1) with the time spent imbibing an artificial diet containing a solution of sucrose, which is highly concentrated in phloem sap and is mainly responsible for the high osmotic potential of phloem sap; (2) with the osmotic potential of the artificial diet, when osmotic potential excess was not related to sucrose concentration; and (3) when aphids were deprived of primary symbionts, a condition previously shown to lead to a higher haemolymph osmotic potential. All our results converge to support the hypothesis that xylem sap consumption contributes to the regulation of the osmotic potential in phloem-sap feeders.

  13. Critical role of SAP in progression and reactivation but not maintenance of T cell-dependent humoral immunity.

    PubMed

    Zhong, Ming-Chao; Veillette, André

    2013-03-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is a small adaptor molecule mutated in X-linked lymphoproliferative disease, a human immunodeficiency. SAP plays a critical role in the initiation of T cell-dependent B cell responses leading to germinal center reaction, the production of high-affinity antibodies, and B cell memory. However, whether SAP has a role in these responses beyond their initiation is not known. It is important to address this matter not only for mechanistic reasons but also because blockade of the SAP pathway is being contemplated as a means to treat autoimmune diseases in humans. Using an inducibly SAP deficient mouse, we found that SAP was required not only for the initiation but also for the progression of primary T cell-driven B cell responses to haptens. It was also necessary for the reactivation of T cell-dependent B cell immunity during secondary immune responses. These activities consistently correlated with the requirement of SAP for full expression of the lineage commitment factor Bcl-6 in follicular T helper (T(FH)) cells. However, once memory B cells and long-lived antibody-secreting cells were established, SAP became dispensable for maintaining T cell-dependent B cell responses. Thus, SAP is pivotal for nearly all phases, but not for maintenance, of T cell-driven B cell humoral immunity. These findings may have implications for the treatment of immune disorders by targeting the SAP pathway.

  14. Immunogenicity, protective efficacy and safety of a recombinant DNA vaccine encoding truncated Plasmodium yoelii sporozoite asparagine-rich protein 1 (PySAP1).

    PubMed

    Zhao, Jia; Deng, Shu; Liang, Jiayuan; Cao, Yaming; Liu, Jun; Du, Feng; Shang, Hong; Cui, Liwang; Luo, Enjie

    2013-05-01

    Although great efforts have been undertaken for the development of malaria vaccines, no completely effective malaria vaccines are available yet. Despite being clinically silent, the pre-erythrocytic stage is considered an ideal target for the development of malaria vaccines. Sporozoite asparagine-rich protein 1 (SAP1) is a sporozoite-localized protein that regulates the expression of UIS (upregulated in infectious sporozoites) genes, which are essential for the infectivity of sporozoites. In this study, a recombinant DNA vaccine encoding a predicted antigenic determinant region of Plasmodium yoelii SAP1 (PySAP1) was constructed. Immunization of mice with this DNA vaccine construct resulted in significant elevation of cytokines such as IFN-γ, IL-2, IL-4 and IL-10, and total IgG as compared with control groups immunized with either the empty DNA vector or saline. After challenge with sporozoites, the group receiving the DNA vaccine showed delayed development of parasitemia and prolonged survival time compared with the control group. The DNA vaccine provided partial protection against P. yoelii 17XL infection, with an overall protection rate of 20%. In addition, the DNA vaccine did not show integration into the host genome. Further studies of SAP1 are needed to test whether it can be used as subunit vaccine candidate.

  15. Surface-layer (S-layer) proteins sap and EA1 govern the binding of the S-layer-associated protein BslO at the cell septa of Bacillus anthracis.

    PubMed

    Kern, Valerie J; Kern, Justin W; Theriot, Julie A; Schneewind, Olaf; Missiakas, Dominique

    2012-08-01

    The Gram-positive pathogen Bacillus anthracis contains 24 genes whose products harbor the structurally conserved surface-layer (S-layer) homology (SLH) domain. Proteins endowed with the SLH domain associate with the secondary cell wall polysaccharide (SCWP) following secretion. Two such proteins, Sap and EA1, have the unique ability to self-assemble into a paracrystalline layer on the surface of bacilli and form S layers. Other SLH domain proteins can also be found within the S layer and have been designated Bacillus S-layer-associated protein (BSLs). While both S-layer proteins and BSLs bind the same SCWP, their deposition on the cell surface is not random. For example, BslO is targeted to septal peptidoglycan zones, where it catalyzes the separation of daughter cells. Here we show that an insertional lesion in the sap structural gene results in elongated chains of bacilli, as observed with a bslO mutant. The chain length of the sap mutant can be reduced by the addition of purified BslO in the culture medium. This complementation in trans can be explained by an increased deposition of BslO onto the surface of sap mutant bacilli that extends beyond chain septa. Using fluorescence microscopy, we observed that the Sap S layer does not overlap the EA1 S layer and slowly yields to the EA1 S layer in a growth-phase-dependent manner. Although present all over bacilli, Sap S-layer patches are not observed at septa. Thus, we propose that the dynamic Sap/EA1 S-layer coverage of the envelope restricts the deposition of BslO to the SCWP at septal rings.

  16. In vivo association of ATFa with JNK/SAP kinase activities.

    PubMed

    Bocco, J L; Bahr, A; Goetz, J; Hauss, C; Kallunki, T; Kedinger, C; Chatton, B

    1996-05-02

    The human ATFa proteins belong to the CREB/ATF family of transcription factors. We have previously shown that the ATFa proteins may contribute to the modulation of the transcriptional activity of the Jun/Fos complexes (Chatton et al. (1994). Oncogene, 9, 375-385). We now show that a protein kinase activity is strongly associated with ATFa in vivo, as revealed by coimmunoprecipitation of ATFa/kinase complexes from whole cell extracts, with antibodies against ATFa. Two independent regions were found to be implicated in kinase binding: a major interaction site is located within the N-terminal 82 residues comprising an important metal-chelating element; a weaker binding site corresponds to the basic sequence element preceding the C-terminal leucine-zipper of ATFa. Induction experiments suggest that each of these ATFa domains may interact with different kinases. The major activity is associated with the ATFa N-terminal domain. Based on its response to various inducers, on both in vitro and in vivo binding assays, and on its immunological properties, this activity most likely corresponds to the 54/55 kDa JNK2 protein. Taken together, these observations suggest that the ATFa proteins, among other CREB/ATF proteins, may be important effectors of cell signalling pathways.

  17. SAP expression in invariant NKT cells is required for cognate help to support B-cell responses.

    PubMed

    Detre, Cynthia; Keszei, Marton; Garrido-Mesa, Natividad; Kis-Toth, Katalin; Castro, Wilson; Agyemang, Amma F; Veerapen, Natacha; Besra, Gurdyal S; Carroll, Michael C; Tsokos, George C; Wang, Ninghai; Leadbetter, Elizabeth A; Terhorst, Cox

    2012-07-05

    One of the manifestations of X-linked lymphoproliferative disease (XLP) is progressive agammaglobulinemia, caused by the absence of a functional signaling lymphocyte activation molecule (SLAM)-associated protein (SAP) in T, invariant natural killer T (NKT) cells and NK cells. Here we report that α-galactosylceramide (αGalCer) activated NKT cells positively regulate antibody responses to haptenated protein antigens at multiple checkpoints, including germinal center formation and affinity maturation. Whereas NKT cell-dependent B cell responses were absent in SAP(-/-).B6 mice that completely lack NKT cells, the small number of SAP-deficient NKT cells in SAP(-/-).BALB/c mice adjuvated antibody production, but not the germinal center reaction. To test the hypothesis that SAP-deficient NKT cells can facilitate humoral immunity, SAP was deleted after development in SAP(fl/fl).tgCreERT2.B6 mice. We find that NKT cell intrinsic expression of SAP is dispensable for noncognate helper functions, but is critical for providing cognate help to antigen-specific B cells. These results demonstrate that SLAM-family receptor-regulated cell-cell interactions are not limited to T-B cell conjugates. We conclude that in the absence of SAP, several routes of NKT cell-mediated antibody production are still accessible. The latter suggests that residual NKT cells in XLP patients might contribute to variations in dysgammaglobulinemia.

  18. Vascular tissue-specific gene expression of xylem sap glycine-rich proteins in root and their localization in the walls of metaxylem vessels in cucumber.

    PubMed

    Sakuta, C; Satoh, S

    2000-05-01

    Root-specific cDNAs of glycine-rich protein (cucumber root glycine rich protein-1 and -2; CRGRP-1 and CRGRP-2) were cloned previously by use of an antiserum raised against whole xylem sap of Cucumis sativus. The accumulation of the corresponding mRNA at high levels was detected in the root-hair zone of cucumber tap root [Sakuta et al. (1998) Plant Cell Physiol. 39: 1330]. The RNA gel blot analysis with the CRGRP-1- and -2-specific probes revealed that the CRGRP genes expressed only in root but not at all in aboveground organs. When the localization of these mRNAs were examined by in situ hybridization, CRGRP mRNAs were found only in the parenchyma cells in the central cylinder of young lateral roots and it was most abundant in the cells that surrounded xylem vessels in the root-hair zone of the tap root. In immunoblotting of xylem sap collected from cucumber stem with an antiserum raised against CRGRP-1 that had been produced in an E. coli expression system, the antibodies, which did not cross-react with GRP1.8 of kidney bean, reacted with two proteins, whose mobilities corresponded to those of proteins deduced from the CRGRP-1 and -2 cDNAs. Immunohistochemical staining revealed that the CRGRPs accumulated specifically in the lignified walls of metaxylem vessels in the root, stem and leaf and in the lignified cell walls of perivascular fibers in cucumber stems. Immunostaining was also detected in the walls of metaxylem vessels and in the cell walls of adjacent sclerenchyma in the hypocotyl of kidney bean. These data clearly indicate that the novel glycine-rich proteins were produced in the vascular tissue of the root, transported systemically over a long distance via the xylem sap and immobilized in the walls of metaxylem vessels and sclerechyma cells in aboveground organs.

  19. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  20. Protein shift and antigenic variation in the S-layer of Campylobacter fetus subsp. venerealis during bovine infection accompanied by genomic rearrangement of sapA homologs.

    PubMed Central

    Garcia, M M; Lutze-Wallace, C L; Denes, A S; Eaglesome, M D; Holst, E; Blaser, M J

    1995-01-01

    Campylobacter fetus subsp. venerealis isolated from a case of human vaginosis was inoculated into the uterus of a C. fetus-negative heifer. Isolates obtained weekly from the vaginal mucus exhibited variations in high-molecular-mass-protein profiles from that of the original inoculum, which had a dominant 110-kDa S-layer protein. Immunoblots of the weekly isolates with monoclonal antibody probes against the 110-kDa S-layer protein and other C. fetus S-layer proteins demonstrated antigenic shifts. Genomic digests of the isolates probed with a 75-mer oligonucleotide of the conserved sapA region also indicated that antigenic variation of the S-layer is accompanied by DNA rearrangement. PMID:7721688

  1. The latex sap of the 'Old World Plant' Lagenaria siceraria with potent lectin activity mitigates neoplastic malignancy targeting neovasculature and cell death.

    PubMed

    Vigneshwaran, V; Thirusangu, Prabhu; Madhusudana, S; Krishna, V; Pramod, Siddanakoppalu N; Prabhakar, B T

    2016-10-01

    Lifestyle and dietary modifications have contributed much to somatic genetic alteration which has concomitantly led to increase in malignant diseases. Henceforth, plant based and dietary interventions to mitigate and impede oncogenic transformation are in great demand. We investigated the latex sap (LSL) of the dietary Lagenaria siceraria vegetable, the first domesticated plant species with the potent lectin activity for its functional role against the tumor progression and its mechanism. LSL has markedly stimulated proliferation of lymphocytes and displayed strong cytotoxic activity against cancer both in-vitro and in-vivo. The tumor regression was paralleled with drastic reduction in tumoral neovasculature as evidenced from angiogenic parameters and abrogated related gene expressions. LSL has also triggered apoptotic signaling cascade in cancer cells through activation of caspase-3 mediated activation of endonuclease and inducing apoptotic cellular events. Collectively our study provides tangible evidences that latex sap from L. siceraria with immunopotentiating ability significantly regresses the tumor progression by targeting angiogenesis and inducing cell death.

  2. Reduced cathepsins B and D cause impaired autophagic degradation that can be almost completely restored by overexpression of these two proteases in Sap C-deficient fibroblasts.

    PubMed

    Tatti, Massimo; Motta, Marialetizia; Di Bartolomeo, Sabrina; Scarpa, Susanna; Cianfanelli, Valentina; Cecconi, Francesco; Salvioli, Rosa

    2012-12-01

    Saposin (Sap) C deficiency, a rare variant form of Gaucher disease, is due to mutations in the Sap C coding region of the prosaposin (PSAP) gene. Sap C is required as an activator of the lysosomal enzyme glucosylceramidase (GCase), which catalyzes glucosylceramide (GC) degradation. Deficit of either GCase or Sap C leads to the accumulation of undegraded GC and other lipids in lysosomes of monocyte/macrophage lineage. Recently, we reported that Sap C mutations affecting a cysteine residue result in increased autophagy. Here, we characterized the basis for the autophagic dysfunction. We analyzed Sap C-deficient and GCase-deficient fibroblasts and observed that autophagic disturbance was only associated with lack of Sap C. By a combined fluorescence microscopy and biochemical studies, we demonstrated that the accumulation of autophagosomes in Sap C-deficient fibroblasts is not due to enhanced autophagosome formation but to delayed degradation of autolysosomes caused, in part, to decreased amount and reduced enzymatic activity of cathepsins B and D. On the contrary, in GCase-deficient fibroblasts, the protein level and enzymatic activity of cathepsin D were comparable with control fibroblasts, whereas those of cathepsin B were almost doubled. Moreover, the enhanced expression of both these lysosomal proteases in Sap C-deficient fibroblasts resulted in close to functional autophagic degradation. Our data provide a novel example of altered autophagy as secondary event resulting from insufficient lysosomal function.

  3. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phloem sap, xylem sap and apoplastic fluid play key roles in long and short distance transport of signals and nutrients, and act as a barrier against local and systemic pathogen infection. Among other components, these plant fluids contain proteins, which are likely to be important players in th...

  4. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phloem sap, xylem sap and apoplastic fluid play key roles in long and short distance transport of signals and nutrients, and act as a barrier against local and systemic pathogen infection. Among other components, these plant fluids contain proteins which are likely to be important players in the...

  5. Decreased SAP Expression in T Cells from Patients with Systemic Lupus Erythematosus Contributes to Early Signaling Abnormalities and Reduced IL-2 Production.

    PubMed

    Karampetsou, Maria P; Comte, Denis; Kis-Toth, Katalin; Terhorst, Cox; Kyttaris, Vasileios C; Tsokos, George C

    2016-06-15

    T cells from patients with systemic lupus erythematosus (SLE) display a number of abnormalities, including increased early signaling events following engagement of the TCR. Signaling lymphocytic activation molecule family cell surface receptors and the X-chromosome-defined signaling lymphocytic activation molecule-associated protein (SAP) adaptor are important in the development of several immunocyte lineages and modulating the immune response. We present evidence that SAP protein levels are decreased in T cells and in their main subsets isolated from 32 women and three men with SLE, independent of disease activity. In SLE T cells, SAP protein is also subject to increased degradation by caspase-3. Forced expression of SAP in SLE T cells normalized IL-2 production, calcium (Ca(2+)) responses, and tyrosine phosphorylation of a number of proteins. Exposure of normal T cells to SLE serum IgG, known to contain anti-CD3/TCR Abs, resulted in SAP downregulation. We conclude that SLE T cells display reduced levels of the adaptor protein SAP, probably as a result of continuous T cell activation and degradation by caspase-3. Restoration of SAP levels in SLE T cells corrects the overexcitable lupus T cell phenotype.

  6. N-terminal SAP97 isoforms differentially regulate synaptic structure and postsynaptic surface pools of AMPA receptors.

    PubMed

    Goodman, Lucy; Baddeley, David; Ambroziak, Wojciech; Waites, Clarissa L; Garner, Craig C; Soeller, Christian; Montgomery, Johanna M

    2017-02-28

    The location and density of postsynaptic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors is controlled by scaffolding proteins within the postsynaptic density (PSD). SAP97 is a PSD protein with two N-terminal isoforms, α and β, that have opposing effects on synaptic strength thought to result from differential targeting of AMPA receptors into distinct synaptic versus extrasynaptic locations, respectively. In this study, we have applied dSTORM super resolution imaging in order to localize the synaptic and extrasynaptic pools of AMPA receptors in neurons expressing α or βSAP97. Unexpectedly, we observed that both α and βSAP97 enhanced the localization of AMPA receptors at synapses. However, this occurred via different mechanisms: αSAP97 increased PSD size and consequently the number of receptor binding sites, whilst βSAP97 increased synaptic receptor cluster size and surface AMPA receptor density at the PSD edge and surrounding perisynaptic sites without changing PSD size. αSAP97 also strongly enlarged presynaptic active zone protein clusters, consistent with both presynaptic and postsynaptic enhancement underlying the previously observed αSAP97-induced increase in AMPA receptor-mediated currents. In contrast, βSAP97-expressing neurons increased the proportion of immature filopodia that express higher levels of AMPA receptors, decreased the number of functional presynaptic terminals, and also reduced the size of the dendritic tree and delayed the maturation of mushroom spines. Our data reveal that SAP97 isoforms can specifically regulate surface AMPA receptor nanodomain clusters, with βSAP97 increasing extrasynaptic receptor domains at peri-synaptic and filopodial sites. Moreover, βSAP97 negatively regulates synaptic maturation both structurally and functionally. These data support diverging presynaptic and postsynaptic roles of SAP97 N-terminal isoforms in synapse maturation and plasticity. As numerous splice isoforms exist in

  7. Potential pathways for regulation of NK and T cell responses: differential X-linked lymphoproliferative syndrome gene product SAP interactions with SLAM and 2B4.

    PubMed

    Sayós, J; Nguyen, K B; Wu, C; Stepp, S E; Howie, D; Schatzle, J D; Kumar, V; Biron, C A; Terhorst, C

    2000-12-01

    SAP, the gene that is altered or absent in the X-linked lymphoproliferative syndrome (XLP), encodes a small protein that comprises a single SH2 domain and binds to the cell-surface protein SLAM which is present on activated or memory T and B cells. Because defective NK cell activity also has been reported in XLP patients, we studied the SAP gene in NK cells. SAP was induced upon viral infection of SCID mice and shown to be expressed in NK cells by in vitro culturing in the presence of IL-2. Moreover, SAP was expressed in the NK cell lines YT and RNK 16. Because SLAM, the cell-surface protein with which SAP interacts, and 2B4, a membrane protein having sequence homologies with SLAM, also were found to be expressed on the surfaces of activated NK and T cell populations, they may access SAP functions in these populations. Whereas we found that 2B4 also binds SAP, 2B4-SAP interactions occurred only upon tyrosine phosphorylation of 2B4. By contrast, SLAM-SAP interactions were independent of phosphorylation of Y281 and Y327 on SLAM. As CD48, the ligand for 2B4, is expressed on the surface of Epstein-Barr virus (EBV)-infected B cells, it is likely that SAP regulates signal transduction through this pair of cell-surface molecules. These data support the hypothesis that XLP is a result of both defective NK and T lymphocyte responses to EBV. The altered responses may be due to aberrant control of the signaling cascades which are initiated by the SLAM-SLAM and 2B4-CD48 interactions.

  8. 30 CFR 285.605 - What is a Site Assessment Plan (SAP)?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What is a Site Assessment Plan (SAP)? 285.605... Assessment Plan (SAP)? (a) A SAP describes the activities (e.g., installation of meteorological towers... project easement, or to test technology devices. (1) Your SAP must describe how you will conduct...

  9. 30 CFR 285.610 - What must I include in my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What must I include in my SAP? 285.610 Section... I include in my SAP? Your SAP must include the following information, as applicable. (a) For all activities you propose to conduct under your SAP, you must provide the following information: ER29AP09.115...

  10. Role of STAT3 and C/EBP in cytokine-dependent expression of the mouse serum amyloid P-component (SAP) and C-reactive protein (CRP) genes.

    PubMed

    Ochrietor, J D; Harrison, K A; Zahedi, K; Mortensen, R F

    2000-07-01

    Inflammation is accompanied by a rapid increase in blood levels of acute phase proteins synthesized by hepatocytes in response to cytokines. Although C-reactive protein (CRP) levels increase dramatically in most mammals, the major acute phase protein in the mouse is the homologous pentraxin, serum amyloid P-component (SAP), whereas CRP is a minor acute phase reactant. The molecular basis for the pronounced difference in SAP and CRP gene expression in the mouse is unknown. Transfection of ++/Li mouse hepatoma cells with CAT-reporter constructs containing the 5'-flanking region of the mouse CRP gene indicated that transcription was stimulated by either IL-6, or IL-6 plus IL-1, when > or =360 bp of the 5'-proximal DNA was present. Examination of the 5'-flanking region of the mouse SAP gene revealed that the region between -433 and -397 from the transcription start site responded to IL-1 and IL-6 by binding both STAT3 and C/EBPbeta. This responsive region consisted of two adjacent C/EBPbeta consensus sites that overlap with two STAT3 consensus sites and was found to bind C/EBPbeta at an upstream site of -427 to -409 and STAT3 at a downstream site of -415 to -397. By contrast, the 360 bp promoter of the CRP gene was bound only by STAT3 at consensus sites at -93, -142, -173, and -287 from the start site; however, a single consensus site for C/EBP at -75 was not recognized. STAT3 appears to be necessary for both mouse SAP and CRP gene transcription since overexpression of an inactive, deletion mutant of STAT3 inhibited transcription of both genes. The results indicate that both STAT3 and C/EBPbeta participate in mouse SAP gene expression, whereas only STAT3 is involved in mouse CRP gene expression. The findings for mouse SAP gene expression are consistent with the reported interaction between these two transcription factors for human CRP gene transcription.

  11. Binding and inhibition of the ternary complex factor Elk-4/Sap1 by the adapter protein Dok-4.

    PubMed

    Hooker, Erika; Baldwin, Cindy; Roodman, Victoria; Batra, Anupam; Takano, Tomoko; Lemay, Serge

    2017-03-08

    The adapter protein Dok-4 has been reported as both activator and inhibitor of Erk and Elk-1, but lack of knowledge about the identity of its partner molecules has precluded any mechanistic insight into these seemingly conflicting properties. We report that Dok-4 interacts with the transactivation domain of Elk-4  through an atypical PTB domain-mediated interaction. Dok-4 possesses a nuclear export signal and can relocalize Elk-4 from nucleus to cytosol, whereas Elk-4 possesses two nuclear localization signals that restrict interaction with Dok-4. Elk-4 protein, unlike Elk-1, is highly unstable in the presence of Dok-4, through both a an interaction-dependent mechanism and a PH domain-dependent but interaction-independent mechanism. This is reversed by proteasome inhibition, depletion of endogenous Dok-4 or lysine-to-arginine mutation of putative Elk-4 ubiquitination sites. Finally, Elk-4 transactivation is potently inhibited by Dok-4 overexpression but enhanced by Dok-4 knockdown in MDCK renal tubular cells, which correlates with  increased basal and EGF-induced expression of Egr-1, Fos and cylcinD1 mRNA and cell proliferation despite reduced Erk activation. Thus, Dok-4 can target Elk-4 activity through multiple mechanisms including binding of the transactivation domain, nuclear exclusion and protein destabilization, without a requirement for inhibition of Erk.

  12. NK cell cytotoxicity mediated by 2B4 and NTB-A is dependent on SAP acting downstream of receptor phosphorylation.

    PubMed

    Meinke, Stephan; Watzl, Carsten

    2013-01-01

    2B4 (CD244) and NK-T-B-antigen (NTB-A, CD352) are activating receptors on human natural killer (NK) cells and belong to the family of signaling lymphocyte activation molecule (SLAM)-related receptors (SRR). Engagement of these receptors leads to phosphorylation of their cytoplasmic tails and recruitment of the adapter proteins SLAM-associated protein (SAP) and Ewing's sarcoma-activated transcript-2 (EAT-2). X-linked lymphoproliferative syndrome (XLP) is a severe immunodeficiency that results from mutations in the SAP gene. 2B4 and NTB-A-mediated cytotoxicity are abrogated in XLP NK cells. To elucidate the molecular basis for this defect we analyzed early signaling events in SAP knockdown cells. Similar to XLP NK cells, knockdown of SAP in primary human NK cells leads to a reduction of 2B4 and NTB-A-mediated cytotoxicity. We found that early signaling events such as raft recruitment and receptor phosphorylation are not affected by the absence of SAP, indicating the defect in the absence of SAP is downstream of these events. In addition, knockdown of EAT-2 does not impair 2B4 or NTB-A-mediated cytotoxicity. Surprisingly, EAT-2 recruitment to both receptors is abrogated in the absence of SAP, revealing a novel cooperativity between these adapters.

  13. Monitoring and Modelling of Soil-Plant Interactions: the Joint Use of ERT, Sap Flow and Eddy Covariance to Define the Volume of Orange Tree Active Root Zones.

    NASA Astrophysics Data System (ADS)

    Cassiani, G.; Boaga, J.; Vanella, D.; Perri, M. T.; Consoli, S.

    2014-12-01

    Mass and energy exchanges between soil, plants and atmosphere are key factors controlling a number of environmental processes involving hydrology, biota and climate. The understanding of these exchanges also play a critical role for practical purposes such as precision agriculture. In this contribution we present a methodology based on coupling innovative data collection and models. In particular we propose the use of hydro-geophysical monitoring via 4D Electrical Resistivity Tomography (ERT) in conjunction with measurements of plant transpiration via sap flow and evapotranspiration from Eddy Correlation (EC). This abundance of data are to be fed in spatially distributed soil models in order to comprehend the distribution of active roots. We conducted experiments in an orange orchard in Eastern Sicily (Italy). We installed a 3D electrical tomography apparatus consisting of 4 instrumented micro boreholes placed at the corners of a square (about 1.3 m in side) surrounding an orange tree. During the monitoring, we collected repeated ERT and TDR soil moisture measurements, soil water sampling, sap flow measurements from the orange tree and EC data. Irrigation, precipitation, sap flow and ET data are available for a long period of time allowing knowledge of the long term forcing conditions on the system. This wealth of information was used to calibrate a 1D Richards' equation model representing the dynamics of the volume monitored via 3D ERT. Information on the soil hydraulic properties was collected from laboratory experiments as well as by time-lapse ERT monitoring of irrigation a few months after the main experiment, when the orange tree had been cut. The results of the calibrated modeling exercise allow the quantification of the soil volume interested by root water uptake. This volume is much smaller (an area less than 2 square meters, 40 cm thick) than generally believed and assumed in the design of classical drip irrigation schemes.

  14. Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation.

    PubMed

    Tangye, Stuart G; Nichols, Kim E; Hare, Nathan J; van de Weerdt, Barbara C M

    2003-09-01

    Cell surface receptors belonging to the CD2 subset of the Ig superfamily of molecules include CD2, CD48, CD58, 2B4, signaling lymphocytic activation molecule (SLAM), Ly9, CD84, and the recently identified molecules NTB-A/Ly108/SLAM family (SF) 2000, CD84H-1/SF2001, B lymphocyte activator macrophage expressed (BLAME), and CRACC (CD2-like receptor-activating cytotoxic cells)/CS-1. Some of these receptors, such as CD2, SLAM, 2B4, CRACC, and NTB-A, contribute to the activation and effector function of T cells and NK cells. Signaling pathways elicited via some of these receptors are believed to involve the Src homology 2 (SH2) domain-containing cytoplasmic adaptor protein SLAM-associated protein (SAP), as it is recruited to SLAM, 2B4, CD84, NTB-A, and Ly-9. Importantly, mutations in SAP cause the inherited human immunodeficiency X-linked lymphoproliferative syndrome (XLP), suggesting that XLP may result from perturbed signaling via one or more of these SAP-associating receptors. We have now studied the requirements for SAP recruitment to CD84 and lymphocyte activation elicited following ligation of CD84 on primary and transformed human T cells. CD84 was found to be rapidly tyrosine phosphorylated following receptor ligation on activated T cells, an event that involved the Src kinase Lck. Phosphorylation of CD84 was indispensable for the recruitment of SAP, which was mediated by Y(262) within the cytoplasmic domain of CD84 and by R(32) within the SH2 domain of SAP. Furthermore, ligating CD84 enhanced the proliferation of anti-CD3 mAb-stimulated human T cells. Strikingly, this effect was also apparent in SAP-deficient T cells obtained from patients with XLP. These results reveal a novel function of CD84 on human lymphocytes and suggest that CD84 can activate human T cells via a SAP-independent mechanism.

  15. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  16. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  17. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  18. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is... maple sap. (g) The actual production history for maple sap shall be recorded on the basis of gallons...

  19. 7 CFR 1437.107 - Maple sap.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 10 2012-01-01 2012-01-01 false Maple sap. 1437.107 Section 1437.107 Agriculture... Yield Coverage Using Actual Production History § 1437.107 Maple sap. (a) NAP assistance for maple sap is limited to maple sap produced on private property for sale as sap or syrup. Eligible maple sap must...

  20. Anti-transpirant activity in xylem sap from flooded tomato (Lycopersicon esculentum Mill.) plants is not due to pH-mediated redistributions of root- or shoot-sourced ABA.

    PubMed

    Else, Mark A; Taylor, June M; Atkinson, Christopher J

    2006-01-01

    In flooded soils, the rapid effects of decreasing oxygen availability on root metabolic activity are likely to generate many potential chemical signals that may impact on stomatal apertures. Detached leaf transpiration tests showed that filtered xylem sap, collected at realistic flow rates from plants flooded for 2 h and 4 h, contained one or more factors that reduced stomatal apertures. The closure could not be attributed to increased root output of the glucose ester of abscisic acid (ABA-GE), since concentrations and deliveries of ABA conjugates were unaffected by soil flooding. Although xylem sap collected from the shoot base of detopped flooded plants became more alkaline within 2 h of flooding, this rapid pH change of 0.5 units did not alter partitioning of root-sourced ABA sufficiently to prompt a transient increase in xylem ABA delivery. More shoot-sourced ABA was detected in the xylem when excised petiole sections were perfused with pH 7 buffer, compared with pH 6 buffer. Sap collected from the fifth oldest leaf of "intact" well-drained plants and plants flooded for 3 h was more alkaline, by approximately 0.4 pH units, than sap collected from the shoot base. Accordingly, xylem [ABA] was increased 2-fold in sap collected from the fifth oldest petiole compared with the shoot base of flooded plants. However, water loss from transpiring, detached leaves was not reduced when the pH of the feeding solution containing 3-h-flooded [ABA] was increased from 6.7 to 7.1 Thus, the extent of the pH-mediated, shoot-sourced ABA redistribution was not sufficient to raise xylem [ABA] to physiologically active levels. Using a detached epidermis bioassay, significant non-ABA anti-transpirant activity was also detected in xylem sap collected at intervals during the first 24 h of soil flooding.

  1. Implementation of SAP Waste Management System

    SciTech Connect

    Frost, M.L.; LaBorde, C.M.; Nichols, C.D.

    2008-07-01

    The Y-12 National Security Complex (Y-12) assumed responsibility for newly generated waste on October 1, 2005. To ensure effective management and accountability of newly generated waste, Y-12 has opted to utilize SAP, Y-12's Enterprise Resource Planning (ERP) tool, to track low-level radioactive waste (LLW), mixed waste (MW), hazardous waste, and non-regulated waste from generation through acceptance and disposal. SAP Waste will include the functionality of the current waste tracking system and integrate with the applicable modules of SAP already in use. The functionality of two legacy systems, the Generator Entry System (GES) and the Waste Information Tracking System (WITS), and peripheral spreadsheets, databases, and e-mail/fax communications will be replaced by SAP Waste. Fundamentally, SAP Waste will promote waste acceptance for certification and disposal, not storage. SAP Waste will provide a one-time data entry location where waste generators can enter waste container information, track the status of their waste, and maintain documentation. A benefit of the new system is that it will provide a single data repository where Y-12's Waste Management organization can establish waste profiles, verify and validate data, maintain inventory control utilizing hand-held data transfer devices, schedule and ship waste, manage project accounting, and report on waste handling activities. This single data repository will facilitate the production of detailed waste generation reports for use in forecasting and budgeting, provide the data for required regulatory reports, and generate metrics to evaluate the performance of the Waste Management organization and its subcontractors. SAP Waste will replace the outdated and expensive legacy system, establish tools the site needs to manage newly generated waste, and optimize the use of the site's ERP tool for integration with related business processes while promoting disposition of waste. (authors)

  2. From Sap to Syrup

    ERIC Educational Resources Information Center

    Bjork, Janna

    2005-01-01

    Warm days, cold nights, melting snow-signs winter is waning and spring is nearing. Though winter may just be getting started in some areas, it's always fun to appreciate the good things about winter, including the special time at the end of winter in New England known as "sugaring time." The sap starts flowing in the sugar maples, and…

  3. (BOREAS) BOREAS TE-7 Sap Flow Data

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Papagno, Andrea (Editor); Hogg, E. H.; Hurdle, P. A.

    2000-01-01

    The BOREAS TE-7 team collected data sets in support of its efforts to characterize and interpret information on the sap flow of boreal vegetation. The heat pulse method was used to monitor sap flow and to estimate rates of transpiration from aspen, black spruce, and mixed wood forests at the SSAOA, MIX, SSA-OBS. and Batoche sites in Saskatchewan, Canada. Measurements were made at the various sites from May to October 1994, May to October 1995, and April to October 1996. A scaling procedure was used to estimate canopy transpiration rates from the sap flow measurements. The data were stored in tabular ASCII files. Analyses to date show a tendency for sap flow in aspen to remain remarkably constant over a wide range of environmental conditions VPD from 1.0 to 4.8 kPa and solar radiation less than 400 W/sq m). For forests with high aerodynamic conductance, the results would indicate an inverse relationship between stomatal conductance and VPD, for VPD greater than 1 kPa. A possible interpretation is that stomata are operating to maintain leaf water potentials above a critical minimum value, which in turn places a maximum value on the rate of sap flow that can be sustained by the tree. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distrobuted Activity Archive Center (DAAC).

  4. Allergenicity Assessment of Allium sativum Leaf Agglutinin, a Potential Candidate Protein for Developing Sap Sucking Insect Resistant Food Crops

    PubMed Central

    Mondal, Hossain Ali; Chakraborti, Dipankar; Majumder, Pralay; Roy, Pampa; Roy, Amit; Bhattacharya, Swati Gupta; Das, Sampa

    2011-01-01

    Background Mannose-binding Allium sativum leaf agglutinin (ASAL) is highly antinutritional and toxic to various phloem-feeding hemipteran insects. ASAL has been expressed in a number of agriculturally important crops to develop resistance against those insects. Awareness of the safety aspect of ASAL is absolutely essential for developing ASAL transgenic plants. Methodology/Principal Findings Following the guidelines framed by the Food and Agriculture Organization/World Health Organization, the source of the gene, its sequence homology with potent allergens, clinical tests on mammalian systems, and the pepsin resistance and thermostability of the protein were considered to address the issue. No significant homology to the ASAL sequence was detected when compared to known allergenic proteins. The ELISA of blood sera collected from known allergy patients also failed to show significant evidence of cross-reactivity. In vitro and in vivo assays both indicated the digestibility of ASAL in the presence of pepsin in a minimum time period. Conclusions/Significance With these experiments, we concluded that ASAL does not possess any apparent features of an allergen. This is the first report regarding the monitoring of the allergenicity of any mannose-binding monocot lectin having insecticidal efficacy against hemipteran insects. PMID:22110739

  5. BOREAS TE-11 Sap Flow Data

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Papagno, Andrea (Editor); Saugier, Bernard

    2000-01-01

    The BOREAS TE-11 team collected several data sets in support of its efforts to characterize and interpret information on the sap flow, gas exchange, and lichen photosynthesis of boreal vegetation and meteorological data of the area studied. This data set contains measurements of sap flow conducted at the SSA-OJP site in the growing seasons of 1993 and 1994. The data are stored in ASCII files. The data files are available on a CD-ROM (see document number 20010000884), or from the Oak Ridge National Laboratory (ORNL) Distributed Active Center (DAAC).

  6. 30 CFR 285.605 - What is a Site Assessment Plan (SAP)?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What is a Site Assessment Plan (SAP)? 285.605... Commercial Leases § 285.605 What is a Site Assessment Plan (SAP)? (a) A SAP describes the activities (e.g... your commercial lease, including your project easement, or to test technology devices. (1) Your...

  7. Plant fluid proteomics: Delving into the xylem sap, phloem sap and apoplastic fluid proteomes.

    PubMed

    Rodríguez-Celma, Jorge; Ceballos-Laita, Laura; Grusak, Michael A; Abadía, Javier; López-Millán, Ana-Flor

    2016-08-01

    The phloem sap, xylem sap and apoplastic fluid play key roles in long and short distance transport of signals and nutrients, and act as a barrier against local and systemic pathogen infection. Among other components, these plant fluids contain proteins which are likely to be important players in their functionalities. However, detailed information about their proteomes is only starting to arise due to the difficulties inherent to the collection methods. This review compiles the proteomic information available to date in these three plant fluids, and compares the proteomes obtained in different plant species in order to shed light into conserved functions in each plant fluid. Inter-species comparisons indicate that all these fluids contain the protein machinery for self-maintenance and defense, including proteins related to cell wall metabolism, pathogen defense, proteolysis, and redox response. These analyses also revealed that proteins may play more relevant roles in signaling in the phloem sap and apoplastic fluid than in the xylem sap. A comparison of the proteomes of the three fluids indicates that although functional categories are somewhat similar, proteins involved are likely to be fluid-specific, except for a small group of proteins present in the three fluids, which may have a universal role, especially in cell wall maintenance and defense. This article is part of a Special Issue entitled: Plant Proteomics--a bridge between fundamental processes and crop production, edited by Dr. Hans-Peter Mock.

  8. Serum Amyloid P Component (SAP) Interactome in Human Plasma Containing Physiological Calcium Levels.

    PubMed

    Poulsen, Ebbe Toftgaard; Pedersen, Kata Wolff; Marzeda, Anna Maria; Enghild, Jan J

    2017-02-14

    The pentraxin serum amyloid P component (SAP) is secreted by the liver and found in plasma at a concentration of approximately 30 mg/L. SAP is a 25 kDa homopentamer known to bind both protein and nonprotein ligands, all in a calcium-dependent manner. The function of SAP is unclear but likely involves the humoral innate immune system spanning the complement system, inflammation, and coagulation. Also, SAP is known to bind to the generic structure of amyloid deposits and possibly to protect them against proteolysis. In this study, we have characterized the SAP interactome in human plasma containing the physiological Ca(2+) concentration using SAP affinity pull-down and co-immunoprecipitation experiments followed by mass spectrometry analyses. The analyses resulted in the identification of 33 proteins, of which 24 were direct or indirect interaction partners not previously reported. The SAP interactome can be divided into categories that include apolipoproteins, the complement system, coagulation, and proteolytic regulation.

  9. Surface-associated proteins from Staphylococcus aureus demonstrate potent bone resorbing activity.

    PubMed

    Nair, S; Song, Y; Meghji, S; Reddi, K; Harris, M; Ross, A; Poole, S; Wilson, M; Henderson, B

    1995-05-01

    Staphylococcus aureus infections are associated with rapid bone destruction in conditions such as osteomyelitis, bacterial arthritis, and infected orthopedic implant failure. How this bacterium induces bone destruction has not been defined. In studies of the role of oral Gram-negative bacteria in periodontal pathology, we have established that cell surface-associated proteins (SAPs) are potent stimulators of bone resorption. The surface-associated components from S. aureus have now been isolated and demonstrated to be extremely potent stimulators of bone resorption in the murine calvarial bone resorption assay. Bone resorption appears to be due to proteins, is not the result of contamination with lipoteichoic acid or muramyl dipeptide, and is potently inhibited by indomethacin and can be completely blocked by high concentrations of interleukin-1 receptor antagonist or TN3-19.12, a neutralizing monoclonal antibody to murine TNF. The SAP fraction can stimulate fibroblasts or monocytes to release osteolytic cytokines, but only at high concentrations. Fractionation of the SAPs by high performance liquid chromatography demonstrated that a number of fractions were osteolytically active. The most active contained a heterodimeric protein of molecular weight 32-36 kD. The presence of this osteolytically active surface-associated fraction may account for the bone resorption associated with local infection with S. aureus.

  10. SAP modulates B cell functions in a genetic background-dependent manner.

    PubMed

    Detre, Cynthia; Yigit, Burcu; Keszei, Marton; Castro, Wilson; Magelky, Erica M; Terhorst, Cox

    2013-06-01

    Mutations affecting the SLAM-associated protein (SAP) are responsible for the X-linked lympho-proliferative syndrome (XLP), a severe primary immunodeficiency syndrome with disease manifestations that include fatal mononucleosis, B cell lymphoma and dysgammaglobulinemia. It is well accepted that insufficient help by SAP-/- CD4+ T cells, in particular during the germinal center reaction, is a component of dysgammaglobulinemia in XLP patients and SAP-/- animals. It is however not well understood whether in XLP patients and SAP-/- mice B cell functions are affected, even though B cells themselves do not express SAP. Here we report that B cell intrinsic responses to haptenated protein antigens are impaired in SAP-/- mice and in Rag-/- mice into which B cells derived from SAP-/- mice together with wt CD4+ T cells had been transferred. This impaired B cells functions are in part depending on the genetic background of the SAP-/- mouse, which affects B cell homeostasis. Surprisingly, stimulation with an agonistic anti-CD40 causes strong in vivo and in vitro B cell responses in SAP-/- mice. Taken together, the data demonstrate that genetic factors play an important role in the SAP-related B cell functions. The finding that anti-CD40 can in part restore impaired B cell responses in SAP-/- mice, suggests potentially novel therapeutic interventions in subsets of XLP patients.

  11. Effect of preservation methods of oil palm sap (Elaeis guineensis) on the reproductive indices of male wistar rats.

    PubMed

    Ikegwu, Theophilus Maduabuchukwu; Okafor, Gabriel Ifeanyi; Ochiogu, Izuchukwu Shedrack

    2014-12-01

    Thirty male Wistar rats, split into five groups of six rats each, were administered different forms of oil palm tree (Elaeis guineensis) sap samples by gavage based on 1.5% of their weekly body weights. Group 1 which served as control received only water, group 2 received pasteurized palm sap (PPS), group 3 received market palm wine (MPW), group 4 received frozen palm sap (FPS), whereas group 5 received fresh palm sap (FrPS). Chemical composition of the sap samples was determined. Normal feed and water were fed ad libitum. After 2 months of treatment, each male rat group was allowed 7 days to mate with six female Wistar rats. Thereafter, blood and epididymal samples were collected for testosterone assay and sperm count, respectively, before they were humanely sacrificed and testicular tissues taken for testicular histology. Litter weight and size of the pups produced by the females of each group were determined at birth. The sap samples contained carbohydrate (0.01-11.71%), protein (1.56-1.95%), ash (0.22-0.35%), moisture (92.55-98.24%), and alcohol (0.26-3.50%). PPS-treated rat group had significantly (P<.05) decreased sperm count (42.60±23.64×10(6)), abnormal increase in testosterone level, and necrosis in the histology of the testes with reduced spermatogenetic activity, compared with other treatment groups. The female rats crossed with male rats fed on FrPS or FPS produced the highest number of pups followed by the control group. This study demonstrated that the intake of FrPS improved fertility in male animals, but its administration for a long period led to necrotic changes in the testes, whereas pasteurization of palm sap, impacted negatively on the reproductive indices of male animals.

  12. Effect of Preservation Methods of Oil Palm Sap (Elaeis guineensis) on the Reproductive Indices of Male Wistar Rats

    PubMed Central

    Ikegwu, Theophilus Maduabuchukwu; Ochiogu, Izuchukwu Shedrack

    2014-01-01

    Abstract Thirty male Wistar rats, split into five groups of six rats each, were administered different forms of oil palm tree (Elaeis guineensis) sap samples by gavage based on 1.5% of their weekly body weights. Group 1 which served as control received only water, group 2 received pasteurized palm sap (PPS), group 3 received market palm wine (MPW), group 4 received frozen palm sap (FPS), whereas group 5 received fresh palm sap (FrPS). Chemical composition of the sap samples was determined. Normal feed and water were fed ad libitum. After 2 months of treatment, each male rat group was allowed 7 days to mate with six female Wistar rats. Thereafter, blood and epididymal samples were collected for testosterone assay and sperm count, respectively, before they were humanely sacrificed and testicular tissues taken for testicular histology. Litter weight and size of the pups produced by the females of each group were determined at birth. The sap samples contained carbohydrate (0.01–11.71%), protein (1.56–1.95%), ash (0.22–0.35%), moisture (92.55–98.24%), and alcohol (0.26–3.50%). PPS-treated rat group had significantly (P<.05) decreased sperm count (42.60±23.64×106), abnormal increase in testosterone level, and necrosis in the histology of the testes with reduced spermatogenetic activity, compared with other treatment groups. The female rats crossed with male rats fed on FrPS or FPS produced the highest number of pups followed by the control group. This study demonstrated that the intake of FrPS improved fertility in male animals, but its administration for a long period led to necrotic changes in the testes, whereas pasteurization of palm sap, impacted negatively on the reproductive indices of male animals. PMID:25101691

  13. NuSAP governs chromosome oscillation by facilitating the Kid-generated polar ejection force.

    PubMed

    Li, Chenyu; Xue, Chenyi; Yang, Qiaoyun; Low, Boon Chuan; Liou, Yih-Cherng

    2016-02-03

    In vertebrate cells, chromosomes oscillate to align precisely during metaphase. NuSAP, a microtubule-associated protein, plays a critical role in stabilizing spindle microtubules. In this study, we utilize 3D time-lapse live-cell imaging to monitor the role of NuSAP in chromosome oscillation and identify NuSAP as a novel regulator of the chromokinesin, Kid. Depletion of NuSAP significantly suppresses the amplitude and velocity of chromosome oscillation. We analyse the effects of NuSAP and Kid depletion in monopolar and bipolar cells with or without kinetochore microtubule depletion. Twelve postulated conditions are deciphered to reveal the contribution of NuSAP to the polar force generated at kinetochore microtubules and to the regulation of the polar ejection force generated by Kid, thus revealing a pivotal role of NuSAP in chromosome oscillation.

  14. Sapping In Nirgal Vallis

    NASA Astrophysics Data System (ADS)

    Jaumann, R.; Reiss, D.

    The topographic information provided by the Mars Orbiter Laser Altimeter has been used in combination with Viking and Mars Observer Camera imagery to estimate the three-dimensional structure of the Nirgal Vallis drainage system in order to constrain the formation process. Based on precisely correlated Viking, Mars Orbiter Laser Altimeter (MOLA) and Mars Orbiter Camera (MOC) cartographic data (1,2), we have measured morphometric and topologic parameters (3,4,5,6,7) of the valley network. Although there is no single parameter, which unambiguously distinguishes between run-off and sapping, the combination of parameters such as surface dip angle, longitudinal profile, width to depth ratio, drainage density, structural control, valley terminations and bifurcation ratio will constrain the formation process. All topographic based valley network parameters indicate an origin by groundwater sapping processes and headward erosion for Nirgal Vallis and confirms former geomorphologic analyses. The extremely low drainage density of Nirgal Vallis may either be caused by very slow erosion, due to low groundwater supply or arid conditions, or by sequential interruptions of the erosion process due to probable climate changes. (1) Zeitler and Oberst, 1999; JGR, 104, 14051. (2) Hauber et al., 2000, Int. Arch. Photogram. Rem. Sens. XXXIII, 360. (3) Horton, 1945, Geol. Sic. Amer. 56. 275. (4) Strahler, 1964, In: Handbook Appl. Hydrogeol. McGraw Hill. (5) Leopold et al, 1964, In: Fluvial Proc. Geomorph. Freeman (6) Summerfield, 1991, In: Global Geomorph. Longman, Burnt Mill.(7) Ritter et al. 1995, In: Processes Geomorph. Wm.C.Brown Publ..

  15. Measuring sap flow in plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sap flow measurements provide a powerful tool for quantifying plant water use and monitoring qualitative physiological responses of plants to environmental conditions. As such, sap flow methods are widely employed to invesitgate the agronomic, ecological and hydrological outcomes of plant growth. T...

  16. SAP suppresses the development of experimental autoimmune encephalomyelitis in C57BL/6 mice.

    PubMed

    Ji, Zhe; Ke, Zun-Ji; Geng, Jian-Guo

    2012-04-01

    Experimental autoimmune encephalomyelitis (EAE) is a CD4(+) T cell-mediated disease of the central nervous system. Serum amyloid P component (SAP) is a highly conserved plasma protein named for its universal presence in amyloid deposits. Here we report that SAP-transgenic mice had unexpectedly attenuated EAE due to impaired encephalitogenic responses. Following induction with myelin oligodendroglial glycoprotein (MOG) peptide 35-55 in complete Freund's adjuvant, SAP-transgenic mice showed reduced spinal cord inflammation with lower severity of EAE attacks as compared with control C57BL/6 mice. However, in SAP-Knockout mice, the severity of EAE is enhanced. Adoptive transfer of Ag-restimulated T cells from wild type to SAP-transgenic mice, or transfer of SAP-transgenic Ag-restimulated T cells to control mice, induced milder EAE. T cells from MOG-primed SAP-transgenic mice showed weak proliferative responses. Furthermore, in SAP-transgenic mice, there is little infiltration of CD45-positive cells in the spinal cord. In vitro, SAP suppressed the secretion of interleukin-2 stimulated by P-selectin and blocked P-selectin binding to T cells. Moreover, SAP could change the affinity between α4-integrin and T cells. These data suggested that SAP could antagonize the development of the acute phase of inflammation accompanying EAE by modulating the function of P-selectin.

  17. Genomic organization and characterization of mouse SAP, the gene that is altered in X-linked lymphoproliferative disease.

    PubMed

    Wu, C; Sayos, J; Wang, N; Howie, D; Coyle, A; Terhorst, C

    2000-08-01

    X-linked lymphoproliferative (XLP) disease is a fatal immunological disorder that renders the immune system unable to respond effectively to Epstein-Barr virus (EBV) infection. The gene that encodes a protein termed SAP or SH2D1A is either deleted or mutated in XLP patients, resulting in uncontrolled B- and T-cell proliferation upon EBV infection. Here, we report the cloning and characterization of the mouse SAP gene. It is localized on the mouse X chromosome and comprises four exons spanning approximately 25 kb. Its expression appears to be restricted to T lymphocytes. Whereas a high level of SAP expression is observed in Thl cells, only small amounts are detectable in Th2 cells. Moreover, SAP expression is down-regulated upon in vitro activation of T cells, including CD4+, CD8+ single-positive T cells, and Thl and Th2 cells. This study provides valuable information for in-depth genetic and biochemical analysis of the function of SAP in the immune system.

  18. Novel Aggregation Properties of Candida albicans Secreted Aspartyl Proteinase Sap6 Mediate Virulence in Oral Candidiasis.

    PubMed

    Kumar, Rohitashw; Saraswat, Darpan; Tati, Swetha; Edgerton, Mira

    2015-07-01

    Candida albicans, a commensal fungus of the oral microbiome, causes oral candidiasis in humans with localized or systemic immune deficiencies. Secreted aspartic proteinases (Saps) are a family of 10 related proteases and are virulence factors due to their proteolytic activity, as well as their roles in adherence and colonization of host tissues. We found that mice infected sublingually with C. albicans cells overexpressing Sap6 (SAP6 OE and a Δsap8 strain) had thicker fungal plaques and more severe oral infection, while infection with the Δsap6 strain was attenuated. These hypervirulent strains had highly aggregative colony structure in vitro and higher secreted proteinase activity; however, the levels of proteinase activity of C. albicans Saps did not uniformly match their abilities to damage cultured oral epithelial cells (SCC-15 cells). Hyphal induction in cells overexpressing Sap6 (SAP6 OE and Δsap8 cells) resulted in formation of large cell-cell aggregates. These aggregates could be produced in germinated wild-type cells by addition of native or heat-inactivated Sap6. Sap6 bound only to germinated cells and increased C. albicans adhesion to oral epithelial cells. The adhesion properties of Sap6 were lost upon deletion of its integrin-binding motif (RGD) and could be inhibited by addition of RGD peptide or anti-integrin antibodies. Thus, Sap6 (but not Sap5) has an alternative novel function in cell-cell aggregation, independent of its proteinase activity, to promote infection and virulence in oral candidiasis.

  19. Novel Aggregation Properties of Candida albicans Secreted Aspartyl Proteinase Sap6 Mediate Virulence in Oral Candidiasis

    PubMed Central

    Kumar, Rohitashw; Saraswat, Darpan; Tati, Swetha

    2015-01-01

    Candida albicans, a commensal fungus of the oral microbiome, causes oral candidiasis in humans with localized or systemic immune deficiencies. Secreted aspartic proteinases (Saps) are a family of 10 related proteases and are virulence factors due to their proteolytic activity, as well as their roles in adherence and colonization of host tissues. We found that mice infected sublingually with C. albicans cells overexpressing Sap6 (SAP6 OE and a Δsap8 strain) had thicker fungal plaques and more severe oral infection, while infection with the Δsap6 strain was attenuated. These hypervirulent strains had highly aggregative colony structure in vitro and higher secreted proteinase activity; however, the levels of proteinase activity of C. albicans Saps did not uniformly match their abilities to damage cultured oral epithelial cells (SCC-15 cells). Hyphal induction in cells overexpressing Sap6 (SAP6 OE and Δsap8 cells) resulted in formation of large cell-cell aggregates. These aggregates could be produced in germinated wild-type cells by addition of native or heat-inactivated Sap6. Sap6 bound only to germinated cells and increased C. albicans adhesion to oral epithelial cells. The adhesion properties of Sap6 were lost upon deletion of its integrin-binding motif (RGD) and could be inhibited by addition of RGD peptide or anti-integrin antibodies. Thus, Sap6 (but not Sap5) has an alternative novel function in cell-cell aggregation, independent of its proteinase activity, to promote infection and virulence in oral candidiasis. PMID:25870228

  20. SAP97-mediated ADAM10 trafficking from Golgi outposts depends on PKC phosphorylation

    PubMed Central

    Saraceno, C; Marcello, E; Di Marino, D; Borroni, B; Claeysen, S; Perroy, J; Padovani, A; Tramontano, A; Gardoni, F; Di Luca, M

    2014-01-01

    A disintegrin and metalloproteinase 10 (ADAM10) is the major α-secretase that catalyzes the amyloid precursor protein (APP) ectodomain shedding in the brain and prevents amyloid formation. Its activity depends on correct intracellular trafficking and on synaptic membrane insertion. Here, we describe that in hippocampal neurons the synapse-associated protein-97 (SAP97), an excitatory synapse scaffolding element, governs ADAM10 trafficking from dendritic Golgi outposts to synaptic membranes. This process is mediated by a previously uncharacterized protein kinase C phosphosite in SAP97 SRC homology 3 domain that modulates SAP97 association with ADAM10. Such mechanism is essential for ADAM10 trafficking from the Golgi outposts to the synapse, but does not affect ADAM10 transport from the endoplasmic reticulum. Notably, this process is altered in Alzheimer's disease brains. These results help in understanding the mechanism responsible for the modulation of ADAM10 intracellular path, and can constitute an innovative therapeutic strategy to finely tune ADAM10 shedding activity towards APP. PMID:25429624

  1. Separating proteins with activated carbon.

    PubMed

    Stone, Matthew T; Kozlov, Mikhail

    2014-07-15

    Activated carbon is applied to separate proteins based on differences in their size and effective charge. Three guidelines are suggested for the efficient separation of proteins with activated carbon. (1) Activated carbon can be used to efficiently remove smaller proteinaceous impurities from larger proteins. (2) Smaller proteinaceous impurities are most efficiently removed at a solution pH close to the impurity's isoelectric point, where they have a minimal effective charge. (3) The most efficient recovery of a small protein from activated carbon occurs at a solution pH further away from the protein's isoelectric point, where it is strongly charged. Studies measuring the binding capacities of individual polymers and proteins were used to develop these three guidelines, and they were then applied to the separation of several different protein mixtures. The ability of activated carbon to separate proteins was demonstrated to be broadly applicable with three different types of activated carbon by both static treatment and by flowing through a packed column of activated carbon.

  2. 30 CFR 285.615 - What other reports or notices must I submit to MMS under my approved SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... MMS under my approved SAP? 285.615 Section 285.615 Mineral Resources MINERALS MANAGEMENT SERVICE... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.615 What other reports or notices must I submit to MMS under my approved SAP? (a) You must notify MMS in writing...

  3. 30 CFR 585.615 - What other reports or notices must I submit to BOEM under my approved SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... BOEM under my approved SAP? 585.615 Section 585.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.615 What other reports or notices must I submit to BOEM under my approved SAP? (a) You must notify BOEM in writing...

  4. 30 CFR 585.615 - What other reports or notices must I submit to BOEM under my approved SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... BOEM under my approved SAP? 585.615 Section 585.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.615 What other reports or notices must I submit to BOEM under my approved SAP? (a) You must notify BOEM in writing...

  5. 30 CFR 585.902 - What are the general requirements for decommissioning for facilities authorized under my SAP, COP...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... decommissioning for facilities authorized under my SAP, COP, or GAP? 585.902 Section 585.902 Mineral Resources..., Inspections, and Facility Assessments for Activities Conducted Under SAPs, COPs and GAPs Decommissioning... authorized under my SAP, COP, or GAP? (a) Except as otherwise authorized by BOEM under § 585.909, within...

  6. 30 CFR 285.615 - What other reports or notices must I submit to MMS under my approved SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... MMS under my approved SAP? 285.615 Section 285.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.615 What other reports or notices must I submit to MMS under my approved SAP? (a) You must...

  7. 30 CFR 585.615 - What other reports or notices must I submit to BOEM under my approved SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... BOEM under my approved SAP? 585.615 Section 585.615 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.615 What other reports or notices must I submit to BOEM under my approved SAP? (a) You must notify BOEM in writing...

  8. Inhibition of α-glucosidase activity by N-deoxynojirimycin analogs in several insect phloem sap feeders.

    PubMed

    Ya'kobovitz, Marina Katzman; Butters, Terry D; Cohen, Ephraim

    2016-02-01

    Secondary metabolites and synthetic iminosugars that structurally resemble monosaccharides are potent inhibitors of α-glucosidase activity. The enzyme is core in cleaving sucrose in phloem feeding insects and it also plays a crucial role of reducing osmotic stress via the formation of oligosaccharides. Inhibition of hydrolysis by iminosugars should result in nutritional deficiencies and/or disruption of normal osmoregulation. Deoxynojirimycin (DNJ) and 2 N-alkylated analogs [N-butyl DNJ (NB-DNJ) and N-nonyl DNJ (NN-DNJ)] were the major iminosugars used throughout the study. The extensive experiments conducted with α-glucosidase of the whitefly Bemisia tabaci indicated the competitive nature of inhibition and that the hydrophilic DNJ is a potent inhibitor in comparison to the more hydrophobic NB-DNJ and NN-DNJ compounds. The same inhibitory pattern was observed with the psyllid Cacopsylla bidens α-glucosidase. In contrast to the above pattern, enzymes of the aphids, Myzus persicae and Aphis gossypii were more sensitive to the hydrophobic iminosugars as compared to DNJ. In vivo experiments in which adult B. tabaci were fed dietary iminosugars, show that the hydrophilic DNJ was far less toxic than the lipophilic NB-DNJ and NN-DNJ. It is proposed that this pattern is attributed to the better accessibility of the hydrophobic NN-DNJ to the α-glucosidase membrane-bound compartment in the midgut. Based on the inhibitory effects of certain polyhydroxy N-alkylated iminosugars, α-glucosidase of phloem feeding hemipterans could serve as an attractive target site for developing novel pest control agents.

  9. Variability of sap flow on forest hillslopes: patterns and controls

    NASA Astrophysics Data System (ADS)

    Hassler, Sibylle; Blume, Theresa

    2013-04-01

    Sap flow in trees is an essential variable in integrated studies of hydrologic fluxes. It gives indication of transpiration rates for single trees and, with a suitable method of upscaling, for whole stands. This information is relevant for hydrologic and climate models, especially for the prediction of change in water fluxes in the soil-plant-atmosphere continuum under climate change. To this end, we do not only need knowledge concerning the response of sapflow to atmospheric forcing but also an understanding of the main controls on its spatial variability. Our study site consists of several subcatchments of the Attert basin in Luxembourg underlain by schists of the Ardennes massif. Within these subcatchments we measure sap flow in more than 20 trees on a range of forested hillslopes covered by a variety of temperate deciduous tree species such as beech, oak, hornbeam and maple as well as conifers such as firs. Our sap flow sensors are based on the heat pulse velocity method and consist of three needles, one needle acting as the heating device and the other two holding three thermistors each, enabling us to simultaneously measure sap flow velocity at three different depths within the tree. In close proximity to the trees we collect additional data on soil moisture, matric potential and groundwater levels. First results show that the sensor design seems promising for an upscaling of the measured sap flow velocities to sap flow at the tree level. The maximum depth of actively used sapwood as well as the decrease in sap flow velocity with increasing depth in the tree can be determined by way of the three thermistors. Marked differences in sap flow velocity profiles are visible between the different species, resulting in differences in sap flow for trees of similar diameter. We examine the range of tree sap flow values and variation due to species, size class, slope position and exposition and finally relate them to the dynamics of soil moisture conditions with the

  10. Euphorbia sap keratopathy: four cases and a possible pathogenic mechanism.

    PubMed Central

    Scott, I U; Karp, C L

    1996-01-01

    AIMS: To report four cases of Euphorbia sap causing anterior segment toxicity. METHODS: Medical records of four patients who presented with Euphorbia sap keratoconjunctivitis were reviewed. Clinical findings were compared with previously published reports. RESULTS: All of these patients experienced a similar clinical course. Initial contact with Euphorbia sap caused punctate epitheliopathy; patients noted immediate burning and photophobia, but no visual loss. In all cases, patients experienced epithelial slough with delayed healing, requiring approximately 9 days to heal the epithelial defect. Patients were treated with topical antibiotics, pressure patching or a bandage contact lens, and final visual acuities were excellent in all cases. A review of the literature revealed that Euphorbia sap contains a diterpenoid diester which exhibits antineoplastic activity in rodents. CONCLUSIONS: Individuals who work with Euphorbia plants should be cautioned to wear eye protection. Patients with Euphorbia sap anterior segment toxicity should be informed that their condition may worsen initially, but that visual outcome is generally excellent. The progressive corneal epithelial sloughing and delayed corneal epithelial healing may be secondary to the antineoplastic effects of Euphorbia sap. Images PMID:8942380

  11. Subcellular targeting and cytoskeletal attachment of SAP97 to the epithelial lateral membrane.

    PubMed

    Wu, H; Reuver, S M; Kuhlendahl, S; Chung, W J; Garner, C C

    1998-08-01

    The synapse-associated protein SAP97 is a member of a novel family of cortical cytoskeletal proteins involved in the localization of ion channels at such membrane specializations as synaptic junctions. These multidomain proteins have binding sites for protein 4.1, GKAPs/SAPAPs, voltage- and ligand-gated ion channels and cell-adhesion molecules containing C-terminal T/SXV motifs. In this study, we evaluated the contribution of individual domains in SAP97 to its selective recruitment and attachment to the cortical cytoskeleton in epithelial cells. We find that the PDZ, SH3 and GK domains, as well as the I3 insert in SAP97, are not essential for subcellular targeting, though both PDZ1-2 domains and the I3 insert affect the efficiency of localization. Instead, we show that the first 65 amino acid residues in SAP97, which are absent from SAP90/PSD-95 and SAP102, direct the selective subcellular localization and can mediate at least one point of attachment of SAP97 to the cytoskeleton assembled at sites of cell-cell contact. Our data demonstrate that it is the sequences unique to SAP97 that direct its subcellular targeting to the epithelial lateral membrane.

  12. Artesunate ameliorates severe acute pancreatitis (SAP) in rats by inhibiting expression of pro-inflammatory cytokines and Toll-like receptor 4.

    PubMed

    Cen, Yanyan; Liu, Chao; Li, Xiaoli; Yan, Zifei; Kuang, Mei; Su, Yujie; Pan, Xichun; Qin, Rongxin; Liu, Xin; Zheng, Jiang; Zhou, Hong

    2016-09-01

    Severe acute pancreatitis (SAP) is a severe clinical condition with significant morbidity and mortality. Multiple organs dysfunction (MOD) is the leading cause of SAP-related death. The over-release of pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α is the underlying mechanism of MOD; however, there is no effective agent against the inflammation. Herein, artesunate (AS) was found to increase the survival of SAP rats significantly when injected with 3.5% sodium taurocholate into the biliopancreatic duct in a retrograde direction, improving their pancreatic pathology and decreasing serum amylase and pancreatic lipase activities along with substantially reduced pancreatic IL-1β and IL-6 release. In vitro, AS-pretreatment strongly inhibited IL-1β and IL-6 release and their mRNA expressions in the pancreatic acinar cells treated with lipopolysaccharide (LPS) but exerted little effect on TNF-α release. Additionally, AS reduced the mRNA expressions of Toll-like receptor 4 (TLR4) and nuclear factor-κB (NF-κB) p65 as well as their protein expressions in the pancreatic acinar cells. In conclusion, our results demonstrated that AS could significantly protect SAP rats, and this protection was related to the reduction of digestive enzyme activities and pro-inflammatory cytokine expressions via inhibition of TLR4/NF-κB signaling pathway. Therefore, AS may be considered as a potential therapeutic agent against SAP.

  13. Overexpression of OsSAP16 Regulates Photosynthesis and the Expression of a Broad Range of Stress Response Genes in Rice (Oryza sativa L.)

    PubMed Central

    Wang, Fei; Coe, Robert A.; Karki, Shanta; Wanchana, Samart; Thakur, Vivek; Henry, Amelia; Lin, Hsiang-Chun; Huang, Jianliang; Peng, Shaobing; Quick, William Paul

    2016-01-01

    This study set out to identify and characterize transcription factors regulating photosynthesis in rice. Screening populations of rice T-DNA activation lines led to the identification of a T-DNA mutant with an increase in intrinsic water use efficiency (iWUE) under well-watered conditions. Flanking sequence analysis showed that the T-DNA construct was located upstream of LOC_Os07g38240 (OsSAP16) encoding for a stress-associated protein (SAP). A second mutant identified with activation in the same gene exhibited the same phenotype; expression of OsSAP16 was shown to be enhanced in both lines. There were no differences in stomatal development or morphology in either of these mutants, although overexpression of OsSAP16 reduced stomatal conductance. This phenotype limited CO2 uptake and the rate of photosynthesis, which resulted in the accumulation of less biomass in the two mutants. Whole transcriptome analysis showed that overexpression of OsSAP16 led to global changes in gene expression consistent with the function of zinc-finger transcription factors. These results show that the gene is involved in modulating the response of rice to drought stress through regulation of the expression of a set of stress-associated genes. PMID:27303811

  14. Phosphorylated SAP155, the spliceosomal component, is localized to chromatin in postnatal mouse testes

    SciTech Connect

    Eto, Ko; Sonoda, Yoshiyuki; Jin, Yuji; Abe, Shin-ichi

    2010-03-19

    SAP155 is an essential component of the spliceosome and its phosphorylation is required for splicing catalysis, but little is known concerning its expression and regulation during spermatogenesis in postnatal mouse testes. We report that SAP155 is ubiquitously expressed in nuclei of germ and Sertoli cells within the seminiferous tubules of 6- and 35-day postpartum (dpp) testes. Analyses by fractionation of testes revealed that (1) phosphorylated SAP155 was found in the fraction containing nuclear structures at 6 dpp in amounts much larger than that at other ages; (2) non-phosphorylated SAP155 was detected in the fraction containing nucleoplasm; and (3) phosphorylated SAP155 was preferentially associated with chromatin. Our findings suggest that the active spliceosome, containing phosphorylated SAP155, performs pre-mRNA splicing on chromatin concomitant with transcription during testicular development.

  15. A Novel Putrescine Exporter SapBCDF of Escherichia coli.

    PubMed

    Sugiyama, Yuta; Nakamura, Atsuo; Matsumoto, Mitsuharu; Kanbe, Ayaka; Sakanaka, Mikiyasu; Higashi, Kyohei; Igarashi, Kazuei; Katayama, Takane; Suzuki, Hideyuki; Kurihara, Shin

    2016-12-16

    Recent research has suggested that polyamines (putrescine, spermidine, and spermine) in the intestinal tract impact the health of animals either negatively or positively. The concentration of polyamines in the intestinal tract results from the balance of uptake and export of the intestinal bacteria. However, the mechanism of polyamine export from bacterial cells to the intestinal lumen is still unclear. In Escherichia coli, PotE was previously identified as a transporter responsible for putrescine excretion in an acidic growth environment. We observed putrescine concentration in the culture supernatant was increased from 0 to 50 μm during growth of E. coli under neutral conditions. Screening for the unidentified putrescine exporter was performed using a gene knock-out collection of E. coli, and deletion of sapBCDF significantly decreased putrescine levels in the culture supernatant. Complementation of the deletion mutant with the sapBCDF genes restored putrescine levels in the culture supernatant. Additionally, the ΔsapBCDF strain did not facilitate uptake of putrescine from the culture supernatant. Quantification of stable isotope-labeled putrescine derived from stable isotope-labeled arginine supplemented in the medium revealed that SapBCDF exported putrescine from E. coli cells to the culture supernatant. It was previously reported that SapABCDF of Salmonella enterica sv. typhimurium and Haemophilus influenzae conferred resistance toantimicrobial peptides; however, the E. coli ΔsapBCDF strain did not affect resistance to antimicrobial peptide LL-37. These results strongly suggest that the natural function of the SapBCDF proteins is the export of putrescine.

  16. Wireless sap flow measurement system

    NASA Astrophysics Data System (ADS)

    Kuo, C.; Davis, T. W.; Tseng, C.; Cheng, C.; Liang, X.; Yu, P.

    2010-12-01

    This study exhibits a measurement system for wireless sensor networks to measure sap flow in multiple locations simultaneously. Transpiration is a major component of the land-surface system because it is indicative of the water movement between the soil and the air. Sap flow can be used to approximate transpiration. In forests, transpiration cannot be represented by the sap flow from a single tree. Multi-location sap flow measurements are required to show the heterogeneity caused by different trees or soil conditions. Traditional multi-location measurements require manpower and capital for data collection and instrument maintenance. Fortunately, multi-location measurements can be achieved by using the new technology of wireless sensor networks. With multi-hop communication protocol, data can be forwarded to the base station via multiple sensor nodes. This communication protocol can provide reliable data collection with the least power consumption. This study encountered two major problems. The first problem was signal amplification. The Crossbow IRIS mote was selected as the sensor node that receives the temperature data of the sap flow probe (thermocouple) through a MDA300 data acquisition board. However, the wireless sensor node could not directly receive any data from the thermocouples since the least significant bit value of the MDA300, 0.6 mV, is much higher than the voltage signal generated. Thus, the signal from the thermocouple must be amplified to exceed this threshold. The second problem is power management. A specific heat differential is required for the thermal dissipation method of measuring sap flow. Thus, an adjustable DC power supply is necessary for calibrating the heater's temperature settings. A circuit was designed to combine the signal amplifier and power regulator. The regulator has been designed to also provide power to the IRIS mote to extend battery life. This design enables wireless sap flow measurements in the forest. With the

  17. Structural characterization of disease-causing mutations on SAP and the functional impact on the SLAM peptide: a molecular dynamics approach.

    PubMed

    Chandrasekaran, P; Rajasekaran, R

    2014-07-01

    X-linked lymphoproliferative (XLP) syndrome is an extremely rare inherited immunodeficiency disease characterized by severe immune dysregulation caused by mutations in signaling lymphocyte activation molecule (SLAM) associated protein (SAP) gene. The XLP syndrome was manifested due to dysfunction of SAP as a result of amino acid substitution. Hence, to understand the molecular aspects of the XLP syndrome, we structurally characterized two observed mutations, R32Q and T53I on SAP through the systematic molecular dynamics (MD) approach. Our MD analysis showed that mutant structures elucidated an atomic level variation influenced by mutations that substantially altered the residual flexibility and more importantly the hot spot residues as well in unbound and bound systems. In addition, change in residual flexibility of mutant structures showed an unusual conformational behavior associated with their molecular recognition function compared to the wild-type SAP in both systems. Besides, both mutant structures established different secondary structural profiles during the course of the simulation period in both systems. Moreover, the docking analysis revealed that mutant R32Q and T53I structures displayed remarkably reduced levels of binding affinity to the unphosphorylated SLAM peptide with respect to their docking scores. Collectively, our findings provide knowledge to understand the structural and functional relationship of disease-causing mutations, R32Q and T53I on SAP as well as gain further insights into the molecular pathogenesis of the XLP syndrome.

  18. Interactions of C-Reactive Protein and Serum Amyloid P Component with Interleukin-8 and Their Role in Regulation of Neutrophil Functions.

    PubMed

    Galkina, Elena V.; Nazarov, Peter G.; Polevschikov, Alexander V.; Berestovaya, Larissa K.; Galkin, Vitold E.; Bychkova, Natalia V.

    2000-12-01

    C-reactive protein (CRP) and serum amyloid P component (SAP) are acute phase proteins, whose concentrations increase within 24 h of inflammation along with concentration of IL-8. Polymorphonuclear neutrophil leukocytes (PMNs) form the earliest barrier protecting an injured organ during acute phase response. The aim of present work was to study interactions between CRP, SAP and IL-8, and to estimate the role of these interactions in regulation of neutrophil transendothelial migration. The results have shown that IL-8 binds to immobilized but not to free CRP. Binding of IL-8 to immobilized SAP was less strong. SAP like IL-8 increased CD11/CD18 integrin expression. IL-8 did not abolish the effect of SAP, and the mixture of IL-8 and SAP has stimulated CD11/CD18 expression. CRP upregulated CD18 but not CD11b expression. Under simultaneous action of CRP and IL-8, the stimulatory effect on CD11b and CD18 was abolished. The expression of fibronectin receptor was reduced by either IL-8 or CRP but increased by SAP. Effect of each protein was downregulated after following preincubations: CRP+SAP, CRP+IL-8 or SAP+IL-8. The mixtures of CRP with SAP, CRP with IL-8 or SAP with IL-8 showed no chemotactic activity, although each of the proteins was chemoattractive. Thus, acute phase proteins and IL-8 can act as anti-inflammatory factors upon binding each other. In summary, CRP and SAP influence PMN adhesion, migration and expression of CD11b/CD18 and fibronectin receptors, and can modulate the action of IL-8 on PMN attachment to endothelium and fibronectin, and on PMN traffic through the extracellular matrix during transendothelial migration.

  19. [Application of thermal dissipation probe in the study of Bambusa chungii sap flow].

    PubMed

    Zhao, Ping; Mei, Ting-Ting; Ni, Guang-Yan; Yu, Meng-Hao; Zeng, Xiao-Ping

    2012-04-01

    Based on the validation of Granier's empirical formula for calculating tree stem sap flux density, a comparative study was conducted on the measurement of Bambusa chungi sap flow by using different lengths of thermal dissipation probe (TDP), aimed to approach the applicability of TDP in measuring the sap flow of B. chungii. The difference in the daily change of the sap flow between B. chungii and nearby growing Schima superb was also analyzed. Because of the thinner bamboo wall and the heterogeneous anatomy, the sap flux density of B. chungii measured by 10 mm long probe could be underestimated, but that measured by 8 and 5 mm long probes could be relatively accurate. The comparison of the sap flow between B. chungii and nearby growing S. superba revealed that both the mean sap flux density and its daily change pattern' s skewness of B. chungii were higher than those of S. superba, but the nighttime sap flow of B. chungii was less than that of S. superba, indicating that the water recharge of B. chungii during nighttime was less active than that of S. superba. It was suggested that using TDP to investigate the sap flow of bamboo would be feasible, but careful calibration would be required before the TDP was put into application on different bamboo species.

  20. Tree Hydraulics: How Sap Rises

    ERIC Educational Resources Information Center

    Denny, Mark

    2012-01-01

    Trees transport water from roots to crown--a height that can exceed 100 m. The physics of tree hydraulics can be conveyed with simple fluid dynamics based upon the Hagen-Poiseuille equation and Murray's law. Here the conduit structure is modelled as conical pipes and as branching pipes. The force required to lift sap is generated mostly by…

  1. MusaSAP1, a A20/AN1 zinc finger gene from banana functions as a positive regulator in different stress responses.

    PubMed

    Sreedharan, Shareena; Shekhawat, Upendra K Singh; Ganapathi, Thumballi R

    2012-11-01

    A20/AN1 zinc finger domain containing Stress Associated Proteins (SAP) are involved in diverse stress response pathways in plants. In the present study, a novel banana SAP gene, MusaSAP1, was identified from banana EST database and was subsequently characterized by overexpression in transgenic banana plants. Expression profiling in native banana plants showed that MusaSAP1 was up-regulated by drought, salt, cold, heat and oxidative stress as well as by treatment with abscisic acid. Cellular localization assay carried out by making a MusaSAP1::GFP fusion protein indicated that MusaSAP1 is incompletely translocated to nucleus. Copy number analysis performed using real time PCR and Southern blotting indicated that MusaSAP1 occurs in the banana genome in a single copy per 11 chromosome set. Transgenic banana plants constitutively overexpressing MusaSAP1 displayed better stress endurance characteristics as compared to controls in both in vitro and ex vivo assays. Lesser membrane damage as indicated by reduced malondialdehyde levels in transgenic leaves subjected to drought, salt or oxidative stress pointed towards significant role for MusaSAP1 in stress amelioration pathways of banana. Strong up-regulation of a polyphenol oxidase (PPO) coding transcript in MusaSAP1 overexpressing plants together with induction of MusaSAP1 by wounding and methyl jasmonate treatment indicated possible involvement of MusaSAP1 in biotic stress responses where PPOs perform major functions in multiple defense pathways.

  2. SAP: structure, function, and its roles in immune-related diseases.

    PubMed

    Xi, Dan; Luo, TianTian; Xiong, Haowei; Liu, Jichen; Lu, Hao; Li, Menghao; Hou, Yuqing; Guo, Zhigang

    2015-01-01

    Serum amyloid P component (SAP), also known as pentraxin-2, is a member of the pentraxin protein family with an established relationship to the immune response. In the last century, SAP has been used as a diagnostic marker in amyloidosis diagnosis and patient follow-up. SAP has been thought to have potential for treating and curing amyloidosis and fibrosis diseases. More recently, it has been shown that SAP may serve as both a diagnostic marker and a therapeutic target for many immune-related diseases, such as cardiovascular, pulmonary, nephritic, neurological and autoimmune diseases. In the cardiovascular system, SAP has been defined as the culprit in amyloidosis in the heart. SAP may also exert a protective role during the early stage of atherosclerosis and myocardial fibrosis. In noncardiovascular system diseases, SAP is being developed for the treatment of pulmonary fibrosis. In this review, we summarize SAP history, structure, and its roles in immune-related diseases in different systems with emphasis on the cardiovascular system.

  3. Isolation and characterization of LcSAP, a Leymus chinensis gene which enhances the salinity tolerance of Saccharomyces cerevisiae.

    PubMed

    Liu, Jingying; Yang, Xiangna; Yang, Xizhe; Xu, Mingyue; Liu, Jie; Xue, Mengmeng; Ma, Pengda

    2017-02-01

    A number of members of the SAP ("stress-associated protein") gene family have been implicated in the plant stress response. Here, a SAP gene has been isolated using PCR RACE from the perennial grass Leymus chinensis, a species which has reputation for ecological adaptability. The 17.6 kDa LcSAP product comprised 161 residues, including both an A20 domain and an AN1 domain, a feature of type I SAPs. Using a semi-quantitative RT-PCR assay to profile its transcription, it was shown that LcSAP was more strongly transcribed in the leaf than in the root under control conditions. The level of LcSAP transcription began to rise 6 h after the plant's exposure to 400 mM NaCl, and the abundance of transcript remained stable for at least 24 h. Exposing the plant to 100 mM Na2CO3 also induced LcSAP transcription, but the abundance of SAP transcript faded after 6 h. When LcSAP was introduced into yeast cells, the transgenic cells grew better than wild type ones when the medium contained 1.4 M NaCl. The ability of LcSAP to respond to salinity stress in yeast suggests that it also makes a contribution to the stress tolerance shown by L. chinensis.

  4. Detoxification of Sap from Felled Oil Palm Trunks for the Efficient Production of Lactic Acid.

    PubMed

    Kunasundari, Balakrishnan; Arai, Takamitsu; Sudesh, Kumar; Hashim, Rokiah; Sulaiman, Othman; Stalin, Natra Joseph; Kosugi, Akihiko

    2017-03-30

    The availability of fermentable sugars in high concentrations in the sap of felled oil palm trunks and the thermophilic nature of the recently isolated Bacillus coagulans strain 191 were exploited for lactic acid production under non-sterile conditions. Screening indicated that strain 191 was active toward most sugars including sucrose, which is a major component of sap. Strain 191 catalyzed a moderate conversion of sap sugars to lactic acid (53%) with a productivity of 1.56 g/L/h. Pretreatment of oil palm sap (OPS) using alkaline precipitation improved the sugar fermentability, providing a lactic acid yield of 92% and productivity of 2.64 g/L/h. To better characterize potential inhibitors in the sap, phenolic, organic, and mineral compounds were analyzed using non-treated sap and saps treated with activated charcoal and alkaline precipitation. Phthalic acid, 3,4-dimethoxybenzoic acid, aconitic acid, syringic acid, and ferulic acid were reduced in the sap after treatment. High concentrations of Mg, P, K, and Ca were also precipitated by the alkaline treatment. These results suggest that elimination of excess phenolic and mineral compounds in OPS can improve the fermentation yield. OPS, a non-food resource that is readily available in bulk quantities from plantation sites, is a promising source for lactic acid production.

  5. THE CELL SAP OF HYDRODICTYON

    PubMed Central

    Blinks, L. R.; Nielsen, John P.

    1940-01-01

    Analysis of the cell sap of Hydrodictyon patenaeforme Pocock, from California indicates the usual marked accumulation of potassium, which is 4000 times as concentrated as in the surrounding pond water. Small amounts of sodium and calcium were found. Chloride makes up about three-fourths of the anions, with a very high sulfate, and much lower bicarbonate concentration accounting for most of the remainder. Electrical conductivity and osmotic studies indicate that the analyzed elements are ionized, and account for most of the sap's osmotic pressure. pH is 5.5 to 6.0. The analytical procedure was designed to determine as many of the cations as possible on one small sample. Hydrodictyon is a large multinucleate cell belonging to an order (Chlorococcales) new to permeability and accumulation studies. PMID:19873174

  6. SAP-Dependent and -Independent Regulation of Innate T Cell Development Involving SLAMF Receptors.

    PubMed

    De Calisto, Jaime; Wang, Ninghai; Wang, Guoxing; Yigit, Burcu; Engel, Pablo; Terhorst, Cox

    2014-01-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) plays an essential role in the immune system mediating the function of several members of the SLAM family (SLAMF) of receptors, whose expression is essential for T, NK, and B-cell responses. Additionally, the expression of SAP in double-positive thymocytes is mandatory for natural killer T (NKT) cells and, in mouse, for innate CD8(+) T cell development. To date, only two members of the SLAMF of receptors, Slamf1 and Slamf6, have been shown to positively cooperate during NKT cell differentiation in mouse. However, it is less clear whether other members of this family may also participate in the development of these innate T cells. Here, we show that Slamf[1 + 6](-/-) and Slamf[1 + 5 + 6](-/-) B6 mice have ~70% reduction of NKT cells compared to wild-type B6 mice. Unexpectedly, the proportion of innate CD8(+) T cells slightly increased in the Slamf[1 + 5 + 6](-/-) , but not in the Slamf[1 + 6](-/-) strain, suggesting that Slamf5 may function as a negative regulator of innate CD8(+) T cell development. Accordingly, Slamf5(-/-) B6 mice showed an exclusive expansion of innate CD8(+) T cells, but not NKT cells. Interestingly, the SAP-independent Slamf7(-/-) strain showed an expansion of both splenic innate CD8(+) T cells and thymic NKT cells. On the other hand, and similar to what was recently shown in Slamf3(-/-) BALB/c mice, the proportions of thymic promyelocytic leukemia zinc finger (PLZF(hi)) NKT cells and innate CD8(+) T cells significantly increased in the SAP-independent Slamf8(-/-) BALB/c strain. In summary, these results show that NKT and innate CD8(+) T cell development can be regulated in a SAP-dependent and -independent fashion by SLAMF receptors, in which Slamf1, Slamf6, and Slamf8 affect development of NKT cells, and that Slamf5, Slamf7, and Slamf8 affect the development of innate CD8(+) T cells.

  7. Nitrogen transport in the xylem sap of Quercus ilex: the role of ornithine.

    PubMed

    Nabais, Cristina; Hagemeyer, Jürgen; Freitas, Helena

    2005-05-01

    The storage and remobilization of nitrogen in deciduous and evergreen species is a major source of N, supporting the seasonal growth of trees. In evergreens, in addition to wood and roots, older leaves are important reservoirs of N used in the growth of new foliage. Just before bud burst, when transpiration is inactive or low, and when uptake of nitrogen by the roots may be restricted due to low temperatures, levels of organic N in the xylem are high. Amino acids usually comprise the bulk of this organic N. Changes in amino acid concentrations in early spring are thought to result mainly from hydrolysis of N reserves, and not from current N uptake. The seasonal profiles of amino acids in the xylem sap of Quercus ilex, an evergreen Mediterranean tree, were investigated. The first amino acid detected in the xylem sap before spring was ornithine, which may result from the breakdown of arginine present in storage proteins. Arginine is one of the main amino acids present in storage proteins because each arginine molecule has four nitrogen atoms. When protein degradation increases the free arginine pool, the arginase activity is enhanced and, consequently, the conversion of arginine to ornithine. It seems that ornithine has an important role in N transport early in the growth season of Q. ilex.

  8. Degradation of Activated Protein Kinases by Ubiquitination

    PubMed Central

    Lu, Zhimin; Hunter, Tony

    2009-01-01

    Protein kinases are important regulators of intracellular signal transduction pathways and play critical roles in diverse cellular functions. Once a protein kinase is activated, its activity is subsequently downregulated through a variety of mechanisms. Accumulating evidence indicates that the activation of protein kinases commonly initiates their downregulation via the ubiquitin/proteasome pathway. Failure to regulate protein kinase activity or expression levels can cause human diseases. PMID:19489726

  9. Altered thalamocortical development in the SAP102 knockout model of intellectual disability

    PubMed Central

    Crocker-Buque, Alex; Currie, Stephen P.; Luz, Liliana L.; Grant, Seth G.; Duffy, Kevin R.; Kind, Peter C.; Daw, Michael I.

    2016-01-01

    Genetic mutations known to cause intellectual disabilities (IDs) are concentrated in specific sets of genes including both those encoding synaptic proteins and those expressed during early development. We have characterized the effect of genetic deletion of Dlg3, an ID-related gene encoding the synaptic NMDA-receptor interacting protein synapse-associated protein 102 (SAP102), on development of the mouse somatosensory cortex. SAP102 is the main representative of the PSD-95 family of postsynaptic MAGUK proteins during early development and is proposed to play a role in stabilizing receptors at immature synapses. Genetic deletion of SAP102 caused a reduction in the total number of thalamocortical (TC) axons innervating the somatosensory cortex, but did not affect the segregation of barrels. On a synaptic level SAP102 knockout mice display a transient speeding of NMDA receptor kinetics during the critical period for TC plasticity, despite no reduction in GluN2B-mediated component of synaptic transmission. These data indicated an interesting dissociation between receptor kinetics and NMDA subunit expression. Following the critical period NMDA receptor function was unaffected by loss of SAP102 but there was a reduction in the divergence of TC connectivity. These data suggest that changes in synaptic function early in development caused by mutations in SAP102 result in changes in network connectivity later in life. PMID:27466188

  10. Isolation and characterization of SAP and CRP, two pentraxins from Pangasianodon (Pangasius) hypophthalmus.

    PubMed

    Huong Giang, Duong Thi; Van Driessche, Edilbert; Vandenberghe, Isabel; Devreese, Bart; Beeckmans, Sonia

    2010-01-01

    From the serum of Pangasianodon hypophthalmus, two proteins were isolated by affinity chromatography on Sepharose and phosphorylcholine-Sepharose. Their binding on the affinity matrices critically depends on the presence of Ca2+ ions. N-terminal sequencing and sequencing of internal tryptic peptides identified the proteins as pentraxins and from their binding properties they are identified as SAP (serum amyloid P component) and CRP (C-reactive protein). Per ml serum, 36 microg SAP and 56 microg CRP was purified. Upon gel filtration, both the SAP and CRP elute as trimers of respectively 24 kDa and 28 kDa subunits. Both proteins are devoid of inter-chain disulfide bonds. Both SAP and CRP are glycosylated and agglutinate rabbit erythrocytes and pathogenic bacteria Edwardsiella ictaluri and Aeromonas hydrophila, but not Micrococcus lysodeikticus or Escherichia coli. Haemagglutination of SAP and CRP is inhibited by galactose (MIC = 1 mM) and by phosphorylcholine (MIC = 1-2 mM), respectively. Circular dichroism studies revealed that antiparallel beta-pleated sheets are dominating the secondary structure. Upon removing the Ca(2+) ions by EDTA, slight structural changes are observed by CD spectroscopy in the near-UV region. Immunodiffusion shows that P. hypophthalmus SAP and CRP do not cross-react.

  11. Tree hydraulics: how sap rises

    NASA Astrophysics Data System (ADS)

    Denny, Mark

    2012-01-01

    Trees transport water from roots to crown—a height that can exceed 100 m. The physics of tree hydraulics can be conveyed with simple fluid dynamics based upon the Hagen-Poiseuille equation and Murray's law. Here the conduit structure is modelled as conical pipes and as branching pipes. The force required to lift sap is generated mostly by transpiration or capillary action; we investigate the effectiveness of both these forces for the two conduit architectures considered. The level of analysis is appropriate for undergraduates. The subject is of broad interest because it provides a naturally-occurring example of an unusual metastable state of matter: liquid under tension.

  12. Changes in the Proteome of Xylem Sap in Brassica oleracea in Response to Fusarium oxysporum Stress.

    PubMed

    Pu, Zijing; Ino, Yoko; Kimura, Yayoi; Tago, Asumi; Shimizu, Motoki; Natsume, Satoshi; Sano, Yoshitaka; Fujimoto, Ryo; Kaneko, Kentaro; Shea, Daniel J; Fukai, Eigo; Fuji, Shin-Ichi; Hirano, Hisashi; Okazaki, Keiichi

    2016-01-01

    Fusarium oxysporum f.sp. conlutinans (Foc) is a serious root-invading and xylem-colonizing fungus that causes yellowing in Brassica oleracea. To comprehensively understand the interaction between F. oxysporum and B. oleracea, composition of the xylem sap proteome of the non-infected and Foc-infected plants was investigated in both resistant and susceptible cultivars using liquid chromatography-tandem mass spectrometry (LC-MS/MS) after in-solution digestion of xylem sap proteins. Whole genome sequencing of Foc was carried out and generated a predicted Foc protein database. The predicted Foc protein database was then combined with the public B. oleracea and B. rapa protein databases downloaded from Uniprot and used for protein identification. About 200 plant proteins were identified in the xylem sap of susceptible and resistant plants. Comparison between the non-infected and Foc-infected samples revealed that Foc infection causes changes to the protein composition in B. oleracea xylem sap where repressed proteins accounted for a greater proportion than those of induced in both the susceptible and resistant reactions. The analysis on the proteins with concentration change > = 2-fold indicated a large portion of up- and down-regulated proteins were those acting on carbohydrates. Proteins with leucine-rich repeats and legume lectin domains were mainly induced in both resistant and susceptible system, so was the case of thaumatins. Twenty-five Foc proteins were identified in the infected xylem sap and 10 of them were cysteine-containing secreted small proteins that are good candidates for virulence and/or avirulence effectors. The findings of differential response of protein contents in the xylem sap between the non-infected and Foc-infected samples as well as the Foc candidate effectors secreted in xylem provide valuable insights into B. oleracea-Foc interactions.

  13. Activation of DNA-PK by Ionizing Radiation Is Mediated by Protein Phosphatase 6

    PubMed Central

    Mi, Jun; Dziegielewski, Jaroslaw; Bolesta, Elzbieta; Brautigan, David L.; Larner, James M.

    2009-01-01

    DNA-dependent protein kinase (DNA-PK) plays a critical role in DNA damage repair, especially in non-homologous end-joining repair of double-strand breaks such as those formed by ionizing radiation (IR) in the course of radiation therapy. Regulation of DNA-PK involves multisite phosphorylation but this is incompletely understood and little is known about protein phosphatases relative to DNA-PK. Mass spectrometry analysis revealed that DNA-PK interacts with the protein phosphatase-6 (PP6) SAPS subunit PP6R1. PP6 is a heterotrimeric enzyme that consists of a catalytic subunit, plus one of three PP6 SAPS regulatory subunits and one of three ankyrin repeat subunits. Endogenous PP6R1 co-immunoprecipitated DNA-PK, and IR enhanced the amount of complex and promoted its import into the nucleus. In addition, siRNA knockdown of either PP6R1 or PP6 significantly decreased IR activation of DNA-PK, suggesting that PP6 activates DNA-PK by association and dephosphorylation. Knockdown of other phosphatases PP5 or PP1γ1 and subunits PP6R3 or ARS-A did not reduce IR activation of DNA-PK, demonstrating specificity for PP6R1. Finally, siRNA knockdown of PP6R1 or PP6 but not other phosphatases increased the sensitivity of glioblastoma cells to radiation-induced cell death to a level similar to DNA-PK deficient cells. Our data demonstrate that PP6 associates with and activates DNA-PK in response to ionizing radiation. Therefore, the PP6/PP6R1 phosphatase is a potential molecular target for radiation sensitization by chemical inhibition. PMID:19198648

  14. Prosaposin Deficiency and Saposin B Deficiency (Activator-Deficient Metachromatic Leukodystrophy): Report on Two Patients Detected by Analysis of Urinary Sphingolipids and Carrying Novel PSAP Gene Mutations

    PubMed Central

    Kuchař, Ladislav; Ledvinová, Jana; Hřebíček, Martin; Myšková, Helena; Dvořáková, Lenka; Berná, Linda; Chrastina, Petr; Asfaw, Befekadu; Elleder, Milan; Petermöller, Margret; Mayrhofer, Heidi; Staudt, Martin; Krägeloh-Mann, Ingeborg; Paton, Barbara C; Harzer, Klaus

    2009-01-01

    Prosaposin deficiency (pSap-d) and saposin B deficiency (SapB-d) are both lipid storage disorders caused by mutations in the PSAP gene that codes for the 65–70 kDa prosaposin protein, which is the precursor for four sphingolipid activator proteins, saposins A–D. We report on two new patients with PSAP gene defects; one, with pSap-d, who had a severe neurovisceral dystrophy and died as a neonate, and the other with SapB-d, who presented with a metachromatic leukodystrophy-like disorder but had normal arylsulfatase activity. Screening for urinary sphingolipids was crucial to the diagnosis of both patients, with electrospray ionization tandem mass spectrometry also providing quantification. The pSap-d patient is the first case with this condition where urinary sphingolipids have been investigated. Multiple sphingolipids were elevated, with globotriaosylceramide showing the greatest increase. Both patients had novel mutations in the PSAP gene. The pSap-d patient was homozygous for a splice-acceptor site mutation two bases upstream of exon 10. This mutation led to a premature stop codon and yielded low levels of transcript. The SapB-d patient was a compound heterozygote with a splice-acceptor site variant exclusively affecting the SapB domain on one allele, and a 2 bp deletion leading to a null, that is, pSap-d mutation, on the other allele. Phenotypically, pSap-d is a relatively uniform disease of the neonate, whereas SapB-d is heterogeneous with a spectrum similar to that in metachromatic leukodystrophy. The possible existence of genotypes and phenotypes intermediate between those of pSap-d and the single saposin deficiencies is speculated. © 2009 Wiley-Liss, Inc. PMID:19267410

  15. Response of Sap-Flow Measurements on Environmental Forcings

    NASA Astrophysics Data System (ADS)

    Howe, J. A.; Dragoni, D.; Schmid, H.

    2005-05-01

    The exchange of water between the atmosphere and biosphere is an important determinant of climate and the productivity of vegetation. Both evaporation and transpiration involve substantial amounts of energy exchange at the interface of the biosphere and atmosphere. Knowing how transpiration changes throughout the seasonal and diurnal cycles can help increase the understanding of how a forest reacts to changes in the biosphere and atmosphere. A common way to estimate transpiration is by measuring the sap flowing through the living tissues of trees. A study was conducted at Morgan-Monroe State Forest, a mixed deciduous forest in south central Indiana (USA), to investigate how sap flow in trees responds to changes in meteorological and environmental conditions. The heat -dissipation technique was used to estimate sap velocities from two Big Tooth Aspen (Populus grandidentata) and two Tulip Poplars (Liriodendron tulipifera). Sap velocity patterns (normalized by a reference potential evapo-transpiration) were directly compared with meteorological and ecological measurements, such as vapor pressure deficits, photosynthetic active radiation (PAR), rain fall, and soil moisture content. In this study, we also investigated the uncertainties and problems that arise in using the heat dissipation technique to extrapolate the single-tree measurements to the forest scale.

  16. N-SAP and G-SAP neutron and gamma ray albedo model scatter shield analysis program

    NASA Technical Reports Server (NTRS)

    Sapovchak, B. J.; Stephenson, L. D.

    1967-01-01

    Computer program calculates neutron or gamma ray first order scattering from a plane or cylindrical surface to a detector point. The SAP Codes, G-SAP and N-SAP, constitute a multiple scatter albedo model shield analysis.

  17. Effects of Acer okamotoanum sap on the function of polymorphonuclear neutrophilic leukocytes in vitro and in vivo.

    PubMed

    An, Beum-Soo; Kang, Ji-Houn; Yang, Hyun; Yang, Mhan-Pyo; Jeung, Eui-Bae

    2013-02-01

    Sap is a plant fluid that primarily consists of water and small amounts of mineral elements, sugars, hormones and other nutrients. Acer mono (A. mono) is an endemic Korean mono maple which was recently suggested to have health benefits due to its abundant calcium and magnesium ion content. In the present study, we examined the effects of sap from Acer okamotoanum (A. okamotoanum) on the phagocytic response of mouse neutrophils in vivo and rat and canine neutrophils in vitro. We tested the regulation of phagocytic activity, oxidative burst activity (OBA) and the levels of filamentous polymeric actin (F-actin) in the absence and presence of dexamethasone (DEX) in vitro and in vivo. Our results showed that DEX primarily reduced OBA in the mouse neutrophils, and that this was reversed in the presence of the sap. By contrast, the phagocytic activity of the mouse cells was not regulated by either DEX or the sap. Rat and canine polymorphonuclear neutrophilic leukocytes (PMNs) responded in vitro to the sap in a similar manner by increasing OBA. However, regulation of phagocytic activity by the sap was different between the species. In canine PMNs, phagocytic activity was enhanced by the sap at a high dose, while it did not significantly modulate this activity in rat PMNs. These findings suggest that the sap of A. okamotoanum stimulates neutrophil activity in the mouse, rat and canine by increasing OBA in vivo and in vitro, and thus may have a potential antimicrobial effect in the PMNs of patients with infections.

  18. Phosphatidylserine-selective targeting and anticancer effects of SapC-DOPS nanovesicles on brain tumors.

    PubMed

    Blanco, Víctor M; Chu, Zhengtao; Vallabhapurapu, Subrahmanya D; Sulaiman, Mahaboob K; Kendler, Ady; Rixe, Olivier; Warnick, Ronald E; Franco, Robert S; Qi, Xiaoyang

    2014-08-30

    Brain tumors, either primary (e.g., glioblastoma multiforme) or secondary (metastatic), remain among the most intractable and fatal of all cancers. We have shown that nanovesicles consisting of Saposin C (SapC) and dioleylphosphatidylserine (DOPS) are able to effectively target and kill cancer cells both in vitro and in vivo. These actions are a consequence of the affinity of SapC-DOPS for phosphatidylserine, an acidic phospholipid abundantly present in the outer membrane of a variety of tumor cells and tumor-associated vasculature. In this study, we first characterize SapC-DOPS bioavailability and antitumor effects on human glioblastoma xenografts, and confirm SapC-DOPS specificity towards phosphatidylserine by showing that glioblastoma targeting is abrogated after in vivo exposure to lactadherin, which binds phosphatidylserine with high affinity. Second, we demonstrate that SapC-DOPS selectively targets brain metastases-forming cancer cells both in vitro, in co-cultures with human astrocytes, and in vivo, in mouse models of brain metastases derived from human breast or lung cancer cells. Third, we demonstrate that SapC-DOPS have cytotoxic activity against metastatic breast cancer cells in vitro, and prolong the survival of mice harboring brain metastases. Taken together, these results support the potential of SapC-DOPS for the diagnosis and therapy of primary and metastatic brain tumors.

  19. [Dynamics of sap flow density in stems of typical desert shrub Calligonum mongolicum and its responses to environmental variables].

    PubMed

    Xu, Shi-qin; Ji, Xi-bin; Jin, Bo-wen

    2016-02-01

    Independent measurements of stem sap flow in stems of Calligonum mongolicum and environmental variables using commercial sap flow gauges and a micrometeorological monitoring system, respectively, were made to simulate the variation of sap flow density in the middle range of Hexi Corridor, Northwest China during June to September, 2014. The results showed that the diurnal process of sap flow density in C. mongolicum showed a broad unimodal change, and the maximum sap flow density reached about 30 minutes after the maximum of photosynthetically active radiation (PAR) , while about 120 minutes before the maximum of temperature and vapor pressure deficit (VPD). During the studying period, sap flow density closely related with atmosphere evapor-transpiration demand, and mainly affected by PAR, temperature and VPD. The model was developed which directly linked the sap flow density with climatic variables, and good correlation between measured and simulated sap flow density was observed in different climate conditions. The accuracy of simulation was significantly improved if the time-lag effect was taken into consideration, while this model underestimated low and nighttime sap flow densities, which was probably caused by plant physiological characteristics.

  20. Structural and functional characterization of synapse-associated protein-97

    NASA Astrophysics Data System (ADS)

    Wang, Lei

    Synapse-associated protein-97 (SAP97) as a scaffold protein plays an important role in regulating neural signal transmission in the central nervous system by coupling with activated membrane receptors, ion channels, and downstream signaling proteins. SAP97 consists of six functional domains: L27, PDZ1, PDZ2, PDZ3, SH3, and GK. Each of these domains mediates the interactions of SAP97 with other proteins. Understanding the molecular mechanism of these interactions in neural signal transmission is a goal of this study. Here high-resolution nuclear magnetic resonance spectroscopy and fluorescence anisotropy are employed towards the goal of the structural and functional characterization of SAP97; specifically, we (a) characterize the binding of the PDZ domains of SAP97 with the C-terminus of NR2B, and determine the structure of the PDZ1-NR2B; (b) characterize the binding of the PDZ domains with the C-terminus of stargazin and multiple mutants, and identify the perturbed amino acids in PDZ2 upon the binding of stargazin; (c) characterize the binding specificity carried by the beta2/beta3 loop of the PDZ3 domain. These results provide insight into the molecular mechanism for the binding specificities of the PDZ domains of SAP97, thereby furthering the development of drugs that target these domains to treat neurological diseases.

  1. A simple, novel and high efficiency sap inoculation method to screen for tobacco streak virus.

    PubMed

    Sundaresha, S; Sreevathsa, Rohini; Balol, Gurupada B; Keshavareddy, G; Rangaswamy, K T; Udayakumar, M

    2012-10-01

    A rapid and efficient sap inoculation method for tobacco streak virus (TSV) was developed in sunflower. Sap from TSV-infected sunflower plants was freshly extracted in phosphate buffer and diluted serially from 10(-1) to 10(-8). Two-day old seedlings of sunflower were injured at the meristem and immersed in the sap for 10 min, maintained at 20 °C for 2-3 days and shifted to greenhouse. The surviving seedlings in the respective sap dilution were scored for symptoms of sunflower necrosis disease (SND). SND symptoms were seen in 80 % of the seedlings inoculated with a sap dilution of 10(-5). ELISA and RT-PCR analysis of coat protein and movement protein of TSV confirmed SND symptoms. The methodology was also found to be reproducible when the sap from the infected plants was inoculated onto healthy plants. The main aim of the study was to develop a primary screening strategy for the selection of transgenics developed for SND resistance. This methodology can also be extended for the analysis of resistance against other viruses.

  2. [Protein nutrition and physical activity].

    PubMed

    Navarro, M P

    1992-09-01

    The relationship between physical exercise and diet in order to optimize performance is getting growing interest. This review examines protein needs and protein intakes as well as the role of protein in the body and the metabolic changes occurring at the synthesis and catabolic levels during exercise. Protein synthesis in muscle or liver, amino acids oxidation, glucose production via gluconeogenesis from amino acids, etc., are modified, and consequently plasma and urinary nitrogen metabolites are affected. A brief comment on the advantages, disadvantages and forms of different protein supplements for sportsmen is given.

  3. Indiscriminate Fisheries: Understanding the Foodweb of the Great Tonle Sap Lake, Cambodia

    NASA Astrophysics Data System (ADS)

    Hannah, L.; Kaufman, L.

    2014-12-01

    Indiscriminate fisheries target multiple species with multiple gear types. In contrast to well-studied, industrialized single-species, single-gear fisheries, little theory and little but growing literature on practice exists for indiscriminate fisheries. Indiscriminate fisheries are disproportionately important in low-income countries, providing most of the animal protein intake in countries such as Cambodia and Bangladesh. Indiscriminate fisheries may be either freshwater or marine, but here we focus on what may be the largest freshwater indiscriminate fishery in the world. Cambodia's freshwater fishery stands out because it provides the majority of animal protein to over 3 million people living in poverty. The fishery of the Tonle Sap lake is one of the largest, if not the largest contributor to this freshwater fish take, and is perhaps the largest freshwater fishery in the world. In contrast to its importance, very little is known about the foodweb ecology of this system, or how community management which now governs the entire fishery, interacts with biological and physical factors such as climate change.The foodweb of the Tonle Sap has changed dramatically due to high fishing pressure. A system that once harbored giant catfish, barbs and stingrays is now dominated by fish under 20cm in length. The simplification of the system may not have reduced its productivity. Theory of indiscriminate fisheries suggests that r-selected species may be favored and that biomass available for harvest may be maximized, while being more sensitive to environmental fluctuations such as climate change due to food web simplification. The r-selection and size predictions of theory have been confirmed by observations of the Tonle Sap. Early model results suggest sensitivity to environmental stochasticity. The interaction of these ecological changes with social systems will be tested in the Tonle Sap. Fisheries management across the lake has been transferred to community management

  4. SAP97 Controls the Trafficking and Resensitization of the Beta-1-Adrenergic Receptor through Its PDZ2 and I3 Domains

    PubMed Central

    Nooh, Mohammed M.; Naren, Anjaparavanda P.; Kim, Sung-Jin; Xiang, Yang K.; Bahouth, Suleiman W.

    2013-01-01

    Previous studies have determined that the type-1 PDZ sequence at the extreme carboxy-terminus of the ß1-adrenergic receptor (ß1-AR) binds SAP97 and AKAP79 to organize a scaffold involved in trafficking of the ß1-AR. In this study we focused on characterizing the domains in SAP97 that were involved in recycling and resensitization of the ß1-AR in HEK-293 cells. Using a SAP97 knockdown and rescue strategy, we determined that PDZ-deletion mutants of SAP97 containing PDZ2 rescued the recycling and resensitization of the ß1-AR. Among the three PDZs of SAP97, PDZ2 displayed the highest affinity in binding to the ß1-AR. Expression of isolated PDZ2, but not the other PDZs, inhibited the recycling of the ß1-AR by destabilizing the macromolecular complex involved in trafficking and functional resensitization of the ß1-AR. In addition to its PDZs, SAP97 contains other protein interacting domains, such as the I3 sequence in the SRC homology-3 (SH3) domain, which binds to AKAP79. Deletion of I3 from SAP97 (ΔI3-SAP97) did not affect the binding of SAP97 to the ß1-AR. However, ΔI3-SAP97 could not rescue the recycling of the ß1-AR because it failed to incorporate AKAP79/PKA into the SAP97-ß1-AR complex. Therefore, bipartite binding of SAP97 to the ß1-AR and to AKAP79 is necessary for SAP97-mediated effects on recycling, externalization and functional resensitization of the ß1-AR. These data establish a prominent role for PDZ2 and I3 domains of SAP97 in organizing the ß1-adrenergic receptosome involved in connecting the ß1-AR to trafficking and signaling networks. PMID:23696820

  5. Protein-water dynamics in antifreeze protein III activity

    NASA Astrophysics Data System (ADS)

    Xu, Yao; Bäumer, Alexander; Meister, Konrad; Bischak, Connor G.; DeVries, Arthur L.; Leitner, David M.; Havenith, Martina

    2016-03-01

    We combine Terahertz absorption spectroscopy (THz) and molecular dynamics (MD) simulations to investigate the underlying molecular mechanism for the antifreeze activity of one class of antifreeze protein, antifreeze protein type III (AFP-III) with a focus on the collective water hydrogen bond dynamics near the protein. After summarizing our previous work on AFPs, we present a new investigation of the effects of cosolutes on protein antifreeze activity by adding sodium citrate to the protein solution of AFP-III. Our results reveal that for AFP-III, unlike some other AFPs, the addition of the osmolyte sodium citrate does not affect the hydrogen bond dynamics at the protein surface significantly, as indicated by concentration dependent THz measurements. The present data, in combination with our previous THz measurements and molecular simulations, confirm that while long-range solvent perturbation is a necessary condition for the antifreeze activity of AFP-III, the local binding affinity determines the size of the hysteresis.

  6. Mekong Floods Fill Tonle Sap

    NASA Technical Reports Server (NTRS)

    2002-01-01

    The monsoon season in Southeast Asia brings recurring, often devastating floods to countries in the region, but these floods also play a necessary role in the region's water cycle. These MODIS images centered on Cambodia reveal extensive flooding of the Mekong River, which comes in from Laos in the north, to the right of center in the images, and flows south through Cambodia and southeast through Vietnam to empty into the South China Sea. The true-color image shows the brownish, sediment-laden floodwaters filling the Mekong Delta in southern Cambodia and Vietnam on September 15, 2001. The false color image above has been enhanced to bring out the contrast between the floodwaters and the lands, with sediment-carrying floodwaters in purple. Sediment can be seen flowing into the South China Sea as well. This year's floods have affected over a million people, and 100 people have been killed in Vietnam alone. The monsoon floods bring not only devastation, but renewal. The large body of water just left of center in Cambodia is the Tonle Sap. This shallow lake plays a changing role in the regional water cycle. During the dry season, the stream-fed Tonle Sap drains via the Tonle Sab River into the Mekong River. During the wet season (June-November), flooding of the Mekong reverses the course of the Tonle Sab, roughly tripling the lake's size from about 3000 km2 to about 10,000. When the dry season returns, the lake once again begins to drain into the Mekong Delta, where it provides a flow of fresh water that balances the intrusion of salty seawater into the delta's agricultural lands. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

  7. Biologically active proteins from natural product extracts.

    PubMed

    O'Keefe, B R

    2001-10-01

    The term "biologically active proteins" is almost redundant. All proteins produced by living creatures are, by their very nature, biologically active to some extent in their homologous species. In this review, a subset of these proteins will be discussed that are biologically active in heterologous systems. The isolation and characterization of novel proteins from natural product extracts including those derived from microorganisms, plants, insects, terrestrial vertebrates, and marine organisms will be reviewed and grouped into several distinct classes based on their biological activity and their structure.

  8. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 1 2014-10-01 2014-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  9. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 1 2013-10-01 2013-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  10. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  11. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 1 2011-10-01 2011-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  12. 46 CFR 16.203 - Employer, MRO, and SAP responsibilities.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 1 2012-10-01 2012-10-01 false Employer, MRO, and SAP responsibilities. 16.203 Section... CHEMICAL TESTING Required Chemical Testing § 16.203 Employer, MRO, and SAP responsibilities. (a) Employers...) Substance Abuse Professional (SAP). Individuals performing SAP functions must meet the training...

  13. 2B4-SAP signaling is required for the priming of naive CD8(+) T cells by antigen-expressing B cells and B lymphoma cells.

    PubMed

    Huang, Yu-Hsuan; Tsai, Kevin; Tan, Sara Y; Kang, Sohyeong; Ford, Mandy L; Harder, Kenneth W; Priatel, John J

    2017-01-01

    Mutations in SH2D1A gene that encodes SAP (SLAM-associated protein) result in X-linked lymphoproliferative disease (XLP), a rare primary immunodeficiency disease defined by exquisite sensitivity to the B-lymphotropic Epstein-Barr virus (EBV) and B cell lymphomas. However, the precise mechanism of how the loss of SAP function contributes to extreme vulnerability to EBV and the development of B cell lymphomas remains unclear. Here, we investigate the hypothesis that SAP is critical for CD8(+) T cell immune surveillance of antigen (Ag)-expressing B cells or B lymphoma cells under conditions of defined T cell receptor (TCR) signaling. Sh2d1a(-)(/)(-) CD8(+) T cells exhibited greatly diminished proliferation relative to wild type when Ag-presenting-B cells or -B lymphoma cells served as the primary Ag-presenting cell (APC). By contrast, Sh2d1a(-)(/)(-) CD8(+) T cells responded equivalently to wild-type CD8(+) T cells when B cell-depleted splenocytes, melanoma cells or breast carcinoma cells performed Ag presentation. Through application of signaling lymphocyte activation molecule (SLAM) family receptor blocking antibodies or SLAM family receptor-deficient CD8(+) T cells and APCs, we found that CD48 engagement on the B cell surface by 2B4 is crucial for initiating SAP-dependent signaling required for the Ag-driven CD8(+) T cell proliferation and differentiation. Altogether, a pivotal role for SAP in promoting the expansion and differentiation of B cell-primed viral-specific naive CD8(+) T cells may explain the selective immune deficiency of XLP patients to EBV and B cell lymphomas.

  14. Rational Design of Protein C Activators

    PubMed Central

    Barranco-Medina, Sergio; Murphy, Mary; Pelc, Leslie; Chen, Zhiwei; Di Cera, Enrico; Pozzi, Nicola

    2017-01-01

    In addition to its procoagulant and proinflammatory functions mediated by cleavage of fibrinogen and PAR1, the trypsin-like protease thrombin activates the anticoagulant protein C in a reaction that requires the cofactor thrombomodulin and the endothelial protein C receptor. Once in the circulation, activated protein C functions as an anticoagulant, anti-inflammatory and regenerative factor. Hence, availability of a protein C activator would afford a therapeutic for patients suffering from thrombotic disorders and a diagnostic tool for monitoring the level of protein C in plasma. Here, we present a fusion protein where thrombin and the EGF456 domain of thrombomodulin are connected through a peptide linker. The fusion protein recapitulates the functional and structural properties of the thrombin-thrombomodulin complex, prolongs the clotting time by generating pharmacological quantities of activated protein C and effectively diagnoses protein C deficiency in human plasma. Notably, these functions do not require exogenous thrombomodulin, unlike other anticoagulant thrombin derivatives engineered to date. These features make the fusion protein an innovative step toward the development of protein C activators of clinical and diagnostic relevance. PMID:28294177

  15. The FORTRAN static source code analyzer program (SAP) system description

    NASA Technical Reports Server (NTRS)

    Decker, W.; Taylor, W.; Merwarth, P.; Oneill, M.; Goorevich, C.; Waligora, S.

    1982-01-01

    A source code analyzer program (SAP) designed to assist personnel in conducting studies of FORTRAN programs is described. The SAP scans FORTRAN source code and produces reports that present statistics and measures of statements and structures that make up a module. The processing performed by SAP and of the routines, COMMON blocks, and files used by SAP are described. The system generation procedure for SAP is also presented.

  16. Behavior and Characteristics of Sap-Feeding North Island kākā (Nestor meridionalis septentrionalis) in Wellington, New Zealand

    PubMed Central

    Charles, Kerry E.; Linklater, Wayne L.

    2013-01-01

    Simple Summary Understanding the behavior of problem animal species assists in understanding and mitigating problems caused by wildlife in urban landscapes. The kākā, a threatened New Zealand native parrot, causes damage to trees while feeding on sap. Through observations of sap foraging kākā in Wellington City, this study builds on the limited knowledge of sap feeding and tests hypotheses about the age and sex of sap feeding birds. We found that sap feeding likely occurs in both sexes and across age groups, and that sap feeding birds also utilize supplementary food. This study suggests that sap is an important food source for kākā and that further provision of supplementary food is unlikely to reduce sap feeding and associated tree damage. Abstract The North Island kākā (Nestor meridionalis septentrionalis), a threatened New Zealand native parrot, was successfully reintroduced to an urban sanctuary in Wellington, New Zealand. Conflict has recently begun to emerge with Wellington City residents due to tree damage caused by kākā sap foraging. Little is known about sap foraging behavior of kākā, and this study aimed to gain a greater understanding of this behavior, and to test hypotheses that sap feeding is predominantly a female activity and that one technique, forming transverse gouges through bark, may be restricted to adult kākā. We used instantaneous scan sampling to record the behavior of kākā during 25 60–100 minute observation periods at Anderson Park, Wellington Botanic Garden, and during 13 opportunistic observations of sap feeding kākā in Wellington City. Forty-one observations of sap feeding were made of 21 individually-identified birds. Sap feeding birds were predominantly young and, based on estimated sex, females were no more likely to sap feed than males (exact binomial test p = 0.868). Twenty of the 21 identified sap feeding kākā utilized supplementary feeding stations at Zealandia-Karori Wildlife Sanctuary. Kākā were observed

  17. Electric Potential Variations on a Poplar: Beyond Electrokinetic Effects Associated With Sap Flow

    NASA Astrophysics Data System (ADS)

    Gibert, D.; Le Mouël, J.; Lambs, L.; Nicollin, F.; Conil, F.; Perrier, F.

    2004-12-01

    Electric potential has been monitored since December 2003 in the roots and at two circumferences and one vertical profile in a standing poplar (Populus incognitus). Electric potential is sampled using 5 mm diameter stainless steel rods, inserted 5 mm deep in the cambium, and is referenced to an unpolarizable Petiau electrode installed 80 cm deep in the soil. Various types of signals are observed. Transient signals with long relaxation times affecting some electrodes simultaneously, may be contact potentials triggered by condensation and evaporation. Diurnal variations are observed which present a seasonal variation. During winter, diurnal variations depend on the measurement point, with variable amplitudes and sometimes anticorrelations between electrodes. By contrast, a stable and coherent organization is established in the spring, with larger amplitudes, and lasts during summer. Such signals have been reported previously (Koppan et al., 2000; Morat et al., 1994; Fensom, 1963), have been interpreted as electrokinetic effects associated with sap flow. However, a comparison of the electrical signals with a measurement of the sap flow by a heat flow method, shows that the electrical variation, although clearly correlated to sap flow, is not simply proportional to it. In a living system, electrokinetic effects, in addition to thermoelectrical effects, are probably modified significantly by additional electrochemical effects, such as membrane diffusion potentials, ion active transport by proteins, and action potentials. Such effects have been evidenced in laboratory experiments with plants (e.g., Fromm and Hei, 1998). Electric potential variations in trees may thus reveal mechanisms not accessible by other methods, and maybe reveal new aspects of the physics of living systems. A better understanding of the electrical response of trees to meteorological, chemical or biological forcing may improve the knowledge of transfer processes between the soil and the atmosphere

  18. Environmental controls on sap flow in a northern hardwood forest.

    PubMed

    Bovard, B D; Curtis, P S; Vogel, C S; Su, H-B; Schmid, H P

    2005-01-01

    Our objective was to gain a detailed understanding of how photosynthetically active radiation (PAR), vapor pressure deficit (D) and soil water interact to control transpiration in the dominant canopy species of a mixed hardwood forest in northern Lower Michigan. An improved understanding of how these environmental factors affect whole-tree water use in unmanaged ecosystems is necessary in assessing the consequences of climate change on the terrestrial water cycle. We used continuously heated sap flow sensors to measure transpiration in mature trees of four species during two successive drought events. The measurements were scaled to the stand level for comparison with eddy covariance estimates of ecosystem water flux (Fw). Photosynthetically active radiation and D together explained 82% of the daytime hourly variation in plot-level transpiration, and low soil water content generally resulted in increased stomatal sensitivity to increasing D. There were also species-specific responses to drought. Quercus rubra L. showed low water use during both dry and wet conditions, and during periods of high D. Among the study species, Acer rubrum L. showed the greatest degree of stomatal closure in response to low soil water availability. Moderate increases in stomatal sensitivity to D during dry periods were observed in Populus grandidentata Michx. and Betula papyrifera Marsh. Sap flow scaled to the plot level and Fw demonstrated similar temporal patterns of water loss suggesting that the mechanisms controlling sap flow of an individual tree also control ecosystem evapotranspiration. However, the absolute magnitude of scaled sap flow estimates was consistently lower than Fw. We conclude that species-specific responses to PAR, D and soil water content are key elements to understanding current and future water fluxes in this ecosystem.

  19. Cbl proteins in platelet activation.

    PubMed

    Buitrago, Lorena; Tsygankov, Alexander; Sanjay, Archana; Kunapuli, Satya P

    2013-01-01

    Platelets play a fundamental role in hemostasis. Their functional responses have to be tightly controlled as any disturbance may lead to bleeding disorders or thrombosis. It is thus important to clearly identify and understand the signaling mechanisms involved in platelet function. An important role of c-Cbl and Cbl-b ubiquitin ligases in platelet functional responses and in hematological malignancies has been recently described. Cbl proteins perform negative and positive regulation of several signaling pathways in platelets. In this review, we explore the role of Cbl proteins in platelet functional responses.

  20. Identification of intracellular receptor proteins for activated protein kinase C.

    PubMed Central

    Mochly-Rosen, D; Khaner, H; Lopez, J

    1991-01-01

    Protein kinase C (PKC) translocates from the cytosol to the particulate fraction on activation. This activation-induced translocation of PKC is thought to reflect PKC binding to the membrane lipids. However, immunological and biochemical data suggest that PKC may bind to proteins in the cytoskeletal elements in the particulate fraction and in the nuclei. Here we describe evidence for the presence of intracellular receptor proteins that bind activated PKC. Several proteins from the detergent-insoluble material of the particulate fraction bound PKC in the presence of phosphatidylserine and calcium; binding was further increased with the addition of diacylglycerol. Binding of PKC to two of these proteins was concentration-dependent, saturable, and specific, suggesting that these binding proteins are receptors for activated C-kinase, termed here "RACKs." PKC binds to RACKs via a site on PKC distinct from the substrate binding site. We suggest that binding to RACKs may play a role in activation-induced translocation of PKC. Images PMID:1850844

  1. Activity-Based Protein Profiling of Microbes

    SciTech Connect

    Sadler, Natalie C.; Wright, Aaron T.

    2015-02-01

    Activity-Based Protein Profiling (ABPP) in conjunction with multimodal characterization techniques has yielded impactful findings in microbiology, particularly in pathogen, bioenergy, drug discovery, and environmental research. Using small molecule chemical probes that react irreversibly with specific proteins or protein families in complex systems has provided insights in enzyme functions in central metabolic pathways, drug-protein interactions, and regulatory protein redox, for systems ranging from photoautotrophic cyanobacteria to mycobacteria, and combining live cell or cell extract ABPP with proteomics, molecular biology, modeling, and other techniques has greatly expanded our understanding of these systems. New opportunities for application of ABPP to microbial systems include: enhancing protein annotation, characterizing protein activities in myriad environments, and reveal signal transduction and regulatory mechanisms in microbial systems.

  2. Remotely activated protein-producing nanoparticles.

    PubMed

    Schroeder, Avi; Goldberg, Michael S; Kastrup, Christian; Wang, Yingxia; Jiang, Shan; Joseph, Brian J; Levins, Christopher G; Kannan, Sneha T; Langer, Robert; Anderson, Daniel G

    2012-06-13

    The development of responsive nanomaterials, nanoscale systems that actively respond to stimuli, is one general goal of nanotechnology. Here we develop nanoparticles that can be controllably triggered to synthesize proteins. The nanoparticles consist of lipid vesicles filled with the cellular machinery responsible for transcription and translation, including amino acids, ribosomes, and DNA caged with a photolabile protecting group. These particles served as nanofactories capable of producing proteins including green fluorescent protein (GFP) and enzymatically active luciferase. In vitro and in vivo, protein synthesis was spatially and temporally controllable, and could be initiated by irradiating micrometer-scale regions on the time scale of milliseconds. The ability to control protein synthesis inside nanomaterials may enable new strategies to facilitate the study of orthogonal proteins in a confined environment and for remotely activated drug delivery.

  3. Mutually exclusive distribution of the sap and eag S-layer genes and the lytB/lytA cell wall hydrolase genes in Bacillus thuringiensis.

    PubMed

    Soufiane, Brahim; Sirois, Marc; Côté, Jean-Charles

    2011-10-01

    Recently, two Bacillus thuringiensis strains were reported to synthesize parasporal inclusion bodies made not of the expected crystal (Cry) proteins but rather of the surface layer proteins (SLP) Sap (encoded by sap) and EA1 (encoded by eag), respectively. Whether the presence of the sap and eag genes is restricted to these two B. thuringiensis strains or ubiquitous in B. thuringiensis is unknown. We report here the distribution of the sap and eag genes in B. thuringiensis. Strains in the Bacillus cereus group were added for comparison purposes. We show that sap and eag are either present in tandem in 35% of the B. thuringiensis strains analysed and absent in 65% of the strains. When absent, a different tandem, the lytB/lytA cell wall hydrolase genes, is present. The distribution of the sap and eag S-layer and the lytB/lytA cell wall hydrolase genes is not species-specific in B. thuringiensis, B. cereus and Bacillus weihenstephanensis. Bacillus anthracis and Bacillus mycoides harbor sap and eag but not lytB/lytA. The sap, eag and lytB/lytA genes were absent in Bacillus pseudomycoides. Clearly, the distribution of the sap and eag S-layer and the lytB/lytA cell wall hydrolase genes in B. thuringiensis and in the Bacillus cereus group is mutually exclusive. We also showed that two genes involved in cell wall metabolism, csaA and csaB, are present not only upstream of the sap and eag S-layer genes, but also upstream of the lytB/lytA tandem in strains where sap and eag are absent. Bootstrapped neighbor-joining trees were inferred from the translated amino acid sequences of sap, eag and the tandem lytB/lytA, respectively.

  4. Dietary protein considerations to support active aging.

    PubMed

    Wall, Benjamin T; Cermak, Naomi M; van Loon, Luc J C

    2014-11-01

    Given our rapidly aging world-wide population, the loss of skeletal muscle mass with healthy aging (sarcopenia) represents an important societal and public health concern. Maintaining or adopting an active lifestyle alleviates age-related muscle loss to a certain extent. Over time, even small losses of muscle tissue can hinder the ability to maintain an active lifestyle and, as such, contribute to the development of frailty and metabolic disease. Considerable research focus has addressed the application of dietary protein supplementation to support exercise-induced gains in muscle mass in younger individuals. In contrast, the role of dietary protein in supporting the maintenance (or gain) of skeletal muscle mass in active older persons has received less attention. Older individuals display a blunted muscle protein synthetic response to dietary protein ingestion. However, this reduced anabolic response can largely be overcome when physical activity is performed in close temporal proximity to protein consumption. Moreover, recent evidence has helped elucidate the optimal type and amount of dietary protein that should be ingested by the older adult throughout the day in order to maximize the skeletal muscle adaptive response to physical activity. Evidence demonstrates that when these principles are adhered to, muscle maintenance or hypertrophy over prolonged periods can be further augmented in active older persons. The present review outlines the current understanding of the role that dietary protein occupies in the lifestyle of active older adults as a means to increase skeletal muscle mass, strength and function, and thus support healthier aging.

  5. Insects attracted to Maple Sap: Observations from Prince Edward Island, Canada

    PubMed Central

    Majka, Christopher G.

    2010-01-01

    Abstract The collection of maple sap for the production of maple syrup is a large commercial enterprise in Canada and the United States. In Canada, which produces 85% of the world’s supply, it has an annual value of over $168 million CAD. Over 38 million trees are tapped annually, 6.5% of which use traditional buckets for sap collection. These buckets attract significant numbers of insects. Despite this, there has been very little investigation of the scale of this phenomenon and the composition of insects that are attracted to this nutrient source. The present paper reports the results of a preliminary study conducted on Prince Edward Island, Canada. Twenty-eight species of Coleoptera, Lepidoptera, and Trichoptera were found in maple sap buckets, 19 of which are known to be attracted to saps and nectars. The physiological role of sap feeding is discussed with reference to moths of the tribe Xylenini, which are active throughout the winter, and are well documented as species that feed on sap flows. Additionally, 18 of the 28 species found in this study are newly recorded in Prince Edward Island. PMID:21594122

  6. Sap phytochemical compositions of some bananas in Thailand.

    PubMed

    Pothavorn, Pongsagon; Kitdamrongsont, Kasipong; Swangpol, Sasivimon; Wongniam, Siripope; Atawongsa, Kanokporn; Savasti, Jisnuson; Somana, Jamorn

    2010-08-11

    Banana sap has some special properties relating to various phenomena such as browning of fruits after harvesting, permanent staining of cloth and fibers, and antioxidant and antibleeding properties. Analysis of banana sap using high-performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS) indicated the presence of phenolic and aromatic amino compounds of interest due to their special properties. With the online positive electrospray ionization mode (ESI), the possible structures of specific compounds were determined from the fragmentation patterns of each particular ion appearing in the mass spectra. The major compounds revealed from the sap of banana accessions, namely, Musa balbisiana , Musa laterita , Musa ornata , and Musa acuminata , and some cultivars were apigenin glycosides, myricetin glycoside, myricetin-3-O-rutinoside, naringenin glycosides, kaempferol-3-O-rutinoside, quercetin-3-O-rutinoside, dopamine, and N-acetylserotonin. The results indicated that there was a variety of phenolic and aromatic amino contents in many banana species. These compounds were reported to relate with biological activities. Moreover, the identities of these phytochemical compositions may be used as markers for banana diet, the assessment of physiochemical status, or the classification of banana clones.

  7. Campylobacter fetus sap inversion occurs in the absence of RecA function.

    PubMed

    Ray, K C; Tu, Z C; Grogono-Thomas, R; Newell, D G; Thompson, S A; Blaser, M J

    2000-10-01

    Phase variation of Campylobacter fetus surface layer proteins (SLPs) occurs by inversion of a 6.2-kb DNA segment containing the unique sap promoter, permitting expression of a single SLP-encoding gene. Previous work has shown that the C. fetus sap inversion system is RecA dependent. When we challenged a pregnant ewe with a recA mutant of wild-type C. fetus (strain 97-211) that expressed the 97-kDa SLP, 15 of the 16 ovine-passaged isolates expressed the 97-kDa protein. However, one strain (97-209) expressed a 127-kDa SLP, suggesting that chromosomal rearrangement may have occurred to enable SLP switching. Lack of RecA function in strains 97-211 and 97-209 was confirmed by their sensitivity to the DNA-damaging agent methyl methanesulfonate. Southern hybridization and PCR of these strains indicated that the aphA insertion into recA was stably present. However, Southern hybridizations demonstrated that in strain 97-209 inversion had occurred in the sap locus. PCR data confirmed inversion of the 6.2-kb DNA element and indicated that in these recA mutants the sap inversion frequency is reduced by 2 to 3 log(10) units compared to that in the wild type. Thus, although the major sap inversion pathway in C. fetus is RecA dependent, alternative lower-frequency, RecA-independent inversion mechanisms exist.

  8. SAP gene transfer restores cellular and humoral immune function in a murine model of X-linked lymphoproliferative disease.

    PubMed

    Rivat, Christine; Booth, Claire; Alonso-Ferrero, Maria; Blundell, Michael; Sebire, Neil J; Thrasher, Adrian J; Gaspar, H Bobby

    2013-02-14

    X-linked lymphoproliferative disease (XLP1) arises from mutations in the gene encoding SLAM-associated protein (SAP) and leads to abnormalities of NKT-cell development, NK-cell cytotoxicity, and T-dependent humoral function. Curative treatment is limited to allogeneic hematopoietic stem cell (HSC) transplantation. We tested whether HSC gene therapy could correct the multilineage defects seen in SAP(-/-) mice. SAP(-/-) murine HSCs were transduced with lentiviral vectors containing either SAP or reporter gene before transplantation into irradiated recipients. NKT-cell development was significantly higher and NK-cell cytotoxicity restored to wild-type levels in mice receiving the SAP vector in comparison to control mice. Baseline immunoglobulin levels were significantly increased and T-dependent humoral responses to NP-CGG, including germinal center formation, were restored in SAP-transduced mice.We demonstrate for the first time that HSC gene transfer corrects the cellular and humoral defects in SAP(-/-) mice providing proof of concept for gene therapy in XLP1.

  9. Targeting and Cytotoxicity of SapC-DOPS Nanovesicles in Pancreatic Cancer

    PubMed Central

    Chu, Zhengtao; Abu-Baker, Shadi; Palascak, Mary B.; Ahmad, Syed A.; Franco, Robert S.; Qi, Xiaoyang

    2013-01-01

    Only a small number of promising drugs target pancreatic cancer, which is the fourth leading cause of cancer deaths with a 5-year survival of less than 5%. Our goal is to develop a new biotherapeutic agent in which a lysosomal protein (saposin C, SapC) and a phospholipid (dioleoylphosphatidylserine, DOPS) are assembled into nanovesicles (SapC-DOPS) for treating pancreatic cancer. A distinguishing feature of SapC-DOPS nanovesicles is their high affinity for phosphatidylserine (PS) rich microdomains, which are abnormally exposed on the membrane surface of human pancreatic tumor cells. To evaluate the role of external cell PS, in vitro assays were used to correlate PS exposure and the cytotoxic effect of SapC-DOPS in human tumor and nontumorigenic pancreatic cells. Next, pancreatic tumor xenografts (orthotopic and subcutaneous models) were used for tumor targeting and therapeutic efficacy studies with systemic SapC-DOPS treatment. We observed that the nanovesicles selectively killed human pancreatic cancer cells in vitro by inducing apoptotic death, whereas untransformed cells remained unaffected. This in vitro cytotoxic effect correlated to the surface exposure level of PS on the tumor cells. Using xenografts, animals treated with SapC-DOPS showed clear survival benefits and their tumors shrank or disappeared. Furthermore, using a double-tracking method in live mice, we showed that the nanovesicles were specifically targeted to orthotopically-implanted, bioluminescent pancreatic tumors. These data suggest that the acidic phospholipid PS is a biomarker for pancreatic cancer that can be effectively targeted for therapy utilizing cancer-selective SapC-DOPS nanovesicles. This study provides convincing evidence in support of developing a new therapeutic approach to pancreatic cancer. PMID:24124494

  10. Studies on the interactions of SAP-1 (an N-terminal truncated form of cystatin S) with its binding partners by CD-spectroscopic and molecular docking methods.

    PubMed

    Yadav, Vikash Kumar; Mandal, Rahul Shubhra; Puniya, Bhanwar Lal; Singh, Sarman; Yadav, Savita

    2015-01-01

    SAP-1 is a 113 amino acid long single-chain protein which belongs to the type 2 cystatin gene family. In our previous study, we have purified SAP-1 from human seminal plasma and observed its cross-class inhibitory property. At this time, we report the interaction of SAP-1 with diverse proteases and its binding partners by CD-spectroscopic and molecular docking methods. The circular dichroism (CD) spectroscopic studies demonstrate that the conformation of SAP-1 is changed after its complexation with proteases, and the alterations in protein secondary structure are quantitatively calculated with increase of α-helices and reduction of β-strand content. To get insight into the interactions between SAP-1 and proteases, we make an effort to model the three-dimensional structure of SAP-1 by molecular modeling and verify its stability and viability through molecular dynamics simulations and finally complexed with different proteases using ClusPro 2.0 Server. A high degree of shape complementarity is examined within the complexes, stabilized by a number of hydrogen bonds (HBs) and hydrophobic interactions. Using HB analyses in different protein complexes, we have identified a series of key residues that may be involved in the interactions between SAP-1 and proteases. These findings will assist to understand the mechanism of inhibition of SAP-1 for different proteases and provide intimation for further research.

  11. MYST protein acetyltransferase activity requires active site lysine autoacetylation.

    PubMed

    Yuan, Hua; Rossetto, Dorine; Mellert, Hestia; Dang, Weiwei; Srinivasan, Madhusudan; Johnson, Jamel; Hodawadekar, Santosh; Ding, Emily C; Speicher, Kaye; Abshiru, Nebiyu; Perry, Rocco; Wu, Jiang; Yang, Chao; Zheng, Y George; Speicher, David W; Thibault, Pierre; Verreault, Alain; Johnson, F Bradley; Berger, Shelley L; Sternglanz, Rolf; McMahon, Steven B; Côté, Jacques; Marmorstein, Ronen

    2012-01-04

    The MYST protein lysine acetyltransferases are evolutionarily conserved throughout eukaryotes and acetylate proteins to regulate diverse biological processes including gene regulation, DNA repair, cell-cycle regulation, stem cell homeostasis and development. Here, we demonstrate that MYST protein acetyltransferase activity requires active site lysine autoacetylation. The X-ray crystal structures of yeast Esa1 (yEsa1/KAT5) bound to a bisubstrate H4K16CoA inhibitor and human MOF (hMOF/KAT8/MYST1) reveal that they are autoacetylated at a strictly conserved lysine residue in MYST proteins (yEsa1-K262 and hMOF-K274) in the enzyme active site. The structure of hMOF also shows partial occupancy of K274 in the unacetylated form, revealing that the side chain reorients to a position that engages the catalytic glutamate residue and would block cognate protein substrate binding. Consistent with the structural findings, we present mass spectrometry data and biochemical experiments to demonstrate that this lysine autoacetylation on yEsa1, hMOF and its yeast orthologue, ySas2 (KAT8) occurs in solution and is required for acetylation and protein substrate binding in vitro. We also show that this autoacetylation occurs in vivo and is required for the cellular functions of these MYST proteins. These findings provide an avenue for the autoposttranslational regulation of MYST proteins that is distinct from other acetyltransferases but draws similarities to the phosphoregulation of protein kinases.

  12. MYST protein acetyltransferase activity requires active site lysine autoacetylation

    PubMed Central

    Yuan, Hua; Rossetto, Dorine; Mellert, Hestia; Dang, Weiwei; Srinivasan, Madhusudan; Johnson, Jamel; Hodawadekar, Santosh; Ding, Emily C; Speicher, Kaye; Abshiru, Nebiyu; Perry, Rocco; Wu, Jiang; Yang, Chao; Zheng, Y George; Speicher, David W; Thibault, Pierre; Verreault, Alain; Johnson, F Bradley; Berger, Shelley L; Sternglanz, Rolf; McMahon, Steven B; Côté, Jacques; Marmorstein, Ronen

    2012-01-01

    The MYST protein lysine acetyltransferases are evolutionarily conserved throughout eukaryotes and acetylate proteins to regulate diverse biological processes including gene regulation, DNA repair, cell-cycle regulation, stem cell homeostasis and development. Here, we demonstrate that MYST protein acetyltransferase activity requires active site lysine autoacetylation. The X-ray crystal structures of yeast Esa1 (yEsa1/KAT5) bound to a bisubstrate H4K16CoA inhibitor and human MOF (hMOF/KAT8/MYST1) reveal that they are autoacetylated at a strictly conserved lysine residue in MYST proteins (yEsa1-K262 and hMOF-K274) in the enzyme active site. The structure of hMOF also shows partial occupancy of K274 in the unacetylated form, revealing that the side chain reorients to a position that engages the catalytic glutamate residue and would block cognate protein substrate binding. Consistent with the structural findings, we present mass spectrometry data and biochemical experiments to demonstrate that this lysine autoacetylation on yEsa1, hMOF and its yeast orthologue, ySas2 (KAT8) occurs in solution and is required for acetylation and protein substrate binding in vitro. We also show that this autoacetylation occurs in vivo and is required for the cellular functions of these MYST proteins. These findings provide an avenue for the autoposttranslational regulation of MYST proteins that is distinct from other acetyltransferases but draws similarities to the phosphoregulation of protein kinases. PMID:22020126

  13. DNA-based control of protein activity

    PubMed Central

    Engelen, W.; Janssen, B. M. G.

    2016-01-01

    DNA has emerged as a highly versatile construction material for nanometer-sized structures and sophisticated molecular machines and circuits. The successful application of nucleic acid based systems greatly relies on their ability to autonomously sense and act on their environment. In this feature article, the development of DNA-based strategies to dynamically control protein activity via oligonucleotide triggers is discussed. Depending on the desired application, protein activity can be controlled by directly conjugating them to an oligonucleotide handle, or expressing them as a fusion protein with DNA binding motifs. To control proteins without modifying them chemically or genetically, multivalent ligands and aptamers that reversibly inhibit their function provide valuable tools to regulate proteins in a noncovalent manner. The goal of this feature article is to give an overview of strategies developed to control protein activity via oligonucleotide-based triggers, as well as hurdles yet to be taken to obtain fully autonomous systems that interrogate, process and act on their environments by means of DNA-based protein control. PMID:26812623

  14. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 2 2013-04-01 2013-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  15. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 2 2012-04-01 2012-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  16. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 2 2014-04-01 2014-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  17. 21 CFR 133.186 - Sap sago cheese.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 2 2011-04-01 2011-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the...

  18. Beneficial effects of Acer okamotoanum sap on L-NAME-induced hypertension-like symptoms in a rat model.

    PubMed

    Yang, Hyun; Hwang, Inho; Koo, Tae-Hyoung; Ahn, Hyo-Jin; Kim, Sun; Park, Mi-Jin; Choi, Won-Sil; Kang, Ha-Young; Choi, In-Gyu; Choi, Kyung-Chul; Jeung, Eui-Bae

    2012-02-01

    The sap of Acer okamotoanum has been termed 'bone-benefit-water' in Korea owing to its mineral and sugar content. In particular, the calcium (Ca) and potassium (K) concentrations of the sap of Acer okamotoanum are 40- and 20-times higher, respectively, than commercial spring water. In the present study, we examined whether Acer okamotoanum sap improves or prevents hypertension-like symptoms in a rat model. Male Sprague-Dawley rats (8-weeks-old) were provided commercial spring water supplemented with 25, 50 or 100% Acer okamotoanum sap, 3% potassium ions (K+) or captopril, and treated daily for 2 weeks with NG-nitro-L-arginine methyl ester (L-NAME; 100 mg/kg/day) by subcutaneous injection, in order to induce hypertensive symptoms. Rats were euthanized 6 h following the final injection. To assess the effect of the sap on hypertension-like symptoms, we examined the mean blood pressure (BP), protein levels and localization of endothelial nitric oxide synthase (eNOS) in the descending aorta of the rats. BP levels were significantly lower in hypertensive rats received 25, 50 and 100% sap compared with rats who were administered only commercial spring water. Protein levels of eNOS were repressed in L-NAME-only-treated rats, but were elevated in the descending aorta of rats administered captopril, K+ water and Acer okamotoanum sap (25, 50 and 100%) up to the level of the sham group provided commercial spring water, and then injected with dimethyl sulfoxide for the same period of time. Localized eNOS protein was abundantly expressed in the perivascular descending aorta adipose tissue of the rats. Taken together, these results demonstrated that the sap of Acer okamotoanum ameliorated high BP induced by L-NAME treatment in a rat model.

  19. Vascular Sap Proteomics: Providing Insight into Long-Distance Signaling during Stress

    PubMed Central

    Carella, Philip; Wilson, Daniel C.; Kempthorne, Christine J.; Cameron, Robin K.

    2016-01-01

    The plant vascular system, composed of the xylem and phloem, is important for the transport of water, mineral nutrients, and photosynthate throughout the plant body. The vasculature is also the primary means by which developmental and stress signals move from one organ to another. Due to practical and technological limitations, proteomics analysis of xylem and phloem sap has been understudied in comparison to accessible sample types such as leaves and roots. However, recent advances in sample collection techniques and mass spectrometry technology are making it possible to comprehensively analyze vascular sap proteomes. In this mini-review, we discuss the emerging field of vascular sap proteomics, with a focus on recent comparative studies to identify vascular proteins that may play roles in long-distance signaling and other processes during stress responses in plants. PMID:27242852

  20. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  1. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 7 2012-10-01 2012-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  2. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 7 2013-10-01 2013-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  3. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 7 2014-10-01 2014-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  4. 49 CFR 655.52 - Substance abuse professional (SAP).

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 7 2011-10-01 2011-10-01 false Substance abuse professional (SAP). 655.52 Section 655.52 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL TRANSIT... OPERATIONS Drug and Alcohol Testing Procedures § 655.52 Substance abuse professional (SAP). The SAP...

  5. Surface Absorption Polarization Sensors (SAPS), Final Technical Report, Laser Probing of Immobilized SAPS Actuators Component

    SciTech Connect

    Joseph I. Cline

    2010-04-22

    A novel hypothesized detection scheme for the detection of chemical agents was proposed: SAPS ``Surface-Adsorbed Polarization Sensors''. In this technique a thin layer of molecular rotors is adsorbed to a surface. The rotors can be energized by light absorption, but are otherwise locked in position or alternatively rotate slowly. Using polarized light, the adsorbed rotors are turned as an ensemble. Chemical agent (analyte) binding that alters the rotary efficiency would be detected by sensitive polarized absorption techniques. The mechanism of the SAPS detection can be mechanical, chemical, or photochemical: only a change in rotary efficiency is required. To achieve the goal of SAPS detection, new spectroscopic technique, polarized Normal Incidence Cavity Ringdown Spectroscopy (polarized NICRDS), was developed. The technique employs very sensitive and general Cavity Ringdown absorption spectroscopy along with the ability to perform polarized absorption measurements. Polarized absorption offers the ability to measure the angular position of molecular chromophores. In the new experiments a thin layer of SAPS sensors (roughly corresponding to a monolayer coverage on a surface) immobilized in PMMA. The PMMA layer is less than 100~nm thick and is spin-coated onto a flat fused-silica substrate. The new technique was applied to study the photoisomerization-driven rotary motion of a family of SAPS actuators based on a family of substituted dibenzofulvene rotors based upon 9-(2,2,2- triphenylethylidene)fluorene. By varying the substitution to include moieties such as nitro, amino, and cyano the absorption spectrum and the quantum efficiency of photoisomerization can be varied. This SAPS effect was readily detected by polarized NICRDS. The amino substituted SAPS actuator binds H+ to form an ammonium species which was shown to have a much larger quantum efficiency for photoisomerization. A thin layer of immobilized amino actuators were then shown by polarized NICRDS to have a

  6. Regulatory CD4+ T-Cell Subsets and Anti-Citrullinated Protein Antibody Repertoire: Potential Biomarkers for Arthritis Development in Seropositive Arthralgia Patients?

    PubMed Central

    Janssen, Koen M. J.; Westra, Johanna; Chalan, Paulina; Boots, Annemieke M. H.; de Smit, Menke J.; van Winkelhoff, Arie Jan; Vissink, Arjan; Brouwer, Elisabeth

    2016-01-01

    Objective Seropositive arthralgia patients (SAP) are at high risk of developing rheumatoid arthritis (RA). This prospective study aimed to determine whether altered peripheral regulatory T-cells (Tregs) and defined subsets, besides a broadened anti-citrullinated protein antibody (ACPA) response, may qualify as biomarkers for RA development in SAP. Methods Thirty-four consecutive SAP were prospectively assessed every 6 months for minimally 2 years. At inclusion, peripheral Treg (CD4+CD25+FoxP3+) numbers and subsets, defined as CD45RA+FoxP3low naive Tregs (Fr I), CD45RA-FoxP3high activated Tregs (Fr II) and CD45RA-FoxP3low non-Tregs (Fr III), were compared to age- and sex-matched healthy controls (HC, n = 16) and treatment-naive RA patients (n = 12). SAP that developed RA were compared to non-switchers and analyzed for Treg numbers and Treg subsets at inclusion. Also, Treg numbers and subsets were compared in switched SAP before and at diagnosis. To assess the ACPA repertoire, IgG and IgA reactivity was measured against citrullinated peptides from fibrinogen, α-enolase and vimentin. Results Treg numbers were similar between HC, SAP and RA patients. Although the bonafide Treg subsets Fr I and Fr II were comparable between groups, Fr III was increased in SAP compared to HC (p = 0.01). Fourteen (41%) SAP developed RA during follow-up. Their Treg numbers and subsets were comparable to non-switched SAP. At RA diagnosis, Treg numbers in switched SAP were similar to 6 months before. Switched SAP displayed a more diverse IgG ACPA repertoire compared to non-switched SAP (p = 0.046) and showed more IgA reactivity than non-switched SAP reaching significance for Fib1 only (p = 0.047). Conclusion Numbers of Total Treg and bonafide Treg subsets are not indicative for RA development in SAP, opposed to the ACPA repertoire. PMID:27585422

  7. Purification and Properties of a New L-Sorbose Dehydrogenase Accelerative Protein from Bacillus megaterium Bred by Ion-Beam Implantation

    NASA Astrophysics Data System (ADS)

    Zhao, Shiguang; Yao, Liming; Su, Caixin; Wang, Tao; Wang, Jun; Tang, Mingli; Yu, Zengliang

    2008-06-01

    Bacillus megaterium BM302 bred by ion-beam implantation produces L-sorbose dehydrogenase accelerative protein (SAP) to accelerate the activity of L-sorbose dehydrogenase (SDH) of Gluconobacter oxydans in the 2-keto-L-gulonic acid (2KLG) fermentation from L-sorbose by the mixed culture of B. megaterium BM302 and G. oxydans. The SAP purified by three chromatographic steps gave 35-fold purification with a yield of 13% and a specific activity of 5.21 units/mg protein. The molecular weight of the purified SAP was about 58 kDa. The SDH accelerative activity of SAP at pH 7 and 50°C was the highest. Additionally, it retained 60% activity at a pH range of 6.5 ~ 10 and was stable at 20°C ~ 60°C. After 0.32-unit SAP was added to the single cultured G. oxydans strains, the SDH activity was apparently accelerated and the 2KLG yield of GO29, GO112, G0 and GI13 was enhanced 2.1, 3.3, 3.5 and 2.9 folds respectively over that of the strains without the addition of SAP.

  8. A lipopolysaccharide-binding domain of the Campylobacter fetus S-layer protein resides within the conserved N terminus of a family of silent and divergent homologs.

    PubMed Central

    Dworkin, J; Tummuru, M K; Blaser, M J

    1995-01-01

    Campylobacter fetus cells can produce multiple S-layer proteins ranging from 97 to 149 kDa, with a single form predominating in cultured cells. We have cloned, sequenced, and expressed in Escherichia coli a sapA homolog, sapA2, which encodes a full-length 1,109-amino-acid (112-kDa) S-layer protein. Comparison with the two previously cloned sapA homologs has demonstrated two regions of identity, approximately 70 bp before the open reading frame (ORF) and proceeding 550 bp into the ORF and immediately downstream of the ORF. The entire genome contains eight copies of each of these conserved regions. Southern analyses has demonstrated that sapA2 existed as a complete copy within the genome in all strains examined, although Northern (RNA) analysis has demonstrated that sapA2 was not expressed in the C. fetus strain from which it was cloned. Further Southern analyses revealed increasing sapA diversity as probes increasingly 3' within the ORF were used. Pulsed-field gel electrophoresis and then Southern blotting with the conserved N-terminal region of the sapA homologs as a probe showed that these genes were tightly clustered on the chromosome. Deletion mutagenesis revealed that the S-layer protein bound serospecifically to the C. fetus lipopolysaccharide via its conserved N-terminal region. These data indicated that the S-layer proteins shared functional activity in the conserved N terminus but diverged in a semiconservative manner for the remainder of the molecule. Variation in S-layer protein expression may involve rearrangement of complete gene copies from a single large locus containing multiple sapA homologs. PMID:7896695

  9. Campylobacter fetus uses multiple loci for DNA inversion within the 5' conserved regions of sap homologs.

    PubMed

    Tu, Z C; Ray, K C; Thompson, S A; Blaser, M J

    2001-11-01

    Campylobacter fetus cells possess multiple promoterless sap homologs, each capable of expressing a surface layer protein (SLP) by utilizing a unique promoter present on a 6.2-kb invertible element. Each sap homolog includes a 626-bp 5' conserved region (FCR) with 74 bp upstream and 552 bp within the open reading frame. After DNA inversion, the splice is seamless because the FCRs are identical. In mutant strain 23D:ACA2K101, in which sapA and sapA2 flanking the invertible element in opposite orientations were disrupted by promoterless chloramphenicol resistance (Cm(r)) and kanamycin resistance (Km(r)) cassettes, respectively, the frequency of DNA inversion is 100-fold lower than that of wild-type strain 23D. To define the roles of a 15-bp inverted repeat (IR) and a Chi-like site (CLS) in the FCR, we mutagenized each upstream of sapA2 in 23D:ACA2K101 by introducing NotI and KpnI sites to create strains 23D:ACA2K101N and 23D:ACA2K101K, respectively. Alternatively selecting colonies for Cm(r) or Km(r) showed that mutagenizing the IR or CLS had no apparent effect on the frequency of the DNA inversion. However, mapping the unique NotI or KpnI site in relation to the Cm(r) or Km(r) cassette in the cells that changed phenotype showed that splices occurred both upstream and downstream of the mutated sites. PCR and sequence analyses also showed that the splice could occur in the 425-bp portion of the FCR downstream of the cassettes. In total, these data indicate that C. fetus can use multiple sites within the FCR for its sap-related DNA inversion.

  10. Analyses of the Xylem Sap Proteomes Identified Candidate Fusarium virguliforme Proteinacious Toxins

    PubMed Central

    Abeysekara, Nilwala S.; Bhattacharyya, Madan K.

    2014-01-01

    Background Sudden death syndrome (SDS) caused by the ascomycete fungus, Fusarium virguliforme, exhibits root necrosis and leaf scorch or foliar SDS. The pathogen has never been identified from the above ground diseased foliar tissues. Foliar SDS is believed to be caused by host selective toxins, including FvTox1, secreted by the fungus. This study investigated if the xylem sap of F. virguliforme-infected soybean plants contains secreted F. virguliforme-proteins, some of which could cause foliar SDS development. Results Xylem sap samples were collected from five biological replications of F. virguliforme-infected and uninfected soybean plants under controlled conditions. We identified five F. virguliforme proteins from the xylem sap of the F. virguliforme-infected soybean plants by conducting LC-ESI-MS/MS analysis. These five proteins were also present in the excreted proteome of the pathogen in culture filtrates. One of these proteins showed high sequence identity to cerato-platanin, a phytotoxin produced by Ceratocystis fimbriata f. sp. platani to cause canker stain disease in the plane tree. Of over 500 soybean proteins identified in this study, 112 were present in at least 80% of the sap samples collected from F. virguliforme-infected and -uninfected control plants. We have identified four soybean defense proteins from the xylem sap of F. virguliforme-infected soybean plants. The data have been deposited to the ProteomeXchange with identifier PXD000873. Conclusion This study confirms that a few F. virguliforme proteins travel through the xylem, some of which could be involved in foliar SDS development. We have identified five candidate proteinaceous toxins, one of which showed high similarity to a previously characterized phytotoxin. We have also shown the presence of four soybean defense proteins in the xylem sap of F. virguliforme-infected soybean plants. This study laid the foundation for studying the molecular basis of foliar SDS development in soybean and

  11. Behavior and Characteristics of Sap-Feeding North Island kākā (Nestor meridionalis septentrionalis) in Wellington, New Zealand.

    PubMed

    Charles, Kerry E; Linklater, Wayne L

    2013-08-16

    The North Island kākā (Nestor meridionalis septentrionalis), a threatened New Zealand native parrot, was successfully reintroduced to an urban sanctuary in Wellington, New Zealand. Conflict has recently begun to emerge with Wellington City residents due to tree damage caused by kākā sap foraging. Little is known about sap foraging behavior of kākā, and this study aimed to gain a greater understanding of this behavior, and to test hypotheses that sap feeding is predominantly a female activity and that one technique, forming transverse gouges through bark, may be restricted to adult kākā. We used instantaneous scan sampling to record the behavior of kākā during 25 60-100 minute observation periods at Anderson Park, Wellington Botanic Garden, and during 13 opportunistic observations of sap feeding kākā in Wellington City. Forty-one observations of sap feeding were made of 21 individually-identified birds. Sap feeding birds were predominantly young and, based on estimated sex, females were no more likely to sap feed than males (exact binomial test p = 0.868). Twenty of the 21 identified sap feeding kākā utilized supplementary feeding stations at Zealandia-Karori Wildlife Sanctuary. Kākā were observed defending sap feeding sites from tui (Prosthemadera novaeseelandiae) and conspecifics. Sap appears to be an important resource for kākā across sexes and life stages, and provision of supplementary food is unlikely to reduce sap feeding and tree damage in Wellington City.

  12. Sampling and analysis of phloem sap.

    PubMed

    Dinant, Sylvie; Kehr, Julia

    2013-01-01

    The transport tubes of the phloem are essential for higher plants. They not only provide the route for the distribution of assimilates produced during photosynthesis from source to sink organs but also (re-) distribute mineral nutrients. Additionally, the phloem is essential for sending information between distant plant organs and steering developmental and defense processes. For example, flowering and tuberization time are controlled by phloem-mobile signals and important defense reactions on the whole plant level, like systemic acquired resistance or systemic gene silencing, are spread through the phloem. In addition, recent results demonstrate that also the allocation of mineral nutrients is coordinated by phloem mobile signaling molecules. However, in many studies the important analysis of phloem sap is neglected, probably because the content of sieve tubes is not easy to access. This chapter will describe the current methods for sampling and analysis of phloem sap in order to encourage researchers to include the analysis of this crucial compartment in their relevant studies.

  13. Activated protein C: biased for translation

    PubMed Central

    Zlokovic, Berislav V.; Mosnier, Laurent O.

    2015-01-01

    The homeostatic blood protease, activated protein C (APC), can function as (1) an antithrombotic on the basis of inactivation of clotting factors Va and VIIIa; (2) a cytoprotective on the basis of endothelial barrier stabilization and anti-inflammatory and antiapoptotic actions; and (3) a regenerative on the basis of stimulation of neurogenesis, angiogenesis, and wound healing. Pharmacologic therapies using recombinant human and murine APCs indicate that APC provides effective acute or chronic therapies for a strikingly diverse range of preclinical injury models. APC reduces the damage caused by the following: ischemia/reperfusion in brain, heart, and kidney; pulmonary, kidney, and gastrointestinal inflammation; sepsis; Ebola virus; diabetes; and total lethal body radiation. For these beneficial effects, APC alters cell signaling networks and gene expression profiles by activating protease-activated receptors 1 and 3. APC’s activation of these G protein–coupled receptors differs completely from thrombin’s activation mechanism due to biased signaling via either G proteins or β-arrestin-2. To reduce APC-associated bleeding risk, APC variants were engineered to lack >90% anticoagulant activity but retain normal cell signaling. Such a neuroprotective variant, 3K3A-APC (Lys191-193Ala), has advanced to clinical trials for ischemic stroke. A rich data set of preclinical knowledge provides a solid foundation for potential translation of APC variants to future novel therapies. PMID:25824691

  14. Assessment of Combined Ascorbyl Palmitate (AP) and Sodium Ascorbyl Phosphate (SAP) on Facial Skin Sebum Control in Female Healthy Volunteers.

    PubMed

    Khan, H; Akhtar, N; Ali, A

    2017-01-01

    The skin is fortified with a setup of lipophilic and hydrophilic, enzymatic and non-enzymatic antioxidant systems. Ascorbyl palmitate (AP) and sodium ascorbyl phosphate (SAP) are reported as lipophilic and hydrophilic antioxidants, respectively used for skin care. Present study was aimed to assess the combined AP (in oil phase) and SAP (in aqueous phase) via multiple emulsion (ME1) for controlling sebum secretions in healthy human females. FTIR analysis of AP and SAP was performed for identification. Multiple emulsions (ME1 and control) were prepared and analyzed for physical stability. Antioxidant activities of AP, SAP as well as ME1 (with combination of these compounds) were determined by DPPH method. 11 female volunteers were included in a single-blinded, placebo-controlled, split-face comparative study. Volunteers were instructed to apply ME1 on left cheek while control (without AP and SAP) on right cheek, for a period of 90 days. A non-invasive photometric device (Sebumeter(®)) was used for the measurement of sebum secretions on both sides of the face with subsequent time intervals. A good antioxidant activity of ME1 was observed. ME1 treatments reduced significant facial sebum secretions as compared with control/placebo treatments. It was concluded that combined AP and SAP supplementations to skin proved a promising choice for controlling facial sebum secretions and could be evaluated for undesired oily skin and acne reductions for beautifying the facial appearance.

  15. Synaptic Vesicle Proteins and Active Zone Plasticity

    PubMed Central

    Kittel, Robert J.; Heckmann, Manfred

    2016-01-01

    Neurotransmitter is released from synaptic vesicles at the highly specialized presynaptic active zone (AZ). The complex molecular architecture of AZs mediates the speed, precision and plasticity of synaptic transmission. Importantly, structural and functional properties of AZs vary significantly, even for a given connection. Thus, there appear to be distinct AZ states, which fundamentally influence neuronal communication by controlling the positioning and release of synaptic vesicles. Vice versa, recent evidence has revealed that synaptic vesicle components also modulate organizational states of the AZ. The protein-rich cytomatrix at the active zone (CAZ) provides a structural platform for molecular interactions guiding vesicle exocytosis. Studies in Drosophila have now demonstrated that the vesicle proteins Synaptotagmin-1 (Syt1) and Rab3 also regulate glutamate release by shaping differentiation of the CAZ ultrastructure. We review these unexpected findings and discuss mechanistic interpretations of the reciprocal relationship between synaptic vesicles and AZ states, which has heretofore received little attention. PMID:27148040

  16. Lipid Dependent Mechanisms of Protein Pump Activity

    DTIC Science & Technology

    1989-05-23

    properties which result form the colligative interactions of many lipid molecules. Important materials properties include . . . i I I II II I i I 1 the...d identify by olock number) *This project is aime at investigating if a lipid elastic property , known as the spontaneous radius of curvature Ro’, is...a regulated membrane property and if its value modulates membrane protein activity. Specific aims reported on here include: 1) Correlation of ion pump

  17. Adjuvant-enhanced antibody and cellular responses to inclusion bodies expressing FhSAP2 correlates with protection of mice to Fasciola hepatica.

    PubMed

    Rivera, Francheska; Espino, Ana M

    2016-01-01

    Fasciola hepatica saposin-like protein-2 (FhSAP2) is a protein differentially expressed in various developmental stages of F. hepatica. Recombinant FhSAP2 has demonstrated the induction of partial protection in mice and rabbits when it is administered subcutaneously (SC) in Freund's adjuvant. Because FhSAP2 is overexpressed in bacteria in the form of inclusion bodies (IBs), we isolated IBs expressing FhSAP2 and tested their immunogenicity when administered SC in mice emulsified in two different adjuvants: QS-21 and Montanide TM ISA720. Animals received three injections containing 20 μg of protein two weeks apart and 4 weeks after the third injection, mice were infected with 10 F. hepatica metacercariae by oral route. The percentages of protection induced by FhSAP2-IBs were estimated to be between 60.0 and 62.5% when compared with adjuvant-vaccinated, infected controls. By determining the levels of IgG1 and IgG2a antibodies and IL-4 and IFNγ cytokines in the serum of experimental animals, it was found that both Th1 and Th2 immune responses were significantly increased in the FhSAP2-IBs vaccinated groups compared with the adjuvant-vaccinated, infected control groups. The adjuvant-vaccinated groups had significantly lower IgG1 to IgG2a ratios and lower IL-4 to IFNγ ratios than the FhSAP2-IBs vaccinated animals, which is indicative of higher levels of Th2 immune responses. Irrespective to the adjuvant used, animals vaccinated with FhSAP2-IBs exhibited significantly higher survival percentage and less liver damage than the adjuvant-control groups. This study suggests that FhSAP2 has potential as vaccine against F. hepatica and that the protection elicited by this molecule could be linked to a mechanism driven by the CD4-Th1 cells.

  18. Comparison of Metalloproteinase Protein and Activity Profiling

    PubMed Central

    Giricz, Orsi; Lauer, Janelle L.; Fields, Gregg B.

    2010-01-01

    Proteolytic enzymes play fundamental roles in many biological processes. Members of the matrix metalloproteinase (MMP) family have been shown to take part in processes crucial in disease progression. The present study used the ExcelArray Human MMP/TIMP Array to quantify MMP and tissue inhibitor of metalloproteinase (TIMP) production in the lysates and media of 14 cancer and one normal cell line. The overall patterns were very similar in terms of which MMPs and TIMPs were secreted in the media versus associated with the cells in the individual samples. However, more MMP was found in the media, both in amount and in variety. TIMP-1 was produced in all cell lines. MMP activity assays with three different FRET substrates were then utilized to determine if protein production correlated with function for the WM-266-4 and BJ cell lines. Metalloproteinase activity was observed for both cell lines with a general MMP substrate (Knight SSP), consistent with protein production data. However, although both cell lines promoted the hydrolysis of a more selective MMP substrate (NFF-3), metalloproteinase activity was only confirmed in the BJ cell line. The use of inhibitors to confirm metalloproteinase activities pointed to the strengths and weaknesses of in situ FRET substrate assays. PMID:20920458

  19. Faculty performance evaluation: the CIPP-SAPS model.

    PubMed

    Mitcham, M

    1981-11-01

    The issues of faculty performance evaluation for allied health professionals are addressed. Daniel Stufflebeam's CIPP (content-input-process-product) model is introduced and its development in a CIPP-SAPS (self-administrative-peer-student) model is pursued. Data sources for the SAPS portion of the model are discussed. A suggestion for the use of the CIPP-SAPS model within a teaching contract plan is explored.

  20. MAPKAP kinase-2; a novel protein kinase activated by mitogen-activated protein kinase.

    PubMed Central

    Stokoe, D; Campbell, D G; Nakielny, S; Hidaka, H; Leevers, S J; Marshall, C; Cohen, P

    1992-01-01

    A novel protein kinase, which was only active when phosphorylated by the mitogen-activated protein kinase (MAP kinase), has been purified 85,000-fold to homogeneity from rabbit skeletal muscle. This MAP kinase activated protein kinase, termed MAPKAP kinase-2, was distinguished from S6 kinase-II (MAPKAP kinase-1) by its response to inhibitors, lack of phosphorylation of S6 peptides and amino acid sequence. MAPKAP kinase-2 phosphorylated glycogen synthase at Ser7 and the equivalent serine (*) in the peptide KKPLNRTLS*VASLPGLamide whose sequence is similar to the N terminus of glycogen synthase. MAPKAP kinase-2 was resolved into two monomeric species of apparent molecular mass 60 and 53 kDa that had similar specific activities and substrate specificities. Peptide sequences of the 60 and 53 kDa species were identical, indicating that they are either closely related isoforms or derived from the same gene. MAP kinase activated the 60 and 53 kDa forms of MAPKAP kinase-2 by phosphorylating the first threonine residue in the sequence VPQTPLHTSR. Furthermore, Mono Q chromatography of extracts from rat phaeochromocytoma and skeletal muscle demonstrated that two MAP kinase isoforms (p42mapk and p44mapk) were the only enzymes in these cells that were capable of reactivating MAPKAP kinase-2. These results indicate that MAP kinase activates at least two distinct protein kinases, suggesting that it represents a point at which the growth factor-stimulated protein kinase cascade bifurcates. Images PMID:1327754

  1. Activation and activities of the p53 tumour suppressor protein

    PubMed Central

    Bálint, É; Vousden, K H

    2001-01-01

    The p53 tumour suppressor protein inhibits malignant progression by mediating cell cycle arrest, apoptosis or repair following cellular stress. One of the major regulators of p53 function is the MDM2 protein, and multiple forms of cellular stress activate p53 by inhibiting the MDM2-mediated degradation of p53. Mutations in p53, or disruption of the pathways that allow activation of p53, seem to be a general feature of all cancers. Here we review recent advances in our understanding of the pathways that regulate p53 and the pathways that are induced by p53, as well as their implications for cancer therapy. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11747320

  2. Expression of SAP5 and SAP9 in Candida albicans biofilms: comparison of bloodstream isolates with isolates from other sources.

    PubMed

    Joo, Min Young; Shin, Jong Hee; Jang, Hee-Chang; Song, Eun Song; Kee, Seung Jung; Shin, Myung Geun; Suh, Soon Pal; Ryang, Dong Wook

    2013-11-01

    Secreted aspartic proteases (Sap), encoded by a family of 10 SAP genes, are key virulence determinants in Candida albicans. Although biofilm-associated bloodstream infections (BSIs) are frequently caused by C. albicans, SAP gene expression in C. albicans biofilms formed by BSI isolates has not been evaluated. We compared the expression of two SAP genes, SAP5 and SAP9, in C. albicans biofilms formed by BSI isolates with those formed by isolates from other body sites. Sixty-three C. albicans isolates were analyzed, comprising 35 BSI isolates and 28 from other sites. A denture-strip biofilm model was used, and expression of the two SAP genes was quantified by real-time RT-PCR during planktonic or biofilm growth. Mean SAP5 expression levels of the BSI isolates were 3.59-fold and 3.86-fold higher in 24-h and 48-h biofilms, respectively, than in planktonic cells. These results did not differ from those for isolates from other sites (2.71-fold and 2.8-fold for 24-h and 48-h biofilms, respectively). By contrast, mean SAP9 expression during biofilm formation was higher in BSI isolates (2.89-fold and 3.29-fold at 24 and 48 h, respectively) than in isolates from other sites (1.27-fold and 1.32-fold at 24 and 48 h, respectively; both, P < 0.001). These results show, for the first time, that both SAP5 and SAP9 are upregulated in C. albicans biofilms formed by BSI isolates, and that BSI isolates may have a greater capacity to express SAP9 under biofilm conditions than isolates from other sites.

  3. Interaction of Protein Inhibitor of Activated STAT (PIAS) Proteins with the TATA-binding Protein, TBP*

    PubMed Central

    Prigge, Justin R.; Schmidt, Edward E.

    2007-01-01

    Transcription activators often recruit promoter-targeted assembly of a pre-initiation complex; many repressors antagonize recruitment. These activities can involve direct interactions with proteins in the pre-initiation complex. We used an optimized yeast two-hybrid system to screen mouse pregnancy-associated libraries for proteins that interact with TATA-binding protein (TBP). Screens revealed an interaction between TBP and a single member of the zinc finger family of transcription factors, ZFP523. Two members of the protein inhibitor of activated STAT (PIAS) family, PIAS1 and PIAS3, also interacted with TBP in screens. Endogenous PIAS1 and TBP co-immunoprecipitated from nuclear extracts, suggesting the interaction occurred in vivo. In vitro-translated PIAS1 and TBP coimmunopreciptated, which indicated that other nuclear proteins were not required for the interaction. Deletion analysis mapped the PIAS-interacting domain of TBP to the conserved TBPCORE and the TBP-interacting domain on PIAS1 to a 39-amino acid C-terminal region. Mammals issue seven known PIAS proteins from four pias genes, pias1, pias3, piasx, and piasy, each with different cell type-specific expression patterns; the TBP-interacting domain reported here is the only part of the PIAS C-terminal region shared by all seven PIAS proteins. Direct analyses indicated that PIASx and PIASy also interacted with TBP. Our results suggest that all PIAS proteins might mediate situation-specific regulatory signaling at the TBP interface and that previously unknown levels of complexity could exist in the gene regulatory interplay between TBP, PIAS proteins, ZFP523, and other transcription factors. PMID:16522640

  4. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false May employees or employers seek a second SAP... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an employee... seek a second SAP's evaluation in order to obtain another recommendation. (b) As an employer, you...

  5. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  6. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  7. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  8. 49 CFR 40.295 - May employees or employers seek a second SAP evaluation if they disagree with the first SAP's...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false May employees or employers seek a second SAP evaluation if they disagree with the first SAP's recommendations? 40.295 Section 40.295 Transportation Office... seek a second SAP evaluation if they disagree with the first SAP's recommendations? (a) As an...

  9. The Role of Mitogen-Activated Protein Kinase-Activated Protein Kinases (MAPKAPKs) in Inflammation

    PubMed Central

    Moens, Ugo; Kostenko, Sergiy; Sveinbjørnsson, Baldur

    2013-01-01

    Mitogen-activated protein kinase (MAPK) pathways are implicated in several cellular processes including proliferation, differentiation, apoptosis, cell survival, cell motility, metabolism, stress response and inflammation. MAPK pathways transmit and convert a plethora of extracellular signals by three consecutive phosphorylation events involving a MAPK kinase kinase, a MAPK kinase, and a MAPK. In turn MAPKs phosphorylate substrates, including other protein kinases referred to as MAPK-activated protein kinases (MAPKAPKs). Eleven mammalian MAPKAPKs have been identified: ribosomal-S6-kinases (RSK1-4), mitogen- and stress-activated kinases (MSK1-2), MAPK-interacting kinases (MNK1-2), MAPKAPK-2 (MK2), MAPKAPK-3 (MK3), and MAPKAPK-5 (MK5). The role of these MAPKAPKs in inflammation will be reviewed. PMID:24705157

  10. Heat dissipation guides activation in signaling proteins

    PubMed Central

    Weber, Jeffrey K.; Shukla, Diwakar; Pande, Vijay S.

    2015-01-01

    Life is fundamentally a nonequilibrium phenomenon. At the expense of dissipated energy, living things perform irreversible processes that allow them to propagate and reproduce. Within cells, evolution has designed nanoscale machines to do meaningful work with energy harnessed from a continuous flux of heat and particles. As dictated by the Second Law of Thermodynamics and its fluctuation theorem corollaries, irreversibility in nonequilibrium processes can be quantified in terms of how much entropy such dynamics produce. In this work, we seek to address a fundamental question linking biology and nonequilibrium physics: can the evolved dissipative pathways that facilitate biomolecular function be identified by their extent of entropy production in general relaxation processes? We here synthesize massive molecular dynamics simulations, Markov state models (MSMs), and nonequilibrium statistical mechanical theory to probe dissipation in two key classes of signaling proteins: kinases and G-protein–coupled receptors (GPCRs). Applying machinery from large deviation theory, we use MSMs constructed from protein simulations to generate dynamics conforming to positive levels of entropy production. We note the emergence of an array of peaks in the dynamical response (transient analogs of phase transitions) that draw the proteins between distinct levels of dissipation, and we see that the binding of ATP and agonist molecules modifies the observed dissipative landscapes. Overall, we find that dissipation is tightly coupled to activation in these signaling systems: dominant entropy-producing trajectories become localized near important barriers along known biological activation pathways. We go on to classify an array of equilibrium and nonequilibrium molecular switches that harmonize to promote functional dynamics. PMID:26240354

  11. Activated Protein C action in inflammation

    PubMed Central

    Sarangi, Pranita P.; Lee, Hyun-wook; Kim, Minsoo

    2010-01-01

    Summary Activated protein C (APC) is a natural anticoagulant that plays an important role in coagulation homeostasis by inactivating the procoagulation factor Va and VIIIa. In addition to its anticoagulation functions, APC also has cytoprotective effects such as anti-inflammatory, anti-apoptotic, and endothelial barrier protection. Recently, a recombinant form of human APC (rhAPC or drotrecogin alfa activated; known commercially as “Xigris”) was approved by the US Federal Drug Administration for treatment of severe sepsis associated with a high risk of mortality. Sepsis, also known as systemic inflammatory response syndrome (SIRS) resulting from infection, is a serious medical condition in critical care patients. In sepsis, hyperactive and dysregulated inflammatory responses lead to secretion of pro- and anti-inflammatory cytokines, activation and migration of leucocytes, activation of coagulation, inhibition of fibrinolysis, and increased apoptosis. Although initial hypotheses focused on antithrombotic and profibrinolytic functions of APC in sepsis, other agents with more potent anticoagulation functions were not effective in treating severe sepsis. Furthermore, APC therapy is also associated with the risk of severe bleeding in treated patients. Therefore, the cytoprotective effects, rather than the anticoagulant effect of APC are postulated to be responsible for the therapeutic benefit of APC in the treatment of severe sepsis. PMID:19995397

  12. Utilization of chitosan as an antimicrobial agent for pasteurized palm sap (Borassus flabellifer Linn.) during storage.

    PubMed

    Naknean, Phisut; Jutasukosol, Keawta; Mankit, Theerarat

    2015-02-01

    The objective of this research was to assess the potential of chitosan for improvement the quality of pasteurized palm sap during storage. First, the effect of chitosan content on sensory attributes was investigated to select suitable concentration of chitosan for further study. Fresh palm sap was enriched with chitosan at various concentrations (0-2 g/L) and pasteurized at 80 °C for 10 min, consequently evaluated by consumers. It was found that samples added chitosan in the range of 0-1.00 g/L were considered acceptable. Thus, the addition chitosan in the concentration of 0-1.00 g/L was chosen for further study. The sample without chitosan addition was used as a control sample. Each selected sample was determined for their qualities during storage at 1 week interval. It was found that lightness and transmittance values of all samples tended to increase during storage. Lower PPO and invertase activity were observed in all chitosan-treated samples compared to control sample. Chitosan could minimize the loss of sucrose and the increase in glucose and fructose content during storage. In addition, an increase in chitosan concentration resulted in the increase in DPPH radical scavenging activity. Furthermore, the addition of chitosan could retard the development of microorganism during storage as demonstrated by lower microbial loads compared to control sample. It can be concluded that a combination of pasteurization with chitosan addition (0.50 g/L) and low temperature storage could preserve palm sap for approximately 6 weeks. Thus, the incorporation of chitosan in palm sap could be used as an alternative way to extend shelf life of pasteurized palm sap.

  13. Creating "SMART" Supply Chain Scenarios Using SAP R/3

    ERIC Educational Resources Information Center

    Ragan, Joseph M.; McGettigan, Patrick J.; Storms, Michael R.; Rizman, Brian

    2004-01-01

    Pedagogical revisions to the undergraduate Haub School of Business curriculum at Saint Joseph's University employing the SAP R/3 system encompass the core accounting courses traversing the sophomore and junior years. The entire accounting curriculum was overhauled in order to integrate SAP R/3. Each course progressively builds upon and expands the…

  14. Stem sap flow in plants under low gravity conditions

    NASA Astrophysics Data System (ADS)

    Tokuda, Ayako; Hirai, Hiroaki; Kitaya, Yoshiaki

    2016-07-01

    A study was conducted to obtain a fundamental knowledge for plant functions in bio-regenerative life support systems in space. Stem sap flow in plants is important indicators for water transport from roots to atmosphere through leaves. In this study, stem sap flow in sweetpotato was assessed at gravity levels from 0.01 to 2 g for about 20 seconds each during parabolic airplane flights. Stem sap flow was monitored with a heat balance method in which heat generated with a tiny heater installed in the stem was transferred upstream and downstream by conduction and upstream by convection with the sap flow through xylems of the vascular tissue. Thermal images of stem surfaces near heated points were captured using infrared thermography and the internal heat convection corresponding to the sap flow was analyzed. In results, the sap flow in stems was suppressed more at lower gravity levels without forced air circulation. No suppression of the stem sap flow was observed with forced air circulation. Suppressed sap flow in stems would be caused by suppression of transpiration in leaves and would cause restriction of water and nutrient uptake in roots. The forced air movement is essential to culture healthy plants at a high growth rate under low gravity conditions in space.

  15. Pyrrolopyridine inhibitors of mitogen-activated protein kinase-activated protein kinase 2 (MK-2).

    PubMed

    Anderson, David R; Meyers, Marvin J; Vernier, William F; Mahoney, Matthew W; Kurumbail, Ravi G; Caspers, Nicole; Poda, Gennadiy I; Schindler, John F; Reitz, David B; Mourey, Robert J

    2007-05-31

    A new class of potent kinase inhibitors selective for mitogen-activated protein kinase-activated protein kinase 2 (MAPKAP-K2 or MK-2) for the treatment of rheumatoid arthritis has been prepared and evaluated. These inhibitors have IC50 values as low as 10 nM against the target and have good selectivity profiles against a number of kinases including CDK2, ERK, JNK, and p38. These MK-2 inhibitors have been shown to suppress TNFalpha production in U397 cells and to be efficacious in an acute inflammation model. The structure-activity relationships of this series, the selectivity for MK-2 and their activity in both in vitro and in vivo models are discussed. The observed selectivity is discussed with the aid of an MK-2/inhibitor crystal structure.

  16. SAPS onset timing during substorms and the westward traveling surge

    NASA Astrophysics Data System (ADS)

    Mishin, Evgeny, V.

    2016-07-01

    We present multispacecraft observations in the magnetosphere and conjugate ionosphere of the onset time of subauroral polarization streams (SAPS) and tens of keV ring current injections on the duskside in three individual substorms. This is probably the first unequivocal determination of the substorm SAPS onset timing. The time lag between the SAPS and substorm onsets is much shorter than the gradient-curvature drift time of ˜10 keV ions in the plasmasphere. It seemingly depends on the propagation time of substorm-injected plasma from the dipolarization onset region to the plasmasphere, as well as on the SAPS position. These observations suggest that fast onset SAPS and ring current injections are causally related to the two-loop system of the westward traveling surge.

  17. Protein kinase C activity in boar sperm.

    PubMed

    Teijeiro, J M; Marini, P E; Bragado, M J; Garcia-Marin, L J

    2017-03-01

    Male germ cells undergo different processes within the female reproductive tract to successfully fertilize the oocyte. These processes are triggered by different extracellular stimuli leading to activation of protein phosphorylation. Protein kinase C (PKC) is a key regulatory enzyme in signal transduction mechanisms involved in many cellular processes. Studies in boar sperm demonstrated a role for PKC in the intracellular signaling involved in motility and cellular volume regulation. Experiments using phorbol 12-myristate 13-acetate (PMA) showed increases in the Serine/Threonine phosphorylation of substrates downstream of PKC in boar sperm. In order to gain knowledge about those cellular processes regulated by PKC, we evaluate the effects of PMA on boar sperm motility, lipid organization of plasma membrane, integrity of acrosome membrane and sperm agglutination. Also, we investigate the crosstalk between PKA and PKC intracellular pathways in spermatozoa from this species. The results presented here reveal a participation of PKC in sperm motility regulation and membrane fluidity changes, which is probably associated to acrosome reaction and to agglutination. Also, we show the existence of a hierarchy in the kinases pathway. Previous works on boar sperm suggest a pathway in which PKA is positioned upstream to PKC and this new results support such model.

  18. Interactions of the SAP Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Carra, Claudio; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

    2007-01-01

    NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku70/80 complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The SAP domain of Ku70 (residues 556-609), contains an a helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the SAP/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the SAP domain of Ku70 and a 10 base pairs DNA duplex. Large-scale conformational changes were observed and some putative binding modes were suggested based on energetic analysis. These modes are consistent with previous experimental investigations. In addition, the results indicate that cooperation of SAP with other domains of Ku70/80 is necessary to explain the high affinity of binding as observed in experiments.

  19. Freshwater bryozoa of Tonle Sap, Cambodia.

    PubMed

    Hirose, Masato; Mawatari, Shunsuke F

    2007-06-01

    We identified a collection of freshwater bryozoans from Tonle Sap (meaning Tonle Lake), Cambodia, a body of water fed by the Mekong River and characterized by extreme fluctuations in water level between the wet and dry seasons. The collection also included specimens from the moat of Angkor Wat, located at the north end of the lake. We found four phylactolaemate species (Plumatella bombayensis, Plumatella casmiana, Plumatella vorstmani, Hyalinella lendenfeldi) and one ctenostome species (Hislopia cambodgiensis) from the lake, and only a single, additional phylactolaemate species (Plumatella javanica) from the moat. We provide brief descriptions of these species, photographs of colonies for some, and photomicrographs by light and scanning electron microscopy (SEM) of statoblasts. None of the species encountered in this study is endemic to Cambodia, and the wide distributions of the species are possibly related to the dispersability of floatoblasts by birds. We briefly discuss some of the taxonomic problems surrounding Hislopia cambodgiensis.

  20. Isolation of human C-reactive protein and serum amyloid P component.

    PubMed

    De Beer, F C; Pepys, M B

    1982-01-01

    Procedures are described for the isolation in high yield of consistent, highly purified preparations of human C-reactive protein (CRP) and serum amyloid P component (SAP). CRP was obtained from malignant ascitic and pleural fluids by calcium-dependent affinity chromatography on pneumococcal C-polysaccharide covalently coupled to cyanogen bromide-activated Sepharose. It was then gel filtered on Ultrogel AcA44 (acrylamide-agarose beads) in the presence of calcium ions, combining molecular sieve chromatography with removal of contaminating SAP by its affinity of agarose. Residual trace contaminants were removed by immunoabsorption with anti-normal human serum and anti-SAP antibodies insolubilised on Sepharose and/or by absorption with Sepharose-Con A to remove glycoproteins and Blue-Sepharose to remove albumin. After a final gel filtration step on Sephacryl S-300 35-45% of the initial CRP was recovered in pure form according to biochemical and immunochemical criteria. SAP was isolated from normal serum by calcium-dependent affinity chromatography on unsubstituted Sepharose beads, followed by solid-phase immunoabsorption of contaminants and finally gel filtration on Sephacryl S-300. At least 50% of the SAP in the starting material was recovered in pure form according to biochemical and immunochemical criteria. Ready availability of such preparations facilitates biochemical, biophysical and particularly biological studies of these plasma proteins.

  1. Protein-Protein Interactions Suggest Novel Activities of Human Cytomegalovirus Tegument Protein pUL103

    PubMed Central

    Ortiz, Daniel A.; Glassbrook, James E.

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is an enveloped double-stranded DNA virus that causes severe disease in newborns and immunocompromised patients. During infection, the host cell endosecretory system is remodeled to form the cytoplasmic virion assembly complex (cVAC). We and others previously identified the conserved, multifunctional HCMV virion tegument protein pUL103 as important for cVAC biogenesis and efficient secondary envelopment. To help define its mechanisms of action and predict additional functions, we used two complementary methods, coimmunoprecipitation (co-IP) and proximity biotinylation (BioID), to identify viral and cellular proteins that interact with pUL103. By using the two methods in parallel and applying stringent selection criteria, we identified potentially high-value interactions of pUL103 with 13 HCMV and 18 cellular proteins. Detection of the previously identified pUL103-pUL71 interaction, as well as verification of several interactions by reverse co-IP, supports the specificity of our screening process. As might be expected for a tegument protein, interactions were identified that suggest distinct roles for pUL103 across the arc of lytic infection, including interactions with proteins involved in cellular antiviral responses, nuclear activities, and biogenesis and transport of cytoplasmic vesicles. Further analysis of some of these interactions expands our understanding of the multifunctional repertoire of pUL103: we detected HCMV pUL103 in nuclei of infected cells and identified an ALIX-binding domain within the pUL103 sequence. IMPORTANCE Human cytomegalovirus (HCMV) is able to reconfigure the host cell machinery to establish a virion production factory, the cytoplasmic virion assembly complex (cVAC). cVAC biogenesis and operation represent targets for development of novel HCMV antivirals. We previously showed that the HCMV tegument protein pUL103 is required for cVAC biogenesis. Using pUL103 as bait, we investigated viral and

  2. Transient response of sap flow to wind speed.

    PubMed

    Chu, Chia R; Hsieh, Cheng-I; Wu, Shen-Yuang; Phillips, Nathan G

    2009-01-01

    Transient responses of sap flow to step changes in wind speed were experimentally investigated in a wind tunnel. A Granier-type sap flow sensor was calibrated and tested in a cylindrical tube for analysis of its transient time response. Then the sensor was used to measure the transient response of a well-watered Pachira macrocarpa plant to wind speed variations. The transient response of sap flow was described using the resistance-capacitance model. The steady sap flow rate increased as the wind speed increased at low wind speeds. Once the wind speed exceeded 8.0 m s(-1), the steady sap flow rate did not increase further. The transpiration rate, measured gravimetrically, showed a similar trend. The response of nocturnal sap flow to wind speed variation was also measured and compared with the results in the daytime. Under the same wind speed, the steady sap flow rate was smaller than that in the daytime, indicating differences between diurnal and nocturnal hydraulic function, and incomplete stomatal closure at night. In addition, it was found that the temporal response of the Granier sensor is fast enough to resolve the transient behaviour of water flux in plant tissue.

  3. Comparison of Sugars, Iridoid Glycosides and Amino Acids in Nectar and Phloem Sap of Maurandya barclayana, Lophospermum erubescens, and Brassica napus

    PubMed Central

    Lohaus, Gertrud; Schwerdtfeger, Michael

    2014-01-01

    Background Floral nectar contains sugars and amino acids to attract pollinators. In addition, nectar also contains different secondary compounds, but little is understood about their origin or function. Does nectar composition reflect phloem composition, or is nectar synthesized and/or modified in nectaries? Studies where both, the nectar as well as the phloem sap taken from the same plant species were analyzed in parallel are rare. Therefore, phloem sap and nectar from different plant species (Maurandya barclayana, Lophospermum erubescens, and Brassica napus) were compared. Methodology and Principal Findings Nectar was collected with microcapillary tubes and phloem sap with the laser-aphid-stylet technique. The nectar of all three plant species contained high amounts of sugars with different percentages of glucose, fructose, and sucrose, whereas phloem sap sugars consisted almost exclusively of sucrose. One possible reason for this could be the activity of invertases in the nectaries. The total concentration of amino acids was much lower in nectars than in phloem sap, indicating selective retention of nitrogenous solutes during nectar formation. Nectar amino acid concentrations were negatively correlated with the nectar volumes per flower of the different plant species. Both members of the tribe Antirrhineae (Plantaginaceae) M. barclayana and L. erubescens synthesized the iridoid glycoside antirrhinoside. High amounts of antirrhinoside were found in the phloem sap and lower amounts in the nectar of both plant species. Conclusions/Significance The parallel analyses of nectar and phloem sap have shown that all metabolites which were found in nectar were also detectable in phloem sap with the exception of hexoses. Otherwise, the composition of both aqueous solutions was not the same. The concentration of several metabolites was lower in nectar than in phloem sap indicating selective retention of some metabolites. Furthermore, the existence of antirrhinoside in nectar

  4. [Characteristics of dominant tree species stem sap flow and their relationships with environmental factors in a mixed conifer-broadleaf forest in Dinghushan, Guangdong Province of South China].

    PubMed

    Huang, De-Wei; Zhang, De-Qiang; Zhou, Guo-Yi; Liu, Shi-Zhong; Otieno, Dennis; Li, Yue-Lin

    2012-05-01

    By the method of Granier' s thermal dissipation probe, the stem sap flow density of four dominant tree species (Pinus massoniana, Castanopsis chinensis, Schima superba, and Machilus kwangtungensis) in a mixed conifer-broadleaf forest in Dinghushan Reserve of South China was continuously measured in the dry season (November) and wet season (July) in 2010, and the environmental factors including air temperature, relative humidity, and photosynthetically active radiation (PAR) were measured synchronically, aimed to study the characteristics of the stem sap flow of the tree species in response to environmental factors. During the dry and wet seasons, the diurnal changes of the stem sap flow velocity of the tree species all presented a typical single-peak curve, with high values in the daytime and low values in the nighttime. The average and maximum sap flow velocities and the daily sap flow flux of broad-leaved trees (C. chinensis, S. superba, and M. kwangtungensis) were significantly higher than those of coniferous tree (P. massoniana), and the maximum sap flow velocity of P. massoniana, C. valueschinensis, S. superba, and M. kwangtungensis was 29.48, 38.54, 51.67 and 58.32 g H2O x m(-2) x s(-1), respectively. A time lag was observed between the sap flow velocity and the diurnal variations of PAR, vapor pressure deficiency, and air temperature, and there existed significant positive correlations between the sap flow velocity and the three environmental factors. The PAR in wet season and the air temperature in dry season were the leading factors affecting the stem sap flow velocity of the dominant tree species.

  5. Activating AMP-activated protein kinase (AMPK) slows renal cystogenesis.

    PubMed

    Takiar, Vinita; Nishio, Saori; Seo-Mayer, Patricia; King, J Darwin; Li, Hui; Zhang, Li; Karihaloo, Anil; Hallows, Kenneth R; Somlo, Stefan; Caplan, Michael J

    2011-02-08

    Renal cyst development and expansion in autosomal dominant polycystic kidney disease (ADPKD) involves both fluid secretion and abnormal proliferation of cyst-lining epithelial cells. The chloride channel of the cystic fibrosis transmembrane conductance regulator (CFTR) participates in secretion of cyst fluid, and the mammalian target of rapamycin (mTOR) pathway may drive proliferation of cyst epithelial cells. CFTR and mTOR are both negatively regulated by AMP-activated protein kinase (AMPK). Metformin, a drug in wide clinical use, is a pharmacological activator of AMPK. We find that metformin stimulates AMPK, resulting in inhibition of both CFTR and the mTOR pathways. Metformin induces significant arrest of cystic growth in both in vitro and ex vivo models of renal cystogenesis. In addition, metformin administration produces a significant decrease in the cystic index in two mouse models of ADPKD. Our results suggest a possible role for AMPK activation in slowing renal cystogenesis as well as the potential for therapeutic application of metformin in the context of ADPKD.

  6. Complement-dependent acute-phase expression of C-reactive protein and serum amyloid P-component.

    PubMed

    Szalai, A J; van Ginkel, F W; Wang, Y; McGhee, J R; Volanakis, J E

    2000-07-15

    The acute-phase response (APR) is regulated by TNF-alpha, IL-1beta, and IL-6 acting alone, in combination, or in concert with hormones. The anaphylotoxin C5a, generated during complement activation, induces in vitro the synthesis of these cytokines by leukocytes and of acute-phase proteins by HepG2 cells. However, there is no clear evidence for a role of C5a or any other complement activation product in regulation of the APR in vivo. In this study, using human C-reactive protein (CRP) transgenic mice deficient in C3 or C5, we investigated whether complement activation contributes to induction of the acute-phase proteins CRP and serum amyloid P-component (SAP). Absence of C3 or C5 resulted in decreased LPS-induced up-regulation of the CRP transgene and the mouse SAP gene. Also, LPS induced both the IL-1beta and IL-6 genes in normocomplementemic mice, but in complement-deficient mice it significantly induced only IL-6. Like LPS injection, activation of complement by cobra venom factor led to significant elevation of serum CRP and SAP in normocomplementemic mice but not in complement-deficient mice. Injection of recombinant human C5a into human CRP transgenic mice induced the IL-1beta gene and caused significant elevation of both serum CRP and SAP. However, in human CRP transgenic IL-6-deficient mice, recombinant human C5a did not induce the CRP nor the SAP gene. Based on these data, we conclude that during the APR, C5a generated as a consequence of complement activation acts in concert with IL-6 and/or IL-1beta to promote up-regulation of the CRP and SAP genes.

  7. Human carotid atherosclerotic plaque protein(s) change HDL protein(s) composition and impair HDL anti-oxidant activity.

    PubMed

    Cohen, Elad; Aviram, Michael; Khatib, Soliman; Volkova, Nina; Vaya, Jacob

    2016-01-01

    High density lipoprotein (HDL) anti-atherogenic functions are closely associated with cardiovascular disease risk factor, and are dictated by its composition, which is often affected by environmental factors. The present study investigates the effects of the human carotid plaque constituents on HDL composition and biological functions. To this end, human carotid plaques were homogenized and incubated with HDL. Results showed that after incubation, most of the apolipoprotein A1 (Apo A1) protein was released from the HDL, and HDL diameter increased by an average of approximately 2 nm. In parallel, HDL antioxidant activity was impaired. In response to homogenate treatment HDL could not prevent the accelerated oxidation of LDL caused by the homogenate. Boiling of the homogenate prior to its incubation with HDL abolished its effects on HDL composition changes. Moreover, tryptophan fluorescence quenching assay revealed an interaction between plaque component(s) and HDL, an interaction that was reduced by 50% upon using pre-boiled homogenate. These results led to hypothesize that plaque protein(s) interacted with HDL-associated Apo A1 and altered the HDL composition. Immuno-precipitation of Apo A1 that was released from the HDL after its incubation with the homogenate revealed a co-precipitation of three isomers of actin. However, beta-actin alone did not significantly affect the HDL composition, and yet the active protein within the plaque was elusive. In conclusion then, protein(s) in the homogenate interact with HDL protein(s), leading to release of Apo A1 from the HDL particle, a process that was associated with an increase in HDL diameter and with impaired HDL anti-oxidant activity.

  8. No association between GSTM1 and GSTT1 genetic polymorphisms and susceptibility to opium sap dependence

    PubMed Central

    Saify, Khyber; Khalighinasab, Mohammad Rashid; Saadat, Mostafa

    2016-01-01

    Glutathione S-transferases (GSTs; EC: 2.5.1.18) are a ubiquitous family of eukaryotic and prokaryotic phase II metabolic isozymes. Genes encoding GSTM1 (OMIM: 138350), and GSTT1 (OMIM: 600436) are members of class mu and theta, respectively. The most common polymorphism in the GSTM1 is a deletion of the whole GSTM1 gene with a lack of enzyme activity. A homozygous deletion in the GSTT1 has also been reported (null genotypes of GSTT1). The aim of the present study was to investigate the association between GSTM1 and GSTT1 polymorphisms and risk of dependency to opium sap. The present study was performed in Shiraz (southern Iran). In total, 71 males dependent to opium sap and 590 healthy males (as a control group) were included in this study. The genotypes of GSTM1 and GSTT1 polymorphisms were determined by PCR. Our data indicate that neither GSTM1 (OR=0.78, 95% CI: 0.47-1.27, P=0.325) nor GSTT1 (OR=1.25, 95% CI: 0.70-2.21, P=0.442) null genotypes significantly associated with the risk of opium sap dependence. There is no additive effect of the null genotypes of GSTT1 and GSTM1 in relation to the risk of dependency to opium sap. The present study indicated that the null genotypes of GSTT1 and GSTM1 are not risk factor for opium sap dependence. PMID:27844021

  9. No association between GSTM1 and GSTT1 genetic polymorphisms and susceptibility to opium sap dependence.

    PubMed

    Saify, Khyber; Khalighinasab, Mohammad Rashid; Saadat, Mostafa

    2016-03-01

    Glutathione S-transferases (GSTs; EC: 2.5.1.18) are a ubiquitous family of eukaryotic and prokaryotic phase II metabolic isozymes. Genes encoding GSTM1 (OMIM: 138350), and GSTT1 (OMIM: 600436) are members of class mu and theta, respectively. The most common polymorphism in the GSTM1 is a deletion of the whole GSTM1 gene with a lack of enzyme activity. A homozygous deletion in the GSTT1 has also been reported (null genotypes of GSTT1). The aim of the present study was to investigate the association between GSTM1 and GSTT1 polymorphisms and risk of dependency to opium sap. The present study was performed in Shiraz (southern Iran). In total, 71 males dependent to opium sap and 590 healthy males (as a control group) were included in this study. The genotypes of GSTM1 and GSTT1 polymorphisms were determined by PCR. Our data indicate that neither GSTM1 (OR=0.78, 95% CI: 0.47-1.27, P=0.325) nor GSTT1 (OR=1.25, 95% CI: 0.70-2.21, P=0.442) null genotypes significantly associated with the risk of opium sap dependence. There is no additive effect of the null genotypes of GSTT1 and GSTM1 in relation to the risk of dependency to opium sap. The present study indicated that the null genotypes of GSTT1 and GSTM1 are not risk factor for opium sap dependence.

  10. Transcription activation by the adenovirus E1a protein

    NASA Astrophysics Data System (ADS)

    Lillie, James W.; Green, Michael R.

    1989-03-01

    The adenovirus Ela protein stimulates transcription of a wide variety of viral and cellular genes. It is shown here that Ela has the two functions characteristic of a typical cellular activator: one direct Ela to the promoter, perhaps by interacting with a DMA-bound protein, and the other, an activating region, enables the bound activator to stimulate transcription.

  11. 30 CFR 285.613 - How will MMS process my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false How will MMS process my SAP? 285.613 Section... MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided... be complex or significant; (2) We will notify you if your submitted SAP lacks any...

  12. 30 CFR 285.610 - What must I include in my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I include in my SAP? 285.610 Section... Requirements Contents of the Site Assessment Plan § 285.610 What must I include in my SAP? Your SAP must... SAP, you must provide the following information: ER29AP09.115 (b) You must provide the results...

  13. Sapflow+: a four-needle heat-pulse sap flow sensor enabling nonempirical sap flux density and water content measurements.

    PubMed

    Vandegehuchte, Maurits W; Steppe, Kathy

    2012-10-01

    • To our knowledge, to date, no nonempirical method exists to measure reverse, low or high sap flux density. Moreover, existing sap flow methods require destructive wood core measurements to determine sapwood water content, necessary to convert heat velocity to sap flux density, not only damaging the tree, but also neglecting seasonal variability in sapwood water content. • Here, we present a nonempirical heat-pulse-based method and coupled sensor which measure temperature changes around a linear heater in both axial and tangential directions after application of a heat pulse. By fitting the correct heat conduction-convection equation to the measured temperature profiles, the heat velocity and water content of the sapwood can be determined. • An identifiability analysis and validation tests on artificial and real stem segments of European beech (Fagus sylvatica L.) confirm the applicability of the method, leading to accurate determinations of heat velocity, water content and hence sap flux density. • The proposed method enables sap flux density measurements to be made across the entire natural occurring sap flux density range of woody plants. Moreover, the water content during low flows can be determined accurately, enabling a correct conversion from heat velocity to sap flux density without destructive core measurements.

  14. DNA helicase activity in purified human RECQL4 protein.

    PubMed

    Suzuki, Takahiro; Kohno, Toshiyuki; Ishimi, Yukio

    2009-09-01

    Human RECQL4 protein was expressed in insect cells using a baculovirus protein expression system and it was purified to near homogeneity. The protein sedimented at a position between catalase (230 kDa) and ferritin (440 kDa) in glycerol gradient centrifugation, suggesting that it forms homo-multimers. Activity to displace annealed 17-mer oligonucleotide in the presence of ATP was co-sedimented with hRECQL4 protein. In ion-exchange chromatography, both DNA helicase activity and single-stranded DNA-dependent ATPase activity were co-eluted with hRECQL4 protein. The requirements of ATP and Mg for the helicase activity were different from those for the ATPase activity. The data suggest that the helicase migrates on single-stranded DNA in a 3'-5' direction. These results suggest that the hRECQL4 protein exhibits DNA helicase activity.

  15. Trithorax group proteins: switching genes on and keeping them active.

    PubMed

    Schuettengruber, Bernd; Martinez, Anne-Marie; Iovino, Nicola; Cavalli, Giacomo

    2011-11-23

    Cellular memory is provided by two counteracting groups of chromatin proteins termed Trithorax group (TrxG) and Polycomb group (PcG) proteins. TrxG proteins activate transcription and are perhaps best known because of the involvement of the TrxG protein MLL in leukaemia. However, in terms of molecular analysis, they have lived in the shadow of their more famous counterparts, the PcG proteins. Recent advances have improved our understanding of TrxG protein function and demonstrated that the heterogeneous group of TrxG proteins is of critical importance in the epigenetic regulation of the cell cycle, senescence, DNA damage and stem cell biology.

  16. Sap Flow Sensors: Construction, Quality Control and Comparison

    PubMed Central

    Davis, Tyler W.; Kuo, Chen-Min; Liang, Xu; Yu, Pao-Shan

    2012-01-01

    This work provides a design for two types of sensors, based on the thermal dissipation and heat ratio methods of sap flow calculation, for moderate to large scale deployments for the purpose of monitoring tree transpiration. These designs include a procedure for making these sensors, a quality control method for the final products, and a complete list of components with vendors and pricing information. Both sensor designs were field tested alongside a commercial sap flow sensor to assess their performance and show the importance for quality controlling the sensor outputs. Results show that for roughly 2% of the cost of commercial sensors, self-made sap flow sensors can provide acceptable estimates of the sap flow measurements compared to the commercial sensors. PMID:22368504

  17. Sap flow sensors: construction, quality control and comparison.

    PubMed

    Davis, Tyler W; Kuo, Chen-Min; Liang, Xu; Yu, Pao-Shan

    2012-01-01

    This work provides a design for two types of sensors, based on the thermal dissipation and heat ratio methods of sap flow calculation, for moderate to large scale deployments for the purpose of monitoring tree transpiration. These designs include a procedure for making these sensors, a quality control method for the final products, and a complete list of components with vendors and pricing information. Both sensor designs were field tested alongside a commercial sap flow sensor to assess their performance and show the importance for quality controlling the sensor outputs. Results show that for roughly 2% of the cost of commercial sensors, self-made sap flow sensors can provide acceptable estimates of the sap flow measurements compared to the commercial sensors.

  18. [Increased fibrinolytic activity during cardiopulmonary bypass is caused by activated protein C system].

    PubMed

    Gando, S; Tedo, I; Masio, H; Goda, Y; Kawahigashi, H

    1994-06-01

    To examine the hypothesis that activated protein C system during cardiopulmonary bypass surgery may increase fibrinolytic activity during cardiopulmonary bypass, protein C activity, protein C antigen and thrombomodulin of sixteen patients undergoing elective cardiopulmonary bypass surgery were investigated after induction of anesthesia, before and after cardiopulmonary bypass, and at the end of operation. Protein C activity decreased and thrombomodulin increased significantly after the cardiopulmonary bypass. There were no significant correlations of thrombomodulin with protein C activity and protein C antigen. In conclusion, we have demonstrated that protein C system is activated and circulating thrombomodulin appears in the systemic circulation during cardiopulmonary bypass surgery and this enhanced activation of protein C system is possibly related to the reported increase of fibrinolytic activity during cardiopulmonary bypass.

  19. Effect of microgravity on sap flow in plant stems

    NASA Astrophysics Data System (ADS)

    Kitaya, Yoshiaki; Hirai, Hiroaki; Nobol Ikeda, MR..

    2012-07-01

    A fundamental study was conducted to assess the possibility of plant growth suppression caused by poor movement of air in closed plant growth facilities in space farming. Sap water flow in plant stems, which plays an important role to transport fluid and nutrients from roots to leaves, will be suppressed through suppression of transpiration because of little natural convection of air under microgravity conditions. In this study, the sap flow in tomato stems was examined using a heat flow method at 0.01 and 1.0 g for 20 seconds each during parabolic airplane flights in order to clarify the effect of microgravity on the sap flow in stems. Heat generated with a tiny heater installed in the stem was transferred upstream and downstream by conduction and upstream by the sap flow through xylems of the vascular tissue. The internal heat convection corresponding to the sap flow was analyzed with thermal images captured on stems near heated points. In results, the sap flow in stems at 0.01 g was suppressed under a retarded air condition at a wind speed of 0.1 m s-1 compared with that at 1 g. No suppression of the sap flow was observed under a stirred air condition at a wind speed of 0.5 m s-1. Suppressed sap water flow in stems would be caused by suppression of transpiration in leaves and would cause restriction of water and nutrient uptake in roots. The forced air movement is, therefore, essential to culture healthy plants at a high growth rate under microgravity conditions in space.

  20. Identification of highly active flocculant proteins in bovine blood.

    PubMed

    Piazza, George J; Nuñez, Alberto; Garcia, Rafael A

    2012-03-01

    Synthetic polymeric flocculants are used extensively for wastewater remediation, soil stabilization, and reduction in water leakage from unlined canals. Sources of highly active, inexpensive, renewable flocculants are needed to replace synthetic flocculants. High kaolin flocculant activity was documented for bovine blood (BB) and blood plasma with several anticoagulant treatments. BB serum also had high flocculant activity. To address the hypothesis that some blood proteins have strong flocculating activity, the BB proteins were separated by SEC. Then, the major proteins of the flocculant-active fractions were separated by SDS-PAGE. Identity of the major protein components was determined by tryptic digestion and peptide analysis by MALDI TOF MS. The sequence of selected peptides was confirmed using TOF/TOF-MS/MS fragmentation. Hemoglobin dimer (subunits α and β) was identified as the major protein component of the active fraction in BB; its high flocculation activity was confirmed by testing a commercial sample of hemoglobin. In the same manner, three proteins from blood plasma (fibrinogen, γ-globulin, α-2-macroglobulin) were found to be highly active flocculants, but bovine serum albumin, α-globulin, and β-globulin were not flocculants. On a mass basis, hemoglobin, γ-globulin, α-2-macroglobulin were as effective as anionic polyacrylamide (PAM), a widely used synthetic flocculant. The blood proteins acted faster than PAM, and unlike PAM, the blood proteins flocculants did not require calcium salts for their activity.

  1. Limitations in the use of ozone to disinfect maple sap.

    PubMed

    Labbe, R G; Kinsley, M; Wu, J

    2001-01-01

    The sap of the maple sugar tree (Acer saccharum) contains 2 to 3% sucrose and is traditionally collected early in the year and concentrated by boiling to produce maple syrup. High levels of microorganisms in the sap occur during holding, leading to a darker syrup with lower economic value. We investigated the use of dissolved ozone as a method to reduce the microbial population in sap. After 40 min of ozone treatment, concentrations of up to 0.30 mg/liter were achieved but were ineffective in reducing the aerobic plate count. Three predominant colonies on nutrient agar were selected for isolation and identification from sap. These included one mucoid and one nonmucoid yeast, both identified as Candida, and Pseudomonas fluorescens. When suspended in buffer, each was readily inactivated by ozone. Addition of 3% sucrose to the buffer markedly reduced the effectiveness of ozone. With the use of an ozone generator with a larger ozone output, saturating ozone concentrations (1 mg/liter) were achieved within 5 min but were accompanied by only a 1-log reduction in aerobic plate count of maple sap. After 40 min of ozone treatment, a less than 3-log reduction occurred. The results indicate that, because of the presence of sucrose, ozone may be of limited use in reducing the microbial population in sap.

  2. BCM-95 and (2-hydroxypropyl)-β-cyclodextrin reverse autophagy dysfunction and deplete stored lipids in Sap C-deficient fibroblasts.

    PubMed

    Tatti, Massimo; Motta, Marialetizia; Scarpa, Susanna; Di Bartolomeo, Sabrina; Cianfanelli, Valentina; Tartaglia, Marco; Salvioli, Rosa

    2015-08-01

    Saposin (Sap) C deficiency is a rare variant form of Gaucher disease caused by impaired Sap C expression or accelerated degradation, and associated with accumulation of glucosylceramide and other lipids in the endo/lysosomal compartment. No effective therapies are currently available for the treatment of Sap C deficiency. We previously reported that a reduced amount and enzymatic activity of cathepsin (Cath) B and Cath D, and defective autophagy occur in Sap C-deficient fibroblasts. Here, we explored the use of two compounds, BCM-95, a curcumin derivative, and (2-hydroxypropyl)-β-cyclodextrin (HP-β-CD), to improve lysosomal function of Sap C-deficient fibroblasts. Immunofluorescence and biochemical studies documented that each compound promotes an increase of the expression levels and activities of Cath B and Cath D, and efficient clearance of cholesterol (Chol) and ceramide (Cer) in lysosomes. We provide evidence that BCM-95 and HP-β-CD enhance lysosomal function promoting autophagic clearance capacity and lysosome reformation. Our findings suggest a novel pharmacological approach to Sap C deficiency directed to treat major secondary pathological aspects in this disorder.

  3. Global Analysis of Protein Activities Using Proteome Chips

    NASA Astrophysics Data System (ADS)

    Zhu, Heng; Bilgin, Metin; Bangham, Rhonda; Hall, David; Casamayor, Antonio; Bertone, Paul; Lan, Ning; Jansen, Ronald; Bidlingmaier, Scott; Houfek, Thomas; Mitchell, Tom; Miller, Perry; Dean, Ralph A.; Gerstein, Mark; Snyder, Michael

    2001-09-01

    To facilitate studies of the yeast proteome, we cloned 5800 open reading frames and overexpressed and purified their corresponding proteins. The proteins were printed onto slides at high spatial density to form a yeast proteome microarray and screened for their ability to interact with proteins and phospholipids. We identified many new calmodulin- and phospholipid-interacting proteins; a common potential binding motif was identified for many of the calmodulin-binding proteins. Thus, microarrays of an entire eukaryotic proteome can be prepared and screened for diverse biochemical activities. The microarrays can also be used to screen protein-drug interactions and to detect posttranslational modifications.

  4. Validation of the scale on Satisfaction of Adolescents with Postoperative pain management – idiopathic Scoliosis (SAP-S)

    PubMed Central

    Khadra, Christelle; Le May, Sylvie; Ballard, Ariane; Théroux, Jean; Charette, Sylvie; Villeneuve, Edith; Parent, Stefan; Tsimicalis, Argerie; MacLaren Chorney, Jill

    2017-01-01

    Background Spinal fusion is a common orthopedic surgery in children and adolescents and is associated with high pain levels postoperatively. If the pain is not well managed, negative outcomes may ensue. To our knowledge, there is no measure in English that assesses patient’s satisfaction with postoperative pain management following idiopathic scoliosis surgery. The aim of the present study was to assess the psychometric properties of the satisfaction subscale of the English version of the Satisfaction of Adolescents with Postoperative pain management – idiopathic Scoliosis (SAP-S) scale. Methods Eighty-two participants aged 10–18 years, who had undergone spinal fusion surgery, fully completed the SAP-S scale at 10–14 days postdischarge. Construct validity was assessed through a principal component analysis using varimax rotation. Results Principal component analysis indicated a three-factor structure of the 13-item satisfaction subscale of the SAP-S scale. Factors referred to satisfaction regarding current medication received (Factor 1), actions taken by nurses and doctors to manage pain (Factor 2) and information received after surgery (Factor 3). Cronbach’s alpha was 0.91, showing very good internal consistency. Data on satisfaction and clinical outcomes were also reported. Conclusion The SAP-S is a valid and reliable measure of satisfaction with postoperative pain management that can be used in both research and clinical settings to improve pain management practices. Although it was developed and validated with adolescents who had undergone spinal fusion surgery, it can be used, with further validation, to assess adolescents’ satisfaction with pain management in other postoperative contexts. PMID:28138264

  5. Aphid salivary proteases are capable of degrading sieve-tube proteins.

    PubMed

    Furch, Alexandra C U; van Bel, Aart J E; Will, Torsten

    2015-02-01

    Sieve tubes serve as transport conduits for photo-assimilates and other resources in angiosperms and are profitable targets for piercing-sucking insects such as aphids. Sieve-tube sap also contains significant amounts of proteins with diverse functions, for example in signalling, metabolism, and defence. The identification of salivary proteases in Acyrthosiphon pisum led to the hypothesis that aphids might be able to digest these proteins and by doing so suppress plant defence and access additional nitrogen sources. Here, the scarce knowledge of proteases in aphid saliva is briefly reviewed. In order to provide a better platform for discussion, we conducted a few tests on in vitro protease activity and degradation of sieve-tube sap proteins of Cucurbita maxima by watery saliva. Inhibition of protein degradation by EDTA indicates the presence of different types of proteases (e.g. metalloproteses) in saliva of A. pisum. Proteases in the watery saliva from Macrosiphum euphorbiae and A. pisum were able to degrade the most abundant phloem protein, which is phloem protein 1. Our results provide support for the breakdown of sieve-element proteins by aphid saliva in order to suppress/neutralize the defence responses of the plant and to make proteins of sieve-tube sap accessible as a nitrogen source, as is discussed in detail. Finally, we discuss whether glycosylation of sieve-element proteins and the presence of protease inhibitors may confer partial protection against the proteolytic activity of aphid saliva.

  6. Radial variation in sap velocity as a function of stem diameter and sapwood thickness in yellow-poplar trees.

    PubMed

    Wullschleger, Stan D.; King, Anthony W.

    2000-04-01

    Canopy transpiration and forest water use are frequently estimated as the product of sap velocity and cross-sectional sapwood area. Few studies, however, have considered whether radial variation in sap velocity and the proportion of sapwood active in water transport are significant sources of uncertainty in the extrapolation process. Therefore, radial profiles of sap velocity were examined as a function of stem diameter and sapwood thickness for yellow-poplar (Liriodendron tulipifera L.) trees growing on two adjacent watersheds in eastern Tennessee. The compensation heat pulse velocity technique was used to quantify sap velocity at four equal-area depths in 20 trees that ranged in stem diameter from 15 to 69 cm, and in sapwood thickness from 2.1 to 14.8 cm. Sap velocity was highly dependent on the depth of probe insertion into the sapwood. Rates of sap velocity were greatest for probes located in the two outer sapwood annuli (P1 and P2) and lowest for probes in closest proximity to the heartwood (P3 and P4). Relative sap velocities averaged 0.98 at P1, 0.66 at P2, 0.41 at P3 and 0.35 at P4. Tree-specific sap velocities measured at each of the four probe positions, divided by the maximum sap velocity measured (usually at P1 or P2), indicated that the fraction of sapwood functional in water transport (f(S)) varied between 0.49 and 0.96. There was no relationship between f(S) and sapwood thickness, or between f(S) and stem diameter. The fraction of functional sapwood averaged 0.66 +/- 0.13 for trees on which radial profiles were determined. No significant depth-related differences were observed for sapwood density, which averaged 469 kg m(-3) across all four probe positions. There was, however, a significant decline in sapwood water content between the two outer probe positions (1.04 versus 0.89 kg kg(-1)). This difference was not sufficient to account for the observed radial variation in sap velocity. A Monte-Carlo analysis indicated that the standard error in

  7. Gc protein (vitamin D-binding protein): Gc genotyping and GcMAF precursor activity.

    PubMed

    Nagasawa, Hideko; Uto, Yoshihiro; Sasaki, Hideyuki; Okamura, Natsuko; Murakami, Aya; Kubo, Shinichi; Kirk, Kenneth L; Hori, Hitoshi

    2005-01-01

    The Gc protein (human group-specific component (Gc), a vitamin D-binding protein or Gc globulin), has important physiological functions that include involvement in vitamin D transport and storage, scavenging of extracellular G-actin, enhancement of the chemotactic activity of C5a for neutrophils in inflammation and macrophage activation (mediated by a GalNAc-modified Gc protein (GcMAF)). In this review, the structure and function of the Gc protein is focused on especially with regard to Gc genotyping and GcMAF precursor activity. A discussion of the research strategy "GcMAF as a target for drug discovery" is included, based on our own research.

  8. AKAP-Lbc nucleates a protein kinase D activation scaffold.

    PubMed

    Carnegie, Graeme K; Smith, F Donelson; McConnachie, George; Langeberg, Lorene K; Scott, John D

    2004-09-24

    The transmission of cellular signals often proceeds through multiprotein complexes where enzymes are positioned in proximity to their upstream activators and downstream substrates. In this report we demonstrate that the A-kinase anchoring protein AKAP-Lbc assembles an activation complex for the lipid-dependent enzyme protein kinase D (PKD). Using a combination of biochemical, enzymatic, and immunofluorescence techniques, we show that the anchoring protein contributes to PKD activation in two ways: it recruits an upstream kinase PKCeta and coordinates PKA phosphorylation events that release activated protein kinase D. Thus, AKAP-Lbc synchronizes PKA and PKC activities in a manner that leads to the activation of a third kinase. This configuration illustrates the utility of kinase anchoring as a mechanism to constrain the action of broad-spectrum enzymes.

  9. Impact of LbSapSal Vaccine in Canine Immunological and Parasitological Features before and after Leishmania chagasi-Challenge

    PubMed Central

    Resende, Lucilene Aparecida; Aguiar-Soares, Rodrigo Dian de Oliveira; Gama-Ker, Henrique; Roatt, Bruno Mendes; de Mendonça, Ludmila Zanandreis; Alves, Marina Luiza Rodrigues; da Silveira-Lemos, Denise; Corrêa-Oliveira, Rodrigo; Martins-Filho, Olindo Assis; Araújo, Márcio Sobreira Silva; Fujiwara, Ricardo Toshio; Gontijo, Nelder Figueiredo; Reis, Alexandre Barbosa; Giunchetti, Rodolfo Cordeiro

    2016-01-01

    Dogs represent the most important domestic reservoir of L. chagasi (syn. L. infantum). A vaccine against canine visceral leishmaniasis (CVL) would be an important tool for decreasing the anxiety related to possible L. chagasi infection and for controlling human visceral leishmaniasis (VL). Because the sand fly salivary proteins are potent immunogens obligatorily co-deposited during transmission of Leishmania parasites, their inclusion in an anti-Leishmania vaccine has been investigated in past decades. We investigated the immunogenicity of the “LbSapSal” vaccine (L. braziliensis antigens, saponin as adjuvant, and Lutzomyia longipalpis salivary gland extract) in dogs at baseline (T0), during the post-vaccination protocol (T3rd) and after early (T90) and late (T885) times following L. chagasi-challenge. Our major data indicated that immunization with “LbSapSal” is able to induce biomarkers characterized by enhanced amounts of type I (tumor necrosis factor [TNF]-α, interleukin [IL]-12, interferon [IFN]-γ) cytokines and reduction in type II cytokines (IL-4 and TGF-β), even after experimental challenge. The establishment of a prominent pro-inflammatory immune response after “LbSapSal” immunization supported the increased levels of nitric oxide production, favoring a reduction in spleen parasitism (78.9%) and indicating long-lasting protection against L. chagasi infection. In conclusion, these results confirmed the hypothesis that the “LbSapSal” vaccination is a potential tool to control the Leishmania chagasi infection. PMID:27556586

  10. Impact of LbSapSal Vaccine in Canine Immunological and Parasitological Features before and after Leishmania chagasi-Challenge.

    PubMed

    Resende, Lucilene Aparecida; Aguiar-Soares, Rodrigo Dian de Oliveira; Gama-Ker, Henrique; Roatt, Bruno Mendes; Mendonça, Ludmila Zanandreis de; Alves, Marina Luiza Rodrigues; Silveira-Lemos, Denise da; Corrêa-Oliveira, Rodrigo; Martins-Filho, Olindo Assis; Araújo, Márcio Sobreira Silva; Fujiwara, Ricardo Toshio; Gontijo, Nelder Figueiredo; Reis, Alexandre Barbosa; Giunchetti, Rodolfo Cordeiro

    2016-01-01

    Dogs represent the most important domestic reservoir of L. chagasi (syn. L. infantum). A vaccine against canine visceral leishmaniasis (CVL) would be an important tool for decreasing the anxiety related to possible L. chagasi infection and for controlling human visceral leishmaniasis (VL). Because the sand fly salivary proteins are potent immunogens obligatorily co-deposited during transmission of Leishmania parasites, their inclusion in an anti-Leishmania vaccine has been investigated in past decades. We investigated the immunogenicity of the "LbSapSal" vaccine (L. braziliensis antigens, saponin as adjuvant, and Lutzomyia longipalpis salivary gland extract) in dogs at baseline (T0), during the post-vaccination protocol (T3rd) and after early (T90) and late (T885) times following L. chagasi-challenge. Our major data indicated that immunization with "LbSapSal" is able to induce biomarkers characterized by enhanced amounts of type I (tumor necrosis factor [TNF]-α, interleukin [IL]-12, interferon [IFN]-γ) cytokines and reduction in type II cytokines (IL-4 and TGF-β), even after experimental challenge. The establishment of a prominent pro-inflammatory immune response after "LbSapSal" immunization supported the increased levels of nitric oxide production, favoring a reduction in spleen parasitism (78.9%) and indicating long-lasting protection against L. chagasi infection. In conclusion, these results confirmed the hypothesis that the "LbSapSal" vaccination is a potential tool to control the Leishmania chagasi infection.

  11. Regulation of the activity of protein kinases by endogenous heat stable protein inhibitors.

    PubMed

    Szmigielski, A

    1985-01-01

    Protein kinase activities are regulated by endogenous thermostable protein inhibitors. Type I inhibitor is a protein of MW 22,000-24,000 which inhibits specifically cyclic AMP-(cAMP) dependent protein kinase (APK) as a competitive inhibitor of catalytic subunits of the enzyme. Type I inhibitor activity changes inversely according to the activation of adenylate cyclase and the changes in cAMP content in tissues. It seems that type I inhibitor serves as a factor preventing spontaneous cAMP-dependent phosphorylation in unstimulated cell. The other thermostable protein which inhibits APK activity has been found in Sertoli cell-enriched testis (testis inhibitor). Physiological role of the testis inhibitor is unknown. Type II inhibitor is a protein of MW 15,000 which blocks phosphorylation mediated by cAMP and cyclic GMP (cGMP) dependent (APK and GPK) and cyclic nucleotide independent protein kinases as a competitive inhibitor of substrate proteins. Activity of this inhibitor specifically changes in reciprocal manner to the changes in cGMP content. It seems that type II inhibitor serves as a factor preventing the phosphorylation catalyzed by GPK when cGMP content is low. Stimulation of guanylate cyclase and activation of GPK is followed by a decrease of type II inhibitor activity. This change in relationship between activities of GPK and type II inhibitor allows for effective phosphorylation catalyzed by this enzyme when cGMP content is increased.

  12. The specific activation of TRPC4 by Gi protein subtype.

    PubMed

    Jeon, Jae-Pyo; Lee, Kyu Pil; Park, Eun Jung; Sung, Tae Sik; Kim, Byung Joo; Jeon, Ju-Hong; So, Insuk

    2008-12-12

    The classical type of transient receptor potential channel (TRPC) is a molecular candidate for Ca(2+)-permeable cation channels in mammalian cells. Especially, TRPC4 has the similar properties to Ca(2+)-permeable nonselective cation channels (NSCCs) activated by muscarinic stimulation in visceral smooth muscles. In visceral smooth muscles, NSCCs activated by muscarinic stimulation were blocked by anti-Galphai/o antibodies. However, there is still no report which Galpha proteins are involved in the activation process of TRPC4. Among Galpha proteins, only Galphai protein can activate TRPC4 channel. The activation effect of Galphai was specific for TRPC4 because Galphai has no activation effect on TRPC5, TRPC6 and TRPV6. Coexpression with muscarinic receptor M2 induced TRPC4 current activation by muscarinic stimulation with carbachol, which was inhibited by pertussis toxin. These results suggest that Galphai is involved specifically in the activation of TRPC4.

  13. Protein Crystal Growth Activities on STS-42

    NASA Technical Reports Server (NTRS)

    1992-01-01

    The Protein Crystal Growth (PCG) middeck payload is currently manifested to fly on STS-42 in January 1992. This payload is a joint effort between NASA s Office of Commercial Programs (OCP) and Office of Space Science and Applications (OSSA). The PCG experiments are managed by the Center for Macromolecular Crystallography (CMC), a NASA Center for the Commercial Development of Space (CCDS) based at the University of Alabama at Birmingham (UAB). This is the eighth flight of a payload in the PCG program that is jointly sponsored by the OCP and the OSSA. The flight hardware for STS-42 includes six Vapor Diffusion Apparatus (VDA) trays stored in two Refrigerator/Incubator Modules (R/TM s). The VDA trays will simultaneously conduct 120 experiments involving 15 different protein compounds, four of which are sponsored by the OCP, the UAB CCDS, and four co-investigators.

  14. Breadboard activities for advanced protein crystal growth

    NASA Technical Reports Server (NTRS)

    Rosenberger, Franz; Banish, Michael

    1993-01-01

    The proposed work entails the design, assembly, testing, and delivery of a turn-key system for the semi-automated determination of protein solubilities as a function of temperature. The system will utilize optical scintillation as a means of detecting and monitoring nucleation and crystallite growth during temperature lowering (or raising, with retrograde solubility systems). The deliverables of this contract are: (1) turn-key scintillation system for the semi-automatic determination of protein solubilities as a function of temperature, (2) instructions and software package for the operation of the scintillation system, and (3) one semi-annual and one final report including the test results obtained for ovostatin with the above scintillation system.

  15. Transition state analogues in structures of ricin and saporin ribosome-inactivating proteins

    SciTech Connect

    Ho, Meng-Chiao; Sturm, Matthew B.; Almo, Steven C.; Schramm, Vern L.

    2010-01-12

    Ricin A-chain (RTA) and saporin-L1 (SAP) catalyze adenosine depurination of 28S rRNA to inhibit protein synthesis and cause cell death. We present the crystal structures of RTA and SAP in complex with transition state analogue inhibitors. These tight-binding inhibitors mimic the sarcin-ricin recognition loop of 28S rRNA and the dissociative ribocation transition state established for RTA catalysis. RTA and SAP share unique purine-binding geometry with quadruple {pi}-stacking interactions between adjacent adenine and guanine bases and 2 conserved tyrosines. An arginine at one end of the {pi}-stack provides cationic polarization and enhanced leaving group ability to the susceptible adenine. Common features of these ribosome-inactivating proteins include adenine leaving group activation, a remarkable lack of ribocation stabilization, and conserved glutamates as general bases for activation of the H{sub 2}O nucleophile. Catalytic forces originate primarily from leaving group activation evident in both RTA and SAP in complex with transition state analogues.

  16. New constitutive latex osmotin-like proteins lacking antifungal activity.

    PubMed

    Freitas, Cleverson D T; Silva, Maria Z R; Bruno-Moreno, Frederico; Monteiro-Moreira, Ana C O; Moreira, Renato A; Ramos, Márcio V

    2015-11-01

    Proteins that share similar primary sequences to the protein originally described in salt-stressed tobacco cells have been named osmotins. So far, only two osmotin-like proteins were purified and characterized of latex fluids. Osmotin from Carica papaya latex is an inducible protein lacking antifungal activity, whereas the Calotropis procera latex osmotin is a constitutive antifungal protein. To get additional insights into this subject, we investigated osmotins in latex fluids of five species. Two potential osmotin-like proteins in Cryptostegia grandiflora and Plumeria rubra latex were detected by immunological cross-reactivity with polyclonal antibodies produced against the C. procera latex osmotin (CpOsm) by ELISA, Dot Blot and Western Blot assays. Osmotin-like proteins were not detected in the latex of Thevetia peruviana, Himatanthus drasticus and healthy Carica papaya fruits. Later, the two new osmotin-like proteins were purified through immunoaffinity chromatography with anti-CpOsm immobilized antibodies. Worth noting the chromatographic efficiency allowed for the purification of the osmotin-like protein belonging to H. drasticus latex, which was not detectable by immunoassays. The identification of the purified proteins was confirmed after MS/MS analyses of their tryptic digests. It is concluded that the constitutive osmotin-like proteins reported here share structural similarities to CpOsm. However, unlike CpOsm, they did not exhibit antifungal activity against Fusarium solani and Colletotrichum gloeosporioides. These results suggest that osmotins of different latex sources may be involved in distinct physiological or defensive events.

  17. SAP- FORTRAN STATIC SOURCE CODE ANALYZER PROGRAM (IBM VERSION)

    NASA Technical Reports Server (NTRS)

    Manteufel, R.

    1994-01-01

    The FORTRAN Static Source Code Analyzer program, SAP, was developed to automatically gather statistics on the occurrences of statements and structures within a FORTRAN program and to provide for the reporting of those statistics. Provisions have been made for weighting each statistic and to provide an overall figure of complexity. Statistics, as well as figures of complexity, are gathered on a module by module basis. Overall summed statistics are also accumulated for the complete input source file. SAP accepts as input syntactically correct FORTRAN source code written in the FORTRAN 77 standard language. In addition, code written using features in the following languages is also accepted: VAX-11 FORTRAN, IBM S/360 FORTRAN IV Level H Extended; and Structured FORTRAN. The SAP program utilizes two external files in its analysis procedure. A keyword file allows flexibility in classifying statements and in marking a statement as either executable or non-executable. A statistical weight file allows the user to assign weights to all output statistics, thus allowing the user flexibility in defining the figure of complexity. The SAP program is written in FORTRAN IV for batch execution and has been implemented on a DEC VAX series computer under VMS and on an IBM 370 series computer under MVS. The SAP program was developed in 1978 and last updated in 1985.

  18. SAP- FORTRAN STATIC SOURCE CODE ANALYZER PROGRAM (DEC VAX VERSION)

    NASA Technical Reports Server (NTRS)

    Merwarth, P. D.

    1994-01-01

    The FORTRAN Static Source Code Analyzer program, SAP, was developed to automatically gather statistics on the occurrences of statements and structures within a FORTRAN program and to provide for the reporting of those statistics. Provisions have been made for weighting each statistic and to provide an overall figure of complexity. Statistics, as well as figures of complexity, are gathered on a module by module basis. Overall summed statistics are also accumulated for the complete input source file. SAP accepts as input syntactically correct FORTRAN source code written in the FORTRAN 77 standard language. In addition, code written using features in the following languages is also accepted: VAX-11 FORTRAN, IBM S/360 FORTRAN IV Level H Extended; and Structured FORTRAN. The SAP program utilizes two external files in its analysis procedure. A keyword file allows flexibility in classifying statements and in marking a statement as either executable or non-executable. A statistical weight file allows the user to assign weights to all output statistics, thus allowing the user flexibility in defining the figure of complexity. The SAP program is written in FORTRAN IV for batch execution and has been implemented on a DEC VAX series computer under VMS and on an IBM 370 series computer under MVS. The SAP program was developed in 1978 and last updated in 1985.

  19. On the role of phosphatidylethanolamine in the inhibition of activated protein C activity by antiphospholipid antibodies.

    PubMed Central

    Smirnov, M D; Triplett, D T; Comp, P C; Esmon, N L; Esmon, C T

    1995-01-01

    Phosphatidylethanolamine (PE) is an important membrane component for supporting activated protein C anticoagulant activity but has little influence on prothrombin activation. This difference constitutes a potential mechanism for selective inhibition of the protein C anticoagulant pathway by lupus anticoagulants and/or antiphospholipid antibodies. In this study, we demonstrate that the presence of PE augments lupus anticoagulant activity. In the plasma of some patients with lupus anticoagulants, activated protein C anticoagulant activity is more potently inhibited than prothrombin activation. As a result, in the presence of activated protein C and PE, these patient plasmas clot faster than normal plasma. Patients with minimal lupus anticoagulant activity are identified whose plasma potently inhibits activated protein C anticoagulant activity. This process is also PE dependent. In three patient plasmas, these phenomena are shown to be due to immunoglobulins. The PE requirement in the expression of activated protein C anticoagulant activity and the PE dependence of some antiphospholipid antibodies provide a mechanistic basis for the selective inhibition of the protein C pathway. Inhibition of activated protein C function may be a common mechanism contributing to increased thrombotic risk in certain patients with antiphospholipid antibodies. PMID:7814631

  20. Expression of proteins and protein kinase activity during germination of aerial spores of Streptomyces granaticolor.

    PubMed

    Mikulík, Karel; Bobek, Jan; Bezousková, Silvia; Benada, Oldrich; Kofronová, Olga

    2002-11-29

    Dormant aerial spores of Streptomyces granaticolor contain pre-existing pool of mRNA and active ribosomes for rapid translation of proteins required for earlier steps of germination. Activated spores were labeled for 30 min with [35S]methionine/cysteine in the presence or absence of rifamycin (400 microg/ml) and resolved by two-dimensional electrophoresis. About 320 proteins were synthesized during the first 30 min of cultivation at the beginning of swelling, before the first DNA replication. Results from nine different experiments performed in the presence of rifamycin revealed 15 protein spots. Transition from dormant spores to swollen spores is not affected by the presence of rifamycin but further development of spores is stopped. To support existence of pre-existing pool of mRNA in spores, cell-free extract of spores (S30 fraction) was used for in vitro protein synthesis. These results indicate that RNA of spores possesses mRNA functionally competent and provides templates for protein synthesis. Cell-free extracts isolated from spores, activated spores, and during spore germination were further examined for in vitro protein phosphorylation. The analyses show that preparation from dormant spores catalyzes phosphorylation of only seven proteins. In the absence of phosphatase inhibitors, several proteins were partially dephosphorylated. The activation of spores leads to a reduction in phosphorylation activity. Results from in vitro phosphorylation reaction indicate that during germination phosphorylation/dephosphorylation of proteins is a complex function of developmental changes.

  1. Adaptor protein Nck1 interacts with p120 Ras GTPase-activating protein and regulates its activity.

    PubMed

    Ger, Marija; Zitkus, Zigmantas; Valius, Mindaugas

    2011-10-01

    Adaptor protein Nck1 binds a number of intracellular proteins and influences various signaling pathways. Here we show that Nck1 directly binds and activates the GTPase-activating protein of Ras (RasGAP), which is responsible for the down-regulation of Ras. The first and the third SH3 domains of Nck1 and the NH(2)-terminal proline-rich sequence of RasGAP contribute most to the complex formation causing direct molecular interaction between the two proteins. Cell adhesion to the substrate is obligatory for the Nck1 and RasGAP association, as cell detachment makes RasGAP incapable of associating with Nck1. This leads to the complex dissipation, decrease of RasGAP activity and the increase of H-Ras-GTP level in the detached cells. Our findings reveal unexpected feature of adaptor protein Nck1 as the regulator of RasGAP activity.

  2. [Radial variation and time lag of sap flow of Populus gansuensis in Minqin Oasis, Northwest].

    PubMed

    Dang, Hong-Zhong; Yang, Wen-Bin; Li, Wei; Zhang, You-Yan; Li, Chang-Long

    2014-09-01

    Sap flow of tree trunk is very important to reflect the dynamics of physiological activities, as well as to estimate the water consumption of individual plant. In the present study, we used the thermal dissipation technique to monitor the sap flow velocity (J) at four depth loci (i. e. 2 cm, 3 cm, 5 cm, 8 cm) of three Populus gansuensis trees (30 year-old) in Minqin Oasis for two consecutive growing seasons. The results showed that there were significant differences among J values at four depth loci under tree trunk cambium. J value at the 3 cm depth locus (J3) of the tree trunk was the highest, and then in sequences, were 2 cm, 5 cm and 8 cm depth loci (J2, J5 and J8). J value (J3) on typical sunny days in June with the highest atmospheric potential evapotranspiration (ET0) was up to 28.53 g · cm(-2) · h(-1), which was 1.42, 2.74 and 4.4 times of J2, J5 and J8, respectively. In the process of diurnal variation of sap flow velocity, the peak value time of J at the four depth loci of the tree trunk was different, but the differences among them were within 20 min. Furthermore, the peak value time of sap flow velocity was very different to that of solar radiation (Rs) and air vapour pressure deficit (VPD). The time lag between J and Rs was from 55 to 88 min on typical sunny days during the main growing seasons (from June to August), and, positively related to the depth of the locus under tree trunk cambium, while the time lag between J and VPD reached 60-96 min, and was negatively related to the depth of the locus. The seasonal variation patterns of J were consistent with ET0. With the increase of tree physiological activities, there was a trend that the major water transportation layer extended to the interior sapwood. The most important meteorological factor was the solar radiation, which primarily drove sap flow at different depths of tree trunk. However, the secondary factor changed along with the depth, and VPD became increasingly important with increasing the

  3. In situ protein folding and activation in bacterial inclusion bodies.

    PubMed

    Gonzalez-Montalban, Nuria; Natalello, Antonino; García-Fruitós, Elena; Villaverde, Antonio; Doglia, Silvia Maria

    2008-07-01

    Recent observations indicate that bacterial inclusion bodies formed in absence of the main chaperone DnaK result largely enriched in functional, properly folded recombinant proteins. Unfortunately, the molecular basis of this intriguing fact, with obvious biotechnological interest, remains unsolved. We have explored here two non-excluding physiological mechanisms that could account for this observation, namely selective removal of inactive polypeptides from inclusion bodies or in situ functional activation of the embedded proteins. By combining structural and functional analysis, we have not observed any preferential selection of inactive and misfolded protein species by the dissagregating machinery during inclusion body disintegration. Instead, our data strongly support that folding intermediates aggregated as inclusion bodies could complete their natural folding process once deposited in protein clusters, which conduces to significant functional activation. In addition, in situ folding and protein activation in inclusion bodies is negatively regulated by the chaperone DnaK.

  4. Protein stability and enzyme activity at extreme biological temperatures.

    PubMed

    Feller, Georges

    2010-08-18

    Psychrophilic microorganisms thrive in permanently cold environments, even at subzero temperatures. To maintain metabolic rates compatible with sustained life, they have improved the dynamics of their protein structures, thereby enabling appropriate molecular motions required for biological activity at low temperatures. As a consequence of this structural flexibility, psychrophilic proteins are unstable and heat-labile. In the upper range of biological temperatures, thermophiles and hyperthermophiles grow at temperatures > 100 °C and synthesize ultra-stable proteins. However, thermophilic enzymes are nearly inactive at room temperature as a result of their compactness and rigidity. At the molecular level, both types of extremophilic proteins have adapted the same structural factors, but in opposite directions, to address either activity at low temperatures or stability in hot environments. A model based on folding funnels is proposed accounting for the stability-activity relationships in extremophilic proteins.

  5. Controlled Activation of Protein Rotational Dynamics Using Smart Hydrogel Tethering

    SciTech Connect

    Beech, Brenda M.; Xiong, Yijia; Boschek, Curt B.; Baird, Cheryl L.; Bigelow, Diana J.; Mcateer, Kathleen; Squier, Thomas C.

    2014-09-05

    Stimulus-responsive hydrogel materials that stabilize and control protein dynamics have the potential to enable a range of applications to take advantage of the inherent specificity and catalytic efficiencies of proteins. Here we describe the modular construction of a hydrogel using an engineered calmodulin (CaM) within a polyethylene glycol (PEG) matrix that involves the reversible tethering of proteins through an engineered CaM-binding sequence. For these measurements, maltose binding protein (MBP) was isotopically labeled with [13C] and [15N], permitting dynamic structural measurements using TROSY-HSQC NMR spectroscopy. Upon initial formation of hydrogels protein dynamics are suppressed, with concomitant increases in protein stability. Relaxation of the hydrogel matrix following transient heating results in the activation of protein dynamics and restoration of substrate-induced large-amplitude domain motions necessary for substrate binding.

  6. Mars Exploration Rover Operations with the Science Activity Planner

    NASA Technical Reports Server (NTRS)

    Jeffrey S. Norris; Powell, Mark W.; Vona, Marsette A.; Backes, Paul G.; Wick, Justin V.

    2005-01-01

    The Science Activity Planner (SAP) is the primary science operations tool for the Mars Exploration Rover mission and NASA's Software of the Year for 2004. SAP utilizes a variety of visualization and planning capabilities to enable the mission operations team to direct the activities of the Spirit and Opportunity rovers. This paper outlines some of the challenging requirements that drove the design of SAP and discusses lessons learned from the development and use of SAP in mission operations.

  7. SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans

    PubMed Central

    Schwartz, Matthew L.; Jorgensen, Erik M.

    2016-01-01

    In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called “SapTrap,” that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then “trapped” in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10–37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. PMID:26837755

  8. Adulteration and Contamination of Commercial Sap of Hymenaea Species.

    PubMed

    Farias, Katyuce de Souza; Auharek, Sarah Alves; Cunha-Laura, Andréa Luiza; de Souza, Jeana Mara Escher; Damasceno-Junior, Geraldo Alves; Toffoli-Kadri, Mônica Cristina; de Oliveira Filiú, Wander Fernando; Dos Santos, Edson Dos Anjos; Chang, Marilene Rodrigues; Carollo, Carlos Alexandre

    2017-01-01

    The Hymenaea stigonocarpa and Hymenaea martiana species, commonly known as "jatobá," produce a sap which is extracted by perforation of the trunk and is commonly used in folk medicine as a tonic. For this study, the authenticity of commercial samples of jatobá was verified by the identification of the main compounds and multivariate analysis and contamination by microbial presence analysis. The acute toxicity of the authentic jatobá sap was also evaluated. The metabolites composition and multivariate analysis revealed that none of the commercial samples were authentic. In the microbiological contamination analysis, five of the six commercial samples showed positive cultures within the range of 1,700-100,000 CFU/mL and the authentic sap produced no signs of toxicity, and from a histological point of view, there was the maintenance of tissue integrity. In brief, the commercial samples were deemed inappropriate for consumption and represent a danger to the population.

  9. SAPFLUXNET: towards a global database of sap flow measurements.

    PubMed

    Poyatos, Rafael; Granda, Víctor; Molowny-Horas, Roberto; Mencuccini, Maurizio; Steppe, Kathy; Martínez-Vilalta, Jordi

    2016-12-01

    Plant transpiration is the main evaporative flux from terrestrial ecosystems; it controls land surface energy balance, determines catchment hydrological responses and influences regional and global climate. Transpiration regulation by plants is a key (and still not completely understood) process that underlies vegetation drought responses and land evaporative fluxes under global change scenarios. Thermometric methods of sap flow measurement have now been widely used to quantify whole-plant and stand transpiration in forests, shrublands and orchards around the world. A large body of research has applied sap flow methods to analyse seasonal and diurnal patterns of transpiration and to quantify their responses to hydroclimatic variability, but syntheses of sap flow data at regional to global scales are extremely rare. Here we present the SAPFLUXNET initiative, aimed at building the first global database of plant-level sap flow measurements. A preliminary metadata survey launched in December 2015 showed an encouraging response by the sap flow community, with sap flow data sets from field studies representing >160 species and >120 globally distributed sites. The main goal of SAPFLUXNET is to analyse the ecological factors driving plant- and stand-level transpiration. SAPFLUXNET will open promising research avenues at an unprecedented global scope, namely: (i) exploring the spatio-temporal variability of plant transpiration and its relationship with plant and stand attributes, (ii) summarizing physiological regulation of transpiration by means of few water-use traits, usable for land surface models, (iii) improving our understanding of the coordination between gas exchange and plant-level traits (e.g., hydraulics) and (iv) analysing the ecological factors controlling stand transpiration and evapotranspiration partitioning. Finally, SAPFLUXNET can provide a benchmark to test models of physiological controls of transpiration, contributing to improve the accuracy of

  10. Cloning of three novel neuronal Cdk5 activator binding proteins.

    PubMed

    Ching, Y P; Qi, Z; Wang, J H

    2000-01-25

    Neuronal Cdc2-like kinase (Nclk) is involved in the regulation of neuronal differentiation and neuro-cytoskeleton dynamics. The active kinase consists of a catalytic subunit, Cdk5, and a 25 kDa activator protein (p25nck5a) derived from a 35 kDa neuronal-specific protein (p35nck5a). As an extension of our previous study (Qi, Z., Tang, D., Zhu, X., Fujita, D.J., Wang, J.H., 1998. Association of neurofilament proteins with neuronal Cdk5 activator. J. Biol. Chem. 270, 2329-2335), which showed that neurofilament is one of the p35nck5a-associated proteins, we now report the isolation of three other novel p35nck5a-associated proteins using the yeast two-hybrid screen. The full-length forms of these three novel proteins, designated C42, C48 and C53, have a molecular mass of 66, 24, and 57 kDa, respectively. Northern analysis indicates that these novel proteins are widely expressed in human tissues, including the heart, brain, skeletal muscle, placenta, lung, liver, kidney and pancreas. The bacterially expressed glutathione S-transferase (GST)-fusion forms of these three proteins were able to co-precipitate p35nck5a complexed with Cdk5 from insect cell lysate. Among these three proteins, only C48 and C53 can be phosphorylated by Nclk, suggesting that they may be the substrates of Nclk. Sequence homology searches have suggested that the C48 protein is marginally related to restin protein, whereas the C42 protein has homologues of unknown function in Caenorhabditis elegans and Arabidopsis thaliana.

  11. Comparative Statistical Study of Some SAP UI Technologies

    NASA Astrophysics Data System (ADS)

    Berdie, Adela; Osaci, Mihaela; Dan Lemle, Ludovic

    2011-09-01

    The goal of this paper is to present a comparative study on some web UI (User Interface) technologies that involve the creation of web applications on the platform SAP Net Weaver AS 7.01 of the integrated SAP (System Application Products) system. The attention will be directed mainly to the ABAP (Advanced Business Application Programing) development environment and to the Web Dynpro (WD) technologies, Floor Plan Manager (FPM) and Web Client UI. Through this study, we make an assesment regarding the decision of choosing a technology for the realisation of a project which consists of a web application.

  12. Metaproteomics: Evaluation of protein extraction from activated sludge.

    PubMed

    Hansen, Susan Hove; Stensballe, Allan; Nielsen, Per Halkjaer; Herbst, Florian-Alexander

    2014-11-01

    Metaproteomic studies of full-scale activated sludge systems require reproducible protein extraction methods. A systematic evaluation of three different extractions protocols, each in combination with three different methods of cell lysis, and a commercial kit were evaluated. Criteria used for comparison of each method included the extracted protein concentration and the number of identified proteins and peptides as well as their phylogenetic, cell localization and functional distribution and quantitative reproducibility. Furthermore, the advantage of using specific metagenomes and a 2-step database approach was illustrated. The results recommend a protocol for protein extraction from activated sludge based on the protein extraction reagent B-Per and bead beating. The data have been deposited to the ProteomeXchange with identifier PXD000862 (http://proteomecentral.proteomexchange.org/dataset/PXD000862).

  13. Depletion of WRN protein causes RACK1 to activate several protein kinase C isoforms.

    PubMed

    Massip, L; Garand, C; Labbé, A; Perreault, E; Turaga, R V N; Bohr, V A; Lebel, M

    2010-03-11

    Werner's syndrome (WS) is a rare autosomal disease characterized by the premature onset of several age-associated pathologies. The protein defective in patients with WS (WRN) is a helicase/exonuclease involved in DNA repair, replication, transcription and telomere maintenance. In this study, we show that a knock down of the WRN protein in normal human fibroblasts induces phosphorylation and activation of several protein kinase C (PKC) enzymes. Using a tandem affinity purification strategy, we found that WRN physically and functionally interacts with receptor for activated C-kinase 1 (RACK1), a highly conserved anchoring protein involved in various biological processes, such as cell growth and proliferation. RACK1 binds strongly to the RQC domain of WRN and weakly to its acidic repeat region. Purified RACK1 has no impact on the helicase activity of WRN, but selectively inhibits WRN exonuclease activity in vitro. Interestingly, knocking down RACK1 increased the cellular frequency of DNA breaks. Depletion of the WRN protein in return caused a fraction of nuclear RACK1 to translocate out of the nucleus to bind and activate PKCdelta and PKCbetaII in the membrane fraction of cells. In contrast, different DNA-damaging treatments known to activate PKCs did not induce RACK1/PKCs association in cells. Overall, our results indicate that a depletion of the WRN protein in normal fibroblasts causes the activation of several PKCs through translocation and association of RACK1 with such kinases.

  14. Depletion of WRN protein causes RACK1 to activate several protein kinase C isoforms

    PubMed Central

    Massip, L; Garand, C; Labbé, A; Perreault, È; Turaga, RVN; Bohr, VA; Lebel, M

    2015-01-01

    Werner’s syndrome (WS) is a rare autosomal disease characterized by the premature onset of several age-associated pathologies. The protein defective in patients with WS (WRN) is a helicase/exonuclease involved in DNA repair, replication, transcription and telomere maintenance. In this study, we show that a knock down of the WRN protein in normal human fibroblasts induces phosphorylation and activation of several protein kinase C (PKC) enzymes. Using a tandem affinity purification strategy, we found that WRN physically and functionally interacts with receptor for activated C-kinase 1 (RACK1), a highly conserved anchoring protein involved in various biological processes, such as cell growth and proliferation. RACK1 binds strongly to the RQC domain of WRN and weakly to its acidic repeat region. Purified RACK1 has no impact on the helicase activity of WRN, but selectively inhibits WRN exonuclease activity in vitro. Interestingly, knocking down RACK1 increased the cellular frequency of DNA breaks. Depletion of the WRN protein in return caused a fraction of nuclear RACK1 to translocate out of the nucleus to bind and activate PKCδ and PKCβII in the membrane fraction of cells. In contrast, different DNA-damaging treatments known to activate PKCs did not induce RACK1/PKCs association in cells. Overall, our results indicate that a depletion of the WRN protein in normal fibroblasts causes the activation of several PKCs through translocation and association of RACK1 with such kinases. PMID:19966859

  15. SARS-CoV nucleocapsid protein interacts with cellular pyruvate kinase protein and inhibits its activity.

    PubMed

    Wei, Wei-Yen; Li, Hui-Chun; Chen, Chiung-Yao; Yang, Chee-Hing; Lee, Shen-Kao; Wang, Chia-Wen; Ma, Hsin-Chieh; Juang, Yue-Li; Lo, Shih-Yen

    2012-04-01

    The pathogenesis of SARS-CoV remains largely unknown. To study the function of the SARS-CoV nucleocapsid protein, we have conducted a yeast two-hybrid screening experiment to identify cellular proteins that may interact with the SARS-CoV nucleocapsid protein. Pyruvate kinase (liver) was found to interact with SARS-CoV nucleocapsid protein in this experiment. The binding domains of these two proteins were also determined using the yeast two-hybrid system. The physical interaction between the SARS-CoV nucleocapsid and cellular pyruvate kinase (liver) proteins was further confirmed by GST pull-down assay, co-immunoprecipitation assay and confocal microscopy. Cellular pyruvate kinase activity in hepatoma cells was repressed by SARS-CoV nucleocapsid protein in either transiently transfected or stably transfected cells. PK deficiency in red blood cells is known to result in human hereditary non-spherocytic hemolytic anemia. It is reasonable to assume that an inhibition of PKL activity due to interaction with SARS-CoV N protein is likely to cause the death of the hepatocytes, which results in the elevation of serum alanine aminotransferase and liver dysfunction noted in most SARS patients. Thus, our results suggest that SARS-CoV could reduce pyruvate kinase activity via its nucleocapsid protein, and this may in turn cause disease.

  16. Protein expression, characterization and activity comparisons of wild type and mutant DUSP5 proteins

    SciTech Connect

    Nayak, Jaladhi; Gastonguay, Adam J.; Talipov, Marat R.; Vakeel, Padmanabhan; Span, Elise A.; Kalous, Kelsey S.; Kutty, Raman G.; Jensen, Davin R.; Pokkuluri, Phani Raj; Sem, Daniel S.; Rathore, Rajendra; Ramchandran, Ramani

    2014-12-18

    Background: The mitogen-activated protein kinases (MAPKs) pathway is critical for cellular signaling, and proteins such as phosphatases that regulate this pathway are important for normal tissue development. Based on our previous work on dual specificity phosphatase-5 (DUSP5), and its role in embryonic vascular development and disease, we hypothesized that mutations in DUSP5 will affect its function. Results: In this study, we tested this hypothesis by generating full-length glutathione-S-transferase-tagged DUSP5 and serine 147 proline mutant (S147P) proteins from bacteria. Light scattering analysis, circular dichroism, enzymatic assays and molecular modeling approaches have been performed to extensively characterize the protein form and function. We demonstrate that both proteins are active and, interestingly, the S147P protein is hypoactive as compared to the DUSP5 WT protein in two distinct biochemical substrate assays. Furthermore, due to the novel positioning of the S147P mutation, we utilize computational modeling to reconstruct full-length DUSP5 and S147P to predict a possible mechanism for the reduced activity of S147P. Conclusion: Taken together, this is the first evidence of the generation and characterization of an active, full-length, mutant DUSP5 protein which will facilitate future structure-function and drug development-based studies.

  17. Protein expression, characterization and activity comparisons of wild type and mutant DUSP5 proteins

    DOE PAGES

    Nayak, Jaladhi; Gastonguay, Adam J.; Talipov, Marat R.; ...

    2014-12-18

    Background: The mitogen-activated protein kinases (MAPKs) pathway is critical for cellular signaling, and proteins such as phosphatases that regulate this pathway are important for normal tissue development. Based on our previous work on dual specificity phosphatase-5 (DUSP5), and its role in embryonic vascular development and disease, we hypothesized that mutations in DUSP5 will affect its function. Results: In this study, we tested this hypothesis by generating full-length glutathione-S-transferase-tagged DUSP5 and serine 147 proline mutant (S147P) proteins from bacteria. Light scattering analysis, circular dichroism, enzymatic assays and molecular modeling approaches have been performed to extensively characterize the protein form and function.more » We demonstrate that both proteins are active and, interestingly, the S147P protein is hypoactive as compared to the DUSP5 WT protein in two distinct biochemical substrate assays. Furthermore, due to the novel positioning of the S147P mutation, we utilize computational modeling to reconstruct full-length DUSP5 and S147P to predict a possible mechanism for the reduced activity of S147P. Conclusion: Taken together, this is the first evidence of the generation and characterization of an active, full-length, mutant DUSP5 protein which will facilitate future structure-function and drug development-based studies.« less

  18. Specific modulation of protein activity by using a bioorthogonal reaction.

    PubMed

    Warner, John B; Muthusamy, Anand K; Petersson, E James

    2014-11-24

    Unnatural amino acids with bioorthogonal reactive groups have the potential to provide a rapid and specific mechanism for covalently inhibiting a protein of interest. Here, we use mutagenesis to insert an unnatural amino acid containing an azide group (Z) into the target protein at positions such that a "click" reaction with an alkyne modulator (X) will alter the function of the protein. This bioorthogonally reactive pair can engender specificity of X for the Z-containing protein, even if the target is otherwise identical to another protein, allowing for rapid target validation in living cells. We demonstrate our method using inhibition of the Escherichia coli enzyme aminoacyl transferase by both active-site occlusion and allosteric mechanisms. We have termed this a "clickable magic bullet" strategy, and it should be generally applicable to studying the effects of protein inhibition, within the limits of unnatural amino acid mutagenesis.

  19. Regulatory Crosstalk by Protein Kinases on CFTR Trafficking and Activity

    PubMed Central

    Farinha, Carlos M.; Swiatecka-Urban, Agnieszka; Brautigan, David L.; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e., channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease. PMID:26835446

  20. Regulatory crosstalk by protein kinases on CFTR trafficking and activity

    NASA Astrophysics Data System (ADS)

    Farinha, Carlos Miguel; Swiatecka-Urban, Agnieszka; Brautigan, David; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e. channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease.

  1. Structural recognition and functional activation of Fc[gamma]R by innate pentraxins

    SciTech Connect

    Lu, Jinghua; Marnell, Lorraine L.; Marjon, Kristopher D.; Mold, Carolyn; Du Clos, Terry W.; Sun, Peter D.

    2009-10-05

    Pentraxins are a family of ancient innate immune mediators conserved throughout evolution. The classical pentraxins include serum amyloid P component (SAP) and C-reactive protein, which are two of the acute-phase proteins synthesized in response to infection. Both recognize microbial pathogens and activate the classical complement pathway through C1q. More recently, members of the pentraxin family were found to interact with cell-surface Fc{gamma} receptors (Fc{gamma}R) and activate leukocyte-mediated phagocytosis. Here we describe the structural mechanism for pentraxin's binding to Fc{gamma}R and its functional activation of Fc{gamma}R-mediated phagocytosis and cytokine secretion. The complex structure between human SAP and Fc{gamma}RIIa reveals a diagonally bound receptor on each SAP pentamer with both D1 and D2 domains of the receptor contacting the ridge helices from two SAP subunits. The 1:1 stoichiometry between SAP and Fc{gamma}RIIa infers the requirement for multivalent pathogen binding for receptor aggregation. Mutational and binding studies show that pentraxins are diverse in their binding specificity for Fc{gamma}R isoforms but conserved in their recognition structure. The shared binding site for SAP and IgG results in competition for Fc{gamma}R binding and the inhibition of immune-complex-mediated phagocytosis by soluble pentraxins. These results establish antibody-like functions for pentraxins in the Fc{gamma}R pathway, suggest an evolutionary overlap between the innate and adaptive immune systems, and have new therapeutic implications for autoimmune diseases.

  2. Cellular reprogramming through mitogen-activated protein kinases

    PubMed Central

    Lee, Justin; Eschen-Lippold, Lennart; Lassowskat, Ines; Böttcher, Christoph; Scheel, Dierk

    2015-01-01

    Mitogen-activated protein kinase (MAPK) cascades are conserved eukaryote signaling modules where MAPKs, as the final kinases in the cascade, phosphorylate protein substrates to regulate cellular processes. While some progress in the identification of MAPK substrates has been made in plants, the knowledge on the spectrum of substrates and their mechanistic action is still fragmentary. In this focused review, we discuss the biological implications of the data in our original paper (Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana; Frontiers in Plant Science 5: 554) in the context of related research. In our work, we mimicked in vivo activation of two stress-activated MAPKs, MPK3 and MPK6, through transgenic manipulation of Arabidopsis thaliana and used phosphoproteomics analysis to identify potential novel MAPK substrates. Here, we plotted the identified putative MAPK substrates (and downstream phosphoproteins) as a global protein clustering network. Based on a highly stringent selection confidence level, the core networks highlighted a MAPK-induced cellular reprogramming at multiple levels of gene and protein expression—including transcriptional, post-transcriptional, translational, post-translational (such as protein modification, folding, and degradation) steps, and also protein re-compartmentalization. Additionally, the increase in putative substrates/phosphoproteins of energy metabolism and various secondary metabolite biosynthesis pathways coincides with the observed accumulation of defense antimicrobial substances as detected by metabolome analysis. Furthermore, detection of protein networks in phospholipid or redox elements suggests activation of downstream signaling events. Taken in context with other studies, MAPKs are key regulators that reprogram cellular events to orchestrate defense signaling in eukaryotes. PMID:26579181

  3. 30 CFR 285.800 - How must I conduct my activities to comply with safety and environmental requirements?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Activities Conducted Under SAPs, COPs and GAPs § 285.800 How must I conduct my activities to comply with... compliance with those terms and conditions identified in your approved SAP, COP, or GAP, as required...

  4. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 1 2011-10-01 2011-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  5. 30 CFR 585.613 - How will BOEM process my SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false How will BOEM process my SAP? 585.613 Section... Information Requirements Contents of the Site Assessment Plan § 585.613 How will BOEM process my SAP? (a) BOEM will review your submitted SAP, and additional information provided pursuant to § 585.611, to...

  6. 30 CFR 585.607 - How do I submit my SAP?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 2 2014-07-01 2014-07-01 false How do I submit my SAP? 585.607 Section 585.607 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY... my SAP? You must submit one paper copy and one electronic version of your SAP to BOEM at the...

  7. 30 CFR 585.607 - How do I submit my SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false How do I submit my SAP? 585.607 Section 585.607 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY... my SAP? You must submit one paper copy and one electronic version of your SAP to BOEM at the...

  8. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  9. 30 CFR 585.613 - How will BOEM process my SAP?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 2 2013-07-01 2013-07-01 false How will BOEM process my SAP? 585.613 Section... Information Requirements Contents of the Site Assessment Plan § 585.613 How will BOEM process my SAP? (a) BOEM will review your submitted SAP, and additional information provided pursuant to § 585.611, to...

  10. 30 CFR 285.607 - How do I submit my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false How do I submit my SAP? 285.607 Section 285.607... Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a)....

  11. 30 CFR 285.606 - What must I demonstrate in my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR OFFSHORE... demonstrate in my SAP? (a) Your SAP must demonstrate that you have planned and are prepared to conduct...

  12. 30 CFR 585.607 - How do I submit my SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false How do I submit my SAP? 585.607 Section 585.607 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, DEPARTMENT OF THE INTERIOR OFFSHORE RENEWABLE ENERGY... my SAP? You must submit one paper copy and one electronic version of your SAP to BOEM at the...

  13. 30 CFR 585.613 - How will BOEM process my SAP?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 2 2012-07-01 2012-07-01 false How will BOEM process my SAP? 585.613 Section... Information Requirements Contents of the Site Assessment Plan § 585.613 How will BOEM process my SAP? (a) BOEM will review your submitted SAP, and additional information provided pursuant to § 585.611, to...

  14. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 1 2012-10-01 2012-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  15. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 1 2013-10-01 2013-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  16. 30 CFR 285.606 - What must I demonstrate in my SAP?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 2 2011-07-01 2011-07-01 false What must I demonstrate in my SAP? 285.606 Section 285.606 Mineral Resources BUREAU OF OCEAN ENERGY MANAGEMENT, REGULATION, AND ENFORCEMENT... Commercial Leases § 285.606 What must I demonstrate in my SAP? (a) Your SAP must demonstrate that you...

  17. 49 CFR Appendix E to Part 40 - SAP Equivalency Requirements for Certification Organizations

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 1 2014-10-01 2014-10-01 false SAP Equivalency Requirements for Certification... TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Pt. 40, App. E Appendix E to Part 40—SAP Equivalency... of knowledge must be of sufficient quantity to ensure a high quality of SAP evaluation and...

  18. 30 CFR 285.613 - How will MMS process my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How will MMS process my SAP? 285.613 Section... Requirements Contents of the Site Assessment Plan § 285.613 How will MMS process my SAP? (a) The MMS will review your submitted SAP, and additional information provided pursuant to § 285.611, to determine if...

  19. Diurnal and seasonal variability in the radial distribution of sap flow: predicting total stem flow in Pinus taeda trees.

    PubMed

    Ford, Chelcy R; Goranson, Carol E; Mitchell, Robert J; Will, Rodney E; Teskey, Robert O

    2004-09-01

    We monitored the radial distribution of sap flux density (v; g H2O m(-2) s(-1)) in the sapwood of six plantation-grown Pinus taeda L. trees during wet and dry soil periods. Mean basal diameter of the 32-year-old trees was 33.3 cm. For all trees, the radial distribution of sap flow in the base of the stem (i.e., radial profile) was Gaussian in shape. Sap flow occurred maximally in the outer 4 cm of sapwood, comprising 50-60% of total stem flow (F), and decreased toward the center, with the innermost 4 cm of sapwood (11-15 cm) comprising less than 10% of F. The percent of flow occurring in the outer 4 cm of sapwood was stable with time (average CV < 10%); however, the percentage of flow occurring in the remaining sapwood was more variable over time (average CV > 40%). Diurnally, the radial profile changed predictably with time and with total stem flow. Seasonally, the radial profile became less steep as the soil water content (theta) declined from 0.38 to 0.21. Throughout the season, daytime sap flow also decreased as theta decreased; however, nighttime sap flow (an estimate of stored water use) remained relatively constant. As a result, the percentage of stored water use increased as theta declined. Time series analysis of 15-min values of F, theta, photosynthetically active radiation (PAR) and vapor pressure deficit (D) showed that F lagged behind D by 0-15 min and behind PAR by 15-30 min. Diurnally, the relationship between F and D was much stronger than the relationship between F and PAR, whereas no relationship was found between F and theta. An autoregressive moving average (ARIMA) model estimated that 97% of the variability in F could be predicted by D alone. Although total sap flow in all trees responded similarly to D, we show that the radial distribution of sap flow comprising total flow could change temporally, both on daily and seasonal scales.

  20. Auto-phosphorylation Represses Protein Kinase R Activity

    PubMed Central

    Wang, Die; de Weerd, Nicole A.; Willard, Belinda; Polekhina, Galina; Williams, Bryan R. G.; Sadler, Anthony J.

    2017-01-01

    The central role of protein kinases in controlling disease processes has spurred efforts to develop pharmaceutical regulators of their activity. A rational strategy to achieve this end is to determine intrinsic auto-regulatory processes, then selectively target these different states of kinases to repress their activation. Here we investigate auto-regulation of the innate immune effector protein kinase R, which phosphorylates the eukaryotic initiation factor 2α to inhibit global protein translation. We demonstrate that protein kinase R activity is controlled by auto-inhibition via an intra-molecular interaction. Part of this mechanism of control had previously been reported, but was then controverted. We account for the discrepancy and extend our understanding of the auto-inhibitory mechanism by identifying that auto-inhibition is paradoxically instigated by incipient auto-phosphorylation. Phosphor-residues at the amino-terminus instigate an intra-molecular interaction that enlists both of the N-terminal RNA-binding motifs of the protein with separate surfaces of the C-terminal kinase domain, to co-operatively inhibit kinase activation. These findings identify an innovative mechanism to control kinase activity, providing insight for strategies to better regulate kinase activity. PMID:28281686

  1. HMG Proteins and DNA Flexibility in Transcription Activation

    PubMed Central

    Ross, Eric D.; Hardwidge, Philip R.; Maher, L. James

    2001-01-01

    The relative stiffness of naked DNA is evident from measured values of longitudinal persistence length (∼150 bp) and torsional persistence length (∼180 bp). These parameters predict that certain arrangements of eukaryotic transcription activator proteins in gene promoters should be much more effective than others in fostering protein-protein interactions with the basal RNA polymerase II transcription apparatus. Thus, if such interactions require some kind of DNA looping, DNA loop energies should depend sensitively on helical phasing of protein binding sites, loop size, and intrinsic DNA curvature within the loop. Using families of artificial transcription templates where these parameters were varied, we were surprised to find that the degree of transcription activation by arrays of Gal4-VP1 transcription activators in HeLa cell nuclear extract was sensitive only to the linear distance separating a basal promoter from an array of bound activators on DNA templates. We now examine the hypothesis that this unexpected result is due to factors in the extract that act to enhance apparent DNA flexibility. We demonstrate that HeLa cell nuclear extract is rich in a heat-resistant activity that dramatically enhances apparent DNA longitudinal and torsional flexibility. Recombinant mammalian high-mobility group 2 (HMG-2) protein can substitute for this activity. We propose that the abundance of HMG proteins in eukaryotic nuclei provides an environment in which DNA is made sufficiently flexible to remove many constraints on protein binding site arrangements that would otherwise limit efficient transcription activation to certain promoter geometries. PMID:11533247

  2. Anthelmintic activity of Leucaena leucocephala protein extracts on Haemonchus contortus.

    PubMed

    Soares, Alexandra Martins dos Santos; de Araújo, Sandra Alves; Lopes, Suzana Gomes; Costa Junior, Livio Martins

    2015-01-01

    The objective of this study was to evaluate the effects of protein extracts obtained from the plant Leucaena leucocephala on the nematode parasite Haemonchus contortus. The seeds, shell and cotyledon of L. leucocephala were separated and their proteins extracted using a sodium phosphate buffer, and named as TE (total seed extract), SE (shell extract) and CE (cotyledon extract). Soluble protein content, protease, protease inhibitory and chitinase activity assays were performed. Exsheathment inhibition of H. contortus larvae were performed at concentrations of 0.6 mg mL-1, and egg hatch assays were conducted at protein concentrations of 0.8, 0.4, 0.2, 0.1 and 0.05 mg mL-1. The effective concentration for 50% hatching inhibition (EC50) was estimated by probit. Different proportions of soluble proteins, protease and chitinase were found in TE and CE. Protease inhibitory activity was detected in all extracts. The EC50 of the CE and TE extracts were 0.48 and 0.33 mg mL-1, respectively. No ovicidal effects on H. contortus were detected in SE extracts, and none of the protein extracts demonstrated larvicidal effects on H. contortus. We therefore conclude that protein extracts of L. leucocephala had a detrimental effect on nematode eggs, which can be correlated with the high protease and chitinase activity of these extracts.

  3. Steady-state compartmentalization of lipid membranes by active proteins.

    PubMed Central

    Sabra, M C; Mouritsen, O G

    1998-01-01

    Using a simple microscopic model of lipid-protein interactions, based on the hydrophobic matching principle, we study some generic aspects of lipid-membrane compartmentalization controlled by a dispersion of active integral membrane proteins. The activity of the proteins is simulated by conformational excitations governed by an external drive, and the deexcitation is controlled by interaction of the protein with its lipid surroundings. In response to the flux of energy into the proteins from the environment and the subsequent dissipation of energy into the lipid bilayer, the lipid-protein assembly reorganizes into a steady-state structure with a typical length scale determined by the strength of the external drive. In the specific case of a mixed dimyristoylphosphatidylcholine-distearoylphosphatidylcholine bilayer in the gel-fluid coexistence region, it is shown explicitly by computer simulation that the activity of an integral membrane protein can lead to a compartmentalization of the lipid-bilayer membrane. The compartmentalization is related to the dynamical process of phase separation and lipid domain formation. PMID:9533687

  4. Modeling the SHG activities of diverse protein crystals

    PubMed Central

    Haupert, Levi M.; DeWalt, Emma L.; Simpson, Garth J.

    2012-01-01

    A symmetry-additive ab initio model for second-harmonic generation (SHG) activity of protein crystals was applied to assess the likely protein-crystal coverage of SHG microscopy. Calculations were performed for 250 proteins in nine point-group symmetries: a total of 2250 crystals. The model suggests that the crystal symmetry and the limit of detection of the instrument are expected to be the strongest predictors of coverage of the factors considered, which also included secondary-structural content and protein size. Much of the diversity in SHG activity is expected to arise primarily from the variability in the intrinsic protein response as well as the orientation within the crystal lattice. Two or more orders-of-­magnitude variation in intensity are expected even within protein crystals of the same symmetry. SHG measurements of tetragonal lysozyme crystals confirmed detection, from which a protein coverage of ∼84% was estimated based on the proportion of proteins calculated to produce SHG responses greater than that of tetragonal lysozyme. Good agreement was observed between the measured and calculated ratios of the SHG intensity from lysozyme in tetragonal and monoclinic lattices. PMID:23090400

  5. CO2 uptake of a mature Acacia mangium plantation estimated from sap flow measurements and stable carbon isotope discrimination

    NASA Astrophysics Data System (ADS)

    Wang, H.; Zhao, P.; Zou, L. L.; McCarthy, H. R.; Zeng, X. P.; Ni, G. Y.; Rao, X. Q.

    2014-03-01

    A simple, nondestructive method for the estimation of canopy CO2 uptake is important for understanding the CO2 exchange between forest and atmosphere. Canopy CO2 uptake (FCO2) of a subtropical mature A. mangium plantation was estimated by combining sap flow measurements and stable carbon isotope discrimination (Δ) in Southern China from 2004 to 2007. The mechanistic relationship linking FCO2, Δ in leaf sap, and sap flow-based canopy stomatal conductance (Gs) was applied in our study. No significant seasonal variations were observed in Δ or in the ratio of the intercellular and ambient CO2 concentrations (Ci/Ca), although diurnal Ci/Ca varied between sunlit and shaded leaves. A sensitivity analysis showed that estimates of FCO2 were more sensitive to dynamics in Gs than in Ca and Δ. By using seasonally and canopy averaged Ci/Ca values, we obtained an acceptable estimate of FCO2 compared to other estimates. FCO2 exhibited similar diurnal variation to that of Gs. Large seasonal variation in FCO2 was attributed to the responsiveness of Gs to vapor pressure deficit, photosynthetically active radiation, and soil moisture deficit. Our estimate of FCO2 for a mature A. mangium plantation (2.13 ± 0.40 gC m-2 d-1) approached the lower range of values for subtropical mixed forests, probably due to lower mean canopy stomatal conductance, higher Ci/Ca, and greater tree height than other measured forests. Our estimate was also lower than values determined by satellite-based modeling or carbon allocation studies, suggesting the necessity of stand level flux data for verification. Qualitatively, the sap flux/stable isotope results compared well with gas exchange results. Differences in results between the two approaches likely reflected variability due to leaf position and age, which should be reduced for the combined sap flux and isotope technique, as it uses canopy average values of Gs and Ci/Ca.

  6. CO2 uptake of a mature Acacia mangium plantation estimated from sap flow measurements and stable carbon isotope discrimination

    NASA Astrophysics Data System (ADS)

    Wang, H.; Zhao, P.; Zou, L. L.; McCarthy, H. R.; Zeng, X. P.; Ni, G. Y.; Rao, X. Q.

    2013-07-01

    Canopy CO2 uptake (FCO2) of a subtropical mature textit{A. mangium} plantation was estimated by combining sap flow measurements and stable carbon isotope discrimination (Δ) in Southern China from 2004 to 2007. The mechanistic relationship linking FCO2, Δ in leaf sap, and sap flow based canopy stomatal conductance (Gs) was applied in our study. No significant seasonal variations were observed in Δ or in the ratio of the intercellular and ambient CO2 concentrations (Ci/Ca), although diurnal Ci/Ca varied between sunlit and shaded leaves. A sensitivity analysis showed that estimates of FCO2 were more sensitive to dynamics in Gs than in Ca and Δ. By using seasonally and canopy averaged Ci/Ca values, an acceptable estimate of FCO2 was obtained. FCO2 exhibited similar diurnal variation to that of Gs. Large seasonal variation in FCO2 was attributed to the responsiveness of Gs to vapour pressure deficit, photosynthetically active radiation, and soil moisture deficit. Our estimate of FCO2 for a mature A. mangium plantation (2.13 ± 0.40 g C m-2 day-1) approached the lower range of values for subtropical mixed forest, probably due to lower mean canopy stomatal conductance, higher Ci/Ca, and greater tree height than other measured forests. Our estimate was also lower than values determined by satellite-based modeling or component carbon analysis, suggesting the necessity of stand level flux data for verification. Qualitatively, the sap flux/stable isotope results compared well with gas exchange results. Differences in results between the two approaches reflected variability due to leaf position and age, which could be reduced for sap flux/stable isotope, which uses canopy average values of Gs and Ci/Ca.

  7. A conserved patch of hydrophobic amino acids modulates Myb activity by mediating protein-protein interactions.

    PubMed

    Dukare, Sandeep; Klempnauer, Karl-Heinz

    2016-07-01

    The transcription factor c-Myb plays a key role in the control of proliferation and differentiation in hematopoietic progenitor cells and has been implicated in the development of leukemia and certain non-hematopoietic tumors. c-Myb activity is highly dependent on the interaction with the coactivator p300 which is mediated by the transactivation domain of c-Myb and the KIX domain of p300. We have previously observed that conservative valine-to-isoleucine amino acid substitutions in a conserved stretch of hydrophobic amino acids have a profound effect on Myb activity. Here, we have explored the function of the hydrophobic region as a mediator of protein-protein interactions. We show that the hydrophobic region facilitates Myb self-interaction and binding of the histone acetyl transferase Tip60, a previously identified Myb interacting protein. We show that these interactions are affected by the valine-to-isoleucine amino acid substitutions and suppress Myb activity by interfering with the interaction of Myb and the KIX domain of p300. Taken together, our work identifies the hydrophobic region in the Myb transactivation domain as a binding site for homo- and heteromeric protein interactions and leads to a picture of the c-Myb transactivation domain as a composite protein binding region that facilitates interdependent protein-protein interactions of Myb with regulatory proteins.

  8. Biologically active protein fragments containing specific binding regions of serum albumin or related proteins

    NASA Technical Reports Server (NTRS)

    Carter, Daniel C. (Inventor)

    1998-01-01

    In accordance with the present invention, biologically active protein fragments can be constructed which contain only those specific portions of the serum albumin family of proteins such as regions known as subdomains IIA and IIIA which are primarily responsible for the binding properties of the serum albumins. The artificial serums that can be prepared from these biologically active protein fragments are advantageous in that they can be produced much more easily than serums containing the whole albumin, yet still retain all or most of the original binding potential of the full albumin proteins. In addition, since the protein fragment serums of the present invention can be made from non-natural sources using conventional recombinant DNA techniques, they are far safer than serums containing natural albumin because they do not carry the potentially harmful viruses and other contaminants that will be found in the natural substances.

  9. Energy transfer at the active sites of heme proteins

    SciTech Connect

    Dlott, D.D.; Hill, J.R.

    1995-12-31

    Experiments using a picosecond pump-probe apparatus at the Picosecond Free-electron Laser Center at Stanford University, were performed to investigate the relaxation of carbon monoxide bound to the active sites of heme proteins. The significance of these experiments is two-fold: (1) they provide detailed information about molecular dynamics occurring at the active sites of proteins; and (2) they provide insight into the nature of vibrational relaxation processes in condensed matter. Molecular engineering is used to construct various molecular systems which are studied with the FEL. We have studied native proteins, mainly myoglobin obtained from different species, mutant proteins produced by genetic engineering using recombinant DNA techniques, and a variety of model systems which mimic the structures of the active sites of native proteins, which are produced using molecular synthesis. Use of these different systems permits us to investigate how specific molecular structural changes affect dynamical processes occurring at the active sites. This research provides insight into the problems of how different species needs are fulfilled by heme proteins which have greatly different functionality, which is induced by rather small structural changes.

  10. Characterisation of microRNAs from apple (Malus domestica 'Royal Gala') vascular tissue and phloem sap

    PubMed Central

    2010-01-01

    Background Plant microRNAs (miRNAs) are a class of small, non-coding RNAs that play an important role in development and environmental responses. Hundreds of plant miRNAs have been identified to date, mainly from the model species for which there are available genome sequences. The current challenge is to characterise miRNAs from plant species with agricultural and horticultural importance, to aid our understanding of important regulatory mechanisms in crop species and enable improvement of crops and rootstocks. Results Based on the knowledge that many miRNAs occur in large gene families and are highly conserved among distantly related species, we analysed expression of twenty-one miRNA sequences in different tissues of apple (Malus x domestica 'Royal Gala'). We identified eighteen sequences that are expressed in at least one of the tissues tested. Some, but not all, miRNAs expressed in apple tissues including the phloem tissue were also detected in the phloem sap sample derived from the stylets of woolly apple aphids. Most of the miRNAs detected in apple phloem sap were also abundant in the phloem sap of herbaceous species. Potential targets for apple miRNAs were identified that encode putative proteins shown to be targets of corresponding miRNAs in a number of plant species. Expression patterns of potential targets were analysed and correlated with expression of corresponding miRNAs. Conclusions This study validated tissue-specific expression of apple miRNAs that target genes responsible for plant growth, development, and stress response. A subset of characterised miRNAs was also present in the apple phloem translocation stream. A comparative analysis of phloem miRNAs in herbaceous species and woody perennials will aid our understanding of non-cell autonomous roles of miRNAs in plants. PMID:20682080

  11. Differential peroxidase activities in three different crops upon insect feeding

    PubMed Central

    Singh, Harpal; Dixit, Sameer; Verma, Praveen Chandra; Singh, Pradhyumna Kumar

    2013-01-01

    Peroxidases are the ubiquitous enzyme and reported to be present in all living genera. They catalyses reduction of peroxide and generate reactive oxygen species. In the present study we demonstrated that insect infestation induces peroxidase activity in sap and total soluble protein (TSP) of plant leaves. Three important crop plants viz. tomato, cowpea and cotton were used for this study. After infestation of chewing insect, Peroxidase activity in the sap and TSP of all the studied plants were enhanced in the range of 1.6 to 3.14 fold. Similar observations were also obtained with feeding of sap sucking insects, in which increment in peroxidase activity of sap and TSP was in the range of 1.8 to 2.53 fold. Enhanced peroxidase activity was reconfirmed by in-gel peroxidase assay. Enzyme kinetic study showed turn over efficiency of peroxidase from cotton (~101.3 min-1) was almost similar to tomato (~100.8 min-1) but higher than cowpea (~98.21min-1). MS/MS analysis of observed band showed significant similarity with the reported peroxidases in database. PMID:23857346

  12. Faculty Performance Evaluation: The CIPP-SAPS Model.

    ERIC Educational Resources Information Center

    Mitcham, Maralynne

    1981-01-01

    The issues of faculty performance evaluation for allied health professionals are addressed. Daniel Stufflebeam's CIPP (content-imput-process-product) model is introduced and its development into a CIPP-SAPS (self-administrative-peer- student) model is pursued. (Author/CT)

  13. Accounting Control Technology Using SAP: A Case-Based Approach

    ERIC Educational Resources Information Center

    Ragan, Joseph; Puccio, Christopher; Talisesky, Brandon

    2014-01-01

    The Sarbanes-Oxley Act (SOX) revolutionized the accounting and audit industry. The use of preventative and process controls to evaluate the continuous audit process done via an SAP ERP ECC 6.0 system is key to compliance with SOX and managing costs. This paper can be used in a variety of ways to discuss issues associated with auditing and testing…

  14. On the Relationship of SAPS to Storm-Enhanced Density

    DTIC Science & Technology

    2007-01-01

    Journal of Atmospheric and Solar - Terrestrial Physics , 69, (2007) © 2007 Elsevier Science B.V. *Massachusetts...TERRESTRIALPHYSICS ELSEVIER Journal of Atmospheric and Solar - Terrestrial Physics 69 (2007) 303--313 www.elevier.comlIocate/jastp 0o On the relationship of SAPS to...2006.07.021 304 J. C Foster et al. / Journal of " Atmospheric and Solar - Terrestrial

  15. Gravity like forces in sap conducting tissue in plants.

    NASA Astrophysics Data System (ADS)

    Wagner, Orvin

    2007-04-01

    I used miniature brass shielded Entran accelerometers in small holes in tree tissue to measure forces (penetrating the brass shield) in the direction of sap flow. These forces increased with sap flow up to 22% of gravity magnitude. It is assumed that measured forces would have been larger except for the presence of the distorting hole. These forces were measured in horizontal roots and vertical trunks (here a gravity decrease). Distances of mm. between the tissue and the accelerometer, over which the measured forces acted, could only be compared to gravity. The force's penetration of the brass shield also indicates gravity like forces. See e.g. Physiol. Chem. Phys. & Med. NMR (1995) 27: 31-34 and other publications of the author. The present generally presented controversial explanation of sap flow up tall trees apparently needs modification. Plant produced forces provide an incredible alternative. The macroscopic behavior of plants has so far been mostly ignored by physicists. The study of plants may answer some fundamental questions about gravity. (Earlier observations of weight loss in hanging weights in sap conducting tissue in bent trees led to the above work).

  16. Utilizing avidity to improve antifreeze protein activity: a type III antifreeze protein trimer exhibits increased thermal hysteresis activity.

    PubMed

    Can, Özge; Holland, Nolan B

    2013-12-03

    Antifreeze proteins (AFPs) are ice growth inhibitors that allow the survival of several species living at temperatures colder than the freezing point of their bodily fluids. AFP activity is commonly defined in terms of thermal hysteresis, which is the difference observed for the solution freezing and melting temperatures. Increasing the thermal hysteresis activity of these proteins, particularly at low concentrations, is of great interest because of their wide range of potential applications. In this study, we have designed and expressed one-, two-, and three-domain antifreeze proteins to improve thermal hysteresis activity through increased binding avidity. The three-domain type III AFP yielded significantly greater activity than the one- and two-domain proteins, reaching a thermal hysteresis of >1.6 °C at a concentration of <1 mM. To elucidate the basis of this increase, the data were fit to a multidomain protein adsorption model based on the classical Langmuir isotherm. Fits of the data to the modified isotherms yield values for the equilibrium binding constants for the adsorption of AFP to ice and indicate that protein surface coverage is proportional to thermal hysteresis activity.

  17. Charge-state dependent compaction and dissociation of protein complexes: insights from ion mobility and molecular dynamics.

    PubMed

    Hall, Zoe; Politis, Argyris; Bush, Matthew F; Smith, Lorna J; Robinson, Carol V

    2012-02-22

    Collapse to compact states in the gas phase, with smaller collision cross sections than calculated for their native-like structure, has been reported previously for some protein complexes although not rationalized. Here we combine experimental and theoretical studies to investigate the gas-phase structures of four multimeric protein complexes during collisional activation. Importantly, using ion mobility-mass spectrometry (IM-MS), we find that all four macromolecular complexes retain their native-like topologies at low energy. Upon increasing the collision energy, two of the four complexes adopt a more compact state. This collapse was most noticeable for pentameric serum amyloid P (SAP) which contains a large central cavity. The extent of collapse was found to be highly correlated with charge state, with the surprising observation that the lowest charge states were those which experience the greatest degree of compaction. We compared these experimental results with in vacuo molecular dynamics (MD) simulations of SAP, during which the temperature was increased. Simulations showed that low charge states of SAP exhibited compact states, corresponding to collapse of the ring, while intermediate and high charge states unfolded to more extended structures, maintaining their ring-like topology, as observed experimentally. To simulate the collision-induced dissociation (CID) of different charge states of SAP, we used MS to measure the charge state of the ejected monomer and assigned this charge to one subunit, distributing the residual charges evenly among the remaining four subunits. Under these conditions, MD simulations captured the unfolding and ejection of a single subunit for intermediate charge states of SAP. The highest charge states recapitulated the ejection of compact monomers and dimers, which we observed in CID experiments of high charge states of SAP, accessed by supercharging. This strong correlation between theory and experiment has implications for further

  18. Heated Proteins are Still Active in a Functionalized Nanoporous Support

    SciTech Connect

    Chen, Baowei; Qi, Wen N.; Li, Xiaolin; Lei, Chenghong; Liu, Jun

    2013-07-08

    We report that even under the heated condition, the conformation and activity of a protein can be hoarded in a functionalized nanoporous support via non-covalent interaction, although the hoarded protein was not exhibiting the full protein activity, the protein released subsequently still maintained its native conformation and activity. Glucose oxidase (GOX) was spontaneously and largely entrapped in aminopropyl-functionalized mesoporous silica (NH2-FMS) at 20 oC via a dominant electrostatic interaction. Although FMS-GOX displayed 45% activity of the free enzyme in solution, the GOX released from FMS exhibited its 100% activity prior to the entrapment. Surprisingly, the released GOX from FMS still maintained 89% of its initial activity prior to the entrapment after FMS-GOX was incubated at 60 oC for 1 h prior to release, while the free GOX in solution lost nearly all activity under the same incubation. Intrinsic fluorescence emission of GOX and native electrophoresis demonstrated that the heating resulted in significant conformational changes and oligomeric structures of the free GOX, but FMS efficiently maintained the thermal stability of GOX therein and resisted the thermal denaturation and oligomeric aggregation.

  19. Counteracting Protein Kinase Activity in the Heart: The Multiple Roles of Protein Phosphatases

    PubMed Central

    Weber, Silvio; Meyer-Roxlau, Stefanie; Wagner, Michael; Dobrev, Dobromir; El-Armouche, Ali

    2015-01-01

    Decades of cardiovascular research have shown that variable and flexible levels of protein phosphorylation are necessary to maintain cardiac function. A delicate balance between phosphorylated and dephosphorylated states of proteins is guaranteed by a complex interplay of protein kinases (PKs) and phosphatases. Serine/threonine phosphatases, in particular members of the protein phosphatase (PP) family govern dephosphorylation of the majority of these cardiac proteins. Recent findings have however shown that PPs do not only dephosphorylate previously phosphorylated proteins as a passive control mechanism but are capable to actively control PK activity via different direct and indirect signaling pathways. These control mechanisms can take place on (epi-)genetic, (post-)transcriptional, and (post-)translational levels. In addition PPs themselves are targets of a plethora of proteinaceous interaction partner regulating their endogenous activity, thus adding another level of complexity and feedback control toward this system. Finally, novel approaches are underway to achieve spatiotemporal pharmacologic control of PPs which in turn can be used to fine-tune misleaded PK activity in heart disease. Taken together, this review comprehensively summarizes the major aspects of PP-mediated PK regulation and discusses the subsequent consequences of deregulated PP activity for cardiovascular diseases in depth. PMID:26617522

  20. Protein kinase C activators inhibit capillary endothelial cell growth

    SciTech Connect

    Doctrow, S.R.

    1986-05-01

    Phorbol 12,13-dibutyrate (PDBu) binds specifically to bovine capillary endothelial (BCE) cells (K/sub d/ = 8nM) and inhibits the proliferation (K/sub 50/ = 6 +/- 4 nM). Under similar conditions, PDBu does not inhibit the growth of bovine aortic endothelial or smooth muscle cells. PDBu markedly attenuates the response of BCE cells to purified human hepatoma-derived growth factor which, in the absence of PDBu, stimulates BCE cell growth by about 3-fold. Several observations suggest that the inhibition of BCE cell growth by PDBu is mediated by protein kinase C: (1) different phorbol compounds inhibit BCE cell growth according to the relative potencies as protein kinase C activators (12-tetradecanoylphorbol 13-acetate > PDBu >> phorbol 12,13-diacetate >>>..beta..-phorbol; ..cap alpha..-phorbol 12,13-didecanoate). (2) Specific binding of PDBu to BCE cells is displaced by sn-1,2-dioctanoylglycerol (diC/sub 8/), a protein kinase C activator and an analog of the putative second messenger activating this kinase in vivo. The weak protein kinase C activator, sn-1,2-dibutyrylglycerol, does not affect PDBu binding. (3) A cytosolic extract from BCE cells contains a Ca/sup 2 +//phosphatidylserine-dependent kinase that is activated by diC/sub 8/ and PDBu, but not by ..beta..-phorbol. These results support a role for protein kinase C in suppressing capillary endothelial cell growth and may therefore have implications in the intracellular regulation of angiogenesis.

  1. Enzymatic Activity of the Scaffold Protein Rapsyn for Synapse Formation.

    PubMed

    Li, Lei; Cao, Yu; Wu, Haitao; Ye, Xinchun; Zhu, Zhihui; Xing, Guanglin; Shen, Chengyong; Barik, Arnab; Zhang, Bin; Xie, Xiaoling; Zhi, Wenbo; Gan, Lin; Su, Huabo; Xiong, Wen-Cheng; Mei, Lin

    2016-12-07

    Neurotransmission is ensured by a high concentration of neurotransmitter receptors at the postsynaptic membrane. This is mediated by scaffold proteins that bridge the receptors with cytoskeleton. One such protein is rapsyn (receptor-associated protein at synapse), which is essential for acetylcholine receptor (AChR) clustering and NMJ (neuromuscular junction) formation. We show that the RING domain of rapsyn contains E3 ligase activity. Mutation of the RING domain that abolishes the enzyme activity inhibits rapsyn- as well as agrin-induced AChR clustering in heterologous and muscle cells. Further biological and genetic studies support a working model where rapsyn, a classic scaffold protein, serves as an E3 ligase to induce AChR clustering and NMJ formation, possibly by regulation of AChR neddylation. This study identifies a previously unappreciated enzymatic function of rapsyn and a role of neddylation in synapse formation, and reveals a potential target of therapeutic intervention for relevant neurological disorders.

  2. The role of adapter proteins in T cell activation.

    PubMed

    Koretzky, G A; Boerth, N J

    1999-12-01

    Engagement of antigen receptors on lymphocytes leads to a myriad of complex signal transduction cascades. Recently, work from several laboratories has led to the identification and characterization of novel adapter molecules, proteins with no intrinsic enzymatic activity but which integrate signal transduction pathways by mediating protein-protein interactions. Interestingly, it appears that many of these adapter proteins play as critical a role as the effector enzymes themselves in both lymphocyte development and activation. This review describes some of the biochemical and molecular features of several of these newly identified hematopoietic cell-specific adapter molecules highlighting their importance in regulating (both positively and negatively) signal transduction mediated by the T cell antigen receptor.

  3. The regulation of AMP-activated protein kinase by phosphorylation.

    PubMed Central

    Stein, S C; Woods, A; Jones, N A; Davison, M D; Carling, D

    2000-01-01

    The AMP-activated protein kinase (AMPK) cascade is activated by an increase in the AMP/ATP ratio within the cell. AMPK is regulated allosterically by AMP and by reversible phosphorylation. Threonine-172 within the catalytic subunit (alpha) of AMPK (Thr(172)) was identified as the major site phosphorylated by the AMP-activated protein kinase kinase (AMPKK) in vitro. We have used site-directed mutagenesis to study the role of phosphorylation of Thr(172) on AMPK activity. Mutation of Thr(172) to an aspartic acid residue (T172D) in either alpha1 or alpha2 resulted in a kinase complex with approx. 50% the activity of the corresponding wild-type complex. The activity of wild-type AMPK decreased by greater than 90% following treatment with protein phosphatases, whereas the activity of the T172D mutant complex fell by only 10-15%. Mutation of Thr(172) to an alanine residue (T172A) almost completely abolished kinase activity. These results indicate that phosphorylation of Thr(172) accounts for most of the activation by AMPKK, but that other sites are involved. In support of this we have shown that AMPKK phosphorylates at least two other sites on the alpha subunit and one site on the beta subunit. Furthermore, we provide evidence that phosphorylation of Thr(172) may be involved in the sensitivity of the AMPK complex to AMP. PMID:10642499

  4. Ultrasensitive electrochemical immunoassay for surface array protein, a Bacillus anthracis biomarker using Au-Pd nanocrystals loaded on boron-nitride nanosheets as catalytic labels.

    PubMed

    Sharma, Mukesh Kumar; Narayanan, J; Pardasani, Deepak; Srivastava, Divesh N; Upadhyay, Sanjay; Goel, Ajay Kumar

    2016-06-15

    Bacillus anthracis, the causative agent of anthrax, is a well known bioterrorism agent. The determination of surface array protein (Sap), a unique biomarker for B. anthracis can offer an opportunity for specific detection of B. anthracis in culture broth. In this study, we designed a new catalytic bionanolabel and fabricated a novel electrochemical immunosensor for ultrasensitive detection of B. anthracis Sap antigen. Bimetallic gold-palladium nanoparticles were in-situ grown on poly (diallyldimethylammonium chloride) functionalized boron nitride nanosheets (Au-Pd NPs@BNNSs) and conjugated with the mouse anti-B. anthracis Sap antibodies (Ab2); named Au-Pd NPs@BNNSs/Ab2. The resulting Au-Pd NPs@BNNSs/Ab2 bionanolabel demonstrated high catalytic activity towards reduction of 4-nitrophenol. The sensitivity of the electrochemical immunosensor along with redox cycling of 4-aminophenol to 4-quinoneimine was improved to a great extent. Under optimal conditions, the proposed immunosensor exhibited a wide working range from 5 pg/mL to 100 ng/mL with a minimum detection limit of 1 pg/mL B. anthracis Sap antigen. The practical applicability of the immunosensor was demonstrated by specific detection of Sap secreted by the B. anthracis in culture broth just after 1h of growth. These labels open a new direction for the ultrasensitive detection of different biological warfare agents and their markers in different matrices.

  5. 30 CFR 585.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.618 What must I do... application, that describes the continued use of existing facilities approved in your SAP, you may keep...

  6. 30 CFR 585.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.618 What must I do... application, that describes the continued use of existing facilities approved in your SAP, you may keep...

  7. 30 CFR 585.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap § 585.618 What must I do... application, that describes the continued use of existing facilities approved in your SAP, you may keep...

  8. 30 CFR 285.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... SHELF Plans and Information Requirements Activities Under An Approved Sap § 285.618 What must I do upon... application, that describes the continued use of existing facilities approved in your SAP, you may keep...

  9. 30 CFR 285.618 - What must I do upon completion of approved site assessment activities?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... FACILITIES ON THE OUTER CONTINENTAL SHELF Plans and Information Requirements Activities Under An Approved Sap... approved in your SAP, you may keep such facilities in place on your lease during the time that MMS...

  10. Protein profiling of mouse livers with peroxisome proliferator-activated receptor alpha activation.

    PubMed

    Chu, Ruiyin; Lim, Hanjo; Brumfield, Laura; Liu, Hong; Herring, Chris; Ulintz, Peter; Reddy, Janardan K; Davison, Matthew

    2004-07-01

    Peroxisome proliferator-activated receptor alpha (PPARalpha) is important in the induction of cell-specific pleiotropic responses, including the development of liver tumors, when it is chronically activated by structurally diverse synthetic ligands such as Wy-14,643 or by unmetabolized endogenous ligands resulting from the disruption of the gene encoding acyl coenzyme A (CoA) oxidase (AOX). Alterations in gene expression patterns in livers with PPARalpha activation were delineated by using a proteomic approach to analyze liver proteins of Wy-14,643-treated and AOX(-/-) mice. We identified 46 differentially expressed proteins in mouse livers with PPARalpha activation. Up-regulated proteins, including acetyl-CoA acetyltransferase, farnesyl pyrophosphate synthase, and carnitine O-octanoyltransferase, are involved in fatty acid metabolism, whereas down-regulated proteins, including ketohexokinase, formiminotransferase-cyclodeaminase, fructose-bisphosphatase aldolase B, sarcosine dehydrogenase, and cysteine sulfinic acid decarboxylase, are involved in carbohydrate and amino acid metabolism. Among stress response and xenobiotic metabolism proteins, selenium-binding protein 2 and catalase showed a dramatic approximately 18-fold decrease in expression and a modest approximately 6-fold increase in expression, respectively. In addition, glycine N-methyltransferase, pyrophosphate phosphohydrolase, and protein phosphatase 1D were down-regulated with PPARalpha activation. These observations establish proteomic profiles reflecting a common and predictable pattern of differential protein expression in livers with PPARalpha activation. We conclude that livers with PPARalpha activation are transcriptionally geared towards fatty acid combustion.

  11. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  12. [Antimodification activity of the ArdA and Ocr proteins].

    PubMed

    Zavil'gel'skiĭ, G V; Kotova, V Iu; Rastorguev, S M

    2011-02-01

    The ArdA and Ocr antirestriction proteins, whose genes are in transmissible plasmids (ardA) and bacteriophage genomes (0.3 (ocr)), specifically inhibit type I restriction-modification enzymes. The Ocr protein (T7 bacteriophage) was shown to inhibit both restriction (endonuclease) and modification (methylase) activities of the EcoKI enzyme in a broad range of intracellular concentrations (starting from 10-20 molecules per cell). In contrast to Ocr, the ArdA protein (ColIb-P9 transmissible plasmid) inhibited both of the EcoKI activities only at high intracellular concentrations (30000-40000 molecules per cell). When the ArdA concentration was several fold lower, only endonuclease activity of EcoKI was inhibited. It was assumed that a poorer ArdA ability to inhibit EcoKI modification activity is related to the substantial difference in life cycle between transmissible plasmids (symbiosis with the bacterial cell) and bacteriophages (infection and lysis of bacteria). The Ocr and ArdA mutants that inhibited exclusively endonuclease activity of EcoKI were obtained. Antirestriction proteins incapable of homodimerization were assumed to inhibit only endonuclease activity of type I restriction-modification enzymes.

  13. Hydrodynamic collective effects of active proteins in biological membranes

    NASA Astrophysics Data System (ADS)

    Koyano, Yuki; Kitahata, Hiroyuki; Mikhailov, Alexander S.

    2016-08-01

    Lipid bilayers forming biological membranes are known to behave as viscous two-dimensional fluids on submicrometer scales; usually they contain a large number of active protein inclusions. Recently, it was shown [A. S. Mikhailov and R. Kapral, Proc. Natl. Acad. Sci. USA 112, E3639 (2015), 10.1073/pnas.1506825112] that such active proteins should induce nonthermal fluctuating lipid flows leading to diffusion enhancement and chemotaxislike drift for passive inclusions in biomembranes. Here, a detailed analytical and numerical investigation of such effects is performed. The attention is focused on the situations when proteins are concentrated within lipid rafts. We demonstrate that passive particles tend to become attracted by active rafts and are accumulated inside them.

  14. [Regulation of G protein-coupled receptor kinase activity].

    PubMed

    Haga, T; Haga, K; Kameyama, K; Nakata, H

    1994-09-01

    Recent progress on the activation of G protein-coupled receptor kinases is reviewed. beta-Adrenergic receptor kinase (beta ARK) is activated by G protein beta gamma -subunits, which interact with the carboxyl terminal portion of beta ARK. Muscarinic receptor m2-subtypes are phosphorylated by beta ARK1 in the central part of the third intracellular loop (I3). Phosphorylation of I3-GST fusion protein by beta ARK1 is synergistically stimulated by the beta gamma -subunits and mastoparan or a peptide corresponding to portions adjacent to the transmembrane segments of m2-receptors or by beta gamma -subunits and the agonist-bound I3-deleted m2 variant. These results indicate that agonist-bound receptors serve as both substrates and activators of beta ARK.

  15. [Histidine triad protein superfamily--biological function and enzymatic activity].

    PubMed

    Krakowiak, Agnieszka; Fryc, Izabela

    2012-01-01

    The HIT superfamily consists of proteins that share the histidine triad motif, His-X-His-X-His-X-X (where X is a hydrophobic amino acid), which constitutes enzymatic catalytic center. These enzymes act as nucleotidylyl hydrolase or transferase, and the mutation of the second histidine in the triad abolishes their activity. HIT proteins were found ubiquitous in all organisms and they were classified into 5 branches, which are represented by human proteins: HINT1, FHIT, Aprataxin, GALT and DCPS. Because HINT1 orthologs, which belong to the evolutionally oldest family branch, were found from prokaryotes to eukaryotes, it is clear that HIT motif was conserved during the evolution what means that the enzymatic activity is necessary for functions of these proteins. However, in few cases, e.g. HINT1 and FHIT, the connection between the biological function and the enzymatic activity is still obscure. In this review, the relations between biology and activity for 7 HIT proteins, which were found in human, are highlighted.

  16. Signal peptides are allosteric activators of the protein translocase

    PubMed Central

    Gouridis, Giorgos; Karamanou, Spyridoula; Gelis, Ioannis; Kalodimos, Charalampos G.; Economou, Anastassios

    2010-01-01

    Extra-cytoplasmic polypeptides are usually synthesized as “preproteins” carrying aminoterminal, cleavable signal peptides1 and secreted across membranes by translocases. The main bacterial translocase comprises the SecYEG protein-conducting channel and the peripheral ATPase motor SecA2,3. Most proteins destined for the periplasm and beyond are exported post-translationally by SecA2,3. Preprotein targeting to SecA is thought to involve signal peptides4 and chaperones like SecB5,6. Here we reveal that signal peptides have a novel role beyond targeting: they are essential allosteric activators of the translocase. Upon docking on their binding groove on SecA, signal peptides act in trans to drive three successive states: first, “triggering” that drives the translocase to a lower activation energy state; then “trapping” that engages non-native preprotein mature domains docked with high affinity on the secretion apparatus and, finally, “secretion” during which trapped mature domains undergo multiple turnovers of translocation in segments7. A significant contribution by mature domains renders signal peptides less critical in bacterial secretory protein targeting than currently assumed. Rather, it is their function as allosteric activators of the translocase that renders signal peptides essential for protein secretion. A role for signal peptides and targeting sequences as allosteric activators may be universal in protein translocases. PMID:19924216

  17. The FORTRAN static source code analyzer program (SAP) user's guide, revision 1

    NASA Technical Reports Server (NTRS)

    Decker, W.; Taylor, W.; Eslinger, S.

    1982-01-01

    The FORTRAN Static Source Code Analyzer Program (SAP) User's Guide (Revision 1) is presented. SAP is a software tool designed to assist Software Engineering Laboratory (SEL) personnel in conducting studies of FORTRAN programs. SAP scans FORTRAN source code and produces reports that present statistics and measures of statements and structures that make up a module. This document is a revision of the previous SAP user's guide, Computer Sciences Corporation document CSC/TM-78/6045. SAP Revision 1 is the result of program modifications to provide several new reports, additional complexity analysis, and recognition of all statements described in the FORTRAN 77 standard. This document provides instructions for operating SAP and contains information useful in interpreting SAP output.

  18. AMP-activated protein kinase--an archetypal protein kinase cascade?

    PubMed

    Hardie, D G; MacKintosh, R W

    1992-10-01

    Mammalian AMP-activated protein kinase is the central component of a protein kinase cascade which inactivates three key enzymes involved in the synthesis or release of free fatty acids and cholesterol inside the cell. The kinase cascade is activated by elevation of AMP, and perhaps also by fatty acid and cholesterol metabolites. The system may fulfil a protective function, preventing damage caused by depletion of ATP or excessive intracellular release of free lipids, a type of stress response. Recent evidence suggests that it may have been in existence for at least a billion years, since a very similar protein kinase cascade is present in higher plants. This system therefore represents an early eukaryotic protein kinase cascade, which is unique in that it is regulated by intracellular metabolites rather than extracellular signals or cell cycle events.

  19. Germ cell mitogenic activity is associated with nerve growth factor-like protein(s).

    PubMed

    Onoda, M; Pflug, B; Djakiew, D

    1991-12-01

    The mitogenicity of germ cell proteins released from round spermatids (RS) and pachytene spermatocytes (PS) was investigated. Germ cells were isolated by centrifugal elutriation from 90-day-old rat testes and incubated in a supplement enriched culture media that lacked exogenous proteins. The conditioned culture media of RS and PS were dialysed/concentrated and lyophilized to prepare RS protein (RSP) and PS protein (PSP). Mitogenic activity of RSP and PSP was determined by 3H-thymidine incorporation into Swiss 3T3 fibroblasts. RSP and PSP stimulated 3H-thymidine incorporation by fibroblasts in a dose-dependent manner. At a higher concentration of RSP (300 micrograms/ml), fibroblast proliferation was stimulated from 6- to 20-fold of control cultures, whereas PSP (300 micrograms/ml) stimulated fibroblast proliferation 2.5-fold of control cultures. Since RSP exhibited substantially greater mitogenic activity than PSP we further investigated the RSP mitogenic substance(s) by immunoneutralization with antibodies against several growth factors. The mitogenic activity of RSP was significantly reduced by treatment with nerve growth factor (NGF) antibody, while neither the treatment of RSP with acidic fibroblast growth factor (aFGF) antibody, nor basic fibroblast growth factor (bFGF) antibody significantly modified the mitogenic activity of RSP. Interestingly, murine NGF-beta, recombinant human NGF-beta, and bovine serum albumin (BSA) did not exhibit mitogenic activity on 3T3 fibroblasts. Nevertheless, the presence of a NGF-like protein in RS and PS was confirmed by indirect immunofluorescence staining with a murine NGF antibody. Subsequently, a Western blot analysis with the NGF antibody identified two immunoreactive bands of 41 +/- 2 kDa and 51 +/- 1 kDa in both RSP and PSP under reduced conditions. These germ cell NGF-like proteins were apparently different from similarly prepared murine and human NGFs (13 kDa) in their molecular weight. Furthermore, neurite outgrowth

  20. The Adaptor Molecule SAP Regulates IFNγ and IL-4 Production in Vα14 Transgenic NKT cells via Effects on GATA-3 and T-bet Expression1

    PubMed Central

    Cen, Osman; Ueda, Aki; Guzman, Laura; Jain, Jimmy; Bassiri, Hamid; Nichols, Kim E.; Stein, Paul L.

    2008-01-01

    NKT cells comprise a rare regulatory T cell population of limited TCR diversity, with most cells utilizing a Vα14Jα18 TCR. These cells exhibit a critical dependence on the signaling adapter molecule SAP for their ontogeny, an aspect not seen in conventional αβ T cells. Prior studies demonstrate that SAP enhances TCR-induced activation of NF-kB in CD4+ T cells. Since NF-kB is required for NKT cell development, SAP might promote the ontogeny of this lineage by signaling to NF-kB. In this report, we demonstrate that forced expression of the NF-kB target gene, Bcl-xL, or IKKβ, a catalytic subunit of the IkB kinase complex essential for NF-kB activation, fails to restore NKT cell development in sap−/− mice, suggesting that SAP mediates NKT cell development independently of NF-kB. To examine the role of SAP in NKT cell function, we generated NKT cells in sap−/− mice by expressing a transgene encoding the Vα14Jα18 component of the invariant TCR. These cells bound α-GalCer loaded CD1d tetramers, but exhibited a very immature CD24+NK1.1- phenotype. While sap−/− tetramer-reactive cells proliferated in response to TCR activation, they did not produce appreciable levels of IL-4 or IFN-γ. The reduction in cytokine production correlated with the near absence of GATA-3 and T-bet, key transcription factors regulating cytokine expression and maturation of NKT cells. Ectopic expression of GATA-3 partially restored IL-4 production by the NKT cells. Collectively these data suggest that by promoting GATA3 and T-bet expression, SAP exerts control over NKT cell development and mature NKT cell cytokine production. PMID:19155483

  1. Biochemical composition of symplastic sap from sugarcane genetically modified to overproduce proline.

    PubMed

    Balestro, Graciele Carraro; Higashi, Bruna; Lopes, Sheila Mara Sanches; Gonçalves, José Eduardo; Vieira, Luiz Gonzaga Esteves; de Oliveira, Arildo José Braz; Gonçalves, Regina Aparecida Correia

    2017-04-01

    Global interest in sugarcane has increased significantly in recent years because of its economic impact on sustainable energy production. The purpose of the present study was to evaluate changes in the concentrations of total sugars, amino acids, free proline, and total proteins by colorimetric analyses and nuclear magnetic resonance (NMR) to perform a metabolic profiling of a water-soluble fraction of symplastic sap in response to the constitutive expression of a mutant Δ(1)-pyrroline-5-carboxylate synthetase (P5CS) gene from Vigna aconitifolia. However, there was not a significant increase in the free proline content in the sap of transgenic plants compared to the non-transformed control plants. The most noticeable difference between the two genotypes was an almost two-fold increase in the accumulation of sucrose in the stem internodes of P5CS transgenic sugarcane plants. The results presented in this work showed that transgenic sugarcane plants with increased levels of free proline accumulates high soluble sugar content and, therefore, may represent a novel genotype for improving sugarcane cultivars.

  2. Protein Phosphorylation in Amyloplasts Regulates Starch Branching Enzyme Activity and Protein–Protein Interactions

    PubMed Central

    Tetlow, Ian J.; Wait, Robin; Lu, Zhenxiao; Akkasaeng, Rut; Bowsher, Caroline G.; Esposito, Sergio; Kosar-Hashemi, Behjat; Morell, Matthew K.; Emes, Michael J.

    2004-01-01

    Protein phosphorylation in amyloplasts and chloroplasts of Triticum aestivum (wheat) was investigated after the incubation of intact plastids with γ-32P-ATP. Among the soluble phosphoproteins detected in plastids, three forms of starch branching enzyme (SBE) were phosphorylated in amyloplasts (SBEI, SBEIIa, and SBEIIb), and both forms of SBE in chloroplasts (SBEI and SBEIIa) were shown to be phosphorylated after sequencing of the immunoprecipitated 32P-labeled phosphoproteins using quadrupole-orthogonal acceleration time of flight mass spectrometry. Phosphoamino acid analysis of the phosphorylated SBE forms indicated that the proteins are all phosphorylated on Ser residues. Analysis of starch granule–associated phosphoproteins after incubation of intact amyloplasts with γ-32P-ATP indicated that the granule-associated forms of SBEII and two granule-associated forms of starch synthase (SS) are phosphorylated, including SSIIa. Measurement of SBE activity in amyloplasts and chloroplasts showed that phosphorylation activated SBEIIa (and SBEIIb in amyloplasts), whereas dephosphorylation using alkaline phosphatase reduced the catalytic activity of both enzymes. Phosphorylation and dephosphorylation had no effect on the measurable activity of SBEI in amyloplasts and chloroplasts, and the activities of both granule-bound forms of SBEII in amyloplasts were unaffected by dephosphorylation. Immunoprecipitation experiments using peptide-specific anti-SBE antibodies showed that SBEIIb and starch phosphorylase each coimmunoprecipitated with SBEI in a phosphorylation-dependent manner, suggesting that these enzymes may form protein complexes within the amyloplast in vivo. Conversely, dephosphorylation of immunoprecipitated protein complex led to its disassembly. This article reports direct evidence that enzymes of starch metabolism (amylopectin synthesis) are regulated by protein phosphorylation and indicate a wider role for protein phosphorylation and protein–protein

  3. Interaction between transcriptional activator protein LAC9 and negative regulatory protein GAL80.

    PubMed Central

    Salmeron, J M; Langdon, S D; Johnston, S A

    1989-01-01

    In Saccharomyces cerevisiae, transcriptional activation mediated by the GAL4 regulatory protein is repressed in the absence of galactose by the binding of the GAL80 protein, an interaction that requires the carboxy-terminal 28 amino acids of GAL4. The homolog of GAL4 from Kluyveromyces lactis, LAC9, activates transcription in S. cerevisiae and is highly similar to GAL4 in its carboxyl terminus but is not repressed by wild-type levels of GAL80 protein. Here we show that GAL80 does repress LAC9-activated transcription in S. cerevisiae if overproduced. We sought to determine the molecular basis for the difference in the responses of the LAC9 and GAL4 proteins to GAL80. Our results indicate that this difference is due primarily to the fact that under wild-type conditions, the level of LAC9 protein in S. cerevisiae is much higher than that of GAL4, which suggests that LAC9 escapes GAL80-mediated repression by titration of GAL80 protein in vivo. The difference in response to GAL80 is not due to amino acid sequence differences between the LAC9 and GAL4 carboxyl termini. We discuss the implications of these results for the mechanism of galactose metabolism regulation in S. cerevisiae and K. lactis. Images PMID:2550790

  4. Actions of Rho family small G proteins and p21-activated protein kinases on mitogen-activated protein kinase family members.

    PubMed Central

    Frost, J A; Xu, S; Hutchison, M R; Marcus, S; Cobb, M H

    1996-01-01

    The mitogen-activated protein (MAP) kinases are a family of serine/threonine kinases that are regulated by distinct extracellular stimuli. The currently known members include extracellular signal-regulated protein kinase 1 (ERK1), ERK2, the c-Jun N-terminal kinase/stress-activated protein kinases (JNK/SAPKs), and p38 MAP kinases. We find that overexpression of the Ste20-related enzymes p21-activated kinase 1 (PAK1) and PAK2 in 293 cells is sufficient to activate JNK/SAPK and to a lesser extent p38 MAP kinase but not ERK2. Rat MAP/ERK kinase kinase 1 can stimulate the activity of each of these MAP kinases. Although neither activated Rac nor the PAKs stimulate ERK2 activity, overexpression of either dominant negative Rac2 or the N-terminal regulatory domain of PAK1 inhibits Ras-mediated activation of ERK2, suggesting a permissive role for Rac in the control of the ERK pathway. Furthermore, constitutively active Rac2, Cdc42hs, and RhoA synergize with an activated form of Raf to increase ERK2 activity. These findings reveal a previously unrecognized connection between Rho family small G proteins and the ERK pathway. PMID:8668187

  5. Methods to distinguish various types of protein phosphatase activity

    SciTech Connect

    Brautigan, D.L.; Shriner, C.L.

    1988-01-01

    To distinguish the action of protein Tyr(P) and protein Ser(P)/Thr(P) phosphatases on /sup 32/P-labeled phosphoproteins in subcellular fractions different inhibitors and activators are utilized. Comparison of the effects of added compounds provides a convenient, indirect method to characterize dephosphorylation reactions. Protein Tyr(P) phosphatases are specifically inhibited by micromolar Zn2+ or vanadate, and show maximal activity in the presence of EDTA. The other class of cellular phosphatases, specific for protein Ser(P) and Thr(P) residues, are inhibited by fluoride and EDTA. In this class of enzymes two major functional types can be distinguished: those sensitive to inhibition by the heat-stable protein inhibitor-2 and not stimulated by polycations, and those not sensitive to inhibition and stimulated by polycations. Preparation of /sup 32/P-labeled Tyr(P) and Ser(P) phosphoproteins also is presented for the direct measurement of phosphatase activities in preparations by the release of acid-soluble (/sup 32/P)phosphate.

  6. Multiple switches in G protein-coupled receptor activation.

    PubMed

    Ahuja, Shivani; Smith, Steven O

    2009-09-01

    The activation mechanism of G protein-coupled receptors has presented a puzzle that finally may be close to solution. These receptors have a relatively simple architecture consisting of seven transmembrane helices that contain just a handful of highly conserved amino acids, yet they respond to light and a range of chemically diverse ligands. Recent NMR structural studies on the active metarhodopsin II intermediate of the visual receptor rhodopsin, along with the recent crystal structure of the apoprotein opsin, have revealed multiple structural elements or 'switches' that must be simultaneously triggered to achieve full activation. The confluence of several required structural changes is an example of "coincidence counting", which is often used by nature to regulate biological processes. In ligand-activated G protein-coupled receptors, the presence of multiple switches may provide an explanation for the differences between full, partial and inverse agonists.

  7. Functional modulation of AMP-activated protein kinase by cereblon.

    PubMed

    Lee, Kwang Min; Jo, Sooyeon; Kim, Hyunyoung; Lee, Jongwon; Park, Chul-Seung

    2011-03-01

    Mutations in cereblon (CRBN), a substrate binding component of the E3 ubiquitin ligase complex, cause a form of mental retardation in humans. However, the cellular proteins that interact with CRBN remain largely unknown. Here, we report that CRBN directly interacts with the α1 subunit of AMP-activated protein kinase (AMPK α1) and inhibits the activation of AMPK activation. The ectopic expression of CRBN reduces phosphorylation of AMPK α1 and, thus, inhibits the enzyme in a nutrient-independent manner. Moreover, AMPK α1 can be potently activated by suppressing endogenous CRBN using CRBN-specific small hairpin RNAs. Thus, CRBN may act as a negative modulator of the AMPK signaling pathway in vivo.

  8. AMP-activated protein kinase and metabolic control

    PubMed Central

    Viollet, Benoit; Andreelli, Fabrizio

    2011-01-01

    AMP-activated protein kinase (AMPK), a phylogenetically conserved serine/threonine protein kinase, is a major regulator of cellular and whole-body energy homeostasis that coordinates metabolic pathways in order to balance nutrient supply with energy demand. It is now recognized that pharmacological activation of AMPK improves blood glucose homeostasis, lipid profile and blood pressure in insulin-resistant rodents. Indeed, AMPK activation mimics the beneficial effects of physical activity or those of calorie restriction by acting on multiple cellular targets. In addition it is now demonstrated that AMPK is one of the probable (albeit indirect) targets of major antidiabetic drugs including, the biguanides (metformin) and thiazolidinediones, as well as of insulin sensitizing adipokines (e.g., adiponectin). Taken together, such findings highlight the logic underlying the concept of targeting the AMPK pathway for the treatment of metabolic syndrome and type 2 diabetes. PMID:21484577

  9. L-Alanylglutamine inhibits signaling proteins that activate protein degradation, but does not affect proteins that activate protein synthesis after an acute resistance exercise.

    PubMed

    Wang, Wanyi; Choi, Ran Hee; Solares, Geoffrey J; Tseng, Hung-Min; Ding, Zhenping; Kim, Kyoungrae; Ivy, John L

    2015-07-01

    Sustamine™ (SUS) is a dipeptide composed of alanine and glutamine (AlaGln). Glutamine has been suggested to increase muscle protein accretion; however, the underlying molecular mechanisms of glutamine on muscle protein metabolism following resistance exercise have not been fully addressed. In the present study, 2-month-old rats climbed a ladder 10 times with a weight equal to 75 % of their body mass attached at the tail. Rats were then orally administered one of four solutions: placebo (PLA-glycine = 0.52 g/kg), whey protein (WP = 0.4 g/kg), low dose of SUS (LSUS = 0.1 g/kg), or high dose of SUS (HSUS = 0.5 g/kg). An additional group of sedentary (SED) rats was intubated with glycine (0.52 g/kg) at the same time as the ladder-climbing rats. Blood samples were collected immediately after exercise and at either 20 or 40 min after recovery. The flexor hallucis longus (FHL), a muscle used for climbing, was excised at 20 or 40 min post exercise and analyzed for proteins regulating protein synthesis and degradation. All supplements elevated the phosphorylation of FOXO3A above SED at 20 min post exercise, but only the SUS supplements significantly reduced the phosphorylation of AMPK and NF-kB p65. SUS supplements had no effect on mTOR signaling, but WP supplementation yielded a greater phosphorylation of mTOR, p70S6k, and rpS6 compared with PLA at 20 min post exercise. However, by 40 min post exercise, phosphorylation of mTOR and rpS6 in PLA had risen to levels not different than WP. These results suggest that SUS blocks the activation of intracellular signals for MPB, whereas WP accelerates mRNA translation.

  10. Detergent activation of the binding protein in the folate radioassay

    SciTech Connect

    Hansen, S.I.; Holm, J.; Lyngbye, J.

    1982-01-01

    A minor cow's whey protein associated with ..beta..-lactoglobulin is used as binding protein in the competitive radioassay for serum and erythrocyte folate. Seeking to optimize the assay, we tested the performance of binder solutions of increasing purity. The folate binding protein was isolated from cow's whey by means of CM-Sepharose CL-6B cation-exchange chromatography, and further purified on a methotrexate-AH-Sepharose 4B affinity matrix. In contrast to ..beta..-lactoglobulin, the purified protein did not bind folate unless the detergents cetyltrimethylammonium (10 mmol/Ll) or Triton X-100 (1 g/L) were present. Such detergent activation was not needed in the presence of serum. There seems to be a striking analogy between these phenomena and the well-known reactivation of certain purified membrane-derived enzymes by surfactants (lipids/detergents).

  11. [Modulators of the regulatory protein activity acting at microdoses].

    PubMed

    Iamskova, V P; Krasnov, M S; Skripnikova, V S; Moliavka, A A; Il'ina, A P; Margasiuk, D V; Borisenko, A V; Berezin, B B; Iamskov, I A

    2009-01-01

    New, previously not studied bioregulators active in the ultra low doses corresponding of 10(-8) - 10(-17) mg/ml have been isolated from vitreoretinal tissue of eye. It has been shown that these bioregulators comprise some regulatory peptides-modulators represented by proteins with molecular weights 15-70 KDa one of which is bovine serum albumin. Correlation between the nanosize of bioregulators and their ability to show activity in ultra low doses is established.

  12. STAT5-Interacting Proteins: A Synopsis of Proteins that Regulate STAT5 Activity

    PubMed Central

    Able, Ashley A.; Burrell, Jasmine A.; Stephens, Jacqueline M.

    2017-01-01

    Signal Transducers and Activators of Transcription (STATs) are key components of the JAK/STAT pathway. Of the seven STATs, STAT5A and STAT5B are of particular interest for their critical roles in cellular differentiation, adipogenesis, oncogenesis, and immune function. The interactions of STAT5A and STAT5B with cytokine/hormone receptors, nuclear receptors, transcriptional regulators, proto-oncogenes, kinases, and phosphatases all contribute to modulating STAT5 activity. Among these STAT5 interacting proteins, some serve as coactivators or corepressors to regulate STAT5 transcriptional activity and some proteins can interact with STAT5 to enhance or repress STAT5 signaling. In addition, a few STAT5 interacting proteins have been identified as positive regulators of STAT5 that alter serine and tyrosine phosphorylation of STAT5 while other proteins have been identified as negative regulators of STAT5 via dephosphorylation. This review article will discuss how STAT5 activity is modulated by proteins that physically interact with STAT5. PMID:28287479

  13. Protein kinase A regulates the osteogenic activity of Osterix.

    PubMed

    He, Siyuan; Choi, You Hee; Choi, Joong-Kook; Yeo, Chang-Yeol; Chun, ChangJu; Lee, Kwang Youl

    2014-10-01

    Osterix belongs to the SP gene family and is a core transcription factor responsible for osteoblast differentiation and bone formation. Activation of protein kinase A (PKA), a serine/threonine kinase, is essential for controlling bone formation and BMP-induced osteoblast differentiation. However, the relationship between Osterix and PKA is still unclear. In this report, we investigated the precise role of the PKA pathway in regulating Osterix during osteoblast differentiation. We found that PKA increased the protein level of Osterix; PKA phosphorylated Osterix, increased protein stability, and enhanced the transcriptional activity of Osterix. These results suggest that Osterix is a novel target of PKA, and PKA modulates osteoblast differentiation partially through the regulation of Osterix.

  14. Installing hydrolytic activity into a completely de novo protein framework

    NASA Astrophysics Data System (ADS)

    Burton, Antony J.; Thomson, Andrew R.; Dawson, William M.; Brady, R. Leo; Woolfson, Derek N.

    2016-09-01

    The design of enzyme-like catalysts tests our understanding of sequence-to-structure/function relationships in proteins. Here we install hydrolytic activity predictably into a completely de novo and thermostable α-helical barrel, which comprises seven helices arranged around an accessible channel. We show that the lumen of the barrel accepts 21 mutations to functional polar residues. The resulting variant, which has cysteine-histidine-glutamic acid triads on each helix, hydrolyses p-nitrophenyl acetate with catalytic efficiencies that match the most-efficient redesigned hydrolases based on natural protein scaffolds. This is the first report of a functional catalytic triad engineered into a de novo protein framework. The flexibility of our system also allows the facile incorporation of unnatural side chains to improve activity and probe the catalytic mechanism. Such a predictable and robust construction of truly de novo biocatalysts holds promise for applications in chemical and biochemical synthesis.

  15. 5'-AMP-activated protein kinase signaling in Caenorhabditis elegans.

    PubMed

    Beale, Elmus G

    2008-01-01

    5'-AMP-activated protein kinase (AMPK) has been called "the metabolic master switch" because of its central role in regulating fuel homeostasis. AMPK, a heterotrimeric serine/threonine protein kinase composed of alpha, beta, and gamma subunits, is activated by upstream kinases and by 5'-AMP in response to various nutritional and stress signals. Downstream effects include regulation of metabolism, protein synthesis, cell growth, and mediation of the actions of a number of hormones, including leptin. However, AMPK research represents a young and growing field; hence, there are many unanswered questions regarding the control and action of AMPK. This review presents evidence for the existence of AMPK signaling pathways in Caenorhabditis elegans, a genetically tractable model organism that has yet to be fully exploited to elucidate AMPK signaling mechanisms.

  16. A designed supramolecular protein assembly with in vivo enzymatic activity.

    PubMed

    Song, Woon Ju; Tezcan, F Akif

    2014-12-19

    The generation of new enzymatic activities has mainly relied on repurposing the interiors of preexisting protein folds because of the challenge in designing functional, three-dimensional protein structures from first principles. Here we report an artificial metallo-β-lactamase, constructed via the self-assembly of a structurally and functionally unrelated, monomeric redox protein into a tetrameric assembly that possesses catalytic zinc sites in its interfaces. The designed metallo-β-lactamase is functional in the Escherichia coli periplasm and enables the bacteria to survive treatment with ampicillin. In vivo screening of libraries has yielded a variant that displays a catalytic proficiency [(k(cat)/K(m))/k(uncat)] for ampicillin hydrolysis of 2.3 × 10(6) and features the emergence of a highly mobile loop near the active site, a key component of natural β-lactamases to enable substrate interactions.

  17. New functional assays to selectively quantify the activated protein C- and tissue factor pathway inhibitor-cofactor activities of protein S in plasma.

    PubMed

    Alshaikh, N A; Rosing, J; Thomassen, M C L G D; Castoldi, E; Simioni, P; Hackeng, T M

    2017-02-17

    Essentials Protein S is a cofactor of activated protein C (APC) and tissue factor pathway inhibitor (TFPI). There are no assays to quantify separate APC and TFPI cofactor activities of protein S in plasma. We developed assays to measure the APC- and TFPI-cofactor activities of protein S in plasma. The assays were sensitive to protein S deficiency, and not affected by the Factor V Leiden mutation.

  18. Protein S as an in vivo cofactor to activated protein C in prevention of microarterial thrombosis in rabbits.

    PubMed Central

    Arnljots, B; Dahlbäck, B

    1995-01-01

    The antithrombotic effects of bovine activated protein C (APC) and protein S were investigated in a rabbit model of microarterial thrombosis. Because of the species specificity of the APC-protein S interaction, bovine APC expresses potent anticoagulant activity in rabbit plasma only when bovine protein S is also present. This provided a way to assess the contribution of bovine protein S to the antithrombotic effect of bovine APC. Rabbits were infused with boluses of activated protein C (0.1, 0.2, 0.4, or 0.8 mg/kg), protein S (0.5 mg/kg), or activated protein C (0.1 or 0.01 mg/kg) plus protein S (0.5 mg/kg). APC alone produced a dose-dependent antithrombotic effect, but only the group receiving the highest dose differed significantly from controls. While a low dose of activated protein C (0.1 mg/kg) alone had no antithrombotic effect, together with protein S (0.5 mg/kg) it produced a potent response. The presented results demonstrate the in vivo significance of protein S as a cofactor to activated protein C. The data show that a potent antithrombotic effect, without hemorrhagic side effects or significant systemic anticoagulation, may be achieved by low doses of activated protein C when combined with protein S. Images PMID:7738165

  19. Impacts of Hydrological Alterations to the Tonle Sap Ecosystem of the Mekong River Basin

    NASA Astrophysics Data System (ADS)

    Arias, M. E.; Cochrane, T. A.

    2013-12-01

    The Tonle Sap is the largest and most important natural wetland in Southeast Asia. It covers an area of more than 15,000 km2 with a unique mosaic of natural and agricultural floodplain habitats that coexist with the largest fishery in the Mekong Basin. Accelerating hydropower development and climate change, however, are altering the Mekong's hydrology, which could negatively affect downstream ecosystems. The Tonle Sap is facing a two-fold problem. First, the link between its hydrology and ecosystem properties is not well understood. Second, potential ecological changes caused by future hydrological disruptions related to hydropower and climate change are unknown. Thus, the main objective of this study was to quantify how alterations to the Mekong hydrology could affect the Tonle Sap ecosystem. An assessment of landscape patterns revealed a distinct relationship between inundation and vegetation. Habitats in the Tonle Sap were divided into five groups based on annual flood duration, as well as physiognomic factors and human activity: (1) open water, (2) gallery forest, (3) seasonally flooded habitats, (4) transitional habitats, and (5) rainfed habitats. Large shifts could occur as a result of hydropower development scenarios by the 2030s; areas optimal for gallery forest could decrease by 82% from baseline conditions, whereas areas of rainfed habitats could increase by 10-13 % (813-1061 km2). An assessment of habitat patterns demonstrated that despite the complexity and intense human use of this ecosystem, the Mekong flood-pulse hydrology is the underlying driver of habitat characteristics by (1) determining inundation depth and duration, (2) creating the main soils gradient, (3) limiting the area cleared for agriculture, (4) influencing vegetation structure and water quality, and (5) shaping the composition of plant species. A numerical model was used to estimate aquatic net primary production (NPP) as a function of hydrology, sediments, and habitat characteristics

  20. Monitoring Brain Activity with Protein Voltage and Calcium Sensors

    PubMed Central

    Storace, Douglas A.; Braubach, Oliver R.; Jin, Lei; Cohen, Lawrence B.; Sung, Uhna

    2015-01-01

    Understanding the roles of different cell types in the behaviors generated by neural circuits requires protein indicators that report neural activity with high spatio-temporal resolution. Genetically encoded fluorescent protein (FP) voltage sensors, which optically report the electrical activity in distinct cell populations, are, in principle, ideal candidates. Here we demonstrate that the FP voltage sensor ArcLight reports odor-evoked electrical activity in the in vivo mammalian olfactory bulb in single trials using both wide-field and 2-photon imaging. ArcLight resolved fast odorant-responses in individual glomeruli, and distributed odorant responses across a population of glomeruli. Comparisons between ArcLight and the protein calcium sensors GCaMP3 and GCaMP6f revealed that ArcLight had faster temporal kinetics that more clearly distinguished activity elicited by individual odorant inspirations. In contrast, the signals from both GCaMPs were a saturating integral of activity that returned relatively slowly to the baseline. ArcLight enables optical electrophysiology of mammalian neuronal population activity in vivo. PMID:25970202

  1. Visible-Light-Triggered Activation of a Protein Kinase Inhibitor.

    PubMed

    Wilson, Danielle; Li, Jason W; Branda, Neil R

    2017-02-20

    A photoresponsive small molecule undergoes a ring-opening reaction when exposed to visible light and becomes an active inhibitor of the enzyme protein kinase C. This "turning on" of enzyme inhibition with light puts control into the hands of the user, creating the opportunity to regulate when and where enzyme catalysis takes place.

  2. Comparative evaluation of p5+14 with SAP and peptide p5 by dual-energy SPECT imaging of mice with AA amyloidosis

    PubMed Central

    Martin, Emily B.; Williams, Angela; Richey, Tina; Stuckey, Alan; Heidel, R. Eric; Kennel, Stephen J.; Wall, Jonathan S.

    2016-01-01

    Amyloidosis is a protein-misfolding disorder characterized by the extracellular deposition of amyloid, a complex matrix composed of protein fibrils, hyper-sulphated glycosaminoglycans and serum amyloid P component (SAP). Accumulation of amyloid in visceral organs results in the destruction of tissue architecture leading to organ dysfunction and failure. Early differential diagnosis and disease monitoring are critical for improving patient outcomes; thus, whole body amyloid imaging would be beneficial in this regard. Non-invasive molecular imaging of systemic amyloid is performed in Europe by using iodine-123-labelled SAP; however, this tracer is not available in the US. Therefore, we evaluated synthetic, poly-basic peptides, designated p5 and p5+14, as alternative radiotracers for detecting systemic amyloidosis. Herein, we perform a comparative effectiveness evaluation of radiolabelled peptide p5+14 with p5 and SAP, in amyloid-laden mice, using dual-energy SPECT imaging and tissue biodistribution measurements. All three radiotracers selectively bound amyloid in vivo; however, p5+14 was significantly more effective as compared to p5 in certain organs. Moreover, SAP bound principally to hepatosplenic amyloid, whereas p5+14 was broadly distributed in numerous amyloid-laden anatomic sites, including the spleen, liver, pancreas, intestines and heart. These data support clinical validation of p5+14 as an amyloid radiotracer for patients in the US. PMID:26936002

  3. Cholesterol-Lowering Activity of Tartary Buckwheat Protein.

    PubMed

    Zhang, Chengnan; Zhang, Rui; Li, Yuk Man; Liang, Ning; Zhao, Yimin; Zhu, Hanyue; He, Zouyan; Liu, Jianhui; Hao, Wangjun; Jiao, Rui; Ma, Ka Ying; Chen, Zhen-Yu

    2017-03-08

    Previous research has shown that Tartary buckwheat flour is capable of reducing plasma cholesterol. The present study was to examine the effect of rutin and Tartary buckwheat protein on plasma total cholesterol (TC) in hypercholesterolemia hamsters. In the first animal experiment, 40 male hamsters were divided into four groups fed either the control diet or one of the three experimental diets containing 8.2 mmol rutin, 8.2 mmol quercetin, or 2.5 g kg(-1) cholestyramine, respectively. Results showed that only cholestyramine but not rutin and its aglycone quercetin decreased plasma TC, which suggested that rutin was not the active ingredient responsible for plasma TC-lowering activity of Tartary buckwheat flour. In the second animal experiment, 45 male hamsters were divided into five groups fed either the control diet or one of the four experimental diets containing 24% Tartary buckwheat protein, 24% rice protein, 24% wheat protein, or 5 g kg(-1) cholestyramine, respectively. Tartary buckwheat protein reduced plasma TC more effectively than cholestyramine (45% versus 37%), while rice and wheat proteins only reduced plasma TC by 10-13%. Tartary buckwheat protein caused 108% increase in the fecal excretion of total neutral sterols and 263% increase in the fecal excretion of total acidic sterols. real-time polymerase chain reaction and Western blotting analyses showed that Tartary buckwheat protein affected the gene expression of intestinal Niemann-Pick C1-like protein 1 (NPC1L1), acyl CoA:cholesterol acyltransferase 2 (ACAT2), and ATP binding cassette transporters 5 and 8 (ABCG5/8) in a down trend, whereas it increased the gene expression of hepatic cholesterol-7α -hydroxylase (CYP7A1). It was concluded that Tartary buckwheat protein was at least one of the active ingredients in Tartary buckwheat flour to lower plasma TC, mainly mediated by enhancing the excretion of bile acids via up-regulation of hepatic CYP7A1 and also by inhibiting the absorption of dietary

  4. Reassessing the Potential Activities of Plant CGI-58 Protein.

    PubMed

    Khatib, Abdallah; Arhab, Yani; Bentebibel, Assia; Abousalham, Abdelkarim; Noiriel, Alexandre

    2016-01-01

    Comparative Gene Identification-58 (CGI-58) is a widespread protein found in animals and plants. This protein has been shown to participate in lipolysis in mice and humans by activating Adipose triglyceride lipase (ATGL), the initial enzyme responsible for the triacylglycerol (TAG) catabolism cascade. Human mutation of CGI-58 is the cause of Chanarin-Dorfman syndrome, an orphan disease characterized by a systemic accumulation of TAG which engenders tissue disorders. The CGI-58 protein has also been shown to participate in neutral lipid metabolism in plants and, in this case, a mutation again provokes TAG accumulation. Although its roles as an ATGL coactivator and in lipid metabolism are quite clear, the catalytic activity of CGI-58 is still in question. The acyltransferase activities of CGI-58 have been speculated about, reported or even dismissed and experimental evidence that CGI-58 expressed in E. coli possesses an unambiguous catalytic activity is still lacking. To address this problem, we developed a new set of plasmids and site-directed mutants to elucidate the in vivo effects of CGI-58 expression on lipid metabolism in E. coli. By analyzing the lipid composition in selected E. coli strains expressing CGI-58 proteins, and by reinvestigating enzymatic tests with adequate controls, we show here that recombinant plant CGI-58 has none of the proposed activities previously described. Recombinant plant and mouse CGI-58 both lack acyltransferase activity towards either lysophosphatidylglycerol or lysophosphatidic acid to form phosphatidylglycerol or phosphatidic acid and recombinant plant CGI-58 does not catalyze TAG or phospholipid hydrolysis. However, expression of recombinant plant CGI-58, but not mouse CGI-58, led to a decrease in phosphatidylglycerol in all strains of E. coli tested, and a mutation of the putative catalytic residues restored a wild-type phenotype. The potential activities of plant CGI-58 are subsequently discussed.

  5. Reassessing the Potential Activities of Plant CGI-58 Protein

    PubMed Central

    Khatib, Abdallah; Arhab, Yani; Bentebibel, Assia; Abousalham, Abdelkarim; Noiriel, Alexandre

    2016-01-01

    Comparative Gene Identification-58 (CGI-58) is a widespread protein found in animals and plants. This protein has been shown to participate in lipolysis in mice and humans by activating Adipose triglyceride lipase (ATGL), the initial enzyme responsible for the triacylglycerol (TAG) catabolism cascade. Human mutation of CGI-58 is the cause of Chanarin-Dorfman syndrome, an orphan disease characterized by a systemic accumulation of TAG which engenders tissue disorders. The CGI-58 protein has also been shown to participate in neutral lipid metabolism in plants and, in this case, a mutation again provokes TAG accumulation. Although its roles as an ATGL coactivator and in lipid metabolism are quite clear, the catalytic activity of CGI-58 is still in question. The acyltransferase activities of CGI-58 have been speculated about, reported or even dismissed and experimental evidence that CGI-58 expressed in E. coli possesses an unambiguous catalytic activity is still lacking. To address this problem, we developed a new set of plasmids and site-directed mutants to elucidate the in vivo effects of CGI-58 expression on lipid metabolism in E. coli. By analyzing the lipid composition in selected E. coli strains expressing CGI-58 proteins, and by reinvestigating enzymatic tests with adequate controls, we show here that recombinant plant CGI-58 has none of the proposed activities previously described. Recombinant plant and mouse CGI-58 both lack acyltransferase activity towards either lysophosphatidylglycerol or lysophosphatidic acid to form phosphatidylglycerol or phosphatidic acid and recombinant plant CGI-58 does not catalyze TAG or phospholipid hydrolysis. However, expression of recombinant plant CGI-58, but not mouse CGI-58, led to a decrease in phosphatidylglycerol in all strains of E. coli tested, and a mutation of the putative catalytic residues restored a wild-type phenotype. The potential activities of plant CGI-58 are subsequently discussed. PMID:26745266

  6. Sap flow measurements combining sap-flux density radial profiles with punctual sap-flux density measurements in oak trees (Quercus ilex and Quercus pyrenaica) - water-use implications in a water-limited savanna-

    NASA Astrophysics Data System (ADS)

    Reyes, J. Leonardo; Lubczynski1, Maciek W.

    2010-05-01

    Sap flow measurement is a key aspect for understanding how plants use water and their impacts on the ecosystems. A variety of sensors have been developed to measure sap flow, each one with its unique characteristics. When the aim of a research is to have accurate tree water use calculations, with high temporal and spatial resolution (i.e. scaled), a sensor with high accuracy, high measurement efficiency, low signal-to-noise ratio and low price is ideal, but such has not been developed yet. Granier's thermal dissipation probes (TDP) have been widely used in many studies and various environmental conditions because of its simplicity, reliability, efficiency and low cost. However, it has two major flaws when is used in semi-arid environments and broad-stem tree species: it is often affected by high natural thermal gradients (NTG), which distorts the measurements, and it cannot measure the radial variability of sap-flux density in trees with sapwood thicker than two centimeters. The new, multi point heat field deformation sensor (HFD) is theoretically not affected by NTG, and it can measure the radial variability of the sap flow at different depths. However, its high cost is a serious limitation when simultaneous measurements are required in several trees (e.g. catchment-scale studies). The underlying challenge is to develop a monitoring schema in which HFD and TDP are combined to satisfy the needs of measurement efficiency and accuracy in water accounting. To assess the level of agreement between TDP and HFD methods in quantifying sap flow rates and temporal patterns on Quercus ilex (Q.i ) and Quercus pyrenaica trees (Q.p.), three measurement schemas: standard TDP, TDP-NTG-corrected and HFD were compared in dry season at the semi-arid Sardon area, near Salamanca in Spain in the period from June to September 2009. To correct TDP measurements with regard to radial sap flow variability, a radial sap flux density correction factor was applied and tested by adjusting TDP

  7. Visualization of scattering angular distributions with the SAP code

    NASA Astrophysics Data System (ADS)

    Fernandez, J. E.; Scot, V.; Basile, S.

    2010-07-01

    SAP (Scattering Angular distribution Plot) is a graphical tool developed at the University of Bologna to compute and plot Rayleigh and Compton differential cross-sections (atomic and electronic), form-factors (FFs) and incoherent scattering functions (SFs) for single elements, compounds and mixture of compounds, for monochromatic excitation in the range of 1-1000 keV. The computation of FFs and SFs may be performed in two ways: (a) by interpolating Hubbell's data from EPDL97 library and (b) by using semi-empirical formulas as described in the text. Two kinds of normalization permit to compare the plots of different magnitudes, by imposing a similar scale. The characteristics of the code SAP are illustrated with one example.

  8. Zn and Cu complexes with glutathione in ricinis phloem sap

    SciTech Connect

    Albrigo, L.G.; Taylor, K.C. )

    1989-04-01

    To characterize phloem Cu and Zn carriers, phloem sap was collected from native stands of Ricinis communis. The sap was separated by DEAE-Sephadex ion exchange chromatography. Two peaks were resolved from subsequent Zorbax CN-HPLC (isocratic elution: 0.25% MeOH, 0.025% TFA). Both peaks contained Cu and Zn. Further assessment by Mono Q-FPLC showed that these peaks were approximately 90% homogeneous, with similar retention times. The amino acid compositions of the HPLC eluted Cu- and Zn-containing fractions were determined. Both peaks contained glutathione (cysteic acid: glutamic acid: glycine, 1:1:1). Further work is underway to verify a complexing association of these metals with glutathione.

  9. Pivotal Role of Mitogen-Activated Protein Kinase-Activated Protein Kinase 2 in Inflammatory Pulmonary Diseases

    PubMed Central

    Qian, Feng; Deng, Jing; Wang, Gang; Ye, Richard D.; Christman, John W.

    2016-01-01

    Mitogen-activated protein kinase (MAPK)-activated protein kinase (MK2) is exclusively regulated by p38 MAPK in vivo. Upon activation of p38 MAPK, MK2 binds with p38 MAPK, leading to phosphorylation of TTP, Hsp27, Akt and Cdc25 that are involved in regulation of various essential cellular functions. In this review, we discuss current knowledge about molecular mechanisms of MK2 in regulation of TNF-α production, NADPH oxidase activation, neutrophil migration, and DNA-damage-induced cell cycle arrest which are involved in the molecular pathogenesis of acute lung injury, pulmonary fibrosis, and non-small-cell lung cancer. Collectively current and emerging new information indicate that developing MK2 inhibitors and blocking MK2-mediated signal pathways is a potential therapeutic strategy for treatment of inflammatory and fibrotic lung diseases and lung cancer. PMID:26119506

  10. Turnover of whole body proteins and myofibrillar proteins in middle-aged active men

    SciTech Connect

    Zackin, M.; Meredith, C.; Frontera, W.; Evans, W.

    1986-03-05

    Endurance-trained older men have a higher proportion of lean tissue and greater muscle cell oxidative capacity, reversing age-related trends and suggesting major changes in protein metabolism. In this study, protein turnover was determined in 6 middle-aged (52+/-1 yr) men who were well trained (VO/sub 2/ max 55.2+/-5.0 ml O/sub 2//kg.min) and lean (body fat 18.9+/-2.8%, muscle mass 36.6+/-0.6%). The maintained habitual exercise while consuming 0.6, 0.9 or 1.2 g protein/kg.day for 10-day periods. N flux was measured from /sup 15/N in urea after oral /sup 15/N-glycine administration. Myofibrillar protein breakdown was estimated from urinary 3-methyl-histidine. Dietary protein had no effect on turnover rates, even when N balance was negative. Whole body protein synthesis was 3.60+/-0.12 g/kg.day and breakdown was 3.40+/-0.14 g/kg.day for all N intakes. Whole body protein flux, synthesis and breakdown were similar to values reported for sedentary young (SY) or sedentary old (SO) men on comparable diets. 3-me-his (3.67+/-0.14 ..mu..mol/kg.day) was similar to values reported for SY but higher (p<0.01) than for SO. Myofibrillar protein breakdown per unit muscle mass (185+/-7 ..mu..mol 3-me-his/g creatinine) was higher (p<0.01) than for SY or SO. In active middle-aged men, myofibrillar proteins may account for a greater proportion of whole body protein turnover, despite an age-related reduction in muscle mass.

  11. A Novel Method for Assessing the Chaperone Activity of Proteins

    PubMed Central

    Hristozova, Nevena; Tompa, Peter; Kovacs, Denes

    2016-01-01

    Protein chaperones are molecular machines which function both during homeostasis and stress conditions in all living organisms. Depending on their specific function, molecular chaperones are involved in a plethora of cellular processes by playing key roles in nascent protein chain folding, transport and quality control. Among stress protein families–molecules expressed during adverse conditions, infection, and diseases–chaperones are highly abundant. Their molecular functions range from stabilizing stress-susceptible molecules and membranes to assisting the refolding of stress-damaged proteins, thereby acting as protective barriers against cellular damage. Here we propose a novel technique to test and measure the capability for protective activity of known and putative chaperones in a semi-high throughput manner on a plate reader. The current state of the art does not allow the in vitro measurements of chaperone activity in a highly parallel manner with high accuracy or high reproducibility, thus we believe that the method we report will be of significant benefit in this direction. The use of this method may lead to a considerable increase in the number of experimentally verified proteins with such functions, and may also allow the dissection of their molecular mechanism for a better understanding of their function. PMID:27564234

  12. Design of a Split Intein with Exceptional Protein Splicing Activity

    PubMed Central

    2016-01-01

    Protein trans-splicing (PTS) by split inteins has found widespread use in chemical biology and biotechnology. Herein, we describe the use of a consensus design approach to engineer a split intein with enhanced stability and activity that make it more robust than any known PTS system. Using batch mutagenesis, we first conduct a detailed analysis of the difference in splicing rates between the Npu (fast) and Ssp (slow) split inteins of the DnaE family and find that most impactful residues lie on the second shell of the protein, directly adjacent to the active site. These residues are then used to generate an alignment of 73 naturally occurring DnaE inteins that are predicted to be fast. The consensus sequence from this alignment (Cfa) demonstrates both rapid protein splicing and unprecedented thermal and chaotropic stability. Moreover, when fused to various proteins including antibody heavy chains, the N-terminal fragment of Cfa exhibits increased expression levels relative to other N-intein fusions. The durability and efficiency of Cfa should improve current intein based technologies and may provide a platform for the development of new protein chemistry techniques. PMID:26854538

  13. Mitogen Activated Protein kinase signal transduction pathways in the prostate

    PubMed Central

    Maroni, Paul D; Koul, Sweaty; Meacham, Randall B; Koul, Hari K

    2004-01-01

    The biochemistry of the mitogen activated protein kinases ERK, JNK, and p38 have been studied in prostate physiology in an attempt to elucidate novel mechanisms and pathways for the treatment of prostatic disease. We reviewed articles examining mitogen-activated protein kinases using prostate tissue or cell lines. As with other tissue types, these signaling modules are links/transmitters for important pathways in prostate cells that can result in cellular survival or apoptosis. While the activation of the ERK pathway appears to primarily result in survival, the roles of JNK and p38 are less clear. Manipulation of these pathways could have important implications for the treatment of prostate cancer and benign prostatic hypertrophy. PMID:15219238

  14. Auxin efflux by PIN-FORMED proteins is activated by two different protein kinases, D6 PROTEIN KINASE and PINOID.

    PubMed

    Zourelidou, Melina; Absmanner, Birgit; Weller, Benjamin; Barbosa, Inês C R; Willige, Björn C; Fastner, Astrid; Streit, Verena; Port, Sarah A; Colcombet, Jean; de la Fuente van Bentem, Sergio; Hirt, Heribert; Kuster, Bernhard; Schulze, Waltraud X; Hammes, Ulrich Z; Schwechheimer, Claus

    2014-06-19

    The development and morphology of vascular plants is critically determined by synthesis and proper distribution of the phytohormone auxin. The directed cell-to-cell distribution of auxin is achieved through a system of auxin influx and efflux transporters. PIN-FORMED (PIN) proteins are proposed auxin efflux transporters, and auxin fluxes can seemingly be predicted based on the--in many cells--asymmetric plasma membrane distribution of PINs. Here, we show in a heterologous Xenopus oocyte system as well as in Arabidopsis thaliana inflorescence stems that PIN-mediated auxin transport is directly activated by D6 PROTEIN KINASE (D6PK) and PINOID (PID)/WAG kinases of the Arabidopsis AGCVIII kinase family. At the same time, we reveal that D6PKs and PID have differential phosphosite preferences. Our study suggests that PIN activation by protein kinases is a crucial component of auxin transport control that must be taken into account to understand auxin distribution within the plant.

  15. Protein Corona of Magnetic Hydroxyapatite Scaffold Improves Cell Proliferation via Activation of Mitogen-Activated Protein Kinase Signaling Pathway.

    PubMed

    Zhu, Yue; Yang, Qi; Yang, Minggang; Zhan, Xiaohui; Lan, Fang; He, Jing; Gu, Zhongwei; Wu, Yao

    2017-03-21

    The beneficial effect of magnetic scaffolds on the improvement of cell proliferation has been well documented. Nevertheless, the underlying mechanisms about the magnetic scaffolds stimulating cell proliferation remain largely unknown. Once the scaffold enters into the biological fluids, a protein corona forms and directly influences the biological function of scaffold. This study aimed at investigating the formation of protein coronas on hydroxyapatite (HA) and magnetic hydroxyapatite (MHA) scaffolds in vitro and in vivo, and consequently its effect on regulating cell proliferation. The results demonstrated that magnetic nanoparticles (MNP)-infiltrated HA scaffolds altered the composition of protein coronas and ultimately contributed to increased concentration of proteins related to calcium ions, G-protein coupled receptors (GPCRs), and MAPK/ERK cascades as compared with pristine HA scaffolds. Noticeably, the enriched functional proteins on MHA samples could efficiently activate of the MAPK/ERK signaling pathway, resulting in promoting MC3T3-E1 cell proliferation, as evidenced by the higher expression levels of the key proteins in the MAPK/ERK signaling pathway, including mitogen-activated protein kinase kinases1/2 (MEK1/2) and extracellular signal regulated kinase 1/2 (ERK1/2). Artificial down-regulation of MEK expression can significantly down-regulate the MAPK/ERK signaling and consequently suppress the cell proliferation on MHA samples. These findings not only provide a critical insight into the molecular mechanism underlying cellular proliferation on magnetic scaffolds, but also have important implications in the design of magnetic scaffolds for bone tissue engineering.

  16. Plasmodium falciparum heat shock protein 70 lacks immune modulatory activity.

    PubMed

    Pooe, Ofentse Jacob; Köllisch, Gabriele; Heine, Holger; Shonhai, Addmore

    2017-02-14

    Heat shock protein 70 (Hsp70) family are conserved molecules that constitute a major part of the cell's protein folding machinery. The role of Hsp70s of parasitic origin in host cell immune modulation has remained contentious. This is largely due to the fact that several studies implicating Hsp70 in immune modulation rely on the use of recombinant protein derived from bacteria which is often fraught contamination. Thus, in the current study, we expressed recombinant Plasmodium falciparum Hsp70 (PfHsp70) using in three bacterial expression hosts: E. coli XL1 Blue, E. coli ClearColi BL21 and Brevibacillus choshinensis, respectively. We further investigated the immunostimulatory capability of the protein by assessing cytokine production by murine immune cells cultured in the presence of the protein. Recombinant PfHsp70 obtained from E. coli XL1 Blue expression host induced IL6 and IL8 cytokines. On the other hand, PfHsp70 produced in E. coli ClearColi and B. choshinensis expression systems was associated with no detectable traces of LPS and exhibited no immunomodulatory activity. Our findings suggest that PfHsp70 does not possess immunomodulatory function. Furthermore, our study suggests that E. coli ClearColi and B. choshinensis are versatile for the production of recombinant protein for use in immunomodulatory studies.

  17. Mechanism for Active Membrane Fusion Triggering by Morbillivirus Attachment Protein

    PubMed Central

    Ader, Nadine; Brindley, Melinda; Avila, Mislay; Örvell, Claes; Horvat, Branka; Hiltensperger, Georg; Schneider-Schaulies, Jürgen; Vandevelde, Marc; Zurbriggen, Andreas; Plemper, Richard K.

    2013-01-01

    The paramyxovirus entry machinery consists of two glycoproteins that tightly cooperate to achieve membrane fusion for cell entry: the tetrameric attachment protein (HN, H, or G, depending on the paramyxovirus genus) and the trimeric fusion protein (F). Here, we explore whether receptor-induced conformational changes within morbillivirus H proteins promote membrane fusion by a mechanism requiring the active destabilization of prefusion F or by the dissociation of prefusion F from intracellularly preformed glycoprotein complexes. To properly probe F conformations, we identified anti-F monoclonal antibodies (MAbs) that recognize conformation-dependent epitopes. Through heat treatment as a surrogate for H-mediated F triggering, we demonstrate with these MAbs that the morbillivirus F trimer contains a sufficiently high inherent activation energy barrier to maintain the metastable prefusion state even in the absence of H. This notion was further validated by exploring the conformational states of destabilized F mutants and stabilized soluble F variants combined with the use of a membrane fusion inhibitor (3g). Taken together, our findings reveal that the morbillivirus H protein must lower the activation energy barrier of metastable prefusion F for fusion triggering. PMID:23077316

  18. Maple sap uptake, exudation, and pressure changes correlated with freezing exotherms and thawing endotherms.

    PubMed

    Tyree, M T

    1983-10-01

    Sap flow rates and sap pressure changes were measured in dormant sugar maple trees (Acer saccharum Marsh.). In the forest, sap flow rates and pressure changes were measured from tap holes drilled into tree trunks in mature trees and sap flow rates were measured from the base of excised branches. Excised branches were also brought into the laboratory where air temperature could be carefully controlled in a refrigerated box and sap flow rates and sap pressures were measured from the cut base of the branches.Under both forest and laboratory conditions, sap uptake occurred as the wood temperature declined but much more rapid sap uptake correlated with the onset of the freezing exotherm. When sap pressures were measured under conditions of negligible volume displacement, the sap pressure rapidly fell to -60 to -80 kilopascals at the start of the freezing exotherm. The volume of water uptake and the rate of uptake depended on the rate of freezing. A slow freezing rate correlated with a large volume of water uptake, a fast freezing rate induced a smaller volume of water uptake. The volume of water uptake ranged from 0.02 to 0.055 grams water per gram dry weight of sapwood. The volume of water exuded after thawing was usually less than the volume of uptake so that after several freezing and thawing cycles the sapwood water content increased from 0.7 to 0.8 grams water per gram dry weight.These results are discussed in terms of a physical model of the mechanism of maple sap uptake and exudation first proposed by P. E. R. O'Malley. The proposed mechanism of sap uptake is by vapor distillation in air filled wood fiber lumina during the freezing of minor branches. Gravity and pressurized air bubbles (compressed during freezing) cause sap flow from the canopy down the tree after the thaw.

  19. Adulteration and Contamination of Commercial Sap of Hymenaea Species

    PubMed Central

    Farias, Katyuce de Souza; Auharek, Sarah Alves; Cunha-Laura, Andréa Luiza; de Souza, Jeana Mara Escher; Damasceno-Junior, Geraldo Alves; Toffoli-Kadri, Mônica Cristina; de Oliveira Filiú, Wander Fernando; dos Santos, Edson dos Anjos; Chang, Marilene Rodrigues

    2017-01-01

    The Hymenaea stigonocarpa and Hymenaea martiana species, commonly known as “jatobá,” produce a sap which is extracted by perforation of the trunk and is commonly used in folk medicine as a tonic. For this study, the authenticity of commercial samples of jatobá was verified by the identification of the main compounds and multivariate analysis and contamination by microbial presence analysis. The acute toxicity of the authentic jatobá sap was also evaluated. The metabolites composition and multivariate analysis revealed that none of the commercial samples were authentic. In the microbiological contamination analysis, five of the six commercial samples showed positive cultures within the range of 1,700–100,000 CFU/mL and the authentic sap produced no signs of toxicity, and from a histological point of view, there was the maintenance of tissue integrity. In brief, the commercial samples were deemed inappropriate for consumption and represent a danger to the population. PMID:28303155

  20. Pharmacological activities in thermal proteins: relationships in molecular evolution

    NASA Technical Reports Server (NTRS)

    Fox, S. W.; Hefti, F.; Hartikka, J.; Junard, E.; Przybylski, A. T.; Vaughan, G.

    1987-01-01

    The model of protobiological events that has been presented in these pages has increasing relevance to pharmacological research. The thermal proteins that function as key substances in the proteinoid theory have recently been found to prolong the survival of rat forebrain neurons in culture and to stimulate the growth of neurites. A search for such activity in thermal proteins added to cultures of modern neurons was suggested by the fact that some of the microspheres assembled from proteinoids rich in hydrophobic amino acids themselves generate fibrous outgrowths.

  1. Pharmacokinetics of activated protein C in guinea pigs

    SciTech Connect

    Berger, H. Jr.; Kirstein, C.G.; Orthner, C.L. )

    1991-05-15

    Protein C is a vitamin K-dependent zymogen of the serine protease, activated protein C (APC), an important regulatory enzyme in hemostasis. In view of the potential of human APC as an anticoagulant and profibrinolytic agent, the pharmacokinetics and tissue distribution of APC were studied in guinea pigs. The plasma elimination of a trace dose of {sup 125}I-APC was biphasic following an initial rapid elimination of approximately 15% of the injected dose within 1 to 2 minutes. This rapid removal of {sup 125}I-APC from the circulation was found to be a result of an association with the liver regardless of the route of injection. Essentially identical results were obtained with active site-blocked forms of APC generated with either diisopropylfluorophosphate or D-phenylalanyl-L-prolyl-L-arginine chloromethyl ketone, which indicates that the active site was not essential for the liver association. Accumulation of all three forms of APC in the liver peaked at 30 minutes and then declined as increasing amounts of degraded radiolabeled material appeared in the gastrointestinal tract and urine. Removal of the gamma-carboxyglutamic acid (gla) domain of diisopropylphosphoryl-APC resulted in a 50% reduction in the association with liver and an accumulation in the kidneys. Protein C and protein S were cleared from the circulation at rates approximately one-half and one-fourth, respectively, that of APC. Both in vitro and in vivo, APC was found to form complexes with protease inhibitors present in guinea pig plasma. Complex formation resulted in a more rapid disappearance of the enzymatic activity of APC than elimination of the protein moiety. These findings indicate two distinct mechanisms for the elimination of APC. One mechanism involves reaction with plasma protease inhibitors and subsequent elimination by specific hepatic receptors. (Abstract Truncated)

  2. Novel condensation products having high activity to insolubilize proteins and protein-insolubilized products

    SciTech Connect

    Krasnobajew, V.; Boeniger, R.

    1980-01-01

    According to the invention a substantially more active product with respect to the fixing or insolubilization pf proteins, including enzymes, is obtained when 1,3 phenylenediamine is condensed with glutardialdehyde. One application of the process is the enzymatic hydrolysis of lactose in milk products by lactase.

  3. The protein activator of protein kinase R, PACT/RAX, negatively regulates protein kinase R during mouse anterior pituitary development.

    PubMed

    Dickerman, Benjamin K; White, Christine L; Kessler, Patricia M; Sadler, Anthony J; Williams, Bryan R G; Sen, Ganes C

    2015-12-01

    The murine double-stranded RNA-binding protein termed protein kinase R (PKR)-associated protein X (RAX) and the human homolog, protein activator of PKR (PACT), were originally characterized as activators of PKR. Mice deficient in RAX show reproductive and developmental defects, including reduced body size, craniofacial defects and anterior pituitary hypoplasia. As these defects are not observed in PKR-deficient mice, the phenotype has been attributed to PKR-independent activities of RAX. Here we further investigated the involvement of PKR in the physiological function of RAX, by generating rax(-/-) mice deficient in PKR, or carrying a kinase-inactive mutant of PKR (K271R) or an unphosphorylatable mutant of the PKR substrate eukaryotic translation initiation factor 2 α subunit (eIF2α) (S51A). Ablating PKR expression rescued the developmental and reproductive deficiencies in rax(-/-) mice. Generating rax(-/-) mice with a kinase-inactive mutant of PKR resulted in similar rescue, confirming that the rax(-/-) defects are PKR dependent; specifically that the kinase activity of PKR was required for these defects. Moreover, generating rax(-/-) mice that were heterozygous for an unphosphorylatable mutant eIF2α provides partial rescue of the rax(-/-) defect, consistent with mutation of one copy of the Eif2s1 gene. These observations were further investigated in vitro by reducing RAX expression in anterior pituitary cells, resulting in increased PKR activity and induction of the PKR-regulated cyclin-dependent kinase inhibitor p21(WAF1/CIP1). These results demonstrate that PKR kinase activity is required for onset of the rax(-/-) phenotype, implying an unexpected function for RAX as a negative regulator of PKR in the context of postnatal anterior pituitary tissue, and identify a critical role for the regulation of PKR activity for normal development.

  4. Phytoplasma Effector SAP54 Induces Indeterminate Leaf-Like Flower Development in Arabidopsis Plants1[C][W][OA

    PubMed Central

    MacLean, Allyson M.; Sugio, Akiko; Makarova, Olga V.; Findlay, Kim C.; Grieve, Victoria M.; Tóth, Réka; Nicolaisen, Mogens; Hogenhout, Saskia A.

    2011-01-01

    Phytoplasmas are insect-transmitted bacterial plant pathogens that cause considerable damage to a diverse range of agricultural crops globally. Symptoms induced in infected plants suggest that these phytopathogens may modulate developmental processes within the plant host. We report herein that Aster Yellows phytoplasma strain Witches’ Broom (AY-WB) readily infects the model plant Arabidopsis (Arabidopsis thaliana) ecotype Columbia, inducing symptoms that are characteristic of phytoplasma infection, such as the production of green leaf-like flowers (virescence and phyllody) and increased formation of stems and branches (witches’ broom). We found that the majority of genes encoding secreted AY-WB proteins (SAPs), which are candidate effector proteins, are expressed in Arabidopsis and the AY-WB insect vector Macrosteles quadrilineatus (Hemiptera; Cicadellidae). To identify which of these effector proteins induce symptoms of phyllody and virescence, we individually expressed the effector genes in Arabidopsis. From this screen, we have identified a novel AY-WB effector protein, SAP54, that alters floral development, resulting in the production of leaf-like flowers that are similar to those produced by plants infected with this phytoplasma. This study offers novel insight into the effector profile of an insect-transmitted plant pathogen and reports to our knowledge the first example of a microbial pathogen effector protein that targets flower development in a host. PMID:21849514

  5. Solubilized placental membrane protein inhibits insulin receptor tyrosine kinase activity

    SciTech Connect

    Strout, H.V. Jr.; Slater, E.E.

    1987-05-01

    Regulation of insulin receptor (IR) tyrosine kinase (TK) activity may be important in modulating insulin action. Utilizing an assay which measures IR phosphorylation of angiotensin II (AII), the authors investigated whether fractions of TX-100 solubilized human placental membranes inhibited IR dependent AII phosphorylation. Autophosphorylated IR was incubated with membrane fractions before the addition of AII, and kinase inhibition measured by the loss of TSP incorporated in AII. An inhibitory activity was detected which was dose, time, and temperature dependent. The inhibitor was purified 200-fold by sequential chromatography on wheat germ agglutinin, DEAE, and hydroxyapatite. This inhibitory activity was found to correlate with an 80 KD protein which was electroeluted from preparative slab gels and rabbit antiserum raised. Incubation of membrane fractions with antiserum before the IRTK assay immunoprecipitated the inhibitor. Protein immunoblots of crude or purified fractions revealed only the 80 KD protein. Since IR autophosphorylation is crucial to IRTK activity, the authors investigated the state of IR autophosphorylation after treatment with inhibitor; no change was detected by phosphoamino acid analysis.

  6. Methods of measuring Protein Disulfide Isomerase activity: a critical overview

    NASA Astrophysics Data System (ADS)

    Watanabe, Monica; Laurindo, Francisco; Fernandes, Denise

    2014-09-01

    Protein disulfide isomerase is an essential redox chaperone from the endoplasmic reticulum (ER) and is responsible for correct disulfide bond formation in nascent proteins. PDI is also found in other cellular locations in the cell, particularly the cell surface. Overall, PDI contributes to ER and global cell redox homeostasis and signaling. The knowledge about PDI structure and function progressed substantially based on in vitro studies using recombinant PDI and chimeric proteins. In these experimental scenarios, PDI reductase and chaperone activities are readily approachable. In contrast, assays to measure PDI isomerase activity, the hallmark of PDI family, are more complex. Assessment of PDI roles in cells and tissues mainly relies on gain- or loss-of-function studies. However, there is limited information regarding correlation of experimental readouts with the distinct types of PDI activities. In this mini-review, we evaluate the main methods described for measuring the different kinds of PDI activity: thiol reductase, thiol oxidase, thiol isomerase and chaperone. We emphasize the need to use appropriate controls and the role of critical interferents (e.g., detergent, presence of reducing agents). We also discuss the translation of results from in vitro studies with purified recombinant PDI to cellular and tissue samples, with critical comments on the interpretation of results.

  7. Analysis of antifreeze protein activity using colorimetric gold nanosensors

    NASA Astrophysics Data System (ADS)

    Jing, Xu; Choi, Ho-seok; Park, Ji-In; Kim, Young-Pil

    2015-07-01

    High activity and long stability of antifreeze proteins (AFPs), also known as ice-binding proteins (IBPs), are necessary for exerting their physiological functions in biotechnology and cryomedicine. Here we report a simple analysis of antifreeze protein activity and stability based on self-assembly of gold nanoparticles (AuNPs) via freezing and thawing cycles. While the mercaptosuccinic acid-capped AuNP (MSA-AuNP) was easily self-assembled after a freezing/thawing cycle, due to the mechanical attack of ice crystal on the MSA-AuNP surface, the presence of AFP impeded the self-assembly of MSA-AuNP via the interaction of AFP with ice crystals via freezing and thawing cycles, which led to a strong color in the MSA-AuNP solution. As a result, the aggregation parameter (E520/E650) of MSA-AuNP showed the rapid detection of both activity and stability of AFPs. We suggest that our newly developed method is very suitable for measuring antifreeze activity and stability in a simple and rapid manner with reliable quantification.

  8. Synthetic phosphorylation of p38α recapitulates protein kinase activity.

    PubMed

    Chooi, K Phin; Galan, Sébastien R G; Raj, Ritu; McCullagh, James; Mohammed, Shabaz; Jones, Lyn H; Davis, Benjamin G

    2014-02-05

    Through a "tag-and-modify" protein chemical modification strategy, we site-selectively phosphorylated the activation loop of protein kinase p38α. Phosphorylation at natural (180) and unnatural (172) sites created two pure phospho-forms. p38α bearing only a single phosphocysteine (pCys) as a mimic of pThr at 180 was sufficient to switch the kinase to an active state, capable of processing natural protein substrate ATF2; 172 site phosphorylation did not. In this way, we chemically recapitulated triggering of a relevant segment of the MAPK-signaling pathway in vitro. This allowed detailed kinetic analysis of global and stoichiometric phosphorylation events catalyzed by p38α and revealed that site 180 is a sufficient activator alone and engenders dominant mono-phosphorylation activity. Moreover, a survey of kinase inhibition using inhibitors with different (Type I/II) modes (including therapeutically relevant) revealed unambiguously that Type II inhibitors inhibit phosphorylated p38α and allowed discovery of a predictive kinetic analysis based on cooperativity to distinguish Type I vs II.

  9. AY-WB phytoplasma secretes a protein that targets plant cell nuclei.

    PubMed

    Bai, Xiaodong; Correa, Valdir R; Toruño, Tania Y; Ammar, El-Desouky; Kamoun, Sophien; Hogenhout, Saskia A

    2009-01-01

    The fully sequenced genome of aster yellows phytoplasma strain witches' broom (AY-WB; Candidatus Phytoplasma asteris) was mined for the presence of genes encoding secreted proteins based on the presence of N-terminal signal peptides (SP). We identified 56 secreted AY-WB proteins (SAP). These SAP are candidate effector proteins potentially involved in interaction with plant and insect cell components. One of these SAP, SAP11, contains an N-terminal SP sequence and a eukaryotic bipartite nuclear localization signal (NLS). Transcripts for SAP11 were detected in AY-WB-infected plants. Yellow fluorescence protein (YFP)-tagged SAP11 accumulated in Nicotiana benthamiana cell nuclei, whereas the nuclear targeting of YFP-tagged SAP11 mutants with disrupted NLS was inhibited. The nuclear transport of YFP-SAP11 was also inhibited in N. benthamiana plants in which the expression of importin alpha was knocked down using virus-induced gene silencing (VIGS). Furthermore, SAP11 was detected by immunocytology in nuclei of young sink tissues of China aster plants infected with AY-WB. In summary, this work shows that AY-WB phytoplasma produces a protein that targets the nuclei of plant host cells; this protein is a potential phytoplasma effector that may alter plant cell physiology.

  10. Sap flux-upscaled canopy transpiration, stomatal conductance, and water use efficiency in an old growth forest in the Great Lakes region of the United States

    NASA Astrophysics Data System (ADS)

    Tang, Jianwu; Bolstad, Paul V.; Ewers, Brent E.; Desai, Ankur R.; Davis, Kenneth J.; Carey, Eileen V.

    2006-06-01

    Combining sap flux and eddy covariance measurements provides a means to study plant stomatal conductance and the relationship between transpiration and photosynthesis. We measured sap flux using Granier-type sensors in a northern hardwood-dominated old growth forest in Michigan, upscaled to canopy transpiration, and calculated canopy conductance. We also measured carbon and water fluxes with the eddy covariance method and derived daytime gross primary production (GPP). The diurnal patterns of sap flux and canopy transpiration were mainly controlled by vapor pressure deficit (D) and photosynthetically active radiation (PAR). Daily sums of sap flux and canopy transpiration had exponential relationships to D that saturated at higher D and had linear relationships to PAR. Sugar maple (Acer saccharum) and yellow birch (Betula alleghaniesis) had higher sap flux per unit of sapwood area than eastern hemlock (Tsuga canadensis), while sugar maple and hemlock had higher canopy transpiration per unit of leaf area than yellow birch. Sugar maple dominated canopy transpiration per ground area. Canopy transpiration averaged 1.57 mm d-1, accounting for 65% of total evapotranspiration in the growing season. Canopy conductance was controlled by both D and PAR, but the day-to-day variation in canopy conductance mainly followed a negatively logarithmic relationship with D. By removing the influences of PAR, half-hourly canopy conductance was also negatively logarithmically correlated with D. Water use efficiency (WUE) had a strong exponential relationship with D on a daily basis and approached a minimum of 4.4 mg g-1. WUE provides an alternative to estimate GPP from measurements of sap flux.

  11. Mitogen-Activated Protein Kinase–Activated Protein Kinase 2 in Angiotensin II–Induced Inflammation and Hypertension

    PubMed Central

    Ebrahimian, Talin; Li, Melissa Wei; Lemarié, Catherine A.; Simeone, Stefania M.C.; Pagano, Patrick J.; Gaestel, Matthias; Paradis, Pierre; Wassmann, Sven; Schiffrin, Ernesto L.

    2015-01-01

    Vascular oxidative stress and inflammation play an important role in angiotensin II–induced hypertension, and mitogen-activated protein kinases participate in these processes. We questioned whether mitogen-activated protein kinase–activated protein kinase 2 (MK2), a downstream target of p38 mitogen–activated protein kinase, is involved in angiotensin II–induced vascular responses. In vivo experiments were performed in wild-type and Mk2 knockout mice infused intravenously with angiotensin II. Angiotensin II induced a 30 mm Hg increase in mean blood pressure in wild-type that was delayed in Mk2 knockout mice. Angiotensin II increased superoxide production and vascular cell adhesion molecule-1 in blood vessels of wild-type but not in Mk2 knockout mice. Mk2 knockdown by small interfering RNA in mouse mesenteric vascular smooth muscle cells caused a 42% reduction in MK2 protein and blunted the angiotensin II–induced 40% increase of MK2 expression. Mk2 knockdown blunted angiotensin II–induced doubling of intracellular adhesion molecule-1 expression, 2.4-fold increase of nuclear p65, and 1.4-fold increase in Ets-1. Mk2 knockdown abrogated the angiotensin II–induced 4.7-fold and 1.3-fold increase of monocyte chemoattractant protein-1 mRNA and protein. Angiotensin II enhanced reactive oxygen species levels (by 29%) and nicotinamide adenine dinucleotide phosphate oxidase activity (by 48%), both abolished by Mk2 knockdown. Reduction of MK2 blocked angiotensin II–induced p47phox translocation to the membrane, associated with a 53% enhanced catalase expression. Angiotensin II–induced increase of MK2 was prevented by the nicotinamide adenine dinucleotide phosphate oxidase inhibitor Nox2ds-tat. Mk2 small interfering RNA prevented the angiotensin II–induced 30% increase of proliferation. In conclusion, MK2 plays a critical role in angiotensin II signaling, leading to hypertension, oxidative stress via activation of p47phox and inhibition of antioxidants, and

  12. Multiscale model of a freeze-thaw process for tree sap exudation.

    PubMed

    Graf, Isabell; Ceseri, Maurizio; Stockie, John M

    2015-10-06

    Sap transport in trees has long fascinated scientists, and a vast literature exists on experimental and modelling studies of trees during the growing season when large negative stem pressures are generated by transpiration from leaves. Much less attention has been paid to winter months when trees are largely dormant but nonetheless continue to exhibit interesting flow behaviour. A prime example is sap exudation, which refers to the peculiar ability of sugar maple (Acer saccharum) and related species to generate positive stem pressure while in a leafless state. Experiments demonstrate that ambient temperatures must oscillate about the freezing point before significantly heightened stem pressures are observed, but the precise causes of exudation remain unresolved. The prevailing hypothesis attributes exudation to a physical process combining freeze-thaw and osmosis, which has some support from experimental studies but remains a subject of active debate. We address this knowledge gap by developing the first mathematical model for exudation, while also introducing several essential modifications to this hypothesis. We derive a multiscale model consisting of a nonlinear system of differential equations governing phase change and transport within wood cells, coupled to a suitably homogenized equation for temperature on the macroscale. Numerical simulations yield stem pressures that are consistent with experiments and provide convincing evidence that a purely physical mechanism is capable of capturing exudation.

  13. Multiscale model of a freeze–thaw process for tree sap exudation

    PubMed Central

    Graf, Isabell; Ceseri, Maurizio; Stockie, John M.

    2015-01-01

    Sap transport in trees has long fascinated scientists, and a vast literature exists on experimental and modelling studies of trees during the growing season when large negative stem pressures are generated by transpiration from leaves. Much less attention has been paid to winter months when trees are largely dormant but nonetheless continue to exhibit interesting flow behaviour. A prime example is sap exudation, which refers to the peculiar ability of sugar maple (Acer saccharum) and related species to generate positive stem pressure while in a leafless state. Experiments demonstrate that ambient temperatures must oscillate about the freezing point before significantly heightened stem pressures are observed, but the precise causes of exudation remain unresolved. The prevailing hypothesis attributes exudation to a physical process combining freeze–thaw and osmosis, which has some support from experimental studies but remains a subject of active debate. We address this knowledge gap by developing the first mathematical model for exudation, while also introducing several essential modifications to this hypothesis. We derive a multiscale model consisting of a nonlinear system of differential equations governing phase change and transport within wood cells, coupled to a suitably homogenized equation for temperature on the macroscale. Numerical simulations yield stem pressures that are consistent with experiments and provide convincing evidence that a purely physical mechanism is capable of capturing exudation. PMID:26400199

  14. Phoenix dactylifera L. sap enhances wound healing in Wistar rats: Phytochemical and histological assessment.

    PubMed

    Abdennabi, Raed; Bardaa, Sana; Mehdi, Meriem; Rateb, Mostafa E; Raab, Andrea; Alenezi, Faizah N; Sahnoun, Zouheir; Gharsallah, Neji; Belbahri, Lassaad

    2016-07-01

    The sap of the date palm "Lagmi" is a clear liquid, rich in sugars and minerals, with a pleasant flavour. Folk remedies based on the use of "Lagmi" for wound healing are still practiced. However, no studies investigated the relevance of "Lagmi" for wound healing. Therefore, the aim of this study was to identify the in vivo healing properties of "lagmi" on mechanically wounded wistar rats. Injured rats were divided into three groups: a first group treated by "lagmi", a second reference group processed by CICAFLORA(®) and a third untreated control group. On the 12th day of the experiment, total healing in the first group was reached, while healing was incomplete in the other groups. The sap seems to accelerate cell proliferation and contribute to faster healing with a gain of more than 30% as compared to CICAFLORA(®). Chemical Analysis of "Lagmi" showed important radical scavenging activity and high total antioxidant capacity. Features reported to help healing process and/or provides a favourable environment for tissue healing in wound sites. Extensive characterization of "Lagmi" phenolic and flavonoid compounds by High Resolution LC-MS (LC-HRESIMS) analysis indicates "Lagmi" is an important source of known anti-inflammatory compounds as well as promising wound healing candidates.

  15. Amiloride, protein synthesis, and activation of quiescent cells.

    PubMed

    Lubin, M; Cahn, F; Coutermarsh, B A

    1982-11-01

    Amiloride is known to inhibit both influx of sodium ions and activation of quiescent cells by growth factors. The coincidence of these effects has been cited to support the proposal that influx of sodium ions acts as a mitogenic signal. Although it was noted that amiloride inhibited protein synthesis, this was attributed to an action on transport of amino acids, particularly those coupled to sodium fluxes. We find, however, that amiloride directly inhibits polypeptide synthesis in a reticulocyte lysate. In Swiss 3T3 cells, concentrations of amiloride and of cycloheximide that are nearly matched in their degree of inhibition of protein synthesis, produce about the same degree of inhibition of transit of cells from G0 to S. Inhibition of protein synthesis is sufficient to explain the effect of amiloride on mitogenesis; the drug, therefore, is not suitable for testing the hypothesis that sodium influx is a mitogenic signal.

  16. Membrane lipids regulate ganglioside GM2 catabolism and GM2 activator protein activity[S

    PubMed Central

    Anheuser, Susi; Breiden, Bernadette; Schwarzmann, Günter; Sandhoff, Konrad

    2015-01-01

    Ganglioside GM2 is the major lysosomal storage compound of Tay-Sachs disease. It also accumulates in Niemann-Pick disease types A and B with primary storage of SM and with cholesterol in type C. Reconstitution of GM2 catabolism with β-hexosaminidase A and GM2 activator protein (GM2AP) at uncharged liposomal surfaces carrying GM2 as substrate generated only a physiologically irrelevant catabolic rate, even at pH 4.2. However, incorporation of anionic phospholipids into the GM2 carrying liposomes stimulated GM2 hydrolysis more than 10-fold, while the incorporation of plasma membrane stabilizing lipids (SM and cholesterol) generated a strong inhibition of GM2 hydrolysis, even in the presence of anionic phospholipids. Mobilization of membrane lipids by GM2AP was also inhibited in the presence of cholesterol or SM, as revealed by surface plasmon resonance studies. These lipids also reduced the interliposomal transfer rate of 2-NBD-GM1 by GM2AP, as observed in assays using Förster resonance energy transfer. Our data raise major concerns about the usage of recombinant His-tagged GM2AP compared with untagged protein. The former binds more strongly to anionic GM2-carrying liposomal surfaces, increases GM2 hydrolysis, and accelerates intermembrane transfer of 2-NBD-GM1, but does not mobilize membrane lipids. PMID:26175473

  17. Antioxidant, Antibacterial, and Cytoprotective Activity of Agathi Leaf Protein

    PubMed Central

    Zarena, A. S.; Gopal, Shubha; Vineeth, R.

    2014-01-01

    In the present study a protein termed agathi leaf protein (ALP) from Sesbania grandiflora Linn. (agathi) leaves was isolated after successive precipitation with 65% ammonium sulphate followed by purification on Sephadex G 75. The column chromatography of the crude protein resulted in four peaks of which Peak I (P I) showed maximum inhibition activity against hydroxyl radical. SDS-PAGE analysis of P I indicated that the molecular weight of the protein is ≈29 kDa. The purity of the protein was 98.4% as determined by RP-HPLC and showed a single peak with a retention time of 19.9 min. ALP was able to reduce oxidative damage by scavenging lipid peroxidation against erythrocyte ghost (85.50 ± 6.25%), linolenic acid (87.67 ± 3.14%) at 4.33 μM, ABTS anion (88 ± 3.22%), and DNA damage (83 ± 4.20%) at 3.44 μM in a dose-dependent manner. The purified protein offered significant protection to lymphocyte (72% at 30 min) induced damage by t-BOOH. In addition, ALP showed strong antibacterial activity against Pseudomonas aeruginosa (20 ± 3.64 mm) and Staphylococcus aureus (19 ± 1.53 mm) at 200 μg/mL. The safety assessment showed that ALP does not induce cytotoxicity towards human lymphocyte at the tested concentration of 0.8 mg/mL. PMID:24616824

  18. Activation of G Proteins by Guanine Nucleotide Exchange Factors Relies on GTPase Activity

    PubMed Central

    Stanley, Rob J.; Thomas, Geraint M. H.

    2016-01-01

    G proteins are an important family of signalling molecules controlled by guanine nucleotide exchange and GTPase activity in what is commonly called an ‘activation/inactivation cycle’. The molecular mechanism by which guanine nucleotide exchange factors (GEFs) catalyse the activation of monomeric G proteins is well-established, however the complete reversibility of this mechanism is often overlooked. Here, we use a theoretical approach to prove that GEFs are unable to positively control G protein systems at steady-state in the absence of GTPase activity. Instead, positive regulation of G proteins must be seen as a product of the competition between guanine nucleotide exchange and GTPase activity—emphasising a central role for GTPase activity beyond merely signal termination. We conclude that a more accurate description of the regulation of G proteins via these processes is as a ‘balance/imbalance’ mechanism. This result has implications for the understanding of intracellular signalling processes, and for experimental strategies that rely on modulating G protein systems. PMID:26986850

  19. Mitogen-activated protein kinase cascades in Vitis vinifera

    PubMed Central

    Çakır, Birsen; Kılıçkaya, Ozan

    2015-01-01

    Protein phosphorylation is one of the most important mechanisms to control cellular functions in response to external and endogenous signals. Mitogen-activated protein kinases (MAPK) are universal signaling molecules in eukaryotes that mediate the intracellular transmission of extracellular signals resulting in the induction of appropriate cellular responses. MAPK cascades are composed of four protein kinase modules: MAPKKK kinases (MAPKKKKs), MAPKK kinases (MAPKKKs), MAPK kinases (MAPKKs), and MAPKs. In plants, MAPKs are activated in response to abiotic stresses, wounding, and hormones, and during plant pathogen interactions and cell division. In this report, we performed a complete inventory of MAPK cascades genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with MAPK, MAPK kinases, MAPK kinase kinases and MAPK kinase kinase kinase kinase members of Arabidopsis thaliana, we revealed the existence of 14 MAPKs, 5 MAPKKs, 62 MAPKKKs, and 7 MAPKKKKs in Vitis vinifera. We identified orthologs of V. vinifera putative MAPKs in different species, and ESTs corresponding to members of MAPK cascades in various tissues. This work represents the first complete inventory of MAPK cascades in V. vinifera and could help elucidate the biological and physiological functions of these proteins in V. vinifera. PMID:26257761

  20. SUMO E3 ligase activity of TRIM proteins.

    PubMed

    Chu, Y; Yang, X

    2011-03-03

    SUMOylation governs numerous cellular processes and is essential to most eukaryotic life. Despite increasing recognition of the importance of this process, an extremely limited number of small ubiquitin-like modifier (SUMO) protein ligases (E3s) have been identified. Here we show that at least some members of the functionally diverse tripartite motif (TRIM) superfamily are SUMO E3s. These TRIM proteins bind both the SUMO-conjugating enzyme Ubc9 and substrates and strongly enhance transfer of SUMOs from Ubc9 to these substrates. Among the substrates of TRIM SUMO E3s are the tumor suppressor p53 and its principal antagonist Mdm2. The E3 activity depends on the TRIM motif, suggesting it to be the first widespread SUMO E3 motif. Given the large number of TRIM proteins, our results may greatly expand the identified SUMO E3s. Furthermore, TRIM E3 activity may be an important contributor to SUMOylation specificity and the versatile functions of TRIM proteins.

  1. Phosphorylation of the mitochondrial protein Sab by stress-activated protein kinase 3.

    PubMed

    Court, Naomi W; Kuo, Ivana; Quigley, Oonagh; Bogoyevitch, Marie A

    2004-06-18

    Mitogen-activated protein kinases (MAPKs) transduce extracellular signals into responses such as growth, differentiation, and death through their phosphorylation of specific substrate proteins. Early studies showed the consensus sequence (Pro/X)-X-(Ser/Thr)-Pro to be phosphorylated by MAPKs. Docking domains such as the "kinase interaction motif" (KIM) also appear to be crucial for efficient substrate phosphorylation. Here, we show that stress-activated protein kinase-3 (SAPK3), a p38 MAPK subfamily member, localizes to the mitochondria. Activated SAPK3 phosphorylates the mitochondrial protein Sab, an in vitro substrate of c-Jun N-terminal kinase (JNK). Sab phosphorylation by SAPK3 was dependent on the most N-terminal KIM (KIM1) of Sab and occurred primarily on Ser321. This appeared to be dependent on the position of Ser321 within Sab and the sequence immediately surrounding it. Our results suggest that SAPK3 and JNK may share a common target at the mitochondria and provide new insights into the substrate recognition by SAPK3.

  2. Retroviral nucleocapsid proteins possess potent nucleic acid strand renaturation activity.

    PubMed Central

    Dib-Hajj, F.; Khan, R.; Giedroc, D. P.

    1993-01-01

    The nucleocapsid protein (NC) is the major genomic RNA binding protein that plays integral roles in the structure and replication of all animal retroviruses. In this report, select biochemical properties of recombinant Mason-Pfizer monkey virus (MPMV) and HIV-1 NCs are compared. Evidence is presented that two types of saturated Zn2 NC-polynucleotide complexes can be formed under conditions of low [NaCl] that differ in apparent site-size (n = 8 vs. n = 14). The formation of one or the other complex appears dependent on the molar ratio of NC to RNA nucleotide with the putative low site-size mode apparently predominating under conditions of protein excess. Both MPMV and HIV-1 NCs kinetically facilitate the renaturation of two complementary DNA strands, suggesting that this is a general property of retroviral NCs. NC proteins increase the second-order rate constant for renaturation of a 149-bp DNA fragment by more than four orders of magnitude over that obtained in the absence of protein at 37 degrees C. The protein-assisted rate is 100-200-fold faster than that obtained at 68 degrees C, 1 M NaCl, solution conditions considered to be optimal for strand renaturation. Provided that sufficient NC is present to coat all strands, the presence of 400-1,000-fold excess nonhomologous DNA does not greatly affect the reaction rate. The HIV-1 NC-mediated renaturation reaction functions stoichiometrically, requiring a saturated strand of DNA nucleotide:NC ratio of about 7-8, rather than 14. Under conditions of less protein, the rate acceleration is not realized. The finding of significant nucleic acid strand renaturation activity may have important implications for various events of reverse transcription particularly in initiation and cDNA strand transfer. PMID:8443601

  3. Regulation of Orange Carotenoid Protein Activity in Cyanobacterial Photoprotection.

    PubMed

    Thurotte, Adrien; Lopez-Igual, Rocio; Wilson, Adjélé; Comolet, Léa; Bourcier de Carbon, Céline; Xiao, Fugui; Kirilovsky, Diana

    2015-09-01

    Plants, algae, and cyanobacteria have developed mechanisms to decrease the energy arriving at reaction centers to protect themselves from high irradiance. In cyanobacteria, the photoactive Orange Carotenoid Protein (OCP) and the Fluorescence Recovery Protein are essential elements in this mechanism. Absorption of strong blue-green light by the OCP induces carotenoid and protein conformational changes converting the orange (inactive) OCP into a red (active) OCP. Only the red orange carotenoid protein (OCP(r)) is able to bind to phycobilisomes, the cyanobacterial antenna, and to quench excess energy. In this work, we have constructed and characterized several OCP mutants and focused on the role of the OCP N-terminal arm in photoactivation and excitation energy dissipation. The N-terminal arm largely stabilizes the closed orange OCP structure by interacting with its C-terminal domain. This avoids photoactivation at low irradiance. In addition, it slows the OCP detachment from phycobilisomes by hindering fluorescence recovery protein interaction with bound OCP(r). This maintains thermal dissipation of excess energy for a longer time. Pro-22, at the beginning of the N-terminal arm, has a key role in the correct positioning of the arm in OCP(r), enabling strong OCP binding to phycobilisomes, but is not essential for photoactivation. Our results also show that the opening of the OCP during photoactivation is caused by the movement of the C-terminal domain with respect to the N-terminal domain and the N-terminal arm.

  4. Protein ultrastructure and the nanoscience of complement activation.

    PubMed

    Vorup-Jensen, Thomas; Boesen, Thomas

    2011-09-16

    The complement system constitutes an important barrier to infection of the human body. Over more than four decades structural properties of the proteins of the complement system have been investigated with X-ray crystallography, electron microscopy, small-angle scattering, and atomic force microscopy. Here, we review the accumulated evidence that the nm-scaled dimensions and conformational changes of these proteins support functions of the complement system with regard to tissue distribution, molecular crowding effects, avidity binding, and conformational regulation of complement activation. In the targeting of complement activation to the surfaces of nanoparticulate material, such as engineered nanoparticles or fragments of the microbial cell wall, these processes play intimately together. This way the complement system is an excellent example where nanoscience may serve to unravel the molecular biology of the immune response.

  5. Groundwater sapping channels: Summary of effects of experiments with varied stratigraphy

    NASA Technical Reports Server (NTRS)

    Kochel, R. Craig; Simmons, David W.

    1987-01-01

    Experiments in the recirculating flume sapping box have modeled valley formation by groundwater sapping processes in a number of settings. The effects of the following parameters on sapping channel morphology were examined: surface slope; stratigraphic variations in permeability cohesion and dip; and structure of joints and dikes. These kinds of modeling experiments are particularly good for: testing concepts; developing a suite of distinctive morphologies and morphometries indicative of sapping; helping to relate process to morphology; and providing data necessary to assess the relative importance of runoff, sapping, and mass wasting processes on channel development. The observations from the flume systems can be used to help interpret features observed in terrestrial and Martian settings where sapping processes are thought to have played an important role in the development of valley networks.

  6. Selective fluorescence probes for dipeptidyl peptidase activity-fibroblast activation protein and dipeptidyl peptidase IV.

    PubMed

    Lai, Koon Siew; Ho, Nan-Hui; Cheng, Jonathan D; Tung, Ching-Hsuan

    2007-01-01

    Development of suitable tools to assess enzyme activity directly from their complex cellular environment has a dramatic impact on understanding the functional roles of proteins as well as on the discovery of new drugs. In this study, a novel fluorescence-based chemosensor strategy for the direct readout of dipeptidase activities within intact living cells is described. Selective activity-based probes were designed to sense two important type II transmembrane serine proteases, fibroblast activation protein (FAP) and dipeptidyl peptidase IV (DPP-IV). These serine proteases have been implicated in diverse cellular activities, including blood coagulation, digestion, immune responses, wound healing, tumor growth, tumor invasion, and metastasis. Here, we validated that Ac-GPGP-2SBPO and GPGP-2SBPO probes are excellent reporters of both proteolytic activities. Furthermore, the novel probes can differentiate between FAP and DPP-IV proteolytic activities in cellular assay. Potentially, this assay platform is immediately useful for novel drug discovery.

  7. Selective Fluorescence Probes for Dipeptidyl Peptidase Activity - Fibroblast Activation Protein and Dipeptidyl Peptidase IV

    PubMed Central

    Lai, Koon Siew; Ho, Nan-Hui; Cheng, Jonathan D.; Tung, Ching-Hsuan

    2008-01-01

    Development of suitable tools to assess enzyme activity directly from their complex cellular environment has a dramatic impact on understanding the functional roles of proteins as well as on the discovery of new drugs. In this study, a novel fluorescence-based chemosensor strategy for the direct readout of dipeptidase activities within intact living cells is described. Selective activity-based probes were designed to sense two important type II transmembrane serine proteases, Fibroblast activation protein (FAP) and Dipeptidyl peptidase IV (DPP-IV). These serine proteases have been implicated in diverse cellular activities, including blood coagulation, digestion, immune responses, wound healing, tumor growth, tumor invasion and metastasis. We here validated that Ac-GPGP-2SBPO and GPGP-2SBPO probes are excellent reporters of both proteolytic activities. Furthermore, the novel probes can differentiate between FAP and DPP-IV proteolytic activities in cellular assay. Potentially, this assay platform is immediately useful for novel drug discovery. PMID:17489551

  8. Quantifying agonist activity at G protein-coupled receptors.

    PubMed

    Ehlert, Frederick J; Suga, Hinako; Griffin, Michael T

    2011-12-26

    When an agonist activates a population of G protein-coupled receptors (GPCRs), it elicits a signaling pathway that culminates in the response of the cell or tissue. This process can be analyzed at the level of a single receptor, a population of receptors, or a downstream response. Here we describe how to analyze the downstream response to obtain an estimate of the agonist affinity constant for the active state of single receptors. Receptors behave as quantal switches that alternate between active and inactive states (Figure 1). The active state interacts with specific G proteins or other signaling partners. In the absence of ligands, the inactive state predominates. The binding of agonist increases the probability that the receptor will switch into the active state because its affinity constant for the active state (K(b)) is much greater than that for the inactive state (K(a)). The summation of the random outputs of all of the receptors in the population yields a constant level of receptor activation in time. The reciprocal of the concentration of agonist eliciting half-maximal receptor activation is equivalent to the observed affinity constant (K(obs)), and the fraction of agonist-receptor complexes in the active state is defined as efficacy (ε) (Figure 2). Methods for analyzing the downstream responses of GPCRs have been developed that enable the estimation of the K(obs) and relative efficacy of an agonist. In this report, we show how to modify this analysis to estimate the agonist K(b) value relative to that of another agonist. For assays that exhibit constitutive activity, we show how to estimate K(b) in absolute units of M(-1). Our method of analyzing agonist concentration-response curves consists of global nonlinear regression using the operational model. We describe a procedure using the software application, Prism (GraphPad Software, Inc., San Diego, CA). The analysis yields an estimate of the product of K(obs) and a parameter proportional to efficacy (

  9. 30 CFR 585.600 - What plans and information must I submit to BOEM before I conduct activities on my lease or grant?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... must submit a SAP, COP, or GAP and receive BOEM approval as set forth in the following table: Before... approval for your SAP according to §§ 585.605 through 585.613. (b) conduct any activities pertaining...

  10. Wounding systemically activates a mitogen-activated protein kinase in forage and turf grasses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Forage and turf grasses are continually cut and grazed by livestock, however very little is known concerning the perception or molecular responses to wounding. Mechanical wounding rapidly activated a 46 kDa and a 44 kDa mitogen-activated protein kinase (MAPK) in six different grass species. In the m...

  11. AMP-activated Protein Kinase Is Activated as a Consequence of Lipolysis in the Adipocyte

    Technology Transfer Automated Retrieval System (TEKTRAN)

    AMP-activated protein kinase (AMPK) is activated in adipocytes during exercise and other states in which lipolysis is stimulated. However, the mechanism(s) responsible for this effect and its physiological relevance are unclear. To examine these questions, 3T3-L1 adipocytes were treated with agents...

  12. 30 CFR 285.607 - How do I submit my SAP?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I submit my SAP? 285.607 Section 285.607... Assessment Plan and Information Requirements for Commercial Leases § 285.607 How do I submit my SAP? You must submit one paper copy and one electronic version of your SAP to MMS at the address listed in § 285.110(a)....

  13. Dynamic control of osmolality and ionic composition of the xylem sap in two mangrove species.

    PubMed

    López-Portillo, Jorge; Ewers, Frank W; Méndez-Alonzo, Rodrigo; Paredes López, Claudia L; Angeles, Guillermo; Alarcón Jiménez, Ana Luisa; Lara-Domínguez, Ana Laura; Torres Barrera, María Del Carmen

    2014-06-01

    • Premise of the study: Xylem sap osmolality and salinity is a critical unresolved issue in plant function with impacts on transport efficiency, pressure gradients, and living cell turgor pressure, especially for halophytes such as mangrove trees.• Methods: We collected successive xylem vessel sap samples from stems and shoots of Avicennia germinans and Laguncularia racemosa using vacuum and pressure extraction and measured their osmolality. Following a series of extractions with the pressure chamber, we depressurized the shoot and pressurized again after various equilibration periods (minutes to hours) to test for dynamic control of osmolality. Transpiration and final sap osmolality were measured in shoots perfused with deionized water or different seawater dilutions.• Key results: For both species, the sap osmolality values of consecutive samples collected by vacuum extraction were stable and matched those of the initial samples extracted with the pressure chamber. Further extraction of samples with the pressure chamber decreased sap osmolality, suggesting reverse osmosis occurred. However, sap osmolalities increased when longer equilibration periods after sap extraction were allowed. Analysis of expressed sap with HPLC indicated a 1:1 relation between measured osmolality and the osmolality of the inorganic ions in the sap (mainly Na(+), K(+), and Cl(-)), suggesting no contamination by organic compounds. In stems perfused with deionized water, the sap osmolality increased to mimic the native sap osmolality.• Conclusions: Xylem sap osmolality and ionic contents are dynamically adjusted by mangroves and may help modulate turgor pressure, hydraulic conductivity, and water potential, thus being important for mangrove physiology, survival, and distribution.

  14. Protein inhibitor of activated STAT3 inhibits adipogenic gene expression

    SciTech Connect

    Deng Jianbei; Hua Kunjie; Caveney, Erica J.; Takahashi, Nobuyuki; Harp, Joyce B. . E-mail: jharp@unc.edu

    2006-01-20

    Protein inhibitor of activated STAT3 (PIAS3), a cytokine-induced repressor of signal transducer and activator of transcription 3 (STAT3) and a modulator of a broad array of nuclear proteins, is expressed in white adipose tissue, but its role in adipogenesis is not known. Here, we determined that PIAS3 was constitutively expressed in 3T3-L1 cells at all stages of adipogenesis. However, it translocated from the nucleus to the cytoplasm 4 days after induction of differentiation by isobutylmethylxanthine, dexamethasone, and insulin (MDI). In ob/ob mice, PIAS3 expression was increased in white adipose tissue depots compared to lean mice and was found in the cytoplasm of adipocytes. Overexpression of PIAS3 in differentiating preadipocytes, which localized primarily to the nucleus, inhibited mRNA level gene expression of adipogenic transcription factors C/EBP{alpha} and PPAR{gamma}, as well as their downstream target genes aP2 and adiponectin. PIAS3 also inhibited C/EBP{alpha} promoter activation mediated specifically by insulin, but not dexamethasone or isobutylmethylxanthine. Taken together, these data suggest that PIAS3 may play an inhibitory role in adipogenesis by modulating insulin-activated transcriptional activation events. Increased PIAS3 expression in adipose tissue may play a role in the metabolic disturbances of obesity.

  15. Chronological Sequence of Leaf Phenology, Xylem and Phloem Formation and Sap Flow of Quercus pubescens from Abandoned Karst Grasslands

    PubMed Central

    Lavrič, Martina; Eler, Klemen; Ferlan, Mitja; Vodnik, Dominik; Gričar, Jožica

    2017-01-01

    Intra-annual variations in leaf development, radial growth, including the phloem part, and sap flow have rarely been studied in deciduous trees from drought-prone environments. In order to understand better the chronological order and temporal course of these processes, we monitored leaf phenology, xylem and phloem formation and sap flow in Quercus pubescens from abandoned karst grasslands in Slovenia during the growing season of 2014. We found that the initial earlywood vessel formation started before bud opening at the beginning of April. Buds started to open in the second half of April and full leaf unfolding occurred by the end of May. LAI values increased correspondingly with leaf development. About 28% of xylem and 22% of phloem annual increment were formed by the time of bud break. Initial earlywood vessels were fully lignified and ready for water transport, indicating that they are essential to provide hydraulic conductivity for axial water flow during leaf development. Sap flow became active and increasing contemporarily with leaf development and LAI values. Similar early spring patterns of xylem sap flow and LAI denoted that water transport in oaks broadly followed canopy leaf area development. In the initial 3 weeks of radial growth, phloem growth preceded that of xylem, indicating its priority over xylem at the beginning of the growing season. This may be related to the fact that after bud break, the developing foliage is a very large sink for carbohydrates but, at the same time, represents a small transpirational area. Whether the interdependence of the chronological sequence of the studied processes is fixed in Q. pubescens needs to be confirmed with more data and several years of analyses, although the ‘correct sequence’ of processes is essential for synchronized plant performance and response to environmental stress. PMID:28321232

  16. [Virucidal activity of disinfectants. Influence of the serum protein upon the virucidal activity of disinfectants].

    PubMed

    Noda, M; Matsuda, S; Kobayashi, M

    2000-08-01

    Five disinfectants were tested for virucidal activity on three DNA viruses and three RNA viruses in the presence or absence of serum protein. Disinfectants of the aldehyde and halogen groups had a virucidal activity on human herpes virus, bovine rhabdo virus, human immunodeficiency virus, human adeno virus, porcine parvo virus, and polio virus. Disinfectants of the invert and amphoteric soap groups, and biganide group had a destructive effect on RNA and DNA viruses possessing an envelope. The presence of serum protein exerted great influence upon the virucidal activity of disinfectants of the invert and amphoteric soap groups.

  17. Prostaglandin E2 negatively regulates AMP-activated protein kinase via protein kinase A signaling pathway.

    PubMed

    Funahashi, Koji; Cao, Xia; Yamauchi, Masako; Kozaki, Yasuko; Ishiguro, Naoki; Kambe, Fukushi

    2009-01-01

    We investigated possible involvement of prostaglandin (PG) E2 in regulation of AMP-activated protein kinase (AMPK). When osteoblastic MG63 cells were cultured in serum-deprived media, Thr-172 phosphorylation of AMPK alpha-subunit was markedly increased. Treatment of the cells with PGE2 significantly reduced the phosphorylation. Ser-79 phosphorylation of acetyl-CoA carboxylase, a direct target for AMPK, was also reduced by PGE2. On the other hand, PGE2 reciprocally increased Ser-485 phosphorylation of the alpha-subunit that could be associated with inhibition of AMPK activity. These effects of PGE2 were mimicked by PGE2 receptor EP2 and EP4 agonists and forskolin, but not by EP1 and EP3 agonists, and the effects were suppressed by an adenylate cyclase inhibitor SQ22536 and a protein kinase A inhibitor H89. Additionally, the PGE2 effects were duplicated in primary calvarial osteoblasts. Together, the present study demonstrates that PGE2 negatively regulates AMPK activity via activation of protein kinase A signaling pathway.

  18. Activity-dependent Protein Dynamics Define Interconnected Cores of Co-regulated Postsynaptic Proteins*

    PubMed Central

    Trinidad, Jonathan C.; Thalhammer, Agnes; Burlingame, Alma L.; Schoepfer, Ralf

    2013-01-01

    Synapses are highly dynamic structures that mediate cell–cell communication in the central nervous system. Their molecular composition is altered in an activity-dependent fashion, which modulates the efficacy of subsequent synaptic transmission events. Whereas activity-dependent trafficking of individual key synaptic proteins into and out of the synapse has been characterized previously, global activity-dependent changes in the synaptic proteome have not been studied. To test the feasibility of carrying out an unbiased large-scale approach, we investigated alterations in the molecular composition of synaptic spines following mass stimulation of the central nervous system induced by pilocarpine. We observed widespread changes in relative synaptic abundances encompassing essentially all proteins, supporting the view that the molecular composition of the postsynaptic density is tightly regulated. In most cases, we observed that members of gene families displayed coordinate regulation even when they were not known to physically interact. Analysis of correlated synaptic localization revealed a tightly co-regulated cluster of proteins, consisting of mainly glutamate receptors and their adaptors. This cluster constitutes a functional core of the postsynaptic machinery, and changes in its size affect synaptic strength and synaptic size. Our data show that the unbiased investigation of activity-dependent signaling of the postsynaptic density proteome can offer valuable new information on synaptic plasticity. PMID:23035237

  19. Pokeweed antiviral protein increases HIV-1 particle infectivity by activating the cellular mitogen activated protein kinase pathway.

    PubMed

    Mansouri, Sheila; Kutky, Meherzad; Hudak, Katalin A

    2012-01-01

    Pokeweed antiviral protein (PAP) is a plant-derived N-glycosidase that exhibits antiviral activity against several viruses. The enzyme removes purine bases from the messenger RNAs of the retroviruses Human immunodeficiency virus-1 and Human T-cell leukemia virus-1. This depurination reduces viral protein synthesis by stalling elongating ribosomes at nucleotides with a missing base. Here, we transiently expressed PAP in cells with a proviral clone of HIV-1 to examine the effect of the protein on virus production and quality. PAP reduced virus production by approximately 450-fold, as measured by p24 ELISA of media containing virions, which correlated with a substantial decline in virus protein synthesis in cells. However, particles released from PAP-expressing cells were approximately 7-fold more infectious, as determined by single-cycle infection of 1G5 cells and productive infection of MT2 cells. This increase in infectivity was not likely due to changes in the processing of HIV-1 polyproteins, RNA packaging efficiency or maturation of virus. Rather, expression of PAP activated the ERK1/2 MAPK pathway to a limited extent, resulting in increased phosphorylation of viral p17 matrix protein. The increase in infectivity of HIV-1 particles produced from PAP-expressing cells was compensated by the reduction in virus number; that is, virus production decreased upon de novo infection of cells over time. However, our findings emphasize the importance of investigating the influence of heterologous protein expression upon host cells when assessing their potential for antiviral applications.

  20. Membrane Recruitment of the Non-receptor Protein GIV/Girdin (Gα-interacting, Vesicle-associated Protein/Girdin) Is Sufficient for Activating Heterotrimeric G Protein Signaling.

    PubMed

    Parag-Sharma, Kshitij; Leyme, Anthony; DiGiacomo, Vincent; Marivin, Arthur; Broselid, Stefan; Garcia-Marcos, Mikel

    2016-12-30

    GIV (aka Girdin) is a guanine nucleotide exchange factor that activates heterotrimeric G protein signaling downstream of RTKs and integrins, thereby serving as a platform for signaling cascade cross-talk. GIV is recruited to the cytoplasmic tail of receptors upon stimulation, but the mechanism of activation of its G protein regulatory function is not well understood. Here we used assays in humanized yeast models and G protein activity biosensors in mammalian cells to investigate the role of GIV subcellular compartmentalization in regulating its ability to promote G protein signaling. We found that in unstimulated cells GIV does not co-fractionate with its substrate G protein Gαi3 on cell membranes and that constitutive membrane anchoring of GIV in yeast cells or rapid membrane translocation in mammalian cells via chemically induced dimerization leads to robust G protein activation. We show that membrane recruitment of the GIV "Gα binding and activating" motif alone is sufficient for G protein activation and that it does not require phosphomodification. Furthermore, we engineered a synthetic protein to show that recruitment of the GIV "Gα binding and activating" motif to membranes via association with active RTKs, instead of via chemically induced dimerization, is also sufficient for G protein activation. These results reveal that recruitment of GIV to membranes in close proximity to its substrate G protein is a major mechanism responsible for the activation of its G protein regulatory function.

  1. Pokeweed Antiviral Protein, a Ribosome Inactivating Protein: Activity, Inhibition and Prospects

    PubMed Central

    Domashevskiy, Artem V.; Goss, Dixie J.

    2015-01-01

    Viruses employ an array of elaborate strategies to overcome plant defense mechanisms and must adapt to the requirements of the host translational systems. Pokeweed antiviral protein (PAP) from Phytolacca americana is a ribosome inactivating protein (RIP) and is an RNA N-glycosidase that removes specific purine residues from the sarcin/ricin (S/R) loop of large rRNA, arresting protein synthesis at the translocation step. PAP is thought to play an important role in the plant’s defense mechanism against foreign pathogens. This review focuses on the structure, function, and the relationship of PAP to other RIPs, discusses molecular aspects of PAP antiviral activity, the novel inhibition of this plant toxin by a virus counteraction—a peptide linked to the viral genome (VPg), and possible applications of RIP-conjugated immunotoxins in cancer therapeutics. PMID:25635465

  2. Crystal Structure of the Protein Kinase Domain of Yeast AMP-Activated Protein Kinase Snf1

    SciTech Connect

    Rudolph,M.; Amodeo, G.; Bai, Y.; Tong, L.

    2005-01-01

    AMP-activated protein kinase (AMPK) is a master metabolic regulator, and is an important target for drug development against diabetes, obesity, and other diseases. AMPK is a hetero-trimeric enzyme, with a catalytic ({alpha}) subunit, and two regulatory ({beta} and {gamma}) subunits. Here we report the crystal structure at 2.2 Angstrom resolution of the protein kinase domain (KD) of the catalytic subunit of yeast AMPK (commonly known as SNF1). The Snf1-KD structure shares strong similarity to other protein kinases, with a small N-terminal lobe and a large C-terminal lobe. Two negative surface patches in the structure may be important for the recognition of the substrates of this kinase.

  3. Protein kinase C phosphorylates AMP-activated protein kinase α1 Ser487

    PubMed Central

    Heathcote, Helen R.; Mancini, Sarah J.; Strembitska, Anastasiya; Jamal, Kunzah; Reihill, James A.; Palmer, Timothy M.; Gould, Gwyn W.; Salt, Ian P.

    2016-01-01

    The key metabolic regulator, AMP-activated protein kinase (AMPK), is reported to be down-regulated in metabolic disorders, but the mechanisms are poorly characterised. Recent studies have identified phosphorylation of the AMPKα1/α2 catalytic subunit isoforms at Ser487/491, respectively, as an inhibitory regulation mechanism. Vascular endothelial growth factor (VEGF) stimulates AMPK and protein kinase B (Akt) in cultured human endothelial cells. As Akt has been demonstrated to be an AMPKα1 Ser487 kinase, the effect of VEGF on inhibitory AMPK phosphorylation in cultured primary human endothelial cells was examined. Stimulation of endothelial cells with VEGF rapidly increased AMPKα1 Ser487 phosphorylation in an Akt-independent manner, without altering AMPKα2 Ser491 phosphorylation. In contrast, VEGF-stimulated AMPKα1 Ser487 phosphorylation was sensitive to inhibitors of protein kinase C (PKC) and PKC activation using phorbol esters or overexpression of PKC-stimulated AMPKα1 Ser487 phosphorylation. Purified PKC and Akt both phosphorylated AMPKα1 Ser487 in vitro with similar efficiency. PKC activation was associated with reduced AMPK activity, as inhibition of PKC increased AMPK activity and phorbol esters inhibited AMPK, an effect lost in cells expressing mutant AMPKα1 Ser487Ala. Consistent with a pathophysiological role for this modification, AMPKα1 Ser487 phosphorylation was inversely correlated with insulin sensitivity in human muscle. These data indicate a novel regulatory role of PKC to inhibit AMPKα1 in human cells. As PKC activation is associated with insulin resistance and obesity, PKC may underlie the reduced AMPK activity reported in response to overnutrition in insulin-resistant metabolic and vascular tissues. PMID:27784766

  4. Positive feedback of protein kinase C proteolytic activation during apoptosis.

    PubMed Central

    Leverrier, Sabrina; Vallentin, Alice; Joubert, Dominique

    2002-01-01

    In contrast with protein kinase Calpha (PKCalpha) and PKCepsilon, which are better known for promoting cell survival, PKCdelta is known for its pro-apoptotic function, which is exerted mainly through a caspase-3-dependent proteolytic activation pathway. In the present study, we used the rat GH3B6 pituitary adenoma cell line to show that PKCalpha and PKCepsilon are activated and relocalized together with PKCdelta when apoptosis is induced by a genotoxic stress. Proteolytic activation is a crucial step used by the three isoforms since: (1) the catalytic domains of the PKCalpha, PKCepsilon or PKCdelta isoforms (CDalpha, CDepsilon and CDdelta respectively) accumulated, and this accumulation was dependent on the activity of both calpain and caspase; and (2) transient expression of CDalpha, CDepsilon or CDdelta sufficed to induce apoptosis. However, following this initial step of proteolytic activation, the pathways diverge; cytochrome c release and caspase-3 activation are induced by CDepsilon and CDdelta, but not by CDalpha. Another interesting finding of the present study is the proteolysis of PKCdelta induced by CDepsilon expression that revealed the existence of a cross-talk between PKC isoforms during apoptosis. Hence the PKC family may participate in the apoptotic process of pituitary adenoma cells at two levels: downstream of caspase and calpain, and via retro-activation of caspase-3, resulting in the amplification of its own proteolytic activation. PMID:12238950

  5. Proapoptotic Activities of Protein Disulfide Isomerase (PDI) and PDIA3 Protein, a Role of the Bcl-2 Protein Bak*

    PubMed Central

    Zhao, Guoping; Lu, Huayi; Li, Chi

    2015-01-01

    Protein disulfide isomerase (PDI) family proteins are classified as enzymatic chaperones for reconstructing misfolded proteins. Previous studies have shown that several PDI members possess potential proapoptotic functions. However, the detailed molecular mechanisms of PDI-mediated apoptosis are not completely known. In this study, we investigated how two members of PDI family, PDI and PDIA3, modulate apoptotic signaling. Inhibiting PDI and PDIA3 activities pharmacologically alleviates apoptosis induced by various apoptotic stimuli. Although a decrease of PDIA3 expression alleviates apoptotic responses, overexpression of PDIA3 exacerbates apoptotic signaling. Importantly, Bak, but not Bax, is essential for PDIA3-induced proapoptotic signaling. Furthermore, both purified PDI and PDIA3 proteins induce Bak-dependent, but not Bax-dependent, mitochondrial outer membrane permeabilization in vitro, probably through triggering Bak oligomerization on mitochondria. Our results suggest that both of PDI and PDIA3 possess Bak-dependent proapoptotic function through inducing mitochondrial outer membrane permeabilization, which provides a new mechanism linking ER chaperone proteins and apoptotic signaling. PMID:25697356

  6. Nizwaside: a new anticancer pregnane glycoside from the sap of Desmidorchis flava.

    PubMed

    Hussain, Hidayat; Raees, Muhammad Adil; Rehman, Najeeb Ur; Al-Rawahi, Ahmed; Csuk, René; Khan, Husain Yar; Abbas, Ghulam; Al-Broumi, Mohammed Abdullah; Green, Ivan R; Elyassi, Ali; Mahmood, Talat; Al-Harrasi, Ahmed

    2015-12-01

    The sap from the succulent Desmidorchis flava (N.E.Br) Meve and Liede yielded a new pregnane glycoside, named nizwaside whose structure was established using 1D and 2D NMR techniques as well as mass spectrometry (ESIMS). Nizwaside was tested for anticancer, DPPH antioxidant, urease enzyme inhibition, α-glucosidase enzyme inhibition and acetylcholinesterase inhibition activities. Interestingly, nizwaside showed significant anti-proliferative effects on MDA MB231 breast cancer cells with an IC(50) of 23.5 µg/ml. Moreover, nizwaside was more effective than Doxorubicin, a well-known clinical anticancer drug, in suppressing MDA MB231 cell proliferation even at concentrations lower than that of Doxorubicin (75 µg/ml nizwaside vs. 100 µg/ml Doxorubicin). On the other hand, nizwaside showed relatively weak antioxidant activity with 15 % inhibition.

  7. Platelet activation by extracellular matrix proteins in haemostasis and thrombosis.

    PubMed

    Watson, Steve P

    2009-01-01

    The prevention of excessive blood loss to avoid fatal haemorrhage is a pivotal process for all organisms possessing a circulatory system. Increased circulating blood volume and pressure, as required in larger animals, make this process all the more important and challenging. It is essential to have a powerful and rapid system to detect damage and generate an effective seal, and which is also exquisitely regulated to prevent unwanted, excessive or systemic activation so as to avoid blockage of vessels. Thus, a highly specialised and efficient haemostatic system has evolved that consists of cellular (platelets) and protein (coagulation factors) components. Importantly, this is able to support haemostasis in both the low shear environment of the venous system and the high shear environment of the arterial system. Endothelial cells, lining the entire circulation system, play a crucial role in the delicate balance between activation and inhibition of the haemostatic system. An intact and healthy endothelium supports blood flow by preventing attachment of cells and proteins which is required for initiation of coagulation and platelet activation. Endothelial cells produce and release the two powerful soluble inhibitors of platelet activation, nitric oxide and prostacyclin, and express high levels of CD39 which rapidly metabolises the major platelet feedback agonist, ADP. This antithrombotic environment however can rapidly change following activation or removal of endothelial cells through injury or rupture of atherosclerotic plaques. Loss of endothelial cells exposes the subendothelial extracellular matrix which creates strong signals for activation of the haemostatic system including powerful platelet adhesion and activation. Quantitative and qualitative changes in the composition of the subendothelial extracellular matrix influence these prothrombotic characteristics with life threatening thrombotic and bleeding complications, as illustrated by formation of

  8. [National evaluation of the diagnosis of activated protein C resistance].

    PubMed

    Montiel-Manzano, Guadalupe; de la Peña-Díaz, Aurora; Majluf-Cruz, Abraham; Cesarman-Maus, Gabriela; Corona-de la Peña, Norma; Cruz-Cruz, Donají; Gaminio, Elizabeth; Martínez-Murillo, Carlos; Mayagoitia, Teresa; Miranda-Peralta, Enrique; Poblete, Teresita; Quintana-Martínez, Sandra; Ramírez, Raúl; Razo, Daniel; Ruiz de Chávez-Ochoa, Adriana; Reyes-Núñez, Virginia Adriana; Salazar, Rosario; Vicencio-Santiago, Guadalupe Virginia; Villa, Rosario; Reyes-Núñez, Aurelia Virginia

    2003-01-01

    Thrombophilia or prothrombotic state appears when activation of blood hemostatic mechanisms overcomes the physiological anticoagulant capacity allowing a thrombotic event. Thrombosis is the leading worldwide mortality cause and due to its high associated morbidity and mortality, it should be insisted in the opportune identification of a thrombophilic state. The study of thrombophilia identifies individuals at high risk for thrombosis. This meeting was conceived first to analyze the current status of the diagnosis of thrombophilia in Mexico and second to create the base for a national consensus for thrombophilia screening and for the establishment of a national center for laboratory reference and quality control for thrombophilia. Since searching of activated protein C resistance (APCR) and FV Leiden seem to have priority either in the clinical setting and in public health services, it was decided to start with these two abnormalities as a model to analyze the current status of thrombophilia diagnosis in the clinical laboratory. At this time, several thrombophilic abnormalities have been described however, APCR remains the most important cause of thrombophilia, accounting for as much as 20% to 60% of all venous thrombosis. APCR is a consequence of the resistance of activated FV to be inactivated by activated protein C. Procoagulant activity of activated FV increases the risk of thrombosis. Hereditary APCR is almost always due to a point mutation at the nucleotide 1691 of the FV gen inducing an Arg506Glu substitution in FV molecule. This mutation is better known as FV Leiden. Heterocygous carriers of FV Leiden have a thrombotic risk 5 to 10 times higher than general population while the risk for the homocygote state is increased 50 to 100-fold. When activated PC is added to plasma from patients with FV Leiden, this last resists the anticoagulant effect of activated PC. Therefore, thrombin production is not inhibited. This phenomenon is called APCR. The functional

  9. Superoxide dismutase activity of Cu-bound prion protein

    NASA Astrophysics Data System (ADS)

    Hodak, Miroslav; Lu, Wenchang; Bernholc, Jerry

    2009-03-01

    Misfolding of the prion protein, PrP, has been linked to a group of neurodegenerative diseases, including the mad cow disease in cattle and the Creutzfeldt-Jakob disease in humans. The normal function of PrP is still unknown, but it was found that the PrP can efficiently bind Cu(II) ions. Early experiments suggested that Cu-PrP complex possesses significant superoxide dismutase (SOD) activity, but later experiments failed to confirm it and at present this issue remains unresolved. Using a recently developed hybrid DFT/DFT method, which combines Kohn-Sham DFT for the solute and its first solvation shells with orbital-free DFT for the remainder of the solvent, we have investigated SOD activity of PrP. The PrP is capable of incorporating Cu(II) ions in several binding modes and our calculations find that each mode has a different SOD activity. The highest activity found is comparable to those of well-known SOD proteins, suggesting that the conflicting experimental results may be due to different bindings of Cu(II) in those experiments.

  10. Covalent agonists for studying G protein-coupled receptor activation

    PubMed Central

    Weichert, Dietmar; Kruse, Andrew C.; Manglik, Aashish; Hiller, Christine; Zhang, Cheng; Hübner, Harald; Kobilka, Brian K.; Gmeiner, Peter

    2014-01-01

    Structural studies on G protein-coupled receptors (GPCRs) provide important insights into the architecture and function of these important drug targets. However, the crystallization of GPCRs in active states is particularly challenging, requiring the formation of stable and conformationally homogeneous ligand-receptor complexes. Native hormones, neurotransmitters, and synthetic agonists that bind with low affinity are ineffective at stabilizing an active state for crystallogenesis. To promote structural studies on the pharmacologically highly relevant class of aminergic GPCRs, we here present the development of covalently binding molecular tools activating Gs-, Gi-, and Gq-coupled receptors. The covalent agonists are derived from the monoamine neurotransmitters noradrenaline, dopamine, serotonin, and histamine, and they were accessed using a general and versatile synthetic strategy. We demonstrate that the tool compounds presented herein display an efficient covalent binding mode and that the respective covalent ligand-receptor complexes activate G proteins comparable to the natural neurotransmitters. A crystal structure of the β2-adrenoreceptor in complex with a covalent noradrenaline analog and a conformationally selective antibody (nanobody) verified that these agonists can be used to facilitate crystallogenesis. PMID:25006259

  11. Interactive ion-mediated sap flow regulation in olive and laurel stems: physicochemical characteristics of water transport via the pit structure.

    PubMed

    Ryu, Jeongeun; Ahn, Sungsook; Kim, Seung-Gon; Kim, TaeJoo; Lee, Sang Joon

    2014-01-01

    Sap water is distributed and utilized through xylem conduits, which are vascular networks of inert pipes important for plant survival. Interestingly, plants can actively regulate water transport using ion-mediated responses and adapt to environmental changes. However, ionic effects on active water transport in vascular plants remain unclear. In this report, the interactive ionic effects on sap transport were systematically investigated for the first time by visualizing the uptake process of ionic solutions of different ion compositions (K+/Ca2+) using synchrotron X-ray and neutron imaging techniques. Ionic solutions with lower K+/Ca2+ ratios induced an increased sap flow rate in stems of Olea europaea L. and Laurus nobilis L. The different ascent rates of ionic solutions depending on K+/Ca2+ ratios at a fixed total concentration increases our understanding of ion-responsiveness in plants from a physicochemical standpoint. Based on these results, effective structural changes in the pit membrane were observed using varying ionic ratios of K+/Ca2+. The formation of electrostatically induced hydrodynamic layers and the ion-responsiveness of hydrogel structures based on Hofmeister series increase our understanding of the mechanism of ion-mediated sap flow control in plants.

  12. Interactive Ion-Mediated Sap Flow Regulation in Olive and Laurel Stems: Physicochemical Characteristics of Water Transport via the Pit Structure

    PubMed Central

    Ryu, Jeongeun; Ahn, Sungsook; Kim, Seung-Gon; Kim, TaeJoo; Lee, Sang Joon

    2014-01-01

    Sap water is distributed and utilized through xylem conduits, which are vascular networks of inert pipes important for plant survival. Interestingly, plants can actively regulate water transport using ion-mediated responses and adapt to environmental changes. However, ionic effects on active water transport in vascular plants remain unclear. In this report, the interactive ionic effects on sap transport were systematically investigated for the first time by visualizing the uptake process of ionic solutions of different ion compositions (K+/Ca2+) using synchrotron X-ray and neutron imaging techniques. Ionic solutions with lower K+/Ca2+ ratios induced an increased sap flow rate in stems of Olea europaea L. and Laurus nobilis L. The different ascent rates of ionic solutions depending on K+/Ca2+ ratios at a fixed total concentration increases our understanding of ion-responsiveness in plants from a physicochemical standpoint. Based on these results, effective structural changes in the pit membrane were observed using varying ionic ratios of K+/Ca2+. The formation of electrostatically induced hydrodynamic layers and the ion-responsiveness of hydrogel structures based on Hofmeister series increase our understanding of the mechanism of ion-mediated sap flow control in plants. PMID:24852943

  13. Centromeric binding and activity of Protein Phosphatase 4

    PubMed Central

    Lipinszki, Zoltan; Lefevre, Stephane; Savoian, Matthew S.; Singleton, Martin R.; Glover, David M.; Przewloka, Marcin R.

    2015-01-01

    The cell division cycle requires tight coupling between protein phosphorylation and dephosphorylation. However, understanding the cell cycle roles of multimeric protein phosphatases has been limited by the lack of knowledge of how their diverse regulatory subunits target highly conserved catalytic subunits to their sites of action. Phosphoprotein phosphatase 4 (PP4) has been recently shown to participate in the regulation of cell cycle progression. We now find that the EVH1 domain of the regulatory subunit 3 of Drosophila PP4, Falafel (Flfl), directly interacts with the centromeric protein C (CENP-C). Unlike other EVH1 domains that interact with proline-rich ligands, the crystal structure of the Flfl amino-terminal EVH1 domain bound to a CENP-C peptide reveals a new target-recognition mode for the phosphatase subunit. We also show that binding of Flfl to CENP-C is required to bring PP4 activity to centromeres to maintain CENP-C and attached core kinetochore proteins at chromosomes during mitosis. PMID:25562660

  14. Nanocarriers from GRAS Zein Proteins to Encapsulate Hydrophobic Actives.

    PubMed

    Weissmueller, Nikolas T; Lu, Hoang D; Hurley, Amanda; Prud'homme, Robert K

    2016-11-14

    One factor limiting the expansion of nanomedicines has been the high cost of the materials and processes required for their production. We present a continuous, scalable, low cost nanoencapsulation process, Flash Nanoprecipitation (FNP) that enables the production of nanocarriers (NCs) with a narrow size distribution using zein corn proteins. Zein is a low cost, GRAS protein (having the FDA status of "Generally Regarded as Safe") currently used in food applications, which acts as an effective encapsulant for hydrophobic compounds using FNP. The four-stream FNP configuration allows the encapsulation of very hydrophobic compounds in a way that is not possible with previous precipitation processes. We present the encapsulation of several model active compounds with as high as 45 wt % drug loading with respect to zein concentration into ∼100 nm nanocarriers. Three examples are presented: (1) the pro-drug antioxidant, vitamin E-acetate, (2) an anticholera quorum-sensing modulator CAI-1 ((S)-3-hydroxytridecan-4-one; CAI-1 that reduces Vibrio cholerae virulence by modulating cellular communication), and (3) hydrophobic fluorescent dyes with a range of hydrophobicities. The specific interaction between zein and the milk protein, sodium caseinate, provides stabilization of the NCs in PBS, LB medium, and in pH 2 solutions. The stability and size changes in the three media provide information on the mechanism of assembly of the zein/active/casein NC.

  15. Fluctuation driven active molecular transport in passive channel proteins

    NASA Astrophysics Data System (ADS)

    Kosztin, Ioan

    2006-03-01

    Living cells interact with their extracellular environment through the cell membrane, which acts as a protective permeability barrier for preserving the internal integrity of the cell. However, cell metabolism requires controlled molecular transport across the cell membrane, a function that is fulfilled by a wide variety of transmembrane proteins, acting as either passive or active transporters. In this talk it is argued that, contrary to the general belief, in active cell membranes passive and spatially asymmetric channel proteins can act as active transporters by consuming energy from nonequilibrium fluctuations fueled by cell metabolism. This assertion is demonstrated in the case of the E. coli aquaglyceroporin GlpF channel protein, whose high resolution crystal structure is manifestly asymmetric. By calculating the glycerol flux through GlpF within the framework of a stochastic model, it is found that, as a result of channel asymmetry, glycerol uptake driven by a concentration gradient is enhanced significantly in the presence of non-equilibrium fluctuations. Furthermore, the enhancement caused by a ratchet-like mechanism is larger for the outward, i.e., from the cytoplasm to the periplasm, flux than for the inward one, suggesting that the same non-equilibrium fluctuations also play an important role in protecting the interior of the cell against poisoning by excess uptake of glycerol. Preliminary data on water and sugar transport through aquaporin and maltoporin channels, respectively, are indicative of the universality of the proposed nonequilibrium-fluctuation-driven active transport mechanism. This work was supported by grants from the Univ. of Missouri Research Board, the Institute for Theoretical Sciences and the Department of Energy (DOE Contract W-7405-ENG-36), and the National Science Foundation (FIBR-0526854).

  16. p38 mitogen-activated protein kinase activation by ultraviolet A radiation in human dermal fibroblasts.

    PubMed

    Le Panse, Rozen; Dubertret, Louis; Coulomb, Bernard

    2003-08-01

    UVA radiation penetrates deeply into the skin reaching both the epidermis and the dermis. We thus investigated the effects of naturally occurring doses of UVA radiation on mitogen-activated protein kinase (MAPK) activities in human dermal fibroblasts. We demonstrated that UVA selectively activates p38 MAPK with no effect on extracellular-regulated kinases (ERK1-ERK2) or JNK-SAPK (cJun NH2-terminal kinase-stress-activated protein kinase) activities. We then investigated the signaling pathway used by UVA to activate p38 MAPK. L-Histidine and sodium azide had an inhibitory effect on UVA activation of p38 MAPK, pointing to a role of singlet oxygen in transduction of the UVA effect. Afterward, using prolonged cell treatments with growth factors to desensitize their signaling pathways or suramin to block growth factor receptors, we demonstrated that UVA signaling pathways shared elements with growth factor signaling pathways. In addition, using emetine (a translation inhibitor altering ribosome functioning) we detected the involvement of ribotoxic stress in p38 MAPK activation by UVA. Our observations suggest that p38 activation by UVA in dermal fibroblasts involves singlet oxygen-dependent activation of ligand-receptor signaling pathways or ribotoxic stress mechanism (or both). Despite the activation of these two distinct signaling mechanisms, the selective activation of p38 MAPK suggests a critical role of this kinase in the effects of UVA radiation.

  17. Direct Activation of Bax Protein for Cancer Therapy

    PubMed Central

    Liu, Zhiqing; Ding, Ye; Ye, Na; Wild, Christopher; Chen, Haiying; Zhou, Jia

    2015-01-01

    Bax, a central cell death regulator, is an indispensable gateway to mitochondrial dysfunction and a major pro-apoptotic member of the Bcl-2 family proteins that control apoptosis in normal and cancer cells. Dysfunction of apoptosis renders the cancer cell resistant to treatment as well as promotes tumorigenesis. Bax activation induces mitochondrial membrane permeabilization, thereby leading to the release of apoptotic factor cytochrome c and consequently cancer cell death. A number of drugs in clinical use are known to indirectly activate Bax. Intriguingly, recent efforts demonstrate that Bax can serve as a promising direct target for small-molecule drug discovery. Several direct Bax activators have been identified to hold promise for cancer therapy with the advantages of specificity and the potential of overcoming chemo- and radioresistance. Further investigation of this new class of drug candidates will be needed to advance them into the clinic as a novel means to treat cancer. PMID:26395559

  18. Sap flow measurements to determine the transpiration of facade greenings

    NASA Astrophysics Data System (ADS)

    Hölscher, Marie-Therese; Nehls, Thomas; Wessolek, Gerd

    2014-05-01

    Facade greening is expected to make a major contribution to the mitigation of the urban heat-island effect through transpiration cooling, thermal insulation and shading of vertical built structures. However, no studies are available on water demand and the transpiration of urban vertical green. Such knowledge is needed as the plants must be sufficiently watered, otherwise the posited positive effects of vertical green can turn into disadvantages when compared to a white wall. Within the framework of the German Research Group DFG FOR 1736 "Urban Climate and Heat Stress" this study aims to test the practicability of the sap flow technique for transpiration measurements of climbing plants and to obtain potential transpiration rates for the most commonly used species. Using sap flow measurements we determined the transpiration of Fallopia baldschuanica, Parthenocissus tricuspidata and Hedera helix in pot experiments (about 1 m high) during the hot summer period from August 17th to August 30th 2012 under indoor conditions. Sap flow measurements corresponded well to simultaneous weight measurement on a daily base (factor 1.19). Fallopia baldschuanica has the highest daily transpiration rate based on leaf area (1.6 mm d-1) and per base area (5.0 mm d-1). Parthenocissus tricuspidata and Hedera helix show transpiration rates of 3.5 and 0.4 mm d-1 (per base area). Through water shortage, transpiration strongly decreased and leaf temperature measured by infrared thermography increased by 1 K compared to a well watered plant. We transferred the technique to outdoor conditions and will present first results for facade greenings in the inner-city of Berlin for the hottest period in summer 2013.

  19. Cyclic-GMP-dependent protein kinase inhibits the Ras/Mitogen-activated protein kinase pathway.

    PubMed

    Suhasini, M; Li, H; Lohmann, S M; Boss, G R; Pilz, R B

    1998-12-01

    Agents which increase the intracellular cyclic GMP (cGMP) concentration and cGMP analogs inhibit cell growth in several different cell types, but it is not known which of the intracellular target proteins of cGMP is (are) responsible for the growth-suppressive effects of cGMP. Using baby hamster kidney (BHK) cells, which are deficient in cGMP-dependent protein kinase (G-kinase), we show that 8-(4-chlorophenylthio)guanosine-3', 5'-cyclic monophosphate and 8-bromoguanosine-3',5'-cyclic monophosphate inhibit cell growth in cells stably transfected with a G-kinase Ibeta expression vector but not in untransfected cells or in cells transfected with a catalytically inactive G-kinase. We found that the cGMP analogs inhibited epidermal growth factor (EGF)-induced activation of mitogen-activated protein (MAP) kinase and nuclear translocation of MAP kinase in G-kinase-expressing cells but not in G-kinase-deficient cells. Ras activation by EGF was not impaired in G-kinase-expressing cells treated with cGMP analogs. We show that activation of G-kinase inhibited c-Raf kinase activation and that G-kinase phosphorylated c-Raf kinase on Ser43, both in vitro and in vivo; phosphorylation of c-Raf kinase on Ser43 uncouples the Ras-Raf kinase interaction. A mutant c-Raf kinase with an Ala substitution for Ser43 was insensitive to inhibition by cGMP and G-kinase, and expression of this mutant kinase protected cells from inhibition of EGF-induced MAP kinase activity by cGMP and G-kinase, suggesting that Ser43 in c-Raf is the major target for regulation by G-kinase. Similarly, B-Raf kinase was not inhibited by G-kinase; the Ser43 phosphorylation site of c-Raf is not conserved in B-Raf. Activation of G-kinase induced MAP kinase phosphatase 1 expression, but this occurred later than the inhibition of MAP kinase activation. Thus, in BHK cells, inhibition of cell growth by cGMP analogs is strictly dependent on G-kinase and G-kinase activation inhibits the Ras/MAP kinase pathway (i) by

  20. Spring sapping on the lower continental slope, offshore New Jersey

    USGS Publications Warehouse

    Robb, James M.

    1984-01-01

    Undersea discharge of ground water during periods of lower sea level may have eroded valleys on part of the lower continental slope, offshore New Jersey. Steep-headed basins, cliffed and terraced walls, and irregular courses of these valleys may have been produced by sapping of exposed near-horizontal Tertiary strata. Joints in Eocene calcareous rocks would have localized ground-water movement. Some karstlike features of the submarine topography and the outcrops suggest that solution of the calcareous rocks also took place.

  1. PPR-SMR protein SOT1 has RNA endonuclease activity.

    PubMed

    Zhou, Wen; Lu, Qingtao; Li, Qingwei; Wang, Lei; Ding, Shunhua; Zhang, Aihong; Wen, Xiaogang; Zhang, Lixin; Lu, Congming

    2017-02-21

    Numerous attempts have been made to identify and engineer sequence-specific RNA endonucleases, as these would allow for efficient RNA manipulation. However, no natural RNA endonuclease that recognizes RNA in a sequence-specific manner has been described to date. Here, we report that SUPPRESSOR OF THYLAKOID FORMATION 1 (SOT1), an Arabidopsis pentatricopeptide repeat (PPR) protein with a small MutS-related (SMR) domain, has RNA endonuclease activity. We show that the SMR moiety of SOT1 performs the endonucleolytic maturation of 23S and 4.5S rRNA through the PPR domain, specifically recognizing a 13-nucleotide RNA sequence in the 5' end of the chloroplast 23S-4.5S rRNA precursor. In addition, we successfully engineered the SOT1 protein with altered PPR motifs to recognize and cleave a predicted RNA substrate. Our findings point to SOT1 as an exciting tool for RNA manipulation.

  2. Refolding techniques for recovering biologically active recombinant proteins from inclusion bodies.

    PubMed

    Yamaguchi, Hiroshi; Miyazaki, Masaya

    2014-02-20

    Biologically active proteins are useful for studying the biological functions of genes and for the development of therapeutic drugs and biomaterials in a biotechnology industry. Overexpression of recombinant proteins in bacteria, such as Escherichia coli, often results in the formation of inclusion bodies, which are protein aggregates with non-native conformations. As inclusion bodies contain relatively pure and intact proteins, protein refolding is an important process to obtain active recombinant proteins from inclusion bodies. However, conventional refolding methods, such as dialysis and dilution, are time consuming and, often, recovered yields of active proteins are low, and a trial-and-error process is required to achieve success. Recently, several approaches have been reported to refold these aggregated proteins into an active form. The strategies largely aim at reducing protein aggregation during the refolding procedure. This review focuses on protein refolding techniques using chemical additives and laminar flow in microfluidic chips for the efficient recovery of active proteins from inclusion bodies.

  3. Steric effects in peptide and protein exchange with activated disulfides.

    PubMed

    Kerr, Jason; Schlosser, Jessica L; Griffin, Donald R; Wong, Darice Y; Kasko, Andrea M

    2013-08-12

    Disulfide exchange is an important bioconjugation tool, enabling chemical modification of peptides and proteins containing free cysteines. We previously reported the synthesis of a macromer bearing an activated disulfide and its incorporation into hydrogels. Despite their ability to diffuse freely into hydrogels, larger proteins were unable to undergo in-gel disulfide exchange. In order to understand this phenomenon, we synthesized four different activated disulfide-bearing model compounds (Mn = 300 Da to 10 kDa) and quantified their rate of disulfide exchange with a small peptide (glutathione), a moderate-sized protein (β-lactoglobulin), and a large protein (bovine serum albumin) in four different pH solutions (6.0, 7.0, 7.4, and 8.0) to mimic biological systems. Rate constants of exchange depend significantly on the size and accessibility of the thiolate. pH also significantly affects the rate of reaction, with the faster reactions occurring at higher pH. Surprisingly, little difference in exchange rates is seen between macromolecular disulfides of varying size (Mn = 2 kDa - 10 kDa), although all undergo exchange more slowly than their small molecule analogue (MW = 300 g/mol). The maximum exchange efficiencies (% disulfides exchanged after 24 h) are not siginificantly affected by thiol size or pH, but somewhat affected by disulfide size. Therefore, while all three factors investigated (pH, disulfide size, and thiolate size) can influence the exchange kinetics and extent of reaction, the size of the thiolate and its accessibility plays the most significant role.

  4. Recombinant Human Peptidoglycan Recognition Proteins Reveal Antichlamydial Activity.

    PubMed

    Bobrovsky, Pavel; Manuvera, Valentin; Polina, Nadezhda; Podgorny, Oleg; Prusakov, Kirill; Govorun, Vadim; Lazarev, Vassili

    2016-07-01

    Peptidoglycan recognition proteins (PGLYRPs) are innate immune components that recognize the peptidoglycan and lipopolysaccharides of bacteria and exhibit antibacterial activity. Recently, the obligate intracellular parasite Chlamydia trachomatis was shown to have peptidoglycan. However, the antichlamydial activity of PGLYRPs has not yet been demonstrated. The aim of our study was to test whether PGLYRPs exhibit antibacterial activity against C. trachomatis Thus, we cloned the regions containing the human Pglyrp1, Pglyrp2, Pglyrp3, and Pglyrp4 genes for subsequent expression in human cell lines. We obtained stable HeLa cell lines that secrete recombinant human PGLYRPs into culture medium. We also generated purified recombinant PGLYRP1, -2, and -4 and confirmed their activities against Gram-positive (Bacillus subtilis) and Gram-negative (Escherichia coli) bacteria. Furthermore, we examined the activities of recombinant PGLYRPs against C. trachomatis and determined their MICs. We also observed a decrease in the infectious ability of chlamydial elementary bodies in the next generation after a single exposure to PGLYRPs. Finally, we demonstrated that PGLYRPs attach to C. trachomatis elementary bodies and activate the expression of the chlamydial two-component stress response system. Thus, PGLYRPs inhibit the development of chlamydial infection.

  5. Recombinant Human Peptidoglycan Recognition Proteins Reveal Antichlamydial Activity

    PubMed Central

    Manuvera, Valentin; Polina, Nadezhda; Podgorny, Oleg; Prusakov, Kirill; Govorun, Vadim; Lazarev, Vassili

    2016-01-01

    Peptidoglycan recognition proteins (PGLYRPs) are innate immune components that recognize the peptidoglycan and lipopolysaccharides of bacteria and exhibit antibacterial activity. Recently, the obligate intracellular parasite Chlamydia trachomatis was shown to have peptidoglycan. However, the antichlamydial activity of PGLYRPs has not yet been demonstrated. The aim of our study was to test whether PGLYRPs exhibit antibacterial activity against C. trachomatis. Thus, we cloned the regions containing the human Pglyrp1, Pglyrp2, Pglyrp3, and Pglyrp4 genes for subsequent expression in human cell lines. We obtained stable HeLa cell lines that secrete recombinant human PGLYRPs into culture medium. We also generated purified recombinant PGLYRP1, -2, and -4 and confirmed their activities against Gram-positive (Bacillus subtilis) and Gram-negative (Escherichia coli) bacteria. Furthermore, we examined the activities of recombinant PGLYRPs against C. trachomatis and determined their MICs. We also observed a decrease in the infectious ability of chlamydial elementary bodies in the next generation after a single exposure to PGLYRPs. Finally, we demonstrated that PGLYRPs attach to C. trachomatis elementary bodies and activate the expression of the chlamydial two-component stress response system. Thus, PGLYRPs inhibit the development of chlamydial infection. PMID:27160295

  6. Ternary complex factors SAP-1 and Elk-1, but not net, are functionally equivalent in thymocyte development.

    PubMed

    Costello, Patrick; Nicolas, Robert; Willoughby, Jane; Wasylyk, Bohdan; Nordheim, Alfred; Treisman, Richard

    2010-07-15

    The ternary complex factors (TCFs; SAP-1, Elk-1, and Net) are serum response factor cofactors that share many functional properties and are coexpressed in many tissues. SAP-1, the predominant thymus TCF, is required for thymocyte positive selection. In this study, we assessed whether the different TCFs are functionally equivalent. Elk-1 deletion, but not the hypomorphic Net(delta) mutation, exacerbated the SAP-1 positive selection phenotype, but triply deficient thymocytes were no more defective than SAP-1(-/-) Elk-1(-/-) cells. Inactivation of the other TCFs did not affect SAP-1-independent processes, including beta-selection, regulatory T cell selection, and negative selection, although reduced marginal zone B cells were observed in SAP-1(-/-) Elk-1(-/-) animals. Ectopic expression of Elk-1, but not Net, rescued positive selection of SAP-1(-/-) thymocytes; thus, SAP-1 and Elk-1 are functionally equivalent in this system, and the SAP-1 null selection phenotype reflects only its high expression in the thymus. Array analysis of TCR-stimulated double-positive cells identified SAP-1-dependent inducible genes whose transcription was further impaired in SAP-1(-/-) Elk-1(-/-) cells; thus, these genes, which include Egr-1 and Egr-2, represent candidate mediators of positive selection. Chromatin immunoprecipitation revealed subtly different promoter targeting between the different TCFs. Ectopic expression of Egr-1 restored positive selection in SAP-1 null thymocytes, establishing it (and possibly other Egr family members) as the major effector for ERK-SAP-1 signaling in thymocyte positive selection.

  7. Protein glycation inhibitory activity and antioxidant capacity of clove extract.

    PubMed

    Suantawee, Tanyawan; Wesarachanon, Krittaporn; Anantsuphasak, Kanokphat; Daenphetploy, Tanuch; Thien-Ngern, Sroshin; Thilavech, Thavaree; Pasukamonset, Porntip; Ngamukote, Sathaporn; Adisakwattana, Sirichai

    2015-06-01

    Syzygium aromaticum (L.) (clove) is one of the most widely cultivated spices in many tropical countries. The aim of this study was to determine the phytochemical content, the antioxidant properties and the antiglycation properties of aqueous extract of clove against fructose-mediated protein glycation and oxidation. The result showed that the content of total phenolics and flavonoids in clove extract was 239.58 ± 0.70 mg gallic acid equivalents/g dried extract and 65.67 ± 0.01 mg catechin equivalents/g dried extract, respectively. In addition, clove exhibited antioxidant properties including DPPH radical scavenging activity (IC50 = 0.29 ± 0.01 mg/ml), Trolox equivalent antioxidant capacity (4.69 ± 0.03 μmol Trolox equivalents/mg dried extract), ferric reducing antioxidant power (20.55 ± 0.11 μmol ascorbic acid equivalents/mg dried extract), Oxygen radical absorbance capacity (31.12 ± 0.21 μmol Trolox equivalents/mg dried extract), hydroxyl radical scavenging activity (0.15 ± 0.04 mg Trolox equivalents/mg dried extract), and superoxide radical scavenging activity (18.82 ± 0.50 mg Trolox equivalents/mg dried extract). The aqueous extract of clove (0.25-1.00 mg/ml) significantly inhibited the formation of fluorescent advanced glycation end products (AGEs) and non-fluorescent AGEs (N(ɛ)-(carboxymethyl) lysine (CML)) in glycated BSA during 4 weeks of incubation. The extract also markedly prevented oxidation-induced protein damage by decreasing protein carbonyl formation and protecting against the loss of protein thiol group. These results clearly demonstrated that a polyphenol enriched clove extract, owing to its antioxidant, was capable to inhibit the formation of AGEs and protein glycation. The findings might lead to the possibility of using the clove extract for targeting diabetic complications.

  8. Egg Activation at Fertilization by a Soluble Sperm Protein.

    PubMed

    Swann, Karl; Lai, F Anthony

    2016-01-01

    The most fundamental unresolved issue of fertilization is to define how the sperm activates the egg to begin embryo development. Egg activation at fertilization in all species thus far examined is caused by some form of transient increase in the cytoplasmic free Ca(2+) concentration. What has not been clear, however, is precisely how the sperm triggers the large changes in Ca(2+) observed within the egg cytoplasm. Here, we review the studies indicating that the fertilizing sperm stimulates a cytosolic Ca(2+) increase in the egg specifically by delivering a soluble factor that diffuses into the cytosolic space of the egg upon gamete membrane fusion. Evidence is primarily considered in species of eggs where the sperm has been shown to elicit a cytosolic Ca(2+) increase by initiating Ca(2+) release from intracellular Ca(2+) stores. We suggest that our best understanding of these signaling events is in mammals, where the sperm triggers a prolonged series of intracellular Ca(2+) oscillations. The strongest empirical studies to date suggest that mammalian sperm-triggered Ca(2+) oscillations are caused by the introduction of a sperm-specific protein, called phospholipase C-zeta (PLCζ) that generates inositol trisphosphate within the egg. We will discuss the role and mechanism of action of PLCζ in detail at a molecular and cellular level. We will also consider some of the evidence that a soluble sperm protein might be involved in egg activation in nonmammalian species.

  9. Candida albicans Shed Msb2 and Host Mucins Affect the Candidacidal Activity of Salivary Hst 5

    PubMed Central

    Puri, Sumant; Friedman, Justin; Saraswat, Darpan; Kumar, Rohitashw; Li, Rui; Ruszaj, Donna; Edgerton, Mira

    2015-01-01

    Salivary Histatin 5 (Hst 5) is an antimicrobial peptide that exhibits potent antifungal activity towards Candida albicans, the causative agent of oral candidiasis. However, it exhibits limited activity in vivo, largely due to inactivation by salivary components of both host and pathogen origin. Proteins secreted by C. albicans during infection such as secreted aspartyl proteases (Saps) and shed mucin Msb2 can reduce Hst 5 activity; and human salivary mucins, while suggested to protect Hst 5 from proteolytic degradation, can entrap peptides into mucin gels, thereby reducing bioavailability. We show here that Sap6 that is secreted during hyphal growth reduces Hst 5 activity, most likely a result of proteolytic degradation of Hst 5 since this effect is abrogated with heat inactivated Sap 6. We further show that just like C. albicans shedding Msb2, mammalian mucins, fetuin and porcine gut mucin (that is related to salivary mucins), also reduce Hst 5 activity. However, we identify mucin-like protein-induced changes in C. albicans cell morphology and aggregation patterns, suggesting that the effect of such proteins on Hst 5 cannot be interpreted independently of their effect on yeast cells. PMID:26529023

  10. Use of gene fusions and protein-protein interaction in the isolation of a biologically active regulatory protein: the replication initiator protein of plasmid R6K.

    PubMed Central

    Germino, J; Gray, J G; Charbonneau, H; Vanaman, T; Bastia, D

    1983-01-01

    The initiation of DNA replication of plasmid R6K is triggered by a 35-kilodalton initiator protein. The initiator protein had been elusive because of its lability and the lack of a convenient assay procedure to aid its purification. Using recombinant DNA techniques, we have fused the cistron of the initiator near its COOH-terminal end, in the correct reading frame, to the lacZ cistron of Escherichia coli at the ninth codon from the NH2 terminus. The fused cistron yielded a protein that was not only stable in vivo but also had dual activities: initiation of DNA replication in vivo and in vitro and hydrolysis of beta-galactoside. Using an affinity column that is specific for beta-galactosidase, we have demonstrated the rapid purification of the hybrid protein to near homogeneity. Exploiting the polymeric structure of the initiator, we have also isolated the nonfused form of the initiator protein, associated through subunit interaction with the beta-galactosidase-fused protein, which permits its purification by affinity chromatography. NH2-terminal amino acid sequence analysis of the heteropolymer has not only shown that the fused and nonfused initiators have the same sequence but also confirmed the protein sequence of the initiator as predicted from its nucleotide sequence. The techniques described here should be generally useful for the isolation of other proteins that are difficult to purify by conventional procedures. Images PMID:6316329

  11. Platelet factor 4 stimulates thrombomodulin protein C-activating cofactor activity. A structure-function analysis.

    PubMed

    Slungaard, A; Key, N S

    1994-10-14

    Thrombomodulin (TM) is an anionic (pI approximately 4) protein cofactor that promotes thrombin (THR) cleavage of protein C to generate activated protein C (APC), a potent anticoagulant. We find that the cationic platelet alpha-granule protein platelet factor 4 (PF4) stimulates 4-25-fold the cofactor activity of rabbit TM and two differentially glycanated versions of an extracellular domain human TM polypeptide in which the glycosaminoglycan (GAG) is either present (GAG+ TM) or absent (GAG- TM) with an ED50 of 3.3-10 micrograms/ml. No such stimulation occurs in response to beta-thromboglobulin or thrombospondin, or when protein C lacking its gamma-carboxyglutamic acid (Gla) domain is the substrate. Heparin and chondroitin sulfates A and E reverse PF4 stimulation. PF4 minimally affects the Kd for THR but decreases 30-fold (from 8.3 to 0.3 microM) the Km for protein C of APC generation by GAG+ TM. PF4 also strikingly transforms the [Ca2+] dependence profile of rabbit and GAG+ TM to resemble that of GAG- TM. A potential explanation for this is that PF4, like Ca2+, induces heparin-reversible alterations in native (but not Gla-domainless) protein C conformation as assessed by autofluorescence emission analysis. We conclude that PF4 stimulates TM APC generation by interacting electrostatically with both the TM GAG and the protein C Gla domain to enhance markedly the affinity of the THR.TM complex for protein C. By this mechanism, PF4 may play a previously unsuspected role in the physiologic regulation of clotting.

  12. Campylobacter fetus Surface Layer Proteins Are Transported by a Type I Secretion System

    PubMed Central

    Thompson, Stuart A.; Shedd, Omer L.; Ray, Kevin C.; Beins, Michael H.; Jorgensen, Jesse P.; Blaser, Martin J.

    1998-01-01

    The virulence of Campylobacter fetus, a bacterial pathogen of ungulates and humans, is mediated in part by the presence of a paracrystalline surface layer (S-layer) that confers serum resistance. The subunits of the S-layer are S-layer proteins (SLPs) that are secreted in the absence of an N-terminal signal sequence and attach to either type A or B C. fetus lipopolysaccharide in a serospecific manner. Antigenic variation of multiple SLPs (encoded by sapA homologs) of type A strain 23D occurs by inversion of a promoter-containing DNA element flanked by two sapA homologs. Cloning and sequencing of the entire 6.2-kb invertible region from C. fetus 23D revealed a probable 5.6-kb operon of four overlapping genes (sapCDEF, with sizes of 1,035, 1,752, 1,284, and 1,302 bp, respectively) transcribed in the opposite direction from sapA. The four genes also were present in the invertible region of type B strain 84-107 and were virtually identical to their counterparts in the type A strain. Although SapC had no database homologies, SapD, SapE, and SapF had predicted amino acid homologies with type I protein secretion systems (typified by Escherichia coli HlyBD/TolC or Erwinia chrysanthemi PrtDEF) that utilize C-terminal secretion signals to mediate the secretion of hemolysins, leukotoxins, or proteases from other bacterial species. Analysis of the C termini of four C. fetus SLPs revealed conserved structures that are potential secretion signals. A C. fetus sapD mutant neither produced nor secreted SLPs. E. coli expressing C. fetus sapA and sapCDEF secreted SapA, indicating that the sapCDEF genes are sufficient for SLP secretion. C. fetus SLPs therefore are transported to the cell surface by a type I secretion system. PMID:9851986

  13. The Interaction of the Gammaherpesvirus 68 orf73 Protein with Cellular BET Proteins Affects the Activation of Cell Cycle Promoters▿

    PubMed Central

    Ottinger, Matthias; Pliquet, Daniel; Christalla, Thomas; Frank, Ronald; Stewart, James P.; Schulz, Thomas F.

    2009-01-01

    Infection of mice with murine gammaherpesvirus 68 (MHV-68) provides a valuable animal model for gamma-2 herpesvirus (rhadinovirus) infection and pathogenesis. The MHV-68 orf73 protein has been shown to be required for the establishment of viral latency in vivo. This study describes a novel transcriptional activation function of the MHV-68 orf73 protein and identifies the cellular bromodomain containing BET proteins Brd2/RING3, Brd3/ORFX, and BRD4 as interaction partners for the MHV-68 orf73 protein. BET protein members are known to interact with acetylated histones, and Brd2 and Brd4 have been implicated in fundamental cellular processes, including cell cycle regulation and transcriptional regulation. Using MHV-68 orf73 peptide array assays, we identified Brd2 and Brd4 interaction sites in the orf73 protein. Mutation of one binding site led to a loss of the interaction with Brd2/4 but not the retinoblastoma protein Rb, to impaired chromatin association, and to a decreased ability to activate the BET-responsive cyclin D1, D2, and E promoters. The results therefore pinpoint the binding site for Brd2/4 in a rhadinoviral orf73 protein and suggest that the recruitment of a member of the BET protein family allows the MHV-68 orf73 protein to activate the promoters of G1/S cyclins. These findings point to parallels between the transcriptional activator functions of rhadinoviral orf73 proteins and papillomavirus E2 proteins. PMID:19244327

  14. Protein kinase C-associated kinase regulates NF-κB activation through inducing IKK activation.

    PubMed

    Kim, Sang-Woo; Schifano, Matthew; Oleksyn, David; Jordan, Craig T; Ryan, Daniel; Insel, Richard; Zhao, Jiyong; Chen, Luojing

    2014-10-01

    Activation of the transcription factor NF-κB induced by extracellular stimuli requires IKKα and IKKβ kinase activity. How IKKα and IKKβ are activated by various upstream signaling molecules is not fully understood. We previously showed that protein kinase C-associated kinase (PKK, also known as DIK/RIP4), which belongs to the receptor-interacting protein (RIP) kinase family, mediates the B cell activating factor of the TNF family (BAFF)-induced NF-κB activation in diffuse large B cell lymphoma (DLBCL) cell lines. Here we have investigated the mechanism underlying NF-κB activation regulated by PKK. Our results suggest that PKK can activate both the classical and the alternative NF-κB activation pathways. PKK associates with IKKα and IKKβ in mammalian cells and induces activation of both IKKα and IKKβ via phosphorylation of their serine residues 176/180 and 177/181, respectively. Unlike other members of the RIP family that activate NF-κB through a kinase-independent pathway, PKK appears to activate IKK and NF-κB mainly in a kinase-dependent manner. Suppression of PKK expression by RNA interference inhibits phosphorylation of IKKα and IKKβ as well as activation of NF-κB in human cancer cell lines. Thus, PKK regulates NF-κB activation by modulating activation of IKKα and IKKβ in mammalian cells. We propose that PKK may provide a critical link between IKK activation and various upstream signaling cascades, and may represent a potential target for inhibiting abnormal NF-κB activation in human cancers.

  15. Scaffold protein enigma homolog activates CREB whereas a short splice variant prevents CREB activation in cardiomyocytes.

    PubMed

    Ito, Jumpei; Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Kuroda, Shun'ichi; Maturana, Andrés D

    2015-12-01

    Enigma Homolog (ENH1 or Pdlim5) is a scaffold protein composed of an N-terminal PDZ domain and three LIM domains at the C-terminal end. The enh gene encodes for several splice variants with opposing functions. ENH1 promotes cardiomyocytes hypertrophy whereas ENH splice variants lacking LIM domains prevent it. ENH1 interacts with various Protein Kinase C (PKC) isozymes and Protein Kinase D1 (PKD1). In addition, the binding of ENH1's LIM domains to PKC is sufficient to activate the kinase without stimulation. The downstream events of the ENH1-PKC/PKD1 complex remain unknown. PKC and PKD1 are known to phosphorylate the transcription factor cAMP-response element binding protein (CREB). We tested whether ENH1 could play a role in the activation of CREB. We found that, in neonatal rat ventricular cardiomyocytes, ENH1 interacts with CREB, is necessary for the phosphorylation of CREB at ser133, and the activation of CREB-dependent transcription. On the contrary, the overexpression of ENH3, a LIM-less splice variant, inhibited the phosphorylation of CREB. ENH3 overexpression or shRNA knockdown of ENH1 prevented the CREB-dependent transcription. Our results thus suggest that ENH1 plays an essential role in CREB's activation and dependent transcription in cardiomyocytes. At the opposite, ENH3 prevents the CREB transcriptional activity. In conclusion, these results provide a first molecular explanation to the opposing functions of ENH splice variants.

  16. Protein changes in the albedo of citrus fruits on postharvesting storage.

    PubMed

    Lliso, Ignacio; Tadeo, Francisco R; Phinney, Brett S; Wilkerson, Curtis G; Talón, Manuel

    2007-10-31

    In this work, major protein changes in the albedo of the fruit peel of Murcott tangor (tangerine x sweet orange) during postharvest ageing were studied through 2D PAGE. Protein content in matured on-tree fruits and in fruits stored in nonstressing [99% relative humidity (RH) and 25 degrees C], cold (99% RH and 4 degrees C), and drought (60% RH and 25 degrees C) conditions was initially determined. Protein identification through MS/MS determinations revealed in all samples analyzed the occurrence of manganese superoxide dismutase (Mn SOD), actin, ATP synthase beta subunit (ATPase), citrus salt-stress associated protein (CitSap), ascorbate peroxidase (APX), translationally controlled tumor protein (TCTP), and a cysteine proteinase (CP) of the papain family. The latter protein was identified in two different gel spots, with different molecular mass, suggesting the simultaneous presence of the proteinase precursor and its active form. While Mn SOD, actin, ATPase, and CitSap were unchanged in the assayed conditions, TCTP and APX were downregulated during the postharvest ageing process. Ageing-induced APX repression was also reversed by drought. CP contents in albedo, which were similar in on- and off-tree fruits, were strongly dependent upon cold storage. The active/total CP protein ratio significantly increased after cold exposure. This proteomic survey indicates that major changes in protein content in the albedo of the peel of postharvest stored citrus fruits are apparently related to the activation of programmed cell death (PCD).

  17. Keap1-Independent Regulation of Nrf2 Activity by Protein Acetylation and a BET Bromodomain Protein

    PubMed Central

    Chatterjee, Nirmalya; Tian, Min; Spirohn, Kerstin; Boutros, Michael; Bohmann, Dirk

    2016-01-01

    Mammalian BET proteins comprise a family of bromodomain-containing epigenetic regulators with complex functions in chromatin organization and gene regulation. We identified the sole member of the BET protein family in Drosophila, Fs(1)h, as an inhibitor of the stress responsive transcription factor CncC, the fly ortholog of Nrf2. Fs(1)h physically interacts with CncC in a manner that requires the function of its bromodomains and the acetylation of CncC. Treatment of cultured Drosophila cells or adult flies with fs(1)h RNAi or with the BET protein inhibitor JQ1 de-represses CncC transcriptional activity and engages protective gene expression programs. The mechanism by which Fs(1)h inhibits CncC function is distinct from the canonical mechanism that stimulates Nrf2 function by abrogating Keap1-dependent proteasomal degradation. Consistent with the independent modes of CncC regulation by Keap1 and Fs(1)h, combinations of drugs that can specifically target these pathways cause a strong synergistic and specific activation of protective CncC- dependent gene expression and boosts oxidative stress resistance. This synergism might be exploitable for the design of combinatorial therapies to target diseases associated with oxidative stress or inflammation. PMID:27233051

  18. A recyclable protein resource derived from cauliflower by-products: Potential biological activities of protein hydrolysates.

    PubMed

    Xu, Yang; Li, Yuting; Bao, Tao; Zheng, Xiaodong; Chen, Wei; Wang, Jianxu

    2017-04-15

    Cauliflower by-products (CBP) are rich in leaf protein. Every year tons of CBP will lead to environmental pollution. Therefore, this study was conducted to extract leaf protein from CBP and investigate its biological activities. Our results showed that the optimal extraction parameters were: a liquid to solid ratio of 4mL/g, a pH of 11, an ultrasonic extraction lasting 15min, and at an applied power of 175W. Under these optimized conditions, 12.066g of soluble leaf protein (SLP) was obtained from 1000g of CBP and its extraction yield was 53.07%. The obtained SLP was further hydrolysed by Alcalase and the SLP hydrolysate (SLPH) showed a potent angiotensin I-converting enzyme (ACE) inhibitory activity with an IC50 value of 138.545μg/mL in vitro. In addition, SLPH promoted the glucose consumption and enhanced the glycogen content in HepG2 cells. Overall, our results suggested that CBP may be recycled for designing future functional foods.

  19. Human lipopolysaccharide-binding protein potentiates bactericidal activity of human bactericidal/permeability-increasing protein.

    PubMed Central

    Horwitz, A H; Williams, R E; Nowakowski, G

    1995-01-01

    Human bactericidal/permeability-increasing protein (BPI) from neutrophils and a recombinant amino-terminal fragment, rBPI23, bind to and are cytotoxic for gram-negative bacteria both in vitro and ex vivo in plasma or whole blood. To function in vivo as an extracellular bactericidal agent, rBPI23 must act in the presence of the lipopolysaccharide-binding protein (LBP), which also binds to but has no reported cytotoxicity for gram-negative bacteria. LBP, which is present at 5 to 10 micrograms/ml in healthy humans and at much higher levels in septic pa