Directed evolution of the TALE N-terminal domain for recognition of all 5' bases.

PubMed

Lamb, Brian M; Mercer, Andrew C; Barbas, Carlos F

2013-11-01

Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5'-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5' T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5' T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes.

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

PubMed

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Systematic Evaluation of the Dependence of Deoxyribozyme Catalysis on Random Region Length

PubMed Central

Velez, Tania E.; Singh, Jaydeep; Xiao, Ying; Allen, Emily C.; Wong, On Yi; Chandra, Madhavaiah; Kwon, Sarah C.; Silverman, Scott K.

2012-01-01

Functional nucleic acids are DNA and RNA aptamers that bind targets, or they are deoxyribozymes and ribozymes that have catalytic activity. These functional DNA and RNA sequences can be identified from random-sequence pools by in vitro selection, which requires choosing the length of the random region. Shorter random regions allow more complete coverage of sequence space but may not permit the structural complexity necessary for binding or catalysis. In contrast, longer random regions are sampled incompletely but may allow adoption of more complicated structures that enable function. In this study, we systematically examined random region length (N20 through N60) for two particular deoxyribozyme catalytic activities, DNA cleavage and tyrosine-RNA nucleopeptide linkage formation. For both activities, we previously identified deoxyribozymes using only N40 regions. In the case of DNA cleavage, here we found that shorter N20 and N30 regions allowed robust catalytic function, either by DNA hydrolysis or by DNA deglycosylation and strand scission via β-elimination, whereas longer N50 and N60 regions did not lead to catalytically active DNA sequences. Follow-up selections with N20, N30, and N40 regions revealed an interesting interplay of metal ion cofactors and random region length. Separately, for Tyr-RNA linkage formation, N30 and N60 regions provided catalytically active sequences, whereas N20 was unsuccessful, and the N40 deoxyribozymes were functionally superior (in terms of rate and yield) to N30 and N60. Collectively, the results indicate that with future in vitro selection experiments for DNA and RNA catalysts, and by extension for aptamers, random region length should be an important experimental variable. PMID:23088677

Biochemical Characterization of a Mycobacteriophage Derived DnaB Ortholog Reveals New Insight into the Evolutionary Origin of DnaB Helicases

PubMed Central

Bhowmik, Priyanka; Das Gupta, Sujoy K.

2015-01-01

The bacterial replicative helicases known as DnaB are considered to be members of the RecA superfamily. All members of this superfamily, including DnaB, have a conserved C- terminal domain, known as the RecA core. We unearthed a series of mycobacteriophage encoded proteins in which the RecA core domain alone was present. These proteins were phylogenetically related to each other and formed a distinct clade within the RecA superfamily. A mycobacteriophage encoded protein, Wildcat Gp80 that roots deep in the DnaB family, was found to possess a core domain having significant sequence homology (Expect value < 10-5) with members of this novel cluster. This indicated that Wildcat Gp80, and by extrapolation, other members of the DnaB helicase family, may have evolved from a single domain RecA core polypeptide belonging to this novel group. Biochemical investigations confirmed that Wildcat Gp80 was a helicase. Surprisingly, our investigations also revealed that a thioredoxin tagged truncated version of the protein in which the N-terminal sequences were removed was fully capable of supporting helicase activity, although its ATP dependence properties were different. DnaB helicase activity is thus, primarily a function of the RecA core although additional N-terminal sequences may be necessary for fine tuning its activity and stability. Based on sequence comparison and biochemical studies we propose that DnaB helicases may have evolved from single domain RecA core proteins having helicase activities of their own, through the incorporation of additional N-terminal sequences. PMID:26237048

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

Development of Active DNA Control Technique for DNA Sequencer With a Solid-state Nanopore

NASA Astrophysics Data System (ADS)

Akahori, Rena; Harada, Kunio; Goto, Yusuke; Yanagi, Itaru; Yokoi, Takahide; Oura, Takeshi; Shibahara, Masashi; Takeda, Ken-Ichi

We have developed a technique that can control the arbitrary speeds of DNA passing through a solid-state nanopore of a DNA sequencer. For this active DNA control technique, we used a DNA-immobilized Si probe, larger than the membrane with a nanopore, and used a piezoelectric actuator and stepper motor to drive the probe. This probe enables a user to adjust the relative position between the nanopore and DNA immobilized on the probe without the need for precise lateral control. In this presentation, we demonstrate how DNA (block copolymer ([(dT)25-(dC)25-(dA)50]m)), immobilized on the probe, slid through a nanopore and was pulled out using the active DNA control technique. As the DNA-immobilized probe was being pulled out, we obtained various ion-current signal levels corresponding to the number of different nucleotides in a single strand of DNA.

Toehold-mediated strand displacement reaction-dependent fluorescent strategy for sensitive detection of uracil-DNA glycosylase activity.

PubMed

Wu, Yushu; Wang, Lei; Jiang, Wei

2017-03-15

Sensitive detection of uracil-DNA glycosylase (UDG) activity is beneficial for evaluating the repairing process of DNA lesions. Here, toehold-mediated strand displacement reaction (TSDR)-dependent fluorescent strategy was constructed for sensitive detection of UDG activity. A single-stranded DNA (ssDNA) probe with two uracil bases and a trigger sequence were designed. A hairpin probe with toehold domain was designed, and a reporter probe was also designed. Under the action of UDG, two uracil bases were removed from ssDNA probe, generating apurinic/apyrimidinic (AP) sites. Then, the AP sites could inhibit the TSDR between ssDNA probe and hairpin probe, leaving the trigger sequence in ssDNA probe still free. Subsequently, the trigger sequence was annealed with the reporter probe, initiating the polymerization and nicking amplification reaction. As a result, numerous G-quadruplex (G4) structures were formed, which could bind with N-methyl-mesoporphyrin IX (NMM) to generate enhanced fluorescent signal. In the absence of UDG, the ssDNA probe could hybridize with the toehold domain of the hairpin probe to initiate TSDR, blocking the trigger sequence, and then the subsequent amplification reaction would not occur. The proposed strategy was successfully implemented for detecting UDG activity with a detection limit of 2.7×10 -5 U/mL. Moreover, the strategy could distinguish UDG well from other interference enzymes. Furthermore, the strategy was also applied for detecting UDG activity in HeLa cells lysate with low effect of cellular components. These results indicated that the proposed strategy offered a promising tool for sensitive quantification of UDG activity in UDG-related function study and disease prognosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Bovine papilloma virus contains an activator of gene expression at the distal end of the early transcription unit.

PubMed Central

Lusky, M; Berg, L; Weiher, H; Botchan, M

1983-01-01

Bovine papilloma virus (BPV) contains a cis-acting DNA element which can enhance transcription of distal promoters. Utilizing both direct and indirect transient transfection assays, we showed that a 59-base-pair DNA sequence from the BPV genome could activate the simian virus 40 promoter from distances exceeding 2.5 kilobases and in an orientation-independent manner. In contrast to the promoter 5'-proximal localization of other known viral activators, this element was located immediately 3' to the early polyadenylation signal in the BPV genome. Deletion of these sequences from the BPV genome inactivated the transforming ability of BPV recombinant plasmids. Orientation-independent reinsertion of this 59-base-pair sequence, or alternatively of activator DNA sequences from simian virus 40 or polyoma virus, restored the transforming activity of the BPV recombinant plasmids. Furthermore, the stable transformation frequency of the herpes simplex virus type 1 thymidine kinase gene was enhanced when linked to restriction fragments of BPV DNA which included the defined activator element. This enhancement was orientation independent with respect to the thymidine kinase promoter. The enhancement also appeared to be unrelated to the establishment of the recombinant plasmids as episomes, since in transformed cells these sequences are found linked to high-molecular-weight DNA. We propose that the enhancement of stable transformation frequencies and the activation of transcription units are in this case alternate manifestations of the same biochemical events. Images PMID:6308425

A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies.

PubMed

Utturkar, Sagar M; Klingeman, Dawn M; Hurt, Richard A; Brown, Steven D

2017-01-01

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted. PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.

APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies

PubMed Central

Shlyakhtenko, Luda S.; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S.; Lyubchenko, Yuri L.

2015-01-01

APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA. PMID:26503602

Directed evolution of the TALE N-terminal domain for recognition of all 5′ bases

PubMed Central

Lamb, Brian M.; Mercer, Andrew C.; Barbas, Carlos F.

2013-01-01

Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5′-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5′ T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5′ T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes. PMID:23980031

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

PubMed

Malhotra, Sony; Sowdhamini, Ramanathan

2013-08-01

The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

Lesion bypass activity of DNA polymerase θ (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts.

PubMed

Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S

2011-01-21

DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.

DNA sequence-selective C8-linked pyrrolobenzodiazepine-heterocyclic polyamide conjugates show anti-tubercular-specific activities.

PubMed

Brucoli, Federico; Guzman, Juan D; Basher, Mohammad A; Evangelopoulos, Dimitrios; McMahon, Eleanor; Munshi, Tulika; McHugh, Timothy D; Fox, Keith R; Bhakta, Sanjib

2016-12-01

New chemotherapeutic agents with novel mechanisms of action are in urgent need to combat the tuberculosis pandemic. A library of 12 C8-linked pyrrolo[2,1-c][1,4]benzodiazepine (PBD)-heterocyclic polyamide conjugates (1-12) was evaluated for anti-tubercular activity and DNA sequence selectivity. The PBD conjugates were screened against slow-growing Mycobacterium bovis Bacillus Calmette-Guérin and M. tuberculosis H 37 Rv, and fast-growing Escherichia coli, Pseudomonas putida and Rhodococcus sp. RHA1 bacteria. DNase I footprinting and DNA thermal denaturation experiments were used to determine the molecules' DNA recognition properties. The PBD conjugates were highly selective for the mycobacterial strains and exhibited significant growth inhibitory activity against the pathogenic M. tuberculosis H 37 Rv, with compound 4 showing MIC values (MIC=0.08 mg l -1 ) similar to those of rifampin and isoniazid. DNase I footprinting results showed that the PBD conjugates with three heterocyclic moieties had enhanced sequence selectivity and produced larger footprints, with distinct cleavage patterns compared with the two-heterocyclic chain PBD conjugates. DNA melting experiments indicated a covalent binding of the PBD conjugates to two AT-rich DNA-duplexes containing either a central GGATCC or GTATAC sequence, and showed that the polyamide chains affect the interactions of the molecules with DNA. The PBD-C8 conjugates tested in this study have a remarkable anti-mycobacterial activity and can be further developed as DNA-targeted anti-tubercular drugs.

Overproduction, purification, and ATPase activity of the Escherichia coli RuvB protein involved in DNA repair.

PubMed Central

Iwasaki, H; Shiba, T; Makino, K; Nakata, A; Shinagawa, H

1989-01-01

The ruvA and ruvB genes of Escherichia coli constitute an operon which belongs to the SOS regulon. Genetic evidence suggests that the products of the ruv operon are involved in DNA repair and recombination. To begin biochemical characterization of these proteins, we developed a plasmid system that overproduced RuvB protein to 20% of total cell protein. Starting from the overproducing system, we purified RuvB protein. The purified RuvB protein behaved like a monomer in gel filtration chromatography and had an apparent relative molecular mass of 38 kilodaltons in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, which agrees with the value predicted from the DNA sequence. The amino acid sequence of the amino-terminal region of the purified protein was analyzed, and the sequence agreed with the one deduced from the DNA sequence. Since the deduced sequence of RuvB protein contained the consensus sequence for ATP-binding proteins, we examined the ATP-binding and ATPase activities of the purified RuvB protein. RuvB protein had a stronger affinity to ADP than to ATP and weak ATPase activity. The results suggest that the weak ATPase activity of RuvB protein is at least partly due to end product inhibition by ADP. Images PMID:2529252

Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

PubMed Central

Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

2014-01-01

The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

Flow cytometry for enrichment and titration in massively parallel DNA sequencing

PubMed Central

Sandberg, Julia; Ståhl, Patrik L.; Ahmadian, Afshin; Bjursell, Magnus K.; Lundeberg, Joakim

2009-01-01

Massively parallel DNA sequencing is revolutionizing genomics research throughout the life sciences. However, the reagent costs and labor requirements in current sequencing protocols are still substantial, although improvements are continuously being made. Here, we demonstrate an effective alternative to existing sample titration protocols for the Roche/454 system using Fluorescence Activated Cell Sorting (FACS) technology to determine the optimal DNA-to-bead ratio prior to large-scale sequencing. Our method, which eliminates the need for the costly pilot sequencing of samples during titration is capable of rapidly providing accurate DNA-to-bead ratios that are not biased by the quantification and sedimentation steps included in current protocols. Moreover, we demonstrate that FACS sorting can be readily used to highly enrich fractions of beads carrying template DNA, with near total elimination of empty beads and no downstream sacrifice of DNA sequencing quality. Automated enrichment by FACS is a simple approach to obtain pure samples for bead-based sequencing systems, and offers an efficient, low-cost alternative to current enrichment protocols. PMID:19304748

Evolution of rDNA in Nicotiana Allopolyploids: A Potential Link between rDNA Homogenization and Epigenetics

PubMed Central

Kovarik, Ales; Dadejova, Martina; Lim, Yoong K.; Chase, Mark W.; Clarkson, James J.; Knapp, Sandra; Leitch, Andrew R.

2008-01-01

Background The evolution and biology of rDNA have interested biologists for many years, in part, because of two intriguing processes: (1) nucleolar dominance and (2) sequence homogenization. We review patterns of evolution in rDNA in the angiosperm genus Nicotiana to determine consequences of allopolyploidy on these processes. Scope Allopolyploid species of Nicotiana are ideal for studying rDNA evolution because phylogenetic reconstruction of DNA sequences has revealed patterns of species divergence and their parents. From these studies we also know that polyploids formed over widely different timeframes (thousands to millions of years), enabling comparative and temporal studies of rDNA structure, activity and chromosomal distribution. In addition studies on synthetic polyploids enable the consequences of de novo polyploidy on rDNA activity to be determined. Conclusions We propose that rDNA epigenetic expression patterns established even in F1 hybrids have a material influence on the likely patterns of divergence of rDNA. It is the active rDNA units that are vulnerable to homogenization, which probably acts to reduce mutational load across the active array. Those rDNA units that are epigenetically silenced may be less vulnerable to sequence homogenization. Selection cannot act on these silenced genes, and they are likely to accumulate mutations and eventually be eliminated from the genome. It is likely that whole silenced arrays will be deleted in polyploids of 1 million years of age and older. PMID:18310159

A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Utturkar, Sagar M.; Klingeman, Dawn M.; Hurt, Jr., Richard A.

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted.more » PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Furthermore, our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.« less

A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies

DOE PAGES

Utturkar, Sagar M.; Klingeman, Dawn M.; Hurt, Jr., Richard A.; ...

2017-07-18

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted.more » PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Furthermore, our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.« less

A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies

PubMed Central

Utturkar, Sagar M.; Klingeman, Dawn M.; Hurt, Richard A.; Brown, Steven D.

2017-01-01

This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted. PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences. PMID:28769883

Population genetics and molecular evolution of DNA sequences in transposable elements. I. A simulation framework.

PubMed

Kijima, T E; Innan, Hideki

2013-11-01

A population genetic simulation framework is developed to understand the behavior and molecular evolution of DNA sequences of transposable elements. Our model incorporates random transposition and excision of transposable element (TE) copies, two modes of selection against TEs, and degeneration of transpositional activity by point mutations. We first investigated the relationships between the behavior of the copy number of TEs and these parameters. Our results show that when selection is weak, the genome can maintain a relatively large number of TEs, but most of them are less active. In contrast, with strong selection, the genome can maintain only a limited number of TEs but the proportion of active copies is large. In such a case, there could be substantial fluctuations of the copy number over generations. We also explored how DNA sequences of TEs evolve through the simulations. In general, active copies form clusters around the original sequence, while less active copies have long branches specific to themselves, exhibiting a star-shaped phylogeny. It is demonstrated that the phylogeny of TE sequences could be informative to understand the dynamics of TE evolution.

The role of DNA repair in herpesvirus pathogenesis.

PubMed

Brown, Jay C

2014-10-01

In cells latently infected with a herpesvirus, the viral DNA is present in the cell nucleus, but it is not extensively replicated or transcribed. In this suppressed state the virus DNA is vulnerable to mutagenic events that affect the host cell and have the potential to destroy the virus' genetic integrity. Despite the potential for genetic damage, however, herpesvirus sequences are well conserved after reactivation from latency. To account for this apparent paradox, I have tested the idea that host cell-encoded mechanisms of DNA repair are able to control genetic damage to latent herpesviruses. Studies were focused on homologous recombination-dependent DNA repair (HR). Methods of DNA sequence analysis were employed to scan herpesvirus genomes for DNA features able to activate HR. Analyses were carried out with a total of 39 herpesvirus DNA sequences, a group that included viruses from the alpha-, beta- and gamma-subfamilies. The results showed that all 39 genome sequences were enriched in two or more of the eight recombination-initiating features examined. The results were interpreted to indicate that HR can stabilize latent herpesvirus genomes. The results also showed, unexpectedly, that repair-initiating DNA features differed in alpha- compared to gamma-herpesviruses. Whereas inverted and tandem repeats predominated in alpha-herpesviruses, gamma-herpesviruses were enriched in short, GC-rich initiation sequences such as CCCAG and depleted in repeats. In alpha-herpesviruses, repair-initiating repeat sequences were found to be concentrated in a specific region (the S segment) of the genome while repair-initiating short sequences were distributed more uniformly in gamma-herpesviruses. The results suggest that repair pathways are activated differently in alpha- compared to gamma-herpesviruses. Copyright © 2014. Published by Elsevier Inc.

An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

PubMed

Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

1995-04-11

SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

[Increased content of nucleotide sequences in transcriptionally active DNA and poly(A)+-mRNA of the rat liver and a rise in its translation activity as affected by inducers].

PubMed

Dashkevich, V S; Vishnivetskiĭ, S N; Skobel'tsina, L M; Luk'ianchikova, N L; Kaledin, V I

1986-12-01

Cortisol and 3'-methyl-4-dimethyl-amino-azobenzene induce an increase in the content of repeated sequences (RS) in transcriptionally active (TA) DNA, while the content of respective RS in potentially active DNA fractions enriched with regulatory regions of the genome decreases. RS content in induced poly A+-mRNA also rises, as determined by the nature of hybridization of respective c DNA with total DNA. The translation of induced poly A+-mRNA rises essentially, with the qualitative distinctions in in vitro synthesized protein product spectrum being absent. Inducible RS with unstable chromatine conformation are thought to provide a universal system of rapid response of the genetic apparatus to extreme situations, serving as transcription intensifiers in TA DNA and as translation intensifiers in induced poly A+-mRNA.

In vitro excision of adeno-associated virus DNA from recombinant plasmids: Isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gottlieb, J.; Muzyczka, N.

1988-06-01

When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less

Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

PubMed

Mukherjee, Anirban; Vasquez, Karen M

2011-08-01

Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Fusion of GFP to the M.EcoKI DNA methyltransferase produces a new probe of Type I DNA restriction and modification enzymes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.

2010-07-23

Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerstermore » resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.« less

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

Distinct DNA methylation patterns associated with active and inactive centromeres of the maize B chromosome.

PubMed

Koo, Dal-Hoe; Han, Fangpu; Birchler, James A; Jiang, Jiming

2011-06-01

Centromeres are determined by poorly understood epigenetic mechanisms. Centromeres can be activated or inactivated without changing the underlying DNA sequences. However, virtually nothing is known about the epigenetic transition of a centromere from an active to an inactive state because of the lack of examples of the same centromere exhibiting alternative forms and being distinguishable from other centromeres. The centromere of the supernumerary B chromosome of maize provides such an opportunity because its functional core can be cytologically tracked, and an inactive version of the centromere is available. We developed a DNA fiber-based technique that can be used to assess the levels of cytosine methylation associated with repetitive DNA sequences. We report that DNA sequences in the normal B centromere exhibit hypomethylation. This methylation pattern is not affected by the genetic background or structural rearrangement of the B chromosome, but is slightly changed when the B chromosome is transferred to oat as an addition chromosome. In contrast, an inactive version of this same centromere exhibits hypermethylation, indicating that the inactive centromere was modified into a different epigenetic state at the DNA level.

Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

DNA sequence templates adjacent nucleosome and ORC sites at gene amplification origins in Drosophila

PubMed Central

Liu, Jun; Zimmer, Kurt; Rusch, Douglas B.; Paranjape, Neha; Podicheti, Ram; Tang, Haixu; Calvi, Brian R.

2015-01-01

Eukaryotic origins of DNA replication are bound by the origin recognition complex (ORC), which scaffolds assembly of a pre-replicative complex (pre-RC) that is then activated to initiate replication. Both pre-RC assembly and activation are strongly influenced by developmental changes to the epigenome, but molecular mechanisms remain incompletely defined. We have been examining the activation of origins responsible for developmental gene amplification in Drosophila. At a specific time in oogenesis, somatic follicle cells transition from genomic replication to a locus-specific replication from six amplicon origins. Previous evidence indicated that these amplicon origins are activated by nucleosome acetylation, but how this affects origin chromatin is unknown. Here, we examine nucleosome position in follicle cells using micrococcal nuclease digestion with Ilumina sequencing. The results indicate that ORC binding sites and other essential origin sequences are nucleosome-depleted regions (NDRs). Nucleosome position at the amplicons was highly similar among developmental stages during which ORC is or is not bound, indicating that being an NDR is not sufficient to specify ORC binding. Importantly, the data suggest that nucleosomes and ORC have opposite preferences for DNA sequence and structure. We propose that nucleosome hyperacetylation promotes pre-RC assembly onto adjacent DNA sequences that are disfavored by nucleosomes but favored by ORC. PMID:26227968

NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

NASA Astrophysics Data System (ADS)

Smith, Jarrod Anson

2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

Extreme-Depth Re-sequencing of Mitochondrial DNA Finds No Evidence of Paternal Transmission in Humans.

PubMed

Pyle, Angela; Hudson, Gavin; Wilson, Ian J; Coxhead, Jonathan; Smertenko, Tania; Herbert, Mary; Santibanez-Koref, Mauro; Chinnery, Patrick F

2015-05-01

Recent reports have questioned the accepted dogma that mammalian mitochondrial DNA (mtDNA) is strictly maternally inherited. In humans, the argument hinges on detecting a signature of inter-molecular recombination in mtDNA sequences sampled at the population level, inferring a paternal source for the mixed haplotypes. However, interpreting these data is fraught with difficulty, and direct experimental evidence is lacking. Using extreme-high depth mtDNA re-sequencing up to ~1.2 million-fold coverage, we find no evidence that paternal mtDNA haplotypes are transmitted to offspring in humans, thus excluding a simple dilution mechanism for uniparental transmission of mtDNA present in all healthy individuals. Our findings indicate that an active mechanism eliminates paternal mtDNA which likely acts at the molecular level.

Extreme-Depth Re-sequencing of Mitochondrial DNA Finds No Evidence of Paternal Transmission in Humans

PubMed Central

Pyle, Angela; Hudson, Gavin; Wilson, Ian J.; Coxhead, Jonathan; Smertenko, Tania; Herbert, Mary; Santibanez-Koref, Mauro; Chinnery, Patrick F.

2015-01-01

Recent reports have questioned the accepted dogma that mammalian mitochondrial DNA (mtDNA) is strictly maternally inherited. In humans, the argument hinges on detecting a signature of inter-molecular recombination in mtDNA sequences sampled at the population level, inferring a paternal source for the mixed haplotypes. However, interpreting these data is fraught with difficulty, and direct experimental evidence is lacking. Using extreme-high depth mtDNA re-sequencing up to ~1.2 million-fold coverage, we find no evidence that paternal mtDNA haplotypes are transmitted to offspring in humans, thus excluding a simple dilution mechanism for uniparental transmission of mtDNA present in all healthy individuals. Our findings indicate that an active mechanism eliminates paternal mtDNA which likely acts at the molecular level. PMID:25973765

Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq)

PubMed Central

Langley, Alexander R.; Gräf, Stefan; Smith, James C.; Krude, Torsten

2016-01-01

Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. PMID:27587586

Genome-wide identification and characterisation of human DNA replication origins by initiation site sequencing (ini-seq).

PubMed

Langley, Alexander R; Gräf, Stefan; Smith, James C; Krude, Torsten

2016-12-01

Next-generation sequencing has enabled the genome-wide identification of human DNA replication origins. However, different approaches to mapping replication origins, namely (i) sequencing isolated small nascent DNA strands (SNS-seq); (ii) sequencing replication bubbles (bubble-seq) and (iii) sequencing Okazaki fragments (OK-seq), show only limited concordance. To address this controversy, we describe here an independent high-resolution origin mapping technique that we call initiation site sequencing (ini-seq). In this approach, newly replicated DNA is directly labelled with digoxigenin-dUTP near the sites of its initiation in a cell-free system. The labelled DNA is then immunoprecipitated and genomic locations are determined by DNA sequencing. Using this technique we identify >25,000 discrete origin sites at sub-kilobase resolution on the human genome, with high concordance between biological replicates. Most activated origins identified by ini-seq are found at transcriptional start sites and contain G-quadruplex (G4) motifs. They tend to cluster in early-replicating domains, providing a correlation between early replication timing and local density of activated origins. Origins identified by ini-seq show highest concordance with sites identified by SNS-seq, followed by OK-seq and bubble-seq. Furthermore, germline origins identified by positive nucleotide distribution skew jumps overlap with origins identified by ini-seq and OK-seq more frequently and more specifically than do sites identified by either SNS-seq or bubble-seq. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA Music.

ERIC Educational Resources Information Center

Miner, Carol; della Villa, Paula

1997-01-01

Describes an activity in which students reverse-translate proteins from their amino acid sequences back to their DNA sequences then assign musical notes to represent the adenine, guanine, cytosine, and thymine bases. Data is obtained from the National Institutes of Health (NIH) on the Internet. (DDR)

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Recognition of Local DNA Structures by p53 Protein

PubMed Central

Brázda, Václav; Coufal, Jan

2017-01-01

p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

Characterization of a periplasmic S1-like nuclease coded by the Mesorhizobium loti symbiosis island

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pimkin, Maxim; Miller, C. Glenn; Blakesley, Lauryn

DNA sequences encoding hypothetical proteins homologous to S1 nuclease from Aspergillus oryzae are found in many organisms including fungi, plants, pathogenic bacteria, and eukaryotic parasites. One of these is the M1 nuclease of Mesorhizobium loti which we demonstrate herein to be an enzymatically active, soluble, and stable S1 homolog that lacks the extensive mannosyl-glycosylation found in eukaryotic S1 nuclease homologs. We have expressed the cloned M1 protein in M. loti and purified recombinant native M1 to near homogeneity and have also isolated a homogeneous M1 carboxy-terminal hexahistidine tag fusion protein. Mass spectrometry and N-terminal Edman degradation sequencing confirmed the proteinmore » identity. The enzymatic properties of the purified M1 nuclease are similar to those of S1. At acidic pH M1 is 25 times more active on single-stranded DNA than on double-stranded DNA and 3 times more active on single-stranded DNA than on single-stranded RNA. At neutral pH the RNase activity of M1 exceeds the DNase activity. M1 nicks supercoiled RF-I plasmid DNA and rapidly cuts the phosphodiester bond across from the nick in the resultant relaxed RF-II plasmid DNA. Therefore, M1 represents an active bacterial S1 homolog in spite of great sequence divergence. The biochemical characterization of M1 nuclease supports our sequence alignment that reveals the minimal 21 amino acid residues that are necessarily conserved for the structure and functions of this enzyme family. The ability of M1 to degrade RNA at neutral pH implies previously unappreciated roles of these nucleases in biological systems.« less

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Presence of DNA methyltransferase activity and CpC methylation in Drosophila melanogaster.

PubMed

Panikar, Chitra S; Rajpathak, Shriram N; Abhyankar, Varada; Deshmukh, Saniya; Deobagkar, Deepti D

2015-12-01

Drosophila melanogaster lacks DNMT1/DNMT3 based methylation machinery. Despite recent reports confirming the presence of low DNA methylation in Drosophila; little is known about the methyltransferase. Therefore, in this study, we have aimed to investigate the possible functioning of DNA methyltransferase in Drosophila. The 14 K oligo microarray slide was incubated with native cell extract from adult Drosophila to check the presence of the methyltransferase activity. After incubation under appropriate conditions, the methylated oligo sequences were identified by the binding of anti 5-methylcytosine monoclonal antibody. The antibody bound to the methylated oligos was detected using Cy3 labeled secondary antibody. Methylation sensitive restriction enzyme mediated PCR was used to assess the methylation at a few selected loci identified on the array. It could be seen that a few of the total oligos got methylated under the assay conditions. Analysis of methylated oligo sequences provides evidence for the presence of de novo methyltransferase activity and allows identification of its sequence specificity in adult Drosophila. With the help of methylation sensitive enzymes we could detect presence of CpC methylation in the selected genomic regions. This study reports presence of an active DNA methyltransferase in adult Drosophila, which exhibits sequence specificity confirmed by presence of asymmetric methylation at corresponding sites in the genomic DNA. It also provides an innovative approach to investigate methylation specificity of a native methyltransferase.

New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

PubMed

Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

2015-03-15

This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

The Arabidopsis At1g30680 gene encodes a homologue to the phage T7 gp4 protein that has both DNA primase and DNA helicase activities.

PubMed

Diray-Arce, Joann; Liu, Bin; Cupp, John D; Hunt, Travis; Nielsen, Brent L

2013-03-04

The Arabidopsis thaliana genome encodes a homologue of the full-length bacteriophage T7 gp4 protein, which is also homologous to the eukaryotic Twinkle protein. While the phage protein has both DNA primase and DNA helicase activities, in animal cells Twinkle is localized to mitochondria and has only DNA helicase activity due to sequence changes in the DNA primase domain. However, Arabidopsis and other plant Twinkle homologues retain sequence homology for both functional domains of the phage protein. The Arabidopsis Twinkle homologue has been shown by others to be dual targeted to mitochondria and chloroplasts. To determine the functional activity of the Arabidopsis protein we obtained the gene for the full-length Arabidopsis protein and expressed it in bacteria. The purified protein was shown to have both DNA primase and DNA helicase activities. Western blot and qRT-PCR analysis indicated that the Arabidopsis gene is expressed most abundantly in young leaves and shoot apex tissue, as expected if this protein plays a role in organelle DNA replication. This expression is closely correlated with the expression of organelle-localized DNA polymerase in the same tissues. Homologues from other plant species show close similarity by phylogenetic analysis. The results presented here indicate that the Arabidopsis phage T7 gp4/Twinkle homologue has both DNA primase and DNA helicase activities and may provide these functions for organelle DNA replication.

Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

PubMed

Lam, Kathy N; Charles, Trevor C

2015-01-01

Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

Conserved Sequences at the Origin of Adenovirus DNA Replication

PubMed Central

Stillman, Bruce W.; Topp, William C.; Engler, Jeffrey A.

1982-01-01

The origin of adenovirus DNA replication lies within an inverted sequence repetition at either end of the linear, double-stranded viral DNA. Initiation of DNA replication is primed by a deoxynucleoside that is covalently linked to a protein, which remains bound to the newly synthesized DNA. We demonstrate that virion-derived DNA-protein complexes from five human adenovirus serological subgroups (A to E) can act as a template for both the initiation and the elongation of DNA replication in vitro, using nuclear extracts from adenovirus type 2 (Ad2)-infected HeLa cells. The heterologous template DNA-protein complexes were not as active as the homologous Ad2 DNA, most probably due to inefficient initiation by Ad2 replication factors. In an attempt to identify common features which may permit this replication, we have also sequenced the inverted terminal repeated DNA from human adenovirus serotypes Ad4 (group E), Ad9 and Ad10 (group D), and Ad31 (group A), and we have compared these to previously determined sequences from Ad2 and Ad5 (group C), Ad7 (group B), and Ad12 and Ad18 (group A) DNA. In all cases, the sequence around the origin of DNA replication can be divided into two structural domains: a proximal A · T-rich region which is partially conserved among these serotypes, and a distal G · C-rich region which is less well conserved. The G · C-rich region contains sequences similar to sequences present in papovavirus replication origins. The two domains may reflect a dual mechanism for initiation of DNA replication: adenovirus-specific protein priming of replication, and subsequent utilization of this primer by host replication factors for completion of DNA synthesis. Images PMID:7143575

Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae

PubMed Central

Chatre, Laurent; Ricchetti, Miria

2011-01-01

The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151

Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

PubMed

Chatre, Laurent; Ricchetti, Miria

2011-03-08

The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

PubMed

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

Mapping the binding site of aflatoxin B/sub 1/ in DNA: systematic analysis of the reactivity of aflatoxin B/sub 1/ with guanines in different DNA sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benasutti, M.; Ejadi, S.; Whitlow, M.D.

The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines inmore » some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.« less

Synthesis and application of a triazene-ferrocene modifier for immobilization and characterization of oligonucleotides at electrodes.

PubMed

Hansen, Majken N; Farjami, Elaheh; Kristiansen, Martin; Clima, Lilia; Pedersen, Steen Uttrup; Daasbjerg, Kim; Ferapontova, Elena E; Gothelf, Kurt V

2010-04-16

A new DNA modifier containing triazene, ferrocene, and activated ester functionalities was synthesized and applied for electrochemical grafting and characterization of DNA at glassy carbon (GC) and gold electrodes. The modifier was synthesized from ferrocenecarboxylic acid by attaching a phenyltriazene derivative to one of the ferrocene Cp rings, while the other Cp ring containing the carboxylic acid was converted to an activated ester. The modifier was conjugated to an amine-modified DNA sequence. For immobilization of the conjugate at Au or GC electrodes, the triazene was activated by dimethyl sulfate for release of the diazonium salt. The salt was reductively converted to the aryl radical which was readily immobilized at the surface. DNA grafted onto electrodes exhibited remarkable hybridization properties, as detected through a reversible shift in the redox potential of the Fc redox label upon repeated hybridization/denaturation procedures with a complementary target DNA sequence. By using a methylene blue (MB) labeled target DNA sequence the hybridization could also be followed through the MB redox potential. Electrochemical studies demonstrated that grafting through the triazene modifier can successfully compete with existing protocols for DNA immobilization through the commonly used alkanethiol linkers and diazonium salts. Furthermore, the triazene modifier provides a practical one-step immobilization procedure.

Negatively supercoiled simian virus 40 DNA contains Z-DNA segments within transcriptional enhancer sequences

NASA Technical Reports Server (NTRS)

Nordheim, A.; Rich, A.

1983-01-01

Three 8-base pair (bp) segments of alternating purine-pyrimidine from the simian virus 40 enhancer region form Z-DNA on negative supercoiling; minichromosome DNase I-hypersensitive sites determined by others bracket these three segments. A survey of transcriptional enhancer sequences reveals a pattern of potential Z-DNA-forming regions which occur in pairs 50-80 bp apart. This may influence local chromatin structure and may be related to transcriptional activation.

Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

PubMed Central

Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

2005-01-01

Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

A simple method for semi-random DNA amplicon fragmentation using the methylation-dependent restriction enzyme MspJI.

PubMed

Shinozuka, Hiroshi; Cogan, Noel O I; Shinozuka, Maiko; Marshall, Alexis; Kay, Pippa; Lin, Yi-Han; Spangenberg, German C; Forster, John W

2015-04-11

Fragmentation at random nucleotide locations is an essential process for preparation of DNA libraries to be used on massively parallel short-read DNA sequencing platforms. Although instruments for physical shearing, such as the Covaris S2 focused-ultrasonicator system, and products for enzymatic shearing, such as the Nextera technology and NEBNext dsDNA Fragmentase kit, are commercially available, a simple and inexpensive method is desirable for high-throughput sequencing library preparation. MspJI is a recently characterised restriction enzyme which recognises the sequence motif CNNR (where R = G or A) when the first base is modified to 5-methylcytosine or 5-hydroxymethylcytosine. A semi-random enzymatic DNA amplicon fragmentation method was developed based on the unique cleavage properties of MspJI. In this method, random incorporation of 5-methyl-2'-deoxycytidine-5'-triphosphate is achieved through DNA amplification with DNA polymerase, followed by DNA digestion with MspJI. Due to the recognition sequence of the enzyme, DNA amplicons are fragmented in a relatively sequence-independent manner. The size range of the resulting fragments was capable of control through optimisation of 5-methyl-2'-deoxycytidine-5'-triphosphate concentration in the reaction mixture. A library suitable for sequencing using the Illumina MiSeq platform was prepared and processed using the proposed method. Alignment of generated short reads to a reference sequence demonstrated a relatively high level of random fragmentation. The proposed method may be performed with standard laboratory equipment. Although the uniformity of coverage was slightly inferior to the Covaris physical shearing procedure, due to efficiencies of cost and labour, the method may be more suitable than existing approaches for implementation in large-scale sequencing activities, such as bacterial artificial chromosome (BAC)-based genome sequence assembly, pan-genomic studies and locus-targeted genotyping-by-sequencing.

[Structural organization of 5S ribosomal DNA of Rosa rugosa].

PubMed

Tynkevych, Iu O; Volkov, R A

2014-01-01

In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

APE1 incision activity at abasic sites in tandem repeat sequences.

PubMed

Li, Mengxia; Völker, Jens; Breslauer, Kenneth J; Wilson, David M

2014-05-29

Repetitive DNA sequences, such as those present in microsatellites and minisatellites, telomeres, and trinucleotide repeats (linked to fragile X syndrome, Huntington disease, etc.), account for nearly 30% of the human genome. These domains exhibit enhanced susceptibility to oxidative attack to yield base modifications, strand breaks, and abasic sites; have a propensity to adopt non-canonical DNA forms modulated by the positions of the lesions; and, when not properly processed, can contribute to genome instability that underlies aging and disease development. Knowledge on the repair efficiencies of DNA damage within such repetitive sequences is therefore crucial for understanding the impact of such domains on genomic integrity. In the present study, using strategically designed oligonucleotide substrates, we determined the ability of human apurinic/apyrimidinic endonuclease 1 (APE1) to cleave at apurinic/apyrimidinic (AP) sites in a collection of tandem DNA repeat landscapes involving telomeric and CAG/CTG repeat sequences. Our studies reveal the differential influence of domain sequence, conformation, and AP site location/relative positioning on the efficiency of APE1 binding and strand incision. Intriguingly, our data demonstrate that APE1 endonuclease efficiency correlates with the thermodynamic stability of the DNA substrate. We discuss how these results have both predictive and mechanistic consequences for understanding the success and failure of repair protein activity associated with such oxidatively sensitive, conformationally plastic/dynamic repetitive DNA domains. Published by Elsevier Ltd.

Identification of genes in anonymous DNA sequences. Final report: Report period, 15 April 1993--15 April 1994

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fields, C.A.

1994-09-01

This Report concludes the DOE Human Genome Program project, ``Identification of Genes in Anonymous DNA Sequence.`` The central goals of this project have been (1) understanding the problem of identifying genes in anonymous sequences, and (2) development of tools, primarily the automated identification system gm, for identifying genes. The activities supported under the previous award are summarized here to provide a single complete report on the activities supported as part of the project from its inception to its completion.

Identification of Active Bacterial Communities in Drinking Water Using 16S rRNA-Based Sequence Analyses

EPA Science Inventory

DNA-based methods have considerably increased our understanding of the bacterial diversity of water distribution systems (WDS). However, as DNA may persist after cell death, the use of DNA-based methods cannot be used to describe metabolically-active microbes. In contrast, intra...

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

PubMed

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

Cloning of a coconut endosperm cDNA encoding a 1-acyl-sn-glycerol-3-phosphate acyltransferase that accepts medium-chain-length substrates.

PubMed Central

Knutzon, D S; Lardizabal, K D; Nelsen, J S; Bleibaum, J L; Davies, H M; Metz, J G

1995-01-01

Immature coconut (Cocos nucifera) endosperm contains a 1-acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT) activity that shows a preference for medium-chain-length fatty acyl-coenzyme A substrates (H.M. Davies, D.J. Hawkins, J.S. Nelsen [1995] Phytochemistry 39:989-996). Beginning with solubilized membrane preparations, we have used chromatographic separations to identify a polypeptide with an apparent molecular mass of 29 kD, whose presence in various column fractions correlates with the acyltransferase activity detected in those same fractions. Amino acid sequence data obtained from several peptides generated from this protein were used to isolate a full-length clone from a coconut endosperm cDNA library. Clone pCGN5503 contains a 1325-bp cDNA insert with an open reading frame encoding a 308-amino acid protein with a calculated molecular mass of 34.8 kD. Comparison of the deduced amino acid sequence of pCGN5503 to sequences in the data banks revealed significant homology to other putative LPAAT sequences. Expression of the coconut cDNA in Escherichia coli conferred upon those cells a novel LPAAT activity whose substrate activity profile matched that of the coconut enzyme. PMID:8552723

Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Cidlowski, J.A.

1989-03-07

Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins priormore » to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.« less

Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

PubMed

Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

2011-11-04

A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of DNA-binding proteins by combining auto-cross covariance transformation and ensemble learning.

PubMed

Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan

2016-04-20

DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

Biomimetic Artificial Epigenetic Code for Targeted Acetylation of Histones.

PubMed

Taniguchi, Junichi; Feng, Yihong; Pandian, Ganesh N; Hashiya, Fumitaka; Hidaka, Takuya; Hashiya, Kaori; Park, Soyoung; Bando, Toshikazu; Ito, Shinji; Sugiyama, Hiroshi

2018-06-13

While the central role of locus-specific acetylation of histone proteins in eukaryotic gene expression is well established, the availability of designer tools to regulate acetylation at particular nucleosome sites remains limited. Here, we develop a unique strategy to introduce acetylation by constructing a bifunctional molecule designated Bi-PIP. Bi-PIP has a P300/CBP-selective bromodomain inhibitor (Bi) as a P300/CBP recruiter and a pyrrole-imidazole polyamide (PIP) as a sequence-selective DNA binder. Biochemical assays verified that Bi-PIPs recruit P300 to the nucleosomes having their target DNA sequences and extensively accelerate acetylation. Bi-PIPs also activated transcription of genes that have corresponding cognate DNA sequences inside living cells. Our results demonstrate that Bi-PIPs could act as a synthetic programmable histone code of acetylation, which emulates the bromodomain-mediated natural propagation system of histone acetylation to activate gene expression in a sequence-selective manner.

The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew

Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less

Functional interrogation of non-coding DNA through CRISPR genome editing

PubMed Central

Canver, Matthew C.; Bauer, Daniel E.; Orkin, Stuart H.

2017-01-01

Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. PMID:28288828

DNA methylation polymorphism in a set of elite rice cultivars and its possible contribution to inter-cultivar differential gene expression.

PubMed

Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao

2004-01-01

RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.

Sequence-dependent nucleosome sliding in rotation-coupled and uncoupled modes revealed by molecular simulations

PubMed Central

Tan, Cheng; Takada, Shoji

2017-01-01

While nucleosome positioning on eukaryotic genome play important roles for genetic regulation, molecular mechanisms of nucleosome positioning and sliding along DNA are not well understood. Here we investigated thermally-activated spontaneous nucleosome sliding mechanisms developing and applying a coarse-grained molecular simulation method that incorporates both long-range electrostatic and short-range hydrogen-bond interactions between histone octamer and DNA. The simulations revealed two distinct sliding modes depending on the nucleosomal DNA sequence. A uniform DNA sequence showed frequent sliding with one base pair step in a rotation-coupled manner, akin to screw-like motions. On the contrary, a strong positioning sequence, the so-called 601 sequence, exhibits rare, abrupt transitions of five and ten base pair steps without rotation. Moreover, we evaluated the importance of hydrogen bond interactions on the sliding mode, finding that strong and weak bonds favor respectively the rotation-coupled and -uncoupled sliding movements. PMID:29194442

Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome.

PubMed

Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D

2014-05-27

We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Effects of Replication and Transcription on DNA Structure-Related Genetic Instability.

PubMed

Wang, Guliang; Vasquez, Karen M

2017-01-05

Many repetitive sequences in the human genome can adopt conformations that differ from the canonical B-DNA double helix (i.e., non-B DNA), and can impact important biological processes such as DNA replication, transcription, recombination, telomere maintenance, viral integration, transposome activation, DNA damage and repair. Thus, non-B DNA-forming sequences have been implicated in genetic instability and disease development. In this article, we discuss the interactions of non-B DNA with the replication and/or transcription machinery, particularly in disease states (e.g., tumors) that can lead to an abnormal cellular environment, and how such interactions may alter DNA replication and transcription, leading to potential conflicts at non-B DNA regions, and eventually result in genetic stability and human disease.

Effects of Replication and Transcription on DNA Structure-Related Genetic Instability

PubMed Central

Wang, Guliang; Vasquez, Karen M.

2017-01-01

Many repetitive sequences in the human genome can adopt conformations that differ from the canonical B-DNA double helix (i.e., non-B DNA), and can impact important biological processes such as DNA replication, transcription, recombination, telomere maintenance, viral integration, transposome activation, DNA damage and repair. Thus, non-B DNA-forming sequences have been implicated in genetic instability and disease development. In this article, we discuss the interactions of non-B DNA with the replication and/or transcription machinery, particularly in disease states (e.g., tumors) that can lead to an abnormal cellular environment, and how such interactions may alter DNA replication and transcription, leading to potential conflicts at non-B DNA regions, and eventually result in genetic stability and human disease. PMID:28067787

Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.

PubMed

Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A

2018-05-14

The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

Properties of some monkey DNA sequences obtained by a procedure that enriches for DNA replication origins.

PubMed

Zannis-Hadjopoulos, M; Kaufmann, G; Wang, S S; Lechner, R L; Karawya, E; Hesse, J; Martin, R G

1985-07-01

Twelve clones of monkey DNA obtained by a procedure that enriches 10(3)- to 10(4)-fold for nascent sequences activated early in S phase (G. Kaufmann, M. Zannis-Hadjopoulos, and R. G. Martin, Mol. Cell. Biol. 5:721-727, 1985) have been examined. Only 2 of the 12 ors sequences (origin-enriched sequences) are unique (ors1 and ors8). Three contain the highly reiterated Alu family (ors3, ors9, and ors11). One contains the highly reiterated alpha-satellite family (ors12), but none contain the Kpn family. Those remaining contain middle repetitive sequences. Two examples of the same middle repetitive sequence were found (ors2 and ors6). Three of the middle repetitive sequences (the ors2-ors6 pair, ors5, and ors10) are moderately dispersed; one (ors4) is highly dispersed. The last, ors7, has been mapped to the bona fide replication origin of the D loop of mitochondrial DNA. Of the nine ors sequences tested, half possess snapback (intrachain reannealing) properties.

Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

1987-01-01

The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

NASA Astrophysics Data System (ADS)

Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

2005-09-01

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA.

PubMed

Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J

2005-09-22

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Switching bonds in a DNA gel: an all-DNA vitrimer.

PubMed

Romano, Flavio; Sciortino, Francesco

2015-02-20

We design an all-DNA system that behaves like vitrimers, innovative plastics with self-healing and stress-releasing properties. The DNA sequences are engineered to self-assemble first into tetra- and bifunctional units which, upon further cooling, bind to each other forming a fully bonded network gel. An innovative design of the binding regions of the DNA sequences, exploiting a double toehold-mediated strand displacement, generates a network gel which is able to reshuffle its bonds, retaining at all times full bonding. As in vitrimers, the rate of bond switching can be controlled via a thermally activated catalyst, which in the present design is very short DNA strands.

Thermodynamics-Based Models of Transcriptional Regulation by Enhancers: The Roles of Synergistic Activation, Cooperative Binding and Short-Range Repression

PubMed Central

He, Xin; Samee, Md. Abul Hassan; Blatti, Charles; Sinha, Saurabh

2010-01-01

Quantitative models of cis-regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled, or heuristic approximations of the underlying regulatory mechanisms. We have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence, as a function of transcription factor concentrations and their DNA-binding specificities. It uses statistical thermodynamics theory to model not only protein-DNA interaction, but also the effect of DNA-bound activators and repressors on gene expression. In addition, the model incorporates mechanistic features such as synergistic effect of multiple activators, short range repression, and cooperativity in transcription factor-DNA binding, allowing us to systematically evaluate the significance of these features in the context of available expression data. Using this model on segmentation-related enhancers in Drosophila, we find that transcriptional synergy due to simultaneous action of multiple activators helps explain the data beyond what can be explained by cooperative DNA-binding alone. We find clear support for the phenomenon of short-range repression, where repressors do not directly interact with the basal transcriptional machinery. We also find that the binding sites contributing to an enhancer's function may not be conserved during evolution, and a noticeable fraction of these undergo lineage-specific changes. Our implementation of the model, called GEMSTAT, is the first publicly available program for simultaneously modeling the regulatory activities of a given set of sequences. PMID:20862354

Cations Form Sequence Selective Motifs within DNA Grooves via a Combination of Cation-Pi and Ion-Dipole/Hydrogen Bond Interactions

PubMed Central

Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

2013-01-01

The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl+) and the polarized first hydration shell waters of divalent cations (Mg2+, Ca2+) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves. PMID:23940752

Cations form sequence selective motifs within DNA grooves via a combination of cation-pi and ion-dipole/hydrogen bond interactions.

PubMed

Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

2013-01-01

The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl⁺) and the polarized first hydration shell waters of divalent cations (Mg²⁺, Ca²⁺) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves.

Molecular Detection, Isolation, and Physiological Characterization of Functionally Dominant Phenol-Degrading Bacteria in Activated Sludge

PubMed Central

Watanabe, Kazuya; Teramoto, Maki; Futamata, Hiroyuki; Harayama, Shigeaki

1998-01-01

DNA was isolated from phenol-digesting activated sludge, and partial fragments of the 16S ribosomal DNA (rDNA) and the gene encoding the largest subunit of multicomponent phenol hydroxylase (LmPH) were amplified by PCR. An analysis of the amplified fragments by temperature gradient gel electrophoresis (TGGE) demonstrated that two major 16S rDNA bands (bands R2 and R3) and two major LmPH gene bands (bands P2 and P3) appeared after the activated sludge became acclimated to phenol. The nucleotide sequences of these major bands were determined. In parallel, bacteria were isolated from the activated sludge by direct plating or by plating after enrichment either in batch cultures or in a chemostat culture. The bacteria isolated were classified into 27 distinct groups by a repetitive extragenic palindromic sequence PCR analysis. The partial nucleotide sequences of 16S rDNAs and LmPH genes of members of these 27 groups were then determined. A comparison of these nucleotide sequences with the sequences of the major TGGE bands indicated that the major bacterial populations, R2 and R3, possessed major LmPH genes P2 and P3, respectively. The dominant populations could be isolated either by direct plating or by chemostat culture enrichment but not by batch culture enrichment. One of the dominant strains (R3) which contained a novel type of LmPH (P3), was closely related to Valivorax paradoxus, and the result of a kinetic analysis of its phenol-oxygenating activity suggested that this strain was the principal phenol digester in the activated sludge. PMID:9797297

A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

PubMed Central

Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

2001-01-01

Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

RNA-programmed genome editing in human cells

PubMed Central

Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer

2013-01-01

Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978

Distribution of cytotoxic and DNA ADP-ribosylating activity in crude extracts from butterflies among the family Pieridae

PubMed Central

Matsumoto, Yasuko; Nakano, Tsuyoshi; Yamamoto, Masafumi; Matsushima-Hibiya, Yuko; Odagiri, Ken-Ichi; Yata, Osamu; Koyama, Kotaro; Sugimura, Takashi; Wakabayashi, Keiji

2008-01-01

Cabbage butterflies, Pieris rapae and Pieris brassicae, contain strong cytotoxic proteins, designated as pierisin-1 and -2, against cancer cell lines. These proteins exhibit DNA ADP-ribosylating activity. To determine the distribution of substances with cytotoxicity and DNA ADP-ribosylating activity among other species, crude extracts from 20 species of the family Pieridae were examined for cytotoxicity in HeLa cells and DNA ADP-ribosylating activity. Both activities were detected in extracts from 13 species: subtribes Pierina (Pieris rapae, Pieris canidia, Pieris napi, Pieris melete, Pieris brassicae, Pontia daplidice, and Talbotia naganum), Aporiina (Aporia gigantea, Aporia crataegi, Aporia hippia, and Delias pasithoe), and Appiadina (Appias nero and Appias paulina). All of these extracts contained substances recognized by anti-pierisin-1 antibodies, with a molecular mass of ≈100 kDa established earlier for pierisin-1. Moreover, sequences containing NAD-binding sites, conserved in ADP-ribosyltransferases, were amplified from genomic DNA from 13 species of butterflies with cytotoxicity and DNA ADP-ribosylating activity by PCR. Extracts from seven species, Appias lyncida, Leptosia nina, Anthocharis scolymus, Eurema hecabe, Catopsilia pomona, Catopsilia scylla, and Colias erate, showed neither cytotoxicity nor DNA ADP-ribosylating activity, and did not contain substances recognized by anti-pierisin-1 antibodies. Sequences containing NAD-binding sites were not amplified from genomic DNA from these seven species. Thus, pierisin-like proteins, showing cytotoxicity and DNA ADP-ribosylating activity, are suggested to be present in the extracts from butterflies not only among the subtribe Pierina, but also among the subtribes Aporiina and Appiadina. These findings offer insight to understanding the nature of DNA ADP-ribosylating activity in the butterfly. PMID:18256183

Synchronization of DNA array replication kinetics

NASA Astrophysics Data System (ADS)

Manturov, Alexey O.; Grigoryev, Anton V.

2016-04-01

In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

PubMed Central

Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

1994-01-01

We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

Functional interrogation of non-coding DNA through CRISPR genome editing.

PubMed

Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H

2017-05-15

Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

Type III restriction-modification enzymes: a historical perspective.

PubMed

Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara

2014-01-01

Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.

DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

PubMed

Rieben, W Kurt; Coulombe, Roger A

2004-12-01

Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

PubMed Central

Palzkill, T G; Oliver, S G; Newlon, C S

1986-01-01

Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

DNA mimic proteins: functions, structures, and bioinformatic analysis.

PubMed

Wang, Hao-Ching; Ho, Chun-Han; Hsu, Kai-Cheng; Yang, Jinn-Moon; Wang, Andrew H-J

2014-05-13

DNA mimic proteins have DNA-like negative surface charge distributions, and they function by occupying the DNA binding sites of DNA binding proteins to prevent these sites from being accessed by DNA. DNA mimic proteins control the activities of a variety of DNA binding proteins and are involved in a wide range of cellular mechanisms such as chromatin assembly, DNA repair, transcription regulation, and gene recombination. However, the sequences and structures of DNA mimic proteins are diverse, making them difficult to predict by bioinformatic search. To date, only a few DNA mimic proteins have been reported. These DNA mimics were not found by searching for functional motifs in their sequences but were revealed only by structural analysis of their charge distribution. This review highlights the biological roles and structures of 16 reported DNA mimic proteins. We also discuss approaches that might be used to discover new DNA mimic proteins.

Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

PubMed Central

Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.

2010-01-01

The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

PubMed Central

Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

2010-01-01

Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

PubMed

Ken, C F; Lin, C T; Wu, J L; Shaw, J F

2000-06-01

A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

The genomes of many yam species contain transcriptionally active endogenous geminiviral sequences that may be functionally expressed

PubMed Central

Filloux, Denis; Murrell, Sasha; Koohapitagtam, Maneerat; Golden, Michael; Julian, Charlotte; Galzi, Serge; Uzest, Marilyne; Rodier-Goud, Marguerite; D’Hont, Angélique; Vernerey, Marie Stephanie; Wilkin, Paul; Peterschmitt, Michel; Winter, Stephan; Murrell, Ben; Martin, Darren P.; Roumagnac, Philippe

2015-01-01

Endogenous viral sequences are essentially ‘fossil records’ that can sometimes reveal the genomic features of long extinct virus species. Although numerous known instances exist of single-stranded DNA (ssDNA) genomes becoming stably integrated within the genomes of bacteria and animals, there remain very few examples of such integration events in plants. The best studied of these events are those which yielded the geminivirus-related DNA elements found within the nuclear genomes of various Nicotiana species. Although other ssDNA virus-like sequences are included within the draft genomes of various plant species, it is not entirely certain that these are not contaminants. The Nicotiana geminivirus-related DNA elements therefore remain the only definitively proven instances of endogenous plant ssDNA virus sequences. Here, we characterize two new classes of endogenous plant virus sequence that are also apparently derived from ancient geminiviruses in the genus Begomovirus. These two endogenous geminivirus-like elements (EGV1 and EGV2) are present in the Dioscorea spp. of the Enantiophyllum clade. We used fluorescence in situ hybridization to confirm that the EGV1 sequences are integrated in the D. alata genome and showed that one or two ancestral EGV sequences likely became integrated more than 1.4 million years ago during or before the diversification of the Asian and African Enantiophyllum Dioscorea spp. Unexpectedly, we found evidence of natural selection actively favouring the maintenance of EGV-expressed replication-associated protein (Rep) amino acid sequences, which clearly indicates that functional EGV Rep proteins were probably expressed for prolonged periods following endogenization. Further, the detection in D. alata of EGV gene transcripts, small 21–24 nt RNAs that are apparently derived from these transcripts, and expressed Rep proteins, provides evidence that some EGV genes are possibly still functionally expressed in at least some of the Enantiophyllum clade species. PMID:27774276

Molecular determinants of origin discrimination by Orc1 initiators in archaea.

PubMed

Dueber, Erin C; Costa, Alessandro; Corn, Jacob E; Bell, Stephen D; Berger, James M

2011-05-01

Unlike bacteria, many eukaryotes initiate DNA replication from genomic sites that lack apparent sequence conservation. These loci are identified and bound by the origin recognition complex (ORC), and subsequently activated by a cascade of events that includes recruitment of an additional factor, Cdc6. Archaeal organisms generally possess one or more Orc1/Cdc6 homologs, belonging to the Initiator clade of ATPases associated with various cellular activities (AAA(+)) superfamily; however, these proteins recognize specific sequences within replication origins. Atomic resolution studies have shown that archaeal Orc1 proteins contact double-stranded DNA through an N-terminal AAA(+) domain and a C-terminal winged-helix domain (WHD), but use remarkably few base-specific contacts. To investigate the biochemical effects of these associations, we mutated the DNA-interacting elements of the Orc1-1 and Orc1-3 paralogs from the archaeon Sulfolobus solfataricus, and tested their effect on origin binding and deformation. We find that the AAA(+) domain has an unpredicted role in controlling the sequence selectivity of DNA binding, despite an absence of base-specific contacts to this region. Our results show that both the WHD and ATPase region influence origin recognition by Orc1/Cdc6, and suggest that not only DNA sequence, but also local DNA structure help define archaeal initiator binding sites. © The Author(s) 2011. Published by Oxford University Press.

Comprehensive Interrogation of Natural TALE DNA Binding Modules and Transcriptional Repressor Domains

PubMed Central

Cong, Le; Zhou, Ruhong; Kuo, Yu-chi; Cunniff, Margaret; Zhang, Feng

2012-01-01

Transcription activator-like effectors (TALE) are sequence-specific DNA binding proteins that harbor modular, repetitive DNA binding domains. TALEs have enabled the creation of customizable designer transcriptional factors and sequence-specific nucleases for genome engineering. Here we report two improvements of the TALE toolbox for achieving efficient activation and repression of endogenous gene expression in mammalian cells. We show that the naturally occurring repeat variable diresidue (RVD) Asn-His (NH) has high biological activity and specificity for guanine, a highly prevalent base in mammalian genomes. We also report an effective TALE transcriptional repressor architecture for targeted inhibition of transcription in mammalian cells. These findings will improve the precision and effectiveness of genome engineering that can be achieved using TALEs. PMID:22828628

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast

PubMed Central

Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian

2015-01-01

The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765

Inhibition of hepatitis B virus replication with linear DNA sequences expressing antiviral micro-RNA shuttles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie

2009-11-20

RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less

Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

PubMed Central

Yasuno, Rie; Wada, Hajime

1998-01-01

Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Double-strand break repair processes drive evolution of the mitochondrial genome in Arabidopsis.

PubMed

Davila, Jaime I; Arrieta-Montiel, Maria P; Wamboldt, Yashitola; Cao, Jun; Hagmann, Joerg; Shedge, Vikas; Xu, Ying-Zhi; Weigel, Detlef; Mackenzie, Sally A

2011-09-27

The mitochondrial genome of higher plants is unusually dynamic, with recombination and nonhomologous end-joining (NHEJ) activities producing variability in size and organization. Plant mitochondrial DNA also generally displays much lower nucleotide substitution rates than mammalian or yeast systems. Arabidopsis displays these features and expedites characterization of the mitochondrial recombination surveillance gene MSH1 (MutS 1 homolog), lending itself to detailed study of de novo mitochondrial genome activity. In the present study, we investigated the underlying basis for unusual plant features as they contribute to rapid mitochondrial genome evolution. We obtained evidence of double-strand break (DSB) repair, including NHEJ, sequence deletions and mitochondrial asymmetric recombination activity in Arabidopsis wild-type and msh1 mutants on the basis of data generated by Illumina deep sequencing and confirmed by DNA gel blot analysis. On a larger scale, with mitochondrial comparisons across 72 Arabidopsis ecotypes, similar evidence of DSB repair activity differentiated ecotypes. Forty-seven repeat pairs were active in DNA exchange in the msh1 mutant. Recombination sites showed asymmetrical DNA exchange within lengths of 50- to 556-bp sharing sequence identity as low as 85%. De novo asymmetrical recombination involved heteroduplex formation, gene conversion and mismatch repair activities. Substoichiometric shifting by asymmetrical exchange created the appearance of rapid sequence gain and loss in association with particular repeat classes. Extensive mitochondrial genomic variation within a single plant species derives largely from DSB activity and its repair. Observed gene conversion and mismatch repair activity contribute to the low nucleotide substitution rates seen in these genomes. On a phenotypic level, these patterns of rearrangement likely contribute to the reproductive versatility of higher plants.

Methods of introducing nucleic acids into cellular DNA

DOEpatents

Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

2017-06-27

A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

PubMed Central

Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

2003-01-01

Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

Ammonia-oxidizing bacteria dominate ammonia oxidation in a full-scale wastewater treatment plant revealed by DNA-based stable isotope probing.

PubMed

Pan, Kai-Ling; Gao, Jing-Feng; Li, Hong-Yu; Fan, Xiao-Yan; Li, Ding-Chang; Jiang, Hao

2018-05-01

A full-scale wastewater treatment plant (WWTP) with three separate treatment processes was selected to investigate the effects of seasonality and treatment process on the community structures of ammonia-oxidizing archaea (AOA) and bacteria (AOB). And then DNA-based stable isotope probing (DNA-SIP) was applied to explore the active ammonia oxidizers. The results of high-throughput sequencing indicated that treatment processes varied AOB communities rather than AOA communities. AOA slightly outnumbered AOB in most of the samples, whose abundance was significantly correlated with temperature. DNA-SIP results showed that the majority of AOB amoA gene was labeled by 13 C-substrate, while just a small amount of AOA amoA gene was labeled. As revealed by high-throughput sequencing of heavy DNA, Nitrosomonadaceae-like AOB, Nitrosomonas sp. NP1, Nitrosomonas oligotropha and Nitrosomonas marina were the active AOB, and Nitrososphaera viennensis dominated the active AOA. The results indicated that AOB, not AOA, dominated active ammonia oxidation in the test WWTP. Copyright © 2018 Elsevier Ltd. All rights reserved.

Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA

PubMed Central

Lukinavičius, Gražvydas; Lapinaitė, Audronė; Urbanavičiūtė, Giedrė; Gerasimaitė, Rūta; Klimašauskas, Saulius

2012-01-01

DNA methyltransferases catalyse the transfer of a methyl group from the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet) onto specific target sites on DNA and play important roles in organisms from bacteria to humans. AdoMet analogs with extended propargylic side chains have been chemically produced for methyltransferase-directed transfer of activated groups (mTAG) onto DNA, although the efficiency of reactions with synthetic analogs remained low. We performed steric engineering of the cofactor pocket in a model DNA cytosine-5 methyltransferase (C5-MTase), M.HhaI, by systematic replacement of three non-essential positions, located in two conserved sequence motifs and in a variable region, with smaller residues. We found that double and triple replacements lead to a substantial improvement of the transalkylation activity, which manifests itself in a mild increase of cofactor binding affinity and a larger increase of the rate of alkyl transfer. These effects are accompanied with reduction of both the stability of the product DNA–M.HhaI–AdoHcy complex and the rate of methylation, permitting competitive mTAG labeling in the presence of AdoMet. Analogous replacements of two conserved residues in M.HpaII and M2.Eco31I also resulted in improved transalkylation activity attesting a general applicability of the homology-guided engineering to the C5-MTase family and expanding the repertoire of sequence-specific tools for covalent in vitro and ex vivo labeling of DNA. PMID:23042683

cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

PubMed

Huang, Shengbing; Song, Wei; Lin, Qishui

2005-08-01

A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

The 'dark matter' in the plant genomes: non-coding and unannotated DNA sequences associated with open chromatin.

PubMed

Jiang, Jiming

2015-04-01

Sequencing of complete plant genomes has become increasingly more routine since the advent of the next-generation sequencing technology. Identification and annotation of large amounts of noncoding but functional DNA sequences, including cis-regulatory DNA elements (CREs), have become a new frontier in plant genome research. Genomic regions containing active CREs bound to regulatory proteins are hypersensitive to DNase I digestion and are called DNase I hypersensitive sites (DHSs). Several recent DHS studies in plants illustrate that DHS datasets produced by DNase I digestion followed by next-generation sequencing (DNase-seq) are highly valuable for the identification and characterization of CREs associated with plant development and responses to environmental cues. DHS-based genomic profiling has opened a door to identify and annotate the 'dark matter' in sequenced plant genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats

PubMed Central

de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

2015-01-01

Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. PMID:26481363

Epigenetically-inherited centromere and neocentromere DNA replicates earliest in S-phase.

PubMed

Koren, Amnon; Tsai, Hung-Ji; Tirosh, Itay; Burrack, Laura S; Barkai, Naama; Berman, Judith

2010-08-19

Eukaryotic centromeres are maintained at specific chromosomal sites over many generations. In the budding yeast Saccharomyces cerevisiae, centromeres are genetic elements defined by a DNA sequence that is both necessary and sufficient for function; whereas, in most other eukaryotes, centromeres are maintained by poorly characterized epigenetic mechanisms in which DNA has a less definitive role. Here we use the pathogenic yeast Candida albicans as a model organism to study the DNA replication properties of centromeric DNA. By determining the genome-wide replication timing program of the C. albicans genome, we discovered that each centromere is associated with a replication origin that is the first to fire on its respective chromosome. Importantly, epigenetic formation of new ectopic centromeres (neocentromeres) was accompanied by shifts in replication timing, such that a neocentromere became the first to replicate and became associated with origin recognition complex (ORC) components. Furthermore, changing the level of the centromere-specific histone H3 isoform led to a concomitant change in levels of ORC association with centromere regions, further supporting the idea that centromere proteins determine origin activity. Finally, analysis of centromere-associated DNA revealed a replication-dependent sequence pattern characteristic of constitutively active replication origins. This strand-biased pattern is conserved, together with centromere position, among related strains and species, in a manner independent of primary DNA sequence. Thus, inheritance of centromere position is correlated with a constitutively active origin of replication that fires at a distinct early time. We suggest a model in which the distinct timing of DNA replication serves as an epigenetic mechanism for the inheritance of centromere position.

Cloning and expression of cDNA coding for bouganin.

PubMed

den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

2002-03-01

Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

Methods and materials relating to IMPDH and GMP production

DOEpatents

Collart, Frank R.; Huberman, Eliezer

1997-01-01

Disclosed are purified and isolated DNA sequences encoding eukaryotic proteins possessing biological properties of inosine 5'-monophosphate dehydrogenase ("IMPDH"). Illustratively, mammalian (e.g., human) IMPDH-encoding DNA sequences are useful in transformation or transfection of host cells for the large scale recombinant production of the enzymatically active expression products and/or products (e.g., GMP) resulting from IMPDH catalyzed synthesis in cells. Vectors including IMPDH-encoding DNA sequences are useful in gene amplification procedures. Recombinant proteins and synthetic peptides provided by the invention are useful as immunological reagents and in the preparation of antibodies (including polyclonal and monoclonal antibodies) for quantitative detection of IMPDH.

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants

PubMed Central

Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier

2017-01-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes. PMID:28212378

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants.

PubMed

Lanciano, Sophie; Carpentier, Marie-Christine; Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier; Mirouze, Marie

2017-02-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes.

cDNA cloning, expression, and mutagenesis of a PR-10 protein SPE-16 from the seeds of Pachyrrhizus erosus.

PubMed

Wu, Fang; Yan, Ming; Li, Yikun; Chang, Shaojie; Song, Xiaomin; Zhou, Zhaocai; Gong, Weimin

2003-12-19

SPE-16 is a new 16kDa protein that has been purified from the seeds of Pachyrrhizus erosus. It's N-terminal amino acid sequence shows significant sequence homology to pathogenesis-related class 10 proteins. cDNA encoding 150 amino acids was cloned by RT-PCR and the gene sequence proved SPE-16 to be a new member of PR-10 family. The cDNA was cloned into pET15b plasmid and expressed in Escherichia coli. The bacterially expressed SPE-16 also demonstrated ribonuclease-like activity in vitro. Site-directed mutation of three conserved amino acids E95A, E147A, Y150A, and a P-loop truncated form were constructed and their different effects on ribonuclease activities were observed. SPE-16 is also able to bind the fluorescent probe 8-anilino-1-naphthalenesulfonate (ANS) in the native state. The ANS anion is a much-utilized "hydrophobic probe" for proteins. This binding activity indicated another biological function of SPE-16.

Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

PubMed

Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

2000-10-06

Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

DNA demethylation activates genes in seed maternal integument development in rice (Oryza sativa L.).

PubMed

Wang, Yifeng; Lin, Haiyan; Tong, Xiaohong; Hou, Yuxuan; Chang, Yuxiao; Zhang, Jian

2017-11-01

DNA methylation is an important epigenetic modification that regulates various plant developmental processes. Rice seed integument determines the seed size. However, the role of DNA methylation in its development remains largely unknown. Here, we report the first dynamic DNA methylomic profiling of rice maternal integument before and after pollination by using a whole-genome bisulfite deep sequencing approach. Analysis of DNA methylation patterns identified 4238 differentially methylated regions underpin 4112 differentially methylated genes, including GW2, DEP1, RGB1 and numerous other regulators participated in maternal integument development. Bisulfite sanger sequencing and qRT-PCR of six differentially methylated genes revealed extensive occurrence of DNA hypomethylation triggered by double fertilization at IAP compared with IBP, suggesting that DNA demethylation might be a key mechanism to activate numerous maternal controlling genes. These results presented here not only greatly expanded the rice methylome dataset, but also shed novel insight into the regulatory roles of DNA methylation in rice seed maternal integument development. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

ComM is a hexameric helicase that promotes branch migration during natural transformation in diverse Gram-negative species.

PubMed

Nero, Thomas M; Dalia, Triana N; Wang, Joseph Che-Yen; Kysela, David T; Bochman, Matthew L; Dalia, Ankur B

2018-05-02

Acquisition of foreign DNA by natural transformation is an important mechanism of adaptation and evolution in diverse microbial species. Here, we characterize the mechanism of ComM, a broadly conserved AAA+ protein previously implicated in homologous recombination of transforming DNA (tDNA) in naturally competent Gram-negative bacterial species. In vivo, we found that ComM was required for efficient comigration of linked genetic markers in Vibrio cholerae and Acinetobacter baylyi, which is consistent with a role in branch migration. Also, ComM was particularly important for integration of tDNA with increased sequence heterology, suggesting that its activity promotes the acquisition of novel DNA sequences. In vitro, we showed that purified ComM binds ssDNA, oligomerizes into a hexameric ring, and has bidirectional helicase and branch migration activity. Based on these data, we propose a model for tDNA integration during natural transformation. This study provides mechanistic insight into the enigmatic steps involved in tDNA integration and uncovers the function of a protein required for this conserved mechanism of horizontal gene transfer.

Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

PubMed Central

Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

2003-01-01

Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

Specific DNA binding activity of T antigen subclasses varies among different SV40-transformed cell lines.

PubMed

Burger, C; Fanning, E

1983-04-15

Large tumor antigen (T antigen) occurs in at least three different oligomeric subclasses in cells infected or transformed by simian virus 40 (SV40): 5-7 S, 14-16 S, and 23-25 S. The 23-25 S form is complexed with a host phosphoprotein (p53). The DNA binding properties of these three subclasses of T antigen from nine different cell lines and free p53 protein were compared using an immunoprecipitation assay. All three subclasses of T antigen bound specifically to SV40 DNA sequences near the origin of replication. However, the DNA binding activity varied between different cell lines over a 40- to 50-fold range. The 23-25 S and 14-16 S forms from most of the cell lines tested bound much less SV40 origin DNA than 5-7 S T antigen. The free p53 phosphoprotein did not bind specifically to any SV40 DNA sequences.

Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

NASA Astrophysics Data System (ADS)

Wang, Hua; Zhang, Jian; Yang, Fan; Wang, Kai; Shen, Si-Le; Liu, Bing-Bing; Zou, Bo; Zou, Guang-Tian

2011-01-01

The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively.

BplI, a new BcgI-like restriction endonuclease, which recognizes a symmetric sequence.

PubMed Central

Vitkute, J; Maneliene, Z; Petrusyte, M; Janulaitis, A

1997-01-01

Bcg I and Bcg I-like restriction endonucleases cleave double stranded DNA specifically on both sides of their asymmetric recognition sequences which are interrupted by several ambiguous base pairs. Their heterosubunit structure, bifunctionality and stimulation by AdoMet make them different from other classified restriction enzymes. Here we report on a new Bcg I-like restriction endonuclease, Bpl I from Bacillus pumilus , which in contrast to all other Bcg I-like enzymes, recognizes a symmetric interrupted sequence, and which, like Bcg I, cleaves double stranded DNA upstream and downstream of its recognition sequence (8/13)GAGN5CTC(13/8). Like Bcg I, Bpl I is a bifunctional enzyme revealing both DNA cleavage and methyltransferase activities. There are two polypeptides in the homogeneous preparation of Bpl I with molecular masses of approximately 74 and 37 kDa. The sizes of the Bpl I subunits are close to those of Bcg I, but the proportion 1:1 in the final preparation is different from that of 2:1 in Bcg I. Low activity observed with Mg2+increases >100-fold in the presence of AdoMet. Even with AdoMet though, specific cleavage is incomplete. S -adenosylhomocysteine (AdoHcy) or sinefungin can replace AdoMet in the cleavage reaction. AdoHcy activated Bpl I yields complete cleavage of DNA. PMID:9358150

Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

PubMed

Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

2014-01-01

DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic DNA digestion.

Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain

PubMed Central

Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.

2012-01-01

Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066

Identification and chromosome mapping of repetitive elements in the Astyanax scabripinnis (Teleostei: Characidae) species complex.

PubMed

Barbosa, Patrícia; de Oliveira, Luiz Antonio; Pucci, Marcela Baer; Santos, Mateus Henrique; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira

2015-02-01

Most part of the eukaryotic genome is composed of repeated sequences or multiple copies of DNA, which were considered as "junk DNA", and may be associated to the heterochromatin. In this study, three populations of Astyanax aff. scabripinnis from Brazilian rivers of Guaratinguetá and Pindamonhangaba (São Paulo) and a population from Maringá (Paraná) were analyzed concerning the localization of the nucleolar organizer regions (Ag-NORs), the As51 satellite DNA, the 18S ribosomal DNA (rDNA), and the 5S rDNA. Repeated sequences were also isolated and identified by the Cot - 1 method, which indicated similarity (90%) with the LINE UnaL2 retrotransposon. The fluorescence in situ hybridization (FISH) showed the retrotransposon dispersed and more concentrated markers in centromeric and telomeric chromosomal regions. These sequences were co-localized and interspaced with 18S and 5S rDNA and As51, confirmed by fiber-FISH essay. The B chromosome found in these populations pointed to a conspicuous hybridization with LINE probe, which is also co-located in As51 sequences. The NORs were active at unique sites of a homologous pair in the three populations. There were no evidences that transposable elements and repetitive DNA had influence in the transcriptional regulation of ribosomal genes in our analyses.

A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library.

PubMed

Waugh, Caryll; Cromer, Deborah; Grimm, Andrew; Chopra, Abha; Mallal, Simon; Davenport, Miles; Mak, Johnson

2015-04-09

Massive, parallel sequencing is a potent tool for dissecting the regulation of biological processes by revealing the dynamics of the cellular RNA profile under different conditions. Similarly, massive, parallel sequencing can be used to reveal the complexity of viral quasispecies that are often found in the RNA virus infected host. However, the production of cDNA libraries for next-generation sequencing (NGS) necessitates the reverse transcription of RNA into cDNA and the amplification of the cDNA template using PCR, which may introduce artefact in the form of phantom nucleic acids species that can bias the composition and interpretation of original RNA profiles. Using HIV as a model we have characterised the major sources of error during the conversion of viral RNA to cDNA, namely excess RNA template and the RNaseH activity of the polymerase enzyme, reverse transcriptase. In addition we have analysed the effect of PCR cycle on detection of recombinants and assessed the contribution of transfection of highly similar plasmid DNA to the formation of recombinant species during the production of our control viruses. We have identified RNA template concentrations, RNaseH activity of reverse transcriptase, and PCR conditions as key parameters that must be carefully optimised to minimise chimeric artefacts. Using our optimised RT-PCR conditions, in combination with our modified PCR amplification procedure, we have developed a reliable technique for accurate determination of RNA species using NGS technology.

DNA G-Wire Formation Using an Artificial Peptide is Controlled by Protease Activity.

PubMed

Usui, Kenji; Okada, Arisa; Sakashita, Shungo; Shimooka, Masayuki; Tsuruoka, Takaaki; Nakano, Shu-Ichi; Miyoshi, Daisuke; Mashima, Tsukasa; Katahira, Masato; Hamada, Yoshio

2017-11-16

The development of a switching system for guanine nanowire (G-wire) formation by external signals is important for nanobiotechnological applications. Here, we demonstrate a DNA nanostructural switch (G-wire <--> particles) using a designed peptide and a protease. The peptide consists of a PNA sequence for inducing DNA to form DNA-PNA hybrid G-quadruplex structures, and a protease substrate sequence acting as a switching module that is dependent on the activity of a particular protease. Micro-scale analyses via TEM and AFM showed that G-rich DNA alone forms G-wires in the presence of Ca 2+ , and that the peptide disrupted this formation, resulting in the formation of particles. The addition of the protease and digestion of the peptide regenerated the G-wires. Macro-scale analyses by DLS, zeta potential, CD, and gel filtration were in agreement with the microscopic observations. These results imply that the secondary structure change (DNA G-quadruplex <--> DNA/PNA hybrid structure) induces a change in the well-formed nanostructure (G-wire <--> particles). Our findings demonstrate a control system for forming DNA G-wire structures dependent on protease activity using designed peptides. Such systems hold promise for regulating the formation of nanowire for various applications, including electronic circuits for use in nanobiotechnologies.

An Automated Pipeline for Engineering Many-Enzyme Pathways: Computational Sequence Design, Pathway Expression-Flux Mapping, and Scalable Pathway Optimization.

PubMed

Halper, Sean M; Cetnar, Daniel P; Salis, Howard M

2018-01-01

Engineering many-enzyme metabolic pathways suffers from the design curse of dimensionality. There are an astronomical number of synonymous DNA sequence choices, though relatively few will express an evolutionary robust, maximally productive pathway without metabolic bottlenecks. To solve this challenge, we have developed an integrated, automated computational-experimental pipeline that identifies a pathway's optimal DNA sequence without high-throughput screening or many cycles of design-build-test. The first step applies our Operon Calculator algorithm to design a host-specific evolutionary robust bacterial operon sequence with maximally tunable enzyme expression levels. The second step applies our RBS Library Calculator algorithm to systematically vary enzyme expression levels with the smallest-sized library. After characterizing a small number of constructed pathway variants, measurements are supplied to our Pathway Map Calculator algorithm, which then parameterizes a kinetic metabolic model that ultimately predicts the pathway's optimal enzyme expression levels and DNA sequences. Altogether, our algorithms provide the ability to efficiently map the pathway's sequence-expression-activity space and predict DNA sequences with desired metabolic fluxes. Here, we provide a step-by-step guide to applying the Pathway Optimization Pipeline on a desired multi-enzyme pathway in a bacterial host.

Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

PubMed

Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

2008-10-15

The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

NASA Astrophysics Data System (ADS)

Zhao, Chunling; Ju, Jiyu

2015-06-01

The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

Plasma DNA aberrations in systemic lupus erythematosus revealed by genomic and methylomic sequencing

PubMed Central

Chan, Rebecca W. Y.; Jiang, Peiyong; Peng, Xianlu; Tam, Lai-Shan; Liao, Gary J. W.; Li, Edmund K. M.; Wong, Priscilla C. H.; Sun, Hao; Chan, K. C. Allen; Chiu, Rossa W. K.; Lo, Y. M. Dennis

2014-01-01

We performed a high-resolution analysis of the biological characteristics of plasma DNA in systemic lupus erythematosus (SLE) patients using massively parallel genomic and methylomic sequencing. A number of plasma DNA abnormalities were found. First, aberrations in measured genomic representations (MGRs) were identified in the plasma DNA of SLE patients. The extent of the aberrations in MGRs correlated with anti-double–stranded DNA (anti-dsDNA) antibody level. Second, the plasma DNA of active SLE patients exhibited skewed molecular size-distribution profiles with a significantly increased proportion of short DNA fragments. The extent of plasma DNA shortening in SLE patients correlated with the SLE disease activity index (SLEDAI) and anti-dsDNA antibody level. Third, the plasma DNA of active SLE patients showed decreased methylation densities. The extent of hypomethylation correlated with SLEDAI and anti-dsDNA antibody level. To explore the impact of anti-dsDNA antibody on plasma DNA in SLE, a column-based protein G capture approach was used to fractionate the IgG-bound and non–IgG-bound DNA in plasma. Compared with healthy individuals, SLE patients had higher concentrations of IgG-bound DNA in plasma. More IgG binding occurs at genomic locations showing increased MGRs. Furthermore, the IgG-bound plasma DNA was shorter in size and more hypomethylated than the non–IgG-bound plasma DNA. These observations have enhanced our understanding of the spectrum of plasma DNA aberrations in SLE and may provide new molecular markers for SLE. Our results also suggest that caution should be exercised when interpreting plasma DNA-based noninvasive prenatal testing and cancer testing conducted for SLE patients. PMID:25427797

Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

PubMed

Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

2017-01-23

Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental inheritance from the tetraploid progenitor. The obtained molecular, cytogenetic and phylogenetic data demonstrate complex evolutionary dynamics of rDNA loci in allohexaploid species of Atropa belladonna. The high level of sequence unification revealed in 45S and 5S rDNA loci of this ancient hybrid species have been seemingly achieved by different molecular mechanisms.

Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

PubMed

Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

2011-01-01

Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

Applications of alignment-free methods in epigenomics.

PubMed

Pinello, Luca; Lo Bosco, Giosuè; Yuan, Guo-Cheng

2014-05-01

Epigenetic mechanisms play an important role in the regulation of cell type-specific gene activities, yet how epigenetic patterns are established and maintained remains poorly understood. Recent studies have supported a role of DNA sequences in recruitment of epigenetic regulators. Alignment-free methods have been applied to identify distinct sequence features that are associated with epigenetic patterns and to predict epigenomic profiles. Here, we review recent advances in such applications, including the methods to map DNA sequence to feature space, sequence comparison and prediction models. Computational studies using these methods have provided important insights into the epigenetic regulatory mechanisms.

Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

PubMed

Pietrowski, D; Förster, M

2000-01-01

The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

Shotgun Bisulfite Sequencing of the Betula platyphylla Genome Reveals the Tree’s DNA Methylation Patterning

PubMed Central

Su, Chang; Wang, Chao; He, Lin; Yang, Chuanping; Wang, Yucheng

2014-01-01

DNA methylation plays a critical role in the regulation of gene expression. Most studies of DNA methylation have been performed in herbaceous plants, and little is known about the methylation patterns in tree genomes. In the present study, we generated a map of methylated cytosines at single base pair resolution for Betula platyphylla (white birch) by bisulfite sequencing combined with transcriptomics to analyze DNA methylation and its effects on gene expression. We obtained a detailed view of the function of DNA methylation sequence composition and distribution in the genome of B. platyphylla. There are 34,460 genes in the whole genome of birch, and 31,297 genes are methylated. Conservatively, we estimated that 14.29% of genomic cytosines are methylcytosines in birch. Among the methylation sites, the CHH context accounts for 48.86%, and is the largest proportion. Combined transcriptome and methylation analysis showed that the genes with moderate methylation levels had higher expression levels than genes with high and low methylation. In addition, methylated genes are highly enriched for the GO subcategories of binding activities, catalytic activities, cellular processes, response to stimulus and cell death, suggesting that methylation mediates these pathways in birch trees. PMID:25514241

Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

PubMed

Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

2015-12-01

Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

Cloning and sequencing of the cDNA species for mammalian dimeric dihydrodiol dehydrogenases.

PubMed Central

Arimitsu, E; Aoki, S; Ishikura, S; Nakanishi, K; Matsuura, K; Hara, A

1999-01-01

Cynomolgus and Japanese monkey kidneys, dog and pig livers and rabbit lens contain dimeric dihydrodiol dehydrogenase (EC 1.3.1.20) associated with high carbonyl reductase activity. Here we have isolated cDNA species for the dimeric enzymes by reverse transcriptase-PCR from human intestine in addition to the above five animal tissues. The amino acid sequences deduced from the monkey, pig and dog cDNA species perfectly matched the partial sequences of peptides digested from the respective enzymes of these animal tissues, and active recombinant proteins were expressed in a bacterial system from the monkey and human cDNA species. Northern blot analysis revealed the existence of a single 1.3 kb mRNA species for the enzyme in these animal tissues. The human enzyme shared 94%, 85%, 84% and 82% amino acid identity with the enzymes of the two monkey strains (their sequences were identical), the dog, the pig and the rabbit respectively. The sequences of the primate enzymes consisted of 335 amino acid residues and lacked one amino acid compared with the other animal enzymes. In contrast with previous reports that other types of dihydrodiol dehydrogenase, carbonyl reductases and enzymes with either activity belong to the aldo-keto reductase family or the short-chain dehydrogenase/reductase family, dimeric dihydrodiol dehydrogenase showed no sequence similarity with the members of the two protein families. The dimeric enzyme aligned with low degrees of identity (14-25%) with several prokaryotic proteins, in which 47 residues are strictly or highly conserved. Thus dimeric dihydrodiol dehydrogenase has a primary structure distinct from the previously known mammalian enzymes and is suggested to constitute a novel protein family with the prokaryotic proteins. PMID:10477285

Preservation and Significance of Extracellular DNA in Ferruginous Sediments from Lake Towuti, Indonesia

PubMed Central

Vuillemin, Aurèle; Horn, Fabian; Alawi, Mashal; Henny, Cynthia; Wagner, Dirk; Crowe, Sean A.; Kallmeyer, Jens

2017-01-01

Extracellular DNA is ubiquitous in soil and sediment and constitutes a dominant fraction of environmental DNA in aquatic systems. In theory, extracellular DNA is composed of genomic elements persisting at different degrees of preservation produced by processes occurring on land, in the water column and sediment. Extracellular DNA can be taken up as a nutrient source, excreted or degraded by microorganisms, or adsorbed onto mineral matrices, thus potentially preserving information from past environments. To test whether extracellular DNA records lacustrine conditions, we sequentially extracted extracellular and intracellular DNA from anoxic sediments of ferruginous Lake Towuti, Indonesia. We applied 16S rRNA gene Illumina sequencing on both fractions to discriminate exogenous from endogenous sources of extracellular DNA in the sediment. Environmental sequences exclusively found as extracellular DNA in the sediment originated from multiple sources. For instance, Actinobacteria, Verrucomicrobia, and Acidobacteria derived from soils in the catchment. Limited primary productivity in the water column resulted in few sequences of Cyanobacteria in the oxic photic zone, whereas stratification of the water body mainly led to secondary production by aerobic and anaerobic heterotrophs. Chloroflexi and Planctomycetes, the main degraders of sinking organic matter and planktonic sequences at the water-sediment interface, were preferentially preserved during the initial phase of burial. To trace endogenous sources of extracellular DNA, we used relative abundances of taxa in the intracellular DNA to define which microbial populations grow, decline or persist at low density with sediment depth. Cell lysis became an important additional source of extracellular DNA, gradually covering previous genetic assemblages as other microbial genera became more abundant with depth. The use of extracellular DNA as nutrient by active microorganisms led to selective removal of sequences with lowest GC contents. We conclude that extracellular DNA preserved in shallow lacustrine sediments reflects the initial environmental context, but is gradually modified and thereby shifts from its stratigraphic context. Discrimination of exogenous and endogenous sources of extracellular DNA allows simultaneously addressing in-lake and post-depositional processes. In deeper sediments, the accumulation of resting stages and sequences from cell lysis would require stringent extraction and specific primers if ancient DNA is targeted. PMID:28798742

Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

PubMed Central

Wozniak, Christopher E.; Hughes, Kelly T.

2008-01-01

Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.

PubMed

Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara

2017-02-20

The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.

The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Yi; Fiscus, Valena; Meng, Wuyi

2012-02-08

The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA bindingmore » activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.« less

Effective DNA Inhibitors of Cathepsin G by In Vitro Selection

PubMed Central

Gatto, Barbara; Vianini, Elena; Lucatello, Lorena; Sissi, Claudia; Moltrasio, Danilo; Pescador, Rodolfo; Porta, Roberto; Palumbo, Manlio

2008-01-01

Cathepsin G (CatG) is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions. PMID:19325843

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Partial DNA-guided Cas9 enables genome editing with reduced off-target activity

PubMed Central

Yin, Hao; Song, Chun-Qing; Suresh, Sneha; Kwan, Suet-Yan; Wu, Qiongqiong; Walsh, Stephen; Ding, Junmei; Bogorad, Roman L; Zhu, Lihua Julie; Wolfe, Scot A; Koteliansky, Victor; Xue, Wen; Langer, Robert; Anderson, Daniel G

2018-01-01

CRISPR–Cas9 is a versatile RNA-guided genome editing tool. Here we demonstrate that partial replacement of RNA nucleotides with DNA nucleotides in CRISPR RNA (crRNA) enables efficient gene editing in human cells. This strategy of partial DNA replacement retains on-target activity when used with both crRNA and sgRNA, as well as with multiple guide sequences. Partial DNA replacement also works for crRNA of Cpf1, another CRISPR system. We find that partial DNA replacement in the guide sequence significantly reduces off-target genome editing through focused analysis of off-target cleavage, measurement of mismatch tolerance and genome-wide profiling of off-target sites. Using the structure of the Cas9–sgRNA complex as a guide, the majority of the 3′ end of crRNA can be replaced with DNA nucleotide, and the 5 - and 3′-DNA-replaced crRNA enables efficient genome editing. Cas9 guided by a DNA–RNA chimera may provide a generalized strategy to reduce both the cost and the off-target genome editing in human cells. PMID:29377001

DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

PubMed

de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

2015-11-16

Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

An Integrated Microfluidic Processor for DNA-Encoded Combinatorial Library Functional Screening

PubMed Central

2017-01-01

DNA-encoded synthesis is rekindling interest in combinatorial compound libraries for drug discovery and in technology for automated and quantitative library screening. Here, we disclose a microfluidic circuit that enables functional screens of DNA-encoded compound beads. The device carries out library bead distribution into picoliter-scale assay reagent droplets, photochemical cleavage of compound from the bead, assay incubation, laser-induced fluorescence-based assay detection, and fluorescence-activated droplet sorting to isolate hits. DNA-encoded compound beads (10-μm diameter) displaying a photocleavable positive control inhibitor pepstatin A were mixed (1920 beads, 729 encoding sequences) with negative control beads (58 000 beads, 1728 encoding sequences) and screened for cathepsin D inhibition using a biochemical enzyme activity assay. The circuit sorted 1518 hit droplets for collection following 18 min incubation over a 240 min analysis. Visual inspection of a subset of droplets (1188 droplets) yielded a 24% false discovery rate (1166 pepstatin A beads; 366 negative control beads). Using template barcoding strategies, it was possible to count hit collection beads (1863) using next-generation sequencing data. Bead-specific barcodes enabled replicate counting, and the false discovery rate was reduced to 2.6% by only considering hit-encoding sequences that were observed on >2 beads. This work represents a complete distributable small molecule discovery platform, from microfluidic miniaturized automation to ultrahigh-throughput hit deconvolution by sequencing. PMID:28199790

An Integrated Microfluidic Processor for DNA-Encoded Combinatorial Library Functional Screening.

PubMed

MacConnell, Andrew B; Price, Alexander K; Paegel, Brian M

2017-03-13

DNA-encoded synthesis is rekindling interest in combinatorial compound libraries for drug discovery and in technology for automated and quantitative library screening. Here, we disclose a microfluidic circuit that enables functional screens of DNA-encoded compound beads. The device carries out library bead distribution into picoliter-scale assay reagent droplets, photochemical cleavage of compound from the bead, assay incubation, laser-induced fluorescence-based assay detection, and fluorescence-activated droplet sorting to isolate hits. DNA-encoded compound beads (10-μm diameter) displaying a photocleavable positive control inhibitor pepstatin A were mixed (1920 beads, 729 encoding sequences) with negative control beads (58 000 beads, 1728 encoding sequences) and screened for cathepsin D inhibition using a biochemical enzyme activity assay. The circuit sorted 1518 hit droplets for collection following 18 min incubation over a 240 min analysis. Visual inspection of a subset of droplets (1188 droplets) yielded a 24% false discovery rate (1166 pepstatin A beads; 366 negative control beads). Using template barcoding strategies, it was possible to count hit collection beads (1863) using next-generation sequencing data. Bead-specific barcodes enabled replicate counting, and the false discovery rate was reduced to 2.6% by only considering hit-encoding sequences that were observed on >2 beads. This work represents a complete distributable small molecule discovery platform, from microfluidic miniaturized automation to ultrahigh-throughput hit deconvolution by sequencing.

Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

PubMed Central

Giresi, Paul G.; Lieb, Jason D.

2009-01-01

The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

PubMed

Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

2017-09-01

DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA Sequence-Mediated, Evolutionarily Rapid Redistribution of Meiotic Recombination Hotspots

PubMed Central

Wahls, Wayne P.; Davidson, Mari K.

2011-01-01

Hotspots regulate the position and frequency of Spo11 (Rec12)-initiated meiotic recombination, but paradoxically they are suicidal and are somehow resurrected elsewhere in the genome. After the DNA sequence-dependent activation of hotspots was discovered in fission yeast, nearly two decades elapsed before the key realizations that (A) DNA site-dependent regulation is broadly conserved and (B) individual eukaryotes have multiple different DNA sequence motifs that activate hotspots. From our perspective, such findings provide a conceptually straightforward solution to the hotspot paradox and can explain other, seemingly complex features of meiotic recombination. We describe how a small number of single-base-pair substitutions can generate hotspots de novo and dramatically alter their distribution in the genome. This model also shows how equilibrium rate kinetics could maintain the presence of hotspots over evolutionary timescales, without strong selective pressures invoked previously, and explains why hotspots localize preferentially to intergenic regions and introns. The model is robust enough to account for all hotspots of humans and chimpanzees repositioned since their divergence from the latest common ancestor. PMID:22084420

Transcription of highly repetitive tandemly organized DNA in amphibians and birds: A historical overview and modern concepts.

PubMed

Trofimova, Irina; Krasikova, Alla

2016-12-01

Tandemly organized highly repetitive DNA sequences are crucial structural and functional elements of eukaryotic genomes. Despite extensive evidence, satellite DNA remains an enigmatic part of the eukaryotic genome, with biological role and significance of tandem repeat transcripts remaining rather obscure. Data on tandem repeats transcription in amphibian and avian model organisms is fragmentary despite their genomes being thoroughly characterized. Review systematically covers historical and modern data on transcription of amphibian and avian satellite DNA in somatic cells and during meiosis when chromosomes acquire special lampbrush form. We highlight how transcription of tandemly repetitive DNA sequences is organized in interphase nucleus and on lampbrush chromosomes. We offer LTR-activation hypotheses of widespread satellite DNA transcription initiation during oogenesis. Recent explanations are provided for the significance of high-yield production of non-coding RNA derived from tandemly organized highly repetitive DNA. In many cases the data on the transcription of satellite DNA can be extrapolated from lampbrush chromosomes to interphase chromosomes. Lampbrush chromosomes with applied novel technical approaches such as superresolution imaging, chromosome microdissection followed by high-throughput sequencing, dynamic observation in life-like conditions provide amazing opportunities for investigation mechanisms of the satellite DNA transcription.

Transcription of highly repetitive tandemly organized DNA in amphibians and birds: A historical overview and modern concepts

PubMed Central

Krasikova, Alla

2016-01-01

ABSTRACT Tandemly organized highly repetitive DNA sequences are crucial structural and functional elements of eukaryotic genomes. Despite extensive evidence, satellite DNA remains an enigmatic part of the eukaryotic genome, with biological role and significance of tandem repeat transcripts remaining rather obscure. Data on tandem repeats transcription in amphibian and avian model organisms is fragmentary despite their genomes being thoroughly characterized. Review systematically covers historical and modern data on transcription of amphibian and avian satellite DNA in somatic cells and during meiosis when chromosomes acquire special lampbrush form. We highlight how transcription of tandemly repetitive DNA sequences is organized in interphase nucleus and on lampbrush chromosomes. We offer LTR-activation hypotheses of widespread satellite DNA transcription initiation during oogenesis. Recent explanations are provided for the significance of high-yield production of non-coding RNA derived from tandemly organized highly repetitive DNA. In many cases the data on the transcription of satellite DNA can be extrapolated from lampbrush chromosomes to interphase chromosomes. Lampbrush chromosomes with applied novel technical approaches such as superresolution imaging, chromosome microdissection followed by high-throughput sequencing, dynamic observation in life-like conditions provide amazing opportunities for investigation mechanisms of the satellite DNA transcription. PMID:27763817

Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

PubMed

Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

2018-02-07

We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

Wanted dead or alive? Using metabarcoding of environmental DNA and RNA to distinguish living assemblages for biosecurity applications

PubMed Central

Zaiko, Anastasija; Fletcher, Lauren M.; Laroche, Olivier; Wood, Susanna A.

2017-01-01

High-throughput sequencing metabarcoding studies in marine biosecurity have largely focused on targeting environmental DNA (eDNA). DNA can persist extracellularly in the environment, making discrimination of living organisms difficult. In this study, bilge water samples (i.e., water accumulating on-board a vessel during transit) were collected from 15 small recreational and commercial vessels. eDNA and eRNA molecules were co-extracted and the V4 region of the 18S ribosomal RNA gene targeted for metabarcoding. In total, 62.7% of the Operational Taxonomic Units (OTUs) were identified at least once in the corresponding eDNA and eRNA reads, with 19.5% unique to eDNA and 17.7% to eRNA. There were substantial differences in diversity between molecular compartments; 57% of sequences from eDNA-only OTUs belonged to fungi, likely originating from legacy DNA. In contrast, there was a higher percentage of metazoan (50.2%) and ciliate (31.7%) sequences in the eRNA-only OTUs. Our data suggest that the presence of eRNA-only OTUs could be due to increased cellular activities of some rare taxa that were not identified in the eDNA datasets, unusually high numbers of rRNA transcripts in ciliates, and/or artefacts produced during the reverse transcriptase, PCR and sequencing steps. The proportions of eDNA/eRNA shared and unshared OTUs were highly heterogeneous within individual bilge water samples. Multiple factors including boat type and the activities performed on-board, such as washing of scientific equipment, may play a major role in contributing to this variability. For some marine biosecurity applications analysis, eDNA-only data may be sufficient, however there are an increasing number of instances where distinguishing the living portion of a community is essential. For these circumstances, we suggest only including OTUs that are present in both eDNA and eRNA data. OTUs found only in the eRNA data need to be interpreted with caution until further research provides conclusive evidence for their origin. PMID:29095959

Wanted dead or alive? Using metabarcoding of environmental DNA and RNA to distinguish living assemblages for biosecurity applications.

PubMed

Pochon, Xavier; Zaiko, Anastasija; Fletcher, Lauren M; Laroche, Olivier; Wood, Susanna A

2017-01-01

High-throughput sequencing metabarcoding studies in marine biosecurity have largely focused on targeting environmental DNA (eDNA). DNA can persist extracellularly in the environment, making discrimination of living organisms difficult. In this study, bilge water samples (i.e., water accumulating on-board a vessel during transit) were collected from 15 small recreational and commercial vessels. eDNA and eRNA molecules were co-extracted and the V4 region of the 18S ribosomal RNA gene targeted for metabarcoding. In total, 62.7% of the Operational Taxonomic Units (OTUs) were identified at least once in the corresponding eDNA and eRNA reads, with 19.5% unique to eDNA and 17.7% to eRNA. There were substantial differences in diversity between molecular compartments; 57% of sequences from eDNA-only OTUs belonged to fungi, likely originating from legacy DNA. In contrast, there was a higher percentage of metazoan (50.2%) and ciliate (31.7%) sequences in the eRNA-only OTUs. Our data suggest that the presence of eRNA-only OTUs could be due to increased cellular activities of some rare taxa that were not identified in the eDNA datasets, unusually high numbers of rRNA transcripts in ciliates, and/or artefacts produced during the reverse transcriptase, PCR and sequencing steps. The proportions of eDNA/eRNA shared and unshared OTUs were highly heterogeneous within individual bilge water samples. Multiple factors including boat type and the activities performed on-board, such as washing of scientific equipment, may play a major role in contributing to this variability. For some marine biosecurity applications analysis, eDNA-only data may be sufficient, however there are an increasing number of instances where distinguishing the living portion of a community is essential. For these circumstances, we suggest only including OTUs that are present in both eDNA and eRNA data. OTUs found only in the eRNA data need to be interpreted with caution until further research provides conclusive evidence for their origin.

Engineering of a DNA Polymerase for Direct m6 A Sequencing.

PubMed

Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas

2018-01-08

Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Label-free technology for the amplified detection of microRNA based on the allosteric hairpin DNA switch and hybridization chain reaction.

PubMed

Cai, Sheng; Cao, Zhijuan; Lau, Choiwan; Lu, Jianzhong

2014-11-21

By using the allosteric hairpin DNA switch, a novel assay for the detection of microRNA (miRNA) let-7a via a hybridization chain reaction (HCR) was introduced. Briefly, the hairpin DNA switch probe is a single-stranded DNA consisting of a streptavidin (SA) aptamer sequence, a target binding sequence and a certain sequence that acts as a trigger of the HCR. In the presence of target let-7a, the hairpin DNA switch would open and expose the stem region sequences, where a part of this sequence acts as initiator sequence strands for the HCR and triggers a cascade of hybridization events that yields nicked double helices analogous to alternating copolymers, another part is the SA aptamer sequence which activates its binding affinity to SA on SA-coated magnetic particles. The hybridization event could be sensitively detected via an instantaneous derivatization reaction between a special chemiluminescence (CL) reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG) and the guanine nucleotides within the target, the hairpin DNA switch probe, and HCR helices to form an unstable CL intermediate for the generation of light. Our results show that the coupling of the hairpin DNA switch probe and the HCR for the amplified detection of let-7a achieves a better performance (e.g. wide linear response range: 0.1-1000 fmol, low detection limit: 0.1 fmol, and high specificity). Furthermore, this approach could be easily applied to the detection of let-7a in human lung cells, and extended to detect other types of miRNA and proteins such as PDGF based on aptamers. We believe such advancements will represent a significant step towards improved diagnostics and more personalized medical treatment.

Sequence-dependent catalytic regulation of the SpoIIIE motor activity ensures directionality of DNA translocation.

PubMed

Chara, Osvaldo; Borges, Augusto; Milhiet, Pierre-Emmanuel; Nöllmann, Marcelo; Cattoni, Diego I

2018-03-27

Transport of cellular cargo by molecular motors requires directionality to ensure proper biological functioning. During sporulation in Bacillus subtilis, directionality of chromosome transport is mediated by the interaction between the membrane-bound DNA translocase SpoIIIE and specific octameric sequences (SRS). Whether SRS regulate directionality by recruiting and orienting SpoIIIE or by simply catalyzing its translocation activity is still unclear. By using atomic force microscopy and single-round fast kinetics translocation assays we determined the localization and dynamics of diffusing and translocating SpoIIIE complexes on DNA with or without SRS. Our findings combined with mathematical modelling revealed that SpoIIIE directionality is not regulated by protein recruitment to SRS but rather by a fine-tuned balance among the rates governing SpoIIIE-DNA interactions and the probability of starting translocation modulated by SRS. Additionally, we found that SpoIIIE can start translocation from non-specific DNA, providing an alternative active search mechanism for SRS located beyond the exploratory length defined by 1D diffusion. These findings are relevant in vivo in the context of chromosome transport through an open channel, where SpoIIIE can rapidly explore DNA while directionality is modulated by the probability of translocation initiation upon interaction with SRS versus non-specific DNA.

Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing.

PubMed

Yu, Stephanie C Y; Chan, K C Allen; Zheng, Yama W L; Jiang, Peiyong; Liao, Gary J W; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y; Go, Attie T J I; van Vugt, John M G; Minekawa, Ryoko; Oudejans, Cees B M; Nicolaides, Kypros H; Chiu, Rossa W K; Lo, Y M Dennis

2014-06-10

Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring.

Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing

PubMed Central

Yu, Stephanie C. Y.; Chan, K. C. Allen; Zheng, Yama W. L.; Jiang, Peiyong; Liao, Gary J. W.; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y.; Go, Attie T. J. I.; van Vugt, John M. G.; Minekawa, Ryoko; Oudejans, Cees B. M.; Nicolaides, Kypros H.; Chiu, Rossa W. K.; Lo, Y. M. Dennis

2014-01-01

Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring. PMID:24843150

Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

PubMed Central

Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

1998-01-01

The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

Intramolecular control of transcriptional activity by the NK2-specific domain in NK-2 homeodomain proteins

PubMed Central

Watada, Hirotaka; Mirmira, Raghavendra G.; Kalamaras, Julie; German, Michael S.

2000-01-01

The developmentally important homeodomain transcription factors of the NK-2 class contain a highly conserved region, the NK2-specific domain (NK2-SD). The function of this domain, however, remains unknown. The primary structure of the NK2-SD suggests that it might function as an accessory DNA-binding domain or as a protein–protein interaction interface. To assess the possibility that the NK2-SD may contribute to DNA-binding specificity, we used a PCR-based approach to identify a consensus DNA-binding sequences for Nkx2.2, an NK-2 family member involved in pancreas and central nervous system development. The consensus sequence (TCTAAGTGAGCTT) is similar to the known binding sequences for other NK-2 homeodomain proteins, but we show that the NK2-SD does not contribute significantly to specific DNA binding to this sequence. To determine whether the NK2-SD contributes to transactivation, we used GAL4-Nkx2.2 fusion constructs to map a powerful transcriptional activation domain in the C-terminal region beyond the conserved NK2-SD. Interestingly, this C-terminal region functions as a transcriptional activator only in the absence of an intact NK2-SD. The NK2-SD also can mask transactivation from the paired homeodomain transcription factor Pax6, but it has no effect on transcription by itself. These results demonstrate that the NK2-SD functions as an intramolecular regulator of the C-terminal activation domain in Nkx2.2 and support a model in which interactions through the NK2-SD regulate the ability of NK-2-class proteins to activate specific genes during development. PMID:10944215

Molecular Cloning and Analysis of a DNA Repetitive Element from the Mouse Genome

ERIC Educational Resources Information Center

Geisinger, Adriana; Cossio, Gabriela; Wettstein, Rodolfo

2006-01-01

We report the development of a 3-week laboratory activity for an undergraduate molecular biology course. This activity introduces students to the practice of basic molecular techniques such as restriction enzyme digestion, agarose gel electrophoresis, cloning, plasmid DNA purification, Southern blotting, and sequencing. Students learn how to carry…

Repetitive DNA loci and their modulation by the non-canonical nucleic acid structures R-loops and G-quadruplexes

PubMed Central

Hall, Amanda C.; Ostrowski, Lauren A.; Mekhail, Karim

2017-01-01

ABSTRACT Cells have evolved intricate mechanisms to maintain genome stability despite allowing mutational changes to drive evolutionary adaptation. Repetitive DNA sequences, which represent the bulk of most genomes, are a major threat to genome stability often driving chromosome rearrangements and disease. The major source of repetitive DNA sequences and thus the most vulnerable constituents of the genome are the rDNA (rDNA) repeats, telomeres, and transposable elements. Maintaining the stability of these loci is critical to overall cellular fitness and lifespan. Therefore, cells have evolved mechanisms to regulate rDNA copy number, telomere length and transposon activity, as well as DNA repair at these loci. In addition, non-canonical structure-forming DNA motifs can also modulate the function of these repetitive DNA loci by impacting their transcription, replication, and stability. Here, we discuss key mechanisms that maintain rDNA repeats, telomeres, and transposons in yeast and human before highlighting emerging roles for non-canonical DNA structures at these repetitive loci. PMID:28406751

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

PubMed

Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

2016-04-01

Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

PubMed Central

Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.

2015-01-01

Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

PubMed Central

Prouse, Michael B.; Campbell, Malcolm M.

2013-01-01

Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

The Epigenomic Landscape of Prokaryotes

DOE PAGES

Blow, Matthew J.; Clark, Tyson A.; Daum, Chris G.; ...

2016-02-12

DNA methylation acts in concert with restriction enzymes to protect the integrity of prokaryotic genomes. Studies in a limited number of organisms suggest that methylation also contributes to prokaryotic genome regulation, but the prevalence and properties of such non-restriction-associated methylation systems remain poorly understood. Here, we used single molecule, real-time sequencing to map DNA modifications including m6A, m4C, and m5C across the genomes of 230 diverse bacterial and archaeal species. We observed DNA methylation in nearly all (93%) organisms examined, and identified a total of 834 distinct reproducibly methylated motifs. This data enabled annotation of the DNA binding specificities ofmore » 620 DNA Methyltransferases (MTases), doubling known specificities for previously hard to study Type I, IIG and III MTases, and revealing their extraordinary diversity. Strikingly, 48% of organisms harbor active Type II MTases with no apparent cognate restriction enzyme. These active ‘orphan’ MTases are present in diverse bacterial and archaeal phyla and show motif specificities and methylation patterns consistent with functions in gene regulation and DNA replication. Our results reveal the pervasive presence of DNA methylation throughout the prokaryotic kingdoms, as well as the diversity of sequence specificities and potential functions of DNA methylation systems.« less

The Epigenomic Landscape of Prokaryotes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blow, Matthew J.; Clark, Tyson A.; Daum, Chris G.

DNA methylation acts in concert with restriction enzymes to protect the integrity of prokaryotic genomes. Studies in a limited number of organisms suggest that methylation also contributes to prokaryotic genome regulation, but the prevalence and properties of such non-restriction-associated methylation systems remain poorly understood. Here, we used single molecule, real-time sequencing to map DNA modifications including m6A, m4C, and m5C across the genomes of 230 diverse bacterial and archaeal species. We observed DNA methylation in nearly all (93%) organisms examined, and identified a total of 834 distinct reproducibly methylated motifs. This data enabled annotation of the DNA binding specificities ofmore » 620 DNA Methyltransferases (MTases), doubling known specificities for previously hard to study Type I, IIG and III MTases, and revealing their extraordinary diversity. Strikingly, 48% of organisms harbor active Type II MTases with no apparent cognate restriction enzyme. These active ‘orphan’ MTases are present in diverse bacterial and archaeal phyla and show motif specificities and methylation patterns consistent with functions in gene regulation and DNA replication. Our results reveal the pervasive presence of DNA methylation throughout the prokaryotic kingdoms, as well as the diversity of sequence specificities and potential functions of DNA methylation systems.« less

Effects of DNA Methylation and Chromatin State on Rates of Molecular Evolution in Insects.

PubMed

Glastad, Karl M; Goodisman, Michael A D; Yi, Soojin V; Hunt, Brendan G

2015-12-04

Epigenetic information is widely appreciated for its role in gene regulation in eukaryotic organisms. However, epigenetic information can also influence genome evolution. Here, we investigate the effects of epigenetic information on gene sequence evolution in two disparate insects: the fly Drosophila melanogaster, which lacks substantial DNA methylation, and the ant Camponotus floridanus, which possesses a functional DNA methylation system. We found that DNA methylation was positively correlated with the synonymous substitution rate in C. floridanus, suggesting a key effect of DNA methylation on patterns of gene evolution. However, our data suggest the link between DNA methylation and elevated rates of synonymous substitution was explained, in large part, by the targeting of DNA methylation to genes with signatures of transcriptionally active chromatin, rather than the mutational effect of DNA methylation itself. This phenomenon may be explained by an elevated mutation rate for genes residing in transcriptionally active chromatin, or by increased structural constraints on genes in inactive chromatin. This result highlights the importance of chromatin structure as the primary epigenetic driver of genome evolution in insects. Overall, our study demonstrates how different epigenetic systems contribute to variation in the rates of coding sequence evolution. Copyright © 2016 Glastad et al.

Protistan diversity and activity inferred from RNA and DNA at a coastal ocean site in the eastern North Pacific.

PubMed

Hu, Sarah K; Campbell, Victoria; Connell, Paige; Gellene, Alyssa G; Liu, Zhenfeng; Terrado, Ramon; Caron, David A

2016-04-01

Microbial eukaryotes fulfill key ecological positions in marine food webs. Molecular approaches that connect protistan diversity and biogeography to their diverse metabolisms will greatly improve our understanding of marine ecosystem function. The majority of molecular-based studies to date use 18S rRNA gene sequencing to characterize natural microbial assemblages, but this approach does not necessarily discriminate between active and non-active cells. We incorporated RNA sequencing into standard 18S rRNA gene sequence surveys with the purpose of assessing those members of the protistan community contributing to biogeochemical cycling (active organisms), using the ratio of cDNA (reverse transcribed from total RNA) to 18S rRNA gene sequences within major protistan taxonomic groups. Trophically important phytoplankton, such as diatoms and chlorophytes exhibited seasonal trends in relative activity. Additionally, both radiolaria and ciliates displayed previously unreported high relative activities below the euphotic zone. This study sheds new light on the relative metabolic activity of specific protistan groups and how microbial communities respond to changing environmental conditions. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

PubMed

Kang, J J; Yokoi, T J; Holland, M J

1995-12-01

The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

Isolation and Characterization of Burkholderia rinojensis sp. nov., a Non-Burkholderia cepacia Complex Soil Bacterium with Insecticidal and Miticidal Activities

PubMed Central

Fernandez, Lorena E.; Koivunen, Marja; Yang, April; Flor-Weiler, Lina; Marrone, Pamela G.

2013-01-01

Isolate A396, a bacterium isolated from a Japanese soil sample demonstrated strong insecticidal and miticidal activities in laboratory bioassays. The isolate was characterized through biochemical methods, fatty acid methyl ester (FAME) analysis, sequencing of 16S rRNA, multilocus sequence typing and analysis, and DNA-DNA hybridization. FAME analysis matched A396 to Burkholderia cenocepacia, but this result was not confirmed by 16S rRNA or DNA-DNA hybridization. 16S rRNA sequencing indicated closest matches with B. glumae and B. plantarii. DNA-DNA hybridization experiments with B. plantarii, B. glumae, B. multivorans, and B. cenocepacia confirmed the low genetic similarity (11.5 to 37.4%) with known members of the genus. PCR-based screening showed that A396 lacks markers associated with members of the B. cepacia complex. Bioassay results indicated two mechanisms of action: through ingestion and contact. The isolate effectively controlled beet armyworms (Spodoptera exigua; BAW) and two-spotted spider mites (Tetranychus urticae; TSSM). In diet overlay bioassays with BAW, 1% to 4% (vol/vol) dilution of the whole-cell broth caused 97% to 100% mortality 4 days postexposure, and leaf disc treatment bioassays attained 75% ± 22% mortality 3 days postexposure. Contact bioassays led to 50% larval mortality, as well as discoloration, stunting, and failure to molt. TSSM mortality reached 93% in treated leaf discs. Activity was maintained in cell-free supernatants and after heat treatment (60°C for 2 h), indicating that a secondary metabolite or excreted thermostable enzyme might be responsible for the activity. Based on these results, we describe the novel species Burkholderia rinojensis, a good candidate for the development of a biocontrol product against insect and mite pests. PMID:24096416

Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

PubMed

Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P

1993-03-31

Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

The Relationship Between Human Nucleolar Organizer Regions and Nucleoli, Probed by 3D-ImmunoFISH.

PubMed

van Sluis, Marjolein; van Vuuren, Chelly; McStay, Brian

2016-01-01

3D-immunoFISH is a valuable technique to compare the localization of DNA sequences and proteins in cells where three-dimensional structure has been preserved. As nucleoli contain a multitude of protein factors dedicated to ribosome biogenesis and form around specific chromosomal loci, 3D-immunoFISH is a particularly relevant technique for their study. In human cells, nucleoli form around transcriptionally active ribosomal gene (rDNA) arrays termed nucleolar organizer regions (NORs) positioned on the p-arms of each of the acrocentric chromosomes. Here, we provide a protocol for fixing and permeabilizing human cells grown on microscope slides such that nucleolar proteins can be visualized using antibodies and NORs visualized by DNA FISH. Antibodies against UBF recognize transcriptionally active rDNA/NORs and NOP52 antibodies provide a convenient way of visualizing the nucleolar volume. We describe a probe designed to visualize rDNA and introduce a probe comprised of NOR distal sequences, which can be used to identify or count individual NORs.

DNA transposon activity is associated with increased mutation rates in genes of rice and other grasses

PubMed Central

Wicker, Thomas; Yu, Yeisoo; Haberer, Georg; Mayer, Klaus F. X.; Marri, Pradeep Reddy; Rounsley, Steve; Chen, Mingsheng; Zuccolo, Andrea; Panaud, Olivier; Wing, Rod A.; Roffler, Stefan

2016-01-01

DNA (class 2) transposons are mobile genetic elements which move within their ‘host' genome through excising and re-inserting elsewhere. Although the rice genome contains tens of thousands of such elements, their actual role in evolution is still unclear. Analysing over 650 transposon polymorphisms in the rice species Oryza sativa and Oryza glaberrima, we find that DNA repair following transposon excisions is associated with an increased number of mutations in the sequences neighbouring the transposon. Indeed, the 3,000 bp flanking the excised transposons can contain over 10 times more mutations than the genome-wide average. Since DNA transposons preferably insert near genes, this is correlated with increases in mutation rates in coding sequences and regulatory regions. Most importantly, we find this phenomenon also in maize, wheat and barley. Thus, these findings suggest that DNA transposon activity is a major evolutionary force in grasses which provide the basis of most food consumed by humankind. PMID:27599761

Active Site Sharing and Subterminal Hairpin Recognition in a New Class of DNA Transposases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ronning, Donald R.; Guynet, Catherine; Ton-Hoang, Bao

2010-07-20

Many bacteria harbor simple transposable elements termed insertion sequences (IS). In Helicobacter pylori, the chimeric IS605 family elements are particularly interesting due to their proximity to genes encoding gastric epithelial invasion factors. Protein sequences of IS605 transposases do not bear the hallmarks of other well-characterized transposases. We have solved the crystal structure of full-length transposase (TnpA) of a representative member, ISHp608. Structurally, TnpA does not resemble any characterized transposase; rather, it is related to rolling circle replication (RCR) proteins. Consistent with RCR, Mg{sup 2+} and a conserved tyrosine, Tyr127, are essential for DNA nicking and the formation of a covalentmore » intermediate between TnpA and DNA. TnpA is dimeric, contains two shared active sites, and binds two DNA stem loops representing the conserved inverted repeats near each end of ISHp608. The cocrystal structure with stem-loop DNA illustrates how this family of transposases specifically recognizes and pairs ends, necessary steps during transposition.« less

Active role of a human genomic insert in replication of a yeast artificial chromosome.

PubMed

van Brabant, A J; Fangman, W L; Brewer, B J

1999-06-01

Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

GATA: A graphic alignment tool for comparative sequenceanalysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nix, David A.; Eisen, Michael B.

2005-01-01

Several problems exist with current methods used to align DNA sequences for comparative sequence analysis. Most dynamic programming algorithms assume that conserved sequence elements are collinear. This assumption appears valid when comparing orthologous protein coding sequences. Functional constraints on proteins provide strong selective pressure against sequence inversions, and minimize sequence duplications and feature shuffling. For non-coding sequences this collinearity assumption is often invalid. For example, enhancers contain clusters of transcription factor binding sites that change in number, orientation, and spacing during evolution yet the enhancer retains its activity. Dotplot analysis is often used to estimate non-coding sequence relatedness. Yet dotmore » plots do not actually align sequences and thus cannot account well for base insertions or deletions. Moreover, they lack an adequate statistical framework for comparing sequence relatedness and are limited to pairwise comparisons. Lastly, dot plots and dynamic programming text outputs fail to provide an intuitive means for visualizing DNA alignments.« less

Identifying sites of replication initiation in yeast chromosomes: looking for origins in all the right places.

PubMed

van Brabant, A J; Hunt, S Y; Fangman, W L; Brewer, B J

1998-06-01

DNA fragments that contain an active origin of replication generate bubble-shaped replication intermediates with diverging forks. We describe two methods that use two-dimensional (2-D) agarose gel electrophoresis along with DNA sequence information to identify replication origins in natural and artificial Saccharomyces cerevisiae chromosomes. The first method uses 2-D gels of overlapping DNA fragments to locate an active chromosomal replication origin within a region known to confer autonomous replication on a plasmid. A variant form of 2-D gels can be used to determine the direction of fork movement, and the second method uses this technique to find restriction fragments that are replicated by diverging forks, indicating that a bidirectional replication origin is located between the two fragments. Either of these two methods can be applied to the analysis of any genomic region for which there is DNA sequence information or an adequate restriction map.

ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

PubMed Central

Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

1997-01-01

ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063

Role of sequence encoded κB DNA geometry in gene regulation by Dorsal

PubMed Central

Mrinal, Nirotpal; Tomar, Archana; Nagaraju, Javaregowda

2011-01-01

Many proteins of the Rel family can act as both transcriptional activators and repressors. However, mechanism that discerns the ‘activator/repressor’ functions of Rel-proteins such as Dorsal (Drosophila homologue of mammalian NFκB) is not understood. Using genomic, biophysical and biochemical approaches, we demonstrate that the underlying principle of this functional specificity lies in the ‘sequence-encoded structure’ of the κB-DNA. We show that Dorsal-binding motifs exist in distinct activator and repressor conformations. Molecular dynamics of DNA-Dorsal complexes revealed that repressor κB-motifs typically have A-tract and flexible conformation that facilitates interaction with co-repressors. Deformable structure of repressor motifs, is due to changes in the hydrogen bonding in A:T pair in the ‘A-tract’ core. The sixth nucleotide in the nonameric κB-motif, ‘A’ (A6) in the repressor motifs and ‘T’ (T6) in the activator motifs, is critical to confer this functional specificity as A6 → T6 mutation transformed flexible repressor conformation into a rigid activator conformation. These results highlight that ‘sequence encoded κB DNA-geometry’ regulates gene expression by exerting allosteric effect on binding of Rel proteins which in turn regulates interaction with co-regulators. Further, we identified and characterized putative repressor motifs in Dl-target genes, which can potentially aid in functional annotation of Dorsal gene regulatory network. PMID:21890896

Scar-less multi-part DNA assembly design automation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hillson, Nathan J.

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

Non-B-Form DNA Is Enriched at Centromeres

PubMed Central

Henikoff, Steven

2018-01-01

Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

PubMed

Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

2018-05-23

Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

Targeted DNA demethylation in human cells by fusion of a plant 5-methylcytosine DNA glycosylase to a sequence-specific DNA binding domain

PubMed Central

Parrilla-Doblas, Jara Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa

2017-01-01

ABSTRACT DNA methylation is a crucial epigenetic mark associated to gene silencing, and its targeted removal is a major goal of epigenetic editing. In animal cells, DNA demethylation involves iterative 5mC oxidation by TET enzymes followed by replication-dependent dilution and/or replication-independent DNA repair of its oxidized derivatives. In contrast, plants use specific DNA glycosylases that directly excise 5mC and initiate its substitution for unmethylated C in a base excision repair process. In this work, we have fused the catalytic domain of Arabidopsis ROS1 5mC DNA glycosylase (ROS1_CD) to the DNA binding domain of yeast GAL4 (GBD). We show that the resultant GBD-ROS1_CD fusion protein binds specifically a GBD-targeted DNA sequence in vitro. We also found that transient in vivo expression of GBD-ROS1_CD in human cells specifically reactivates transcription of a methylation-silenced reporter gene, and that such reactivation requires both ROS1_CD catalytic activity and GBD binding capacity. Finally, we show that reactivation induced by GBD-ROS1_CD is accompanied by decreased methylation levels at several CpG sites of the targeted promoter. All together, these results show that plant 5mC DNA glycosylases can be used for targeted active DNA demethylation in human cells. PMID:28277978

Reading of the non-template DNA by transcription elongation factors.

PubMed

Svetlov, Vladimir; Nudler, Evgeny

2018-05-14

Unlike transcription initiation and termination, which have easily discernable signals such as promoters and terminators, elongation is regulated through a dynamic network involving RNA/DNA pause signals and states- rather than sequence-specific protein interactions. A report by Nedialkov et al. (in press) provides experimental evidence for sequence-specific recruitment of elongation factor RfaH to transcribing RNA polymerase (RNAP) and outlines the mechanism of gene expression regulation by restraint ("locking") of the DNA non-template strand. According to this model, the elongation complex pauses at the so called "operon polarity sequence" (found in some long bacterial operons coding for virulence genes), when the usually flexible non-template DNA strand adopts a distinct hairpin-loop conformation on the surface of transcribing RNAP. Sequence-specific binding of RfaH to this DNA segment facilitates conversion of RfaH from its inactive closed to its active open conformation. The interaction network formed between RfaH, non-template DNA, and RNAP locks DNA in a conformation that renders the elongation complex resistant to pausing and termination. The effects of such locking on transcript elongation can be mimicked by restraint of the non-template strand due to its shortening. This work advances our understanding of regulation of transcript elongation and has important implications for the action of general transcription factors, such as NusG, which lack apparent sequence-specificity, as well as for the mechanisms of other processes linked to transcription such as transcription-coupled DNA repair. This article is protected by copyright. All rights reserved. © 2018 John Wiley & Sons Ltd.

Ribosomal DNA replication fork barrier and HOT1 recombination hot spot: shared sequences but independent activities.

PubMed

Ward, T R; Hoang, M L; Prusty, R; Lau, C K; Keil, R L; Fangman, W L; Brewer, B J

2000-07-01

In the ribosomal DNA of Saccharomyces cerevisiae, sequences in the nontranscribed spacer 3' of the 35S ribosomal RNA gene are important to the polar arrest of replication forks at a site called the replication fork barrier (RFB) and also to the cis-acting, mitotic hyperrecombination site called HOT1. We have found that the RFB and HOT1 activity share some but not all of their essential sequences. Many of the mutations that reduce HOT1 recombination also decrease or eliminate fork arrest at one of two closely spaced RFB sites, RFB1 and RFB2. A simple model for the juxtaposition of RFB and HOT1 sequences is that the breakage of strands in replication forks arrested at RFB stimulates recombination. Contrary to this model, we show here that HOT1-stimulated recombination does not require the arrest of forks at the RFB. Therefore, while HOT1 activity is independent of replication fork arrest, HOT1 and RFB require some common sequences, suggesting the existence of a common trans-acting factor(s).

Autonomous replication of nucleic acids by polymerization/nicking enzyme/DNAzyme cascades for the amplified detection of DNA and the aptamer-cocaine complex.

PubMed

Wang, Fuan; Freage, Lina; Orbach, Ron; Willner, Itamar

2013-09-03

The progressive development of amplified DNA sensors and aptasensors using replication/nicking enzymes/DNAzyme machineries is described. The sensing platforms are based on the tailoring of a DNA template on which the recognition of the target DNA or the formation of the aptamer-substrate complex trigger on the autonomous isothermal replication/nicking processes and the displacement of a Mg(2+)-dependent DNAzyme that catalyzes the generation of a fluorophore-labeled nucleic acid acting as readout signal for the analyses. Three different DNA sensing configurations are described, where in the ultimate configuration the target sequence is incorporated into a nucleic acid blocker structure associated with the sensing template. The target-triggered isothermal autonomous replication/nicking process on the modified template results in the formation of the Mg(2+)-dependent DNAzyme tethered to a free strand consisting of the target sequence. This activates additional template units for the nucleic acid self-replication process, resulting in the ultrasensitive detection of the target DNA (detection limit 1 aM). Similarly, amplified aptamer-based sensing platforms for cocaine are developed along these concepts. The modification of the cocaine-detection template by the addition of a nucleic acid sequence that enables the autonomous secondary coupled activation of a polymerization/nicking machinery and DNAzyme generation path leads to an improved analysis of cocaine (detection limit 10 nM).

Incidence of genome structure, DNA asymmetry, and cell physiology on T-DNA integration in chromosomes of the phytopathogenic fungus Leptosphaeria maculans.

PubMed

Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry

2012-08-01

The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.

The Relative Abundance and Transcriptional Activity of Marine Sponge-Associated Microorganisms Emphasizing Groups Involved in Sulfur Cycle.

PubMed

Jensen, Sigmund; Fortunato, Sofia A V; Hoffmann, Friederike; Hoem, Solveig; Rapp, Hans Tore; Øvreås, Lise; Torsvik, Vigdis L

2017-04-01

During the last decades, our knowledge about the activity of sponge-associated microorganisms and their contribution to biogeochemical cycling has gradually increased. Functional groups involved in carbon and nitrogen metabolism are well documented, whereas knowledge about microorganisms involved in the sulfur cycle is still limited. Both sulfate reduction and sulfide oxidation has been detected in the cold water sponge Geodia barretti from Korsfjord in Norway, and with specimens from this site, the present study aims to identify extant versus active sponge-associated microbiota with focus on sulfur metabolism. Comparative analysis of small subunit ribosomal RNA (16S rRNA) gene (DNA) and transcript (complementary DNA (cDNA)) libraries revealed profound differences. The transcript library was predominated by Chloroflexi despite their low abundance in the gene library. An opposite result was found for Acidobacteria. Proteobacteria were detected in both libraries with representatives of the Alpha- and Gammaproteobacteria related to clades with presumably thiotrophic bacteria from sponges and other marine invertebrates. Sequences that clustered with sponge-associated Deltaproteobacteria were remotely related to cultivated sulfate-reducing bacteria. The microbes involved in sulfur cycling were identified by the functional gene aprA (adenosine-5'-phosphosulfate reductase) and its transcript. Of the aprA sequences (DNA and cDNA), 87 % affiliated with sulfur-oxidizing bacteria. They clustered with Alphaproteobacteria and with clades of deep-branching Gammaproteobacteria. The remaining sequences clustered with sulfate-reducing Archaea of the phylum Euryarchaeota. These results indicate an active role of yet uncharacterized Bacteria and Archaea in the sponge's sulfur cycle.

ILG1 : a new integrase-like gene that is a marker of bacterial contamination by the laboratory Escherichia coli strain TOP10F'.

PubMed Central

Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.

2002-01-01

BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938

Molecular cloning and sequencing of the cDNA and gene for a novel elastinolytic metalloproteinase from Aspergillus fumigatus and its expression in Escherichia coli.

PubMed Central

Sirakova, T D; Markaryan, A; Kolattukudy, P E

1994-01-01

An extracellular elastinolytic metalloproteinase, purified from Aspergillus fumigatus isolated from an aspergillosis and patient/and an internal peptide derived from it were subjected to N-terminal sequencing. Oligonucleotide primers based on these sequences were used to PCR amplify a segment of the metalloproteinase cDNA, which was used as a probe to isolate the cDNA and gene for this enzyme. The gene sequence matched exactly with the cDNA sequence except for the four introns that interrupted the open reading frame. According to the deduced amino acid sequence, the metalloproteinase has a signal sequence and 227 additional amino acids preceding the sequence for the mature protein of 389 amino acids with a calculated molecular mass of 42 kDa, which is close to the size of the purified mature fungal proteinase. This sequence contains segments that matched both the N terminus of the mature protein and the internal peptide. A. fumigatus metalloproteinase contains some of the conserved zinc-binding and active-site motifs characteristic of metalloproteinases but shows no overall homology with known metalloproteinases. The cDNA of the mature protein when introduced into Escherichia coli directed the expression of a protein with a size, N-terminal sequence, and immunological cross-reactivity identical to those of the native fungal enzyme. Although the enzyme in the inclusion bodies could not be renatured, expression at 30 degrees C yielded soluble enzyme that showed chromatographic behavior identical to that of the native fungal enzyme and catalyzed hydrolysis of elastin. The metalloproteinase gene described here was not found in Aspergillus flavus. Images PMID:7927676

Composition and immuno-stimulatory properties of extracellular DNA from mouse gut flora.

PubMed

Qi, Ce; Li, Ya; Yu, Ren-Qiang; Zhou, Sheng-Li; Wang, Xing-Guo; Le, Guo-Wei; Jin, Qing-Zhe; Xiao, Hang; Sun, Jin

2017-11-28

To demonstrate that specific bacteria might release bacterial extracellular DNA (eDNA) to exert immunomodulatory functions in the mouse small intestine. Extracellular DNA was extracted using phosphate buffered saline with 0.5 mmol/L dithiothreitol combined with two phenol extractions. TOTO-1 iodide, a cell-impermeant and high-affinity nucleic acid stain, was used to confirm the existence of eDNA in the mucus layers of the small intestine and colon in healthy Male C57BL/6 mice. Composition difference of eDNA and intracellular DNA (iDNA) of the small intestinal mucus was studied by Illumina sequencing and terminal restriction fragment length polymorphism (T-RFLP). Stimulation of cytokine production by eDNA was studied in RAW264.7 cells in vitro . TOTO-1 iodide staining confirmed existence of eDNA in loose mucus layer of the mouse colon and thin surface mucus layer of the small intestine. Illumina sequencing analysis and T-RFLP revealed that the composition of the eDNA in the small intestinal mucus was significantly different from that of the iDNA of the small intestinal mucus bacteria. Illumina Miseq sequencing showed that the eDNA sequences came mainly from Gram-negative bacteria of Bacteroidales S24-7. By contrast, predominant bacteria of the small intestinal flora comprised Gram-positive bacteria. Both eDNA and iDNA were added to native or lipopolysaccharide-stimulated Raw267.4 macrophages, respectively. The eDNA induced significantly lower tumor necrosis factor-α/interleukin-10 (IL-10) and IL-6/IL-10 ratios than iDNA, suggesting the predominance for maintaining immune homeostasis of the gut. Our results indicated that degraded bacterial genomic DNA was mainly released by Gram-negative bacteria, especially Bacteroidales-S24-7 and Stenotrophomonas genus in gut mucus of mice. They decreased pro-inflammatory activity compared to total gut flora genomic DNA.

Preparation of fosmid libraries and functional metagenomic analysis of microbial community DNA.

PubMed

Martínez, Asunción; Osburne, Marcia S

2013-01-01

One of the most important challenges in contemporary microbial ecology is to assign a functional role to the large number of novel genes discovered through large-scale sequencing of natural microbial communities that lack similarity to genes of known function. Functional screening of metagenomic libraries, that is, screening environmental DNA clones for the ability to confer an activity of interest to a heterologous bacterial host, is a promising approach for bridging the gap between metagenomic DNA sequencing and functional characterization. Here, we describe methods for isolating environmental DNA and constructing metagenomic fosmid libraries, as well as methods for designing and implementing successful functional screens of such libraries. © 2013 Elsevier Inc. All rights reserved.

TALE proteins search DNA using a rotationally decoupled mechanism.

PubMed

Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M

2016-10-01

Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins used extensively for gene editing. Despite recent progress, however, little is known about their sequence search mechanism. Here, we use single-molecule experiments to study TALE search along DNA. Our results show that TALEs utilize a rotationally decoupled mechanism for nonspecific search, despite remaining associated with DNA templates during the search process. Our results suggest that the protein helical structure enables TALEs to adopt a loosely wrapped conformation around DNA templates during nonspecific search, facilitating rapid one-dimensional (1D) diffusion under a range of solution conditions. Furthermore, this model is consistent with a previously reported two-state mechanism for TALE search that allows these proteins to overcome the search speed-stability paradox. Taken together, our results suggest that TALE search is unique among the broad class of sequence-specific DNA-binding proteins and supports efficient 1D search along DNA.

A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

PubMed

Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

1994-12-01

We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

DNA replication-timing analysis of human chromosome 22 at high resolution and different developmental states.

PubMed

White, Eric J; Emanuelsson, Olof; Scalzo, David; Royce, Thomas; Kosak, Steven; Oakeley, Edward J; Weissman, Sherman; Gerstein, Mark; Groudine, Mark; Snyder, Michael; Schübeler, Dirk

2004-12-21

Duplication of the genome during the S phase of the cell cycle does not occur simultaneously; rather, different sequences are replicated at different times. The replication timing of specific sequences can change during development; however, the determinants of this dynamic process are poorly understood. To gain insights into the contribution of developmental state, genomic sequence, and transcriptional activity to replication timing, we investigated the timing of DNA replication at high resolution along an entire human chromosome (chromosome 22) in two different cell types. The pattern of replication timing was correlated with respect to annotated genes, gene expression, novel transcribed regions of unknown function, sequence composition, and cytological features. We observed that chromosome 22 contains regions of early- and late-replicating domains of 100 kb to 2 Mb, many (but not all) of which are associated with previously described chromosomal bands. In both cell types, expressed sequences are replicated earlier than nontranscribed regions. However, several highly transcribed regions replicate late. Overall, the DNA replication-timing profiles of the two different cell types are remarkably similar, with only nine regions of difference observed. In one case, this difference reflects the differential expression of an annotated gene that resides in this region. Novel transcribed regions with low coding potential exhibit a strong propensity for early DNA replication. Although the cellular function of such transcripts is poorly understood, our results suggest that their activity is linked to the replication-timing program.

[Transcription activator-like effectors(TALEs)based genome engineering].

PubMed

Zhao, Mei-Wei; Duan, Cheng-Li; Liu, Jiang

2013-10-01

Systematic reverse-engineering of functional genome architecture requires precise modifications of gene sequences and transcription levels. The development and application of transcription activator-like effectors(TALEs) has created a wealth of genome engineering possibilities. TALEs are a class of naturally occurring DNA-binding proteins found in the plant pathogen Xanthomonas species. The DNA-binding domain of each TALE typically consists of tandem 34-amino acid repeat modules rearranged according to a simple cipher to target new DNA sequences. Customized TALEs can be used for a wide variety of genome engineering applications, including transcriptional modulation and genome editing. Such "genome engineering" has now been established in human cells and a number of model organisms, thus opening the door to better understanding gene function in model organisms, improving traits in crop plants and treating human genetic disorders.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

2013-06-25

A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

2011-01-18

A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

PubMed

Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

2012-11-01

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Inhibition of HMGA2 binding to DNA by netropsin

PubMed Central

Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

2008-01-01

The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

Design, synthesis and DNA interactions of a chimera between a platinum complex and an IHF mimicking peptide.

PubMed

Rao, Harita; Damian, Mariana S; Alshiekh, Alak; Elmroth, Sofi K C; Diederichsen, Ulf

2015-12-28

Conjugation of metal complexes with peptide scaffolds possessing high DNA binding affinity has shown to modulate their biological activities and to enhance their interaction with DNA. In this work, a platinum complex/peptide chimera was synthesized based on a model of the Integration Host Factor (IHF), an architectural protein possessing sequence specific DNA binding and bending abilities through its interaction with a minor groove. The model peptide consists of a cyclic unit resembling the minor grove binding subdomain of IHF, a positively charged lysine dendrimer for electrostatic interactions with the DNA phosphate backbone and a flexible glycine linker tethering the two units. A norvaline derived artificial amino acid was designed to contain a dimethylethylenediamine as a bidentate platinum chelating unit, and introduced into the IHF mimicking peptides. The interaction of the chimeric peptides with various DNA sequences was studied by utilizing the following experiments: thermal melting studies, agarose gel electrophoresis for plasmid DNA unwinding experiments, and native and denaturing gel electrophoresis to visualize non-covalent and covalent peptide-DNA adducts, respectively. By incorporation of the platinum metal center within the model peptide mimicking IHF we have attempted to improve its specificity and DNA targeting ability, particularly towards those sequences containing adjacent guanine residues.

A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.

PubMed

Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza

2016-08-15

In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

Traceless splicing enabled by substrate-induced activation of the Nostoc punctiforme Npu DnaE intein after mutation of a catalytic cysteine to serine.

PubMed

Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine

2014-12-12

Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.

Titration of DnaA protein by oriC DnaA-boxes increases dnaA gene expression in Escherichia coli.

PubMed Central

Hansen, F G; Koefoed, S; Sørensen, L; Atlung, T

1987-01-01

Binding of the DnaA protein to its binding sites, the DnaA-boxes (TTATCCACA), was measured by a simple physiological approach. The presence of extra DnaA-boxes in growing cells leads to a derepression of dnaA gene expression, measured as beta-galactosidase activity of a dnaA-lacZ fusion polypeptide. Different DnaA-boxes caused different degrees of derepression indicating that the DnaA protein requires sequences in addition to the DnaA-box for efficient binding. The DnaA-boxes in oriC might act cooperatively in binding of the DnaA protein. The derepressed levels of DnaA protein obtained in a strain carrying an oriC+-pBR322 chimera were very high and sufficient to activate oriC on the chimeric plasmid, which was maintained at a copy number more than three times that of pBR322. PMID:3034578

The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome.

PubMed

González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred; Llosa, Matxalen

2017-06-15

Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. Copyright © 2017 American Society for Microbiology.

The Conjugative Relaxase TrwC Promotes Integration of Foreign DNA in the Human Genome

PubMed Central

González-Prieto, Coral; Gabriel, Richard; Dehio, Christoph; Schmidt, Manfred

2017-01-01

ABSTRACT Bacterial conjugation is a mechanism of horizontal DNA transfer. The relaxase TrwC of the conjugative plasmid R388 cleaves one strand of the transferred DNA at the oriT gene, covalently attaches to it, and leads the single-stranded DNA (ssDNA) into the recipient cell. In addition, TrwC catalyzes site-specific integration of the transferred DNA into its target sequence present in the genome of the recipient bacterium. Here, we report the analysis of the efficiency and specificity of the integrase activity of TrwC in human cells, using the type IV secretion system of the human pathogen Bartonella henselae to introduce relaxase-DNA complexes. Compared to Mob relaxase from plasmid pBGR1, we found that TrwC mediated a 10-fold increase in the rate of plasmid DNA transfer to human cells and a 100-fold increase in the rate of chromosomal integration of the transferred DNA. We used linear amplification-mediated PCR and plasmid rescue to characterize the integration pattern in the human genome. DNA sequence analysis revealed mostly reconstituted oriT sequences, indicating that TrwC is active and recircularizes transferred DNA in human cells. One TrwC-mediated site-specific integration event was detected, proving that TrwC is capable of mediating site-specific integration in the human genome, albeit with very low efficiency compared to the rate of random integration. Our results suggest that TrwC may stabilize the plasmid DNA molecules in the nucleus of the human cell, probably by recircularization of the transferred DNA strand. This stabilization would increase the opportunities for integration of the DNA by the host machinery. IMPORTANCE Different biotechnological applications, including gene therapy strategies, require permanent modification of target cells. Long-term expression is achieved either by extrachromosomal persistence or by integration of the introduced DNA. Here, we studied the utility of conjugative relaxase TrwC, a bacterial protein with site-specific integrase activity in bacteria, as an integrase in human cells. Although it is not efficient as a site-specific integrase, we found that TrwC is active in human cells and promotes random integration of the transferred DNA in the human genome, probably acting as a DNA chaperone until it is integrated by host mechanisms. TrwC-DNA complexes can be delivered to human cells through a type IV secretion system involved in pathogenesis. Thus, TrwC could be used in vivo to transfer the DNA of interest into the appropriate cell and promote its integration. If used in combination with a site-specific nuclease, it could lead to site-specific integration of the incoming DNA by homologous recombination. PMID:28411218

No evidence of genome editing activity from Natronobacterium gregoryi Argonaute (NgAgo) in human cells.

PubMed

Javidi-Parsijani, Parisa; Niu, Guoguang; Davis, Meghan; Lu, Pin; Atala, Anthony; Lu, Baisong

2017-01-01

The argonaute protein from the thermophilic bacterium Thermus thermophilus shows DNA-guided DNA interfering activity at high temperatures, complicating its application in mammalian cells. A recent work reported that the argonaute protein from Natronobacterium gregoryi (NgAgo) had DNA-guided genome editing activity in mammalian cells. We compared the genome editing activities of NgAgo and Staphylococcus aureus Cas9 (SaCas9) in human HEK293T cells side by side. EGFP reporter assays and DNA sequencing consistently revealed high genome editing activity from SaCas9. However, these assays did not demonstrate genome editing activity by NgAgo. We confirmed that the conditions allowed simultaneous transfection of the NgAgo expressing plasmid DNA and DNA guides, as well as heterologous expression of NgAgo in the HEK293T cells. Our data show that NgAgo is not a robust genome editing tool, although it may have such activity under other conditions.

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain

PubMed Central

de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

2014-01-01

The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. PMID:24792163

Diversity of the Arabidopsis mitochondrial genome occurs via nuclear-controlled recombination activity.

PubMed

Arrieta-Montiel, Maria P; Shedge, Vikas; Davila, Jaime; Christensen, Alan C; Mackenzie, Sally A

2009-12-01

The plant mitochondrial genome is recombinogenic, with DNA exchange activity controlled to a large extent by nuclear gene products. One nuclear gene, MSH1, appears to participate in suppressing recombination in Arabidopsis at every repeated sequence ranging in size from 108 to 556 bp. Present in a wide range of plant species, these mitochondrial repeats display evidence of successful asymmetric DNA exchange in Arabidopsis when MSH1 is disrupted. Recombination frequency appears to be influenced by repeat sequence homology and size, with larger size repeats corresponding to increased DNA exchange activity. The extensive mitochondrial genomic reorganization of the msh1 mutant produced altered mitochondrial transcription patterns. Comparison of mitochondrial genomes from the Arabidopsis ecotypes C24, Col-0, and Ler suggests that MSH1 activity accounts for most or all of the polymorphisms distinguishing these genomes, producing ecotype-specific stoichiometric changes in each line. Our observations suggest that MSH1 participates in mitochondrial genome evolution by influencing the lineage-specific pattern of mitochondrial genetic variation in higher plants.

The dynamics of genome replication using deep sequencing

PubMed Central

Müller, Carolin A.; Hawkins, Michelle; Retkute, Renata; Malla, Sunir; Wilson, Ray; Blythe, Martin J.; Nakato, Ryuichiro; Komata, Makiko; Shirahige, Katsuhiko; de Moura, Alessandro P.S.; Nieduszynski, Conrad A.

2014-01-01

Eukaryotic genomes are replicated from multiple DNA replication origins. We present complementary deep sequencing approaches to measure origin location and activity in Saccharomyces cerevisiae. Measuring the increase in DNA copy number during a synchronous S-phase allowed the precise determination of genome replication. To map origin locations, replication forks were stalled close to their initiation sites; therefore, copy number enrichment was limited to origins. Replication timing profiles were generated from asynchronous cultures using fluorescence-activated cell sorting. Applying this technique we show that the replication profiles of haploid and diploid cells are indistinguishable, indicating that both cell types use the same cohort of origins with the same activities. Finally, increasing sequencing depth allowed the direct measure of replication dynamics from an exponentially growing culture. This is the first time this approach, called marker frequency analysis, has been successfully applied to a eukaryote. These data provide a high-resolution resource and methodological framework for studying genome biology. PMID:24089142

Cloning, expression and activation of a truncated 92-kDa gelatinase minienzyme.

PubMed

Kröger, M; Tschesche, H

1997-09-01

The matrix metalloproteinases (MMPs) are a family of highly homologous zinc-endopeptidases that degrade extracellular matrix components. Human 92-kDa gelatinase (MMP-9) represents one of the MMPs that cleaves native collagen type IV. As a basis for structural investigations, the short form (catalytic domain, amino acid residues 113-450) of the 92-kDa gelatinase cDNA was cloned and expressed in E. coli as a minienzyme. By combination of reverse transcription (RT) and polymerase chain reaction (PCR), the truncated 92-kDa gelatinase-cDNA was amplified from the corresponding mRNA derived from ovarian carcinoma cells. The cDNA fragment obtained was cloned in E. coli and sequenced. With the exception of one nucleotide inversion at position 745 (gt-->tg) the cDNA sequence was identical to the nucleotide sequence of the 92-kDa gelatinase as has been previously reported. The protein was expressed in E. coli using the vector pET-12b. The recombinant protein was stored in inclusion bodies and extracted as a 38 kDa species from the inclusion bodies by solubilization in 8 M urea. The product was purified by affinity chromatography and gel filtration. Amino-terminal sequence analysis confirmed the identity with the catalytic domain of 92-kDa gelatinase. The recombinant protein was refolded in the presence of Ca2+ and Zn2+ and yielded an active minienzyme with gelatinolytic activity. It degrades the native substrate collagen type IV and the synthetic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 x AcOH like the full-length 92-kDa gelatinase. The catalytic activity could be inhibited by the specific MMP inhibitors TIMP-1 and TIMP-2.

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

Cloning and sequencing of a gene encoding a novel extracellular neutral proteinase from Streptomyces sp. strain C5 and expression of the gene in Streptomyces lividans 1326.

PubMed Central

Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R

1992-01-01

The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011

The influence of sequence context and length on the kinetics of DNA duplex formation from complementary hairpins possessing (CNG) repeats.

PubMed

Paiva, Anthony M; Sheardy, Richard D

2005-04-20

The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.

An AP Endonuclease Functions in Active DNA Demethylation and Gene Imprinting in Arabidopsis

PubMed Central

Li, Yan; Córdoba-Cañero, Dolores; Qian, Weiqiang; Zhu, Xiaohong; Tang, Kai; Zhang, Huiming; Ariza, Rafael R.; Roldán-Arjona, Teresa; Zhu, Jian-Kang

2015-01-01

Active DNA demethylation in plants occurs through base excision repair, beginning with removal of methylated cytosine by the ROS1/DME subfamily of 5-methylcytosine DNA glycosylases. Active DNA demethylation in animals requires the DNA glycosylase TDG or MBD4, which functions after oxidation or deamination of 5-methylcytosine, respectively. However, little is known about the steps following DNA glycosylase action in the active DNA demethylation pathways in plants and animals. We show here that the Arabidopsis APE1L protein has apurinic/apyrimidinic endonuclease activities and functions downstream of ROS1 and DME. APE1L and ROS1 interact in vitro and co-localize in vivo. Whole genome bisulfite sequencing of ape1l mutant plants revealed widespread alterations in DNA methylation. We show that the ape1l/zdp double mutant displays embryonic lethality. Notably, the ape1l+/−zdp−/− mutant shows a maternal-effect lethality phenotype. APE1L and the DNA phosphatase ZDP are required for FWA and MEA gene imprinting in the endosperm and are important for seed development. Thus, APE1L is a new component of the active DNA demethylation pathway and, together with ZDP, regulates gene imprinting in Arabidopsis. PMID:25569774

Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.

PubMed

Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C

2017-03-21

A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.

Mechanism for CCC DNA synthesis in hepadnaviruses.

PubMed

Sohn, Ji A; Litwin, Samuel; Seeger, Christoph

2009-11-30

Hepadnavirus replication requires the synthesis of a covalently closed circular (CCC) DNA from the relaxed circular (RC) viral genome by an unknown mechanism. CCC DNA formation could require enzymatic activities of the viral reverse transcriptase (RT), or cellular DNA repair enzymes, or both. Physical mapping of the 5' and 3' ends of RC DNA and sequence analysis of CCC DNA revealed that CCC DNA synthesis requires the removal of the RT and an RNA oligomer from the 5' ends of minus and plus strand DNA, respectively, removal of sequences from the terminally redundant minus strand, completion of the less than full-length plus strand, and ligation of the ends. Two models have been proposed that could explain CCC DNA formation. The first (model 1) invokes a role for the RT to catalyze a cleavage-ligation reaction leading to the formation of a unit length minus strand in CCC DNA and a DNA repair reaction for the completion and ligation of plus strand DNA; the second (model 2) predicts that CCC DNA formation depends entirely on cellular DNA repair enzymes. To determine which mechanism is utilized, we developed cell lines expressing duck hepatitis B virus genomes carrying mutations permitting us to follow the fate of viral DNA sequences during their conversion from RC to CCC DNA. Our results demonstrated that the oligomer at the 5' end of minus strand DNA is completely or at least partially removed prior to CCC DNA synthesis. The results indicated that both RC DNA strands undergo DNA repair reactions carried out by the cellular DNA repair machinery as predicted by model 2. Thus, our study provided the basis for the identification of the cellular components required for CCC DNA formation.

Non-invasive prenatal testing using massively parallel sequencing of maternal plasma DNA: from molecular karyotyping to fetal whole-genome sequencing.

PubMed

Lo, Y M Dennis

2013-12-01

The discovery of cell-free fetal DNA in maternal plasma in 1997 has stimulated a rapid development of non-invasive prenatal testing. The recent advent of massively parallel sequencing has allowed the analysis of circulating cell-free fetal DNA to be performed with unprecedented sensitivity and precision. Fetal trisomies 21, 18 and 13 are now robustly detectable in maternal plasma and such analyses have been available clinically since 2011. Fetal genome-wide molecular karyotyping and whole-genome sequencing have now been demonstrated in a number of proof-of-concept studies. Genome-wide and targeted sequencing of maternal plasma has been shown to allow the non-invasive prenatal testing of β-thalassaemia and can potentially be generalized to other monogenic diseases. It is thus expected that plasma DNA-based non-invasive prenatal testing will play an increasingly important role in future obstetric care. It is thus timely and important that the ethical, social and legal issues of non-invasive prenatal testing be discussed actively by all parties involved in prenatal care. Copyright © 2013 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

The molecular biology of environmental aromatic hydrocarbons: Progress report for the period September 1, 1986 through July 31, 1987

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weiss, S.B.

Our laboratory has explored the use of short DNA oligomers as targets for activated polycyclic aromatic hydrocarbons, such as benzo(a)pyrene diol epoxide (BPDE), in order to detect alterations in DNA sequence arrangement. In this model system, oligomers alkylated with (+)-BPDE are ligated into M13 viral DNA and used to transfect Escherichia coli. These cells are plated on agar, incubated at 37/sup 0/C, progeny viral clones are selected, amplified, and the viral DNAs isolated are sequenced at the site of oligomer insertion. We have devised a procedure for the preparation of unique duplex DNA oligomers such that the site of oligomermore » alkylation is specific for a single deoxynucleotide species in the two DNA strands. The procedure for oligomer assembly also allows us to vary the position of the alkylated residue in each of the two strands. Using our model system, the results obtained over the past year can be summarized as follows. When nonalkylated oligomer constructs are ligated into M13 viral DNA and used to transfect E. coli, no modifications in DNA sequence arrangement are detected in progeny viral DNAs. On the other hand, with oligomer constructs containing BP-adducts two major types of modifications in DNA sequence arrangement were observed: (1) large deletions, and (2) nonhomologous (illegitimate) recombinants. Both of these DNA modifications result in the complete removal of the oligomer insert. Transfection of E. coli that are recA/sup -/ does not alter these DNA modifications, therefore, it appears that the deletions and recombinants induced by the alkylated inserts are not under control of the RecA gene. As the distance between the alkylated residues in the duplex strands is increased, the number of recombinant events detected is reduced. In addition to the above types of DNA modifications, restoration of the original nucleotide sequence in the alkylated construct was also observed in progeny viral DNAs. 7 refs., 6 figs., 2 tabs.« less

Biochemical and Structural Characterisation of DNA Ligases from Bacteria and Archaea.

PubMed

Pergolizzi, Giulia; Wagner, Gerd K; Bowater, Richard Peter

2016-08-31

DNA ligases are enzymes that seal breaks in the backbones of DNA, leading to them being essential for the survival of all organisms. DNA ligases have been studied from many different types of cells and organisms and shown to have diverse sizes and sequences, with well conserved specific sequences that are required for enzymatic activity. A significant number of DNA ligases have been isolated or prepared in recombinant forms and, here, we review their biochemical and structural characterisation. All DNA ligases contain an essential lysine that transfers an adenylate group from a co-factor to the 5'-phosphate of the DNA end that will ultimately be joined to the 3'-hydroxyl of the neighbouring DNA strand. The essential DNA ligases in bacteria use nicotinamide adenine dinucleotide ( β -NAD + ) as their co-factor whereas those that are essential in other cells use adenosine-5'-triphosphate (ATP) as their co-factor. This observation suggests that the essential bacterial enzyme could be targeted by novel antibiotics and the complex molecular structure of β -NAD + affords multiple opportunities for chemical modification. Several recent studies have synthesised novel derivatives and their biological activity against a range of DNA ligases has been evaluated as inhibitors for drug discovery and/or non-natural substrates for biochemical applications. Here, we review the recent advances that herald new opportunities to alter the biochemical activities of these important enzymes. The recent development of modified derivatives of nucleotides highlights that the continued combination of structural, biochemical and biophysical techniques will be useful in targeting these essential cellular enzymes. ©2016 The Author(s).

Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.

PubMed

Cox, J M; Sloan, L S; Schepartz, A

1995-12-01

HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.

In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

PubMed

Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

1994-01-01

The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

Direct DNA binding by Brca1.

PubMed

Paull, T T; Cortez, D; Bowers, B; Elledge, S J; Gellert, M

2001-05-22

The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein-DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription.

Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

NASA Astrophysics Data System (ADS)

Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

2017-07-01

DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

Sequence-selective DNA cleavage by a chimeric metallopeptide.

PubMed

Kovacic, Roger T; Welch, Joel T; Franklin, Sonya J

2003-06-04

A chimeric metallopeptide derived from the sequences of two structurally superimposable motifs was designed as an artificial nuclease. Both DNA recognition and nuclease activity have been incorporated into a small peptide sequence. P3W, a 33-mer peptide comprising helices alpha2 and alpha3 from the engrailed homeodomain and the consensus EF-hand Ca-binding loop binds one equivalent of lanthanides or calcium and folds upon metal binding. The conditional formation constants (in the presence of 50 mM Tris) of P3W for Eu(III) (K(a) = (2.1 +/- 0.1) x 10(5) M(-1)) and Ce(IV) (K(a) = (2.6 +/- 0.1) x 10(5) M(-1)) are typical of isolated EF-hand peptides. Circular dichroism studies show that 1:1 CeP3W is 26% alpha-helical and EuP3W is up to 40% alpha-helical in the presence of excess metal. The predicted helicity of the folded peptide based on helix length and end effects is about 50%, showing the metallopeptides are significantly folded. EuP3W has considerably more secondary structure than our previously reported chimeras (Welch, J. T.; Sirish, M.; Lindstrom, K. M.; Franklin, S. J. Inorg. Chem. 2001, 40, 1982-1984). Eu(III)P3W and Ce(IV)P3W nick supercoiled DNA at pH 6.9, although EuP3W is more active at pH 8. CeP3W cleaves linearized, duplex DNA as well as supercoiled plasmid. The cleavage of a 5'-(32)P-labeled 121-mer DNA fragment was followed by polyacrylamide gel electrophoresis. The cleavage products are 3'-OPO(3) termini exclusively, suggesting a regioselective or multistep mechanism. In contrast, uncomplexed Ce(IV) and Eu(III) ions produce both 3'-OPO(3) and 3'-OH, and no evidence of 4'-oxidative cleavage termini with either metal. The complementary 3'-(32)P-labeled oligonucleotide experiment also showed both 5'-OPO(3) and 5'-OH termini were produced by the free ions, whereas CeP3W produces only 5'-OPO(3) termini. In addition to apparent regioselectivity, the metallopeptides cut DNA with modest sequence discrimination, which suggests that the HTH motif binds DNA as a folded domain and thus cleaves selected sequences. The de novo artificial nuclease LnP3W represents the first small, underivatized peptide that is both active as a nuclease and sequence selective.

Cloning, sequence, and expression of a blood group B active recombinant alpha-D-galactosidase from pinto bean (Phaseolus vulgaris).

PubMed

Davis, M O; Hata, D J; Johnson, S A; Jones, D E; Harmata, M A; Evans, M L; Walker, J C; Smith, D S

1997-07-01

A cDNA encoding pinto bean alpha-D-galactosidase [E.C. 3.2.1.22] was obtained by amplification of cDNA using highly conserved sequences found in eucaryotic alpha-D-galactosidases. Subsequently a full length Phaseolus cDNA clone was obtained that is 1537 nt long and contains untranslated 5' and 3' sequences. The nucleotide sequence of the cDNA has a high degree of homology with other eucaryotic alpha-D-galactosidase genes. The recombinant alpha-D-galactosidase (rGal) was expressed in Escherichia coli and purified by ion exchange and affinity chromatography. Purified rGal was homogeneous by SDS-PAGE and had relative masses of 40.1 and 45.4 kDa under nonreducing and reducing conditions, respectively. The N-terminal sequence of the expressed protein contained the sequence GNGLGQTPPMG corresponding to that deduced from the cDNA sequence. The native molecular weight for rGal was determined to be 32.18 kDa by Sephacryl S-200 chromatography. The specific activity of the rGal was 349 mu moles of PNP-alpha-D-galactopyranoside hydrolyzed per mg of pure rGal per min. rGal was highly specific for alpha-D-galactosyl residues and degraded B oligosaccharide. No detectable hemagglutinin or protease activity was present in the preparations. Furthermore, rGal was active against the blood group B antigen on native human erythrocytes in cell suspension assays. The only detectable RBC phenotypic change was loss of the B and P1 epitopes. Recombinant Phaseolus vulgaris alpha-D-galactosidase may have useful biotechnical applications in the potential mass production of enzymatically converted, universally transfusable type O RBCs. alpha-D-galactosidase [E.C. 3.2.1.22] has been purified from a variety of procaryotic and eucaryotic species. Most alpha-D-galactosidases have similar low molecular weight substrate specificities, but activity against high molecular weight substrates is variable. Terminal alpha-D-galactoside residues are present in glycoproteins and glycolipids. Some alpha-D-galactosidases have activity against alpha-D-galactosyl residues on cell membrane glycoconjugates. Glycosidases with this property are useful for carbohydrate structural studies and biotechnical applications. Enzymes free of other glycosidase activities with activity near neutral pH are particularly useful for membrane modification studies on native cells. Complex sugar chains in glycolipids and glycoproteins have often been implicated in the growth and development of eucaryotes. In particular, complex sugar chains play an important role in the recognition of self in the immune system. Some alpha-D-galactosidases can modify certain carbohydrate membrane epitopes, thereby modulating the immune response. For example, the blood group B epitope expressed on erythrocytes contains a terminal alpha-D-galactosyl residue. Individuals lacking this antigen produce naturally occurring complement fixing antibodies to the B epitope. Hydrolysis of this terminal saccharide destroys the antigenic activity of the B determinant producing H antigen (blood type O) on erythrocytes. Only rare individuals produce clinically significant antibodies to the H antigen, and therefore, type O red blood cells are "universally" compatible and in great demand. Dhar purified alpha-D-galactosidase isozymes from Phaseolus vulgaris and characterized their activity. To our knowledge, our laboratory, in a brief report, is the first to describe the cloning of the gene and the use of recombinant enzyme for seroconverting blood type B to O cells. This paper describes the cloning, sequence, expression, purification, and characterization of recombinant alpha-D-galactosidase. Activity of the recombinant enzyme on the native human erythrocyte blood group B epitope is shown.

Nanosilver-based surface-enhanced Raman spectroscopic determination of DNA methyltransferase activity through real-time hybridization chain reaction.

PubMed

Hu, Ping Ping; Liu, Hui; Zhen, Shu Jun; Li, Chun Mei; Huang, Cheng Zhi

2015-11-15

In this manuscript, a nanosilver enhanced SERS strategy was successfully constructed for the determination of DNA methyltransferase activity in soulution combined with hybridization chain reaction (HCR). The proposed method was mainly on the basis of excellent separation ability of magnetic microparticles (MMPs), HCR as signal amplification unit and assembled AgNPs as enhancement substrate. In the presence of M. SssI MTase, the duplex sequence (5'-CCGG-3') tethered to MMPs was methylated, which cannot be cleaved by HpaII endonuclease. The resulted DNA skeleton captured on MMPs then triggered the HCR reaction, generated a polymerized and extended symmetrical sequence, in which more biotin terminal was available for the conjugation of AgNPs-SA, leading to significantly amplified SERS response. When it was used to analyze M. SssI activity, a linear equation ∆ISERS=1215.32+446.80 cM.SssI was obtained with the M. SssI activity ranged from 0.1 to 10.0 U with the correlation coefficient (r(2)) of 0.97. The most important advantage of this method is the combination of SERS and HCR in solution for the first time and its good selectivity, which enabled the detection of even one-base mismatched sequence. The new assay method holds great promising application to be a versatile platform for sensitive, high-throughput detection, and the screening of new anticancer drugs on DNA MTase. Copyright © 2015 Elsevier B.V. All rights reserved.

The production and repair of aflatoxin B sub 1 -induced DNA damage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leadon, S.A.

To investigate the influence of function or activity of a DNA sequence on its repair, we have studied excision repair of aflatoxin B{sub 1} (AFB{sub 1})-induced damage in the nontranscribed, heterochromatic alpha DNA of monkey cells and in the metallothionein genes of human cells. In confluent cells, AFB{sub 1} adducts are produced in similar frequencies in alpha and in the rest of the DNA, but removal from alpha DNA is severely deficient, however, removal of AFB{sub 1} adducts from alpha DNA is enhanced by small doses of UV. The repair deficiencies are not observed in actively growing cells. We havemore » also shown that there is preferential repair of AFB{sub 1} damage in active genes. AFB{sub 1} damage is efficiently repaired in the active human metallothionein (hMT) genes, but deficiently repaired in inactive hMT genes. 51 refs., 3 tabs.« less

Isolation and characterization of high affinity aptamers against DNA polymerase iota.

PubMed

Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V

2012-02-01

Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.

Rapid and highly efficient construction of TALE-based transcriptional regulators and nucleases for genome modification.

PubMed

Li, Lixin; Piatek, Marek J; Atef, Ahmed; Piatek, Agnieszka; Wibowo, Anjar; Fang, Xiaoyun; Sabir, J S M; Zhu, Jian-Kang; Mahfouz, Magdy M

2012-03-01

Transcription activator-like effectors (TALEs) can be used as DNA-targeting modules by engineering their repeat domains to dictate user-selected sequence specificity. TALEs have been shown to function as site-specific transcriptional activators in a variety of cell types and organisms. TALE nucleases (TALENs), generated by fusing the FokI cleavage domain to TALE, have been used to create genomic double-strand breaks. The identity of the TALE repeat variable di-residues, their number, and their order dictate the DNA sequence specificity. Because TALE repeats are nearly identical, their assembly by cloning or even by synthesis is challenging and time consuming. Here, we report the development and use of a rapid and straightforward approach for the construction of designer TALE (dTALE) activators and nucleases with user-selected DNA target specificity. Using our plasmid set of 100 repeat modules, researchers can assemble repeat domains for any 14-nucleotide target sequence in one sequential restriction-ligation cloning step and in only 24 h. We generated several custom dTALEs and dTALENs with new target sequence specificities and validated their function by transient expression in tobacco leaves and in vitro DNA cleavage assays, respectively. Moreover, we developed a web tool, called idTALE, to facilitate the design of dTALENs and the identification of their genomic targets and potential off-targets in the genomes of several model species. Our dTALE repeat assembly approach along with the web tool idTALE will expedite genome-engineering applications in a variety of cell types and organisms including plants.

Context influences on TALE–DNA binding revealed by quantitative profiling

PubMed Central

Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

2015-01-01

Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

Context influences on TALE-DNA binding revealed by quantitative profiling.

PubMed

Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

2015-06-11

Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

Darwin and Evolution: A Set of Activities Based on the Evolution of Mammals

ERIC Educational Resources Information Center

Haresnape, Janet M.

2010-01-01

These activities, prepared for key stage 5 students (ages 16-18) and also suitable for key stage 4 (ages 14-16), show that physical appearance is not necessarily the best way to classify mammals. DNA structure is examined to show how similarities and differences between DNA sequences of mammals can be used to establish evolutionary relationships.…

Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

PubMed

Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

2011-12-10

Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, W.M.; Sylvester, J.E.

1994-09-01

In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less

Investigation of the mechanism of meiotic DNA cleavage by VMA1-derived endonuclease uncovers a meiotic alteration in chromatin structure around the target site.

PubMed

Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

2006-06-01

VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation.

Investigation of the Mechanism of Meiotic DNA Cleavage by VMA1-Derived Endonuclease Uncovers a Meiotic Alteration in Chromatin Structure around the Target Site

PubMed Central

Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

2006-01-01

VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation. PMID:16757746

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

Synthesis of DNA

DOEpatents

Mariella, Jr., Raymond P.

2008-11-18

A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

Phosphorylation of serine-515 activates the Mammalian maintenance methyltransferase Dnmt1.

PubMed

Goyal, Rachna; Rathert, Philipp; Laser, Heike; Gowher, Humaira; Jeltsch, Albert

2007-09-01

DNA methyltransferase 1 methylates hemi-methylated CG sites generated during DNA replication. Serine 515 of this enzyme has been shown to be phosphorylated. To explore the importance of S515 phosphorylation, we generated mutants of Dnmt1 which removed the phosphorylation potential (S515A) or mimic phosphoserine (S515E), purified the proteins from insect cells and analyzed their DNA methylation activity in vitro. The S515E mutant was found to be active, while S515A mutant had severe loss in activity when compared to the wild type protein. The loss of activity of the S515A variant was not due to loss of DNA binding capacity. Furthermore, we show that a phosphorylated peptide whose sequence mimics the surrounding of Ser515 (EKIYIS(P)KIVVE) inhibited the activity of wild type Dnmt1 ten-fold more than the non-phosphorylated peptide. The inhibition was specific for Dnmt1 and for the particular peptide sequence. Our data suggest that phosphorylation of Ser515 is important for an interaction between the N-terminal domain of Dnmt1 and its catalytic domain that is necessary for activity and that this interaction is specifically disrupted by the phosphorylated peptide. We conclude that phosphorylation of Dnmt1 at Ser515 could be an important regulator of Dnmt1 activity during cell cycle and after proliferative stimuli.

Nanopore Technology: A Simple, Inexpensive, Futuristic Technology for DNA Sequencing.

PubMed

Gupta, P D

2016-10-01

In health care, importance of DNA sequencing has been fully established. Sanger's Capillary Electrophoresis DNA sequencing methodology is time consuming, cumbersome, hence become more expensive. Lately, because of its versatility DNA sequencing became house hold name, and therefore, there is an urgent need of simple, fast, inexpensive, DNA sequencing technology. In the beginning of this century efforts were made, and Nanopore DNA sequencing technology was developed; still it is infancy, nevertheless, it is the futuristic technology.

The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

PubMed

Murray, Vincent; Chen, Jon K; Tanaka, Mark M

2016-07-01

The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

The Centromere: Chromatin Foundation for the Kinetochore Machinery

PubMed Central

Fukagawa, Tatsuo; Earnshaw, William C.

2014-01-01

Since discovery of the centromere-specific histone H3 variant CENP-A, centromeres have come to be defined as chromatin structures that establish the assembly site for the complex kinetochore machinery. In most organisms, centromere activity is defined epigenetically, rather than by specific DNA sequences. In this review, we describe selected classic work and recent progress in studies of centromeric chromatin with a focus on vertebrates. We consider possible roles for repetitive DNA sequences found at most centromeres, chromatin factors and modifications that assemble and activate CENP-A chromatin for kinetochore assembly, plus the use of artificial chromosomes and kinetochores to study centromere function. PMID:25203206

Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

PubMed Central

Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W

1989-01-01

We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

Specific Inhibition of the transcription factor Ci by a Cobalt(III)-Schiff base-DNA conjugate

PubMed Central

Hurtado, Ryan R.; Harney, Allison S.; Heffern, Marie C.; Holbrook, Robert J.; Holmgren, Robert A.; Meade, Thomas J.

2012-01-01

We describe the use of Co(III) Schiff base-DNA conjugates, a versatile class of research tools that target C2H2 transcription factors, to inhibit the Hedgehog (Hh) pathway. In developing mammalian embryos, Hh signaling is critical for the formation and development of many tissues and organs. Inappropriate activation of the Hedgehog (Hh) pathway has been implicated in a variety of cancers including medulloblastomas and basal cell carcinomas. It is well known that Hh regulates the activity of the Gli family of C2H2 zinc finger transcription factors in mammals. In Drosophila the function of the Gli proteins is performed by a single transcription factor with an identical DNA binding consensus sequence, Cubitus Interruptus (Ci). We have demonstrated previously that conjugation of a specific 17 base-pair oligonucleotide to a Co(III) Schiff base complex results in a targeted inhibitor of the Snail family C2H2 zinc finger transcription factors. Modification of the oligonucleotide sequence in the Co(III) Schiff base-DNA conjugate to that of Ci’s consensus sequence (Co(III)-Ci) generates an equally selective inhibitor of Ci. Co(III)-Ci irreversibly binds the Ci zinc finger domain and prevents it from binding DNA in vitro. In a Ci responsive tissue culture reporter gene assay, Co(III)-Ci reduces the transcriptional activity of Ci in a concentration dependent manner. In addition, injection of wild-type Drosophila embryos with Co(III)-Ci phenocopies a Ci loss of function phenotype, demonstrating effectiveness in vivo. This study provides evidence that Co(III) Schiff base-DNA conjugates are a versatile class of specific and potent tools for studying zinc finger domain proteins and have potential applications as customizable anti-cancer therapeutics. PMID:22214326

Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

PubMed

Heyduk, E; Baichoo, N; Heyduk, T

2001-11-30

The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

Structure, replication efficiency and fragility of yeast ARS elements.

PubMed

Dhar, Manoj K; Sehgal, Shelly; Kaul, Sanjana

2012-05-01

DNA replication in eukaryotes initiates at specific sites known as origins of replication, or replicators. These replication origins occur throughout the genome, though the propensity of their occurrence depends on the type of organism. In eukaryotes, zones of initiation of replication spanning from about 100 to 50,000 base pairs have been reported. The characteristics of eukaryotic replication origins are best understood in the budding yeast Saccharomyces cerevisiae, where some autonomously replicating sequences, or ARS elements, confer origin activity. ARS elements are short DNA sequences of a few hundred base pairs, identified by their efficiency at initiating a replication event when cloned in a plasmid. ARS elements, although structurally diverse, maintain a basic structure composed of three domains, A, B and C. Domain A is comprised of a consensus sequence designated ACS (ARS consensus sequence), while the B domain has the DNA unwinding element and the C domain is important for DNA-protein interactions. Although there are ∼400 ARS elements in the yeast genome, not all of them are active origins of replication. Different groups within the genus Saccharomyces have ARS elements as components of replication origin. The present paper provides a comprehensive review of various aspects of ARSs, starting from their structural conservation to sequence thermodynamics. All significant and conserved functional sequence motifs within different types of ARS elements have been extensively described. Issues like silencing at ARSs, their inherent fragility and factors governing their replication efficiency have also been addressed. Progress in understanding crucial components associated with the replication machinery and timing at these ARS elements is discussed in the section entitled "The replicon revisited". Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

'FloraArray' for screening of specific DNA probes representing the characteristics of a certain microbial community.

PubMed

Yokoi, Takahide; Kaku, Yoshiko; Suzuki, Hiroyuki; Ohta, Masayuki; Ikuta, Hajime; Isaka, Kazuichi; Sumino, Tatsuo; Wagatsuma, Masako

2007-08-01

To investigate uncharacterized microbial communities, a custom DNA microarray named 'FloraArray' was developed for screening specific probes that would represent the characteristics of a microbial community. The array was prepared by spotting 2000 plasmid DNAs from a genomic shotgun library of a sludge sample on a DNA microarray. By comparative hybridization of the array with two different samples of genomic DNA, one from the activated sludge and the other from a nonactivated sludge sample of an anaerobic ammonium oxidation (anammox) bacterial community, specific spots were visualized as a definite fluctuating profile in an MA (differential intensity ratio vs. spot intensity) plot. About 300 spots of the array accounted for the candidate probes to represent anammox reaction of the activated sludge. After sequence analysis of the probes and examination of the results of blastn searches against the reported anammox reference sequence, complete matches were found for 161 probes (58.3%) and >90% matches were found for 242 probes (87.1%). These results demonstrate that 'FloraArray' could be a useful tool for screening specific DNA molecules of unknown microbial communities.

New strategy to address DNA-methyl transferase activity in ovarian cancer cell cultures by monitoring the formation of 5-methylcytosine using HPLC-UV.

PubMed

Iglesias González, T; Blanco-González, E; Montes-Bayón, M

2016-08-15

Methylation of mammalian genomic DNA is catalyzed by DNA methyltransferases (DNMTs). Aberrant expression and activity of these enzymes has been reported to play an important role in the initiation and progression of tumors and its response to chemotherapy. Therefore, there is a great interest in developing strategies to detect human DNMTs activity. We propose a simple, antibody-free, label-free and non-radioactive analytical strategy in which methyltransferase activity is measured trough the determination of the 5-methylcytosine (5mC) content in DNA by a chromatographic method (HPLC-UV) previously developed. For this aim, a correlation between the enzyme activity and the concentration of 5mC obtained by HPLC-UV is previously obtained under optimized conditions using both, un-methylated and hemi-methylated DNA substrates and the prokaryotic methyltransferase M.SssI as model enzyme. The evaluation of the methylation yield in un-methylated known sequences (a 623bp PCR-amplicon) turned to be quantitative (110%) in experiments conducted in-vitro. Methylation of hemi-methylated and low-methylated sequences could be also detected with the proposed approach. The application of the methodology to the determination of the DNMTs activity in nuclear extracts from human ovarian cancer cells has revealed the presence of matrix effects (also confirmed by standard additions) that hampered quantitative enzyme recovery. The obtained results showed the high importance of adequate sample clean-up steps. Copyright © 2016. Published by Elsevier B.V.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

PubMed

Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

2014-03-06

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

NASA Astrophysics Data System (ADS)

Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

2014-03-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

Homeologous plastid DNA transformation in tobacco is mediated by multiple recombination events.

PubMed Central

Kavanagh, T A; Thanh, N D; Lao, N T; McGrath, N; Peter, S O; Horváth, E M; Dix, P J; Medgyesy, P

1999-01-01

Efficient plastid transformation has been achieved in Nicotiana tabacum using cloned plastid DNA of Solanum nigrum carrying mutations conferring spectinomycin and streptomycin resistance. The use of the incompletely homologous (homeologous) Solanum plastid DNA as donor resulted in a Nicotiana plastid transformation frequency comparable with that of other experiments where completely homologous plastid DNA was introduced. Physical mapping and nucleotide sequence analysis of the targeted plastid DNA region in the transformants demonstrated efficient site-specific integration of the 7.8-kb Solanum plastid DNA and the exclusion of the vector DNA. The integration of the cloned Solanum plastid DNA into the Nicotiana plastid genome involved multiple recombination events as revealed by the presence of discontinuous tracts of Solanum-specific sequences that were interspersed between Nicotiana-specific markers. Marked position effects resulted in very frequent cointegration of the nonselected peripheral donor markers located adjacent to the vector DNA. Data presented here on the efficiency and features of homeologous plastid DNA recombination are consistent with the existence of an active RecA-mediated, but a diminished mismatch, recombination/repair system in higher-plant plastids. PMID:10388829

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

PubMed Central

2013-01-01

Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

Sequence and Structure Dependent DNA-DNA Interactions

NASA Astrophysics Data System (ADS)

Kopchick, Benjamin; Qiu, Xiangyun

Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

Highly Iterated Palindromic Sequences (HIPs) and Their Relationship to DNA Methyltransferases

PubMed Central

Elhai, Jeff

2015-01-01

The sequence GCGATCGC (Highly Iterated Palindrome, HIP1) is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences. PMID:25789551

Highly Iterated Palindromic Sequences (HIPs) and Their Relationship to DNA Methyltransferases.

PubMed

Elhai, Jeff

2015-03-17

The sequence GCGATCGC (Highly Iterated Palindrome, HIP1) is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences.

Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

PubMed

Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

2008-09-01

WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

Yeast Sub1 and human PC4 are G-quadruplex binding proteins that suppress genome instability at co-transcriptionally formed G4 DNA.

PubMed

Lopez, Christopher R; Singh, Shivani; Hambarde, Shashank; Griffin, Wezley C; Gao, Jun; Chib, Shubeena; Yu, Yang; Ira, Grzegorz; Raney, Kevin D; Kim, Nayun

2017-06-02

G-quadruplex or G4 DNA is a non-B secondary DNA structure consisting of a stacked array of guanine-quartets that can disrupt critical cellular functions such as replication and transcription. When sequences that can adopt Non-B structures including G4 DNA are located within actively transcribed genes, the reshaping of DNA topology necessary for transcription process stimulates secondary structure-formation thereby amplifying the potential for genome instability. Using a reporter assay designed to study G4-induced recombination in the context of an actively transcribed locus in Saccharomyces cerevisiae, we tested whether co-transcriptional activator Sub1, recently identified as a G4-binding factor, contributes to genome maintenance at G4-forming sequences. Our data indicate that, upon Sub1-disruption, genome instability linked to co-transcriptionally formed G4 DNA in Top1-deficient cells is significantly augmented and that its highly conserved DNA binding domain or the human homolog PC4 is sufficient to suppress G4-associated genome instability. We also show that Sub1 interacts specifically with co-transcriptionally formed G4 DNA in vivo and that yeast cells become highly sensitivity to G4-stabilizing chemical ligands by the loss of Sub1. Finally, we demonstrate the physical and genetic interaction of Sub1 with the G4-resolving helicase Pif1, suggesting a possible mechanism by which Sub1 suppresses instability at G4 DNA. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Demonstration: Genetic Jewelry

ERIC Educational Resources Information Center

Atkins, Thomas; Roderick, Joyce

2006-01-01

In order for students to understand genetics and evolution, they must first understand the structure of the DNA molecule. The function of DNA proceeds from its unique structure, a structure beautifully adapted for information storage, transcription, translation into amino acid sequences, replication, and time travel. The activity described in this…

Nucleosome breathing and remodeling constrain CRISPR-Cas9 function

PubMed Central

Isaac, R Stefan; Jiang, Fuguo; Doudna, Jennifer A; Lim, Wendell A; Narlikar, Geeta J; Almeida, Ricardo

2016-01-01

The CRISPR-Cas9 bacterial surveillance system has become a versatile tool for genome editing and gene regulation in eukaryotic cells, yet how CRISPR-Cas9 contends with the barriers presented by eukaryotic chromatin is poorly understood. Here we investigate how the smallest unit of chromatin, a nucleosome, constrains the activity of the CRISPR-Cas9 system. We find that nucleosomes assembled on native DNA sequences are permissive to Cas9 action. However, the accessibility of nucleosomal DNA to Cas9 is variable over several orders of magnitude depending on dynamic properties of the DNA sequence and the distance of the PAM site from the nucleosome dyad. We further find that chromatin remodeling enzymes stimulate Cas9 activity on nucleosomal templates. Our findings imply that the spontaneous breathing of nucleosomal DNA together with the action of chromatin remodelers allow Cas9 to effectively act on chromatin in vivo. DOI: http://dx.doi.org/10.7554/eLife.13450.001 PMID:27130520

A model of EcoRII restriction endonuclease action: the active complex is most likely formed by one protein subunit and one DNA recognition site

NASA Technical Reports Server (NTRS)

Karpova, E. A.; Kubareva, E. A.; Shabarova, Z. A.

1999-01-01

To elucidate the mechanism of interaction of restriction endonuclease EcoRII with DNA, we studied by native gel electrophoresis the binding of this endonuclease to a set of synthetic DNA-duplexes containing the modified or canonical recognition sequence 5'-d(CCA/TGG)-3'. All binding substrate or substrate analogues tested could be divided into two major groups: (i) duplexes that, at the interaction with endonuclease EcoRII, form two types of stable complexes on native gel in the absence of Mg2+ cofactor; (ii) duplexes that form only one type of complex, observed both in the presence and absence of Mg2+. Unlike the latter, duplexes under the first group can be hydrolyzed by endonuclease. Data obtained suggest that the active complex is most likely formed by one protein subunit and one DNA recognition sequence. A model of EcoRII endonuclease action is presented.

MitoTALEN: A General Approach to Reduce Mutant mtDNA Loads and Restore Oxidative Phosphorylation Function in Mitochondrial Diseases

PubMed Central

Hashimoto, Masami; Bacman, Sandra R; Peralta, Susana; Falk, Marni J; Chomyn, Anne; Chan, David C; Williams, Sion L; Moraes, Carlos T

2015-01-01

We have designed mitochondrially targeted transcription activator-like effector nucleases or mitoTALENs to cleave specific sequences in the mitochondrial DNA (mtDNA) with the goal of eliminating mtDNA carrying pathogenic point mutations. To test the generality of the approach, we designed mitoTALENs to target two relatively common pathogenic mtDNA point mutations associated with mitochondrial diseases: the m.8344A>G tRNALys gene mutation associated with myoclonic epilepsy with ragged red fibers (MERRF) and the m.13513G>A ND5 mutation associated with MELAS/Leigh syndrome. Transmitochondrial cybrid cells harbouring the respective heteroplasmic mtDNA mutations were transfected with the respective mitoTALEN and analyzed after different time periods. MitoTALENs efficiently reduced the levels of the targeted pathogenic mtDNAs in the respective cell lines. Functional assays showed that cells with heteroplasmic mutant mtDNA were able to recover respiratory capacity and oxidative phosphorylation enzymes activity after transfection with the mitoTALEN. To improve the design in the context of the low complexity of mtDNA, we designed shorter versions of the mitoTALEN specific for the MERRF m.8344A>G mutation. These shorter mitoTALENs also eliminated the mutant mtDNA. These reductions in size will improve our ability to package these large sequences into viral vectors, bringing the use of these genetic tools closer to clinical trials. PMID:26159306

Formation and Repair of Mismatches Containing Ribonucleotides and Oxidized Bases at Repeated DNA Sequences*

PubMed Central

Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena

2015-01-01

The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. PMID:26338705

Epigenetic Telomere Protection by Drosophila DNA Damage Response Pathways

PubMed Central

Oikemus, Sarah R; Queiroz-Machado, Joana; Lai, KuanJu; McGinnis, Nadine; Sunkel, Claudio; Brodsky, Michael H

2006-01-01

Analysis of terminal deletion chromosomes indicates that a sequence-independent mechanism regulates protection of Drosophila telomeres. Mutations in Drosophila DNA damage response genes such as atm/tefu, mre11, or rad50 disrupt telomere protection and localization of the telomere-associated proteins HP1 and HOAP, suggesting that recognition of chromosome ends contributes to telomere protection. However, the partial telomere protection phenotype of these mutations limits the ability to test if they act in the epigenetic telomere protection mechanism. We examined the roles of the Drosophila atm and atr-atrip DNA damage response pathways and the nbs homolog in DNA damage responses and telomere protection. As in other organisms, the atm and atr-atrip pathways act in parallel to promote telomere protection. Cells lacking both pathways exhibit severe defects in telomere protection and fail to localize the protection protein HOAP to telomeres. Drosophila nbs is required for both atm- and atr-dependent DNA damage responses and acts in these pathways during DNA repair. The telomere fusion phenotype of nbs is consistent with defects in each of these activities. Cells defective in both the atm and atr pathways were used to examine if DNA damage response pathways regulate telomere protection without affecting telomere specific sequences. In these cells, chromosome fusion sites retain telomere-specific sequences, demonstrating that loss of these sequences is not responsible for loss of protection. Furthermore, terminally deleted chromosomes also fuse in these cells, directly implicating DNA damage response pathways in the epigenetic protection of telomeres. We propose that recognition of chromosome ends and recruitment of HP1 and HOAP by DNA damage response proteins is essential for the epigenetic protection of Drosophila telomeres. Given the conserved roles of DNA damage response proteins in telomere function, related mechanisms may act at the telomeres of other organisms. PMID:16710445

Epigenetic telomere protection by Drosophila DNA damage response pathways.

PubMed

Oikemus, Sarah R; Queiroz-Machado, Joana; Lai, KuanJu; McGinnis, Nadine; Sunkel, Claudio; Brodsky, Michael H

2006-05-01

Analysis of terminal deletion chromosomes indicates that a sequence-independent mechanism regulates protection of Drosophila telomeres. Mutations in Drosophila DNA damage response genes such as atm/tefu, mre11, or rad50 disrupt telomere protection and localization of the telomere-associated proteins HP1 and HOAP, suggesting that recognition of chromosome ends contributes to telomere protection. However, the partial telomere protection phenotype of these mutations limits the ability to test if they act in the epigenetic telomere protection mechanism. We examined the roles of the Drosophila atm and atr-atrip DNA damage response pathways and the nbs homolog in DNA damage responses and telomere protection. As in other organisms, the atm and atr-atrip pathways act in parallel to promote telomere protection. Cells lacking both pathways exhibit severe defects in telomere protection and fail to localize the protection protein HOAP to telomeres. Drosophila nbs is required for both atm- and atr-dependent DNA damage responses and acts in these pathways during DNA repair. The telomere fusion phenotype of nbs is consistent with defects in each of these activities. Cells defective in both the atm and atr pathways were used to examine if DNA damage response pathways regulate telomere protection without affecting telomere specific sequences. In these cells, chromosome fusion sites retain telomere-specific sequences, demonstrating that loss of these sequences is not responsible for loss of protection. Furthermore, terminally deleted chromosomes also fuse in these cells, directly implicating DNA damage response pathways in the epigenetic protection of telomeres. We propose that recognition of chromosome ends and recruitment of HP1 and HOAP by DNA damage response proteins is essential for the epigenetic protection of Drosophila telomeres. Given the conserved roles of DNA damage response proteins in telomere function, related mechanisms may act at the telomeres of other organisms.

DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

PubMed

Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

2014-02-03

The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

Facile Site-Directed Mutagenesis of Large Constructs Using Gibson Isothermal DNA Assembly.

PubMed

Yonemoto, Isaac T; Weyman, Philip D

2017-01-01

Site-directed mutagenesis is a commonly used molecular biology technique to manipulate biological sequences, and is especially useful for studying sequence determinants of enzyme function or designing proteins with improved activity. We describe a strategy using Gibson Isothermal DNA Assembly to perform site-directed mutagenesis on large (>~20 kbp) constructs that are outside the effective range of standard techniques such as QuikChange II (Agilent Technologies), but more reliable than traditional cloning using restriction enzymes and ligation.

Quantitative and Dynamic Imaging of ATM Kinase Activity by Bioluminescence Imaging.

PubMed

Nyati, Shyam; Young, Grant; Ross, Brian Dale; Rehemtulla, Alnawaz

2017-01-01

Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA damage response, including DNA double strand breaks (DSBs). ATM activation results in the initiation of a complex cascade of events facilitating DNA damage repair, cell cycle checkpoint control, and survival. Traditionally, protein kinases have been analyzed in vitro using biochemical methods (kinase assays using purified proteins or immunological assays) requiring a large number of cells and cell lysis. Genetically encoded biosensors based on optical molecular imaging such as fluorescence or bioluminescence have been developed to enable interrogation of kinase activities in live cells with a high signal to background. We have genetically engineered a hybrid protein whose bioluminescent activity is dependent on the ATM-mediated phosphorylation of a substrate. The engineered protein consists of the split luciferase-based protein complementation pair with a CHK2 (a substrate for ATM kinase activity) target sequence and a phospho-serine/threonine-binding domain, FHA2, derived from yeast Rad53. Phosphorylation of the serine residue within the target sequence by ATM would lead to its interaction with the phospho-serine-binding domain, thereby preventing complementation of the split luciferase pair and loss of reporter activity. Bioluminescence imaging of reporter-expressing cells in cultured plates or as mouse xenografts provides a quantitative surrogate for ATM kinase activity and therefore the cellular DNA damage response in a noninvasive, dynamic fashion.

Quantitative and Dynamic Imaging of ATM Kinase Activity.

PubMed

Nyati, Shyam; Young, Grant; Ross, Brian Dale; Rehemtulla, Alnawaz

2017-01-01

Ataxia telangiectasia mutated (ATM) is a serine/threonine kinase critical to the cellular DNA-damage response, including DNA double-strand breaks (DSBs). ATM activation results in the initiation of a complex cascade of events facilitating DNA damage repair, cell cycle checkpoint control, and survival. Traditionally, protein kinases have been analyzed in vitro using biochemical methods (kinase assays using purified proteins or immunological assays) requiring a large number of cells and cell lysis. Genetically encoded biosensors based on optical molecular imaging such as fluorescence or bioluminescence have been developed to enable interrogation of kinase activities in live cells with a high signal to background. We have genetically engineered a hybrid protein whose bioluminescent activity is dependent on the ATM-mediated phosphorylation of a substrate. The engineered protein consists of the split luciferase-based protein complementation pair with a CHK2 (a substrate for ATM kinase activity) target sequence and a phospho-serine/threonine-binding domain, FHA2, derived from yeast Rad53. Phosphorylation of the serine residue within the target sequence by ATM would lead to its interaction with the phospho-serine-binding domain, thereby preventing complementation of the split luciferase pair and loss of reporter activity. Bioluminescence imaging of reporter expressing cells in cultured plates or as mouse xenografts provides a quantitative surrogate for ATM kinase activity and therefore the cellular DNA damage response in a noninvasive, dynamic fashion.

Penetration of short fluorescence-labeled peptides into the nucleus in HeLa cells and in vitro specific interaction of the peptides with deoxyribooligonucleotides and DNA.

PubMed

Fedoreyeva, L I; Kireev, I I; Khavinson, V Kh; Vanyushin, B F

2011-11-01

Marked fluorescence in cytoplasm, nucleus, and nucleolus was observed in HeLa cells after incubation with each of several fluorescein isothiocyanate-labeled peptides (epithalon, Ala-Glu-Asp-Gly; pinealon, Glu-Asp-Arg; testagen, Lys-Glu-Asp-Gly). This means that short biologically active peptides are able to penetrate into an animal cell and its nucleus and, in principle they may interact with various components of cytoplasm and nucleus including DNA and RNA. It was established that various initial (intact) peptides differently affect the fluorescence of the 5,6-carboxyfluorescein-labeled deoxyribooligonucleotides and DNA-ethidium bromide complexes. The Stern-Volmer constants characterizing the degree of fluorescence quenching of various single- and double-stranded fluorescence-labeled deoxyribooligonucleotides with short peptides used were different depending on the peptide primary structures. This indicates the specific interaction between short biologically active peptides and nucleic acid structures. On binding to them, the peptides discriminate between different nucleotide sequences and recognize even their cytosine methylation status. Judging from corresponding constants of the fluorescence quenching, the epithalon, pinealon, and bronchogen (Ala-Glu-Asp-Leu) bind preferentially with deoxyribooligonucleotides containing CNG sequence (CNG sites are targets for cytosine DNA methylation in eukaryotes). Epithalon, testagen, and pinealon seem to preferentially bind with CAG- but bronchogen with CTG-containing sequences. The site-specific interactions of peptides with DNA can control epigenetically the cell genetic functions, and they seem to play an important role in regulation of gene activity even at the earliest stages of life origin and in evolution.

Emergence of a replicating species from an in vitro RNA evolution reaction

NASA Technical Reports Server (NTRS)

Breaker, R. R.; Joyce, G. F.

1994-01-01

The technique of self-sustained sequence replication allows isothermal amplification of DNA and RNA molecules in vitro. This method relies on the activities of a reverse transcriptase and a DNA-dependent RNA polymerase to amplify specific nucleic acid sequences. We have modified this protocol to allow selective amplification of RNAs that catalyze a particular chemical reaction. During an in vitro RNA evolution experiment employing this modified system, a unique class of "selfish" RNAs emerged and replicated to the exclusion of the intended RNAs. Members of this class of selfish molecules, termed RNA Z, amplify efficiently despite their inability to catalyze the target chemical reaction. Their amplification requires the action of both reverse transcriptase and RNA polymerase and involves the synthesis of both DNA and RNA replication intermediates. The proposed amplification mechanism for RNA Z involves the formation of a DNA hairpin that functions as a template for transcription by RNA polymerase. This arrangement links the two strands of the DNA, resulting in the production of RNA transcripts that contain an embedded RNA polymerase promoter sequence.

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

PubMed Central

Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

2015-01-01

CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

PubMed

Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

1996-01-01

The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

PubMed Central

Eberwine, James; Bartfai, Tamas

2011-01-01

We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.

PubMed

Lam, Kathy N; Martens, Eric C; Charles, Trevor C

2018-01-01

Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be introduced into the gut microbe Bacteroides thetaiotaomicron to identify genes based on activity screening. Our results support the continuing development of genetically tractable systems to obtain information about gene function.

Statistical physics of nucleosome positioning and chromatin structure

NASA Astrophysics Data System (ADS)

Morozov, Alexandre

2012-02-01

Genomic DNA is packaged into chromatin in eukaryotic cells. The fundamental building block of chromatin is the nucleosome, a 147 bp-long DNA molecule wrapped around the surface of a histone octamer. Arrays of nucleosomes are positioned along DNA according to their sequence preferences and folded into higher-order chromatin fibers whose structure is poorly understood. We have developed a framework for predicting sequence-specific histone-DNA interactions and the effective two-body potential responsible for ordering nucleosomes into regular higher-order structures. Our approach is based on the analogy between nucleosomal arrays and a one-dimensional fluid of finite-size particles with nearest-neighbor interactions. We derive simple rules which allow us to predict nucleosome occupancy solely from the dinucleotide content of the underlying DNA sequences.Dinucleotide content determines the degree of stiffness of the DNA polymer and thus defines its ability to bend into the nucleosomal superhelix. As expected, the nucleosome positioning rules are universal for chromatin assembled in vitro on genomic DNA from baker's yeast and from the nematode worm C.elegans, where nucleosome placement follows intrinsic sequence preferences and steric exclusion. However, the positioning rules inferred from in vivo C.elegans chromatin are affected by global nucleosome depletion from chromosome arms relative to central domains, likely caused by the attachment of the chromosome arms to the nuclear membrane. Furthermore, intrinsic nucleosome positioning rules are overwritten in transcribed regions, indicating that chromatin organization is actively managed by the transcriptional and splicing machinery.

A High-Throughput Process for the Solid-Phase Purification of Synthetic DNA Sequences

PubMed Central

Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L.

2017-01-01

An efficient process for the purification of synthetic phosphorothioate and native DNA sequences is presented. The process is based on the use of an aminopropylated silica gel support functionalized with aminooxyalkyl functions to enable capture of DNA sequences through an oximation reaction with the keto function of a linker conjugated to the 5′-terminus of DNA sequences. Deoxyribonucleoside phosphoramidites carrying this linker, as a 5′-hydroxyl protecting group, have been synthesized for incorporation into DNA sequences during the last coupling step of a standard solid-phase synthesis protocol executed on a controlled pore glass (CPG) support. Solid-phase capture of the nucleobase- and phosphate-deprotected DNA sequences released from the CPG support is demonstrated to proceed near quantitatively. Shorter than full-length DNA sequences are first washed away from the capture support; the solid-phase purified DNA sequences are then released from this support upon reaction with tetra-n-butylammonium fluoride in dry dimethylsulfoxide (DMSO) and precipitated in tetrahydrofuran (THF). The purity of solid-phase-purified DNA sequences exceeds 98%. The simulated high-throughput and scalability features of the solid-phase purification process are demonstrated without sacrificing purity of the DNA sequences. PMID:28628204

Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA

PubMed Central

Mori, Tetsuya; Saveliev, Sergei V.; Xu, Yao; Stafford, Walter F.; Cox, Michael M.; Inman, Ross B.; Johnson, Carl H.

2002-01-01

KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecA/DnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecA/DnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns. PMID:12477935

Preselection of EGFR mutations in non-small-cell lung cancer patients by immunohistochemistry: comparison with DNA-sequencing, EGFR wild-type expression, gene copy number gain and clinicopathological data.

PubMed

Gaber, Rania; Watermann, Iris; Kugler, Christian; Vollmer, Ekkehard; Perner, Sven; Reck, Martin; Goldmann, Torsten

2017-01-01

Targeting epidermal growth factor receptor (EGFR) in patients with non-small-cell lung cancer (NSCLC) having EGFR mutations is associated with an improved overall survival. The aim of this study is to verify, if EGFR mutations detected by immunohistochemistry (IHC) is a convincing way to preselect patients for DNA-sequencing and to figure out, the statistical association between EGFR mutation, wild-type EGFR overexpression, gene copy number gain, which are the main factors inducing EGFR tumorigenic activity and the clinicopathological data. Two hundred sixteen tumor tissue samples of primarily chemotherapeutic naïve NSCLC patients were analyzed for EGFR mutations E746-A750del and L858R and correlated with DNA-sequencing. Two hundred six of which were assessed by IHC, using 6B6 and 43B2 specific antibodies followed by DNA-sequencing of positive cases and 10 already genotyped tumor tissues were also included to investigate debugging accuracy of IHC. In addition, EGFR wild-type overexpression was IHC evaluated and EGFR gene copy number determination was performed by fluorescence in situ hybridization (FISH). Forty-one÷206 (19.9%) cases were positive for mutated EGFR by IHC. Eight of them had EGFR mutations of exons 18-21 by DNA-sequencing. Hit rate of 10 already genotyped NSCLC mutated cases was 90% by IHC. Positive association was found between EGFR mutations determined by IHC and both EGFR overexpression and increased gene copy number (p=0.002 and p<0.001, respectively). Additionally, positive association was detected between EGFR mutations, high tumor grade and clinical stage (p<0.001). IHC staining with mutation specific antibodies was demonstrated as a possible useful screening test to preselect patients for DNA-sequencing.

PRP5: a helicase-like protein required for mRNA splicing in yeast.

PubMed Central

Dalbadie-McFarland, G; Abelson, J

1990-01-01

A 96-kDa protein predicted by the DNA sequence of the Saccharomyces cerevisiae PRP5 gene contains a domain that bears a striking resemblance to a family of RNA helicases characterized by the conserved amino acid sequence Asp-Glu-Ala-Asp (D-E-A-D). Previous work indicated that the product of the PRP5 gene is required for splicing and that spliceosome assembly does not occur in its absence. However, its precise role in splicing and the nature of its biochemical activity remained unknown. To examine the role of PRP5 in splicing, we cloned the gene by complementation of a temperature-sensitive mutation and determined its DNA sequence. We discuss here the possible roles for an RNA helicase in splicing and for the activity of the PRP5 protein. Images PMID:2349233

Assessment of configurations and chemistries of bridged nucleic acids-containing oligomers as external guide sequences: a methodology for inhibition of expression of antibiotic resistance genes

PubMed Central

Jackson, Alexis; Jani, Saumya; Davies-Sala, Carol; Soler-Bistué, Alfonso J. C.; Zorreguieta, Angeles; Tolmasky, Marcelo E.

2016-01-01

External guide sequences (EGSs) are short antisense oligoribonucleotides that elicit RNase P-mediated cleavage of a target mRNA, which results in inhibition of gene expression. EGS technology is used to inhibit expression of a wide variety of genes, a strategy that may lead to development of novel treatments of numerous diseases, including multidrug-resistant bacterial and viral infections. Successful development of EGS technology depends on finding nucleotide analogs that resist degradation by nucleases present in biological fluids and the environment but still elicit RNase P-mediated degradation when forming a duplex with a target mRNA. Previous results suggested that locked nucleic acids (LNA)/DNA chimeric oligomers have these properties. LNA are now considered the first generation of compounds collectively known as bridged nucleic acids (BNAs) – modified ribonucleotides that contain a bridge at the 2ʹ,4ʹ-position of the ribose. LNA and the second-generation BNA, known as BNANC, differ in the chemical nature of the bridge. Chimeric oligomers containing LNA or BNANC and deoxynucleotide monomers in different configurations are nuclease resistant and could be excellent EGS compounds. However, not all configurations may be equally active as EGSs. RNase P cleavage assays comparing LNA/DNA and BNANC/DNA chimeric oligonucleotides that share identical nucleotide sequence but with different configurations were carried out using as target the amikacin resistance aac(6ʹ)-Ib mRNA. LNA/DNA gapmers with 5 and 3/4 LNA residues at the 5ʹ- and 3ʹ-ends, respectively, were the most efficient EGSs while all BNANC/DNA gapmers showed very poor activity. When the most efficient LNA/DNA gapmer was covalently bound to a cell-penetrating peptide, the hybrid compound conserved the EGS activity as determined by RNase P cleavage assays and reduced the levels of resistance to amikacin when added to Acinetobacter baumannii cells in culture, an indication of cellular uptake and biological activity. PMID:27857983

Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues.

PubMed

Bown, David P; Gatehouse, John A

2004-05-01

Carboxypeptidases were purified from guts of larvae of corn earworm (Helicoverpa armigera), a lepidopteran crop pest, by affinity chromatography on immobilized potato carboxypeptidase inhibitor, and characterized by N-terminal sequencing. A larval gut cDNA library was screened using probes based on these protein sequences. cDNA HaCA42 encoded a carboxypeptidase with sequence similarity to enzymes of clan MC [Barrett, A. J., Rawlings, N. D. & Woessner, J. F. (1998) Handbook of Proteolytic Enzymes. Academic Press, London.], but with a novel predicted specificity towards C-terminal acidic residues. This carboxypeptidase was expressed as a recombinant proprotein in the yeast Pichia pastoris. The expressed protein could be activated by treatment with bovine trypsin; degradation of bound pro-region, rather than cleavage of pro-region from mature protein, was the rate-limiting step in activation. Activated HaCA42 carboxypeptidase hydrolysed a synthetic substrate for glutamate carboxypeptidases (FAEE, C-terminal Glu), but did not hydrolyse substrates for carboxypeptidase A or B (FAPP or FAAK, C-terminal Phe or Lys) or methotrexate, cleaved by clan MH glutamate carboxypeptidases. The enzyme was highly specific for C-terminal glutamate in peptide substrates, with slow hydrolysis of C-terminal aspartate also observed. Glutamate carboxypeptidase activity was present in larval gut extract from H. armigera. The HaCA42 protein is the first glutamate-specific metallocarboxypeptidase from clan MC to be identified and characterized. The genome of Drosophila melanogaster contains genes encoding enzymes with similar sequences and predicted specificity, and a cDNA encoding a similar enzyme has been isolated from gut tissue in tsetse fly. We suggest that digestive carboxypeptidases with sequence similarity to the classical mammalian enzymes, but with specificity towards C-terminal glutamate, are widely distributed in insects.

An improved model for whole genome phylogenetic analysis by Fourier transform.

PubMed

Yin, Changchuan; Yau, Stephen S-T

2015-10-07

DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress.

PubMed

Santos, Efrén; Remy, Serge; Thiry, Els; Windelinckx, Saskia; Swennen, Rony; Sági, László

2009-06-24

Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+) gene and low temperature-responsive luciferase activation was monitored in real time. Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26 degrees C followed by a gradual decrease to 8 degrees C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate promoters even in a multicopy T-DNA line. Qualitative and quantitative GUS expression analyses of one tagged promoter in a commercial cultivar demonstrated a reproducible promoter activity pattern during in vitro culture. Thus, this promoter could be used during in vitro selection and generation of commercial transgenic plants.

Properties of a U1 RNA enhancer-like sequence.

PubMed Central

Ciliberto, G; Palla, F; Tebb, G; Mattaj, I W; Philipson, L

1987-01-01

The properties of a X.laevis U1B snRNA gene enhancer have been studied by microinjection in Xenopus oocytes. The enhancer-like sequence, defined as a short DNA stretch that is able to activate transcription in an orientation independent manner, is interchangeable between different U snRNA genes. The enhancer sequence alone does not, however, efficiently activate transcription from an SV40 pol II promoter but regains its activity when combined with the U-gene specific proximal sequence element. DNase I protection experiments show that the X.laevis U1B enhancer can interact specifically with a nuclear factor present in mammalian cells. Images PMID:3031597

Back to Basics--The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities.

PubMed

Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H

2015-01-01

DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.

Prospecting Metagenomic Enzyme Subfamily Genes for DNA Family Shuffling by a Novel PCR-based Approach*

PubMed Central

Wang, Qiuyan; Wu, Huili; Wang, Anming; Du, Pengfei; Pei, Xiaolin; Li, Haifeng; Yin, Xiaopu; Huang, Lifeng; Xiong, Xiaolong

2010-01-01

DNA family shuffling is a powerful method for enzyme engineering, which utilizes recombination of naturally occurring functional diversity to accelerate laboratory-directed evolution. However, the use of this technique has been hindered by the scarcity of family genes with the required level of sequence identity in the genome database. We describe here a strategy for collecting metagenomic homologous genes for DNA shuffling from environmental samples by truncated metagenomic gene-specific PCR (TMGS-PCR). Using identified metagenomic gene-specific primers, twenty-three 921-bp truncated lipase gene fragments, which shared 64–99% identity with each other and formed a distinct subfamily of lipases, were retrieved from 60 metagenomic samples. These lipase genes were shuffled, and selected active clones were characterized. The chimeric clones show extensive functional and genetic diversity, as demonstrated by functional characterization and sequence analysis. Our results indicate that homologous sequences of genes captured by TMGS-PCR can be used as suitable genetic material for DNA family shuffling with broad applications in enzyme engineering. PMID:20962349

alpha-Mannosidosis in the guinea pig: cloning of the lysosomal alpha-mannosidase cDNA and identification of a missense mutation causing alpha-mannosidosis.

PubMed

Berg, Thomas; Hopwood, John J

2002-03-16

alpha-Mannosidosis is a lysosomal storage disorder caused by deficient activity of the lysosomal alpha-mannosidase. We report here the sequencing and expression of the lysosomal alpha-mannosidase cDNA from normal and alpha-mannosidosis guinea pigs. The amino acid sequence of the guinea pig enzyme displayed 82-85% identity to the lysosomal alpha-mannosidase in other mammals. The cDNA of the alpha-mannosidosis guinea pig contained a missense mutation, 679C>T, leading to substitution of arginine by tryptophan at amino acid position 227 (R227W). The R227W allele segregated with the alpha-mannosidosis genotype in the guinea pig colony and introduction of R227W into the wild-type sequence eliminated the production of recombinant alpha-mannosidase activity in heterologous expression studies. Furthermore, the guinea pig mutation has been found in human patients. Our results strongly indicate that the 679C>T mutation causes alpha-mannosidosis and suggest that the guinea pig will be an excellent model for investigation of pathogenesis and evaluation of therapeutic strategies for human alpha-mannosidosis.

Complementary DNA cloning and functional characterization of cytochrome P450 3A138 in common carp (Cyprinus carpio L.).

PubMed

Ma, Junguo; Bu, Yanzhen; Li, Yao; Niu, Daichun; Li, Xiaoyu

2014-06-01

The full-length sequence of a cytochrome P450 3A 138 (CYP3A138) cDNA in common carp was cloned and sequenced. The transcriptional and microsome enzyme activities of CYP3A138 in the fish liver after rifampicin exposure were also determined in this study. The results showed that the full-length CYP3A138 cDNA is 1912 base pairs (bp) long and contains an open reading frame of 1551 bp encoding a protein of 517 amino acids. Sequence analysis revealed that CYP3A138 is highly conserved in fish. Furthermore, the results of quantitative real-time PCR revealed that CYP3A138 in common carp is constitutively expressed in all tissues, but mainly in the liver and intestine. Additionally, rifampicin exposure promoted both the expression of CYP3A138 at the transcriptional level and the activity of the protein, suggesting that CYP3A138 is a member of the CYP3A subfamily. © 2014 Wiley Periodicals, Inc.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

PubMed

Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

2018-03-01

LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

PubMed

Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

2017-02-01

Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Expression of ZmMET1, a gene encoding a DNA methyltransferase from maize, is associated not only with DNA replication in actively proliferating cells, but also with altered DNA methylation status in cold-stressed quiescent cells.

PubMed

Steward, N; Kusano, T; Sano, H

2000-09-01

A cDNA fragment encoding part of a DNA methyltransferase was isolated from maize. The putative amino acid sequence identically matched that deduced from a genomic sequence in the database (accession no. AF063403), and the corresponding gene was designated as ZmMET1. Bacterially expressed ZmMET1 actively methylated DNA in vitro. Transcripts of ZmMET1 could be shown to exclusively accumulate in actively proliferating cells of the meristems of mesocotyls and root apices, suggesting ZmMET1 expression to be associated with DNA replication. This was confirmed by simultaneous decrease of transcripts of ZmMET1 and histone H3, a marker for DNA replication, in seedlings exposed to wounding, desiccation and salinity, all of which suppress cell division. Cold stress also depressed both transcripts in root tissues. In contrast, however, accumulation of ZmMET1 transcripts in shoot mesocotyls was not affected by cold stress, whereas those for H3 sharply decreased. Such a differential accumulation of ZmMET1 transcripts was consistent with ZmMET1 protein levels as revealed by western blotting. Expression of ZmMET1 is thus coexistent, but not completely dependent on DNA replication. Southern hybridization analysis with a methylation-sensitive restriction enzyme revealed that cold treatment induced demethylation of DNA in the Ac/Ds transposon region, but not in other genes, and that such demethylation primarily occurred in roots. These results suggested that the methylation level was decreased selectively by cold treatment, and that ZmMET1 may, at least partly, prevent such demethylation.

Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

PubMed

Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

2015-08-01

Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain.

PubMed

de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

2014-06-01

The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

PubMed

Yin, Changchuan

2015-04-01

To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.

Single-cell genomic sequencing using Multiple Displacement Amplification.

PubMed

Lasken, Roger S

2007-10-01

Single microbial cells can now be sequenced using DNA amplified by the Multiple Displacement Amplification (MDA) reaction. The few femtograms of DNA in a bacterium are amplified into micrograms of high molecular weight DNA suitable for DNA library construction and Sanger sequencing. The MDA-generated DNA also performs well when used directly as template for pyrosequencing by the 454 Life Sciences method. While MDA from single cells loses some of the genomic sequence, this approach will greatly accelerate the pace of sequencing from uncultured microbes. The genetically linked sequences from single cells are also a powerful tool to be used in guiding genomic assembly of shotgun sequences of multiple organisms from environmental DNA extracts (metagenomic sequences).

Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.

PubMed

Cooper, D N; Errington, L H; Clayton, R M

1983-01-01

Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.

The NnCenH3 protein and centromeric DNA sequence profiles of Nelumbo nucifera Gaertn. (sacred lotus) reveal the DNA structures and dynamics of centromeres in basal eudicots.

PubMed

Zhu, Zhixuan; Gui, Songtao; Jin, Jing; Yi, Rong; Wu, Zhihua; Qian, Qian; Ding, Yi

2016-09-01

Centromeres on eukaryotic chromosomes consist of large arrays of DNA repeats that undergo very rapid evolution. Nelumbo nucifera Gaertn. (sacred lotus) is a phylogenetic relict and an aquatic perennial basal eudicot. Studies concerning the centromeres of this basal eudicot species could provide ancient evolutionary perspectives. In this study, we characterized the centromeric marker protein NnCenH3 (sacred lotus centromere-specific histone H3 variant), and used a chromatin immunoprecipitation (ChIP)-based technique to recover the NnCenH3 nucleosome-associated sequences of sacred lotus. The properties of the centromere-binding protein and DNA sequences revealed notable divergence between sacred lotus and other flowering plants, including the following factors: (i) an NnCenH3 alternative splicing variant comprising only a partial centromere-targeting domain, (ii) active genes with low transcription levels in the NnCenH3 nucleosomal regions, and (iii) the prevalence of the Ty1/copia class of long terminal repeat (LTR) retrotransposons in the centromeres of sacred lotus chromosomes. In addition, the dynamic natures of the centromeric region showed that some of the centromeric repeat DNA sequences originated from telomeric repeats, and a pair of centromeres on the dicentric chromosome 1 was inactive in the metaphase cells of sacred lotus. Our characterization of the properties of centromeric DNA structure within the sacred lotus genome describes a centromeric profile in ancient basal eudicots and might provide evidence of the origins and evolution of centromeres. Furthermore, the identification of centromeric DNA sequences is of great significance for the assembly of the sacred lotus genome. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

NASA Astrophysics Data System (ADS)

Ray, Sujay

Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Finally, we studied another protein-GQ system where a protein complex works synergistically with a GQ to suppress DNA damage signals by preventing RPA to bind to telomeric DNA. Human telomeres that terminate with a single-stranded 3' G-overhang can be recognized as a DNA damage site by RPA. The protection of telomere-1 (POT1) and POT1-interacting protein (TPP1) heterodimer, binds specifically to telomeric DNA and protects it against RPA binding. Using model telomeric DNA, we studied the competition between POT1/TPP1 and RPA to access telomeric GQs in vitro. Under physiological salt and pH conditions, POT1/TPP1 stably load to a minimal DNA sequence adjacent to a folded GQ and unfolds the anti-parallel GQ as the parallel conformation remains folded. We showed that GQ formation of telomeres enhances the ability of POT1/TPP1 to block RPA's access to telomeres by two orders of magnitude and contributes to suppress DNA damage signals.

Regulation of a Viral Proteinase by a Peptide and DNA in One-dimensional Space

PubMed Central

Graziano, Vito; Luo, Guobin; Blainey, Paul C.; Pérez-Berná, Ana J.; McGrath, William J.; Flint, S. Jane; San Martín, Carmen; Xie, X. Sunney; Mangel, Walter F.

2013-01-01

Late in an adenovirus infection, the viral proteinase (AVP) becomes activated to process virion precursor proteins used in virus assembly. AVP is activated by two cofactors, the viral DNA and pVIc, an 11-amino acid peptide originating from the C terminus of the precursor protein pVI. There is a conundrum in the activation of AVP in that AVP and pVI are sequence-independent DNA-binding proteins with nm equilibrium dissociation constants such that in the virus particle, they are predicted to be essentially irreversibly bound to the viral DNA. Here, we resolve that conundrum by showing that activation of AVP takes place on the one-dimensional contour of DNA. In vitro, pVI, a substrate, slides on DNA via one-dimensional diffusion, D1 = 1.45 × 106 bp2/s, until it binds to AVP also on the same DNA molecule. AVP, partially activated by being bound to DNA, excises pVIc, which binds to the AVP molecule that cut it out. pVIc then forms a disulfide bond with AVP forming the fully active AVP-pVIc complex bound to DNA. In vivo, in heat-disrupted immature virus, AVP was also activated by pVI in DNA-dependent reactions. This activation mechanism illustrates a new paradigm for virion maturation and a new way, by sliding on DNA, for bimolecular complexes to form among proteins not involved in DNA metabolism. PMID:23043137

DOE Office of Scientific and Technical Information (OSTI.GOV)

Changela, Anita; DiGate, Russell J.; Mondragon, Alfonso

Escherichia coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5{prime} phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an eight-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is boundmore » along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding.« less

Mangiferin activates the Nrf2-ARE pathway and reduces etoposide-induced DNA damage in human umbilical cord mononuclear blood cells.

PubMed

Zhang, Benping; Zhao, Jie; Li, Shanshan; Zeng, Linglan; Chen, Yan; Fang, Jun

2015-04-01

Mangiferin (2-C-β-d-gluco-pyranosyl-1,3,6,7-tetrahydroxyxanthone) is a well-known natural antioxidant distributed in various plants of the Anacardiaceae and Gentianaceae families. Mangiferin can inhibit carcinogen-induced lung or colon tumor formation in experimental animals. However, the molecular mechanisms of its chemopreventive activity remain unexplored. This study aimed to investigate the effects of mangiferin on chemical carcinogen-induced DNA damage and Nrf2-ARE signaling in hematopoietic cells. Mononuclear cells (MNCs) were isolated from human umbilical cord blood (hUCB). DNA damage was evaluated by comet and micronucleus assays. The expression of Nrf2 and NQO1 was examined by immunofluorescence and western blotting. An electrophoretic mobility shift assay (EMSA) was used to detect the binding activity of Nrf2 with NQO1-ARE sequences. We found that mangiferin treatment significantly reduced DNA damage in etoposide-treated MNCs, which was verified by decreased olive tail moment (OTM) and micronucleus (MN) frequency. Mangiferin treatment significantly promoted Nrf2 translocation into the nucleus and increased nuclear Nrf2 expression. Moreover, NQO1, an Nrf2 signaling target, was significantly upregulated by mangiferin treatment, and the binding activity of Nrf2 with NQO1-ARE sequences was elevated after mangiferin treatment. Mangiferin activated Nrf2 signaling, upregulated NQO1 expression, and significantly reduced etoposide-induced DNA damage. Thus, mangiferin is a potential cytoprotective agent for hematopoietic cells.

DNA Prime/Adenovirus Boost Malaria Vaccine Encoding P. falciparum CSP and AMA1 Induces Sterile Protection Associated with Cell-Mediated Immunity

DTIC Science & Technology

2013-02-14

immunization, was severe (Grade 3), preventing daily activities . Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum...administering a drug selectively active against blood stage parasites such as chloroquine [4,5]. While the immunological mechanisms underlying the...promoter sequence activated within the host cell. Alternatively, the genes are inserted into a viral vector, which efficiently transports the DNA into

Isolation and characterization of the chicken trypsinogen gene family.

PubMed Central

Wang, K; Gan, L; Lee, I; Hood, L

1995-01-01

Based on genomic Southern hybridizations and cDNA sequence analyses, the chicken trypsinogen gene family can be divided into two multi-member subfamilies, a six-member trypsinogen I subfamily which encodes the cationic trypsin isoenzymes and a three-member trypsinogen II subfamily which encodes the anionic trypsin isoenzymes. The chicken cDNA and genomic clones containing these two subfamilies were isolated and characterized by DNA sequence analysis. The results indicated that the chicken trypsinogen genes encoded a signal peptide of 15 to 16 amino acid residues, an activation peptide of 9 to 10 residues and a trypsin of 223 amino acid residues. The chicken trypsinogens contain all the common catalytic and structural features for trypsins, including the catalytic triad His, Asp and Ser and the six disulphide bonds. The trypsinogen I and II subfamilies share approximately 70% sequence identity at the nucleotide and amino acid level. The sequence comparison among chicken trypsinogen subfamily members and trypsin sequences from other species suggested that the chicken trypsinogen genes may have evolved in coincidental or concerted fashion. Images Figure 6 Figure 7 PMID:7733885

Detecting DNA double-stranded breaks in mammalian genomes by linear amplification-mediated high-throughput genome-wide translocation sequencing.

PubMed

Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L

2016-05-01

Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.

Nucleotide sequence and regulatory studies of VGF, a nervous system-specific mRNA that is rapidly and relatively selectively induced by nerve growth factor.

PubMed

Salton, S R

1991-09-01

A nervous system-specific mRNA that is rapidly induced in PC12 cells to a greater extent by nerve growth factor (NGF) than by epidermal growth factor treatment has been cloned. The polypeptide deduced from the nucleic acid sequence of the NGF33.1 cDNA clone contains regions of amino acid sequence identity with that predicted by the cDNA clone VGF, and further analysis suggests that both NGF33.1 and VGF cDNA clones very likely correspond to the same mRNA (VGF). In this report both the nucleic acid sequence that corresponds to VGF mRNA and the polypeptide predicted by the NGF33.1 cDNA clone are presented. Genomic Southern analysis and database comparison did not detect additional sequences with high homology to the VGF gene. Induction of VGF mRNA by depolarization and phorbol 12-myristate 13-acetate treatment was greater than by serum stimulation or protein kinase A pathway activation. These studies suggest that VGF mRNA is induced to the greatest extent by NGF treatment and that VGF is one of the most rapidly regulated neuronal mRNAs identified in PC12 cells.

DNA gel electrophoresis: the reptation model(s).

PubMed

Slater, Gary W

2009-06-01

DNA gel electrophoresis has been the most important experimental tool to separate DNA fragments for several decades. The introduction of PFGE in the 1980s and capillary gel electrophoresis in the 1990s made it possible to study, map and sequence entire genomes. Explaining how very large DNA molecules move in a gel and why PFGE is needed to separate them has been an active field of research ever since the launch of the journal Electrophoresis. This article presents a personal and historical overview of the development of the theory of gel electrophoresis, focusing on the reptation model, the band broadening mechanisms, and finally the factors that limit the read length and the resolution of electrophoresis-based sequencing systems. I conclude with a short discussion of some of the questions that remain unanswered.

DNA binding of the p21 repressor ZBTB2 is inhibited by cytosine hydroxymethylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lafaye, Céline; Barbier, Ewa; Miscioscia, Audrey

2014-03-28

Highlights: • 5-hmC epigenetic modification is measurable in HeLa, SH-SY5Y and UT7-MPL cell lines. • ZBTB2 binds to DNA probes containing 5-mC but not to sequences containing 5-hmC. • This differential binding is verified with DNA sequences involved in p21 regulation. - Abstract: Recent studies have demonstrated that the modified base 5-hydroxymethylcytosine (5-hmC) is detectable at various rates in DNA extracted from human tissues. This oxidative product of 5-methylcytosine (5-mC) constitutes a new and important actor of epigenetic mechanisms. We designed a DNA pull down assay to trap and identify nuclear proteins bound to 5-hmC and/or 5-mC. We applied thismore » strategy to three cancerous cell lines (HeLa, SH-SY5Y and UT7-MPL) in which we also measured 5-mC and 5-hmC levels by HPLC-MS/MS. We found that the putative oncoprotein Zinc finger and BTB domain-containing protein 2 (ZBTB2) is associated with methylated DNA sequences and that this interaction is inhibited by the presence of 5-hmC replacing 5-mC. As published data mention ZBTB2 recognition of p21 regulating sequences, we verified that this sequence specific binding was also alleviated by 5-hmC. ZBTB2 being considered as a multifunctional cell proliferation activator, notably through p21 repression, this work points out new epigenetic processes potentially involved in carcinogenesis.« less

Information analysis of sequences that bind the replication initiator RepA | Center for Cancer Research

Cancer.gov

The tall letters represent the highly conserved bases in DNA binding sites of several prokaryotic repressors and activators. Conservation is strongest where major grooves of the double helical DNA (represented by crests of a cosine wave) face the protein. This shows that conservation analysis alone can be used to predict the face of DNA that contacts the proteins.

Acquisition of New DNA Sequences After Infection of Chicken Cells with Avian Myeloblastosis Virus

PubMed Central

Shoyab, M.; Baluda, M. A.; Evans, R.

1974-01-01

DNA-RNA hybridization studies between 70S RNA from avian myeloblastosis virus (AMV) and an excess of DNA from (i) AMV-induced leukemic chicken myeloblasts or (ii) a mixture of normal and of congenitally infected K-137 chicken embryos producing avian leukosis viruses revealed the presence of fast- and slow-hybridizing virus-specific DNA sequences. However, the leukemic cells contained twice the level of AMV-specific DNA sequences observed in normal chicken embryonic cells. The fast-reacting sequences were two to three times more numerous in leukemic DNA than in DNA from the mixed embryos. The slow-reacting sequences had a reiteration frequency of approximately 9 and 6, in the two respective systems. Both the fast- and the slow-reacting DNA sequences in leukemic cells exhibited a higher Tm (2 C) than the respective DNA sequences in normal cells. In normal and leukemic cells the slow hybrid sequences appeared to have a Tm which was 2 C higher than that of the fast hybrid sequences. Individual non-virus-producing chicken embryos, either group-specific antigen positive or negative, contained 40 to 100 copies of the fast sequences and 2 to 6 copies of the slowly hybridizing sequences per cell genome. Normal rat cells did not contain DNA that hybridized with AMV RNA, whereas non-virus-producing rat cells transformed by B-77 avian sarcoma virus contained only the slowly reacting sequences. The results demonstrate that leukemic cells transformed by AMV contain new AMV-specific DNA sequences which were not present before infection. PMID:16789139

Biological function in the twilight zone of sequence conservation.

PubMed

Ponting, Chris P

2017-08-16

Strong DNA conservation among divergent species is an indicator of enduring functionality. With weaker sequence conservation we enter a vast 'twilight zone' in which sequence subject to transient or lower constraint cannot be distinguished easily from neutrally evolving, non-functional sequence. Twilight zone functional sequence is illuminated instead by principles of selective constraint and positive selection using genomic data acquired from within a species' population. Application of these principles reveals that despite being biochemically active, most twilight zone sequence is not functional.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

PubMed Central

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

An extraovarian protein accumulated in mosquito oocytes is a carboxypeptidase activated in embryos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wenlong Cho; Deitsch, K.W.; Raikhel, A.S.

1991-12-01

The authors report a phenomenon previously unknown for oviparous animals; in Aedes aegypti mosquitoes a serine carboxypeptidase is synthesized extraovarially and then internalized by oocytes. The cDNA encoding mosquito vitellogenic carboxypeptidase (VCP) was cloned and sequenced. The VCP cDNA hybridizes to a 1.5-kilobase mRNA present only in the fat body of vitellogenic females. The deduced amino acid sequence of VCP shares significant homology with members of the serine carboxypeptidase family. Binding assays using a serine protease inhibitor, ({sup 3}H)diisopropyl fluorophosphate, showed that VCP is activated in eggs at the onset of embryonic development. Activation of VCP is associated with themore » reduction in its size from 53 kDa (inactive proenzyme) to 48 kDa (active enzyme). The active, 48-kDa, form of VCP is maximally present at the middle of embryonic development and disappears by the end.« less

MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

PubMed

Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

2012-06-29

The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

Integrative Clinical Genomics of Metastatic Cancer

PubMed Central

Robinson, Dan R.; Wu, Yi-Mi; Lonigro, Robert J.; Vats, Pankaj; Cobain, Erin; Everett, Jessica; Cao, Xuhong; Rabban, Erica; Kumar-Sinha, Chandan; Raymond, Victoria; Schuetze, Scott; Alva, Ajjai; Siddiqui, Javed; Chugh, Rashmi; Worden, Francis; Zalupski, Mark M.; Innis, Jeffrey; Mody, Rajen J.; Tomlins, Scott A.; Lucas, David; Baker, Laurence H.; Ramnath, Nithya; Schott, Ann F.; Hayes, Daniel F.; Vijai, Joseph; Offit, Kenneth; Stoffel, Elena M.; Roberts, J. Scott; Smith, David C.; Kunju, Lakshmi P.; Talpaz, Moshe; Cieslik, Marcin; Chinnaiyan, Arul M.

2017-01-01

SUMMARY Metastasis is the primary cause of cancer-related deaths. While The Cancer Genome Atlas (TCGA) has sequenced primary tumor types obtained from surgical resections, much less comprehensive molecular analysis is available from clinically acquired metastatic cancers. Here, we perform whole exome and transcriptome sequencing of 500 adult patients with metastatic solid tumors of diverse lineage and biopsy site. The most prevalent genes somatically altered in metastatic cancer included TP53, CDKN2A, PTEN, PIK3CA, and RB1. Putative pathogenic germline variants were present in 12.2% of cases of which 75% were related to defects in DNA repair. RNA sequencing complemented DNA sequencing for the identification of gene fusions, pathway activation, and immune profiling. Integrative sequence analysis provides a clinically relevant, multi-dimensional view of the complex molecular landscape and microenvironment of metastatic cancers. PMID:28783718

cDNA cloning, functional expression and antifungal activities of a dimeric plant defensin SPE10 from Pachyrrhizus erosus seeds.

PubMed

Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin

2005-01-01

SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.

Characterization of c-Ki-ras and N-ras oncogenes in aflatoxin B sub 1 -induced rat liver tumors

DOE Office of Scientific and Technical Information (OSTI.GOV)

McMahon, G.; Davis, E.F.; Huber, L.J.

c-Ki-ras and N-ras oncogenes have been characterized in aflatoxin B{sub 1}-induced hepatocellular carcinomas. Detection of different protooncogene and oncogene sequences and estimation of their frequency distribution were accomplished by polymerase chain reaction, cloning, and plaque screening methods. Two c-Ki-ras oncogene sequences were identified in DNA from liver tumors that contained nucleotide changes absent in DNA from livers of untreated control rats. Sequence changes involving G{center dot}C to T{center dot}A or G{center dot}C to A{center dot}T nucleotide substitutions in codon 12 were scored in three of eight tumor-bearing animals. Distributions of c-Ki-ras sequences in tumors and normal liver DNA indicated thatmore » the observed nucleotide changes were consistent with those expected to result from direct mutagenesis of the germ-line protooncogene by aflatoxin B{sub 1}. N-ras oncogene sequences were identified in DNA from two of eight tumors. Three N-ras gene regions were identified, one of which was shown to be associated with an oncogene containing a putative activating amino acid residing at codon 13. All three N-ras sequences, including the region detected in N-ras oncogenes, were present at similar frequencies in DNA samples from control livers as well as liver tumors. The presence of a potential germ-line oncogene may be related to the sensitivity of the Fischer rat strain to liver carcinogenesis by aflatoxin B{sub 1} and other chemical carcinogens.« less

A Sequence-Specific Nicking Endonuclease from Streptomyces: Purification, Physical and Catalytic Properties

PubMed Central

Somyoonsap, Peechapack; Kitpreechavanich, Vichein

2013-01-01

A sequence-specific nicking endonuclease from Streptomyces designated as DC13 was purified to near homogeneity. Starting with 30 grams of wet cells, the enzyme was purified by ammonium sulfate fractionation, DEAE cellulose, and phenyl-Sepharose chromatography. The purified protein had a specific activity 1000 units/mg and migrated on SDS-PAGE gel with an estimated molecular weight of 71 kDa. Determination of subunit composition by gel filtration chromatography indicated that the native enzyme is a monomer. When incubated with different DNA substrates including pBluescript II KS, pUC118, pET-15b, and pET-26b, the enzyme converted these supercoiled plasmids to a mixture of open circular and linear DNA products, with the open circular DNA as the major cleavage product. Analysis of the kinetic of DNA cleavage showed that the enzyme appeared to cleave super-coiled plasmid in two distinct steps: a rapid cleavage of super-coiled plasmid to an open circular DNA followed a much slower step to linear DNA. The DNA cleavage reaction of the enzyme required Mg2+ as a cofactor. Based on the monomeric nature of the enzyme, the kinetics of DNA cleavage exhibited by the enzyme, and cofactor requirement, it is suggested here that the purified enzyme is a sequence-specific nicking endonuclease that is similar to type IIS restriction endonuclease. PMID:25937959

Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cairns, S.S.

1987-01-01

In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

Determinants of spontaneous mutation in the bacterium Escherichia coli as revealed by whole-genome sequencing

PubMed Central

Foster, Patricia L.; Lee, Heewook; Popodi, Ellen; Townes, Jesse P.; Tang, Haixu

2015-01-01

A complete understanding of evolutionary processes requires that factors determining spontaneous mutation rates and spectra be identified and characterized. Using mutation accumulation followed by whole-genome sequencing, we found that the mutation rates of three widely diverged commensal Escherichia coli strains differ only by about 50%, suggesting that a rate of 1–2 × 10−3 mutations per generation per genome is common for this bacterium. Four major forces are postulated to contribute to spontaneous mutations: intrinsic DNA polymerase errors, endogenously induced DNA damage, DNA damage caused by exogenous agents, and the activities of error-prone polymerases. To determine the relative importance of these factors, we studied 11 strains, each defective for a major DNA repair pathway. The striking result was that only loss of the ability to prevent or repair oxidative DNA damage significantly impacted mutation rates or spectra. These results suggest that, with the exception of oxidative damage, endogenously induced DNA damage does not perturb the overall accuracy of DNA replication in normally growing cells and that repair pathways may exist primarily to defend against exogenously induced DNA damage. The thousands of mutations caused by oxidative damage recovered across the entire genome revealed strong local-sequence biases of these mutations. Specifically, we found that the identity of the 3′ base can affect the mutability of a purine by oxidative damage by as much as eightfold. PMID:26460006

Restriction/modification polypeptides, polynucleotides, and methods

DOEpatents

Westpheling, Janet; Chung, DaeHwan; Huddleston, Jennifer; Farkas, Joel A

2015-02-24

The present invention relates to the discovery of a novel restriction/modification system in Caldicellulosiruptor bescii. The discovered restriction enzyme is a HaeIII-like restriction enzyme that possesses a thermophilic activity profile. The restriction/modification system also includes a methyltransferase, M.CbeI, that methylates at least one cytosine residue in the CbeI recognition sequence to m.sup.4C. Thus, the invention provides, in various aspects, isolated CbeI or M.CbeI polypeptides, or biologically active fragments thereof; isolated polynucleotides that encode the CbeI or M.CbeI polypeptides or biologically active fragments thereof, including expression vectors that include such polynucleotide sequences; methods of digesting DNA using a CbeI polypeptide; methods of treating a DNA molecule using a M.CbeI polypeptide; and methods of transforming a Caldicellulosiruptor cell.

Detection and isolation of novel rhizopine-catabolizing bacteria from the environment

PubMed

Gardener; de Bruijn FJ

1998-12-01

Microbial rhizopine-catabolizing (Moc) activity was detected in serial dilutions of soil and rhizosphere washes. The activity observed generally ranged between 10(6) and 10(7) catabolic units per g, and the numbers of nonspecific culture-forming units were found to be approximately 10 times higher. A diverse set of 37 isolates was obtained by enrichment on scyllo-inosamine-containing media. However, none of the bacteria that were isolated were found to contain DNA sequences homologous to the known mocA, mocB, and mocC genes of Sinorhizobium meliloti L5-30. Twenty-one of the isolates could utilize an SI preparation as the sole carbon and nitrogen source for growth. Partial sequencing of 16S ribosomal DNAs (rDNAs) amplified from these strains indicated that five distinct bacterial genera (Arthrobacter, Sinorhizobium, Pseudomonas, Aeromonas, and Alcaligenes) were represented in this set. Only 6 of these 21 isolates could catabolize 3-O-methyl-scyllo-inosamine under standard assay conditions. Two of these, strains D1 and R3, were found to have 16S rDNA sequences very similar to those of Sinorhizobium meliloti. However, these strains are not symbiotically effective on Medicago sativa, and DNA sequences homologous to the nodB and nodC genes were not detected in strains D1 and R3 by Southern hybridization analysis.

Detection and Isolation of Novel Rhizopine-Catabolizing Bacteria from the Environment

PubMed Central

Gardener, Brian B. McSpadden; de Bruijn, Frans J.

1998-01-01

Microbial rhizopine-catabolizing (Moc) activity was detected in serial dilutions of soil and rhizosphere washes. The activity observed generally ranged between 106 and 107 catabolic units per g, and the numbers of nonspecific culture-forming units were found to be approximately 10 times higher. A diverse set of 37 isolates was obtained by enrichment on scyllo-inosamine-containing media. However, none of the bacteria that were isolated were found to contain DNA sequences homologous to the known mocA, mocB, and mocC genes of Sinorhizobium meliloti L5-30. Twenty-one of the isolates could utilize an SI preparation as the sole carbon and nitrogen source for growth. Partial sequencing of 16S ribosomal DNAs (rDNAs) amplified from these strains indicated that five distinct bacterial genera (Arthrobacter, Sinorhizobium, Pseudomonas, Aeromonas, and Alcaligenes) were represented in this set. Only 6 of these 21 isolates could catabolize 3-O-methyl-scyllo-inosamine under standard assay conditions. Two of these, strains D1 and R3, were found to have 16S rDNA sequences very similar to those of Sinorhizobium meliloti. However, these strains are not symbiotically effective on Medicago sativa, and DNA sequences homologous to the nodB and nodC genes were not detected in strains D1 and R3 by Southern hybridization analysis. PMID:9835587

Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.

PubMed

Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N

1984-03-26

The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.

Process of labeling specific chromosomes using recombinant repetitive DNA

DOEpatents

Moyzis, R.K.; Meyne, J.

1988-02-12

Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

N-acyl homoserine lactone binding to the CarR receptor determines quorum-sensing specificity in Erwinia.

PubMed

Welch, M; Todd, D E; Whitehead, N A; McGowan, S J; Bycroft, B W; Salmond, G P

2000-02-15

Quorum sensing via an N-acyl homoserine lactone (HSL) pheromone controls the biosynthesis of a carbapenem antibiotic in Erwinia carotovora. Transcription of the carbapenem biosynthetic genes is dependent on the LuxR-type activator protein, CarR. Equilibrium binding of a range of HSL molecules, which are thought to activate CarR to bind to its DNA target sequence, was examined using fluorescence quenching, DNA bandshift analysis, limited proteolysis and reporter gene assays. CarR bound the most physiologically relevant ligand, N-(3-oxohexanoyl)-L-homoserine lactone, with a stoichiometry of two molecules of ligand per dimer of protein and a dissociation constant of 1.8 microM, in good agreement with the concentration of HSL required to activate carbapenem production in vivo. In the presence of HSL, CarR formed a very high molecular weight complex with its target DNA, indicating that the ligand causes the protein to multimerize. Chemical cross-linking analysis supported this interpretation. Our data show that the ability of a given HSL to facilitate CarR binding to its target DNA sequence is directly proportional to the affinity of the HSL for the protein.

Sequence-specific DNA binding activity of the cross-brace zinc finger motif of the piggyBac transposase

PubMed Central

Morellet, Nelly; Li, Xianghong; Wieninger, Silke A; Taylor, Jennifer L; Bischerour, Julien; Moriau, Séverine; Lescop, Ewen; Bardiaux, Benjamin; Mathy, Nathalie; Assrir, Nadine; Bétermier, Mireille; Nilges, Michael; Hickman, Alison B; Dyda, Fred; Craig, Nancy L; Guittet, Eric

2018-01-01

Abstract The piggyBac transposase (PB) is distinguished by its activity and utility in genome engineering, especially in humans where it has highly promising therapeutic potential. Little is known, however, about the structure–function relationships of the different domains of PB. Here, we demonstrate in vitro and in vivo that its C-terminal Cysteine-Rich Domain (CRD) is essential for DNA breakage, joining and transposition and that it binds to specific DNA sequences in the left and right transposon ends, and to an additional unexpectedly internal site at the left end. Using NMR, we show that the CRD adopts the specific fold of the cross-brace zinc finger protein family. We determine the interaction interfaces between the CRD and its target, the 5′-TGCGT-3′/3′-ACGCA-5′ motifs found in the left, left internal and right transposon ends, and use NMR results to propose docking models for the complex, which are consistent with our site-directed mutagenesis data. Our results provide support for a model of the PB/DNA interactions in the context of the transpososome, which will be useful for the rational design of PB mutants with increased activity. PMID:29385532

The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

PubMed

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.

The Paramecium Germline Genome Provides a Niche for Intragenic Parasitic DNA: Evolutionary Dynamics of Internal Eliminated Sequences

PubMed Central

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Two synthetic Sp1-binding sites functionally substitute for the 21-base-pair repeat region to activate simian virus 40 growth in CV-1 cells.

PubMed Central

Lednicky, J; Folk, W R

1992-01-01

The 21-bp repeat region of simian virus 40 (SV40) activates viral transcription and DNA replication and contains binding sites for many cellular proteins, including Sp1, LSF, ETF, Ap2, Ap4, GT-1B, H16, and p53, and for the SV40 large tumor antigen. We have attempted to reduce the complexity of this region while maintaining its growth-promoting capacity. Deletion of the 21-bp repeat region from the SV40 genome delays the expression of viral early proteins and DNA replication and reduces virus production in CV-1 cells. Replacement of the 21-bp repeat region with two copies of DNA sequence motifs bound with high affinities by Sp1 promotes SV40 growth in CV-1 cells to nearly wild-type levels, but substitution by motifs bound less avidly by Sp1 or bound by other activator proteins does not restore growth. This indicates that Sp1 or a protein with similar sequence specificity is primarily responsible for the function of the 21-bp repeat region. We speculate about how Sp1 activates both SV40 transcription and DNA replication. Images PMID:1328672

Cooperative heteroassembly of the adenoviral L4-22K and IVa2 proteins onto the viral packaging sequence DNA.

PubMed

Yang, Teng-Chieh; Maluf, Nasib Karl

2012-02-21

Human adenovirus (Ad) is an icosahedral, double-stranded DNA virus. Viral DNA packaging refers to the process whereby the viral genome becomes encapsulated by the viral particle. In Ad, activation of the DNA packaging reaction requires at least three viral components: the IVa2 and L4-22K proteins and a section of DNA within the viral genome, called the packaging sequence. Previous studies have shown that the IVa2 and L4-22K proteins specifically bind to conserved elements within the packaging sequence and that these interactions are absolutely required for the observation of DNA packaging. However, the equilibrium mechanism for assembly of IVa2 and L4-22K onto the packaging sequence has not been determined. Here we characterize the assembly of the IVa2 and L4-22K proteins onto truncated packaging sequence DNA by analytical sedimentation velocity and equilibrium methods. At limiting concentrations of L4-22K, we observe a species with two IVa2 monomers and one L4-22K monomer bound to the DNA. In this species, the L4-22K monomer is promoting positive cooperative interactions between the two bound IVa2 monomers. As L4-22K levels are increased, we observe a species with one IVa2 monomer and three L4-22K monomers bound to the DNA. To explain this result, we propose a model in which L4-22K self-assembly on the DNA competes with IVa2 for positive heterocooperative interactions, destabilizing binding of the second IVa2 monomer. Thus, we propose that L4-22K levels control the extent of cooperativity observed between adjacently bound IVa2 monomers. We have also determined the hydrodynamic properties of all observed stoichiometric species; we observe that species with three L4-22K monomers bound have more extended conformations than species with a single L4-22K bound. We suggest this might reflect a molecular switch that controls insertion of the viral DNA into the capsid.

Linear Lepidopteran ambidensovirus 1 sequences drive random integration of a reporter gene in transfected Spodoptera frugiperda cells.

PubMed

Rizk, Francine; Laverdure, Sylvain; d'Alençon, Emmanuelle; Bossin, Hervé; Dupressoir, Thierry

2018-01-01

The Lepidopteran ambidensovirus 1 isolated from Junonia coenia (hereafter JcDV) is an invertebrate parvovirus considered as a viral transduction vector as well as a potential tool for the biological control of insect pests. Previous works showed that JcDV-based circular plasmids experimentally integrate into insect cells genomic DNA. In order to approach the natural conditions of infection and possible integration, we generated linear JcDV- gfp based molecules which were transfected into non permissive Spodoptera frugiperda ( Sf9 ) cultured cells. Cells were monitored for the expression of green fluorescent protein (GFP) and DNA was analyzed for integration of transduced viral sequences. Non-structural protein modulation of the VP-gene cassette promoter activity was additionally assayed. We show that linear JcDV-derived molecules are capable of long term genomic integration and sustained transgene expression in Sf9 cells. As expected, only the deletion of both inverted terminal repeats (ITR) or the polyadenylation signals of NS and VP genes dramatically impairs the global transduction/expression efficiency. However, all the integrated viral sequences we characterized appear "scrambled" whatever the viral content of the transfected vector. Despite a strong GFP expression, we were unable to recover any full sequence of the original constructs and found rearranged viral and non-viral sequences as well. Cellular flanking sequences were identified as non-coding ones. On the other hand, the kinetics of GFP expression over time led us to investigate the apparent down-regulation by non-structural proteins of the VP-gene cassette promoter. Altogether, our results show that JcDV-derived sequences included in linear DNA molecules are able to drive efficiently the integration and expression of a foreign gene into the genome of insect cells, whatever their composition, provided that at least one ITR is present. However, the transfected sequences were extensively rearranged with cellular DNA during or after random integration in the host cell genome. Lastly, the non-structural proteins seem to participate in the regulation of p9 promoter activity rather than to the integration of viral sequences.

Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion

PubMed Central

Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko

2011-01-01

Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143

DNA Data Visualization (DDV): Software for Generating Web-Based Interfaces Supporting Navigation and Analysis of DNA Sequence Data of Entire Genomes.

PubMed

Neugebauer, Tomasz; Bordeleau, Eric; Burrus, Vincent; Brzezinski, Ryszard

2015-01-01

Data visualization methods are necessary during the exploration and analysis activities of an increasingly data-intensive scientific process. There are few existing visualization methods for raw nucleotide sequences of a whole genome or chromosome. Software for data visualization should allow the researchers to create accessible data visualization interfaces that can be exported and shared with others on the web. Herein, novel software developed for generating DNA data visualization interfaces is described. The software converts DNA data sets into images that are further processed as multi-scale images to be accessed through a web-based interface that supports zooming, panning and sequence fragment selection. Nucleotide composition frequencies and GC skew of a selected sequence segment can be obtained through the interface. The software was used to generate DNA data visualization of human and bacterial chromosomes. Examples of visually detectable features such as short and long direct repeats, long terminal repeats, mobile genetic elements, heterochromatic segments in microbial and human chromosomes, are presented. The software and its source code are available for download and further development. The visualization interfaces generated with the software allow for the immediate identification and observation of several types of sequence patterns in genomes of various sizes and origins. The visualization interfaces generated with the software are readily accessible through a web browser. This software is a useful research and teaching tool for genetics and structural genomics.

Purification, characterization and molecular cloning of chymotrypsin inhibitor peptides from the venom of Burmese Daboia russelii siamensis.

PubMed

Guo, Chun-Teng; McClean, Stephen; Shaw, Chris; Rao, Ping-Fan; Ye, Ming-Yu; Bjourson, Anthony J

2013-05-01

One novel Kunitz BPTI-like peptide designated as BBPTI-1, with chymotrypsin inhibitory activity was identified from the venom of Burmese Daboia russelii siamensis. It was purified by three steps of chromatography including gel filtration, cation exchange and reversed phase. A partial N-terminal sequence of BBPTI-1, HDRPKFCYLPADPGECLAHMRSF was obtained by automated Edman degradation and a Ki value of 4.77nM determined. Cloning of BBPTI-1 including the open reading frame and 3' untranslated region was achieved from cDNA libraries derived from lyophilized venom using a 3' RACE strategy. In addition a cDNA sequence, designated as BBPTI-5, was also obtained. Alignment of cDNA sequences showed that BBPTI-5 exhibited an identical sequence to BBPTI-1 cDNA except for an eight nucleotide deletion in the open reading frame. Gene variations that represented deletions in the BBPTI-5 cDNA resulted in a novel protease inhibitor analog. Amino acid sequence alignment revealed that deduced peptides derived from cloning of their respective precursor cDNAs from libraries showed high similarity and homology with other Kunitz BPTI proteinase inhibitors. BBPTI-1 and BBPTI-5 consist of 60 and 66 amino acid residues respectively, including six conserved cysteine residues. As these peptides have been reported to have influence on the processes of coagulation, fibrinolysis and inflammation, their potential application in biomedical contexts warrants further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

"First generation" automated DNA sequencing technology.

PubMed

Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M

2011-10-01

Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.

An Analysis of Enzyme Kinetics Data for Mitochondrial DNA Strand Termination by Nucleoside Reverse Transcription Inhibitors

PubMed Central

Wendelsdorf, Katherine V.; Song, Zhuo; Cao, Yang; Samuels, David C.

2009-01-01

Nucleoside analogs used in antiretroviral treatment have been associated with mitochondrial toxicity. The polymerase-γ hypothesis states that this toxicity stems from the analogs' inhibition of the mitochondrial DNA polymerase (polymerase-γ) leading to mitochondrial DNA (mtDNA) depletion. We have constructed a computational model of the interaction of polymerase-γ with activated nucleoside and nucleotide analog drugs, based on experimentally measured reaction rates and base excision rates, together with the mtDNA genome size, the human mtDNA sequence, and mitochondrial dNTP concentrations. The model predicts an approximately 1000-fold difference in the activated drug concentration required for a 50% probability of mtDNA strand termination between the activated di-deoxy analogs d4T, ddC, and ddI (activated to ddA) and the activated forms of the analogs 3TC, TDF, AZT, FTC, and ABC. These predictions are supported by experimental and clinical data showing significantly greater mtDNA depletion in cell culture and patient samples caused by the di-deoxy analog drugs. For zidovudine (AZT) we calculated a very low mtDNA replication termination probability, in contrast to its reported mitochondrial toxicity in vitro and clinically. Therefore AZT mitochondrial toxicity is likely due to a mechanism that does not involve strand termination of mtDNA replication. PMID:19132079

Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2004-06-01

The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.

Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haruta, Mayumi; Shimada, Midori, E-mail: midorism@med.nagoya-cu.ac.jp; Nishiyama, Atsuya

The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program.more » Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.« less

Diversity and survivability of microbial community in ancient permafrost sediment of northeast Siberia

NASA Astrophysics Data System (ADS)

Liang, R.; Lau, M.; Vishnivetskaya, T. A.; Lloyd, K. G.; Pfiffner, S. M.; Rivkina, E.; Onstott, T. C.

2017-12-01

The prevalence of microorganisms in frozen permafrost has been well documented in ancient sediment up to several million years old. However, the long term survivability and metabolic activity of microbes over geological timespans remain underexplored. Siberian permafrost sediment was collected at various depths (1.4m, 11.8 m and 24.8m) to represent a wide range of geological time from thousands to millions of years. Extracellular (eDNA) and intracellular DNA (iDNA) was simultaneously recovered for sequencing to characterize the potentially extinct and extant microbial community. Additionally, aspartic acid racemization assay (D/L Asp) was used to infer the metabolic activity of microbes in ancient permafrost. As compared with the young sample (1.4m), DNA yield and content of aspartic acid dramatically decreased in old samples (11.8m and 24.8m). However, D/L Asp and eDNA/iDNA significantly increased with the geological age. Such findings suggested that ancient microbiomes might be subjected to racemization or even DNA/proteins degradation at subzero temperature over the wide geological time scale. Preliminary characterization of microbial community indicated that the majority of sequences in old samples were identified as bacteria and only a small fraction was identified as archaea from the iDNA pool. While the eDNA and iDNA fractions shared similar dominant taxa at phylum level, the relative abundance of Proteobacteria in eDNA library was much higher than iDNA. By contrast, the phylum affiliated with Firmicutes was more numerically abundant in the iDNA fraction. More dramatic differences were observed between eDNA and iDNA library at lower taxonomic levels. Particularly, the microbial lineages affiliated with the genera Methanoregula, Desulfosporosinus and Syntrophomonas were only detected in the iDNA library. Such taxonomic difference between the relic eDNA and iDNA suggested that numerous species become locally "extinct" whereas many other taxa might survive in ancient sediment. Ultimately, when coupling our current findings to the D/L Asp in cellular proteins and metaproteomics, a better understanding will be achieved about the microbial activity of the extant microbial community and their roles in biogeochemical cycling in ancient permafrost.

Structural Studies of E. coli Topoisomerase III-DNA Complexes Reveal A Novel Type IA Topoisomerase-DNA Conformational Intermediate

PubMed Central

Changela, Anita; DiGate, Russell J.; Mondragón, Alfonso

2007-01-01

Summary E. coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5′ phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an 8-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is bound along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding. PMID:17331537

Influence of DNA sequence on the structure of minicircles under torsional stress

PubMed Central

Wang, Qian; Irobalieva, Rossitza N.; Chiu, Wah; Schmid, Michael F.; Fogg, Jonathan M.; Zechiedrich, Lynn

2017-01-01

Abstract The sequence dependence of the conformational distribution of DNA under various levels of torsional stress is an important unsolved problem. Combining theory and coarse-grained simulations shows that the DNA sequence and a structural correlation due to topology constraints of a circle are the main factors that dictate the 3D structure of a 336 bp DNA minicircle under torsional stress. We found that DNA minicircle topoisomers can have multiple bend locations under high torsional stress and that the positions of these sharp bends are determined by the sequence, and by a positive mechanical correlation along the sequence. We showed that simulations and theory are able to provide sequence-specific information about individual DNA minicircles observed by cryo-electron tomography (cryo-ET). We provided a sequence-specific cryo-ET tomogram fitting of DNA minicircles, registering the sequence within the geometric features. Our results indicate that the conformational distribution of minicircles under torsional stress can be designed, which has important implications for using minicircle DNA for gene therapy. PMID:28609782

In vitro selection of high temperature Zn(2+)-dependent DNAzymes.

PubMed

Nelson, Kevin E; Bruesehoff, Peter J; Lu, Yi

2005-08-01

In vitro selection of Zn(2+)-dependent RNA-cleaving DNAzymes with activity at 90 degrees C has yielded a diverse spool of selected sequences. The RNA cleavage efficiency was found in all cases to be specific for Zn(2+) over Pb(2+), Ca(2+), Cd(2+), Co(2+), Hg(2+), and Mg(2+). The Zn(2+)-dependent activity assay of the most active sequence showed that the DNAzyme possesses an apparent Zn(2+)-binding dissociation constant of 234 muM and that its activity increases with increasing temperatures from 50-90 degrees C. A fit of the Arrhenius plot data gave E(a) = 15.3 kcal mol(-1). Surprisingly, the selected Zn(2+)-dependent DNAzymes showed only a modest (approximately 3-fold) activity enhancement over the background rate of cleavage of random sequences containing a single embedded ribonucleotide within an otherwise DNA oligonucleotide. The result is attributable to the ability of DNA to sustain cleavage activity at high temperature with minimal secondary structure when Zn(2+) is present. Since this effect is highly specific for Zn(2+), this metal ion may play a special role in molecular evolution of nucleic acids at high temperature.

Open resource metagenomics: a model for sharing metagenomic libraries.

PubMed

Neufeld, J D; Engel, K; Cheng, J; Moreno-Hagelsieb, G; Rose, D R; Charles, T C

2011-11-30

Both sequence-based and activity-based exploitation of environmental DNA have provided unprecedented access to the genomic content of cultivated and uncultivated microorganisms. Although researchers deposit microbial strains in culture collections and DNA sequences in databases, activity-based metagenomic studies typically only publish sequences from the hits retrieved from specific screens. Physical metagenomic libraries, conceptually similar to entire sequence datasets, are usually not straightforward to obtain by interested parties subsequent to publication. In order to facilitate unrestricted distribution of metagenomic libraries, we propose the adoption of open resource metagenomics, in line with the trend towards open access publishing, and similar to culture- and mutant-strain collections that have been the backbone of traditional microbiology and microbial genetics. The concept of open resource metagenomics includes preparation of physical DNA libraries, preferably in versatile vectors that facilitate screening in a diversity of host organisms, and pooling of clones so that single aliquots containing complete libraries can be easily distributed upon request. Database deposition of associated metadata and sequence data for each library provides researchers with information to select the most appropriate libraries for further research projects. As a starting point, we have established the Canadian MetaMicroBiome Library (CM(2)BL [1]). The CM(2)BL is a publicly accessible collection of cosmid libraries containing environmental DNA from soils collected from across Canada, spanning multiple biomes. The libraries were constructed such that the cloned DNA can be easily transferred to Gateway® compliant vectors, facilitating functional screening in virtually any surrogate microbial host for which there are available plasmid vectors. The libraries, which we are placing in the public domain, will be distributed upon request without restriction to members of both the academic research community and industry. This article invites the scientific community to adopt this philosophy of open resource metagenomics to extend the utility of functional metagenomics beyond initial publication, circumventing the need to start from scratch with each new research project.

Open resource metagenomics: a model for sharing metagenomic libraries

PubMed Central

Neufeld, J.D.; Engel, K.; Cheng, J.; Moreno-Hagelsieb, G.; Rose, D.R.; Charles, T.C.

2011-01-01

Both sequence-based and activity-based exploitation of environmental DNA have provided unprecedented access to the genomic content of cultivated and uncultivated microorganisms. Although researchers deposit microbial strains in culture collections and DNA sequences in databases, activity-based metagenomic studies typically only publish sequences from the hits retrieved from specific screens. Physical metagenomic libraries, conceptually similar to entire sequence datasets, are usually not straightforward to obtain by interested parties subsequent to publication. In order to facilitate unrestricted distribution of metagenomic libraries, we propose the adoption of open resource metagenomics, in line with the trend towards open access publishing, and similar to culture- and mutant-strain collections that have been the backbone of traditional microbiology and microbial genetics. The concept of open resource metagenomics includes preparation of physical DNA libraries, preferably in versatile vectors that facilitate screening in a diversity of host organisms, and pooling of clones so that single aliquots containing complete libraries can be easily distributed upon request. Database deposition of associated metadata and sequence data for each library provides researchers with information to select the most appropriate libraries for further research projects. As a starting point, we have established the Canadian MetaMicroBiome Library (CM2BL [1]). The CM2BL is a publicly accessible collection of cosmid libraries containing environmental DNA from soils collected from across Canada, spanning multiple biomes. The libraries were constructed such that the cloned DNA can be easily transferred to Gateway® compliant vectors, facilitating functional screening in virtually any surrogate microbial host for which there are available plasmid vectors. The libraries, which we are placing in the public domain, will be distributed upon request without restriction to members of both the academic research community and industry. This article invites the scientific community to adopt this philosophy of open resource metagenomics to extend the utility of functional metagenomics beyond initial publication, circumventing the need to start from scratch with each new research project. PMID:22180823

Analysis of DNA Sequences by an Optical Time-Integrating Correlator: Proof-of-Concept Experiments.

DTIC Science & Technology

1992-05-01

DNA ANALYSIS STRATEGY 4 2.1 Representation of DNA Bases 4 2.2 DNA Analysis Strategy 6 3.0 CUSTOM GENERATORS FOR DNA SEQUENCES 10 3.1 Hardware Design 10...of the DNA bases where each base is represented by a 7-bits long pseudorandom sequence. 5 Figure 4: Coarse analysis of a DNA sequence. 7 Figure 5: Fine...a 20-bases long database. 32 xiii LIST OF TABLES PAGE Table 1: Short representations of the DNA bases where each base is represented by 7-bits long

Drosophila cell cycle under arrest: uncapped telomeres plead guilty.

PubMed

Cenci, Giovanni

2009-04-01

Telomeres are specialized structures that protect chromosome ends from degradation and fusion events. In most organisms, telomeres consist of short, repetitive G-rich sequences added to chromosome ends by a reverse transcriptase with an internal RNA template, called telomerase. Specific DNA-binding protein complexes associate with telomeric sequences preventing chromosome ends from being recognized as DNA double strand breaks (DSBs). Telomeres that lose their cap activate the DNA damage response (DDR) likewise DSBs and, if inappropriately repaired, generate telomeric fusions, which eventually lead to genome instability. In Drosophila there is not telomerase, and telomere length is maintained by transposition of three specialized retroelements. However, fly telomeres are protected by multi protein complexes like their yeast and vertebrate counterparts; these complexes bind chromosome ends in a sequence-independent fashion and are required to prevent checkpoint activation and end-to-end fusion. Uncapped Drosophila telomeres elicit a DDR just as dysfunctional human telomeres. Most interestingly, uncapped Drosophila telomeres also activate the spindle assembly checkpoint (SAC) by recruiting the SAC kinase BubR1. BubR1 accumulations at chromosome ends trigger the SAC that inhibits the metaphase-to-anaphase transition. These findings, reviewed here, highlight an intriguing and unsuspected connection between telomeres and cell cycle regulation, providing a clue to understand human telomere function.

NASBA: A detection and amplification system uniquely suited for RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sooknanan, R.; Malek, L.T.

1995-06-01

The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

Variations in Nuclear Localization Strategies Among Pol X Family Enzymes.

PubMed

Kirby, Thomas W; Pedersen, Lars C; Gabel, Scott A; Gassman, Natalie R; London, Robert E

2018-06-22

Despite the essential roles of pol X family enzymes in DNA repair, information about the structural basis of their nuclear import is limited. Recent studies revealed the unexpected presence of a functional NLS in DNA polymerase β, indicating the importance of active nuclear targeting, even for enzymes likely to leak into and out of the nucleus. The current studies further explore the active nuclear transport of these enzymes by identifying and structurally characterizing the functional NLS sequences in the three remaining human pol X enzymes: terminal deoxynucleotidyl transferase (TdT), DNA polymerase μ (pol μ), and DNA polymerase λ (pol λ). NLS identifications are based on Importin α (Impα) binding affinity determined by fluorescence polarization of fluorescein-labeled NLS peptides, X-ray crystallographic analysis of the Impα∆IBB•NLS complexes, and fluorescence-based subcellular localization studies. All three polymerases use NLS sequences located near their N-terminus; TdT and pol μ utilize monopartite NLS sequences, while pol λ utilizes a bipartite sequence, unique among the pol X family members. The pol μ NLS has relatively weak measured affinity for Impα, due in part to its proximity to the N-terminus that limits non-specific interactions of flanking residues preceding the NLS. However, this effect is partially mitigated by an N-terminal sequence unsupportive of Met1 removal by methionine aminopeptidase, leading to a 3-fold increase in affinity when the N-terminal methionine is present. Nuclear targeting is unique to each pol X family enzyme with variations dependent on the structure and unique functional role of each polymerase. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Role of the Adenovirus DNA-Binding Protein in In Vitro Adeno-Associated Virus DNA Replication

PubMed Central

Ward, Peter; Dean, Frank B.; O’Donnell, Michael E.; Berns, Kenneth I.

1998-01-01

A basic question in adeno-associated virus (AAV) biology has been whether adenovirus (Ad) infection provided any function which directly promoted replication of AAV DNA. Previously in vitro assays for AAV DNA replication, using linear duplex AAV DNA as the template, uninfected or Ad-infected HeLa cell extracts, and exogenous AAV Rep protein, demonstrated that Ad infection provides a direct helper effect for AAV DNA replication. It was shown that the nature of this helper effect was to increase the processivity of AAV DNA replication. Left unanswered was the question of whether this effect was the result of cellular factors whose activity was enhanced by Ad infection or was the result of direct participation of Ad proteins in AAV DNA replication. In this report, we show that in the in vitro assay, enhancement of processivity occurs with the addition of either the Ad DNA-binding protein (Ad-DBP) or the human single-stranded DNA-binding protein (replication protein A [RPA]). Clearly Ad-DBP is present after Ad infection but not before, whereas the cellular level of RPA is not apparently affected by Ad infection. However, we have not measured possible modifications of RPA which might occur after Ad infection and affect AAV DNA replication. When the substrate for replication was an AAV genome inserted into a plasmid vector, RPA was not an effective substitute for Ad-DBP. Extracts supplemented with Ad-DBP preferentially replicated AAV sequences rather than adjacent vector sequences; in contrast, extracts supplemented with RPA preferentially replicated vector sequences. PMID:9420241

Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

PubMed Central

Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

2013-01-01

Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

DNA Persistence in a Sink Drain Environment

DOE PAGES

Winder, Eric M.; Bonheyo, George T.

2015-07-31

Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 10 7 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition ofmore » the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively.« less

DNA Persistence in a Sink Drain Environment

PubMed Central

Winder, Eric M.; Bonheyo, George T.

2015-01-01

Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 107 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition of the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively. PMID:26230525

DNA Persistence in a Sink Drain Environment.

PubMed

Winder, Eric M; Bonheyo, George T

2015-01-01

Biofilms are organized structures composed mainly of cells and extracellular polymeric substances produced by the constituent microorganisms. Ubiquitous in nature, biofilms have an innate ability to capture and retain passing material and may therefore act as natural collectors of contaminants or signatures of upstream activities. To determine the persistence and detectability of DNA passing through a sink drain environment, Bacillus anthracis strain Ames35 was cultured (6.35 x 107 CFU/mL), sterilized, and disposed of by addition to a sink drain apparatus with an established biofilm. The sink drain apparatus was sampled before and for several days after the addition of the sterilized B. anthracis culture to detect the presence of B. anthracis DNA. Multiple PCR primer pairs were used to screen for chromosomal and plasmid DNA with primers targeting shorter sequences showing greater amplification efficiency and success. PCR amplification and detection of target sequences indicate persistence of chromosomal DNA and plasmid DNA in the biofilm for 5 or more and 14 or more days, respectively.

Locating and Activating Molecular ‘Time Bombs’: Induction of Mycolata Prophages

PubMed Central

Dyson, Zoe A.; Brown, Teagan L.; Farrar, Ben; Doyle, Stephen R.; Tucci, Joseph; Seviour, Robert J.; Petrovski, Steve

2016-01-01

Little is known about the prevalence, functionality and ecological roles of temperate phages for members of the mycolic acid producing bacteria, the Mycolata. While many lytic phages infective for these organisms have been isolated, and assessed for their suitability for use as biological control agents of activated sludge foaming, no studies have investigated how temperate phages might be induced for this purpose. Bioinformatic analysis using the PHAge Search Tool (PHAST) on Mycolata whole genome sequence data in GenBank for members of the genera Gordonia, Mycobacterium, Nocardia, Rhodococcus, and Tsukamurella revealed 83% contained putative prophage DNA sequences. Subsequent prophage inductions using mitomycin C were conducted on 17 Mycolata strains. This led to the isolation and genome characterization of three novel Caudovirales temperate phages, namely GAL1, GMA1, and TPA4, induced from Gordonia alkanivorans, Gordonia malaquae, and Tsukamurella paurometabola, respectively. All possessed highly distinctive dsDNA genome sequences. PMID:27487243

Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

NASA Astrophysics Data System (ADS)

Chen, C. H. Winston; Taranenko, N. I.; Zhu, Y. F.; Chung, C. N.; Allman, S. L.

1997-05-01

Since laser mass spectrometry has the potential for achieving very fast DNA analysis, we recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Sanger's enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. Our preliminary results indicate laser mass spectrometry can possible be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, we applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation

PubMed Central

Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob

2014-01-01

As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252

Formation and Repair of Mismatches Containing Ribonucleotides and Oxidized Bases at Repeated DNA Sequences.

PubMed

Cilli, Piera; Minoprio, Anna; Bossa, Cecilia; Bignami, Margherita; Mazzei, Filomena

2015-10-23

The cellular pool of ribonucleotide triphosphates (rNTPs) is higher than that of deoxyribonucleotide triphosphates. To ensure genome stability, DNA polymerases must discriminate against rNTPs and incorporated ribonucleotides must be removed by ribonucleotide excision repair (RER). We investigated DNA polymerase β (POL β) capacity to incorporate ribonucleotides into trinucleotide repeated DNA sequences and the efficiency of base excision repair (BER) and RER enzymes (OGG1, MUTYH, and RNase H2) when presented with an incorrect sugar and an oxidized base. POL β incorporated rAMP and rCMP opposite 7,8-dihydro-8-oxoguanine (8-oxodG) and extended both mispairs. In addition, POL β was able to insert and elongate an oxidized rGMP when paired with dA. We show that RNase H2 always preserves the capacity to remove a single ribonucleotide when paired to an oxidized base or to incise an oxidized ribonucleotide in a DNA duplex. In contrast, BER activity is affected by the presence of a ribonucleotide opposite an 8-oxodG. In particular, MUTYH activity on 8-oxodG:rA mispairs is fully inhibited, although its binding capacity is retained. This results in the reduction of RNase H2 incision capability of this substrate. Thus complex mispairs formed by an oxidized base and a ribonucleotide can compromise BER and RER in repeated sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Plant centromeres: structure and control.

PubMed

Richards, E J; Dawe, R K

1998-04-01

Recent work has led to a better understanding of the molecular components of plant centromeres. Conservation of at least some centromere protein constituents between plant and non-plant systems has been demonstrated. The identity and organization of plant centromeric DNA sequences are also beginning to yield to analysis. While there is little primary DNA sequence conservation among the characterized plant centromeres and their non-plant counterparts, some parallels in centromere genomic organisation can be seen across species. Finally, the emerging idea that centromere activity is controlled epigenetically finds support in an examination of the plant centromere literature.

Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

PubMed

El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

2013-07-01

Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

The use of enzymopathic human red cells in the study of malarial parasite glucose metabolism.

PubMed

Roth, E; Joulin, V; Miwa, S; Yoshida, A; Akatsuka, J; Cohen-Solal, M; Rosa, R

1988-05-01

The in vitro growth of Plasmodium falciparum malaria parasites was assayed in mutant red cells deficient in either diphosphoglycerate mutase (DPGM) or phosphoglycerate kinase (PGK). In addition, cDNA probes developed for human DNA sequences coding for these enzymes were used to examine the parasite genome by means of restriction endonuclease digestion and Southern blot analysis of parasite DNA. In both types of enzymopathic red cells, parasite growth was normal. In infected DPGM deficient red cells, no DPGM activity could be detected, and in normal red cells, DPGM activity declined slightly in a manner suggestive of parasite catabolism of host protein. However, in infected PGK deficient red cells, there was a 100-fold increase in PGK activity, and in normal red cells, a threefold increase in PGK activity was observed. Parasite PGK could be recovered from isolated parasites, and a marked increase in heat instability of parasite PGK as compared with the host cell enzyme was noted. Neither cDNA probe was found to cross-react with DNA sequences in the parasite genome. It is concluded that the parasite has no requirement for DPGM, and probably has no gene for this enzyme. On the other hand, the parasite does require PGK, (an adenosine triphosphate [ATP] generating enzyme) and synthesizes its own enzyme, which must have been encoded in the parasite genome. The parasite PGK gene most likely lacks sufficient homology to be detected by a human cDNA probe. Enzymopathic red cells are useful tools for elucidating the glycolytic enzymology of parasites and their co-evolution with their human hosts.

A Novel Model System to Examine Agents Used in Breast Cancer Therapy.

DTIC Science & Technology

1995-07-01

We have recently characterized a multiprotein DNA replication complex (MRC) that was purified from NODA NIB 468 human breast cancer cells by a series...proliferating cell nuclear antigen (PCNA), RE-C RP-A and DNA topoisomerase I. Based upon its requirements for DNA replication activity and its...SV4O) origin sequences, the MRC executes all of the steps required for the in vitro, bidirectional replication of the SV4O genome. Several of the DNA

Inactivation of Hepatitis B Virus Replication in Cultured Cells and In Vivo with Engineered Transcription Activator-Like Effector Nucleases

PubMed Central

Bloom, Kristie; Ely, Abdullah; Mussolino, Claudio; Cathomen, Toni; Arbuthnot, Patrick

2013-01-01

Chronic hepatitis B virus (HBV) infection remains an important global health problem. Stability of the episomal covalently closed circular HBV DNA (cccDNA) is largely responsible for the modest curative efficacy of available therapy. Since licensed anti-HBV drugs have a post-transcriptional mechanism of action, disabling cccDNA is potentially of therapeutic benefit. To develop this approach, we engineered mutagenic transcription activator-like effector nucleases (TALENs) that target four HBV-specific sites within the viral genome. TALENs with cognate sequences in the S or C open-reading frames (ORFs) efficiently disrupted sequences at the intended sites and suppressed markers of viral replication. Following triple transfection of cultured HepG2.2.15 cells under mildly hypothermic conditions, the S TALEN caused targeted mutation in ~35% of cccDNA molecules. Markers of viral replication were also inhibited in vivo in a murine hydrodynamic injection model of HBV replication. HBV target sites within S and C ORFs of the injected HBV DNA were mutated without evidence of toxicity. These findings are the first to demonstrate a targeted nuclease-mediated disruption of HBV cccDNA. Efficacy in vivo also indicates that these engineered nucleases have potential for use in treatment of chronic HBV infection. PMID:23883864

Direct inhibition of excision/synthesis DNA repair activities by cadmium: analysis on dedicated biochips.

PubMed

Candéias, S; Pons, B; Viau, M; Caillat, S; Sauvaigo, S

2010-12-10

The well established toxicity of cadmium and cadmium compounds results from their additive effects on several key cellular processes, including DNA repair. Mammalian cells have evolved several biochemical pathways to repair DNA lesions and maintain genomic integrity. By interfering with the homeostasis of redox metals and antioxidant systems, cadmium promotes the development of an intracellular environment that results in oxidative DNA damage which can be mutagenic if unrepaired. Small base lesions are recognised by specialized glycosylases and excised from the DNA molecule. The resulting abasic sites are incised, and the correct sequences restored by DNA polymerases using the opposite strands as template. Bulky lesions are recognised by a different set of proteins and excised from DNA as part of an oligonucleotide. As in base repair, the resulting gaps are filled by DNA polymerases using the opposite strands as template. Thus, these two repair pathways consist in excision of the lesion followed by DNA synthesis. In this study, we analysed in vitro the direct effects of cadmium exposure on the functionality of base and nucleotide DNA repair pathways. To this end, we used recently described dedicated microarrays that allow the parallel monitoring in cell extracts of the repair activities directed against several model base and/or nucleotide lesions. Both base and nucleotide excision/repair pathways are inhibited by CdCl₂, with different sensitivities. The inhibitory effects of cadmium affect mainly the recognition and excision stages of these processes. Furthermore, our data indicate that the repair activities directed against different damaged bases also exhibit distinct sensitivities, and the direct comparison of cadmium effects on the excision of uracile in different sequences even allows us to propose a hierarchy of cadmium sensibility within the glycosylases removing U from DNA. These results indicate that, in our experimental conditions, cadmium is a very potent DNA repair poison. Copyright © 2010 Elsevier B.V. All rights reserved.

Affordable hands-on DNA sequencing and genotyping: an exercise for teaching DNA analysis to undergraduates.

PubMed

Shah, Kushani; Thomas, Shelby; Stein, Arnold

2013-01-01

In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C Sanger sequencing reactions. They prepare and run the gels, perform Southern blots (which require only 10 min), and detect sequencing ladders using a colorimetric detection system. Students enlarge their sequencing ladders from digital images of their small nylon membranes, and read the sequence manually. They compare their reads with the actual DNA sequence using BLAST2. After mastering the DNA sequencing system, students prepare their own DNA from a cheek swab, polymerase chain reaction-amplify a region of their DNA that encompasses a SNP of interest, and perform sequencing to determine their genotype at the SNP position. A family pedigree can also be constructed. The SNP chosen by the instructor was rs17822931, which is in the ABCC11 gene and is the determinant of human earwax type. Genotypes at the rs178229931 site vary in different ethnic populations. © 2013 by The International Union of Biochemistry and Molecular Biology.

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

PubMed

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

PubMed

Eberwine, James; Bartfai, Tamas

2011-03-01

We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

NASA Astrophysics Data System (ADS)

Knight, Jonathan D.; Li, Rong; Botchan, Michael

1991-04-01

The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

Dissecting enzyme function with microfluidic-based deep mutational scanning.

PubMed

Romero, Philip A; Tran, Tuan M; Abate, Adam R

2015-06-09

Natural enzymes are incredibly proficient catalysts, but engineering them to have new or improved functions is challenging due to the complexity of how an enzyme's sequence relates to its biochemical properties. Here, we present an ultrahigh-throughput method for mapping enzyme sequence-function relationships that combines droplet microfluidic screening with next-generation DNA sequencing. We apply our method to map the activity of millions of glycosidase sequence variants. Microfluidic-based deep mutational scanning provides a comprehensive and unbiased view of the enzyme function landscape. The mapping displays expected patterns of mutational tolerance and a strong correspondence to sequence variation within the enzyme family, but also reveals previously unreported sites that are crucial for glycosidase function. We modified the screening protocol to include a high-temperature incubation step, and the resulting thermotolerance landscape allowed the discovery of mutations that enhance enzyme thermostability. Droplet microfluidics provides a general platform for enzyme screening that, when combined with DNA-sequencing technologies, enables high-throughput mapping of enzyme sequence space.

Diversity and potential activity patterns of planktonic eukaryotic microbes in a mesoeutrophic coastal area (eastern English Channel)

PubMed Central

Rachik, Sara; Christaki, Urania; Li, Luen Luen; Genitsaris, Savvas; Breton, Elsa

2018-01-01

The diversity of planktonic eukaryotic microbes was studied at a coastal station of the eastern English Channel (EEC) from March 2011 to July 2015 (77 samples) using high throughput sequencing (454-pyrosequencing and Illumina) of the V2-V3 hypervariable region of the 18S SSU rDNA gene. Similar estimations of OTU relative abundance and taxonomic distribution for the dominant higher taxonomic groups (contributing >1% of the total number of OTUs) were observed with the two methods (Kolmogorov-Smirnov p-value = 0.22). Eight super-groups were identified throughout all samples: Alveolata, Stramenopiles, Opisthokonta, Hacrobia, Archeaplastida, Apusozoa, Rhizaria, and Amoebozoa (ordered by decreasing OTU richness). To gain further insight into microbial activity in the EEC, ribosomal RNA was extracted for samples from 2013–2015 (30 samples). Analysis of 18S rDNA and rRNA sequences led to the detection of 696 and 700 OTUs, respectively. Cluster analysis based on OTUs’ abundance indicated three major seasonal groups that were associated to spring, winter/autumn, and summer conditions. The clusters inferred from rRNA data showed a clearer seasonal representation of the community succession than the one based on rDNA. The rRNA/rDNA ratio was used as a proxy for relative cell activity. When all OTUs were considered, the average rRNA:rDNA ratio showed a linear trend around the 1:1 line, suggesting a linear relation between OTU abundance (rDNA) and activity (rRNA). However, this ratio was highly variable over time when considering individual OTUs. Interestingly, the OTU affiliated with P. globosa displayed rRNA:rDNA ratio that allowed to delimit high vs low abundance and high vs low activity periods. It unveiled quite well the Phaeocystis bloom dynamic regarding cell proliferation and activity, and could even be used as early indicator of an upcoming bloom. PMID:29746519

Diversity and potential activity patterns of planktonic eukaryotic microbes in a mesoeutrophic coastal area (eastern English Channel).

PubMed

Rachik, Sara; Christaki, Urania; Li, Luen Luen; Genitsaris, Savvas; Breton, Elsa; Monchy, Sébastien

2018-01-01

The diversity of planktonic eukaryotic microbes was studied at a coastal station of the eastern English Channel (EEC) from March 2011 to July 2015 (77 samples) using high throughput sequencing (454-pyrosequencing and Illumina) of the V2-V3 hypervariable region of the 18S SSU rDNA gene. Similar estimations of OTU relative abundance and taxonomic distribution for the dominant higher taxonomic groups (contributing >1% of the total number of OTUs) were observed with the two methods (Kolmogorov-Smirnov p-value = 0.22). Eight super-groups were identified throughout all samples: Alveolata, Stramenopiles, Opisthokonta, Hacrobia, Archeaplastida, Apusozoa, Rhizaria, and Amoebozoa (ordered by decreasing OTU richness). To gain further insight into microbial activity in the EEC, ribosomal RNA was extracted for samples from 2013-2015 (30 samples). Analysis of 18S rDNA and rRNA sequences led to the detection of 696 and 700 OTUs, respectively. Cluster analysis based on OTUs' abundance indicated three major seasonal groups that were associated to spring, winter/autumn, and summer conditions. The clusters inferred from rRNA data showed a clearer seasonal representation of the community succession than the one based on rDNA. The rRNA/rDNA ratio was used as a proxy for relative cell activity. When all OTUs were considered, the average rRNA:rDNA ratio showed a linear trend around the 1:1 line, suggesting a linear relation between OTU abundance (rDNA) and activity (rRNA). However, this ratio was highly variable over time when considering individual OTUs. Interestingly, the OTU affiliated with P. globosa displayed rRNA:rDNA ratio that allowed to delimit high vs low abundance and high vs low activity periods. It unveiled quite well the Phaeocystis bloom dynamic regarding cell proliferation and activity, and could even be used as early indicator of an upcoming bloom.

Adenovirus EIIA early promoter: transcriptional control elements and induction by the viral pre-early EIA gene, which appears to be sequence independent.

PubMed Central

Murthy, S C; Bhat, G P; Thimmappaya, B

1985-01-01

A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577

Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

PubMed

Salter, Jason D; Smith, Harold C

2018-05-23

The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

DNA capture and next-generation sequencing can recover whole mitochondrial genomes from highly degraded samples for human identification

PubMed Central

2013-01-01

Background Mitochondrial DNA (mtDNA) typing can be a useful aid for identifying people from compromised samples when nuclear DNA is too damaged, degraded or below detection thresholds for routine short tandem repeat (STR)-based analysis. Standard mtDNA typing, focused on PCR amplicon sequencing of the control region (HVS I and HVS II), is limited by the resolving power of this short sequence, which misses up to 70% of the variation present in the mtDNA genome. Methods We used in-solution hybridisation-based DNA capture (using DNA capture probes prepared from modern human mtDNA) to recover mtDNA from post-mortem human remains in which the majority of DNA is both highly fragmented (<100 base pairs in length) and chemically damaged. The method ‘immortalises’ the finite quantities of DNA in valuable extracts as DNA libraries, which is followed by the targeted enrichment of endogenous mtDNA sequences and characterisation by next-generation sequencing (NGS). Results We sequenced whole mitochondrial genomes for human identification from samples where standard nuclear STR typing produced only partial profiles or demonstrably failed and/or where standard mtDNA hypervariable region sequences lacked resolving power. Multiple rounds of enrichment can substantially improve coverage and sequencing depth of mtDNA genomes from highly degraded samples. The application of this method has led to the reliable mitochondrial sequencing of human skeletal remains from unidentified World War Two (WWII) casualties approximately 70 years old and from archaeological remains (up to 2,500 years old). Conclusions This approach has potential applications in forensic science, historical human identification cases, archived medical samples, kinship analysis and population studies. In particular the methodology can be applied to any case, involving human or non-human species, where whole mitochondrial genome sequences are required to provide the highest level of maternal lineage discrimination. Multiple rounds of in-solution hybridisation-based DNA capture can retrieve whole mitochondrial genome sequences from even the most challenging samples. PMID:24289217

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

PubMed

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

Direct Detection and Sequencing of Damaged DNA Bases

PubMed Central

2011-01-01

Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications. PMID:22185597

Direct detection and sequencing of damaged DNA bases.

PubMed

Clark, Tyson A; Spittle, Kristi E; Turner, Stephen W; Korlach, Jonas

2011-12-20

Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications.

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1987-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1990-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1988-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1989-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

PubMed Central

Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

1991-01-01

Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

Kilo-sequencing: an ordered strategy for rapid DNA sequence data acquisition.

PubMed Central

Barnes, W M; Bevan, M

1983-01-01

A strategy for rapid DNA sequence acquisition in an ordered, nonrandom manner, while retaining all of the conveniences of the dideoxy method with M13 transducing phage DNA template, is described. Target DNA 3 to 14 kb in size can be stably carried by our M13 vectors. Suitable targets are stretches of DNA which lack an enzyme recognition site which is unique on our cloning vectors and adjacent to the sequencing primer; current sites that are so useful when lacking are Pst, Xba, HindIII, BglII, EcoRI. By an in vitro procedure, we cut RF DNA once randomly and once specifically, to create thousands of deletions which start at the unique restriction site adjacent to the dideoxy sequencing primer and extend various distances across the target DNA. Phage carrying a desired size of deletions, whose DNA as template will give rise to DNA sequence data in a desired location along the target DNA, may be purified by electrophoresis alive on agarose gels. Phage running in the same location on the agarose gel thus conveniently give rise to nucleotide sequence data from the same kilobase of target DNA. Images PMID:6298723

Silicene nanoribbon as a new DNA sequencing device

NASA Astrophysics Data System (ADS)

Alesheikh, Sara; Shahtahmassebi, Nasser; Roknabadi, Mahmood Rezaee; Pilevar Shahri, Raheleh

2018-02-01

The importance of applying DNA sequencing in different fields, results in looking for fast and cheap methods. Nanotechnology helps this development by introducing nanostructures used for DNA sequencing. In this work we study the interaction between zigzag silicene nanoribbon and DNA nucleobases using DFT and non equilibrium Green's function approach, to investigate the possibility of using zigzag silicene nanoribbons as a biosensor for DNA sequencing.

Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

PubMed Central

Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

1998-01-01

Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

Sequence periodicity in nucleosomal DNA and intrinsic curvature.

PubMed

Nair, T Murlidharan

2010-05-17

Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

Cyclosporin A and FK-506 both affect DNA binding of regulatory nuclear proteins to the human interleukin-2 promoter.

PubMed

Baumann, G; Geisse, S; Sullivan, M

1991-03-01

The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.

Assessing the Fidelity of Ancient DNA Sequences Amplified From Nuclear Genes

PubMed Central

Binladen, Jonas; Wiuf, Carsten; Gilbert, M. Thomas P.; Bunce, Michael; Barnett, Ross; Larson, Greger; Greenwood, Alex D.; Haile, James; Ho, Simon Y. W.; Hansen, Anders J.; Willerslev, Eske

2006-01-01

To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from environments ranging from permafrost to desert, we demonstrate the presence of miscoding lesion damage in both the mtDNA and nuDNA, resulting in insertion of erroneous bases during amplification. Interestingly, no significant differences in the frequency of miscoding lesion damage are recorded between mtDNA and nuDNA despite great differences in cellular copy numbers. For both mtDNA and nuDNA, we find significant positive correlations between total sequence heterogeneity and the rates of type 1 transitions (adenine → guanine and thymine → cytosine) and type 2 transitions (cytosine → thymine and guanine → adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nuDNA sequences. We argue that the problems presented by postmortem damage, as well as problems with contamination from exogenous sources of conserved nuclear genes, allelic variation, and the reliance on single nucleotide polymorphisms, call for great caution in studies relying on ancient nuDNA sequences. PMID:16299392

Ferrate oxidation of Escherichia coli DNA polymerase-I. Identification of a methionine residue that is essential for DNA binding.

PubMed

Basu, A; Williams, K R; Modak, M J

1987-07-15

Treatment of Escherichia coli DNA polymerase-I with potassium ferrate (K2FeO4), a site-specific oxidizing agent for the phosphate group-binding sites of proteins, results in the irreversible inactivation of enzyme activity as judged by the loss of polymerization as well as 3'-5' exonuclease activity. A significant protection from ferrate-mediated inactivation is observed in the presence of DNA but not by substrate deoxynucleoside triphosphates. Furthermore, ferrate-treated enzyme also exhibits loss of template-primer binding activity, whereas its ability to bind substrate triphosphates is unaffected. In addition, comparative high pressure liquid chromatography tryptic peptide maps obtained before and after ferrate oxidation demonstrated that only five peptides of the more than 60 peptide peaks present in the tryptic digest underwent a major change in either peak position or intensity as a result of ferrate treatment. Amino acid analyses and/or sequencing identified four of these affected peaks as corresponding to peptides that span residues 324-340, 437-455, 456-464, and 512-518, respectively. However, only the last peptide, which has the sequence: Met-Trp-Pro-Asp-Leu-Gln-Lys, was significantly protected in the presence of DNA. This latter peptide was also the only peptide whose degree of oxidation correlated directly with the extent of inactivation of the enzyme. Amino acid analysis indicated that methionine 512 is the target site in this peptide for ferrate oxidation. Methionine 512, therefore, appears to be essential for the DNA-binding function of DNA polymerase-I from E. coli.

[Current applications of high-throughput DNA sequencing technology in antibody drug research].

PubMed

Yu, Xin; Liu, Qi-Gang; Wang, Ming-Rong

2012-03-01

Since the publication of a high-throughput DNA sequencing technology based on PCR reaction was carried out in oil emulsions in 2005, high-throughput DNA sequencing platforms have been evolved to a robust technology in sequencing genomes and diverse DNA libraries. Antibody libraries with vast numbers of members currently serve as a foundation of discovering novel antibody drugs, and high-throughput DNA sequencing technology makes it possible to rapidly identify functional antibody variants with desired properties. Herein we present a review of current applications of high-throughput DNA sequencing technology in the analysis of antibody library diversity, sequencing of CDR3 regions, identification of potent antibodies based on sequence frequency, discovery of functional genes, and combination with various display technologies, so as to provide an alternative approach of discovery and development of antibody drugs.

Modeling of DNA local parameters predicts encrypted architectural motifs in Xenopus laevis ribosomal gene promoter.

PubMed

Roux-Rouquie, M; Marilley, M

2000-09-15

We have modeled local DNA sequence parameters to search for DNA architectural motifs involved in transcription regulation and promotion within the Xenopus laevis ribosomal gene promoter and the intergenic spacer (IGS) sequences. The IGS was found to be shaped into distinct topological domains. First, intrinsic bends split the IGS into domains of common but different helical features. Local parameters at inter-domain junctions exhibit a high variability with respect to intrinsic curvature, bendability and thermal stability. Secondly, the repeated sequence blocks of the IGS exhibit right-handed supercoiled structures which could be related to their enhancer properties. Thirdly, the gene promoter presents both inherent curvature and minor groove narrowing which may be viewed as motifs of a structural code for protein recognition and binding. Such pre-existing deformations could simply be remodeled during the binding of the transcription complex. Alternatively, these deformations could pre-shape the promoter in such a way that further remodeling is facilitated. Mutations shown to abolish promoter curvature as well as intrinsic minor groove narrowing, in a variant which maintained full transcriptional activity, bring circumstantial evidence for structurally-preorganized motifs in relation to transcription regulation and promotion. Using well documented X. laevis rDNA regulatory sequences we showed that computer modeling may be of invaluable assistance in assessing encrypted architectural motifs. The evidence of these DNA topological motifs with respect to the concept of structural code is discussed.

Effect of sustained elevated temperature prior to amplification on template copy number estimation using digital polymerase chain reaction.

PubMed

Bhat, Somanath; McLaughlin, Jacob L H; Emslie, Kerry R

2011-02-21

Digital polymerase chain reaction (dPCR) has the potential to enable accurate quantification of target DNA copy number provided that all target DNA molecules are successfully amplified. Following duplex dPCR analysis from a linear DNA target sequence that contains single copies of two independent template sequences, we have observed that amplification of both templates in a single partition does not always occur. To investigate this finding, we heated the target DNA solution to 95 °C for increasing time intervals and then immediately chilled on ice prior to preparing the dPCR mix. We observed an exponential decline in estimated copy number (R(2)≥ 0.98) of the two template sequences when amplified from either a linearized plasmid or a 388 base pair (bp) amplicon containing the same two template sequences. The distribution of amplifiable templates and the final concentration (copies per µL) were both affected by heat treatment of the samples at 95 °C from 0 s to 30 min. The proportion of target sequences from which only one of the two templates was amplified in a single partition (either 1507 or hmg only) increased over time, while the proportion of target sequences where both templates were amplified (1507 and hmg) in each individual partition declined rapidly from 94% to 52% (plasmid) and 88% to 31% (388 bp amplicon) suggesting an increase in number of targets from which both templates no longer amplify. A 10 min incubation at 95 °C reduced the initial amplifiable template concentration of the plasmid and the 388 bp amplicon by 59% and 91%, respectively. To determine if a similar decrease in amplifiable target occurs during the default pre-activation step of typical PCR amplification protocol, we used mastermixes with a 20 s or 10 min hot-start. The choice of mastermix and consequent pre-activation time did not affect the estimated plasmid concentration. Therefore, we conclude that prolonged exposure of this DNA template to elevated temperatures could lead to significant bias in dPCR measurements. However, care must be taken when designing PCR and non-PCR based experiments by reducing exposure of the DNA template to sustained elevated temperatures in order to improve accuracy in copy number estimation and concentration determination.

DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

PubMed

Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

2012-01-01

DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

Mammalian DNA enriched for replication origins is enriched for snap-back sequences.

PubMed

Zannis-Hadjopoulos, M; Kaufmann, G; Martin, R G

1984-11-15

Using the instability of replication loops as a method for the isolation of double-stranded nascent DNA, extruded DNA enriched for replication origins was obtained and denatured. Snap-back DNA, single-stranded DNA with inverted repeats (palindromic sequences), reassociates rapidly into stem-loop structures with zero-order kinetics when conditions are changed from denaturing to renaturing, and can be assayed by chromatography on hydroxyapatite. Origin-enriched nascent DNA strands from mouse, rat and monkey cells growing either synchronously or asynchronously were purified and assayed for the presence of snap-back sequences. The results show that origin-enriched DNA is also enriched for snap-back sequences, implying that some origins for mammalian DNA replication contain or lie near palindromic sequences.

Next stop for the CRISPR revolution: RNA-guided epigenetic regulators.

PubMed

Vora, Suhani; Tuttle, Marcelle; Cheng, Jenny; Church, George

2016-09-01

Clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) proteins offer a breakthrough platform for cheap, programmable, and effective sequence-specific DNA targeting. The CRISPR-Cas system is naturally equipped for targeted DNA cutting through its native nuclease activity. As such, groups researching a broad spectrum of biological organisms have quickly adopted the technology with groundbreaking applications to genomic sequence editing in over 20 different species. However, the biological code of life is not only encoded in genetics but also in epigenetics as well. While genetic sequence editing is a powerful ability, we must also be able to edit and regulate transcriptional and epigenetic code. Taking inspiration from work on earlier sequence-specific targeting technologies such as zinc fingers (ZFs) and transcription activator-like effectors (TALEs), researchers quickly expanded the CRISPR-Cas toolbox to include transcriptional activation, repression, and epigenetic modification. In this review, we highlight advances that extend the CRISPR-Cas toolkit for transcriptional and epigenetic regulation, as well as best practice guidelines for these tools, and a perspective on future applications. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

MethVisual - visualization and exploratory statistical analysis of DNA methylation profiles from bisulfite sequencing.

PubMed

Zackay, Arie; Steinhoff, Christine

2010-12-15

Exploration of DNA methylation and its impact on various regulatory mechanisms has become a very active field of research. Simultaneously there is an arising need for tools to process and analyse the data together with statistical investigation and visualisation. MethVisual is a new application that enables exploratory analysis and intuitive visualization of DNA methylation data as is typically generated by bisulfite sequencing. The package allows the import of DNA methylation sequences, aligns them and performs quality control comparison. It comprises basic analysis steps as lollipop visualization, co-occurrence display of methylation of neighbouring and distant CpG sites, summary statistics on methylation status, clustering and correspondence analysis. The package has been developed for methylation data but can be also used for other data types for which binary coding can be inferred. The application of the package, as well as a comparison to existing DNA methylation analysis tools and its workflow based on two datasets is presented in this paper. The R package MethVisual offers various analysis procedures for data that can be binarized, in particular for bisulfite sequenced methylation data. R/Bioconductor has become one of the most important environments for statistical analysis of various types of biological and medical data. Therefore, any data analysis within R that allows the integration of various data types as provided from different technological platforms is convenient. It is the first and so far the only specific package for DNA methylation analysis, in particular for bisulfite sequenced data available in R/Bioconductor enviroment. The package is available for free at http://methvisual.molgen.mpg.de/ and from the Bioconductor Consortium http://www.bioconductor.org.

MethVisual - visualization and exploratory statistical analysis of DNA methylation profiles from bisulfite sequencing

PubMed Central

2010-01-01

Background Exploration of DNA methylation and its impact on various regulatory mechanisms has become a very active field of research. Simultaneously there is an arising need for tools to process and analyse the data together with statistical investigation and visualisation. Findings MethVisual is a new application that enables exploratory analysis and intuitive visualization of DNA methylation data as is typically generated by bisulfite sequencing. The package allows the import of DNA methylation sequences, aligns them and performs quality control comparison. It comprises basic analysis steps as lollipop visualization, co-occurrence display of methylation of neighbouring and distant CpG sites, summary statistics on methylation status, clustering and correspondence analysis. The package has been developed for methylation data but can be also used for other data types for which binary coding can be inferred. The application of the package, as well as a comparison to existing DNA methylation analysis tools and its workflow based on two datasets is presented in this paper. Conclusions The R package MethVisual offers various analysis procedures for data that can be binarized, in particular for bisulfite sequenced methylation data. R/Bioconductor has become one of the most important environments for statistical analysis of various types of biological and medical data. Therefore, any data analysis within R that allows the integration of various data types as provided from different technological platforms is convenient. It is the first and so far the only specific package for DNA methylation analysis, in particular for bisulfite sequenced data available in R/Bioconductor enviroment. The package is available for free at http://methvisual.molgen.mpg.de/ and from the Bioconductor Consortium http://www.bioconductor.org. PMID:21159174

Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution

PubMed Central

Modahl, Cassandra M.; Mackessy, Stephen P.

2016-01-01

Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides access to cDNA sequences in the absence of living specimens, even from commercial venom sources, to evaluate important regional differences in venom composition and to study snake venom protein evolution. PMID:27280639

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE PAGES

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

2016-03-09

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

Molecular Cloning and Characterization of Novel Morus alba Germin-Like Protein Gene Which Encodes for a Silkworm Gut Digestion-Resistant Antimicrobial Protein

PubMed Central

Patnaik, Bharat Bhusan; Kim, Dong Hyun; Oh, Seung Han; Song, Yong-Su; Chanh, Nguyen Dang Minh; Kim, Jong Sun; Jung, Woo-jin; Saha, Atul Kumar; Bindroo, Bharat Bhushan; Han, Yeon Soo

2012-01-01

Background Silkworm fecal matter is considered one of the richest sources of antimicrobial and antiviral protein (substances) and such economically feasible and eco-friendly proteins acting as secondary metabolites from the insect system can be explored for their practical utility in conferring broad spectrum disease resistance against pathogenic microbial specimens. Methodology/Principal Findings Silkworm fecal matter extracts prepared in 0.02 M phosphate buffer saline (pH 7.4), at a temperature of 60°C was subjected to 40% saturated ammonium sulphate precipitation and purified by gel-filtration chromatography (GFC). SDS-PAGE under denaturing conditions showed a single band at about 21.5 kDa. The peak fraction, thus obtained by GFC wastested for homogeneityusing C18reverse-phase high performance liquid chromatography (HPLC). The activity of the purified protein was tested against selected Gram +/− bacteria and phytopathogenic Fusarium species with concentration-dependent inhibitionrelationship. The purified bioactive protein was subjected to matrix-assisted laser desorption and ionization-time of flight mass spectrometry (MALDI-TOF-MS) and N-terminal sequencing by Edman degradation towards its identification. The N-terminal first 18 amino acid sequence following the predicted signal peptide showed homology to plant germin-like proteins (Glp). In order to characterize the full-length gene sequence in detail, the partial cDNA was cloned and sequenced using degenerate primers, followed by 5′- and 3′-rapid amplification of cDNA ends (RACE-PCR). The full-length cDNA sequence composed of 630 bp encoding 209 amino acids and corresponded to germin-like proteins (Glps) involved in plant development and defense. Conclusions/Significance The study reports, characterization of novel Glpbelonging to subfamily 3 from M. alba by the purification of mature active protein from silkworm fecal matter. The N-terminal amino acid sequence of the purified protein was found similar to the deduced amino acid sequence (without the transit peptide sequence) of the full length cDNA from M. alba. PMID:23284650

Specific minor groove solvation is a crucial determinant of DNA binding site recognition

PubMed Central

Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

2014-01-01

The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

PubMed

Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

2000-12-01

The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

A Method for Preparing DNA Sequencing Templates Using a DNA-Binding Microplate

PubMed Central

Yang, Yu; Hebron, Haroun R.; Hang, Jun

2009-01-01

A DNA-binding matrix was immobilized on the surface of a 96-well microplate and used for plasmid DNA preparation for DNA sequencing. The same DNA-binding plate was used for bacterial growth, cell lysis, DNA purification, and storage. In a single step using one buffer, bacterial cells were lysed by enzymes, and released DNA was captured on the plate simultaneously. After two wash steps, DNA was eluted and stored in the same plate. Inclusion of phosphates in the culture medium was found to enhance the yield of plasmid significantly. Purified DNA samples were used successfully in DNA sequencing with high consistency and reproducibility. Eleven vectors and nine libraries were tested using this method. In 10 μl sequencing reactions using 3 μl sample and 0.25 μl BigDye Terminator v3.1, the results from a 3730xl sequencer gave a success rate of 90–95% and read-lengths of 700 bases or more. The method is fully automatable and convenient for manual operation as well. It enables reproducible, high-throughput, rapid production of DNA with purity and yields sufficient for high-quality DNA sequencing at a substantially reduced cost. PMID:19568455

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

Biological sequence compression algorithms.

PubMed

Matsumoto, T; Sadakane, K; Imai, H

2000-01-01

Today, more and more DNA sequences are becoming available. The information about DNA sequences are stored in molecular biology databases. The size and importance of these databases will be bigger and bigger in the future, therefore this information must be stored or communicated efficiently. Furthermore, sequence compression can be used to define similarities between biological sequences. The standard compression algorithms such as gzip or compress cannot compress DNA sequences, but only expand them in size. On the other hand, CTW (Context Tree Weighting Method) can compress DNA sequences less than two bits per symbol. These algorithms do not use special structures of biological sequences. Two characteristic structures of DNA sequences are known. One is called palindromes or reverse complements and the other structure is approximate repeats. Several specific algorithms for DNA sequences that use these structures can compress them less than two bits per symbol. In this paper, we improve the CTW so that characteristic structures of DNA sequences are available. Before encoding the next symbol, the algorithm searches an approximate repeat and palindrome using hash and dynamic programming. If there is a palindrome or an approximate repeat with enough length then our algorithm represents it with length and distance. By using this preprocessing, a new program achieves a little higher compression ratio than that of existing DNA-oriented compression algorithms. We also describe new compression algorithm for protein sequences.

Community Composition and Transcriptional Activity of Ammonia-Oxidizing Prokaryotes of Seagrass Thalassia hemprichii in Coral Reef Ecosystems.

PubMed

Ling, Juan; Lin, Xiancheng; Zhang, Yanying; Zhou, Weiguo; Yang, Qingsong; Lin, Liyun; Zeng, Siquan; Zhang, Ying; Wang, Cong; Ahmad, Manzoor; Long, Lijuan; Dong, Junde

2018-01-01

Seagrasses in coral reef ecosystems play important ecological roles by enhancing coral reef resilience under ocean acidification. However, seagrass primary productivity is typically constrained by limited nitrogen availability. Ammonia oxidation is an important process conducted by ammonia-oxidizing archaea (AOA) and bacteria (AOB), yet little information is available concerning the community structure and potential activity of seagrass AOA and AOB. Therefore, this study investigated the variations in the abundance, diversity and transcriptional activity of AOA and AOB at the DNA and transcript level from four sample types: the leaf, root, rhizosphere sediment and bulk sediment of seagrass Thalassia hemprichii in three coral reef ecosystems. DNA and complementary DNA (cDNA) were used to prepare clone libraries and DNA and cDNA quantitative PCR ( q PCR) assays, targeting the ammonia monooxygenase-subunit ( amo A) genes as biomarkers. Our results indicated that the closest relatives of the obtained archaeal and bacterial amo A gene sequences recovered from DNA and cDNA libraries mainly originated from the marine environment. Moreover, all the obtained AOB sequences belong to the Nitrosomonadales cluster. Nearly all the AOA communities exhibited higher diversity than the AOB communities at the DNA level, but the q PCR data demonstrated that the abundances of AOB communities were higher than that of AOA communities based on both DNA and RNA transcripts. Collectively, most of the samples shared greater community composition similarity with samples from the same location rather than sample type. Furthermore, the abundance of archaeal amo A gene in rhizosphere sediments showed significant relationships with the ammonium concentration of sediments and the nitrogen content of plant tissue (leaf and root) at the DNA level ( P < 0.05). Conversely, no such relationships were found for the AOB communities. This work provides new insight into the nitrogen cycle, particularly nitrification of seagrass meadows in coral reef ecosystems.

Detection of DNA Methylation by Whole-Genome Bisulfite Sequencing.

PubMed

Li, Qing; Hermanson, Peter J; Springer, Nathan M

2018-01-01

DNA methylation plays an important role in the regulation of the expression of transposons and genes. Various methods have been developed to assay DNA methylation levels. Bisulfite sequencing is considered to be the "gold standard" for single-base resolution measurement of DNA methylation levels. Coupled with next-generation sequencing, whole-genome bisulfite sequencing (WGBS) allows DNA methylation to be evaluated at a genome-wide scale. Here, we described a protocol for WGBS in plant species with large genomes. This protocol has been successfully applied to assay genome-wide DNA methylation levels in maize and barley. This protocol has also been successfully coupled with sequence capture technology to assay DNA methylation levels in a targeted set of genomic regions.

Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

PubMed Central

Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

2012-01-01

X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

Single-Molecule Electrical Random Resequencing of DNA and RNA

NASA Astrophysics Data System (ADS)

Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

2012-07-01

Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

PubMed

Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

1998-08-01

An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

Molecular characterization of a nuclear topoisomerase II from Nicotiana tabacum that functionally complements a temperature-sensitive topoisomerase II yeast mutant.

PubMed

Singh, B N; Mudgil, Yashwanti; Sopory, S K; Reddy, M K

2003-07-01

We have successfully expressed enzymatically active plant topoisomerase II in Escherichia coli for the first time, which has enabled its biochemical characterization. Using a PCR-based strategy, we obtained a full-length cDNA and the corresponding genomic clone of tobacco topoisomerase II. The genomic clone has 18 exons interrupted by 17 introns. Most of the 5' and 3' splice junctions follow the typical canonical consensus dinucleotide sequence GU-AG present in other plant introns. The position of introns and phasing with respect to primary amino acid sequence in tobacco TopII and Arabidopsis TopII are highly conserved, suggesting that the two genes are evolved from the common ancestral type II topoisomerase gene. The cDNA encodes a polypeptide of 1482 amino acids. The primary amino acid sequence shows a striking sequence similarity, preserving all the structural domains that are conserved among eukaryotic type II topoisomerases in an identical spatial order. We have expressed the full-length polypeptide in E. coli and purified the recombinant protein to homogeneity. The full-length polypeptide relaxed supercoiled DNA and decatenated the catenated DNA in a Mg(2+)- and ATP-dependent manner, and this activity was inhibited by 4'-(9-acridinylamino)-3'-methoxymethanesulfonanilide (m-AMSA). The immunofluorescence and confocal microscopic studies, with antibodies developed against the N-terminal region of tobacco recombinant topoisomerase II, established the nuclear localization of topoisomerase II in tobacco BY2 cells. The regulated expression of tobacco topoisomerase II gene under the GAL1 promoter functionally complemented a temperature-sensitive TopII(ts) yeast mutant.

Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

PubMed Central

Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

2011-01-01

To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

PubMed

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-10-04

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.

A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

PubMed Central

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-01-01

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

The minisatellite of the GPI/AMF/NLK/MF gene: interspecies conservation and transcriptional activity.

PubMed

Williams, R R; Hassan-Walker, A F; Lavender, F L; Morgan, M; Faik, P; Ragoussis, J

2001-05-16

Minisatellites are tandemly repeated DNA sequences found throughout the genomes of all eukaryotes. They are regions often prone to instability and hence hypervariability; thus repeat unit sequence is generally not conserved beyond closely related species. We have studied the minisatellite located in intron 9 of the human glucose phosphate isomerase (GPI) gene (also known as neuroleukin, autocrine motility factor, maturation and differentiation factor) and have found, by Zoo blotting coupled with PCR amplification and DNA sequencing, that similar repeat units are present in seven other species of mammal. There is also evidence for the presence of the minisatellite in chicken. The repeat unit does not appear to be present at any other locus in these genomes. Minisatellite DNA has been reported to be involved in recombination activity, control of gene expression of nearby gene(s) (both transcriptional and translational), whilst others form protein coding regions. The high level of conservation exhibited by the GPI minisatellite, coupled with the unique location, strongly suggests a functional role. Our results from transient and stable transfections using luciferase reporter constructs have shown that the GPI minisatellite region can act to increase transcription from the SV40 promoter, CMV promoter and the human GPI promoter.

Diversity of Metabolically Active Bacteria in Water-Flooded High-Temperature Heavy Oil Reservoir

PubMed Central

Nazina, Tamara N.; Shestakova, Natalya M.; Semenova, Ekaterina M.; Korshunova, Alena V.; Kostrukova, Nadezda K.; Tourova, Tatiana P.; Min, Liu; Feng, Qingxian; Poltaraus, Andrey B.

2017-01-01

The goal of this work was to study the overall genomic diversity of microorganisms of the Dagang high-temperature oilfield (PRC) and to characterize the metabolically active fraction of these populations. At this water-flooded oilfield, the microbial community of formation water from the near-bottom zone of an injection well where the most active microbial processes of oil degradation occur was investigated using molecular, cultural, radiotracer, and physicochemical techniques. The samples of microbial DNA and RNA from back-flushed water were used to obtain the clone libraries for the 16S rRNA gene and cDNA of 16S rRNA, respectively. The DNA-derived clone libraries were found to contain bacterial and archaeal 16S rRNA genes and the alkB genes encoding alkane monooxygenases similar to those encoded by alkB-geo1 and alkB-geo6 of geobacilli. The 16S rRNA genes of methanogens (Methanomethylovorans, Methanoculleus, Methanolinea, Methanothrix, and Methanocalculus) were predominant in the DNA-derived library of Archaea cloned sequences; among the bacterial sequences, the 16S rRNA genes of members of the genus Geobacillus were the most numerous. The RNA-derived library contained only bacterial cDNA of the 16S rRNA sequences belonging to metabolically active aerobic organotrophic bacteria (Tepidimonas, Pseudomonas, Acinetobacter), as well as of denitrifying (Azoarcus, Tepidiphilus, Calditerrivibrio), fermenting (Bellilinea), iron-reducing (Geobacter), and sulfate- and sulfur-reducing bacteria (Desulfomicrobium, Desulfuromonas). The presence of the microorganisms of the main functional groups revealed by molecular techniques was confirmed by the results of cultural, radioisotope, and geochemical research. Functioning of the mesophilic and thermophilic branches was shown for the microbial food chain of the near-bottom zone of the injection well, which included the microorganisms of the carbon, sulfur, iron, and nitrogen cycles. PMID:28487680

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

Long-range correlations and charge transport properties of DNA sequences

NASA Astrophysics Data System (ADS)

Liu, Xiao-liang; Ren, Yi; Xie, Qiong-tao; Deng, Chao-sheng; Xu, Hui

2010-04-01

By using Hurst's analysis and transfer approach, the rescaled range functions and Hurst exponents of human chromosome 22 and enterobacteria phage lambda DNA sequences are investigated and the transmission coefficients, Landauer resistances and Lyapunov coefficients of finite segments based on above genomic DNA sequences are calculated. In a comparison with quasiperiodic and random artificial DNA sequences, we find that λ-DNA exhibits anticorrelation behavior characterized by a Hurst exponent 0.5

Congenital hypothyroidism with goiter in Tenterfield terriers.

PubMed

Dodgson, S E; Day, R; Fyfe, J C

2012-01-01

A cluster of cases of congenital hypothyroidism with goiter (CHG) in Tenterfield Terriers was identified and hypothesized to be dyshormonogenesis of genetic etiology with autosomal recessive inheritance. To describe the phenotype, thyroid histopathology, biochemistry, mode of inheritance, and causal mutation of CHG in Tenterfield Terriers. Thyroid tissue from 1 CHG-affected Tenterfield Terriers, 2 affected Toy Fox Terriers, and 7 normal control dogs. Genomic DNA from blood or buccal brushings of 114 additional Tenterfield Terriers. Biochemical and genetic segregation analysis of functional gene candidates in a Tenterfield Terrier kindred. Thyroid peroxidase (TPO) iodide oxidation activity was measured, and TPO protein and SDS-resistant thyroglobulin aggregation were assessed on western blots. TPO cDNA was amplified from thyroid RNA and sequenced. Exons and flanking splice sites were amplified from genomic DNA and sequenced. Variant TPO allele segregation was assessed by restriction enzyme digestion of PCR products. Thyroid from an affected pup had lesions consistent with dyshormonogenesis. TPO activity was absent, but normal sized immunocrossreactive TPO protein was present. Affected dog cDNA and genomic sequences revealed a homozygous TPO missense mutation in exon 9 (R593W) that was heterozygous in all obligate carriers and in 31% of other clinically normal Tenterfield Terriers. The mutation underlying CHG in Tenterfield Terriers was identified, and a convenient carrier test made available for screening Tenterfield Terriers used for breeding. Copyright © 2012 by the American College of Veterinary Internal Medicine.

Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

PubMed Central

Kamenova, Ivanka; Warfield, Linda

2014-01-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

PubMed

Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

2014-08-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Signatures of DNA Methylation across Insects Suggest Reduced DNA Methylation Levels in Holometabola

PubMed Central

Provataris, Panagiotis; Meusemann, Karen; Niehuis, Oliver; Grath, Sonja; Misof, Bernhard

2018-01-01

Abstract It has been experimentally shown that DNA methylation is involved in the regulation of gene expression and the silencing of transposable element activity in eukaryotes. The variable levels of DNA methylation among different insect species indicate an evolutionarily flexible role of DNA methylation in insects, which due to a lack of comparative data is not yet well-substantiated. Here, we use computational methods to trace signatures of DNA methylation across insects by analyzing transcriptomic and genomic sequence data from all currently recognized insect orders. We conclude that: 1) a functional methylation system relying exclusively on DNA methyltransferase 1 is widespread across insects. 2) DNA methylation has potentially been lost or extremely reduced in species belonging to springtails (Collembola), flies and relatives (Diptera), and twisted-winged parasites (Strepsiptera). 3) Holometabolous insects display signs of reduced DNA methylation levels in protein-coding sequences compared with hemimetabolous insects. 4) Evolutionarily conserved insect genes associated with housekeeping functions tend to display signs of heavier DNA methylation in comparison to the genomic/transcriptomic background. With this comparative study, we provide the much needed basis for experimental and detailed comparative analyses required to gain a deeper understanding on the evolution and function of DNA methylation in insects. PMID:29697817

[Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

PubMed

Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

2017-08-01

To analyze and detect the whole genome sequence of human mitochondrial DNA （mtDNA） by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

Identification of cDNAs encoding viper venom hyaluronidases: cross-generic sequence conservation of full-length and unusually short variant transcripts.

PubMed

Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C

2007-05-01

The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.

Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

PubMed

Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

2016-08-24

A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

Selection of differently temporally regulated African swine fever virus promoters with variable expression activities and their application for transient and recombinant virus mediated gene expression.

PubMed

Portugal, Raquel S; Bauer, Anja; Keil, Guenther M

2017-08-01

African swine fever virus threatens pig production worldwide due to the lack of vaccines, for which generation of both deletion and insertion mutants is considered. For development of the latter, operational ASFV promoters of different temporal regulation and strengths are desirable. We therefore compared the capacities of putative promoter sequences from p72, CD2v, p30, viral DNA polymerase and U104L genes to mediate expression of luciferase from transfected plasmids after activation in trans, or p30-, DNA polymerase- and U104L promoters in cis, using respective ASFV recombinants. We identified sequences with promoter activities upstream the viral ORFs, and showed that they differ in both their expression intensity regulating properties and in their temporal regulation. In summary, p30 and DNA polymerase promoters are recommended for high level early regulated transgene expression. For late expression, the p72, CD2v and U104L promoter are suitable. The latter however, only if low level transgene expression is aimed. Copyright © 2017 Elsevier Inc. All rights reserved.

Sequence periodicity in nucleosomal DNA and intrinsic curvature

PubMed Central

2010-01-01

Background Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Results Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. Conclusions The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA. PMID:20487515

A survey of the sequence-specific interaction of damaging agents with DNA: emphasis on antitumor agents.

PubMed

Murray, V

1999-01-01

This article reviews the literature concerning the sequence specificity of DNA-damaging agents. DNA-damaging agents are widely used in cancer chemotherapy. It is important to understand fully the determinants of DNA sequence specificity so that more effective DNA-damaging agents can be developed as antitumor drugs. There are five main methods of DNA sequence specificity analysis: cleavage of end-labeled fragments, linear amplification with Taq DNA polymerase, ligation-mediated polymerase chain reaction (PCR), single-strand ligation PCR, and footprinting. The DNA sequence specificity in purified DNA and in intact mammalian cells is reviewed for several classes of DNA-damaging agent. These include agents that form covalent adducts with DNA, free radical generators, topoisomerase inhibitors, intercalators and minor groove binders, enzymes, and electromagnetic radiation. The main sites of adduct formation are at the N-7 of guanine in the major groove of DNA and the N-3 of adenine in the minor groove, whereas free radical generators abstract hydrogen from the deoxyribose sugar and topoisomerase inhibitors cause enzyme-DNA cross-links to form. Several issues involved in the determination of the DNA sequence specificity are discussed. The future directions of the field, with respect to cancer chemotherapy, are also examined.

Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

PubMed Central

Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2016-01-01

Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

Determination of a mutational spectrum

DOEpatents

Thilly, William G.; Keohavong, Phouthone

1991-01-01

A method of resolving (physically separating) mutant DNA from nonmutant DNA and a method of defining or establishing a mutational spectrum or profile of alterations present in nucleic acid sequences from a sample to be analyzed, such as a tissue or body fluid. The present method is based on the fact that it is possible, through the use of DGGE, to separate nucleic acid sequences which differ by only a single base change and on the ability to detect the separate mutant molecules. The present invention, in another aspect, relates to a method for determining a mutational spectrum in a DNA sequence of interest present in a population of cells. The method of the present invention is useful as a diagnostic or analytical tool in forensic science in assessing environmental and/or occupational exposures to potentially genetically toxic materials (also referred to as potential mutagens); in biotechnology, particularly in the study of the relationship between the amino acid sequence of enzymes and other biologically-active proteins or protein-containing substances and their respective functions; and in determining the effects of drugs, cosmetics and other chemicals for which toxicity data must be obtained.

Lineage-specific genomics: Frequent birth and death in the human genome: The human genome contains many lineage-specific elements created by both sequence and functional turnover.

PubMed

Young, Robert S

2016-07-01

Frequent evolutionary birth and death events have created a large quantity of biologically important, lineage-specific DNA within mammalian genomes. The birth and death of DNA sequences is so frequent that the total number of these insertions and deletions in the human population remains unknown, although there are differences between these groups, e.g. transposable elements contribute predominantly to sequence insertion. Functional turnover - where the activity of a locus is specific to one lineage, but the underlying DNA remains conserved - can also drive birth and death. However, this does not appear to be a major driver of divergent transcriptional regulation. Both sequence and functional turnover have contributed to the birth and death of thousands of functional promoters in the human and mouse genomes. These findings reveal the pervasive nature of evolutionary birth and death and suggest that lineage-specific regions may play an important but previously underappreciated role in human biology and disease. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.

Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.

PubMed Central

Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M

1996-01-01

The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645

Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

PubMed Central

Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

1998-01-01

Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

PubMed

Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

2014-05-06

In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

DNA oligonucleotide duplexes containing intramolecular platinated cross-links: energetics, hydration, sequence, and ionic effects.

PubMed

Kankia, Besik I; Soto, Ana Maria; Burns, Nicole; Shikiya, Ronald; Tung, Chang-Shung; Marky, Luis A

2002-11-05

The anticancer activity of cisplatin arises from its ability to bind covalently to DNA, forming primarily intrastrand cross-links to adjacent purine residues; the most common adducts involve d(GpG) (65%) and d(ApG) (25%) intrastrand cross-links. The incorporation of these platinum adducts in a B-DNA helix induces local distortions, causing bending and unwinding of the DNA. In this work, we used temperature-dependent UV spectroscopy to investigate the unfolding thermodynamics, and associated ionic effects, of two sets of DNA decamer duplexes containing either cis-[Pt(NH(3))(2)[d(GpG

Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

PubMed

Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

2018-05-22

Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

Diversity of ribosomal 16S DNA- and RNA-based bacterial community in an office building drinking water system.

PubMed

Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T

2016-06-01

Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied Microbiology.

Scalable whole-exome sequencing of cell-free DNA reveals high concordance with metastatic tumors.

PubMed

Adalsteinsson, Viktor A; Ha, Gavin; Freeman, Samuel S; Choudhury, Atish D; Stover, Daniel G; Parsons, Heather A; Gydush, Gregory; Reed, Sarah C; Rotem, Denisse; Rhoades, Justin; Loginov, Denis; Livitz, Dimitri; Rosebrock, Daniel; Leshchiner, Ignaty; Kim, Jaegil; Stewart, Chip; Rosenberg, Mara; Francis, Joshua M; Zhang, Cheng-Zhong; Cohen, Ofir; Oh, Coyin; Ding, Huiming; Polak, Paz; Lloyd, Max; Mahmud, Sairah; Helvie, Karla; Merrill, Margaret S; Santiago, Rebecca A; O'Connor, Edward P; Jeong, Seong H; Leeson, Rachel; Barry, Rachel M; Kramkowski, Joseph F; Zhang, Zhenwei; Polacek, Laura; Lohr, Jens G; Schleicher, Molly; Lipscomb, Emily; Saltzman, Andrea; Oliver, Nelly M; Marini, Lori; Waks, Adrienne G; Harshman, Lauren C; Tolaney, Sara M; Van Allen, Eliezer M; Winer, Eric P; Lin, Nancy U; Nakabayashi, Mari; Taplin, Mary-Ellen; Johannessen, Cory M; Garraway, Levi A; Golub, Todd R; Boehm, Jesse S; Wagle, Nikhil; Getz, Gad; Love, J Christopher; Meyerson, Matthew

2017-11-06

Whole-exome sequencing of cell-free DNA (cfDNA) could enable comprehensive profiling of tumors from blood but the genome-wide concordance between cfDNA and tumor biopsies is uncertain. Here we report ichorCNA, software that quantifies tumor content in cfDNA from 0.1× coverage whole-genome sequencing data without prior knowledge of tumor mutations. We apply ichorCNA to 1439 blood samples from 520 patients with metastatic prostate or breast cancers. In the earliest tested sample for each patient, 34% of patients have ≥10% tumor-derived cfDNA, sufficient for standard coverage whole-exome sequencing. Using whole-exome sequencing, we validate the concordance of clonal somatic mutations (88%), copy number alterations (80%), mutational signatures, and neoantigens between cfDNA and matched tumor biopsies from 41 patients with ≥10% cfDNA tumor content. In summary, we provide methods to identify patients eligible for comprehensive cfDNA profiling, revealing its applicability to many patients, and demonstrate high concordance of cfDNA and metastatic tumor whole-exome sequencing.

Identification of Smoking-Associated Differentially Methylated Regions Using Reduced Representation Bisulfite Sequencing and Cell type-Specific Enhancer Activation and Gene Expression.

PubMed

Wan, Ma; Bennett, Brian D; Pittman, Gary S; Campbell, Michelle R; Reynolds, Lindsay M; Porter, Devin K; Crowl, Christopher L; Wang, Xuting; Su, Dan; Englert, Neal A; Thompson, Isabel J; Liu, Yongmei; Bell, Douglas A

2018-04-27

Cigarette smoke is a causal factor in cancers and cardiovascular disease. Smoking-associated differentially methylated regions (SM-DMRs) have been observed in disease studies, but the causal link between altered DNA methylation and transcriptional change is obscure. Our objectives were to finely resolve SM-DMRs and to interrogate the mechanistic link between SM-DMRs and altered transcription of enhancer noncoding RNA (eRNA) and mRNA in human circulating monocytes. We integrated SM-DMRs identified by reduced representation bisulfite sequencing (RRBS) of circulating CD14+ monocyte DNA collected from two independent human studies [ n =38 from Clinical Research Unit (CRU) and n =55 from the Multi-Ethnic Study of Atherosclerosis (MESA), about half of whom were active smokers] with gene expression for protein-coding genes and noncoding RNAs measured by RT-PCR or RNA sequencing. Candidate SM-DMRs were compared with RRBS of purified CD4+ T cells, CD8+ T cells, CD15+ granulocytes, CD19+ B cells, and CD56+ NK cells ( n =19 females, CRU). DMRs were validated using pyrosequencing or bisulfite amplicon sequencing in up to 85 CRU volunteers, who also provided saliva DNA. RRBS identified monocyte SM-DMRs frequently located in putative gene regulatory regions. The most significant monocyte DMR occurred at a poised enhancer in the aryl-hydrocarbon receptor repressor gene ( AHRR ) and it was also detected in both granulocytes and saliva DNA. To our knowledge, we identify for the first time that SM-DMRs in or near AHRR , C5orf55-EXOC-AS , and SASH1 were associated with increased noncoding eRNA as well as mRNA in monocytes. Functionally, the AHRR SM-DMR appeared to up-regulate AHRR mRNA through activating the AHRR enhancer, as suggested by increased eRNA in the monocytes, but not granulocytes, from smokers compared with nonsmokers. Our findings suggest that AHRR SM-DMR up-regulates AHRR mRNA in a monocyte-specific manner by activating the AHRR enhancer. Cell type-specific activation of enhancers at SM-DMRs may represent a mechanism driving smoking-related disease. https://doi.org/10.1289/EHP2395.

An evolution based biosensor receptor DNA sequence generation algorithm.

PubMed

Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng

2010-01-01

A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.

RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis

PubMed Central

Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

2012-01-01

RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. Availability http://www.cemb.edu.pk/sw.html Abbreviations RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language. PMID:23055611

Land use type significantly affects microbial gene transcription in soil.

PubMed

Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

2014-05-01

Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.

Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsodikov, Oleg V.; Biswas, Tapan

An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

Regulated expression of the human cytomegalovirus pp65 gene: Octamer sequence in the promoter is required for activation by viral gene products

DOE Office of Scientific and Technical Information (OSTI.GOV)

Depto, A.S.; Stenberg, R.M.

1989-03-01

To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection ofmore » the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.« less

Extended HSR/CARD domain mediates AIRE binding to DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

NASA Astrophysics Data System (ADS)

Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

2015-07-01

The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

UV Decontamination of MDA Reagents for Single Cell Genomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Janey; Tighe, Damon; Sczyrba, Alexander

2011-03-18

Single cell genomics, the amplification and sequencing of genomes from single cells, can provide a glimpse into the genetic make-up and thus life style of the vast majority of uncultured microbial cells, making it an immensely powerful and increasingly popular tool. This is accomplished by use of multiple displacement amplification (MDA), which can generate billions of copies of a single bacterial genome producing microgram-range DNA required for shotgun sequencing. Here, we address a key challenge inherent to this approach and propose a solution for the improved recovery of single cell genomes. While DNA-free reagents for the amplification of a singlemore » cell genome are a prerequisite for successful single cell sequencing and analysis, DNA contamination has been detected in various reagents, which poses a considerable challenge. Our study demonstrates the effect of UV irradiation in efficient elimination of exogenous contaminant DNA found in MDA reagents, while maintaining Phi29 activity. Consequently, we also find that increased UV exposure to Phi29 does not adversely affect genome coverage of MDA amplified single cells. While additional challenges in single cell genomics remain to be resolved, the proposed methodology is relatively quick and simple and we believe that its application will be of high value for future single cell sequencing projects.« less

1,4-Benzoquinone reductase from Phanerochaete chrysosporium: cDNA cloning and regulation of expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akileswaran, L.; Brock, B.J.; Cereghino, J.L.

1999-02-01

A cDNA clone encoding a quinone reductase (QR) from the white rot basidiomycete Phanerochaete chrysosporium was isolated and sequenced. The cDNA consisted of 1,007 nucleotides and a poly(A) tail and encoded a deduced protein containing 271 amino acids. The experimentally determined eight-amino-acid N-germinal sequence of the purified QR protein from P. chrysosporium matched amino acids 72 to 79 of the predicted translation product of the cDNA. The M{sub r} of the predicted translation product, beginning with Pro-72, was essentially identical to the experimentally determined M{sub r} of one monomer of the QR dimer, and this finding suggested that QR ismore » synthesized as a proenzyme. The results of in vitro transcription-translation experiments suggested that QR is synthesized as a proenzyme with a 71-amino-acid leader sequence. This leader sequence contains two potential KEX2 cleavage sites and numerous potential cleavage sites for dipeptidyl aminopeptidase. The QR activity in cultures of P. chrysosporium increased following the addition of 2-dimethoxybenzoquinone, vanillic acid, or several other aromatic compounds. An immunoblot analysis indicated that induction resulted in an increase in the amount of QR protein, and a Northern blot analysis indicated that this regulation occurs at the level of the qr mRNA.« less

Building Phylogenetic Trees from DNA Sequence Data: Investigating Polar Bear and Giant Panda Ancestry.

ERIC Educational Resources Information Center

Maier, Caroline Alexandra

2001-01-01

Presents an activity in which students seek answers to questions about evolutionary relationships by using genetic databases and bioinformatics software. Students build genetic distance matrices and phylogenetic trees based on molecular sequence data using web-based resources. Provides a flowchart of steps involved in accessing, retrieving, and…

Brain feminization requires active repression of masculinization via DNA methylation

PubMed Central

Nugent, Bridget M.; Wright, Christopher L.; Shetty, Amol C.; Hodes, Georgia E.; Lenz, Kathryn M.; Mahurkar, Anup; Russo, Scott J.; Devine, Scott E.; McCarthy, Margaret M.

2015-01-01

The developing mammalian brain is destined for a female phenotype unless exposed to gonadal hormones during a perinatal sensitive period. It has been assumed that the undifferentiated brain is masculinized by direct induction of transcription by ligand-activated nuclear steroid receptors. We found that a primary effect of gonadal steroids in the highly sexually-dimorphic preoptic area (POA) is to reduce activity of DNA methyltransferase (Dnmt) enzymes, thereby decreasing DNA methylation and releasing masculinizing genes from epigenetic repression. Pharmacological inhibition of Dnmts mimicked gonadal steroids, resulting in masculinized neuronal markers and male sexual behavior in females. Conditional knockout of the de novo Dnmt isoform, Dnmt3a, also masculinized sexual behavior in female mice. RNA sequencing revealed gene and isoform variants modulated by methylation that may underlie the divergent reproductive behaviors of males versus females. Our data show that brain feminization is maintained by the active suppression of masculinization via DNA methylation. PMID:25821913

DNA barcode goes two-dimensions: DNA QR code web server.

PubMed

Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

2012-01-01

The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

TaxI: a software tool for DNA barcoding using distance methods

PubMed Central

Steinke, Dirk; Vences, Miguel; Salzburger, Walter; Meyer, Axel

2005-01-01

DNA barcoding is a promising approach to the diagnosis of biological diversity in which DNA sequences serve as the primary key for information retrieval. Most existing software for evolutionary analysis of DNA sequences was designed for phylogenetic analyses and, hence, those algorithms do not offer appropriate solutions for the rapid, but precise analyses needed for DNA barcoding, and are also unable to process the often large comparative datasets. We developed a flexible software tool for DNA taxonomy, named TaxI. This program calculates sequence divergences between a query sequence (taxon to be barcoded) and each sequence of a dataset of reference sequences defined by the user. Because the analysis is based on separate pairwise alignments this software is also able to work with sequences characterized by multiple insertions and deletions that are difficult to align in large sequence sets (i.e. thousands of sequences) by multiple alignment algorithms because of computational restrictions. Here, we demonstrate the utility of this approach with two datasets of fish larvae and juveniles from Lake Constance and juvenile land snails under different models of sequence evolution. Sets of ribosomal 16S rRNA sequences, characterized by multiple indels, performed as good as or better than cox1 sequence sets in assigning sequences to species, demonstrating the suitability of rRNA genes for DNA barcoding. PMID:16214755

Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

Cancer.gov

Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in

Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

USDA-ARS?s Scientific Manuscript database

A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

Algorithms for optimizing cross-overs in DNA shuffling.

PubMed

He, Lu; Friedman, Alan M; Bailey-Kellogg, Chris

2012-03-21

DNA shuffling generates combinatorial libraries of chimeric genes by stochastically recombining parent genes. The resulting libraries are subjected to large-scale genetic selection or screening to identify those chimeras with favorable properties (e.g., enhanced stability or enzymatic activity). While DNA shuffling has been applied quite successfully, it is limited by its homology-dependent, stochastic nature. Consequently, it is used only with parents of sufficient overall sequence identity, and provides no control over the resulting chimeric library. This paper presents efficient methods to extend the scope of DNA shuffling to handle significantly more diverse parents and to generate more predictable, optimized libraries. Our CODNS (cross-over optimization for DNA shuffling) approach employs polynomial-time dynamic programming algorithms to select codons for the parental amino acids, allowing for zero or a fixed number of conservative substitutions. We first present efficient algorithms to optimize the local sequence identity or the nearest-neighbor approximation of the change in free energy upon annealing, objectives that were previously optimized by computationally-expensive integer programming methods. We then present efficient algorithms for more powerful objectives that seek to localize and enhance the frequency of recombination by producing "runs" of common nucleotides either overall or according to the sequence diversity of the resulting chimeras. We demonstrate the effectiveness of CODNS in choosing codons and allocating substitutions to promote recombination between parents targeted in earlier studies: two GAR transformylases (41% amino acid sequence identity), two very distantly related DNA polymerases, Pol X and β (15%), and beta-lactamases of varying identity (26-47%). Our methods provide the protein engineer with a new approach to DNA shuffling that supports substantially more diverse parents, is more deterministic, and generates more predictable and more diverse chimeric libraries.