Sample records for active gene transcription

  1. Bidirectional Transcription Directs Both Transcriptional Gene Activation and Suppression in Human Cells

    PubMed Central

    Morris, Kevin V.; Santoso, Sharon; Turner, Anne-Marie; Pastori, Chiara; Hawkins, Peter G.


    Small RNAs targeted to gene promoters in human cells have been shown to modulate both transcriptional gene suppression and activation. However, the mechanism involved in transcriptional activation has remained poorly defined, and an endogenous RNA trigger for transcriptional gene silencing has yet to be identified. Described here is an explanation for siRNA-directed transcriptional gene activation, as well as a role for non-coding antisense RNAs as effector molecules driving transcriptional gene silencing. Transcriptional activation of p21 gene expression was determined to be the result of Argonaute 2–dependent, post-transcriptional silencing of a p21-specific antisense transcript, which functions in Argonaute 1–mediated transcriptional control of p21 mRNA expression. The data presented here suggest that in human cells, bidirectional transcription is an endogenous gene regulatory mechanism whereby an antisense RNA directs epigenetic regulatory complexes to a sense promoter, resulting in RNA-directed epigenetic gene regulation. The observations presented here support the notion that epigenetic silencing of tumor suppressor genes, such as p21, may be the result of an imbalance in bidirectional transcription levels. This imbalance allows the unchecked antisense RNA to direct silent state epigenetic marks to the sense promoter, resulting in stable transcriptional gene silencing. PMID:19008947

  2. Transcriptional activation of heat-shock genes in eukaryotes.


    Tanguay, R M


    Prokaryotes and eukaryotes respond to thermal or various chemical stresses by the rapid induction of a group of genes collectively referred to as the heat shock genes. In eucaryotes, the expression of these genes is primarily regulated at the transcriptional level. The early observations that transfected heat shock genes were inducible in heterologous systems suggested the existence of common regulatory elements in these ubiquitous genes. Sequence analysis of cloned Drosophila heat shock genes revealed a conserved 14 base pair (bp) inverted repeat, which is essential for heat induction. This regulatory sequence, referred to as the heat shock element (HSE), is found in multiple imperfect copies upstream of the TATA box of all heat shock genes. While studies in heterologous systems indicated that a single copy of HSE was sufficient for inducibility, further analysis in homologous assays suggests that multiple HSE can act in a cooperative way and that the efficiency of transcriptional activation is related, within limits, to the number of HSE. Comparative analysis of heat shock genes reveals that HSE can be positioned at different distances from the TATA box in either orientation, a behavior reminiscent of enhancer elements. However, the presence of HSE does not necessarily confer heat inducibility, as shown by their presence in the constitutively expressed but non-heat-inducible homologous cognate genes. Footprinting and nuclease mapping have been used to show that a protein factor (HSTF: heat shock transcription factor) binds to the HSE element, activating heat shock gene transcription in a dose-dependent manner. The recent progress in the isolation and characterization of HSTF in Drosophila, yeast, and human cells is reviewed. Finally, different models suggested to account for the positive regulation of heat shock genes by the HSTF are presented.

  3. Estrogen-dependent transcriptional activation and vitellogenin gene memory.


    Edinger, R S; Mambo, E; Evans, M I


    The concept of hepatic memory suggests that a gene responds more rapidly to a second exposure of an inducer than it does during the initial activation. To determine how soon estrogen-dependent DNA/protein interactions occur during the primary response, in vivo dimethylsulfate footprinting was carried out using genomic DNA amplified by ligation-mediated PCR. When estrogen was added to disrupted cells from a hormone-naive liver, changes within and around the estrogen response elements occurred within seconds, indicating a direct and rapid effect on this estrogen-responsive promoter that had never before been activated. Because this effect was so rapid relative to the delayed onset of mRNA accumulation during the primary response, run-on transcription assays were used to determine the transcription profiles for four of the yolk protein genes during the primary and secondary responses to estrogen. As with the accumulation of mRNA, the onset of transcription was delayed for all of these genes after a primary exposure to estrogen. Interestingly, after the secondary exposure to estrogen, the vitellogenin I, vitellogenin II, and very low density apolipoprotein II genes displayed a more rapid onset of transcription, whereas the primary and secondary profiles of apolipoprotein B transcription in response to estrogen were identical. Because the apoB gene is constitutively expressed in the absence of estrogen, and the vitellogenins are quiescent before the administration of the hormone, hepatic memory most likely represents a relatively stable event in the transition to an active state of a gene that is committed for tissue-specific expression.

  4. Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression.

    EPA Science Inventory

    Building predictive gene signatures through simultaneous assessment of transcription factor activation and gene expression Exposure to many drugs and environmentally-relevant chemicals can cause adverse outcomes. These adverse outcomes, such as cancer, have been linked to mol...

  5. Cis and trans activation of adenovirus IVa2 gene transcription.

    PubMed Central

    Natarajan, V; Salzman, N P


    The transcriptional control region of the adenovirus IVa2 promoter was analyzed by cloning this promoter in front of a gene coding for bacterial chloramphenicol acetyl transferase (CATase) and estimating levels of CATase and IVa2 promoter specific RNA synthesized after transfection. To produce detectable amounts of CATase with the IVa2 promoter, an enhancer has to be present in cis. In the absence of enhancer sequences, the adenovirus E1A gene can not stimulate CATase synthesis. When cells were transfected with plasmids containing enhancer sequences and various IVa2 mutant promoters upstream of the CAT gene, we observed that CATase activity was not reduced significantly even after deletion of all sequences upstream of the RNA initiation site. Synthesis of IVa2 specific RNA was dependent on plasmids containing an enhancer (SV40 72 bp repeat) that was present in cis. In the absence of enhancer sequences, co-transfection to provide the adenovirus E1A gene in trans also stimulated IVa2 RNA synthesis. When HeLa cells were transfected with various deletion mutants with an enhancer in cis it was seen that sequences -38 to -64 base pairs upstream of the RNA initiation site are necessary for efficient transcription. The E1A gene in trans and an enhancer in cis have an additive effect on RNA synthesis from both IVa2 and major late promoters. The basis for the conflicting results between transcription and CATase synthesis is discussed. Images PMID:2989786

  6. Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

    PubMed Central

    Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi


    Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

  7. Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus.


    Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi


    Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer-promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them.

  8. Building gene expression signatures indicative of transcription factor activation to predict AOP modulation

    EPA Science Inventory

    Building gene expression signatures indicative of transcription factor activation to predict AOP modulation Adverse outcome pathways (AOPs) are a framework for predicting quantitative relationships between molecular initiatin...

  9. Effect Of Simulated Microgravity On Activated T Cell Gene Transcription

    NASA Technical Reports Server (NTRS)

    Morrow, Maureen A.


    Studies of T lymphocytes under the shear stress environment of clinorotation have demonstrated an inhibition of activation in response to TCR mediated signaling. These results mimic those observed during space flight. This work investigates the molecular signaling events of T lymphocyte activation with clinorotation. Purified human T lymphocytes and the T cell clone Jurkat exhibit an uncoupling of signaling as mediated through the TCR. Activation of the transcription factor AP-1 is inhibited while activation of NFAT occurs. NFAT dephosphorylation and activation is dependent on sustained Ca(++) influx. Alternatively, AP-1, which consists of two transcription factors, jun and fos, is activated by PKC and Ras mediated pathways. TCR signaling is known to be dependent on cytoskeletal rearrangements, in particular, raft aggregation is critical. Raft aggregation, as mediated through GM, crosslinking, overcomes the inhibition of T lymphocyte activation with clinorotation, indicating that the block is occurring upstream of raft aggregation. Clinorotation is shown to have an effect similar to a weak TCR signal.

  10. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.


    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E


    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding. PMID:26569329

  11. Transcriptional Activation of Inflammatory Genes: Mechanistic Insight into Selectivity and Diversity.


    Ahmed, Afsar U; Williams, Bryan R G; Hannigan, Gregory E


    Acute inflammation, an integral part of host defence and immunity, is a highly conserved cellular response to pathogens and other harmful stimuli. An inflammatory stimulation triggers transcriptional activation of selective pro-inflammatory genes that carry out specific functions such as anti-microbial activity or tissue healing. Based on the nature of inflammatory stimuli, an extensive exploitation of selective transcriptional activations of pro-inflammatory genes is performed by the host to ensure a defined inflammatory response. Inflammatory signal transductions are initiated by the recognition of inflammatory stimuli by transmembrane receptors, followed by the transmission of the signals to the nucleus for differential gene activations. The differential transcriptional activation of pro-inflammatory genes is precisely controlled by the selective binding of transcription factors to the promoters of these genes. Among a number of transcription factors identified to date, NF-κB still remains the most prominent and studied factor for its diverse range of selective transcriptional activities. Differential transcriptional activities of NF-κB are dictated by post-translational modifications, specificities in dimer formation, and variability in activation kinetics. Apart from the differential functions of transcription factors, the transcriptional activation of selective pro-inflammatory genes is also governed by chromatin structures, epigenetic markers, and other regulators as the field is continuously expanding.

  12. Manganese peroxidase gene transcription in Phanerochaete chrysosporium: Activation by manganese

    SciTech Connect

    Brown, J.A.; Alic, M. Gold, M.H. )


    The expression of manganese peroxidase in nitrogen-limited cultures of Phanerochaete chrysosporium is dependent on Mn, and initial work suggested that Mn regulates transcription of the mnp gene. In this study, using Northern (RNA) blot analysis of kinetic, dose-response, and inhibitor experiments, the authors demonstrate unequivocally that Mn regulates mnp gene transcription. The amount of mnp mRNA in cells of 4-day-old nitrogen-limited cultures is a direct function of the concentration of Mn in the culture medium up to a maximum of 180 {mu}M. Addition of Mn to nitrogen-limited Mn-deficient secondary metabolic (4-, 5-, and 6-day-old) cultures results in the appearance of mnp mRNA within 40 min. The appearance of this message is completely inhibited by the RNA synthesis inhibitor dactinomycin but not by the protein synthesis inhibitor cycloheximide. Furthermore, the amount of mnp mRNA produced is a direct function of the concentration of added Mn. In contrast, addition of Mn to low-nitrogen Mn-deficient 2- or 3-day-old cultures does not result in the appearance of mnp mRNA. Manganese peroxidase protein is detected by specific immunoprecipitation of the in vitro translation products of poly(A) RNA isolated from Mn-supplemented (but nor from Mn-deficient) cells. All of these results demonstrate that Mn, the substrate for the enzyme, regulates mnp gene transcription via a growth-stage-specific and concentration-dependent mechanism.

  13. Fur-mediated activation of gene transcription in the human pathogen Neisseria gonorrhoeae.


    Yu, Chunxiao; Genco, Caroline Attardo


    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms. PMID:22287521

  14. Fur-Mediated Activation of Gene Transcription in the Human Pathogen Neisseria gonorrhoeae

    PubMed Central

    Yu, Chunxiao


    It is well established that the ferric uptake regulatory protein (Fur) functions as a transcriptional repressor in diverse microorganisms. Recent studies demonstrated that Fur also functions as a transcriptional activator. In this study we defined Fur-mediated activation of gene transcription in the sexually transmitted disease pathogen Neisseria gonorrhoeae. Analysis of 37 genes which were previously determined to be iron induced and which contained putative Fur boxes revealed that only 30 of these genes exhibited reduced transcription in a gonococcal fur mutant strain. Fur-mediated activation was established by examining binding of Fur to the putative promoter regions of 16 Fur-activated genes with variable binding affinities observed. Only ∼50% of the newly identified Fur-regulated genes bound Fur in vitro, suggesting that additional regulatory circuits exist which may function through a Fur-mediated indirect mechanism. The gonococcal Fur-activated genes displayed variable transcription patterns in a fur mutant strain, which correlated with the position of the Fur box in each (promoter) region. These results suggest that Fur-mediated direct transcriptional activation is fulfilled by multiple mechanisms involving either competing with a repressor or recruiting RNA polymerase. Collectively, our studies have established that gonococcal Fur functions as an activator of gene transcription through both direct and indirect mechanisms. PMID:22287521

  15. Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts.


    Pandian, Ganesh N; Taniguchi, Junichi; Junetha, Syed; Sato, Shinsuke; Han, Le; Saha, Abhijit; AnandhaKumar, Chandran; Bando, Toshikazu; Nagase, Hiroki; Vaijayanthi, Thangavel; Taylor, Rhys D; Sugiyama, Hiroshi


    The influential role of the epigenome in orchestrating genome-wide transcriptional activation instigates the demand for the artificial genetic switches with distinct DNA sequence recognition. Recently, we developed a novel class of epigenetically active small molecules called SAHA-PIPs by conjugating selective DNA binding pyrrole-imidazole polyamides (PIPs) with the histone deacetylase inhibitor SAHA. Screening studies revealed that certain SAHA-PIPs trigger targeted transcriptional activation of pluripotency and germ cell genes in mouse and human fibroblasts, respectively. Through microarray studies and functional analysis, here we demonstrate for the first time the remarkable ability of thirty-two different SAHA-PIPs to trigger the transcriptional activation of exclusive clusters of genes and noncoding RNAs. QRT-PCR validated the microarray data, and some SAHA-PIPs activated therapeutically significant genes like KSR2. Based on the aforementioned results, we propose the potential use of SAHA-PIPs as reagents capable of targeted transcriptional activation.

  16. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T


    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  17. A Synthetic Transcriptional Activator of Genes Associated with the Retina in Human Dermal Fibroblasts.


    Syed, Junetha; Chandran, Anandhakumar; Pandian, Ganesh N; Taniguchi, Junichi; Sato, Shinsuke; Hashiya, Kaori; Kashiwazaki, Gengo; Bando, Toshikazu; Sugiyama, Hiroshi


    Small molecules capable of modulating epigenetic signatures can activate the transcription of tissue-restricted genes in a totally unrelated cell type and have potential use in epigenetic therapy. To provide an example for an initial approach, we report here on one synthetic small-molecule compound-termed "SAHA-PIP X"-from our library of conjugates. This compound triggered histone acetylation accompanied by the transcription of retinal-tissue-related genes in human dermal fibroblasts (HDFs).

  18. Encoding four gene expression programs in the activation dynamics of a single transcription factor.


    Hansen, Anders S; O'Shea, Erin K


    Cellular signaling response pathways often exhibit a bow-tie topology [1,2]: multiple upstream stress signals converge on a single shared transcription factor, which is thought to induce different downstream gene expression programs (Figure 1A). However, if several different signals activate the same transcription factor, can each signal then induce a specific gene expression response? A growing body of literature supports a temporal coding theory where information about environmental signals can be encoded, at least partially, in the temporal dynamics of the shared transcription factor [1,2]. For example, in the case of the budding yeast transcription factor Msn2, different stresses induce distinct Msn2 activation dynamics: Msn2 shows pulsatile nuclear activation with dose-dependent frequency under glucose limitation, but sustained nuclear activation with dose-dependent amplitude under oxidative stress [3]. These dynamic patterns can then lead to differential gene expression responses [3-5], but it is not known how much specificity can be obtained. Thus, a major question of this temporal coding theory is how many gene response programs or cellular functions can be robustly encoded by dynamic control of a single transcription factor. Here we provide the first direct evidence that, simply by regulating the activation dynamics of a single transcription factor, it is possible to preferentially induce four distinct gene expression programs. PMID:27046808

  19. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase

    PubMed Central

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke


    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5′- and 3′-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  20. Promoter-like sequences regulating transcriptional activity in neurexin and neuroligin genes.


    Runkel, Fabian; Rohlmann, Astrid; Reissner, Carsten; Brand, Stefan-Martin; Missler, Markus


    Synapse function requires the cell-adhesion molecules neurexins (Nrxn) and neuroligins (Nlgn). Although these molecules are essential for neurotransmission and prefer distinct isoform combinations for interaction, little is known about their transcriptional regulation. Here, we started to explore this important aspect because expression of Nrxn1-3 and Nlgn1-3 genes is altered in mice lacking the transcriptional regulator methyl-CpG-binding protein2 (MeCP2). Since MeCP2 can bind to methylated CpG-dinucleotides and Nrxn/Nlgn contain CpG-islands, we tested genomic sequences for transcriptional activity in reporter gene assays. We found that their influence on transcription are differentially activating or inhibiting. As we observed an activity difference between heterologous and neuronal cell lines for distinct Nrxn1 and Nlgn2 sequences, we dissected their putative promoter regions. In both genes, we identify regions in exon1 that can induce transcription, in addition to the alternative transcriptional start points in exon2. While the 5'-regions of Nrxn1 and Nlgn2 contain two CpG-rich elements that show distinct methylation frequency and binding to MeCP2, other regions may act independently of this transcriptional regulator. These data provide first insights into regulatory sequences of Nrxn and Nlgn genes that may represent an important aspect of their function at synapses in health and disease.

  1. Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.

    PubMed Central

    Deretic, V; Gill, J F; Chakrabarty, A M


    Transcriptional regulation of alginate biosynthesis by Pseudomonas aeruginosa was studied. A DNA region complementing the alg-5 mutation within the alginate gene cluster was found by RNA-DNA dot blot and Northern hybridization to be transcriptionally activated in mucoid P. aeruginosa. This region was subcloned as a 3.2-kilobase BglII-ClaI DNA fragment on the broad-host-range controlled transcription vector pMMB24, and gene products were analyzed by expression from the tac promoter. A 48-kilodalton polypeptide was detected in extracts of P. aeruginosa and 35S-labeled Escherichia coli maxicells. By using the same expression system, GDPmannose dehydrogenase activity was detected in both P. aeruginosa and E. coli. Thus, gene algD coding for this enzyme was found to be present in the transcriptionally active DNA area. Insertion of the xylE gene within the BglII-ClaI fragment disrupted the induction of the 48-kilodalton polypeptide, GDPmannose dehydrogenase activity, and alg-5 complementing ability. With the algD-xylE transcription fusion, activation of algD gene expression was shown to occur in mucoid P. aeruginosa of different origins. In addition, regulation of the algD promoter activity was demonstrated to be mediated by a diffusible factor. Images PMID:3025179

  2. Exploring the transcription factor activity in high-throughput gene expression data using RLQ analysis

    PubMed Central


    Background Interpretation of gene expression microarray data in the light of external information on both columns and rows (experimental variables and gene annotations) facilitates the extraction of pertinent information hidden in these complex data. Biologists classically interpret genes of interest after retrieving functional information from a subset of genes of interest. Transcription factors play an important role in orchestrating the regulation of gene expression. Their activity can be deduced by examining the presence of putative transcription factors binding sites in the gene promoter regions. Results In this paper we present the multivariate statistical method RLQ which aims to analyze microarray data where additional information is available on both genes and samples. As an illustrative example, we applied RLQ methodology to analyze transcription factor activity associated with the time-course effect of steroids on the growth of primary human lung fibroblasts. RLQ could successfully predict transcription factor activity, and could integrate various other sources of external information in the main frame of the analysis. The approach was validated by means of alternative statistical methods and biological validation. Conclusions RLQ provides an efficient way of extracting and visualizing structures present in a gene expression dataset by directly modeling the link between experimental variables and gene annotations. PMID:23742070

  3. Retinoic acid receptors and GATA transcription factors activate the transcription of the human lecithin:retinol acyltransferase gene

    PubMed Central

    Cai, Kun; Gudas, Lorraine J.


    Lecithin retinol acyltransferase (LRAT) catalyzes the esterification of retinol (vitamin A). Retinyl esters and LRAT protein levels are reduced in many types of cancer cells. We present data that both the LRAT and retinoic acid receptor β2 (RARβ2) mRNA levels in the human prostate cancer cell line PC-3 are lower than those in cultured normal human prostate epithelial cells (PrEC). The activity of the human LRAT promoter (2.0 kb) driving a luciferase reporter gene in PC-3 cells is less than 40% of that in PrEC cells. Retinoic acid (RA) treatment increased this LRAT promoter-luciferase activity in PrEC cells, but not in PC-3 cells. Deletion of various regions of the human LRAT promoter demonstrated that a 172-bp proximal promoter region is essential for LRAT transcription and confers RA responsiveness in PrEC cells. This 172-bp region, contained within the 186 bp pLRAT/luciferase construct, has five putative GATA binding sites. Co-transfection of RARβ2 or RARγ and the transcription factor GATA-4 increased LRAT (pLRAT186) promoter activity in both PrEC and PC-3 cells. In addition, we found that both retinoic acid and retinol induced transcripts for the STRA6 gene, which encodes a membrane receptor involved in retinol (vitamin A) uptake, in PrEC cells but not in PC-3 cells. In summary, our data show that the transcriptional regulation of the human LRAT gene is aberrant in human prostate cancer cells and that GATA transcription factors are involved in the transcriptional activation of LRAT in PrEC cells. PMID:18652909

  4. ZXDC, a novel zinc finger protein that binds CIITA and activates MHC gene transcription

    PubMed Central

    Al-Kandari, Wafa; Jambunathan, Srikarthika; Navalgund, Vandana; Koneni, Rupa; Freer, Margot; Parimi, Neeta; Mudhasani, Rajini; Fontes, Joseph D.


    The class II trans-activator (CIITA) is recognized as the master regulator of major histocompatibility complex (MHC) class II gene transcription and contributes to the transcription of MHC class I genes. To better understand the function of CIITA, we performed yeast two-hybrid with the C-terminal 807 amino acids of CIITA, and cloned a novel human cDNA named zinc finger, X-linked, duplicated family member C (ZXDC). The 858 amino acid ZXDC protein contains 10 zinc fingers and a transcriptional activation domain, and was found to interact with the region of CIITA containing leucine-rich repeats. Over-expression of ZXDC in human cell lines resulted in super-activation of MHC class I and class II promoters by CIITA. Conversely, silencing of ZXDC expression reduced the ability of CIITA to activate transcription of MHC class II genes. Given the specific interaction between the ZXDC and CIITA proteins, as well as the effect of ZXDC on MHC gene transcription, it appears that ZXDC is an important regulator of both MHC class I and class II transcription. PMID:16600381

  5. DNA methylation, riboswitches, and transcription factor activity: fundamental mechanisms of gene-nutrient interactions involving vitamins.


    Huang, Janet; Vieira, Amandio


    Nutrient-gene interactions occur with a variety of nutrients including some minerals, vitamins, polyunsaturated fatty acids and other lipids. Fundamental molecular mechanisms that underlie many of the effects of nutrients on gene expression are presented herein. Two of the mechanisms described influence gene transcription: DNA methylation and transcription factor activation. Another mechanism, riboswitching, can regulate gene expression at different levels, for example, at the mRNA translation level. The first two mechanisms are widely distributed across animal phyla. Riboswitches are documented primarily in more primitive organisms, but may prove to be of wider relevance. Riboswitches are known for several vitamins; those involving thiamine are presented here. The role of folates and retinoids in DNA methylation and transcriptional factor (nuclear retinoid receptor) activities, respectively, is presented in the context of cell proliferation and differentiation, and related physiological or pathological effects during embryogenesis and cancer.

  6. Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.


    Kim, Kihoon; Kim, AeRi


    Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR.

  7. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central


    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  8. Enhanced osteoclastogenesis by mitochondrial retrograde signaling through transcriptional activation of the cathepsin K gene.


    Guha, Manti; Srinivasan, Satish; Koenigstein, Alexander; Zaidi, Mone; Avadhani, Narayan G


    Mitochondrial dysfunction has emerged as an important factor in wide ranging human pathologies. We have previously defined a retrograde signaling pathway that originates from dysfunctional mitochondria (Mt-RS) and causes a global nuclear transcriptional reprograming as its end point. Mitochondrial dysfunction causing disruption of mitochondrial membrane potential and consequent increase in cytosolic calcium [Ca(2) ](c) activates calcineurin and the transcription factors NF-κB, NFAT, CREB, and C/EBPδ. In macrophages, this signaling complements receptor activator of nuclear factor kappa-B ligand (RANKL)-induced osteoclastic differentiation. Here, we show that the Mt-RS activated transcriptional coactivator heterogeneous ribonucleoprotein A2 (hnRNP A2) is induced by hypoxia in murine macrophages. We demonstrate that the cathepsin K gene (Ctsk), one of the key genes upregulated during osteoclast differentiation, is transcriptionally activated by Mt-RS factors. HnRNP A2 acts as a coactivator with nuclear transcription factors, cRel, and C/EBPδ for Ctsk promoter activation under hypoxic conditions. Notably, our study shows that hypoxia-induced activation of the stress target factors mediates effects similar to that of RANKL with regard to Ctsk activation. We therefore suggest that mitochondrial dysfunction and activation of Mt-RS, induced by various pathophysiologic conditions, is a potential risk factor for osteoclastogenesis and bone loss.

  9. Defining the epigenetic actions of growth hormone: acute chromatin changes accompany GH-activated gene transcription.


    Chia, Dennis J; Rotwein, Peter


    Many of the long-term physiological effects of GH require hormone-mediated changes in gene expression. The transcription factor signal transducer and activator of transcription 5b (Stat5b) plays a critical role in the actions of GH on growth and metabolism by regulating a large number of GH-dependent genes by incompletely understood mechanisms. Here we have assessed the impact of GH-initiated and Stat5b-mediated signaling on the chromatin landscape of hormone-regulated genes in the liver of pituitary-deficient young adult male rats. In the absence of GH there was minimal ongoing transcription at the Socs2, Cish, Igfals, and Spi 2.1 promoters, minimal occupancy of Stat5b at proximal promoter sites, and relatively closed chromatin, as evidenced by low levels of core histone acetylation. In contrast, transcriptionally silent Igf1 promoter 1 appeared poised to be activated, based on binding of coactivators p300 and Med1/Trap220, high levels of histone acetylation, and the presence of RNA polymerase II. GH treatment led to a 8- to 20-fold rise in transcriptional activity of all five genes within 30-60 min and was accompanied by binding of Stat5b to the proximal Socs2, Cish, Igfals, and Spi 2.1 promoters and to seven distal Igf1 Stat5b elements, by enhanced histone acetylation at all five promoters, by recruitment of RNA polymerase II to the Socs2, Cish, Igfals, and Spi 2.1 promoters, and by loss of the transcriptional repressor Bcl6 from Socs2, Cish, and Igfals Stat5b sites, but not from two Igf1 Stat5b domains. We conclude that GH actions induce rapid and dramatic changes in hepatic chromatin at target promoters and propose that the chromatin signature of Igf1 differs from other GH-and Stat5b-dependent genes. PMID:20702579

  10. Differential regulation of plasminogen activator and inhibitor gene transcription by the tumor suppressor p53.

    PubMed Central

    Kunz, C; Pebler, S; Otte, J; von der Ahe, D


    The ability of p53 to activate or repress transcription suggests that its biological function as tumor suppressor is in part accomplished by regulating a number of genes including such required for inhibition of cell growth. We here give evidence that p53 also may regulate genes responsible for the proteolytic degradation of the extracellular matrix, which is considered a crucial feature for local invasion and metastasis of neoplastic cells. An important and highly regulated cascade of such proteolytic events involves the plasminogen activator system. We show that wild-type p53 represses transcription from the enhancer and promoter of the human urokinase-type (u-PA) and the tissue-type plasminogen activator (t-PA) gene through a non-DNA binding mechanism. Oncogenic mutants lost the repressing activity. In contrast, wild-type but not mutant p53 specifically binds to and activates the promoter of the plasminogen activator inhibitor type-1 (PAI-1) gene. Interestingly, one of the p53 mutants (273his) inhibited PAI-1 promoter activity. Our results suggest that altered function of oncogenic forms of p53 may lead to altered expression of the plasminogen activators and their inhibitor(s) and thus to altered activation of the plasminogen/plasmin system during tumor progression. Images PMID:7479001

  11. Prolyl 4-hydroxylase activity-responsive transcription factors: From hydroxylation to gene expression and neuroprotection

    PubMed Central

    Siddiq, Ambreena; Aminova, Leila R; Ratan, Rajiv R


    Most homeostatic processes including gene transcription occur as a result of deviations in physiological tone that threatens the survival of the organism. A prototypical homeostatic stress response includes changes in gene expression following alterations in oxygen, iron or 2-oxoglutarate levels. Each of these cofactors plays an important role in cellular metabolism. Accordingly, a family of enzymes known as the Prolyl 4-hydroxylase (PHD) enzymes are a group of dioxygenases that have evolved to sense changes in 2-oxoglutarate, oxygen and iron via changes in enzyme activity. Indeed, PHDs are a part of an established oxygen sensor system that regulates transcriptional regulation of hypoxia/stress-regulated genes and thus are an important component of events leading to cellular rescue from oxygen, iron or 2-oxoglutarate deprivations. The ability of PHD activity to regulate homeostatic responses to oxygen, iron or 2-oxoglutarate metabolism has led to the development of small molecule inhibitors of the PHDs as a strategy for activating or augmenting cellular stress responses. These small molecules are proving effective in preclinical models of stroke and Parkinson's disease. However the precise protective pathways engaged by PHD inhibition are only beginning to be defined. In the current review, we summarize the role of iron, 2-oxoglutarate and oxygen in the PHD catalyzed hydroxylation reaction and provide a brief discussion of some of the transcription factors that play an effective role in neuroprotection against oxidative stress as a result of changes in PHD activity. PMID:17981760

  12. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.


    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C


    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  13. Transcriptional regulator-mediated activation of adaptation genes triggers CRISPR de novo spacer acquisition.


    Liu, Tao; Li, Yingjun; Wang, Xiaodi; Ye, Qing; Li, Huan; Liang, Yunxiang; She, Qunxin; Peng, Nan


    Acquisition of de novo spacer sequences confers CRISPR-Cas with a memory to defend against invading genetic elements. However, the mechanism of regulation of CRISPR spacer acquisition remains unknown. Here we examine the transcriptional regulation of the conserved spacer acquisition genes in Type I-A of Sulfolobus islandicus REY15A. Csa3a, a MarR-like transcription factor encoded by the gene located adjacent to csa1, cas1, cas2 and cas4 cluster, but on the reverse strand, was demonstrated to specifically bind to the csa1 and cas1 promoters with the imperfect palindromic sequence. Importantly, it was demonstrated that the transcription level of csa1, cas1, cas2 and cas4 was significantly enhanced in a csa3a-overexpression strain and, moreover, the Csa1 and Cas1 protein levels were increased in this strain. Furthermore, we demonstrated the hyperactive uptake of unique spacers within both CRISPR loci in the presence of the csa3a overexpression vector. The spacer acquisition process is dependent on the CCN PAM sequence and protospacer selection is random and non-directional. These results suggested a regulation mechanism of CRISPR spacer acquisition where a single transcriptional regulator senses the presence of an invading element and then activates spacer acquisition gene expression which leads to de novo spacer uptake from the invading element.

  14. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation

    PubMed Central

    Weake, Vikki M.; Dyer, Jamie O.; Seidel, Christopher; Box, Andrew; Swanson, Selene K.; Peak, Allison; Florens, Laurence; Washburn, Michael P.; Abmayr, Susan M.; Workman, Jerry L.


    The Spt–Ada–Gcn5–acetyltransferase (SAGA) complex was discovered from Saccharomyces cerevisiae and has been well characterized as an important transcriptional coactivator that interacts both with sequence-specific transcription factors and the TATA-binding protein TBP. SAGA contains a histone acetyltransferase and a ubiquitin protease. In metazoans, SAGA is essential for development, yet little is known about the function of SAGA in differentiating tissue. We analyzed the composition, interacting proteins, and genomic distribution of SAGA in muscle and neuronal tissue of late stage Drosophila melanogaster embryos. The subunit composition of SAGA was the same in each tissue; however, SAGA was associated with considerably more transcription factors in muscle compared with neurons. Consistent with this finding, SAGA was found to occupy more genes specifically in muscle than in neurons. Strikingly, SAGA occupancy was not limited to enhancers and promoters but primarily colocalized with RNA polymerase II within transcribed sequences. SAGA binding peaks at the site of RNA polymerase pausing at the 5′ end of transcribed sequences. In addition, many tissue-specific SAGA-bound genes required its ubiquitin protease activity for full expression. These data indicate that in metazoans SAGA plays a prominent post-transcription initiation role in tissue-specific gene expression. PMID:21764853

  15. Activation protein 1-dependent transcriptional activation of interleukin 2 gene by Ca2+/calmodulin kinase type IV/Gr

    PubMed Central


    The Ca2+/calmodulin-dependent protein kinase (CaMK) type IV/Gr is selectively expressed in T lymphocytes and is activated after signaling via the T cell antigen receptor (TCR), indicating that it mediates some of the Ca(2+)-dependent transcriptional events that follow TCR engagement. Here we show that CaMKIV/Gr induces the transcription factor activation protein 1 (AP-1) alone or in synergy with T cell mitogens and with the p21ras oncoprotein. CaMKIV/ Gr signaling is associated with transcriptional activation of c-fos but is independent of p21ras or calcineurin. AP-1 is an integral component of the nuclear factor of activated T cells (NFAT) transcriptional complex, which is required for interleukin 2 gene expression in T cells. We demonstrate that CaMKIV/Gr reconstitutes the capacity of the cytosolic component of NFAT to direct transcription from NFAT sites in non-T cells. These results reveal a central role for CaMKIV/Gr as a Ca(2+)-regulated activator of gene transcription in T lymphocytes. PMID:8691123

  16. Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes.

    PubMed Central

    Hanson, R D; Ley, T J


    The cytotoxic serine protease B (CSP-B) gene is activated during cytotoxic T-lymphocyte maturation. In this report, we demonstrate that the PEER T-cell line (bearing gamma/delta T-cell receptors) accumulates CSP-B mRNA following exposure to 12-O-tetradecanoylphorbol-13-acetate (TPA) and N6-2'-O-dibutyryladenosine 3',5'-cyclic monophosphate (bt2cAMP) because of transcriptional activation of the CSP-B gene. TPA and bt2cAMP act synergistically to induce CSP-B expression, since neither agent alone causes activation of CSP-B transcription or mRNA accumulation. Chromatin upstream from the CSP-B gene is resistant to DNase I digestion in untreated PEER cells, but becomes sensitive following TPA-bt2cAMP treatment. Upon activation of PEER cells, a DNase I-hypersensitive site forms upstream from the CSP-B gene within a region that is highly conserved in the mouse. Transient transfection of CSP-B promoter constructs identified two regulatory regions in the CSP-B 5'-flanking sequence, located at positions -609 to -202 and positions -202 to -80. The region from -615 to -63 is sufficient to activate a heterologous promoter in activated PEER cells, but activation is orientation specific, suggesting that this region behaves as an upstream promoter element rather than a classical enhancer. Consensus AP-1, AP-2, and cAMP response elements are found upstream from the CSP-B gene (as are several T-cell-specific consensus elements), but the roles of these elements in CSP-B gene activation have yet to be determined. Images PMID:2233710

  17. A chromatin activity based chemoproteomic approach reveals a transcriptional repressome for gene-specific silencing

    PubMed Central

    Liu, Cui; Yu, Yanbao; Liu, Feng; Wei, Xin; Wrobel, John A.; Gunawardena, Harsha P.; Zhou, Li; Jin, Jian; Chen, Xian


    Immune cells develop endotoxin tolerance (ET) after prolonged stimulation. ET increases the level of a repression mark H3K9me2 in the transcriptional-silent chromatin specifically associated with pro-inflammatory genes. However, it is not clear what proteins are functionally involved in this process. Here we show that a novel chromatin activity based chemoproteomic (ChaC) approach can dissect the functional chromatin protein complexes that regulate ET-associated inflammation. Using UNC0638 that binds the enzymatically active H3K9-specific methyltransferase G9a/GLP, ChaC reveals that G9a is constitutively active at a G9a-dependent mega-dalton repressome in primary endotoxin-tolerant macrophages. G9a/GLP broadly impacts the ET-specific reprogramming of the histone code landscape, chromatin remodeling, and the activities of select transcription factors. We discover that the G9a-dependent epigenetic environment promotes the transcriptional repression activity of c-Myc for gene-specific co-regulation of chronic inflammation. ChaC may be also applicable to dissect other functional protein complexes in the context of phenotypic chromatin architectures. PMID:25502336

  18. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.


    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J


    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs.

  19. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver.


    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J; Cook, Edwin; Das, Soma; Ratain, Mark J


    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74-217% and 52%, 39-105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6-58%; 47%, 9-58%; and 52%, 24-75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs. PMID:24879639

  20. Cloning and Transcriptional Activity of the Mouse Omi/HtrA2 Gene Promoter

    PubMed Central

    Liu, Dan; Liu, Xin; Wu, Ye; Wang, Wen; Ma, Xinliang; Liu, Huirong


    HtrA serine peptidase 2 (HtrA2), also named Omi, is a pro-apoptotic protein that exhibits dramatic changes in expression levels in a variety of disorders, including ischemia/reperfusion injury, cancer, and neurodegeneration. In our study, Omi/HtrA2 protein levels were high in the heart, brain, kidney and liver, with elevated heart/brain expression in aging mice. A similar expression pattern was observed at the mRNA level, which suggests that the regulation of Omi/HtrA2 is predominately transcriptional. Promoter binding by transcription factors is the main influencing factor of transcription, and to identify specific promoter elements that contribute to the differential expression of mouse Omi/HtrA2, we constructed truncated Omi/HtrA2 promoter/luciferase reporter vectors and analyzed their relative luciferase activity; it was greatest in the promoter regions at −1205~−838 bp and −146~+93 bp, with the −838~−649 bp region exhibiting negative regulatory activity. Bioinformatics analysis suggested that the Omi/HtrA2 gene promoter contains a CpG island at −709~+37 bp, and eight heat shock transcription factor 1 (HSF1) sites, two Sp1 transcription factor (SP1)sites, one activator protein (AP) site, seven p53 sites, and four YY1 transcription factor(YY1) sites were predicted in the core areas. Furthermore, we found that p53 and HSF1 specifically binds to the Omi/HtrA2 promoter using chromatin immunoprecipitation analysis. These results provide a foundation for understanding Omi/HtrA2 regulatory mechanisms, which could further understanding of HtrA-associated diseases. PMID:26784188

  1. EGR1 regulates hepatic clock gene amplitude by activating Per1 transcription

    PubMed Central

    Tao, Weiwei; Wu, Jing; Zhang, Qian; Lai, Shan-Shan; Jiang, Shan; Jiang, Chen; Xu, Ying; Xue, Bin; Du, Jie; Li, Chao-Jun


    The mammalian clock system is composed of a master clock and peripheral clocks. At the molecular level, the rhythm-generating mechanism is controlled by a molecular clock composed of positive and negative feedback loops. However, the underlying mechanisms for molecular clock regulation that affect circadian clock function remain unclear. Here, we show that Egr1 (early growth response 1), an early growth response gene, is expressed in mouse liver in a circadian manner. Consistently, Egr1 is transactivated by the CLOCK/BMAL1 heterodimer through a conserved E-box response element. In hepatocytes, EGR1 regulates the transcription of several core clock genes, including Bmal1, Per1, Per2, Rev-erbα and Rev-erbβ, and the rhythm amplitude of their expression is dependent on EGR1’s transcriptional function. Further mechanistic studies indicated that EGR1 binds to the proximal region of the Per1 promoter to activate its transcription directly. When the peripheral clock is altered by light or feeding behavior transposition in Egr1-deficient mice, the expression phase of hepatic clock genes shifts normally, but the amplitude is also altered. Our data reveal a critical role for EGR1 in the regulation of hepatic clock circuitry, which may contribute to the rhythm stability of peripheral clock oscillators. PMID:26471974

  2. Ldb1-nucleated transcription complexes function as primary mediators of global erythroid gene activation

    PubMed Central

    Li, LiQi; Freudenberg, Johannes; Cui, Kairong; Dale, Ryan; Song, Sang-Hyun; Dean, Ann; Zhao, Keji


    Erythropoiesis is dependent on the lineage-specific transcription factors Gata1, Tal1, and Klf1. Several erythroid genes have been shown to require all 3 factors for their expression, suggesting that they function synergistically; however, there is little direct evidence for widespread cooperation. Gata1 and Tal1 can assemble within higher-order protein complexes (Ldb1 complexes) that include the adapter molecules Lmo2 and Ldb1. Ldb1 proteins are capable of coassociation, and long-range Ldb1-mediated oligomerization of enhancer- and promoter-bound Ldb1 complexes has been shown to be required for β-globin gene expression. In this study, we generated a genomewide map of Ldb1 complex binding sites that revealed widespread binding at erythroid genes and at known erythroid enhancer elements. Ldb1 complex binding sites frequently colocalized with Klf1 binding sites and with consensus binding motifs for other erythroid transcription factors. Transcriptomic analysis demonstrated a strong correlation between Ldb1 complex binding and Ldb1 dependency for gene expression and identified a large cohort of genes coregulated by Ldb1 complexes and Klf1. Together, these results provide a foundation for defining the mechanism and scope of Ldb1 complex activity during erythropoiesis. PMID:23610375

  3. SUMOylation modulates the transcriptional activity of androgen receptor in a target gene and pathway selective manner.


    Sutinen, Päivi; Malinen, Marjo; Heikkinen, Sami; Palvimo, Jorma J


    Androgen receptor (AR) plays an important regulatory role in prostate cancer. AR's transcriptional activity is regulated by androgenic ligands, but also by post-translational modifications, such as SUMOylation. To study the role of AR SUMOylation in genuine chromatin environment, we compared androgen-regulated gene expression and AR chromatin occupancy in PC-3 prostate cancer cell lines stably expressing wild-type (wt) or doubly SUMOylation site-mutated AR (AR-K386R,K520R). Our genome-wide gene expression analyses reveal that the SUMOylation modulates the AR function in a target gene and pathway selective manner. The transcripts that are differentially regulated by androgen and SUMOylation are linked to cellular movement, cell death, cellular proliferation, cellular development and cell cycle. Fittingly, SUMOylation mutant AR cells proliferate faster and are more sensitive to apoptosis. Moreover, ChIP-seq analyses show that the SUMOylation can modulate the chromatin occupancy of AR on many loci in a fashion that parallels their differential androgen-regulated expression. De novo motif analyses reveal that FOXA1, C/EBP and AP-1 motifs are differentially enriched at the wtAR- and the AR-K386R,K520R-preferred genomic binding positions. Taken together, our data indicate that SUMOylation does not simply repress the AR activity, but it regulates AR's interaction with the chromatin and the receptor's target gene selection.

  4. Correlation of Methane Production and Functional Gene Transcriptional Activity in a Peat Soil ▿

    PubMed Central

    Freitag, Thomas E.; Prosser, James I.


    The transcription dynamics of subunit A of the key gene in methanogenesis (methyl coenzyme M reductase; mcrA) was studied to evaluate the relationship between process rate (methanogenesis) and gene transcription dynamics in a peat soil ecosystem. Soil methanogen process rates were determined during incubation of peat slurries at temperatures from 4 to 37°C, and real-time quantitative PCR was applied to quantify the abundances of mcrA genes and transcripts; corresponding transcriptional dynamics were calculated from mcrA transcript/gene ratios. Internal standards suggested unbiased recovery of mRNA abundances in comparison to DNA levels. In comparison to those in pure-culture studies, mcrA transcript/gene ratios indicated underestimation by 1 order of magnitude, possibly due to high proportions of inactive or dead methanogens. Methane production rates were temperature dependent, with maxima at 25°C, but changes in abundance and transcription of the mcrA gene showed no correlation with temperature. However, mcrA transcript/gene ratios correlated weakly (regression coefficient = 0.76) with rates of methanogenesis. Methanogen process rates increased over 3 orders of magnitude, while the corresponding maximum transcript/gene ratio increase was only 18-fold. mcrA transcript dynamics suggested steady-state expression in peat soil after incubation for 24 and 48 h, similar to that in stationary-phase cultures. mcrA transcript/gene ratios are therefore potential in situ indicators of methanogen process rate changes in complex soil systems. PMID:19749064

  5. Correlation of methane production and functional gene transcriptional activity in a peat soil.


    Freitag, Thomas E; Prosser, James I


    The transcription dynamics of subunit A of the key gene in methanogenesis (methyl coenzyme M reductase; mcrA) was studied to evaluate the relationship between process rate (methanogenesis) and gene transcription dynamics in a peat soil ecosystem. Soil methanogen process rates were determined during incubation of peat slurries at temperatures from 4 to 37 degrees C, and real-time quantitative PCR was applied to quantify the abundances of mcrA genes and transcripts; corresponding transcriptional dynamics were calculated from mcrA transcript/gene ratios. Internal standards suggested unbiased recovery of mRNA abundances in comparison to DNA levels. In comparison to those in pure-culture studies, mcrA transcript/gene ratios indicated underestimation by 1 order of magnitude, possibly due to high proportions of inactive or dead methanogens. Methane production rates were temperature dependent, with maxima at 25 degrees C, but changes in abundance and transcription of the mcrA gene showed no correlation with temperature. However, mcrA transcript/gene ratios correlated weakly (regression coefficient = 0.76) with rates of methanogenesis. Methanogen process rates increased over 3 orders of magnitude, while the corresponding maximum transcript/gene ratio increase was only 18-fold. mcrA transcript dynamics suggested steady-state expression in peat soil after incubation for 24 and 48 h, similar to that in stationary-phase cultures. mcrA transcript/gene ratios are therefore potential in situ indicators of methanogen process rate changes in complex soil systems.

  6. Transcription factor GATA-6 activates expression of gastroprotective trefoil genes TFF1 and TFF2.


    Al-azzeh, E D; Fegert, P; Blin, N; Gött, P


    One of the early events in inflammation and epithelial restitution of the gastrointestinal tract is the up-regulation of secretory peptides belonging to the trefoil factor family (TFF) that promote cell migration, protect and heal the mucosa. Their major expression site is stomach (TFF1, TFF2) and intestine (TFF3). Located in the 5'-flanking region of the genes are several consensus sites for members of the GATA transcription factors known to control gut-specific gene expression. By reverse transcription-PCR (RT-PCR), GATA-6 was shown to be expressed in a variety of tumor cell lines of gastric, intestinal and pancreatic origin. In MKN45, KATOIII and LS174T, cotransfection with TFF reporter genes and GATA-6 expression vectors revealed that GATA-6 activates TFF1 and TFF2 4-6-fold, without an effect on TFF3. The functional contribution of GATA binding sequences in the reverse orientation was further characterized by reporter gene assays using TFF2 deletion constructs and by gel shift experiments. PMID:10684977

  7. Activating human genes with zinc finger proteins, transcription activator-like effectors and CRISPR/Cas9 for gene therapy and regenerative medicine.


    Gersbach, Charles A; Perez-Pinera, Pablo


    New technologies have recently been developed to control the expression of human genes in their native genomic context by engineering synthetic transcription factors that can be targeted to any DNA sequence. The ability to precisely regulate any gene as it occurs naturally in the genome provides a means to address a variety of diseases and disorders. This approach also circumvents some of the traditional challenges of gene therapy. In this editorial, we review the technologies that have enabled targeted human gene activation, including the engineering of transcription factors based on zinc finger proteins, transcription activator-like effectors and the CRISPR/Cas9 system. Additionally, we highlight examples in which these methods have been developed for therapeutic applications and discuss challenges and opportunities.

  8. Acetohydroxyacid synthase activity and transcripts profiling reveal tissue-specific regulation of ahas genes in sunflower.


    Ochogavía, Ana C; Breccia, Gabriela; Vega, Tatiana; Felitti, Silvina A; Picardi, Liliana A; Nestares, Graciela


    Acetohydroxyacid synthase (AHAS) is the target site of several herbicides and catalyses the first step in the biosynthesis of branched chain amino acid. Three genes coding for AHAS catalytic subunit (ahas1, ahas2 and ahas3) have been reported for sunflower. The aim of this work was to study the expression pattern of ahas genes family and AHAS activity in sunflower (Helianthus annuus L.). Different organs (leaves, hypocotyls, roots, flowers and embryos) were evaluated at several developmental stages. The transcriptional profile was studied through RT-qPCR. The highest expression for ahas1 was shown in leaves, where all the induced and natural gene mutations conferring herbicide resistance were found. The maximal expression of ahas2 and ahas3 occurred in immature flowers and embryos. The highest AHAS activity was found in leaves and immature embryos. Correlation analysis among ahas gene expression and AHAS activity was discussed. Our results show that differences in ahas genes expression are tissue-specific and temporally regulated. Moreover, the conservation of multiple AHAS isoforms in sunflower seems to result from different expression requirements controlled by tissue-specific regulatory mechanisms at different developmental stages. PMID:24908515

  9. Oxidative stress increases hepatocyte iNOS gene transcription and promoter activity.


    Kuo, P C; Abe, K Y; Schroeder, R A


    Hepatocyte expression of inducible nitric oxide synthase (iNOS) is initiated by the presence of pro-inflammatory cytokines, such as interleukin-1beta (IL-1). In the presence of oxidative stress, IL-1beta mediated hepatocyte iNOS expression and NO synthesis are significantly increased. To determine the underlying molecular mechanism responsible for oxidative stress augmentation of hepatocyte iNOS expression, rat hepatocytes in primary culture were stimulated with IL-1beta (250 U/mL) in the presence and absence of benzenetriol (BZT, 0-100 microM), an autocatalytic source of superoxide at physiologic pH. Nuclear runon analysis demonstrated that BZT was associated with increased iNOS gene transcription in the setting of IL-1 stimulation. Transient transfection of a plasmid construct composed of the rat hepatocyte iNOS promoter and a chloramphenicol transferase reporter gene demonstrated that the combination of BZT and IL-1 significantly increased iNOS promoter activity in comparison to that of IL-1beta alone. These data indicate that BZT-mediated oxidative stress increases IL-1beta induced iNOS gene transcription and iNOS promoter activity.

  10. VprBP Has Intrinsic Kinase Activity Targeting Histone H2A and Represses Gene Transcription

    PubMed Central

    Kim, Kyunghwan; Kim, Jin-Man; Kim, Joong-Sun; Choi, Jongkyu; Lee, Yong Suk; Neamati, Nouri; Song, Jin Sook; Heo, Kyu; An, Woojin


    SUMMARY Histone modifications play important roles in the regulation of gene expression and chromatin organization. VprBP has been implicated in transcriptionally silent chromatin formation and cell cycle regulation, but the molecular basis underlying such effects remains unclear. Here we report that VprBP possesses an intrinsic protein kinase activity and is capable of phosphorylating histone H2A on threonine 120 (H2AT120p) in a nucleosomal context. VprBP is localized to a large set of tumor suppressor genes and blocks their transcription, in a manner that is dependent on its kinase activity toward H2AT120. The functional significance of VprBP-mediated H2AT120p is further underscored by the fact that RNAi knockdown and small-molecule inhibition of VprBP reactivate growth regulatory genes and impede tumor growth. Our findings establish VprBP as a major kinase responsible for H2AT120p in cancer cells and suggest that VprBP inhibition could be a new strategy for the development of anticancer therapeutics. PMID:24140421

  11. Three promoters regulate the transcriptional activity of the human holocarboxylase synthetase gene1,2

    PubMed Central

    Xia, Mengna; Malkaram, Sridhar A.; Zempleni, Janos


    Holocarboxylase synthetase (HLCS) is the only protein biotin ligase in the human proteome. HLCS-dependent biotinylation of carboxylases plays crucial roles in macronutrient metabolism. HLCS appears to be an essential part of multiprotein complexes in the chromatin that cause gene repression and contribute toward genome stability. Consistent with these essential functions, HLCS knockdown causes strong phenotypes including shortened life span and low stress resistance in Drosophila melanogaster, and de-repression of long-terminal repeats in humans, other mammalian cell lines, and Drosophila. Despite previous observations that the expression of HLCS depends on biotin status in rats and in human cell lines, little is known about the regulation of HLCS expression. The goal of this study was to identify promoters that regulate the expression of the human HLCS gene. Initially, the human HLCS locus was interrogated in silico using predictors of promoters including sequences of HLCS mRNA and expressed sequence tags, CpG islands, histone marks denoting transcriptionally poised chromatin, transcription factor binding sites, and DNaseI hypersensitive regions. Our predictions revealed three putative HLCS promoters, denoted P1, P2, and P3. Promoters lacked a TATA box, which is typical for housekeeping genes. When the three promoters were cloned into a luciferase reporter plasmid, reporter gene activity was at least three times background noise in human breast, colon, and kidney cell lines; activities consistently followed the pattern P1> >P3>P2. Promoter activity depended on the concentration of biotin in culture media, but the effect was moderate. We conclude that we have identified promoters in the human HLCS gene. PMID:24075901

  12. Retroviral vectors containing Tet-controlled bidirectional transcription units for simultaneous regulation of two gene activities

    PubMed Central

    Loew, Rainer; Vigna, Elisa; Lindemann, Dirk; Naldini, Luigi; Bujard, Herman


    In this study retroviral self-inactivating (SIN)-vectors were constructed, that allow simultaneous regulation of two genes by integration of bidirectional Tet controlled transcription units. Marker genes (luciferase and eGFP) were expressed under the control of various bidirectional promoters Ptetbis, in order to determine (i) the fraction of HtTA-1 cells exhibiting tight doxycycline (Dox) dependent control; (ii) possible effects of the vector backbone on the regulation of gene transcription; (iii) the possibility for crosstalk between different minimal promoters within Ptetbi. When HtTA-1 cells, constitutively expressing the Tet-Transactivator (tTA), were transduced by S2f-lMCg retroviral vector, a high percentage (40) of the cell population displayed tight regulation (5000 fold) of Ptetbi activity over a wide range of Dox concentrations. As a result of our comparative study on the activity of virus derived minimal promoters (from MMTV, HIV and CMV), a clear hierarchy of activity as well as a different sensitivity to external influences among the various promoters studied was observed. Furthermore, our results strongly support the idea, that viral elements such as part of the MuLV pol/env region significantly affect the regulation capacity of an integrate. Taking into account our observations as outlined above, we succeeded in generating significantly optimized Tet regulated retroviral vectors. The application of such a one-step transfer system for Ptet controlled genes would be of particular relevance to applications where cellular systems do not allow prolonged selection procedures as it is the case with primary cells considered for ex vivo gene therapy. PMID:19565004

  13. Evaluating Transcription Factor Activity Changes by Scoring Unexplained Target Genes in Expression Data

    PubMed Central

    Berchtold, Evi; Csaba, Gergely; Zimmer, Ralf


    Several methods predict activity changes of transcription factors (TFs) from a given regulatory network and measured expression data. But available gene regulatory networks are incomplete and contain many condition-dependent regulations that are not relevant for the specific expression measurement. It is not known which combination of active TFs is needed to cause a change in the expression of a target gene. A method to systematically evaluate the inferred activity changes is missing. We present such an evaluation strategy that indicates for how many target genes the observed expression changes can be explained by a given set of active TFs. To overcome the problem that the exact combination of active TFs needed to activate a gene is typically not known, we assume a gene to be explained if there exists any combination for which the predicted active TFs can possibly explain the observed change of the gene. We introduce the i-score (inconsistency score), which quantifies how many genes could not be explained by the set of activity changes of TFs. We observe that, even for these minimal requirements, published methods yield many unexplained target genes, i.e. large i-scores. This holds for all methods and all expression datasets we evaluated. We provide new optimization methods to calculate the best possible (minimal) i-score given the network and measured expression data. The evaluation of this optimized i-score on a large data compendium yields many unexplained target genes for almost every case. This indicates that currently available regulatory networks are still far from being complete. Both the presented Act-SAT and Act-A* methods produce optimal sets of TF activity changes, which can be used to investigate the difficult interplay of expression and network data. A web server and a command line tool to calculate our i-score and to find the active TFs associated with the minimal i-score is available from PMID:27723775

  14. Mediators of activation of fushi tarazu gene transcription by BmFTZ-F1.

    PubMed Central

    Li, F Q; Ueda, H; Hirose, S


    Transcriptional activation by many eukaryotic sequence-specific regulators appears to be mediated through transcription factors which do not directly bind to DNA. BmFTZ-F1 is a silkworm counterpart of FTZ-F1, a sequence-specific activator of the fushi tarazu gene in Drosophila melanogaster. We report here the isolation of 18- and 22-kDa polypeptides termed MBF1 and MBF2, respectively, that form a heterodimer and mediate activation of in vitro transcription from the fushi tarazu promoter by BmFTZ-F1. Neither MBF1, MBF2, nor a combination of them binds to DNA. MBF1 interacts with BmFTZ-F1 and stabilizes the BmFTZ-F1-DNA complex. MBF1 also makes direct contact with TATA-binding protein (TBP). Both MBF1 and MBF2 are necessary to form a complex between BmFTZ-F1 and TBP. We propose a model in which MBF1 and MBF2 form a bridge between BmFTZ-F1 and TBP and mediate transactivation by stabilizing the protein-DNA interactions. Images PMID:8164657

  15. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene

    SciTech Connect

    Virbasius, J.V.; Scarpulla, R.C. )


    A mutational analysis of the rat cytochrome c oxidase subunit IV (RCO4) promoter region revealed the presence of a major control element consisting of a tandemly repeated pair of binding sites for a nuclear factor from HeLa cells. This factor was designated NRF-2 (nuclear respiratory factor 2) because a functional recognition site was also found in the human ATP synthase {beta}-subunit gene. Deletion or site-directed point mutations of the NRF-2 binding sites in the RCO4 promoter resulted in substantial loss of transcriptional activity, and synthetic oligomers of the NRF-2 binding sites from both genes stimulated a heterologous promoter when cloned in cis. NRF-2 binding a transcriptional activation required a purine-rich core sequence, GGAA. This motif is characteristic of the recognition site for a family of activators referred to as ETS domain proteins because of the similarity within their DNA-binding domains to the ets-1 proto-oncogene product. NRF-2 recognized an authentic Ets-1 site within the Moloney murine sarcoma virus long terminal repeat, and this site was able to compete for NRF-2 binding to the RCO4 promoter sequence. However, in contrast to Ets-1, which appears to be exclusive to lymphoid tissues, NRF-2 has the broad tissue distribution expected of a regulator of respiratory chain expression.

  16. CXXC5 plays a role as a transcription activator for myelin genes on oligodendrocyte differentiation.


    Kim, Mi-Yeon; Kim, Hyun-Yi; Hong, Jiso; Kim, Daesoo; Lee, Hyojung; Cheong, Eunji; Lee, Yangsin; Roth, Jürgen; Kim, Dong Goo; Min, Do Sik; Choi, Kang-Yell


    Myelination in corpus callosum plays important role for normal brain functions by transferring neurological information between various brain regions. However, the factors controlling expression of myelin genes in myelination are poorly understood. Here, CXXC5, a recently identified protein with CXXC-type zinc finger DNA binding motif, was characterized as a transcriptional activator of major myelin genes. We identified expression of CXXC5 expression was increased by Wnt/β-catenin signaling. CXXC5 specifically expressed in the white matter induced expression of myelin genes through the direct binding of CXXC DNA-binding motif of CXXC5 on the MBP promoter. During the differentiation of neural stem cells (NSCs) of CXXC5(-/-) mice, the expressions of myelin genes were simultaneously reduced. The CXXC5(-/-) mice exhibited severely reduction of myelin genes expression in corpus callosum as well as abnormalities in myelin structure. The disrupted structural integrity of myelin in the CXXC5(-/-) mice resulted in reduced electrical conduction amplitudes at corpus callosum. These findings indicate that the regulation of myelin genes expression by CXXC5 is important for forming myelin structure involved with axonal electrical signal transfer in the corpus callosum.

  17. Lactase gene transcription is activated in response to hypoxia in intestinal epithelial cells.


    Lee, So Young; Madan, Ashima; Furuta, Glenn T; Colgan, Sean P; Sibley, Eric


    Lactase-phlorizin hydrolase, a brush-border membrane disaccharidase, is a marker of intestinal epithelial cell differentiation and digestive function. The intestine is susceptible to conditions of hypoxia resulting from vascular perfusion deficits. We hypothesized that lactase gene induction may provide a mechanism to efficiently increase nutrient energy substrates during gut hypoxia. These studies sought to characterize expression of the lactase gene in response to hypoxia and to characterize a role for hypoxia-inducible factor (HIF-1) in mediating the hypoxic response. Microarray analysis and confirmatory RT-PCR identified a 4-fold induction of lactase mRNA abundance in intestinal epithelial Caco-2 cells exposed to hypoxia. Lactase promoter activity was similarly induced by hypoxia in cells stably transfected with a 2.0-kb 5' flanking region of the rat lactase gene linked to a reporter gene. Transient cotransfection with HIF-1alpha and beta stimulated lactase promoter activity 2.4- and 3.5-fold under conditions of normoxia and hypoxia, respectively. We conclude that HIF-1 can activate the lactase promoter in intestinal epithelial cells exposed to hypoxia. Induction of lactase transcription may represent an adaptive response to gut hypoxia.

  18. Ribavirin-induced intracellular GTP depletion activates transcription elongation in coagulation factor VII gene expression.


    Suzuki, Atsuo; Miyawaki, Yuhri; Okuyama, Eriko; Murata, Moe; Ando, Yumi; Kato, Io; Takagi, Yuki; Takagi, Akira; Murate, Takashi; Saito, Hidehiko; Kojima, Tetsuhito


    Coagulation FVII (Factor VII) is a vitamin K-dependent glycoprotein synthesized in hepatocytes. It was reported previously that FVII gene (F7) expression was up-regulated by ribavirin treatment in hepatitis C virus-infected haemophilia patients; however, its precise mechanism is still unknown. In the present study, we investigated the molecular mechanism of ribavirin-induced up-regulation of F7 expression in HepG2 (human hepatoma cell line). We found that intracellular GTP depletion by ribavirin as well as other IMPDH (inosine-5'-monophosphate dehydrogenase) inhibitors, such as mycophenolic acid and 6-mercaptopurine, up-regulated F7 expression. FVII mRNA transcription was mainly enhanced by accelerated transcription elongation, which was mediated by the P-TEFb (positive-transcription elongation factor b) complex, rather than by promoter activation. Ribavirin unregulated ELL (eleven-nineteen lysine-rich leukaemia) 3 mRNA expression before F7 up-regulation. We observed that ribavirin enhanced ELL3 recruitment to F7, whereas knockdown of ELL3 diminished ribavirin-induced FVII mRNA up-regulation. Ribavirin also enhanced recruitment of CDK9 (cyclin-dependent kinase 9) and AFF4 to F7. These data suggest that ribavirin-induced intracellular GTP depletion recruits a super elongation complex containing P-TEFb, AFF4 and ELL3, to F7, and modulates FVII mRNA transcription elongation. Collectively, we have elucidated a basal mechanism for ribavirin-induced FVII mRNA up-regulation by acceleration of transcription elongation, which may be crucial in understanding its pleiotropic functions in vivo.

  19. Pronounced cohabitation of active immunoglobulin genes from three different chromosomes in transcription factories during maximal antibody synthesis.


    Park, Sung-Kyun; Xiang, Yougui; Feng, Xin; Garrard, William T


    To understand the relationships between nuclear organization and gene expression in a model system, we employed three-dimensional imaging and chromatin immunoprecipitation (ChIP)-chromosome conformation capture (3C) techniques to investigate the topographies of the immunoglobulin (Ig) genes and transcripts during B-cell development. Remarkably, in plasma cells, when antibody synthesis peaks, active Ig genes residing on three different chromosomes exhibit pronounced colocalizations in transcription factories, often near the nuclear periphery, and display trans-chromosomal enhancer interactions, and their transcripts frequently share interchromatin trafficking channels. Conceptually, these features of nuclear organization maximize coordinated transcriptional and transcript trafficking control for potentiating the optimal cytoplasmic assembly of the resulting translation products into protein multimers.

  20. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.


    Arbel-Goren, Rinat; Tal, Asaf; Parasar, Bibudha; Dym, Alvah; Costantino, Nina; Muñoz-García, Javier; Court, Donald L; Stavans, Joel


    Post-transcriptional regulatory processes may change transcript levels and affect cell-to-cell variability or noise. We study small-RNA downregulation to elucidate its effects on noise in the iron homeostasis network of Escherichia coli In this network, the small-RNA RyhB undergoes stoichiometric degradation with the transcripts of target genes in response to iron stress. Using single-molecule fluorescence in situ hybridization, we measured transcript numbers of the RyhB-regulated genes sodB and fumA in individual cells as a function of iron deprivation. We observed a monotonic increase of noise with iron stress but no evidence of theoretically predicted, enhanced stoichiometric fluctuations in transcript numbers, nor of bistable behavior in transcript distributions. Direct detection of RyhB in individual cells shows that its noise is much smaller than that of these two targets, when RyhB production is significant. A generalized two-state model of bursty transcription that neglects RyhB fluctuations describes quantitatively the dependence of noise and transcript distributions on iron deprivation, enabling extraction of in vivo RyhB-mediated transcript degradation rates. The transcripts' threshold-linear behavior indicates that the effective in vivo interaction strength between RyhB and its two target transcripts is comparable. Strikingly, the bacterial cell response exhibits Fur-dependent, switch-like activation instead of a graded response to iron deprivation. PMID:27085802

  1. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.


    Arbel-Goren, Rinat; Tal, Asaf; Parasar, Bibudha; Dym, Alvah; Costantino, Nina; Muñoz-García, Javier; Court, Donald L; Stavans, Joel


    Post-transcriptional regulatory processes may change transcript levels and affect cell-to-cell variability or noise. We study small-RNA downregulation to elucidate its effects on noise in the iron homeostasis network of Escherichia coli In this network, the small-RNA RyhB undergoes stoichiometric degradation with the transcripts of target genes in response to iron stress. Using single-molecule fluorescence in situ hybridization, we measured transcript numbers of the RyhB-regulated genes sodB and fumA in individual cells as a function of iron deprivation. We observed a monotonic increase of noise with iron stress but no evidence of theoretically predicted, enhanced stoichiometric fluctuations in transcript numbers, nor of bistable behavior in transcript distributions. Direct detection of RyhB in individual cells shows that its noise is much smaller than that of these two targets, when RyhB production is significant. A generalized two-state model of bursty transcription that neglects RyhB fluctuations describes quantitatively the dependence of noise and transcript distributions on iron deprivation, enabling extraction of in vivo RyhB-mediated transcript degradation rates. The transcripts' threshold-linear behavior indicates that the effective in vivo interaction strength between RyhB and its two target transcripts is comparable. Strikingly, the bacterial cell response exhibits Fur-dependent, switch-like activation instead of a graded response to iron deprivation.

  2. Three Genes Are Required for trans-Activation of Ty Transcription in Yeast

    PubMed Central

    Winston, Fred; Dollard, Catherine; Malone, Elizabeth A.; Clare, Jeffrey; Kapakos, James G.; Farabaugh, Philip; Minehart, Patricia L.


    Mutations in the SPT3 gene were isolated as one class of suppressors of Ty and solo δ insertion mutations in Saccharomyces cerevisiae. Previous work has shown that null mutations in SPT3 abolish the normal Ty δ-δ transcript; instead, a transcript that initiates 800 bases farther downstream is made, suggesting that SPT3 is required for transcription initiation in δ sequences. We have selected for new spt mutations and have screened for those with the unique suppression pattern of spt3 mutations with respect to two insertion mutations. Our selection and screen has identified two additional genes, SPT7 and SPT8, that are also required for transcription initiation in δ sequences. We show that mutations in SPT7 or SPT8 result in the same alteration of Ty transcription as do mutations in SPT3. In addition, mutations in all three genes cause a sporulation defect. By assay of a Ty-lacZ fusion we have shown that spt3, spt7 and spt8 mutations reduce transcription from a δ sequence by 10–25-fold. Finally, we show that SPT3 mRNA levels are unaffected in either spt7 or spt8 mutants, suggesting that these two genes do not regulate transcription of SPT3. PMID:3034719

  3. Multiple GCD genes required for repression of GCN4, a transcriptional activator of amino acid biosynthetic genes in Saccharomyces cerevisiae.


    Harashima, S; Hinnebusch, A G


    GCN4 encodes a positive regulator of multiple unlinked genes encoding amino acid biosynthetic enzymes in Saccharomyces cerevisiae. Expression of GCN4 is coupled to amino acid availability by a control mechanism involving GCD1 as a negative effector and GCN1, GCN2, and GCN3 as positive effectors of GCN4 expression. We used reversion of a gcn2 gcn3 double mutation to isolate new alleles of GCD1 and mutations in four additional GCD genes which we designate GCD10, GCD11, GCD12, and GCD13. All of the mutations lead to constitutive derepression of HIS4 transcription in the absence of the GCN2+ and GCN3+ alleles. By contrast, the gcd mutations require the wild-type GCN4 allele for their derepressing effect, suggesting that each acts by influencing the level of GCN4 activity in the cell. Consistent with this interpretation, mutations in each GCD gene lead to constitutive derepression of a GCN4::lacZ gene fusion. Thus, at least five gene products are required to maintain the normal repressed level of GCN4 expression in nonstarvation conditions. Interestingly, the gcd mutations are pleiotropic and also affect growth rate in nonstarvation conditions. In addition, certain alleles lead to a loss of M double-stranded RNA required for the killer phenotype. This pleiotropy suggests that the GCD gene products contribute to an essential cellular function, in addition to, or in conjunction with, their role in GCN4 regulation.

  4. Transcriptional activation by heat and cold of a thiol protease gene in tomato. [Lycopersicon esculentum

    SciTech Connect

    Schaffer, M.A.; Fischer, R.L. )


    We previously determined that low temperature induces the accumulation in tomato (Lycopersicon esculentum) fruit of a cloned mRNA, designated C14, encoding a polypeptide related to thiol proteases. We now demonstrate that C14 mRNA accumulation is a response common to both high (40{degree}C) and low (4{degree}C) temperature stresses. Exposure of tomato fruit to 40{degree}C results in the accumulation of C14 mRNA, by 8 hours. This response is more rapid than that to 4{degree}C, but slower than the induction of many heat shock messages by 40{degree}C, and therefore unique. We have also studied the mechanism by which heat and cold exposure activate C14 gene expression. Both high and low temperature regulate protease gene expression through transcriptional induction of a single C14 gene. A hypothesis for the function of C14 thiol protease gene expression in response to heat and cold is discussed.

  5. Autocrine activation of neuronal NMDA receptors by aspartate mediates dopamine- and cAMP-induced CREB-dependent gene transcription.


    Almeida, Luis E F; Murray, Peter D; Zielke, H Ronald; Roby, Clinton D; Kingsbury, Tami J; Krueger, Bruce K


    cAMP can stimulate the transcription of many activity-dependent genes via activation of the transcription factor, cAMP response element-binding protein (CREB). However, in mouse cortical neuron cultures, prior to synaptogenesis, neither cAMP nor dopamine, which acts via cAMP, stimulated CREB-dependent gene transcription when NR2B-containing NMDA receptors (NMDARs) were blocked. Stimulation of transcription by cAMP was potentiated by inhibitors of excitatory amino acid uptake, suggesting a role for extracellular glutamate or aspartate in cAMP-induced transcription. Aspartate was identified as the extracellular messenger: enzymatic scavenging of l-aspartate, but not glutamate, blocked stimulation of CREB-dependent gene transcription by cAMP; moreover, cAMP induced aspartate but not glutamate release. Together, these results suggest that cAMP acts via an autocrine or paracrine pathway to release aspartate, which activates NR2B-containing NMDARs, leading to Ca(2+) entry and activation of transcription. This cAMP/aspartate/NMDAR signaling pathway may mediate the effects of transmitters such as dopamine on axon growth and synaptogenesis in developing neurons or on synaptic plasticity in mature neural networks.

  6. Binding of TFIIIC to SINE Elements Controls the Relocation of Activity-Dependent Neuronal Genes to Transcription Factories

    PubMed Central

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T.; Jongbloets, Bart C.; Down, Thomas A.; Riccio, Antonella


    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes. PMID:23966877

  7. A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

    PubMed Central

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi


    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

  8. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.


    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi


    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  9. GA binding protein augments autophagy via transcriptional activation of BECN1-PIK3C3 complex genes.


    Zhu, Wan; Swaminathan, Gayathri; Plowey, Edward D


    Macroautophagy is a vesicular catabolic trafficking pathway that is thought to protect cells from diverse stressors and to promote longevity. Recent studies have revealed that transcription factors play important roles in the regulation of autophagy. In this study, we have identified GA binding protein (GABP) as a transcriptional regulator of the combinatorial expression of BECN1-PIK3C3 complex genes involved in autophagosome initiation. We performed bioinformatics analyses that demonstrated highly conserved putative GABP sites in genes that encode BECN1/Beclin 1, several BECN1 interacting proteins, and downstream autophagy proteins including the ATG12-ATG5-ATG16L1 complex. We demonstrate that GABP binds to the promoter regions of BECN1-PIK3C3 complex genes and activates their transcriptional activities. Knockdown of GABP reduced BECN1-PIK3C3 complex transcripts, BECN1-PIK3C3 complex protein levels and autophagy in cultured cells. Conversely, overexpression of GABP increased autophagy. Nutrient starvation increased GABP-dependent transcriptional activity of BECN1-PIK3C3 complex gene promoters and increased the recruitment of GABP to the BECN1 promoter. Our data reveal a novel function of GABP in the regulation of autophagy via transcriptional activation of the BECN1-PIK3C3 complex.

  10. Mutant p53 is a transcriptional co-factor that binds to G-rich regulatory regions of active genes and generates transcriptional plasticity

    PubMed Central

    Quante, Timo; Otto, Benjamin; Brázdová, Marie; Kejnovská, Iva; Deppert, Wolfgang; Tolstonog, Genrich V.


    The molecular mechanisms underlying mutant p53 (mutp53) “gain-of-function” (GOF) are still insufficiently understood, but there is evidence that mutp53 is a transcriptional regulator that is recruited by specialized transcription factors. Here we analyzed the binding sites of mutp53 and the epigenetic status of mutp53-regulated genes that had been identified by global expression profiling upon depletion of endogenous mutp53 (R273H) expression in U251 glioblastoma cells. We found that mutp53 preferentially and autonomously binds to G/C-rich DNA around transcription start sites (TSS) of many genes characterized by active chromatin marks (H3K4me3) and frequently associated with transcription-competent RNA polymerase II. Mutp53-bound regions overlap predominantly with CpG islands and are enriched in G4-motifs that are prone to form G-quadruplex structures. In line, mutp53 binds and stabilizes a well-characterized G-quadruplex structure in vitro. Hence, we assume that binding of mutp53 to G/C-rich DNA regions associated with a large set of cancer-relevant genes is an initial step in their regulation by mutp53. Using GAS1 and HTR2A as model genes, we show that mutp53 affects several parameters of active transcription. Finally, we discuss a dual mode model of mutp53 GOF, which includes both stochastic and deterministic components. PMID:22894900

  11. Transcription factors GAF and HSF act at distinct regulatory steps to modulate stress-induced gene activation

    PubMed Central

    Fuda, Nicholas J.; Mahat, Dig B.; Core, Leighton J.; Guertin, Michael J.


    The coordinated regulation of gene expression at the transcriptional level is fundamental to development and homeostasis. Inducible systems are invaluable when studying transcription because the regulatory process can be triggered instantaneously, allowing the tracking of ordered mechanistic events. Here, we use precision run-on sequencing (PRO-seq) to examine the genome-wide heat shock (HS) response in Drosophila and the function of two key transcription factors on the immediate transcription activation or repression of all genes regulated by HS. We identify the primary HS response genes and the rate-limiting steps in the transcription cycle that GAGA-associated factor (GAF) and HS factor (HSF) regulate. We demonstrate that GAF acts upstream of promoter-proximally paused RNA polymerase II (Pol II) formation (likely at the step of chromatin opening) and that GAF-facilitated Pol II pausing is critical for HS activation. In contrast, HSF is dispensable for establishing or maintaining Pol II pausing but is critical for the release of paused Pol II into the gene body at a subset of highly activated genes. Additionally, HSF has no detectable role in the rapid HS repression of thousands of genes. PMID:27492368

  12. The Mediator Complex MED15 Subunit Mediates Activation of Downstream Lipid-Related Genes by the WRINKLED1 Transcription Factor.


    Kim, Mi Jung; Jang, In-Cheol; Chua, Nam-Hai


    The Mediator complex is known to be a master coordinator of transcription by RNA polymerase II, and this complex is recruited by transcription factors (TFs) to target promoters for gene activation or repression. The plant-specific TF WRINKLED1 (WRI1) activates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. However, no Mediator subunit has yet been identified that mediates WRI1 transcriptional activity. Promoter-β-glucuronidase fusion experiments showed that MEDIATOR15 (MED15) is expressed in the same cells in the embryo as WRI1. We found that the Arabidopsis (Arabidopsis thaliana) MED15 subunit of the Mediator complex interacts directly with WRI1 in the nucleus. Overexpression of MED15 or WRI1 increased transcript levels of WRI1 target genes involved in glycolysis and fatty acid biosynthesis; these genes were down-regulated in wild-type or WRI1-overexpressing plants by silencing of MED15 However, overexpression of MED15 in the wri1 mutant also increased transcript levels of WRI1 target genes, suggesting that MED15 also may act with other TFs to activate downstream lipid-related genes. Chromatin immunoprecipitation assays confirmed the association of MED15 with six WRI1 target gene promoters. Additionally, silencing of MED15 resulted in reduced fatty acid content in seedlings and mature seeds, whereas MED15 overexpression increased fatty acid content in both developmental stages. Similar results were found in wri1 mutant and WRI1 overexpression lines. Together, our results indicate that the WRI1/MED15 complex transcriptionally regulates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. PMID:27246098

  13. Transcriptional activation of human CDCA8 gene regulated by transcription factor NF-Y in embryonic stem cells and cancer cells.


    Dai, Can; Miao, Cong-Xiu; Xu, Xiao-Ming; Liu, Lv-Jun; Gu, Yi-Fan; Zhou, Di; Chen, Lian-Sheng; Lin, Ge; Lu, Guang-Xiu


    The cell division cycle associated 8 (CDCA8) gene plays an important role in mitosis. Overexpression of CDCA8 was reported in some human cancers and is required for cancer growth and progression. We found CDCA8 expression was also high in human ES cells (hESCs) but dropped significantly upon hESC differentiation. However, the regulation of CDCA8 expression has not yet been studied. Here, we characterized the CDCA8 promoter and identified its cis-elements and transcription factors. Three transcription start sites were identified. Reporter gene assays revealed that the CDCA8 promoter was activated in hESCs and cancer cell lines. The promoter drove the reporter expression specifically to pluripotent cells during early mouse embryo development and to tumor tissues in tumor-bearing mice. These results indicate that CDCA8 is transcriptionally activated in hESCs and cancer cells. Mechanistically, two key activation elements, bound by transcription factor NF-Y and CREB1, respectively, were identified in the CDCA8 basic promoter by mutation analyses and electrophoretic motility shift assays. NF-Y binding is positively correlated with promoter activities in different cell types. Interestingly, the NF-YA subunit, binding to the promoter, is primarily a short isoform in hESCs and a long isoform in cancer cells, indicating a different activation mechanism of the CDCA8 transcription between hESCs and cancer cells. Finally, enhanced CDCA8 promoter activities by NF-Y overexpression and reduced CDCA8 transcription by NF-Y knockdown further verified that NF-Y is a positive regulator of CDCA8 transcription. Our study unearths the molecular mechanisms underlying the activation of CDCA8 expression in hESCs and cancer cells, which provides a better understanding of its biological functions.

  14. Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers.


    Bultmann, Sebastian; Morbitzer, Robert; Schmidt, Christine S; Thanisch, Katharina; Spada, Fabio; Elsaesser, Janett; Lahaye, Thomas; Leonhardt, Heinrich


    Specific control of gene activity is a valuable tool to study and engineer cellular functions. Recent studies uncovered the potential of transcription activator-like effector (TALE) proteins that can be tailored to activate user-defined target genes. It remains however unclear whether and how epigenetic modifications interfere with TALE-mediated transcriptional activation. We studied the activity of five designer TALEs (dTALEs) targeting the oct4 pluripotency gene. In vitro assays showed that the five dTALEs that target distinct sites in the oct4 promoter had the expected DNA specificity and comparable affinities to their corresponding DNA targets. In contrast to their similar in vitro properties, transcriptional activation of oct4 by these distinct dTALEs varied up to 25-fold. While dTALEs efficiently upregulated transcription of the active oct4 promoter in embryonic stem cells (ESCs) they failed to activate the silenced oct4 promoter in ESC-derived neural stem cells (NSCs), indicating that as for endogenous transcription factors also dTALE activity is limited by repressive epigenetic mechanisms. We therefore targeted the activity of epigenetic modulators and found that chemical inhibition of histone deacetylases by valproic acid or DNA methyltransferases by 5-aza-2'-deoxycytidine facilitated dTALE-mediated activation of the epigenetically silenced oct4 promoter in NSCs. Notably, demethylation of the oct4 promoter occurred only if chemical inhibitors and dTALEs were applied together but not upon treatment with inhibitors or dTALEs only. These results show that dTALEs in combination with chemical manipulation of epigenetic modifiers facilitate targeted transcriptional activation of epigenetically silenced target genes.

  15. Targeted transcriptional activation of silent oct4 pluripotency gene by combining designer TALEs and inhibition of epigenetic modifiers

    PubMed Central

    Bultmann, Sebastian; Morbitzer, Robert; Schmidt, Christine S.; Thanisch, Katharina; Spada, Fabio; Elsaesser, Janett; Lahaye, Thomas; Leonhardt, Heinrich


    Specific control of gene activity is a valuable tool to study and engineer cellular functions. Recent studies uncovered the potential of transcription activator-like effector (TALE) proteins that can be tailored to activate user-defined target genes. It remains however unclear whether and how epigenetic modifications interfere with TALE-mediated transcriptional activation. We studied the activity of five designer TALEs (dTALEs) targeting the oct4 pluripotency gene. In vitro assays showed that the five dTALEs that target distinct sites in the oct4 promoter had the expected DNA specificity and comparable affinities to their corresponding DNA targets. In contrast to their similar in vitro properties, transcriptional activation of oct4 by these distinct dTALEs varied up to 25-fold. While dTALEs efficiently upregulated transcription of the active oct4 promoter in embryonic stem cells (ESCs) they failed to activate the silenced oct4 promoter in ESC-derived neural stem cells (NSCs), indicating that as for endogenous transcription factors also dTALE activity is limited by repressive epigenetic mechanisms. We therefore targeted the activity of epigenetic modulators and found that chemical inhibition of histone deacetylases by valproic acid or DNA methyltransferases by 5-aza-2′-deoxycytidine facilitated dTALE-mediated activation of the epigenetically silenced oct4 promoter in NSCs. Notably, demethylation of the oct4 promoter occurred only if chemical inhibitors and dTALEs were applied together but not upon treatment with inhibitors or dTALEs only. These results show that dTALEs in combination with chemical manipulation of epigenetic modifiers facilitate targeted transcriptional activation of epigenetically silenced target genes. PMID:22387464

  16. Characterization of transcriptional activation and inserted-into-gene preference of various transposable elements in the Brassica species.


    Gao, Caihua; Xiao, Meili; Jiang, Lingyan; Li, Jiana; Yin, Jiaming; Ren, Xiaodong; Qian, Wei; Oscar, Ortegón; Fu, Donghui; Tang, Zhanglin


    Transposable elements (TEs) have attracted increasing attention because of their tremendous contributions to genome reorganization and gene variation through dramatic proliferation and excision via transposition. However, less known are the transcriptional activation of various TEs and the characteristics of TE insertion into genomes at the genome-wide level. In the present study, we focused on TE genes for transposition and gene disruption by insertion of TEs in expression sequences of Brassica, to investigate the transcriptional activation of TEs, the biased insertion of TEs into genes, and their salient characteristics. Long terminal repeat (LTR-retrotransposon) accounted for the majority of these active TE genes (70.8%), suggesting that transposition activation varied with TE type. 6.1% genes were interrupted by LTR-retrotransposons, which indicated their preference for insertion into genes. TEs were preferentially inserted into cellular component-specific genes acted as "binding" elements and involved in metabolic processes. TEs have a biased insertion into some host genes that were involved with important molecular functions and TE genes exhibited spatiotemporal expression. These results suggested that various types of transposons differentially contributed to gene variation and affected gene function.

  17. GCN5 is essential for IRF-4 gene expression followed by transcriptional activation of Blimp-1 in immature B cells.


    Kikuchi, Hidehiko; Nakayama, Masami; Kuribayashi, Futoshi; Imajoh-Ohmi, Shinobu; Nishitoh, Hideki; Takami, Yasunari; Nakayama, Tatsuo


    During B-cell differentiation, the gene expression of B-cell differentiation-related transcription factors must be strictly controlled by epigenetic mechanisms including histone acetylation and deacetylation, to complete the differentiation pathway. GCN5, one of the most important histone acetyltransferases, is involved in epigenetic events for transcriptional regulation through alterations in the chromatin structure. In this study, by analyzing the homozygous DT40 mutants GCN5(-/-), generated with gene targeting techniques, we found that GCN5 was necessary for transcriptional activation of IRF-4, an essential transcription factor for plasma cell differentiation. GCN5 deficiency caused drastic decreases in both the mRNA and the protein levels of Blimp-1 and IRF-4. The ectopic expression of Blimp-1 and IRF-4 suggests that IRF-4, but not Blimp-1, is the target gene of GCN5 in immature B cells. Moreover, a chromatin immunoprecipitation assay showed that GCN5 bound to the IRF-4 gene around its 5'-flanking region and acetylated H3K9 residues within chromatin surrounding the region in vivo, suggesting that gene expression of IRF-4 is certainly regulated by GCN5. These results reveal that GCN5 is essential for IRF-4 gene expression, followed by transcriptional activation of Blimp-1, and plays a key role in epigenetic regulation of B-cell differentiation.

  18. Selective down-regulation of tyrosinase family gene TYRP1 by inhibition of the activity of melanocyte transcription factor, MITF

    PubMed Central

    Fang, Dong; Tsuji, Yoshiaki; Setaluri, Vijayasaradhi


    Tyrosinase (TYR), tyrosinase-related protein-1 (TYRP1/gp75) and dopachrome tautomerase (DCT/TYRP2) belong to a family of melanocyte-specific gene products involved in melanin pigmentation. During melanocyte development expression of tyrosinase family genes is thought to be orchestrated in part by the binding of a shared basic helix–loop–helix transcription factor MITF to the M box, a regulatory element conserved among these genes. In transformed melanocytes, expression of tyrosinase and TYRPs is highly variable. Whereas TYR expression in melanoma cells is regulated by both transcriptional and post-translational mechanisms, TYRP1/gp75 transcription is often completely extinguished during melanoma tumor progression. In this study, we investigated the mechanisms of selective repression of TYRP1 transcription. Interestingly, in early stage melanoma cells TYRP1 mRNA could be induced by inhibition of protein synthesis. Transient transfection experiments with a minimal TYRP1 promoter showed that the promoter activity correlates with expression of the endogenous TYRP1 gene. Nucleotide deletion analysis revealed novel regulatory sequences that attenuate the M box-dependent MITF activity, but which are not involved in the repression of TYRP1. Gel mobility shift analysis showed that binding of the transcription factor MITF to the TYRP1 M box is selectively inhibited in TYRP1– cells. These data suggest that protein factors that modulate the activity of MITF in melanoma cells repress TYRP1 and presumably other MITF target genes. PMID:12136092

  19. Nuclear localization domains of GATA activator Gln3 are required for transcription of target genes through dephosphorylation in Saccharomyces cerevisiae.


    Numamoto, Minori; Tagami, Shota; Ueda, Yusuke; Imabeppu, Yusuke; Sasano, Yu; Sugiyama, Minetaka; Maekawa, Hiromi; Harashima, Satoshi


    The GATA transcription activator Gln3 in the budding yeast (Saccharomyces cerevisiae) activates transcription of nitrogen catabolite repression (NCR)-sensitive genes. In cells grown in the presence of preferred nitrogen sources, Gln3 is phosphorylated in a TOR-dependent manner and localizes in the cytoplasm. In cells grown in non-preferred nitrogen medium or treated with rapamycin, Gln3 is dephosphorylated and is transported from the cytoplasm to the nucleus, thereby activating the transcription of NCR-sensitive genes. Caffeine treatment also induces dephosphorylation of Gln3 and its translocation to the nucleus and transcription of NCR-sensitive genes. However, the details of the mechanism by which phosphorylation controls Gln3 localization and transcriptional activity are unknown. Here, we focused on two regions of Gln3 with nuclear localization signal properties (NLS-K, and NLS-C) and one with nuclear export signal (NES). We constructed various mutants for our analyses: gln3 containing point mutations in all potential phosphoacceptor sites (Thr-339, Ser-344, Ser-347, Ser-355, Ser-391) in the NLS and NES regions to produce non-phosphorylatable (alanine) or mimic-phosphorylatable (aspartic acid) residues; and deletion mutants. We found that phosphorylation of Gln3 was impaired in all of these mutations and that the aspartic acid substitution mutants showed drastic reduction of Gln3-mediated transcriptional activity despite the fact that the mutations had no effect on nuclear localization of Gln3. Our observations suggest that these regions are required for transcription of target genes presumably through dephosphorylation.

  20. Regulation of urokinase-type plasminogen activator gene transcription by macrophage colony-stimulating factor.

    PubMed Central

    Stacey, K J; Fowles, L F; Colman, M S; Ostrowski, M C; Hume, D A


    The mouse urokinase-type plasminogen activator (uPA) gene was used as a model macrophage colony-stimulating factor 1 (CSF-1)-inducible gene to investigate CSF-1 signalling pathways. Nuclear run-on analysis showed that induction of uPA mRNA by CSF-1 and phorbol myristate acetate (PMA) was at the transcriptional level in bone marrow-derived macrophages. CSF-1 and PMA synergized strongly in the induction of uPA mRNA, showing that at least some components of CSF-1 action are mediated independently of protein kinase C. Promoter targets of CSF-1 signalling were investigated with NIH 3T3 cells expressing the human CSF-1 receptor (c-fms). uPA mRNA was induced in these cells by treatment with CSF-1, and a PEA3/AP-1 element at -2.4 kb in the uPA promoter was involved in this response. Ets transcription factors can act through PEA3 sequences, and the involvement of Ets factors in the induction of uPA was confirmed by use of a dominant negative Ets-2 factor. Expression of the DNA binding domain of Ets-2 fused to the lacZ gene product prevented CSF-1-mediated induction of uPA mRNA in NIH 3T3 cells expressing the CSF-1 receptor. Examination of ets-2 mRNA expression in macrophages showed that it was also induced synergistically by CSF-1 and PMA. In the macrophage cell line RAW264, the uPA PEA3/AP-1 element mediated a response to both PMA and cotransfected Ets-2. uPA promoter constructs were induced 60- to 130-fold by Ets-2 expression, and the recombinant Ets-2 DNA binding domain was able to bind to the uPA PEA3/AP-1 element. This work is consistent with a proposed pathway for CSF-1 signalling involving sequential activation of fms, ras, and Ets factors. PMID:7760840

  1. Crystal structure of the caseinolytic protease gene regulator, a transcriptional activator in actinomycetes.


    Russo, Santina; Schweitzer, Jens-Eric; Polen, Tino; Bott, Michael; Pohl, Ehmke


    Human pathogens of the genera Corynebacterium and Mycobacterium possess the transcriptional activator ClgR (clp gene regulator) which in Corynebacterium glutamicum has been shown to regulate the expression of the ClpCP protease genes. ClgR specifically binds to pseudo-palindromic operator regions upstream of clpC and clpP1P2. Here, we present the first crystal structure of a ClgR protein from C. glutamicum. The structure was determined from two different crystal forms to resolutions of 1.75 and 2.05 A, respectively. ClgR folds into a five-helix bundle with a helix-turn-helix motif typical for DNA-binding proteins. Upon dimerization the two DNA-recognition helices are arranged opposite to each other at the protein surface in a distance of approximately 30 A, which suggests that they bind into two adjacent major grooves of B-DNA in an anti-parallel manner. A binding pocket is situated at a strategic position in the dimer interface and could possess a regulatory role altering the positions of the DNA-binding helices. PMID:19019826

  2. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages.


    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Iudicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki


    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage.

  3. Reverse transcriptase genes are highly abundant and transcriptionally active in marine plankton assemblages

    PubMed Central

    Lescot, Magali; Hingamp, Pascal; Kojima, Kenji K; Villar, Emilie; Romac, Sarah; Veluchamy, Alaguraj; Boccara, Martine; Jaillon, Olivier; Iudicone, Daniele; Bowler, Chris; Wincker, Patrick; Claverie, Jean-Michel; Ogata, Hiroyuki


    Genes encoding reverse transcriptases (RTs) are found in most eukaryotes, often as a component of retrotransposons, as well as in retroviruses and in prokaryotic retroelements. We investigated the abundance, classification and transcriptional status of RTs based on Tara Oceans marine metagenomes and metatranscriptomes encompassing a wide organism size range. Our analyses revealed that RTs predominate large-size fraction metagenomes (>5 μm), where they reached a maximum of 13.5% of the total gene abundance. Metagenomic RTs were widely distributed across the phylogeny of known RTs, but many belonged to previously uncharacterized clades. Metatranscriptomic RTs showed distinct abundance patterns across samples compared with metagenomic RTs. The relative abundances of viral and bacterial RTs among identified RT sequences were higher in metatranscriptomes than in metagenomes and these sequences were detected in all metatranscriptome size fractions. Overall, these observations suggest an active proliferation of various RT-assisted elements, which could be involved in genome evolution or adaptive processes of plankton assemblage. PMID:26613339

  4. Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.


    Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo


    The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells.

  5. Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.


    Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo


    The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells. PMID:24500196

  6. SATB1 Packages Densely Looped, Transcriptionally Active Chromatin for Coordinated Expression of Cytokine Genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    SATB1 (special AT-rich sequence binding protein 1) organizes cell type–specific nuclear architecture by anchoring specialized DNA sequences and recruiting chromatin remodeling factors to control gene transcription. We studied the role of SATB1 in regulating the coordinated expression of Il5, Il4 and...

  7. Intrinsic HER4/4ICD transcriptional activation domains are required for STAT5A activated gene expression.


    Han, Wen; Sfondouris, Mary E; Semmes, Eleanor C; Meyer, Alicia M; Jones, Frank E


    The epidermal growth factor receptor family member HER4 undergoes proteolytic processing at the cell surface to release the HER4 intracellular domain (4ICD) nuclear protein. Interestingly, 4ICD directly interacts with STAT5 and functions as an obligate STAT5 nuclear chaperone. Once in the nucleus 4ICD binds with STAT5 at STAT5 target genes, dramatically potentiating STAT5 transcriptional activation. These observations raise the possibility that 4ICD directly coactivates STAT5 gene expression. Using both yeast and mammalian transactivation reporter assays, we performed truncations of 4ICD fused to a GAL4 DNA binding domain and identified two independent 4ICD transactivation domains located between residues 1022 and 1090 (TAD1) and 1192 and 1225 (TAD2). The ability of the 4ICD DNA binding domain fusions to transactivate reporter gene expression required deletion of the intrinsic tyrosine kinase domain. In addition, we identified the 4ICD carboxyl terminal TVV residues, a PDZ domain binding motif (PDZ-DBM), as a potent transcriptional repressor. The transactivation activity of the HER4 carboxyl terminal domain lacking the tyrosine kinase (CTD) was significantly lower than similar EGFR or HER2 CTD. However, deletion of the HER4 CTD PDZ-DBM enhanced HER4 CTD transactivation to levels equivalent to the EGFR and HER2 CTDs. To determine if 4ICD TAD1 and TAD2 have a physiologically relevant role in STAT5 transactivation, we coexpressed 4ICD or 4ICD lacking TAD2 or both TAD1 and TAD2 with STAT5 in a luciferase reporter assay. Our results demonstrate that each 4ICD TAD contributes additively to STAT5A transactivation and the ability of STAT5A to transactivate the β-casein promoter requires the 4ICD TADs. Taken together, published data and our current results demonstrate that both 4ICD nuclear chaperone and intrinsic coactivation activities are essential for STAT5 regulated gene expression. PMID:27502417

  8. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).


    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook


    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  9. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 synergistically activate transcription of fatty-acid synthase gene (FASN).


    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook


    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation.

  10. The Zinc Finger Transcription Factor ZXDC Activates CCL2 Gene Expression by Opposing BCL6-mediated Repression

    PubMed Central

    Ramsey, Jon E.; Fontes, Joseph D.


    The zinc finger X-linked duplicated (ZXD) family of transcription factors has been implicated in regulating transcription of major histocompatibility complex class II genes in antigen presenting cells; roles beyond this function are not yet known. The expression of one gene in this family, ZXD family zinc finger C (ZXDC), is enriched in myeloid lineages and therefore we hypothesized that ZXDC may regulate myeloid-specific gene expression. Here we demonstrate that ZXDC regulates genes involved in myeloid cell differentiation and inflammation. Overexpression of the larger isoform of ZXDC, ZXDC1, activates expression of monocyte-specific markers of differentiation and synergizes with phorbol 12-myristate 13-acetate (which causes differentiation) in the human leukemic monoblast cell line U937. To identify additional gene targets of ZXDC1, we performed gene expression profiling which revealed multiple inflammatory gene clusters regulated by ZXDC1. Using a combination of approaches we show that ZXDC1 activates transcription of a gene within one of the regulated clusters, chemokine (C-C motif) ligand 2 (CCL2; monocyte chemoattractant protein 1; MCP1) via a previously defined distal regulatory element. Further, ZXDC1-dependent up-regulation of the gene involves eviction of the transcriptional repressor B-cell CLL/lymphoma 6 (BCL6), a factor known to be important in resolving inflammatory responses, from this region of the promoter. Collectively, our data show that ZXDC1 is a regulator in the process of myeloid function and that ZXDC1 is responsible for Ccl2 gene de-repression by BCL6. PMID:23954399

  11. Hes-1, a known transcriptional repressor, acts as a transcriptional activator for the human acid alpha-glucosidase gene in human fibroblast cells.


    Yan, Bo; Raben, Nina; Plotz, Paul H


    Hes-1, the mammalian homologue 1 of Drosophila hairy and Enhancer of split proteins, belongs to a family of basic helix-loop-helix proteins that are essential to neurogenesis, myogenesis, hematopoiesis, and sex determination. Hes-1 is a transcriptional repressor for a number of known genes including the human acid alpha-glucosidase (GAA) gene as we have previously shown in Hep G2 cells. The human GAA gene encodes the enzyme for glycogen breakdown in lysosomes, deficiency of which results in Glycogen Storage Disease type II (Pompe syndrome). Using constructs containing the DNA element that demonstrates repressive activity in Hep G2 cells and conditions in which the same transcription factors, Hes-1 and YY1, bind, we have shown that this element functions as an enhancer in human fibroblasts. Site-directed mutagenesis and overexpression of Hes-1 showed that Hes-1 functions as a transcriptional activator. The dual function of Hes-1 we have found is likely to contribute to the subtle tissue-specific control of this housekeeping gene.

  12. Gene switching rate determines response to extrinsic perturbations in the self-activation transcriptional network motif.


    de Franciscis, Sebastiano; Caravagna, Giulio; Mauri, Giancarlo; d'Onofrio, Alberto


    Gene switching dynamics is a major source of randomness in genetic networks, also in the case of large concentrations of the transcription factors. In this work, we consider a common network motif - the positive feedback of a transcription factor on its own synthesis - and assess its response to extrinsic noises perturbing gene deactivation in a variety of settings where the network might operate. These settings are representative of distinct cellular types, abundance of transcription factors and ratio between gene switching and protein synthesis rates. By investigating noise-induced transitions among the different network operative states, our results suggest that gene switching rates are key parameters to shape network response to external perturbations, and that such response depends on the particular biological setting, i.e. the characteristic time scales and protein abundance. These results might have implications on our understanding of irreversible transitions for noise-related phenomena such as cellular differentiation. In addition these evidences suggest to adopt the appropriate mathematical model of the network in order to analyze the system consistently to the reference biological setting. PMID:27256916

  13. Gene switching rate determines response to extrinsic perturbations in the self-activation transcriptional network motif

    PubMed Central

    de Franciscis, Sebastiano; Caravagna, Giulio; Mauri, Giancarlo; d’Onofrio, Alberto


    Gene switching dynamics is a major source of randomness in genetic networks, also in the case of large concentrations of the transcription factors. In this work, we consider a common network motif - the positive feedback of a transcription factor on its own synthesis - and assess its response to extrinsic noises perturbing gene deactivation in a variety of settings where the network might operate. These settings are representative of distinct cellular types, abundance of transcription factors and ratio between gene switching and protein synthesis rates. By investigating noise-induced transitions among the different network operative states, our results suggest that gene switching rates are key parameters to shape network response to external perturbations, and that such response depends on the particular biological setting, i.e. the characteristic time scales and protein abundance. These results might have implications on our understanding of irreversible transitions for noise-related phenomena such as cellular differentiation. In addition these evidences suggest to adopt the appropriate mathematical model of the network in order to analyze the system consistently to the reference biological setting. PMID:27256916

  14. The product of the murine homolog of the Drosophila extra sex combs gene displays transcriptional repressor activity.

    PubMed Central

    Denisenko, O N; Bomsztyk, K


    The heterogeneous nuclear ribonucleoprotein K protein represents a novel class of proteins that may act as docking platforms that orchestrate cross-talk among molecules involved in signal transduction and gene expression. Using a fragment of K protein as bait in the yeast two-hybrid screen, we isolated a cDNA that encodes a protein whose primary structure has extensive similarity to the Drosophila melanogaster extra sex combs (esc) gene product, Esc, a putative silencer of homeotic genes. The cDNA that we isolated is identical to the cDNA of the recently positionally cloned mouse embryonic ectoderm development gene, eed. Like Esc, Eed contains six WD-40 repeats in the C-terminal half of the protein and is thought to repress homeotic gene expression during mouse embryogenesis. Eed binds to K protein through a domain in its N terminus, but interestingly, this domain is not found in the Drosophila Esc. Gal4-Eed fusion protein represses transcription of a reporter gene driven by a promoter that contains Gal4-binding DNA elements. Eed also represses transcription when recruited to a target promoter by Gal4-K protein. Point mutations within the eed gene that are responsible for severe embryonic development abnormalities abolished the transcriptional repressor activity of Eed. Results of this study suggest that Eed-restricted homeotic gene expression during embryogenesis reflects the action of Eed as a transcriptional repressor. The Eed-mediated transcriptional effects are likely to reflect the interaction of Eed with multiple molecular partners, including K protein. PMID:9234727

  15. Human Krüppel-related 3 (HKR3) Is a Novel Transcription Activator of Alternate Reading Frame (ARF) Gene*

    PubMed Central

    Yoon, Jae-Hyeon; Choi, Won-Il; Jeon, Bu-Nam; Koh, Dong-In; Kim, Min-Kyeong; Kim, Myung-Hwa; Kim, Jungho; Hur, Sujin Susanne; Kim, Kyung-Sup; Hur, Man-Wook


    HKR3 (Human Krüppel-related 3) is a novel POK (POZ-domain Krüppel-like zinc-finger) family transcription factor. Recently, some of the POK (POZ-domain Krüppel-like zinc finger) family proteins have been shown to play roles in cell cycle arrest, apoptosis, cell proliferation, and oncogenesis. We investigated whether HKR3, an inhibitor of cell proliferation and an uncharacterized POK family protein, could regulate the cell cycle by controlling expression of genes within the p53 pathway (ARF-MDM2-TP53-p21WAF/CDKN1A). HKR3 potently activated the transcription of the tumor suppressor gene ARF by acting on the proximal promoter region (bp, −149∼+53), which contains Sp1 and FBI-1 binding elements (FREs). HKR3 interacted with the co-activator p300 to activate ARF transcription, which increased the acetylation of histones H3 and H4 within the proximal promoter. Oligonucleotide pull-down assays and ChIP assays revealed that HKR3 interferes with the binding of the proto-oncogenic transcription repressor FBI-1 to proximal FREs, thus derepressing ARF transcription. PMID:24382891

  16. Peach MYB7 activates transcription of the proanthocyanidin pathway gene encoding leucoanthocyanidin reductase, but not anthocyanidin reductase

    PubMed Central

    Zhou, Hui; Lin-Wang, Kui; Liao, Liao; Gu, Chao; Lu, Ziqi; Allan, Andrew C.; Han, Yuepeng


    Proanthocyanidins (PAs) are a group of natural phenolic compounds that have a great effect on both flavor and nutritious value of fruit. It has been shown that PA synthesis is regulated by R2R3-MYB transcription factors (TFs) via activation of PA-specific pathway genes encoding leucoanthocyanidin reductase and anthocyanidin reductase. Here, we report the isolation and characterization of a MYB gene designated PpMYB7 in peach. The peach PpMYB7 represents a new group of R2R3-MYB genes regulating PA synthesis in plants. It is able to activate transcription of PpLAR1 but not PpANR, and has a broader selection of potential bHLH partners compared with PpMYBPA1. Transcription of PpMYB7 can be activated by the peach basic leucine-zipper 5 TF (PpbZIP5) via response to ABA. Our study suggests a transcriptional network regulating PA synthesis in peach, with the results aiding the understanding of the functional divergence between R2R3-MYB TFs in plants. PMID:26579158

  17. A feedback control element near the transcription start site of the maize Shrunken gene determines promoter activity.

    PubMed Central

    Maas, C; Schaal, S; Werr, W


    The transcriptional activity of the Shrunken (Sh) promoter of Zea mays was monitored in transient expression assays using the neomycin phosphotransferase (NPT) II gene as a reporter in maize suspension protoplasts. Shortly after transfection, expression of this chimeric NPTII gene was negatively affected by high extracellular sucrose concentrations in the protoplast cultivation medium. However, 3-5 days after transfection an up to 405-fold increase in NPTII activity was observed. This could be blocked by dichlorobenzonitril (DCB) an inhibitor of cellulose biosynthesis. In the analysis of promoter deletions 20 bp upstream of the Sh transcription start site were sufficient to reproduce the expression profile and the activity of the full promoter. Surprisingly this start sequence does not include the natural TATA-box. Images Fig.1 Fig.2 Fig.3 Fig.4 PMID:2145150

  18. Abiotic-stress induces demethylation and transcriptional activation of a gene encoding a glycerophosphodiesterase-like protein in tobacco plants.


    Choi, Chang-Sun; Sano, Hiroshi


    To examine the relationship between gene expression and DNA methylation, transcriptionally activated genes were screened in hypomethylated transgenic tobacco plants expressing an anti-DNA methyltransferase sequence. Among 16 genes initially identified, one clone was found to encode a glycerophosphodiesterase-like protein (NtGPDL), earlier reported to be responsive to aluminium stress. When detached leaves from wild type tobacco plants were treated with aluminium, NtGPDL transcripts were induced within 6 h, and corresponding genomic loci were demethylated at CCGG sites within 1 h. Direct bisulfite methylation mapping revealed that CG sites in coding regions were selectively demethylated, and that promoter regions were totally unmethylated regardless of the stress. Salt and low temperature treatments also induced similar demethylation patterns. Such effects could be attributable to oxidative stress, since reactive oxygen species generated by paraquat efficiently induced the same pattern of demethylation at coding regions. Pathogen infection induced neither transcripts nor genomic demethylation. These results suggested a close correlation between methylation and expression of NtGPDL upon abiotic stresses with a cause-effect relationship. Since DNA methylation is linked to histone modification, it is conceivable that demethylation at coding regions might induce alteration of chromatin structure, thereby enhancing transcription. We propose that environmental responses of plants are partly mediated through active alteration of the DNA methylation status. PMID:17273870

  19. Rac1 inhibition negatively regulates transcriptional activity of the amyloid precursor protein gene.


    Wang, Pi-Lin; Niidome, Tetsuhiro; Akaike, Akinori; Kihara, Takeshi; Sugimoto, Hachiro


    Rac1, a member of the Rho family GTPases, participates in a variety of cellular functions including lamellipodia formation, actin cytoskeleton organization, cell growth, apoptosis, and neuronal development. Recent studies have implicated Rac1 in cytoskeletal abnormalities, production of reactive oxygen species, and generation of the amyloid beta-peptide (Abeta) observed in Alzheimer's disease. In this study, we examined the relationship between Rac1 and amyloid precursor protein (APP), because the abnormal proteolytic processing of APP is a pathologic feature of Alzheimer's disease. In primary hippocampal neurons, the Rac1-specific inhibitor NSC23766 decreased both Rac1 activity and APP protein levels in a concentration-dependent manner. To elucidate how NSC23766 decreases APP protein levels, we examined the effects of NSC23766 on APP processing, degradation, and biosynthesis. NSC23766 did not increase the levels of the proteolytic products of APP, sAPPalpha, Abeta40, and Abeta42. The proteasome inhibitor lactacystin did not reverse the NSC23766-induced decrease in APP protein levels. NSC23766 did, however, decrease the levels of both APP mRNA and APP protein. Decreased levels of APP mRNA and protein were also observed when HEK293 cells were transfected with an expression vector containing a dominant-negative Rac1 mutant or with siRNA targeting Rac1. By overexpressing progressively deleted fragments of the APP promoter in HEK293 cells, we identified a Rac1 response site at positions -233 to -41 bp in the APP promoter. Taken together, our results suggest that Rac1 regulates transcription of the APP gene in primary hippocampal neurons.

  20. Induction of human adiponectin gene transcription by telmisartan, angiotensin receptor blocker, independently on PPAR-{gamma} activation

    SciTech Connect

    Moriuchi, Akie ||. E-mail:; Shimamura, Mika; Kita, Atsushi; Kuwahara, Hironaga; Satoh, Tsuyoshi; Satoh, Tsuyoshi; Fujishima, Keiichiro; Fukushima, Keiko |; Hayakawa, Takao; Mizuguchi, Hiroyuki; Nagayama, Yuji; Kawasaki, Eiji


    Adiponectin, an adipose tissue-specific plasma protein, has been shown to ameliorate insulin resistance and inhibit the process of atherosclerosis. Recently, several reports have stated that angiotensin type 1 receptor blockers (ARBs), increase adiponectin plasma level, and ameliorate insulin resistance. Telmisartan, a subclass of ARBs, has been shown to be a partial agonist of the peroxisome proliferator-activated receptor (PPAR)-{gamma}, and to increase the plasma adiponectin level. However, the transcriptional regulation of the human adiponectin gene by telmisartan has not been determined yet. To elucidate the effect of telmisartan on adiponectin, the stimulatory regulation of human adiponectin gene by telmisartan was investigated in 3T3-L1 adipocytes, utilizing adenovirus-mediated luciferase reporter gene-transferring technique. This study indicates that telmisartan may stimulate adiponectin transcription independent of PPAR-{gamma}.

  1. Direct transcriptional control of the plasminogen activator gene of Yersinia pestis by the cyclic AMP receptor protein.


    Kim, Tae-Jong; Chauhan, Sadhana; Motin, Vladimir L; Goh, Ee-Been; Igo, Michele M; Young, Glenn M


    Horizontal gene transfer events followed by proper regulatory integration of a gene drive rapid evolution of bacterial pathogens. A key event in the evolution of the highly virulent plague bacterium Yersinia pestis was the acquisition of plasmid pPCP1, which carries the plasminogen activator gene, pla. This promoted the bubonic form of the disease by increasing bacterial dissemination from flea bite sites and incidentally enhanced replication in respiratory airways during pneumonic infection. We determined that expression of pla is controlled by the global regulator cyclic AMP (cAMP) receptor protein (Crp). This transcription factor is well conserved among distantly related bacteria, where it acts as a soluble receptor for the ubiquitous signaling molecule cAMP and controls a global network of metabolic and stress-protective genes. Crp has a similar physiological role in Y. pestis since loss of its function resulted in an inability to metabolize a variety of nonglucose substrates. Activation of pla expression requires a transcription activation element of the pla promoter that serves as a Crp binding site. Crp interaction with this site was demonstrated to occur only in the presence of cAMP. Alteration of the Crp binding site nucleotide sequence prevented in vitro formation of Crp-DNA complexes and inhibited in vivo expression of pla. The placement of pla under direct regulatory control of Crp highlights how highly adapted pathogens integrate laterally acquired genes to coordinate virulence factor expression with global gene networks to maintain homeostasis through the infectious life cycle.

  2. Progesterone receptor repression of prolactin/signal transducer and activator of transcription 5-mediated transcription of the beta-casein gene in mammary epithelial cells.


    Buser, Adam C; Gass-Handel, Elizabeth K; Wyszomierski, Shannon L; Doppler, Wolfgang; Leonhardt, Susan A; Schaack, Jerome; Rosen, Jeffrey M; Watkin, Harriet; Anderson, Steven M; Edwards, Dean P


    Prolactin (PRL) and glucocorticoids act synergistically to stimulate transcription of the beta-casein milk protein gene. Signal transducer and activator of transcription 5 (Stat5) mediates PRL-dependent trans-activation, and glucocorticoid potentiation occurs through cross talk between glucocorticoid receptor (GR) and Stat5 at the beta-casein promoter. In the mouse, progesterone withdrawal leads to terminal differentiation and secretory activation of the mammary gland at parturition, indicating progesterone's role in repressing milk protein gene expression during pregnancy. To investigate the mechanism of the inhibitory action of progesterone, experiments were performed with cell culture systems reconstituted to express progesterone receptor (PR), the PRL receptor/Stat5 signaling pathway, and GR, enabling evaluation of PR, GR, and Stat5 interactions at the beta-casein promoter. With COS-1, normal murine mammary gland, HC-11, and primary mammary epithelial cells, progestin-PR directly repressed the PRL receptor/Stat5a signaling pathway's mediation of PRL-induced beta-casein transcription. Progestin-PR also inhibited glucocorticoid-GR enhancement of PRL induced trans-activation of beta-casein. Inhibition depended on a functional PR DNA binding domain and specific PR-DNA interactions at the beta-casein promoter. Chromatin immunoprecipitation assays in HC-11 cells revealed recruitment of PR and Stat5a to the beta-casein promoter by progestin or PRL, respectively. Recruitment was disrupted by cotreatment with progestin and PRL, suggesting a mutual interference between activated PR and Stat5a. Without PRL, progestin-PR also recruited Stat5a to the beta-casein promoter, suggesting that recruitment of an unactivated form of Stat5a may contribute to inhibition of beta-casein by progesterone. These results define a negative cross talk between PR and Stat5a/GR that may contribute to the physiological role of progesterone to repress lactogenic hormone induction of the beta

  3. The 8q24 Gene Desert: An Oasis of Non-Coding Transcriptional Activity

    PubMed Central

    Huppi, Konrad; Pitt, Jason J.; Wahlberg, Brady M.; Caplen, Natasha J.


    Understanding the functional effects of the wide-range of aberrant genetic characteristics associated with the human chromosome 8q24 region in cancer remains daunting due to the complexity of the locus. The most logical target for study remains the MYC proto-oncogene, a prominent resident of 8q24 that was first identified more than a quarter of a century ago. However, many of the amplifications, translocation breakpoints, and viral integration sites associated with 8q24 are often found throughout regions surrounding large expanses of the MYC locus that include other transcripts. In addition, chr.8q24 is host to a number of single nucleotide polymorphisms associated with cancer risk. Yet, the lack of a direct correlation between cancer risk alleles and MYC expression has also raised the possibility that MYC is not always the target of these genetic associations. The 8q24 region has been described as a “gene desert” because of the paucity of functionally annotated genes located within this region. Here we review the evidence for the role of other loci within the 8q24 region, most of which are non-coding transcripts, either in concert with MYC or independent of MYC, as possible candidate gene targets in malignancy. PMID:22558003

  4. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi


    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  5. Transcriptional activation of homologous and heterologous genes by the hepatitis B virus X gene product in cells permissive for viral replication.

    PubMed Central

    Colgrove, R; Simon, G; Ganem, D


    The potential of the hepadnavirus X gene product to activate gene expression in trans was tested through a series of cotransfections of X expression vectors with a variety of potential targets for transactivation. The X gene products from human hepatitis B virus (HBV), woodchuck hepatitis virus, and ground squirrel hepatitis virus are all equally active in augmenting the expression of a wide array of target promoters in both permissive and nonpermissive cells. Using the HBV genome itself as the source of X protein, we demonstrate that transactivation of HBV and heterologous genes occurs when X protein is expressed in its native state during productive infection of permissive cells. Run-on transcription analysis indicates that this transactivation occurs at the level of primary transcription. Images PMID:2788226

  6. A Global Genomic and Genetic Strategy to Identify, Validate and Use Gene Signatures of Xenobiotic-Responsive Transcription Factors in Prediction of Pathway Activation in the Mouse Liver

    EPA Science Inventory

    Many drugs and environmentally-relevant chemicals activate xenobiotic-responsive transcription factors. Identification of target genes of these factors would be useful in predicting pathway activation in in vitro chemical screening as well as their involvement in disease states. ...

  7. The full-length transcript of a caulimovirus is a polycistronic mRNA whose genes are trans activated by the product of gene VI.


    Scholthof, H B; Gowda, S; Wu, F C; Shepherd, R J


    Gene expression of figwort mosaic virus (FMV), a caulimovirus, was investigated by electroporation of Nicotiana edwardsonii cell suspension protoplasts with cloned viral constructs in which a reporter gene was inserted at various positions on the genome. The results showed that the genome of FMV contains two promoters; one is used for the production of a full-length RNA and another initiates synthesis of a separate monocistronic RNA for gene VI. Evidence is provided that the full-length transcript, the probable template for reverse transcription, can serve as a polycistronic mRNA for translation of genes I through V and perhaps also gene VI. Expression of all the genes on the polycistronic mRNA is trans activated by the gene VI protein. Reporter gene expression appears most efficient when its start codon is in close proximity to the stop codon of the preceding gene, as for the native genes of caulimoviruses. We propose that the gene VI product enables expression of the polycistronic mRNA by promoting reinitiation of ribosomes to give translational coupling of individual genes.

  8. Cystatin D locates in the nucleus at sites of active transcription and modulates gene and protein expression.


    Ferrer-Mayorga, Gemma; Alvarez-Díaz, Silvia; Valle, Noelia; De Las Rivas, Javier; Mendes, Marta; Barderas, Rodrigo; Canals, Francesc; Tapia, Olga; Casal, J Ignacio; Lafarga, Miguel; Muñoz, Alberto


    Cystatin D is an inhibitor of lysosomal and secreted cysteine proteases. Strikingly, cystatin D has been found to inhibit proliferation, migration, and invasion of colon carcinoma cells indicating tumor suppressor activity that is unrelated to protease inhibition. Here, we demonstrate that a proportion of cystatin D locates within the cell nucleus at specific transcriptionally active chromatin sites. Consistently, transcriptomic analysis show that cystatin D alters gene expression, including that of genes encoding transcription factors such as RUNX1, RUNX2, and MEF2C in HCT116 cells. In concordance with transcriptomic data, quantitative proteomic analysis identified 292 proteins differentially expressed in cystatin D-expressing cells involved in cell adhesion, cytoskeleton, and RNA synthesis and processing. Furthermore, using cytokine arrays we found that cystatin D reduces the secretion of several protumor cytokines such as fibroblast growth factor-4, CX3CL1/fractalkine, neurotrophin 4 oncostatin-M, pulmonary and activation-regulated chemokine/CCL18, and transforming growth factor B3. These results support an unanticipated role of cystatin D in the cell nucleus, controlling the transcription of specific genes involved in crucial cellular functions, which may mediate its protective action in colon cancer.

  9. Cystatin D Locates in the Nucleus at Sites of Active Transcription and Modulates Gene and Protein Expression*

    PubMed Central

    Ferrer-Mayorga, Gemma; Alvarez-Díaz, Silvia; Valle, Noelia; De Las Rivas, Javier; Mendes, Marta; Barderas, Rodrigo; Canals, Francesc; Tapia, Olga; Casal, J. Ignacio; Lafarga, Miguel; Muñoz, Alberto


    Cystatin D is an inhibitor of lysosomal and secreted cysteine proteases. Strikingly, cystatin D has been found to inhibit proliferation, migration, and invasion of colon carcinoma cells indicating tumor suppressor activity that is unrelated to protease inhibition. Here, we demonstrate that a proportion of cystatin D locates within the cell nucleus at specific transcriptionally active chromatin sites. Consistently, transcriptomic analysis show that cystatin D alters gene expression, including that of genes encoding transcription factors such as RUNX1, RUNX2, and MEF2C in HCT116 cells. In concordance with transcriptomic data, quantitative proteomic analysis identified 292 proteins differentially expressed in cystatin D-expressing cells involved in cell adhesion, cytoskeleton, and RNA synthesis and processing. Furthermore, using cytokine arrays we found that cystatin D reduces the secretion of several protumor cytokines such as fibroblast growth factor-4, CX3CL1/fractalkine, neurotrophin 4 oncostatin-M, pulmonary and activation-regulated chemokine/CCL18, and transforming growth factor B3. These results support an unanticipated role of cystatin D in the cell nucleus, controlling the transcription of specific genes involved in crucial cellular functions, which may mediate its protective action in colon cancer. PMID:26364852

  10. Perinucleolar relocalization and nucleolin as crucial events in the transcriptional activation of key genes in mantle cell lymphoma.


    Allinne, Jeanne; Pichugin, Andrei; Iarovaia, Olga; Klibi, Manel; Barat, Ana; Zlotek-Zlotkiewicz, Ewa; Markozashvili, Diana; Petrova, Natalia; Camara-Clayette, Valérie; Ioudinkova, Elena; Wiels, Joëlle; Razin, Sergey V; Ribrag, Vincent; Lipinski, Marc; Vassetzky, Yegor S


    In mantle cell lymphoma (MCL), one allele of the cyclin D1 (Ccnd1) gene is translocated from its normal localization on chromosome 11 to chromosome 14. This is considered as the crucial event in the transformation process of a normal naive B-cell; however, the actual molecular mechanism leading to Ccnd1 activation remains to be deciphered. Using a combination of three-dimensional and immuno-fluorescence in situ hybridization experiments, the radial position of the 2 Ccnd1 alleles was investigated in MCL-derived cell lines and malignant cells from affected patients. The translocated Ccnd1 allele was observed significantly more distant from the nuclear membrane than its nontranslocated counterpart, with a very high proportion of IgH-Ccnd1 chromosomal segments localized next to a nucleolus. These perinucleolar areas were found to contain active RNA polymerase II (PolII) clusters. Nucleoli are rich in nucleolin, a potent transcription factor that we found to bind sites within the Ccnd1 gene specifically in MCL cells and to activate Ccnd1 transcription. We propose that the Ccnd1 transcriptional activation in MCL cells relates to the repositioning of the rearranged IgH-Ccnd1-carrying chromosomal segment in a nuclear territory with abundant nucleolin and active PolII molecules. Similar transforming events could occur in Burkitt and other B-cell lymphomas.

  11. Optimizations of siRNA design for the activation of gene transcription by targeting the TATA-box motif.


    Fan, Miaomiao; Zhang, Yijun; Huang, Zhuoqiong; Liu, Jun; Guo, Xuemin; Zhang, Hui; Luo, Haihua


    Small interfering RNAs (siRNAs) are widely used to repress gene expression by targeting mRNAs. Some reports reveal that siRNAs can also activate or inhibit gene expression through targeting the gene promoters. Our group has found that microRNAs (miRNAs) could activate gene transcription via interaction with the TATA-box motif in gene promoters. To investigate whether siRNA targeting the same region could upregulate the promoter activity, we test the activating efficiency of siRNAs targeting the TATA-box motif of 16 genes and perform a systematic analysis to identify the common features of the functional siRNAs for effective activation of gene promoters. Further, we try various modifications to improve the activating efficiency of siRNAs and find that it is quite useful to design the promoter-targeting activating siRNA by following several rules such as (a) complementary to the TATA-box-centered region; (b) UA usage at the first two bases of the antisense strand; (c) twenty-three nucleotides (nts) in length; (d) 2'-O-Methyl (2'-OMe) modification at the 3' terminus of the antisense strand; (e) avoiding mismatches at the 3' end of the antisense strand. The optimized activating siRNAs potently enhance the expression of interleukin-2 (IL-2) gene in human and mouse primary CD4+ T cells with a long-time effect. Taken together, our study provides a guideline for rational design the promoter-targeting siRNA to sequence-specifically enhance gene expression.

  12. Transcriptional activation of the H-ferritin gene in differentiated Caco-2 cells parallels a change in the activity of the nuclear factor Bbf.

    PubMed Central

    Bevilacqua, M A; Faniello, M C; D'Agostino, P; Quaresima, B; Tiano, M T; Pignata, S; Russo, T; Cimino, F; Costanzo, F


    In this paper, we examine the mechanisms that regulate the expression of the heavy (H) ferritin subunit in the colon carcinoma Caco-2 cell line allowed to differentiate spontaneously in vitro. The differentiation process of these cells in continuous culture is accompanied by an accumulation of the mRNA coding for the apoferritin H chain. The analysis of Caco-2 subclones stably transfected with an H-chain promoter-chloramphenicol acetyltransferase (CAT) construct revealed that the mRNA increase is paralleled by an enhanced transcription of the H gene, driven by the -100 to +4 region of the H promoter. The H gene transcriptional activation seems to be a specific feature of differentiated Caco-2 cells, since the activity of other promoters did not change upon differentiation. The -100 to +4 region of the H promoter binds a transcription factor called Bbf (B-box binding factor); electrophoretic-mobility-shift-assay analyses showed that the retarded complex due to Bbf-H promoter interaction is significantly increased in the differentiated cells. We propose that the activation of H-ferritin gene expression may be associated with the establishment of a differentiated phenotype in Caco-2 cells, and that the H-ferritin gene transcriptional up-regulation is accompanied by a modification in the activity of the transcription factor Bbf. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:7487931

  13. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

    PubMed Central

    Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.


    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

  14. Widespread Inducible Transcription Downstream of Human Genes

    PubMed Central

    Vilborg, Anna; Passarelli, Maria C.; Yario, Therese A.; Tycowski, Kazimierz T.; Steitz, Joan A.


    Summary Pervasive transcription of the human genome generates RNAs whose mode of formation and functions are largely uncharacterized. Here, we combine RNA-Seq with detailed mechanistic studies to describe a transcript type derived from protein-coding genes. The resulting RNAs, which we call DoGs for downstream of gene containing transcripts, possess long non-coding regions (often >45 kb) and remain chromatin bound. DoGs are inducible by osmotic stress through an IP3 receptor signaling-dependent pathway, indicating active regulation. DoG levels are increased by decreased termination of the upstream transcript, a previously undescribed mechanism for rapid transcript induction. Relative depletion of polyA signals in DoG regions correlates with increased levels of DoGs after osmotic stress. We detect DoG transcription in several human cell lines and provide evidence for thousands of DoGs genome-wide. PMID:26190259

  15. Identification of a Potent Inhibitor of CREB-Mediated Gene Transcription with Efficacious in Vivo Anticancer Activity

    PubMed Central


    Recent studies have shown that nuclear transcription factor cyclic adenosine monophosphate response element binding protein (CREB) is overexpressed in many different types of cancers. Therefore, CREB has been pursued as a novel cancer therapeutic target. Naphthol AS-E and its closely related derivatives have been shown to inhibit CREB-mediated gene transcription and cancer cell growth. Previously, we identified naphthamide 3a as a different chemotype to inhibit CREB’s transcription activity. In a continuing effort to discover more potent CREB inhibitors, a series of structural congeners of 3a was designed and synthesized. Biological evaluations of these compounds uncovered compound 3i (666-15) as a potent and selective inhibitor of CREB-mediated gene transcription (IC50 = 0.081 ± 0.04 μM). 666-15 also potently inhibited cancer cell growth without harming normal cells. In an in vivo MDA-MB-468 xenograft model, 666-15 completely suppressed the tumor growth without overt toxicity. These results further support the potential of CREB as a valuable cancer drug target. PMID:26023867

  16. Signal transducer and activator of transcription (STAT)-3 regulates microRNA gene expression in chronic lymphocytic leukemia cells

    PubMed Central


    Backgrounds Approximately 1,000 microRNAs (miRs) are present in the human genome; however, little is known about the regulation of miR transcription. Because miR levels are deregulated in chronic lymphocytic leukemia (CLL) and signal transducer and activator of transcription (STAT)-3 is constitutively activated in CLL, we sought to determine whether STAT3 affects the transcription of miR genes in CLL cells. Methods We used publically available data from the ENCODE project to identify putative STAT3 binding sites in the promoters of miR genes. Then we transfected CLL cells with STAT3-shRNA or with an empty vector, and to determine which miRs are differentially expressed, we used a miR microarray approach followed by validation of the microarray results for 6 miRs using quantitative real-time polymerase chain reaction (qRT-PCR). Results We identified putative STAT3 binding sites in 160 promoter regions of 200 miRs, including miR-21, miR-29, and miR-155, whose levels have been reported to be upregulated in CLL. Levels of 72 miRs were downregulated (n = 63) or upregulated (n = 9). qRT-PCR confirmed the array data in 5 of 6 miRs. Conclusions The presence of activated STAT3 has a profound effect on miR expression in CLL cells. PMID:23725032

  17. Characterization of a new ARID family transcription factor (Brightlike/ARID3C) that co-activates Bright/ARID3A-mediated immunoglobulin gene transcription.


    Tidwell, Josephine A; Schmidt, Christian; Heaton, Phillip; Wilson, Van; Tucker, Philip W


    Two members, Bright/ARID3A and Bdp/ARID3B, of the ARID (AT-Rich Interaction Domain) transcription family are distinguished by their ability to specifically bind to DNA and to self-associate via a second domain, REKLES. Bright and Bdp positively regulate immunoglobulin heavy chain gene (IgH) transcription by binding to AT-rich motifs within Matrix Associating Regions (MARs) residing within a subset of V(H) promoters and the Eμ intronic enhancer. In addition, REKLES provides Bright nuclear export function, and a small pool of Bright is directed to plasma membrane sub-domains/lipid rafts where it associates with and modulates signaling of the B cell antigen receptor (BCR). Here, we characterize a third, highly conserved, physically condensed ARID3 locus, Brightlike/ARID3C. Brightlike encodes two alternatively spliced, SUMO-I-modified isoforms that include or exclude (Δ6) the REKLES-encoding exon 6. Brightlike transcripts and proteins are expressed preferentially within B lineage lymphocytes and coordinate with highest Bright expression in activated follicular B cells. Brightlike, but not BrightlikeΔ6, undergoes nuclear-cytoplasmic shuttling with a fraction localizing within lipid rafts following BCR stimulation. Brightlike, but not BrightlikeΔ6, associates with Bright in solution, at common DNA binding sites in vitro, and is enriched at Bright binding sites in chromatin. Although possessing little transactivation capacity of its own, Brightlike significantly co-activates Bright-dependent IgH transcription with maximal activity mediated by the unsumoylated form. In sum, this report introduces Brightlike as an additional functional member of the family of ARID proteins, which should be considered in regulatory circuits, previously ascribed to be mediated by Bright.

  18. MCAF1 and synergistic activation of the transcription of Epstein-Barr virus lytic genes by Rta and Zta.


    Chang, Li-Kwan; Chuang, Jian-Ying; Nakao, Mitsuyoshi; Liu, Shih-Tung


    Epstein-Barr virus (EBV) expresses two transcription factors, Rta and Zta, during the immediate-early stage of the lytic cycle. The two proteins often collaborate to activate the transcription of EBV lytic genes synergistically. This study demonstrates that Rta and Zta form a complex via an intermediary protein, MCAF1, on Zta response element (ZRE) in vitro. The interaction among these three proteins in P3HR1 cells is also verified via coimmunoprecipitation, CHIP analysis and confocal microscopy. The interaction between Rta and Zta in vitro depends on the region between amino acid 562 and 816 in MCAF1. In addition, overexpressing MCAF1 enhances and introducing MCAF1 siRNA into the cells markedly reduces the level of the synergistic activation in 293T cells. Moreover, the fact that the synergistic activation depends on ZRE but not on Rta response element (RRE) originates from the fact that Rta and Zta are capable of activating the BMRF1 promoter synergistically after an RRE but not ZREs in the promoter are mutated. The binding of Rta-MCAF1-Zta complex to ZRE but not RRE also explains why Rta and Zta do not use RRE to activate transcription synergistically. Importantly, this study elucidates the mechanism underlying synergistic activation, which is important to the lytic development of EBV. PMID:20385599

  19. [Transcriptional control of ciliary genes].


    Vieillard, Jennifer; Jerber, Julie; Durand, Bénédicte


    Cilia are found in many eukaryotic species and share a common microtubule architecture that can nonetheless show very diverse features within one animal. The genesis of cilia and their diversity require the expression of different specific genes. At least two classes of transcription factors are involved in ciliogenesis: the RFX family, essential for the assembly of most cilia and the FOXJ1 transcription factors that are key regulators of motile cilia assembly. These two different families of transcription factors have both specific and common target genes and they can also cooperate for the formation of cilia. In collaboration with cell type specific factors, they also contribute to the specialisation of cilia. As a consequence, the identification of RFX and FOXJ1 target genes has emerged as an efficient strategy to identify novel ciliary genes, and in particular genes potentially implicated in ciliopathies.

  20. Functional interplay of SP family members and nuclear factor Y is essential for transcriptional activation of the human Calreticulin gene.


    Schardt, Julian A; Keller, Manuela; Seipel, Katja; Pabst, Thomas


    Calreticulin (CALR) is a highly conserved, multifunctional protein involved in a variety of cellular processes including the maintenance of intracellular calcium homeostasis, proper protein folding, differentiation and immunogenic cell death. More recently, a crucial role for CALR in the pathogenesis of certain hematologic malignancies was discovered: in clinical subgroups of acute myeloid leukemia, CALR overexpression mediates a block in differentiation, while somatic mutations have been found in the majority of patients with myeloproliferative neoplasms with nonmutated Janus kinase 2 gene (JAK2) or thrombopoietin receptor gene (MPL). However, the mechanisms underlying CALR promoter activation have insufficiently been investigated so far. By dissecting the core promoter region, we could identify a functional TATA-box relevant for transcriptional activation. In addition, we characterized two evolutionary highly conserved cis-regulatory modules (CRMs) within the proximal promoter each composed of one binding site for the transcription factors SP1 and SP3 as well as for the nuclear transcription factor Y (NFY) and we verified binding of these factors to their cognate sites in vitro and in vivo.

  1. Phytanic acid, a novel activator of uncoupling protein-1 gene transcription and brown adipocyte differentiation.

    PubMed Central

    Schlüter, Agatha; Barberá, Maria José; Iglesias, Roser; Giralt, Marta; Villarroya, Francesc


    Phytanic acid (3,7,11,15-tetramethylhexadecanoic acid) is a phytol-derived branched-chain fatty acid present in dietary products. Phytanic acid increased uncoupling protein-1 (UCP1) mRNA expression in brown adipocytes differentiated in culture. Phytanic acid induced the expression of the UCP1 gene promoter, which was enhanced by co-transfection with a retinoid X receptor (RXR) expression vector but not with other expression vectors driving peroxisome proliferator-activated receptor (PPAR)alpha, PPARgamma or a form of RXR devoid of ligand-dependent sensitivity. The effect of phytanic acid on the UCP1 gene required the 5' enhancer region of the gene and the effects of phytanic acid were mediated in an additive manner by three binding sites for RXR. Moreover, phytanic acid activates brown adipocyte differentiation: long-term exposure of brown preadipocytes to phytanic acid promoted the acquisition of the brown adipocyte morphology and caused a co-ordinate induction of the mRNAs for gene markers of brown adipocyte differentiation, such as UCP1, adipocyte lipid-binding protein aP2, lipoprotein lipase, the glucose transporter GLUT4 or subunit II of cytochrome c oxidase. In conclusion, phytanic acid is a natural product of phytol metabolism that activates brown adipocyte thermogenic function. It constitutes a potential nutritional signal linking dietary status to adaptive thermogenesis. PMID:11829740

  2. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    PubMed Central

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen


    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  3. Bordetella pertussis fim3 gene regulation by BvgA: phosphorylation controls the formation of inactive vs. active transcription complexes.


    Boulanger, Alice; Moon, Kyung; Decker, Kimberly B; Chen, Qing; Knipling, Leslie; Stibitz, Scott; Hinton, Deborah M


    Two-component systems [sensor kinase/response regulator (RR)] are major tools used by microorganisms to adapt to environmental conditions. RR phosphorylation is typically required for gene activation, but few studies have addressed how and if phosphorylation affects specific steps during transcription initiation. We characterized transcription complexes made with RNA polymerase and the Bordetella pertussis RR, BvgA, in its nonphosphorylated or phosphorylated (BvgA∼P) state at P(fim3), the promoter for the virulence gene fim3 (fimbrial subunit), using gel retardation, potassium permanganate and DNase I footprinting, cleavage reactions with protein conjugated with iron bromoacetamidobenzyl-EDTA, and in vitro transcription. Previous work has shown that the level of nonphosphorylated BvgA remains high in vivo under conditions in which BvgA is phosphorylated. Our results here indicate that surprisingly both BvgA and BvgA∼P form open and initiating complexes with RNA polymerase at P(fim3). However, phosphorylation of BvgA is needed to generate the correct conformation that can transition to competent elongation. Footprints obtained with the complexes made with nonphosphorylated BvgA are atypical; while the initiating complex with BvgA synthesizes short RNA, it does not generate full-length transcripts. Extended incubation of the BvgA/RNA polymerase initiated complex in the presence of heparin generates a stable, but defective species that depends on the initial transcribed sequence of fim3. We suggest that the presence of nonphosphorylated BvgA down-regulates P(fim3) activity when phosphorylated BvgA is present and may allow the bacterium to quickly adapt to the loss of inducing conditions by rapidly eliminating P(fim3) activation once the signal for BvgA phosphorylation is removed.

  4. Insertional mutagenesis in Neurospora crassa: cloning and molecular analysis of the preg+ gene controlling the activity of the transcriptional activator NUC-1.


    Kang, S; Metzenberg, R L


    The transcriptional activator NUC-1 controls the transcription of the genes for phosphorus acquisition enzymes, and its activity is regulated by the negative regulatory factors, PREG and PGOV In this report, we describe the cloning and molecular analysis of the preg+ gene. In Neurospora crassa, as in higher eukaryotes, transformation frequently results in nonhomologous integration of transforming DNA. Insertion of transforming DNA into host genes mutates the gene and provides a molecular tag for cloning it. We obtained two mutants that have an insertion in the preg+ and pgov+ genes, respectively, among 2 x 10(5) transformants. The preg+ gene was cloned by screening a Neurospora genomic DNA library with DNA sequences flanking the transforming DNA of the rescued plasmid. Northern analysis showed that the transcription of the preg+ gene is not regulated by phosphate. The carboxy-terminal half of PREG shows strong homology with Saccharomyces cerevisiae PHO80 whose function is analogous to that of PREG. The pregc mutations are located in the well conserved residues which may directly interact with the residues in the regulatory domain of NUC-1.

  5. Insertional Mutagenesis in Neurospora Crassa: Cloning and Molecular Analysis of the Preg(+) Gene Controlling the Activity of the Transcriptional Activator Nuc-1

    PubMed Central

    Kang, S.; Metzenberg, R. L.


    The transcriptional activator NUC-1 controls the transcription of the genes for phosphorus acquisition enzymes, and its activity is regulated by the negative regulatory factors, PREG and PGOV. In this report, we describe the cloning and molecular analysis of the preg(+) gene. In Neurospora crassa, as in higher eukaryotes, transformation frequently results in nonhomologous integration of transforming DNA. Insertion of transforming DNA into host genes mutates the gene and provides a molecular tag for cloning it. We obtained two mutants that have an insertion in the preg(+) and pgov(+) genes, respectively, among 2 X 10(5) transformants. The preg(+) gene was cloned by screening a Neurospora genomic DNA library with DNA sequences flanking the transforming DNA of the rescued plasmid. Northern analysis showed that the transcription of the preg(+) gene is not regulated by phosphate. The carboxy-terminal half of PREG shows strong homology with Saccharomyces cerevisiae PHO80 whose function is analogous to that of PREG. The preg(c) mutations are located in the well conserved residues which may directly interact with the residues in the regulatory domain of NUC-1. PMID:8436269

  6. Sequential activation of alpha-actin genes during avian cardiogenesis: vascular smooth muscle alpha-actin gene transcripts mark the onset of cardiomyocyte differentiation

    PubMed Central


    The expression of cytoplasmic beta-actin and cardiac, skeletal, and smooth muscle alpha-actins during early avian cardiogenesis was analyzed by in situ hybridization with mRNA-specific single-stranded DNA probes. The cytoplasmic beta-actin gene was ubiquitously expressed in the early chicken embryo. In contrast, the alpha-actin genes were sequentially activated in avian cardiac tissue during the early stages of heart tube formation. The accumulation of large quantities of smooth muscle alpha-actin transcripts in epimyocardial cells preceded the expression of the sarcomeric alpha-actin genes. The accumulation of skeletal alpha-actin mRNAs in the developing heart lagged behind that of cardiac alpha-actin by several embryonic stages. At Hamburger- Hamilton stage 12, the smooth muscle alpha-actin gene was selectively down-regulated in the heart such that only the conus, which subsequently participates in the formation of the vascular trunks, continued to express this gene. This modulation in smooth muscle alpha- actin gene expression correlated with the beginning of coexpression of sarcomeric alpha-actin transcripts in the epimyocardium and the onset of circulation in the embryo. The specific expression of the vascular smooth muscle alpha-actin gene marks the onset of differentiation of cardiac cells and represents the first demonstration of coexpression of both smooth muscle and striated alpha-actin genes within myogenic cells. PMID:3204121

  7. The anti-tumor drug bleomycin preferentially cleaves at the transcription start sites of actively transcribed genes in human cells.


    Murray, Vincent; Chen, Jon K; Galea, Anne M


    The genome-wide pattern of DNA cleavage at transcription start sites (TSSs) for the anti-tumor drug bleomycin was examined in human HeLa cells using next-generation DNA sequencing. It was found that actively transcribed genes were preferentially cleaved compared with non-transcribed genes. The 143,600 identified human TSSs were split into non-transcribed genes (82,596) and transcribed genes (61,004) for HeLa cells. These transcribed genes were further split into quintiles of 12,201 genes comprising the top 20, 20-40, 40-60, 60-80, and 80-100 % of expressed genes. The bleomycin cleavage pattern at highly transcribed gene TSSs was greatly enhanced compared with purified DNA and non-transcribed gene TSSs. The top 20 and 20-40 % quintiles had a very similar enhanced cleavage pattern, the 40-60 % quintile was intermediate, while the 60-80 and 80-100 % quintiles were close to the non-transcribed and purified DNA profiles. The pattern of bleomycin enhanced cleavage had peaks that were approximately 200 bp apart, and this indicated that bleomycin was identifying the presence of phased nucleosomes at TSSs. Hence bleomycin can be utilized to detect chromatin structures that are present at actively transcribed genes. In this study, for the first time, the pattern of DNA damage by a clinically utilized cancer chemotherapeutic agent was performed on a human genome-wide scale at the nucleotide level.

  8. DEP-induced fra-1 expression correlates with a distinct activation of AP-1-dependent gene transcription in the lung.


    Zhang, Qin; Kleeberger, Steven R; Reddy, Sekhar P


    Recent studies indicate a potential role for Fra-1, a heterodimeric partner of activator protein (AP)-1, in toxicant-induced epithelial injury, repair, and cellular transformation. Here we have investigated the effects of diesel exhaust particles (DEP) on fra-1 expression in C10 cells, a murine lung epithelial cell line. DEP markedly upregulated fra-1, but not fra-2, expression. The increase in fra-1 mRNA expression correlated well with its protein- and DNA-binding activity. DNA-binding assays also revealed a predominant presence of Jun-B and Jun-D in the AP-1 complex. Interestingly, DEP did not alter Jun-B and Jun-D protein levels. Transcriptional analysis revealed that fra-1 induction is regulated in part at the transcriptional level. The -379 to +32 bp 5'-flanking region mediated this induction. Furthermore, inhibitors of ERK1/2, JNK1, and p38 mitogen-activated protein kinases (MAPKs) significantly suppressed DEP-stimulated fra-1 transcription, suggesting their involvement in the induction process. Consistent with this finding, DEP stimulated phosphorylation of ERK1/2, JNK1, and p38 MAPKs with a distinct activation pattern. Overexpression of Fra-1 downregulated c-Jun and Nrf2 enhanced AP-1- and ARE-mediated reporter gene expression, respectively. In contrast, Fra-1 had the opposite effect on matrix metalloproteinase (MMP)-9 promoter activity. In particular, it bound to the functional AP-1 site of the MMP-9 promoter after DEP stimulation. Consistent with this result, DEP also markedly upregulated MMP-9 promoter activity. Collectively, these findings suggest that fra-1 induction by DEP may play a role in selectively regulating gene expression involved in alveolar epithelial cell injury and repair. PMID:14565943

  9. The promoter competition assay (PCA): a new approach to identify motifs involved in the transcriptional activity of reporter genes.


    Hube, Florent; Myal, Yvonne; Leygue, Etienne


    Identifying particular motifs responsible for promoter activity is a crucial step toward the development of new gene-based preventive and therapeutic strategies. However, to date, experimental methods to study promoter activity remain limited. We present in this report a promoter competition assay designed to identify, within a given promoter region, motifs critical for its activity. This assay consists in co-transfecting the promoter to be analyzed and double-stranded oligonucleotides which will compete for the binding of transcription factors. Using the recently characterized SBEM promoter as model, we first delineated the feasibility of the method and optimized the experimental conditions. We then identified, within an 87-bp region responsible for a strong expression of the reporter gene, an octamer-binding site essential for its transcriptional regulation. The importance of this motif has been confirmed by site-directed mutagenesis. The promoter competition assay appears to be a fast and efficient approach to identify, within a given promoter sequence, sites critical for its activity.

  10. Abscisic acid affects transcription of chloroplast genes via protein phosphatase 2C-dependent activation of nuclear genes: repression by guanosine-3'-5'-bisdiphosphate and activation by sigma factor 5.


    Yamburenko, Maria V; Zubo, Yan O; Börner, Thomas


    Abscisic acid (ABA) represses the transcriptional activity of chloroplast genes (determined by run-on assays), with the exception of psbD and a few other genes in wild-type Arabidopsis seedlings and mature rosette leaves. Abscisic acid does not influence chloroplast transcription in the mutant lines abi1-1 and abi2-1 with constitutive protein phosphatase 2C (PP2C) activity, suggesting that ABA affects chloroplast gene activity by binding to the pyrabactin resistance (PYR)/PYR1-like or regulatory component of ABA receptor protein family (PYR/PYL/RCAR) and signaling via PP2Cs and sucrose non-fermenting protein-related kinases 2 (SnRK2s). Further we show by quantitative PCR that ABA enhances the transcript levels of RSH2, RSH3, PTF1 and SIG5. RelA/SpoT homolog 2 (RSH2) and RSH3 are known to synthesize guanosine-3'-5'-bisdiphosphate (ppGpp), an inhibitor of the plastid-gene-encoded chloroplast RNA polymerase. We propose, therefore, that ABA leads to an inhibition of chloroplast gene expression via stimulation of ppGpp synthesis. On the other hand, sigma factor 5 (SIG5) and plastid transcription factor 1 (PTF1) are known to be necessary for the transcription of psbD from a specific light- and stress-induced promoter (the blue light responsive promoter, BLRP). We demonstrate that ABA activates the psbD gene by stimulation of transcription initiation at BLRP. Taken together, our data suggest that ABA affects the transcription of chloroplast genes by a PP2C-dependent activation of nuclear genes encoding proteins involved in chloroplast transcription. PMID:25976841

  11. HIF-1α and PPARγ during physiological cardiac hypertrophy induced by pregnancy: Transcriptional activities and effects on target genes.


    Soñanez-Organis, José G; Godoy-Lugo, José A; Hernández-Palomares, Magally L E; Rodríguez-Martínez, Daniel; Rosas-Rodríguez, Jesús A; González-Ochoa, Guadalupe; Virgen-Ortiz, Adolfo; Ortiz, Rudy M


    Hypoxia inducible factor 1-α (HIF-1α) and peroxisome proliferator-activated receptor γ (PPARγ) are transcription factors that activate genes involved in cellular metabolism. Physiological cardiac hypertrophy induced by pregnancy initiates compensatory changes in metabolism. However, the contributions of HIF-1α and PPARγ to this physiological status and to its reversible, metabolic process (postpartum) in the heart are not well-defined. Therefore, the aim of the present study was to evaluate the transcriptional activities of HIF-1α and PPARγ in the left ventricle of rats before, during, and after pregnancy. Furthermore, the effects of pregnancy on target genes of glycolysis and glycerol-lipid biosynthesis, key regulatory enzymes, and metabolic intermediates were evaluated. The activities of HIF-1α and PPARγ increased 1.2- and 1.6-fold, respectively, during pregnancy, and decreased to basal levels during postpartum. Expressions of mRNA for glucose transport 1 (GLUT1), enzymes of glycolysis (HK2, PFKM, and GAPDH) and glycerol-lipid biosynthesis (GPAT and GPD1) increased 1.6- to 14-fold during pregnancy and returned to basal levels postpartum. The increase in GPD1 expression translated to an increase in its activity, but such was not the case for GAPDH suggesting that post-translational regulation of these proteins is differential during pregnancy. Glycolytic (glucose, lactate, and DHAP) and glycerol-lipid biosynthesis (G3P and FFA) intermediates increased with pregnancy and were maintained postpartum. The results demonstrate that pregnancy-induced, physiological cardiac hypertrophy activates the expression of genes involved in glycolytic and glycerol-lipid biosynthesis suggesting that the shift in cardiac metabolism is mediated by the activation of HIF-1α and PPARγ.

  12. Correlating gene-specific DNA methylation changes with expression and transcriptional activity of astrocytic KCNJ10 (Kir4.1)

    PubMed Central

    Nwaobi, Sinifunanya E.; Olsen, Michelle L.


    to not only explore correlative changes between DNA methylation and gene expression, but also directly assess if changes in the DNA methylation status of a given gene region are sufficient to affect transcriptional activity. PMID:26436772

  13. Hepatic oxidative stress activates the Gadd45b gene via degradation of the transcriptional repressor STAT3

    PubMed Central

    Kim, Jung-Hwan; Qu, Aijuan; Reddy, Janardan K.; Gao, Bin; Gonzalez, Frank J.


    Growth arrest and DNA damage-inducible beta (GADD45b) plays an important role in many intracellular events, such as cell cycle arrest, DNA repair, cell survival, apoptosis and senescence. However, its mechanism of transcriptional regulation remains unclear. In this study, the mechanism of proliferator-activated receptor α (PPARα) ligand induction of the Gadd45b gene in mouse liver was investigated. Gadd45b mRNA was markedly induced by the PPARα agonist, Wy-14,643, in wild-type mice but not in Ppara-null mice. STAT3 was found to be a repressor of the Gadd45b gene through binding to upstream regulatory elements. The role of STAT3 in control of Gadd45b was confirmed using liver-specific Stat3-null mice. Wy-14,643 treatment stimulated STAT3 ubiquitination leading to activation of the Gadd45b gene as a result of loss of Gadd45b repression by STAT3. STAT3 degradation was induced by forced overexpression of the PPARα target gene-encoded enzyme ACOX1, that produces increased H2O2 as a by product of fatty acid β-oxidation. H2O2 also stimulated expression of Gadd45b in cultured cells. These studies revealed that PPARα indirectly induces the Gadd45b gene in liver through promoting degradation of the repressor STAT3 as a result of elevated oxidative stress. PMID:23939942

  14. Spirulina non-protein components induce BDNF gene transcription via HO-1 activity in C6 glioma cells.


    Morita, Kyoji; Itoh, Mari; Nishibori, Naoyoshi; Her, Song; Lee, Mi-Sook


    Blue-green algae are known to contain biologically active proteins and non-protein substances and considered as useful materials for manufacturing the nutritional supplements. Particularly, Spirulina has been reported to contain a variety of antioxidants, such as flavonoids, carotenoids, and vitamin C, thereby exerting their protective effects against the oxidative damage to the cells. In addition to their antioxidant actions, polyphenolic compounds have been speculated to cause the protection of neuronal cells and the recovery of neurologic function in the brain through the production of brain-derived neurotrophic factor (BDNF) in glial cells. Then, the protein-deprived extract was prepared by removing the most part of protein components from aqueous extract of Spirulina platensis, and the effect of this extract on BDNF gene transcription was examined in C6 glioma cells. Consequently, the protein-deprived extract was shown to cause the elevation of BDNF mRNA levels following the expression of heme oxygenase-1 (HO-1) in the glioma cells. Therefore, the non-protein components of S. platensis are considered to stimulate BDNF gene transcription through the HO-1 induction in glial cells, thus proposing a potential ability of the algae to indirectly modulate the brain function through the glial cell activity. PMID:25349086

  15. Isolation and DNA-binding characteristics of a protein involved in transcription activation of two divergently transcribed, essential yeast genes.

    PubMed Central

    Halfter, H; Müller, U; Winnacker, E L; Gallwitz, D


    We have identified a protein, BAF1, which has two oppositely oriented, partially overlapping binding sites within a symmetrical sequence located midway between and upstream of the divergently transcribed YPT1 and TUB2 genes of the yeast Saccharomyces cerevisiae. The 120 kd BAF1 protein was purified to near homogeneity and used to delineate the two binding sites and to identify apparent protein contact sites by the missing contact technique, methylation interference and by site-directed mutagenesis. The BAF1-recognition sequence contains a conserved TCN7ACG element recently identified at autonomously replicating sequences (ARS) and in the 5' and 3' flanking region of other yeast genes. The symmetrical sequence of the YPT1/TUB2 intergene region seems not to be involved in DNA replication but activates transcription in an orientation-independent fashion. Images PMID:2684633

  16. Interactions of the ubiquitous octamer-binding transcription factor-1 with both the signal transducer and activator of transcription 5 and the glucocorticoid receptor mediate prolactin and glucocorticoid-induced β-casein gene expression in mammary epithelial cells.


    Qian, Xi; Zhao, Feng-Qi


    Regulation of milk protein gene expression by lactogenic hormones (prolactin and glucocorticoids) provides an attractive model for studying the mechanisms by which protein and steroid hormones synergistically regulate gene expression. β-Casein is one of the major milk proteins and its expression in mammary epithelial cells is stimulated by lactogenic hormones. The signal transducer and activator of transcription 5 and glucocorticoid receptor are essential downstream mediators of prolactin and glucocorticoid signaling, respectively. Previous studies have shown that mutating the octamer-binding site of the β-casein gene proximal promoter dramatically reduces the hormonal induction of the promoter activity. However, little is known about the underlying molecular mechanisms. In this report, we show that lactogenic hormones rapidly induce the binding of octamer-binding transcription factor-1 to the β-casein promoter and this induction is not mediated by either increasing the expression of octamer-binding transcription factor-1 or inducing its translocation to the nucleus. Rather, lactogenic hormones induce physical interactions between the octamer-binding transcription factor-1, signal transducer and activator of transcription 5, and glucocorticoid receptor to form a ternary complex, and these interactions enhance or stabilize the binding of these transcription factors to the promoter. Abolishing these interactions significantly reduces the hormonal induction of β-casein gene transcription. Thus, our study indicates that octamer-binding transcription factor-1 may serve as a master regulator that facilitates the DNA binding of both signal transducer and activator of transcription 5 and glucocorticoid receptor in hormone-induced β-casein expression, and defines a novel mechanism of regulation of tissue-specific gene expression by the ubiquitous octamer-binding transcription factor-1.

  17. The Pioneer Transcription Factor FoxA Maintains an Accessible Nucleosome Configuration at Enhancers for Tissue-Specific Gene Activation.


    Iwafuchi-Doi, Makiko; Donahue, Greg; Kakumanu, Akshay; Watts, Jason A; Mahony, Shaun; Pugh, B Franklin; Lee, Dolim; Kaestner, Klaus H; Zaret, Kenneth S


    Nuclear DNA wraps around core histones to form nucleosomes, which restricts the binding of transcription factors to gene regulatory sequences. Pioneer transcription factors can bind DNA sites on nucleosomes and initiate gene regulatory events, often leading to the local opening of chromatin. However, the nucleosomal configuration of open chromatin and the basis for its regulation is unclear. We combined low and high levels of micrococcal nuclease (MNase) digestion along with core histone mapping to assess the nucleosomal configuration at enhancers and promoters in mouse liver. We find that MNase-accessible nucleosomes, bound by transcription factors, are retained more at liver-specific enhancers than at promoters and ubiquitous enhancers. The pioneer factor FoxA displaces linker histone H1, thereby keeping enhancer nucleosomes accessible in chromatin and allowing other liver-specific transcription factors to bind and stimulate transcription. Thus, nucleosomes are not exclusively repressive to gene regulation when they are retained with, and exposed by, pioneer factors.

  18. lasA and lasB genes of Pseudomonas aeruginosa: analysis of transcription and gene product activity.

    PubMed Central

    Toder, D S; Ferrell, S J; Nezezon, J L; Rust, L; Iglewski, B H


    The lasA gene was the first of the Pseudomonas aeruginosa genes involved in proteolysis and elastolysis to be cloned and sequenced. Its function and significance have been studied by genetic approaches (D. S. Toder, M. J. Gambello, and B. H. Iglewski, Mol. Microbiol. 5:2003-2010, 1991) and by attempts to purify an active fragment of the protein (J. E. Peters and D. R. Galloway, J. Bacteriol. 172:2236-2240, 1990). To further study LasA in vivo, we have constructed and characterized an insertional mutant in the lasA gene in strain PAO1 (PAO-A1) and in the lasB insertional mutant, PAO-B1. Analysis of these isogenic strains demonstrates that the lasA lesion diminished elastolysis more than proteolysis and that LasA is required for staphylolytic activity. Despite previous suggestions that lasB elastase cleaves the LasA protein, the size of the LasA protein was the same whether or not lasB elastase was present. Expression of lasA in a lasR-negative mutant, PAO-R1, demonstrated that the LasA protein is produced in an active form in the absence of (lasB) elastase or alkaline protease and is itself a protease with elastolytic activity. We also observed that PAO-A1 was closer to the parental phenotype, with respect to elastolytic and proteolytic activities, than the previously characterized, chemically induced lasA mutant PAO-E64. Quantification of promoter activity with lasA::lacZ and lasB::lacZ fusions suggests that PAO-E64 harbors a mutation in a gene which regulates expression of both lasA and lasB. Images PMID:8132339

  19. The Agrobacterium tumefaciens virulence protein VirE3 is a transcriptional activator of the F-box gene VBF.


    Niu, Xiaolei; Zhou, Meiliang; Henkel, Christiaan V; van Heusden, G Paul H; Hooykaas, Paul J J


    During Agrobacterium tumefaciens-mediated transformation of plant cells a part of the tumour-inducing plasmid, T-DNA, is integrated into the host genome. In addition, a number of virulence proteins are translocated into the host cell. The virulence protein VirE3 binds to the Arabidopsis thaliana pBrp protein, a plant-specific general transcription factor of the TFIIB family. To study a possible role for VirE3 in transcriptional regulation, we stably expressed virE3 in A. thaliana under control of a tamoxifen-inducible promoter. By RNA sequencing we showed that upon expression of virE3 the RNA levels of 607 genes were increased more than three-fold and those of 132 genes decreased more than three-fold. One of the strongly activated genes was that encoding VBF (At1G56250), an F-box protein that may affect the levels of the VirE2 and VIP1 proteins. Using Arabidopsis cell suspension protoplasts we showed that VirE3 stimulates the VBF promoter, especially when co-expressed with pBrp. Although pBrp is localized at the external surface of plastids, co-expression of VirE3 and pBrp in Arabidopsis cell suspension protoplasts resulted in the accumulation of pBrp in the nucleus. Our results suggest that VirE3 affects the transcriptional machinery of the host cell to favour the transformation process. PMID:26461850

  20. The Fluoroquinolone Levofloxacin Triggers the Transcriptional Activation of Iron Transport Genes That Contribute to Cell Death in Streptococcus pneumoniae

    PubMed Central

    Ferrándiz, María-José


    We studied the transcriptomic response of Streptococcus pneumoniae to levofloxacin (LVX) under conditions inhibiting topoisomerase IV but not gyrase. Although a complex transcriptomic response was observed, the most outstanding result was the upregulation of the genes of the fatDCEB operon, involved in iron (Fe2+ and Fe3+) uptake, which were the only genes varying under every condition tested. Although the inhibition of topoisomerase IV by levofloxacin did not have a detectable effect in the level of global supercoiling, increases in general supercoiling and fatD transcription were observed after topoisomerase I inhibition, while the opposite was observed after gyrase inhibition with novobiocin. Since fatDCEB is located in a topological chromosomal domain downregulated by DNA relaxation, we studied the transcription of a copy of the 422-bp (including the Pfat promoter) region located upstream of fatDCEB fused to the cat reporter inserted into the chromosome 106 kb away from its native position: PfatfatD was upregulated in the presence of LVX in its native location, whereas no change was observed in the Pfatcat construction. Results suggest that topological changes are indeed involved in PfatfatDCE transcription. Upregulation of fatDCEB would lead to an increase of intracellular iron and, in turn, to the activation of the Fenton reaction and the increase of reactive oxygen species. In accordance, we observed an attenuation of levofloxacin lethality in iron-deficient media and in a strain lacking the gene coding for SpxB, the main source of hydrogen peroxide. In addition, we observed an increase of reactive oxygen species that contributed to levofloxacin lethality. PMID:24145547

  1. DNA methylation by CcrM activates the transcription of two genes required for the division of Caulobacter crescentus.


    Gonzalez, Diego; Collier, Justine


    DNA methylation regulates many processes, including gene expression, by superimposing secondary information on DNA sequences. The conserved CcrM enzyme, which methylates adenines in GANTC sequences, is essential to the viability of several Alphaproteobacteria. In this study, we find that Caulobacter crescentus cells lacking the CcrM enzyme accumulate low levels of the two conserved FtsZ and MipZ proteins, leading to a severe defect in cell division. This defect can be compensated by the expression of the ftsZ gene from an inducible promoter or by spontaneous suppressor mutations that promote FtsZ accumulation. We show that CcrM promotes the transcription of the ftsZ and mipZ genes and that the ftsZ and mipZ promoter regions contain a conserved CGACTC motif that is critical to their activities and to their regulation by CcrM. In addition, our results suggest that the ftsZ promoter has the lowest activity when the CGACTC motif is non-methylated, an intermediate activity when it is hemi-methylated and the highest activity when it is fully methylated. The regulation of ftsZ expression by DNA methylation may explain why CcrM is essential in a subset of Alphaproteobacteria.

  2. BET Inhibition Attenuates Helicobacter pylori-Induced Inflammatory Response by Suppressing Inflammatory Gene Transcription and Enhancer Activation.


    Chen, Jinjing; Wang, Zhen; Hu, Xiangming; Chen, Ruichuan; Romero-Gallo, Judith; Peek, Richard M; Chen, Lin-Feng


    Helicobacter pylori infection causes chronic gastritis and peptic ulceration. H. pylori-initiated chronic gastritis is characterized by enhanced expression of many NF-κB-regulated inflammatory cytokines. Brd4 has emerged as an important NF-κB regulator and regulates the expression of many NF-κB-dependent inflammatory genes. In this study, we demonstrated that Brd4 was not only actively involved in H. pylori-induced inflammatory gene mRNA transcription but also H. pylori-induced inflammatory gene enhancer RNA (eRNA) synthesis. Suppression of H. pylori-induced eRNA synthesis impaired H. pylori-induced mRNA synthesis. Furthermore, H. pylori stimulated NF-κB-dependent recruitment of Brd4 to the promoters and enhancers of inflammatory genes to facilitate the RNA polymerase II-mediated eRNA and mRNA synthesis. Inhibition of Brd4 by JQ1 attenuated H. pylori-induced eRNA and mRNA synthesis for a subset of NF-κB-dependent inflammatory genes. JQ1 also inhibited H. pylori-induced interaction between Brd4 and RelA and the recruitment of Brd4 and RNA polymerase II to the promoters and enhancers of inflammatory genes. Finally, we demonstrated that JQ1 suppressed inflammatory gene expression, inflammation, and cell proliferation in H. pylori-infected mice. These studies highlight the importance of Brd4 in H. pylori-induced inflammatory gene expression and suggest that Brd4 could be a potential therapeutic target for the treatment of H. pylori-triggered inflammatory diseases and cancer. PMID:27084101

  3. Efficient Gene Editing in Pluripotent Stem Cells by Bacterial Injection of Transcription Activator-Like Effector Nuclease Proteins

    PubMed Central

    Jia, Jingyue; Bai, Fang; Jin, Yongxin; Santostefano, Katherine E.; Ha, Un-Hwan; Wu, Donghai


    The type III secretion system (T3SS) of Pseudomonas aeruginosa is a powerful tool for direct protein delivery into mammalian cells and has successfully been used to deliver various exogenous proteins into mammalian cells. In the present study, transcription activator-like effector nuclease (TALEN) proteins have been efficiently delivered using the P. aeruginosa T3SS into mouse embryonic stem cells (mESCs), human ESCs (hESCs), and human induced pluripotent stem cells (hiPSCs) for genome editing. This bacterial delivery system offers an alternative method of TALEN delivery that is highly efficient in cleavage of the chromosomal target and presumably safer by avoiding plasmid DNA introduction. We combined the method of bacterial T3SS-mediated TALEN protein injection and transfection of an oligonucleotide template to effectively generate precise genetic modifications in the stem cells. Initially, we efficiently edited a single-base in the gfp gene of a mESC line to silence green fluorescent protein (GFP) production. The resulting GFP-negative mESC was cloned from a single cell and subsequently mutated back to a GFP-positive mESC line. Using the same approach, the gfp gene was also effectively knocked out in hESCs. In addition, a defined single-base edition was effectively introduced into the X-chromosome-linked HPRT1 gene in hiPSCs, generating an in vitro model of Lesch-Nyhan syndrome. T3SS-mediated TALEN protein delivery provides a highly efficient alternative for introducing precise gene editing within pluripotent stem cells for the purpose of disease genotype-phenotype relationship studies and cellular replacement therapies. Significance The present study describes a novel and powerful tool for the delivery of the genome editing enzyme transcription activator-like effector nuclease (TALEN) directly into pluripotent stem cells (PSCs), achieving desired base changes on the genomes of PSCs with high efficiency. This novel approach uses bacteria as a protein delivery

  4. Unique role of SRSF2 in transcription activation and diverse functions of the SR and hnRNP proteins in gene expression regulation.


    Mo, Sudong; Ji, Xiong; Fu, Xiang-Dong


    Transcription pause release from gene promoters has been recognized to be a critical point for transcriptional regulation in higher eukaryotes. Recent studies suggest that regulatory RNAs are extensively involved in transcriptional control, which may enlist various RNA binding proteins. We recently showed a key role of SRSF2, a member of the SR family of splicing regulators, in binding to promoter-associated small RNA to mediate transcription pause release, a regulatory strategy akin to the function of the HIV Tat protein via binding to the TAR element in nascent RNA to activate transcription. In this report, we further dissect the structural requirement for SRSF2 to function as a transcription activator and extend the analysis to multiple SR and hnRNP proteins by using the MS2 tethering strategy. Our results reveal that SRSF2 is a unique SR protein that activates transcription in a position-dependent manner while three other SR proteins enhance translation in a position-independent fashion. In contrast, multiple hnRNP proteins appear to negatively influence mRNA levels, especially when tethered in the gene body. These findings suggest broad participation of RNA binding proteins in diverse aspects of regulated gene expression at both the transcriptional and posttranscriptional levels in mammalian cells.

  5. Archaeal amoA and ureC genes and their transcriptional activity in the Arctic Ocean.


    Pedneault, Estelle; Galand, Pierre E; Potvin, Marianne; Tremblay, Jean-Éric; Lovejoy, Connie


    Thaumarchaeota and the gene encoding for a subunit of ammonia monooxygenase (amoA) are ubiquitous in Polar Seas, and some Thaumarchaeota also have a gene coding for ureC, diagnostic for urease. Using quantitative PCR we investigated the occurrence of genes and transcripts of ureC and amoA in Arctic samples from winter, spring and summer. AmoA genes, ureC genes and amoA transcripts were always present, but ureC transcripts were rarely detected. Over a 48 h light manipulation experiment amoA transcripts persisted under light and dark conditions, but not ureC transcripts. In addition, maxima for amoA transcript were nearer the surface compared to amoA genes. Clone libraries using DNA template recovered shallow and deep amoA clades but only the shallow clade was recovered from cDNA (from RNA). These results imply environmental control of amoA expression with direct or indirect light effects, and rare ureC expression despite its widespread occurrence in the Arctic Ocean.

  6. Archaeal amoA and ureC genes and their transcriptional activity in the Arctic Ocean

    PubMed Central

    Pedneault, Estelle; Galand, Pierre E.; Potvin, Marianne; Tremblay, Jean-Éric; Lovejoy, Connie


    Thaumarchaeota and the gene encoding for a subunit of ammonia monooxygenase (amoA) are ubiquitous in Polar Seas, and some Thaumarchaeota also have a gene coding for ureC, diagnostic for urease. Using quantitative PCR we investigated the occurrence of genes and transcripts of ureC and amoA in Arctic samples from winter, spring and summer. AmoA genes, ureC genes and amoA transcripts were always present, but ureC transcripts were rarely detected. Over a 48 h light manipulation experiment amoA transcripts persisted under light and dark conditions, but not ureC transcripts. In addition, maxima for amoA transcript were nearer the surface compared to amoA genes. Clone libraries using DNA template recovered shallow and deep amoA clades but only the shallow clade was recovered from cDNA (from RNA). These results imply environmental control of amoA expression with direct or indirect light effects, and rare ureC expression despite its widespread occurrence in the Arctic Ocean. PMID:24722490

  7. Trans-activation of transcription, from promoters containing immunoglobulin gene octamer sequences, by myeloma cell mRNA in Xenopus oocytes.

    PubMed Central

    Sweeney, G E; Old, R W


    To study factors required for immunoglobulin gene transcription hybrid promoters were made by linking octamer elements to a Xenopus albumin gene construct containing only 50bp of the albumin gene promoter. When injected into oocytes these hybrid promoters directed transcription far less efficiently than the unmodified 50bp albumin gene promoter fragment. Activity of the hybrid promoter, but not the unmodified albumin promoter, could be stimulated by preinjection of poly(A)+ RNA from NS1 myeloma cells. This stimulation may be caused by translation of the NS1 poly(A)+ RNA into transcription factors that act on the octamer. Both the reduction in transcription caused by octamer insertion and the extent of the inducibility by NS1 RNA are greater when two, rather than one, octamers are inserted. Images PMID:2898754

  8. VID22 is required for transcriptional activation of the PSD2 gene in the yeast Saccharomyces cerevisiae.


    Miyata, Non; Miyoshi, Takuya; Yamaguchi, Takanori; Nakazono, Toshimitsu; Tani, Motohiro; Kuge, Osamu


    Phosphatidylethanolamine (PE) in the yeast Saccharomyces cerevisiae is synthesized through decarboxylation of phosphatidylserine (PS), catalysed by PS decarboxylase 1 (Psd1p) and 2 (Psd2p) and the cytidine 5'-diphosphate (CDP)-ethanolamine (CDP-Etn) pathway. PSD1 null (psd1Δ) and PSD2 null (psd2Δ) mutants are viable in a synthetic minimal medium, but a psd1Δ psd2Δ double mutant exhibits Etn auxotrophy, which is incorporated into PE through the CDP-Etn pathway. We have previously shown that psd1Δ is synthetic lethal with deletion of VID22 (vid22Δ) [Kuroda et al. (2011) Mol. Microbiol. 80: , 248-265]. In the present study, we found that vid22Δ mutant exhibits Etn auxotrophy under PSD1-depressed conditions. Deletion of VID22 in wild-type and PSD1-depressed cells caused partial defects in PE formation through decarboxylation of PS. The enzyme activity of PS decarboxylase in an extract of vid22Δ cells was ∼70% of that in wild-type cells and similar to that in psd2Δ cells and the PS decarboxylase activity remaining in the PSD1-depressed cells became almost negligible with deletion of VID22. Thus, the vid22Δ mutation was suggested to cause a defect in the Psd2p activity. Furthermore, vid22Δ cells were shown to be defective in expression of the PSD2 gene tagged with 6×HA, the defect being ameliorated by replacement of the native promoter of the PSD2 gene with a CYC1 promoter. In addition, an α-galactosidase reporter assay revealed that the activity of the promoter of the PSD2 gene in vid22Δ cells was ∼5% of that in wild-type cells. These results showed that VID22 is required for transcriptional activation of the PSD2 gene.

  9. Transcriptional reporters for genes activated by cell wall stress through a non-catalytic mechanism involving Mpk1 and SBF

    PubMed Central

    Kim, Ki-Young; Levin, David E.


    The Mpk1 MAP kinase of the Cell Wall Integrity (CWI) signaling pathway induces transcription of the FKS2 gene in response to cell wall stress through a non-catalytic mechanism that involves stable association of Mpk1 with the Swi4 transcription factor. This dimeric complex binds to a Swi4 recognition site in the FKS2 promoter. The Swi6 transcription factor is also required to bind this ternary complex for transcription initiation to ensue. In this context, the Mlp1 pseudokinase serves a redundant function with Mpk1. We have identified three additional genes, CHA1, YLR042c, and YKR013w that are induced by cell wall stress through the same mechanism. We report on the behavior of several promoter-lacZ reporter plasmids designed to detect cell wall stress transcription through this pathway. PMID:20641022

  10. A novel c-Jun-dependent signal transduction pathway necessary for the transcriptional activation of interferon gamma response genes.


    Gough, Daniel J; Sabapathy, Kanaga; Ko, Enoch Yi-No; Arthur, Helen A; Schreiber, Robert D; Trapani, Joseph A; Clarke, Christopher J P; Johnstone, Ricky W


    The biological effects of interferon gamma (IFNgamma) are mediated by interferon-stimulated genes (ISGs), many of which are activated downstream of Janus kinase (JAK)/signal transducer and activator of transcription 1 (STAT1) signaling. Herein we have shown that IFNgamma rapidly activated AP-1 DNA binding that required c-Jun but was independent of JAK1 and STAT1. IFNgamma-induced c-Jun phosphorylation and AP-1 DNA binding required the MEK1/2 and ERK1/2 signaling pathways, whereas the JNK1/2 and p38 mitogen-activated protein kinase pathways were dispensable. The induction of several ISGs, including ifi-205 and iNOS, was impaired in IFNgamma-treated c-Jun-/- cells, but others, such as IP-10 and SOCS3, were unaffected, and chromatin immunoprecipitation demonstrated that c-Jun binds to the iNOS promoter following treatment with IFNgamma. Thus, IFNgamma induced JAK1- and STAT1-independent activation of the ERK mitogen-activated protein kinase pathway, phosphorylation of c-Jun, and activation of AP-1 DNA binding, which are important for the induction of a subset of ISGs. This represents a novel signal transduction pathway induced by IFNgamma that proceeds in parallel with conventional JAK/STAT signaling to activate ISGs.

  11. A novel c-Jun-dependent signal transduction pathway necessary for the transcriptional activation of interferon gamma response genes.


    Gough, Daniel J; Sabapathy, Kanaga; Ko, Enoch Yi-No; Arthur, Helen A; Schreiber, Robert D; Trapani, Joseph A; Clarke, Christopher J P; Johnstone, Ricky W


    The biological effects of interferon gamma (IFNgamma) are mediated by interferon-stimulated genes (ISGs), many of which are activated downstream of Janus kinase (JAK)/signal transducer and activator of transcription 1 (STAT1) signaling. Herein we have shown that IFNgamma rapidly activated AP-1 DNA binding that required c-Jun but was independent of JAK1 and STAT1. IFNgamma-induced c-Jun phosphorylation and AP-1 DNA binding required the MEK1/2 and ERK1/2 signaling pathways, whereas the JNK1/2 and p38 mitogen-activated protein kinase pathways were dispensable. The induction of several ISGs, including ifi-205 and iNOS, was impaired in IFNgamma-treated c-Jun-/- cells, but others, such as IP-10 and SOCS3, were unaffected, and chromatin immunoprecipitation demonstrated that c-Jun binds to the iNOS promoter following treatment with IFNgamma. Thus, IFNgamma induced JAK1- and STAT1-independent activation of the ERK mitogen-activated protein kinase pathway, phosphorylation of c-Jun, and activation of AP-1 DNA binding, which are important for the induction of a subset of ISGs. This represents a novel signal transduction pathway induced by IFNgamma that proceeds in parallel with conventional JAK/STAT signaling to activate ISGs. PMID:17105733

  12. Angiotensinogen Gene Transcription in Pulmonary Fibrosis

    PubMed Central

    Uhal, Bruce D.; Dang, My-Trang T.; Li, Xiaopeng; Abdul-Hafez, Amal


    An established body of literature supports the hypothesis that activation of a local tissue angiotensin (ANG) system in the extravascular tissue compartment of the lungs is required for lung fibrogenesis. Transcriptional activation of the angiotensinogen (AGT) gene is believed to be a critical and necessary step in this activation. This paper summarizes the data in support of this theory and discusses transcriptional regulation of AGT, with an emphasis on lung AGT synthesis as a determinant of fibrosis severity. Genetic data linking AGT polymorphisms to the severity of disease in Idiopathic Pulmonary Fibrosis are also discussed. PMID:22500179

  13. Targeted Ablation Reveals a Novel Role of FKBP52 in Gene-Specific Regulation of Glucocorticoid Receptor Transcriptional Activity

    PubMed Central

    Wolf, Irene M.; Periyasamy, Sumudra; Hinds, Terry; Yong, Weidong; Shou, Weinian; Sanchez, Edwin R.


    FKBP52 is a tetratricopeptide repeat (TPR) protein with peptidyl-prolyl isomerase activity and is found in steroid receptor complexes, including glucocorticoid receptor (GR). It is generally accepted that FKBP52 has a stimulatory effect on GR transcriptional activity. However, the mechanism by which FKBP52 controls GR is not yet clear, with reports showing effects on GR hormone-binding affinity and/or hormone-induced nuclear translocation. To address this issue, we have generated mice with targeted ablation of the FKBP52 gene. To date, no overt defects of GR-regulated physiology have been found in these animals, demonstrating that FKBP52 is not an essential regulator of global GR activity. To better assess the impact of FKBP52 on GR, mouse embryonic fibroblasts (MEFs) were generated from wild-type (WT) and FKBP52-deficient (KO) animals. Analysis of GR activity at reporter genes showed an approximate 70% reduction of activity in 52KO MEF cells, with no effect of FKBP52 loss on thyroid receptor. Interestingly, GR activity at endogenous genes was not globally affected in 52KO cells, with reduced activity at GILZ and FKBP51, but not at SGK and p21. Thus, FKBP52 appears to be a gene-specific modulator of GR. To investigate the mechanism of this action, analyses of GR heterocomplex composition, hormone-binding affinity, and ability to undergo hormone-induced nuclear translocation and DNA-binding were performed. Interestingly, no effect of FKBP52 loss was found for any of these GR properties, suggesting that the main function of FKBP52 is a heretofore-unknown ability to control GR activity at target genes. Lastly, loss of FKBP52 did not affect the ability of GR to undergo hormone-induced autologous down-regulation, showing that FKBP52 does not contribute to all branches of GR signaling. The implications of these results to the potential actions of FKBP52 on GR activity in vivo are discussed. PMID:19073255

  14. Riboactivators: transcription activation by noncoding RNA.


    Ansari, Aseem Z


    The paradigm of gene regulation was forever changed by the discovery that short RNA duplexes could directly regulate gene expression. Most regulatory roles attributed to noncoding RNA were often repressive. Recent observations are beginning to reveal that duplex RNA molecules can stimulate gene transcription. These RNA activators employ a wide array of mechanisms to up-regulate transcription of target genes, including functioning as DNA-tethered activation domains, as coactivators and modulators of general transcriptional machinery, and as regulators of other noncoding transcripts. The discoveries over the past few years defy "Moore's law" in the breath-taking rapidity with which new roles for noncoding RNA in gene expression are being revealed. As gene regulatory networks are reconstructed to accommodate the influence of noncoding RNAs, their importance in maintenance of cellular health will become increasingly apparent. In fact, a new generation of therapeutic agents will focus on modulating the function of noncoding RNA.

  15. A WRKY transcription factor recruits the SYG1-like protein SHB1 to activate gene expression and seed cavity enlargement.


    Kang, Xiaojun; Li, Wei; Zhou, Yun; Ni, Min


    Seed development in Arabidopsis and in many dicots involves an early proliferation of the endosperm to form a large embryo sac or seed cavity close to the size of the mature seed, followed by a second phase during which the embryo grows and replaces the endosperm. Short hypocotyl under BLUE1 (SHB1) is a member of the SYG1 protein family in fungi, Caenorhabditis elegans, flies, and mammals. SHB1 gain-of-function enhances endosperm proliferation, increases seed size, and up-regulates the expression of the WRKY transcription factor gene MINISEED3 (MINI3) and the LRR receptor kinase gene HAIKU2 (IKU2). Mutations in either IKU2 or MINI3 retard endosperm proliferation and reduce seed size. However, the molecular mechanisms underlying the establishment of the seed cavity and hence the seed size remain largely unknown. Here, we show that the expression of MINI3 and IKU2 is repressed before fertilization and after 4 days after pollination (DAP), but is activated by SHB1 from 2 to 4 DAP prior to the formation of the seed cavity. SHB1 associates with their promoters but without a recognizable DNA binding motif, and this association is abolished in mini3 mutant. MINI3 binds to W-boxes in, and recruits SHB1 to, its own and IKU2 promoters. Interestingly, SHB1, but not MINI3, activates transcription of pMINI3::GUS or pIKU2::GUS. We reveal a critical developmental switch through the activation of MINI3 expression by SHB1. The recruitment of SHB1 by MINI3 to its own and IKU2 promoters represents a novel two-step amplification to counter the low expression level of IKU2, which is a trigger for endosperm proliferation and seed cavity enlargement. PMID:23505389

  16. Core promoter-specific gene regulation: TATA box selectivity and Initiator-dependent bi-directionality of serum response factor-activated transcription.


    Xu, Muyu; Gonzalez-Hurtado, Elsie; Martinez, Ernest


    Gene-specific activation by enhancers involves their communication with the basal RNA polymerase II transcription machinery at the core promoter. Core promoters are diverse and may contain a variety of sequence elements such as the TATA box, the Initiator (INR), and the downstream promoter element (DPE) recognized, respectively, by the TATA-binding protein (TBP) and TBP-associated factors of the TFIID complex. Core promoter elements contribute to the gene selectivity of enhancers, and INR/DPE-specific enhancers and activators have been identified. Here, we identify a TATA box-selective activating sequence upstream of the human β-actin (ACTB) gene that mediates serum response factor (SRF)-induced transcription from TATA-dependent but not INR-dependent promoters and requires the TATA-binding/bending activity of TBP, which is otherwise dispensable for transcription from a TATA-less promoter. The SRF-dependent ACTB sequence is stereospecific on TATA promoters but activates in an orientation-independent manner a composite TATA/INR-containing promoter. More generally, we show that SRF-regulated genes of the actin/cytoskeleton/contractile family tend to have a TATA box. These results suggest distinct TATA-dependent and INR-dependent mechanisms of TFIID-mediated transcription in mammalian cells that are compatible with only certain stereospecific combinations of activators, and that a TBP-TATA binding mechanism is important for SRF activation of the actin/cytoskeleton-related gene family.

  17. The Mediator Complex MED15 Subunit Mediates Activation of Downstream Lipid-Related Genes by the WRINKLED1 Transcription Factor1[OPEN

    PubMed Central

    Kim, Mi Jung


    The Mediator complex is known to be a master coordinator of transcription by RNA polymerase II, and this complex is recruited by transcription factors (TFs) to target promoters for gene activation or repression. The plant-specific TF WRINKLED1 (WRI1) activates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. However, no Mediator subunit has yet been identified that mediates WRI1 transcriptional activity. Promoter-β-glucuronidase fusion experiments showed that MEDIATOR15 (MED15) is expressed in the same cells in the embryo as WRI1. We found that the Arabidopsis (Arabidopsis thaliana) MED15 subunit of the Mediator complex interacts directly with WRI1 in the nucleus. Overexpression of MED15 or WRI1 increased transcript levels of WRI1 target genes involved in glycolysis and fatty acid biosynthesis; these genes were down-regulated in wild-type or WRI1-overexpressing plants by silencing of MED15. However, overexpression of MED15 in the wri1 mutant also increased transcript levels of WRI1 target genes, suggesting that MED15 also may act with other TFs to activate downstream lipid-related genes. Chromatin immunoprecipitation assays confirmed the association of MED15 with six WRI1 target gene promoters. Additionally, silencing of MED15 resulted in reduced fatty acid content in seedlings and mature seeds, whereas MED15 overexpression increased fatty acid content in both developmental stages. Similar results were found in wri1 mutant and WRI1 overexpression lines. Together, our results indicate that the WRI1/MED15 complex transcriptionally regulates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. PMID:27246098

  18. Multiple forms of the human gene-specific transcription factor USF. II. DNA binding properties and transcriptional activity of the purified HeLa USF.


    Sawadogo, M


    The gene-specific upstream stimulatory transcription factor (USF) is required for maximal expression of the adenovirus major late promoter in vivo as well as in vitro. We have examined the DNA binding and transcriptional properties of USF purified to near-homogeneity from HeLa cell nuclei (Sawadogo, M., Van Dyke, M. W., Gregor, P. D., and Roeder, R. G. (1988) J. Biol. Chem. 263, 11985-11993). The 44-and 43,000-dalton forms of USF displayed identical affinities for the major late promoter upstream sequence. Specific binding parameters were greatly influenced by neighboring sequences, but not by the topological state of the DNA. The dissociation rate was highly dependent upon the concentration of competitor DNA, indicating that USF can efficiently transfer from one binding site to another by passing through a doubly bound intermediate state (direct transfer mechanism). Transcription stimulation by purified USF showed titration curves identical to those observed with cruder preparations of the transcription factor. However, the overall stimulation observed at saturating USF concentration was significantly lower with the purified protein. By contrast, interaction with TATA box-binding RNA polymerase II transcription factor D was observed with both USF-containing fractions. This could suggest the existence of two different mechanisms for upstream sequence-dependent transcription stimulation, where one critical component (or some necessary modification of the upstream factor itself) may be missing in reactions reconstituted with purified USF.

  19. Genetic diversity of transcriptional activator-like effector genes in Chinese isolates of Xanthomonas oryzae pv. oryzicola.


    Ji, Zhi-Yuan; Zakria, Muhammad; Zou, Li-Fang; Xiong, Li; Li, Zheng; Ji, Guang-Hai; Chen, Gong-You


    Xanthomonas oryzae pv. oryzicola causes bacterial leaf streak (BLS), a devastating disease of rice in Asia countries. X. oryzae pv. oryzicola utilizes repertoires of transcriptional activator-like effectors (TALEs) to manipulate host resistance or susceptibility; thus, TALEs can determine the outcome of BLS. In this report, we studied genetic diversity in putative tale genes of 65 X. oryzae pv. oryzicola strains that originated from nine provinces of southern China. Genomic DNAs from the 65 strains were digested with BamHI and hybridized with an internal fragment of avrXa3, a tale gene originating from the related pathogen, X. oryzae pv. oryzae, which causes bacterial leaf blight (BLB). Southern blot analysis indicated that the strains contained a variable number (9 to 22) of avrXa3-hybridizing fragments (e.g., putative tale genes). Based on the number and size of hybridizing bands, strains were classified into 14 genotypes (designated 1 to 14), and genotypes 3 and 10 represented 29.23 and 24.64% of the total, respectively. A high molecular weight BamHI fragment (HMWB; ≈6.0 kb) was present in 12 of the 14 genotypes, and sequence analysis of the HMWB revealed the presence of a C-terminally truncated tale, an insertion element related to IS1403, and genes encoding phosphoglycerate mutase and endonuclease V. Primers were developed from the 6.0-kb HMWB fragment and showed potential in genotyping X. oryzae pv. oryzicola strains by polymerase chain reaction. Virulence of X. oryzae pv. oryzicola strains was assessed on 23 rice cultivars containing different resistance genes for BLB. The X. oryzae pv. oryzicola strains could be grouped into 14 pathotypes (I to XIV), and the grouping of strains was almost identical to the categories determined by genotypic analysis. In general, strains containing higher numbers of putative tale genes were more virulent on rice than strains containing fewer tales. The results also indicate that there are no gene-for-gene relationships

  20. Mitotic Transcriptional Activation: Clearance of Actively Engaged Pol II via Transcriptional Elongation Control in Mitosis.


    Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali


    Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division.

  1. Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    NASA Astrophysics Data System (ADS)

    Huang, Yong-Zhen; Zhang, Liang-Zhi; Lai, Xin-Sheng; Li, Ming-Xun; Sun, Yu-Jia; Li, Cong-Jun; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Zhao, Xin; Chen, Hong


    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were upregulated during C2C12 differentiation. The IGF2 expression levels were negatively associated with the methylation status in beef cattle (P < 0.05). A luciferase assay for the IGF2 intron 3 and P3 promoter showed that the mutant-type 439 A-SNP-pGL3 in driving reporter gene transcription is significantly higher than that of the wild-type 439 G-SNP-pGL3 construct (P < 0.05). An over-expression assay revealed that ZBED6 regulate IGF2 expression and promote myoblast differentiation. Furthermore, knockdown of ZBED6 led to IGF2 expression change in vitro. Taken together, these results suggest that ZBED6 inhibits IGF2 activity and expression via a G to A transition disrupts the interaction. Thus, we propose that ZBED6 plays a critical role in myogenic differentiation.

  2. Transcriptional interference among the murine β-like globin genes

    PubMed Central

    Hu, Xiao; Eszterhas, Susan; Pallazzi, Nicolas; Bouhassira, Eric E.; Fields, Jennifer; Tanabe, Osamu; Gerber, Scott A.; Bulger, Michael; Engel, James Douglas; Groudine, Mark


    Mammalian β-globin loci contain multiple genes that are activated at different developmental stages. Studies have suggested that the transcription of one gene in a locus can influence the expression of the other locus genes. The prevalent model to explain this transcriptional interference is that all potentially active genes compete for locus control region (LCR) activity. To investigate the influence of transcription by the murine embryonic genes on transcription of the other β-like genes, we generated mice with deletions of the promoter regions of Ey and βh1 and measured transcription of the remaining genes. Deletion of the Ey and βh1 promoters increased transcription of βmajor and βminor 2-fold to 3-fold during primitive erythropoiesis. Deletion of Ey did not affect βh1 nor did deletion of βh1 affect Ey, but Ey deletion uniquely activated transcription from βh0, a β-like globin gene immediately downstream of Ey. Protein analysis showed that βh0 encodes a translatable β-like globin protein that can pair with alpha globin. The lack of transcriptional interference between Ey and βh1 and the gene-specific repression of βh0 did not support LCR competition among the embryonic genes and suggested that direct transcriptional interference from Ey suppressed βh0. PMID:17077320

  3. Single Cell Analysis of Transcriptional Activation Dynamics

    PubMed Central

    Rafalska-Metcalf, Ilona U.; Powers, Sara Lawrence; Joo, Lucy M.; LeRoy, Gary; Janicki, Susan M.


    Background Gene activation is thought to occur through a series of temporally defined regulatory steps. However, this process has not been completely evaluated in single living mammalian cells. Methodology/Principal Findings To investigate the timing and coordination of gene activation events, we tracked the recruitment of GCN5 (histone acetyltransferase), RNA polymerase II, Brd2 and Brd4 (acetyl-lysine binding proteins), in relation to a VP16-transcriptional activator, to a transcription site that can be visualized in single living cells. All accumulated rapidly with the VP16 activator as did the transcribed RNA. RNA was also detected at significantly more transcription sites in cells expressing the VP16-activator compared to a p53-activator. After α-amanitin pre-treatment, the VP16-activator, GCN5, and Brd2 are still recruited to the transcription site but the chromatin does not decondense. Conclusions/Significance This study demonstrates that a strong activator can rapidly overcome the condensed chromatin structure of an inactive transcription site and supercede the expected requirement for regulatory events to proceed in a temporally defined order. Additionally, activator strength determines the number of cells in which transcription is induced as well as the extent of chromatin decondensation. As chromatin decondensation is significantly reduced after α-amanitin pre-treatment, despite the recruitment of transcriptional activation factors, this provides further evidence that transcription drives large-scale chromatin decondensation. PMID:20422051

  4. Cooperative Transcriptional Activation of Antimicrobial Genes by STAT and NF-κB Pathways by Concerted Recruitment of the Mediator Complex

    PubMed Central

    Wienerroither, Sebastian; Shukla, Priyank; Farlik, Matthias; Majoros, Andrea; Stych, Bernadette; Vogl, Claus; Cheon, HyeonJoo; Stark, George R.; Strobl, Birgit; Müller, Mathias; Decker, Thomas


    Summary The transcriptional response to infection with the bacterium Listeria monocytogenes (Lm) requires cooperative signals of the type I interferon (IFN-I)-stimulated JAK-STAT and proinflammatory NF-κB pathways. Using ChIP-seq analysis, we define genes induced in Lm-infected macrophages through synergistic transcriptional activation by NF-κB and the IFN-I-activated transcription factor ISGF3. Using the Nos2 and IL6 genes as prime examples of this group, we show that NF-κB functions to recruit enzymes that establish histone marks of transcriptionally active genes. In addition, NF-κB regulates transcriptional elongation by employing the mediator kinase module for the recruitment of the pTEFb complex. ISGF3 has a major role in associating the core mediator with the transcription start as a prerequisite for TFIID and RNA polymerase II (Pol II) binding. Our data suggest that the functional cooperation between two major antimicrobial pathways is based on promoter priming by NF-κB and the engagement of the core mediator for Pol II binding by ISGF3. PMID:26146080

  5. PPARalpha and PPARgamma activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene.

    PubMed Central

    Schoonjans, K; Peinado-Onsurbe, J; Lefebvre, A M; Heyman, R A; Briggs, M; Deeb, S; Staels, B; Auwerx, J


    Increased activity of lipoprotein lipase (LPL) may explain the hypotriglyceridemic effects of fibrates, thiazolidinediones and fatty acids, which are known activators (and/or ligands) of the various peroxisome proliferator-activated receptors (PPARs). Treatment with compounds which activate preferentially PPARalpha, such as fenofibrate, induced LPL expression exclusively in rat liver. In contrast, the antidiabetic thiazolidinedione BRL 49653, a high affinity ligand for PPARgamma, had no effect on liver, but induced LPL expression in rat adipose tissue. In the hepatocyte cell line AML-12, fenofibric acid, but not BRL 49653, induced LPL mRNA, whereas in 3T3-L1 preadipocytes, the PPARgamma ligand induced LPL mRNA levels much quicker and to a higher extent than fenofibric acid. In both the in vivo and in vitro studies, inducibility by either PPARalpha or gamma activators, correlated with the tissue distribution of the respective PPARs: an adipocyte-restricted expression of PPARgamma, whereas PPARalpha was expressed predominantly in liver. A sequence element was identified in the human LPL promoter that mediates the functional responsiveness to fibrates and thiazolidinediones. Methylation interference and gel retardation assays demonstrated that a PPARalpha or gamma and the 9-cis retinoic acid receptor (RXR) heterodimers bind to this sequence -169 TGCCCTTTCCCCC -157. These data provide evidence that transcriptional activation of the LPL gene by fibrates and thiazolidinediones is mediated by PPAR-RXR heterodimers and contributes significantly to their hypotriglyceridemic effects in vivo. Whereas thiazolidinediones predominantly affect adipocyte LPL production through activation of PPARgamma, fibrates exert their effects mainly in the liver via activation of PPARalpha. Images PMID:8895578

  6. The sensitivity of Cockayne's syndrome cells to DNA-damaging agents is not due to defective transcription-coupled repair of active genes.


    van Oosterwijk, M F; Versteeg, A; Filon, R; van Zeeland, A A; Mullenders, L H


    Two of the hallmarks of Cockayne's syndrome (CS) are the hypersensitivity of cells to UV light and the lack of recovery of the ability to synthesize RNA following exposure of cells to UV light, in spite of the normal repair capacity at the overall genome level. The prolonged repressed RNA synthesis has been attributed to a defect in transcription-coupled repair, resulting in slow removal of DNA lesions from the transcribed strand of active genes. This model predicts that the sensitivity of CS cells to another DNA-damaging agent, i.e., the UV-mimetic agent N-acetoxy-2-acetylaminofluorene (NA-AAF), should also be associated with a lack of resumption of RNA synthesis and defective transcription-coupled repair of NA-AAF-induced DNA adducts. We tested this by measuring the rate of excision of DNA adducts in the adenosine deaminase gene of primary normal human fibroblasts and two CS (complementation group A and B) fibroblast strains. High-performance liquid chromatography analysis of DNA adducts revealed that N-(deoxyguanosin-8-yl)-2-aminofluorene (dG-C8-AF) was the main adduct induced by NA-AAF in both normal and CS cells. No differences were found between normal and CS cells with respect to induction of this lesion either at the level of the genome overall or at the gene level. Moreover, repair of dG-C8-AF in the active adenosine deaminase gene occurred at similar rates and without strand specificity in normal and CS cells, indicating that transcription-coupled repair does not contribute significantly to repair of dG-C8-AF in active genes. Yet CS cells are threefold more sensitive to NA-AAF than are normal cells and are unable to recover the ability to synthesize RNA. Our data rule out defective transcription-coupled repair as the cause of the increased sensitivity of CS cells to DNA-damaging agents and suggest that the cellular sensitivity and the prolonged repressed RNA synthesis are primarily due to a transcription defect. We hypothesize that upon treatment of cells

  7. Phorate-induced oxidative stress, DNA damage and transcriptional activation of p53 and caspase genes in male Wistar rats

    SciTech Connect

    Saquib, Quaiser; Attia, Sabry M.; Siddiqui, Maqsood A.; Aboul-Soud, Mourad A.M.; Al-Khedhairy, Abdulaziz A.; Giesy, John P.; Musarrat, Javed


    Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G{sub 2}/M arrest and appearance of a distinctive SubG{sub 1} peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced

  8. Transcript levels of antioxidative genes and oxygen radical scavenging enzyme activities in chilled zucchini squash in response to superatmospheric oxygen

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The transcript levels of antioxidative genes including Mn-superoxide dismutase (Mn-SOD), Cu/Zn SOD, ascorbate peroxidise (APX), and catalase (CAT) do not vary significantly during storage at 5 °C with high oxygen treatment in freshly harvested zucchini squash (Cucurbita pepo L. cv. Elite). However, ...

  9. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    PubMed Central

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook


    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  10. TcpH influences virulence gene expression in Vibrio cholerae by inhibiting degradation of the transcription activator TcpP.


    Beck, Nancy A; Krukonis, Eric S; DiRita, Victor J


    Expression of toxT, the transcription activator of cholera toxin and pilus production in Vibrio cholerae, is the consequence of a complex cascade of regulatory events that culminates in activation of the toxT promoter by TcpP and ToxR, two membrane-localized transcription factors. Both are encoded in operons with genes whose products, TcpH and ToxS, which are also membrane localized, are hypothesized to control their activity. In this study we analyzed the role of TcpH in controlling TcpP function. We show that a mutant of V. cholerae lacking TcpH expressed virtually undetectable levels of TcpP, although tcpP mRNA levels remain unaffected. A time course experiment showed that levels of TcpP, expressed from a plasmid, are dramatically reduced over time without co-overexpression of TcpH. By contrast, deletion of toxS did not affect ToxR protein levels. A fusion protein in which the TcpP periplasmic domain is replaced with that of ToxR remains stable, suggesting that the periplasmic domain of TcpP is the target for degradation of the protein. Placement of the periplasmic domain of TcpP on ToxR, an otherwise stable protein, results in instability, providing further evidence for the hypothesis that the periplasmic domain of TcpP is a target for degradation. Consistent with this interpretation is our finding that derivatives of TcpP lacking a periplasmic domain are more stable in V. cholerae than are derivatives in which the periplasmic domain has been truncated. This work identifies at least one role for the periplasmic domain of TcpP, i.e., to act as a target for a protein degradation pathway that regulates TcpP levels. It also provides a rationale for why the V. cholerae tcpH mutant strain is avirulent. We hypothesize that regulator degradation may be an important mechanism for regulating virulence gene expression in V. cholerae. PMID:15576780

  11. Specific Association of Transcripts of tbzF and tbz17, Tobacco Genes Encoding Basic Region Leucine Zipper-Type Transcriptional Activators, with Guard Cells of Senescing Leaves and/or Flowers1

    PubMed Central

    Yang, Seung Hwan; Berberich, Thomas; Sano, Hiroshi; Kusano, Tomonobu


    Induction by low temperature is a common feature of the lip19 subfamily members of the basic region leucine zipper gene family in plants. Here, we characterize two tobacco (Nicotiana tabacum) genes, tbzF and tbz17, belonging to the lip19 subfamily, whose gene products, TBZF and TBZ17, show 73% identity and are located in nuclei. They preferentially bind to DNA fragments spanning A-box/G-box and C-box/G-box hybrid motifs and show transactivation activity in cobombarded tobacco BY-2 cells, indicating they function as transcriptional activators. Transcripts of tbzF were detected at a high level in senescing leaves and flowers. In contrast, tbz17 transcripts could be shown to accumulate in aged leaves but not in flowers. In situ hybridization analysis revealed transcripts of tbzF and tbz17 to be predominantly located in guard cells and vascular tissues of senescing leaves. These results suggest that TBZF and TBZ17 are both involved in controlling gene transcription related to functions of guard cells in senescing leaves and that TBZF bifunctionally acts in floral development. PMID:11553731

  12. A library of synthetic transcription activator-like effector-activated promoters for coordinated orthogonal gene expression in plants

    PubMed Central

    Brückner, Kathleen; Schäfer, Petra; Weber, Ernst; Grützner, Ramona; Marillonnet, Sylvestre; Tissier, Alain


    A library of synthetic promoters containing the binding site of a single designer transcription activator-like effector (dTALE) was constructed. The promoters contain a constant sequence, consisting of an 18-base long dTALE-binding site and a TATA box, flanked by degenerate sequences of 49 bases downstream and 19 bases upstream. Forty-three of these promoters were sequenced and tested in transient assays in Nicotiana benthamiana using a GUS reporter gene. The strength of expression of the promoters ranged from around 5% to almost 100% of the viral 35S promoter activity. We then demonstrated the utility of these promoters for metabolic engineering by transiently expressing three genes for the production of a plant diterpenoid in N. benthamiana. The simplicity of the promoter structure shows great promise for the development of genetic circuits, with wide potential applications in plant synthetic biology and metabolic engineering. PMID:25846505


    EPA Science Inventory

    Differential transcription factor activation and gene expression profiles in human vascular endothelial cells on exposure to residual oil fly ash (ROFA) and vanadium.
    Srikanth S. Nadadur and Daniel L. Costa, US EPA, ORD, NHEERL (ETD, Pulmonary Toxicology Branch), Research ...

  14. Proinsulin C-peptide stimulates a PKC/IkappaB/NF-kappaB signaling pathway to activate COX-2 gene transcription in Swiss 3T3 fibroblasts.


    Kitazawa, Masashi; Shibata, Yasutaka; Hashimoto, Seiichi; Ohizumi, Yasushi; Yamakuni, Tohru


    Proinsulin C-peptide causes multiple molecular and physiological effects, and improves renal and neuronal dysfunction in patients with diabetes. However, whether C-peptide controls the inhibitor kappaB (IkappaB)/NF-kappaB-dependent transcription of genes, including inflammatory genes is unknown. Here we showed that 1 nM C-peptide increased the expression of cyclooxygenase-2 (COX-2) mRNA and its protein in Swiss 3T3 fibroblasts. Consistently, C-peptide enhanced COX-2 gene promoter-activity, which was inhibited by GF109203X and Go6976, specific PKC inhibitors, and BAY11-7082, a specific nuclear factor-kappaB (NF-kappaB) inhibitor, accompanied by increased phosphorylation and degradation of IkappaB. These results suggest that C-peptide stimulates the transcription of inflammatory genes via activation of a PKC/IkappaB/NF-kappaB signaling pathway.

  15. Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.


    Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay


    The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. PMID:27156884

  16. Plakophilin-3 Catenin Associates with the ETV1/ER81 Transcription Factor to Positively Modulate Gene Activity

    PubMed Central

    Munoz, William A.; Lee, Moonsup; Miller, Rachel K.; Ahmed, Zamal; Ji, Hong; Link, Todd M.; Lee, Gilbert R.; Kloc, Malgorzata; Ladbury, John E.; McCrea, Pierre D.


    Members of the plakophilin-catenin sub-family (Pkp-1, -2, and -3) facilitate the linkage of desmosome junctional components to each other (e.g. desmosomal cadherins to desmoplakin) and the intermediate-filament cytoskeleton. Pkps also contribute to desmosomal stabilization and the trafficking of its components. The functions of Pkps outside of the desmosome are less well studied, despite evidence suggesting their roles in mRNA regulation, small-GTPase modulation (e.g. mid-body scission) during cell division, and cell survival following DNA damage. Pkp-catenins are further believed to have roles in the nucleus given their nuclear localization in some contexts and the known nuclear roles of structurally related catenins, such as beta-catenin and p120-catenin. Further, Pkp-catenin activities in the nuclear compartment have become of increased interest with the identification of interactions between Pkp2-catenin and RNA Pol III and Pkp1 with single-stranded DNA. Consistent with earlier reports suggesting possible nuclear roles in development, we previously demonstrated prominent nuclear localization of Pkp3 in Xenopus naïve ectoderm (“animal cap”) cells and recently resolved a similar localization in mouse embryonic stem cells. Here, we report the association and positive functional interaction of Pkp3 with a transcription factor, Ets variant gene 1 (ETV1), which has critical roles in neural development and prominent roles in human genetic disease. Our results are the first to report the interaction of a sequence-specific transcription factor with any Pkp. Using Xenopus laevis embryos and mammalian cells, we provide evidence for the Pkp3:ETV1 complex on both biochemical and functional levels. PMID:24475179

  17. A functional interaction of E7 with B-Myb-MuvB complex promotes acute cooperative transcriptional activation of both S- and M-phase genes. (129 c).


    Pang, C L; Toh, S Y; He, P; Teissier, S; Ben Khalifa, Y; Xue, Y; Thierry, F


    High-risk human papillomaviruses are causative agents of cervical cancer. Viral protein E7 is required to establish and maintain the pro-oncogenic phenotype in infected cells, but the molecular mechanisms by which E7 promotes carcinogenesis are only partially understood. Our transcriptome analyses in primary human fibroblasts transduced with the viral protein revealed that E7 activates a group of mitotic genes via the activator B-Myb-MuvB complex. We show that E7 interacts with the B-Myb, FoxM1 and LIN9 components of this activator complex, leading to cooperative transcriptional activation of mitotic genes in primary cells and E7 recruitment to the corresponding promoters. E7 interaction with LIN9 and FoxM1 depended on the LXCXE motif, which is also required for pocket protein interaction and degradation. Using E7 mutants for the degradation of pocket proteins but intact for the LXCXE motif, we demonstrate that E7 functional interaction with the B-Myb-MuvB complex and pocket protein degradation are two discrete functions of the viral protein that cooperate to promote acute transcriptional activation of mitotic genes. Transcriptional level of E7 in patient's cervical lesions at different stages of progression was shown to correlate with those of B-Myb and FoxM1 as well as other mitotic gene transcripts, thereby linking E7 with cellular proliferation and progression in cervical cancer in vivo. E7 thus can directly activate the transcriptional levels of cell cycle genes independently of pocket protein stability.

  18. Indirubin, a component of Ban-Lan-Gen, activates CYP3A4 gene transcription through the human pregnane X receptor.


    Kumagai, Takeshi; Aratsu, Yusuke; Sugawara, Ryosuke; Sasaki, Takamitsu; Miyairi, Shinichi; Nagata, Kiyoshi


    Ban-Lan-Gen is the common name for the dried roots of indigo plants, including Polygonum tinctorium, Isatis indigotica, Isatis tinctoria, and Strobilanthes cusia. Ban-Lan-Gen is frequently used as an anti-inflammatory and an anti-viral for the treatment of hepatitis, influenza, and various types of inflammation. One of the cytochrome P450 (CYP) enzymes, CYP3A4, is responsible for the metabolism of a wide variety of xenobiotics, including an estimated 60% of all clinically used drugs. In this study, we investigated the effect of Ban-Lan-Gen on the transcriptional activation of the CYP3A4 gene. Ban-Lan-Gen extract increased CYP3A4 gene reporter activity in a dose-dependent manner. Indirubin, one of the biologically active ingredients in the Ban-Lan-Gen, also dose-dependently increased CYP3A4 gene reporter activity. Expression of short hairpin RNA for the human pregnane X receptor (hPXR-shRNA) inhibited CYP3A4 gene reporter activity, and overexpression of human PXR increased indirubin- and rifampicin-induced CYP3A4 gene reporter activity. Furthermore, indirubin induced CYP3A4 mRNA expression in HepG2 cells. Taken together, these results indicate that indirubin, a component of Ban-Lan-Gen, activated CYP3A4 gene transcription through the activation of the human PXR. PMID:26987505

  19. Indirubin, a component of Ban-Lan-Gen, activates CYP3A4 gene transcription through the human pregnane X receptor.


    Kumagai, Takeshi; Aratsu, Yusuke; Sugawara, Ryosuke; Sasaki, Takamitsu; Miyairi, Shinichi; Nagata, Kiyoshi


    Ban-Lan-Gen is the common name for the dried roots of indigo plants, including Polygonum tinctorium, Isatis indigotica, Isatis tinctoria, and Strobilanthes cusia. Ban-Lan-Gen is frequently used as an anti-inflammatory and an anti-viral for the treatment of hepatitis, influenza, and various types of inflammation. One of the cytochrome P450 (CYP) enzymes, CYP3A4, is responsible for the metabolism of a wide variety of xenobiotics, including an estimated 60% of all clinically used drugs. In this study, we investigated the effect of Ban-Lan-Gen on the transcriptional activation of the CYP3A4 gene. Ban-Lan-Gen extract increased CYP3A4 gene reporter activity in a dose-dependent manner. Indirubin, one of the biologically active ingredients in the Ban-Lan-Gen, also dose-dependently increased CYP3A4 gene reporter activity. Expression of short hairpin RNA for the human pregnane X receptor (hPXR-shRNA) inhibited CYP3A4 gene reporter activity, and overexpression of human PXR increased indirubin- and rifampicin-induced CYP3A4 gene reporter activity. Furthermore, indirubin induced CYP3A4 mRNA expression in HepG2 cells. Taken together, these results indicate that indirubin, a component of Ban-Lan-Gen, activated CYP3A4 gene transcription through the activation of the human PXR.

  20. Trm1p, a Zn(II)₂Cys₆-type transcription factor, is essential for the transcriptional activation of genes of methanol utilization pathway, in Pichia pastoris.


    Sahu, Umakant; Krishna Rao, Kamisetty; Rangarajan, Pundi N


    The zinc finger transcription factors Mxr1p and Rop are key regulators of methanol metabolism in the methylotrophic yeast, Pichia pastoris, while Trm1p and Trm2p regulate methanol metabolism in Candida boidinii. Here, we demonstrate that Trm1p is essential for the expression of genes of methanol utilization (mut) pathway in P. pastoris as well. Expression of AOXI and other genes of mut pathway is severely compromised in P. pastoris ΔTrm1 strain resulting in impaired growth on media containing methanol as the sole source of carbon. Trm1p localizes to the nucleus of cells cultured on glucose or methanol. The zinc finger domain of Mxr1p but not Trm1p binds to AOXI promoter sequences in vitro, indicating that these two positive regulators act by different mechanisms. We conclude that both Trm1p and Mxr1p are essential for the expression of genes of mut pathway in P. pastoris and the mechanism of transcriptional regulation of mut pathway may be similar in P. pastoris and C. boidinii.

  1. LATERAL ROOT PRIMORDIA 1 of maize acts as a transcriptional activator in auxin signalling downstream of the Aux/IAA gene rootless with undetectable meristem 1.


    Zhang, Yanxiang; von Behrens, Inga; Zimmermann, Roman; Ludwig, Yvonne; Hey, Stefan; Hochholdinger, Frank


    Only little is known about target genes of auxin signalling downstream of the Aux/IAA-ARF module. In the present study, it has been demonstrated that maize lateral root primordia 1 (lrp1) encodes a transcriptional activator that is directly regulated by the Aux/IAA protein ROOTLESS WITH UNDETECTABLE MERISTEM 1 (RUM1). Expression of lrp1 is confined to early root primordia and meristems and is auxin-inducible. Based on its primary protein structure, LRP1 is predicted to be a transcription factor. This notion is supported by exclusive LRP1 localization in the nucleus and its ability to activate downstream gene activity. Based on the observation that lrp1 transcription is completely repressed in the semi-dominant gain of function mutant rum1, it was demonstrated that the lrp1 promoter is a direct target of RUM1 proteins. Subsequently, promoter activation assays indicated that RUM1 represses the expression of a GFP reporter fused to the native promoter of lrp1. Constitutive repression of lrp1 in rum1 mutants is a consequence of the stability of mutated rum1 proteins which cannot be degraded by the proteasome and thus constitutively bind to the lrp1 promoter and repress transcription. Taken together, the repression of the transcriptional activator lrp1 by direct binding of RUM1 to its promoter, together with specific expression of lrp1 in root meristems, suggests a function in maize root development via the RUM1-dependent auxin signalling pathway. PMID:25911745

  2. Transgenic tobacco plants expressing siRNA targeted against the Mungbean yellow mosaic virus transcriptional activator protein gene efficiently block the viral DNA accumulation.


    Shanmugapriya, Gnanasekaran; Das, Sudhanshu Sekhar; Veluthambi, Karuppannan


    Mungbean yellow mosaic virus (MYMV) is a bipartite begomovirus that infects many pulse crops such as blackgram, mungbean, mothbean, Frenchbean, and soybean. We tested the efficacy of the transgenically expressed intron-spliced hairpin RNA gene of the transcriptional activator protein (hpTrAP) in reducing MYMV DNA accumulation. Tobacco plants transformed with the MYMV hpTrAP gene accumulated 21-22 nt siRNA. Leaf discs of the transgenic plants, agroinoculated with the partial dimers of MYMV, displayed pronounced reduction in MYMV DNA accumulation. Thus, silencing of the TrAP gene, a suppressor of gene silencing, emerged as an effective strategy to control MYMV. PMID:26436122

  3. A Novel E2F-like Protein Involved in Transcriptional Activation of Cyst Wall Protein Genes in Giardia lamblia*

    PubMed Central

    Su, Li-Hsin; Pan, Yu-Jiao; Huang, Yu-Chang; Cho, Chao-Cheng; Chen, Chia-Wei; Huang, Shao-Wei; Chuang, Sheng-Fung; Sun, Chin-Hung


    Giardia lamblia differentiates into resistant walled cysts for survival outside the host and transmission. During encystation, synthesis of cyst wall proteins is coordinately induced. The E2F family of transcription factors in higher eukaryotes is involved in cell cycle progression and cell differentiation. We asked whether Giardia has E2F-like genes and whether they influence gene expression during Giardia encystation. Blast searches of the Giardia genome database identified one gene (e2f1) encoding a putative E2F protein with two putative DNA-binding domains. We found that the e2f1 gene expression levels increased significantly during encystation. Epitope-tagged E2F1 was found to localize to nuclei. Recombinant E2F1 specifically bound to the thymidine kinase and cwp1–3 gene promoters. E2F1 contains several key residues for DNA binding, and mutation analysis revealed that its binding sequence is similar to those of the known E2F family proteins. The E2F1-binding sequences were positive cis-acting elements of the thymidine kinase and cwp1 promoters. We also found that E2F1 transactivated the thymidine kinase and cwp1 promoters through its binding sequences in vivo. Interestingly, E2F1 overexpression resulted in a significant increase of the levels of CWP1 protein, cwp1–3 gene mRNA, and cyst formation. We also found E2F1 can interact with Myb2, a transcription factor that coordinate up-regulates the cwp1–3 genes during encystation. Our results suggest that E2F family has been conserved during evolution and that E2F1 is an important transcription factor in regulation of the Giardia cwp genes, which are key to Giardia differentiation into cysts. PMID:21835923

  4. Blue light-mediated transcriptional activation and repression of gene expression in bacteria.


    Jayaraman, Premkumar; Devarajan, Kavya; Chua, Tze Kwang; Zhang, Hanzhong; Gunawan, Erry; Poh, Chueh Loo


    Light-regulated modules offer unprecedented new ways to control cellular behavior in precise spatial and temporal resolution. The availability of such tools may dramatically accelerate the progression of synthetic biology applications. Nonetheless, current optogenetic toolbox of prokaryotes has potential issues such as lack of rapid and switchable control, less portable, low dynamic expression and limited parts. To address these shortcomings, we have engineered a novel bidirectional promoter system for Escherichia coli that can be induced or repressed rapidly and reversibly using the blue light dependent DNA-binding protein EL222. We demonstrated that by modulating the dosage of light pulses or intensity we could control the level of gene expression precisely. We show that both light-inducible and repressible system can function in parallel with high spatial precision in a single cell and can be switched stably between ON- and OFF-states by repetitive pulses of blue light. In addition, the light-inducible and repressible expression kinetics were quantitatively analysed using a mathematical model. We further apply the system, for the first time, to optogenetically synchronize two receiver cells performing different logic behaviors over time using blue light as a molecular clock signal. Overall, our modular approach layers a transformative platform for next-generation light-controllable synthetic biology systems in prokaryotes. PMID:27353329

  5. Blue light-mediated transcriptional activation and repression of gene expression in bacteria.


    Jayaraman, Premkumar; Devarajan, Kavya; Chua, Tze Kwang; Zhang, Hanzhong; Gunawan, Erry; Poh, Chueh Loo


    Light-regulated modules offer unprecedented new ways to control cellular behavior in precise spatial and temporal resolution. The availability of such tools may dramatically accelerate the progression of synthetic biology applications. Nonetheless, current optogenetic toolbox of prokaryotes has potential issues such as lack of rapid and switchable control, less portable, low dynamic expression and limited parts. To address these shortcomings, we have engineered a novel bidirectional promoter system for Escherichia coli that can be induced or repressed rapidly and reversibly using the blue light dependent DNA-binding protein EL222. We demonstrated that by modulating the dosage of light pulses or intensity we could control the level of gene expression precisely. We show that both light-inducible and repressible system can function in parallel with high spatial precision in a single cell and can be switched stably between ON- and OFF-states by repetitive pulses of blue light. In addition, the light-inducible and repressible expression kinetics were quantitatively analysed using a mathematical model. We further apply the system, for the first time, to optogenetically synchronize two receiver cells performing different logic behaviors over time using blue light as a molecular clock signal. Overall, our modular approach layers a transformative platform for next-generation light-controllable synthetic biology systems in prokaryotes.

  6. Effect of selenium deficiency on gene transcription

    SciTech Connect

    Christensen, M.J.; Burgener, K.W. )


    To investigate the general effects of dietary selenium (Se) deficiency on gene transcription, weanling male Sprague-Dawley rats were fed a basal Se-deficient Torula yeast-based diet or the same diet supplemented with 0.5 ppm Se as sodium selenite for 40 days. At that time three rats in each dietary group were sacrificed. Livers were excised and divided into two portions for isolation of nuclei and for assay of cytosolic Se-glutathione peroxidase (Se-GPX) activity. Se-GPX activity was 279 {plus minus} 4 (mean {plus minus} SEM) mUnits/mg protein in Se-adequate livers, and 10 {plus minus} 2 mUnits/mg protein in Se-deficient livers. One aliquot of nuclei from each dietary group was used in a run-on transcription assay, employing {alpha}-{sup 32}P-UTP to label nascent transcripts. Equal quantities of radioactivity from these nuclei were hybridized with cDNA probes bound to nitrocellulose. Message bound to each probe was quantitated by laser densitometry of autoradiographs, and by scintillation counting of dot blotted nitrocellulose. Transcription of most genes tested, including Se-GPX, was not significantly affected by dietary Se intake. However, the amount of hybridization to a murine oncogene probe (v-fos) was increased in Se deficiency.

  7. Identification of a cellular repressor of transcription of the adenoviral late IVa(2) gene that is unaltered in activity in infected cells.


    Lin, H J; Flint, S J


    The gene encoding the adenovirus type 2 IVa(2) protein, a sequence-specific activator of transcription from the viral major late promoter, is itself transcribed only during the late phase of infection. We previously identified a cellular protein (IVa(2)-RF) that binds specifically to an intragenic sequence of the IVa(2) transcription unit. We now report that precise substitutions within the IVa(2)-RF-binding site that decreased binding affinity increased the efficiency of IVa(2) transcription in in vitro reactions containing IVa(2)-RF. Consistent with the conclusion that this cellular protein represses IVa(2) transcription, mutations that led to more efficient transcription in the presence of IVa(2)-RF were without effect in reactions lacking this cellular protein. No change in the concentration or activity of IVa(2)-RF could be detected in adenovirus-infected cells during the period in which the IVa(2) gene is transcribed. We therefore propose that restriction of IVa(2) transcription to the late phase is the result of titration of this cellular repressor as the number of copies of the IVa(2) promoter increases upon replication of the viral genome.

  8. A Model for Aryl Hydrocarbon Receptor-Activated Gene Expression Shows Potency and Efficacy Changes and Predicts Squelching Due to Competition for Transcription Co-Activators

    PubMed Central

    Simon, Ted W.; Budinsky, Robert A.; Rowlands, J. Craig


    A stochastic model of nuclear receptor-mediated transcription was developed based on activation of the aryl hydrocarbon receptor (AHR) by 2,3,7,8-tetrachlorodibenzodioxin (TCDD) and subsequent binding the activated AHR to xenobiotic response elements (XREs) on DNA. The model was based on effects observed in cells lines commonly used as in vitro experimental systems. Following ligand binding, the AHR moves into the cell nucleus and forms a heterodimer with the aryl hydrocarbon nuclear translocator (ARNT). In the model, a requirement for binding to DNA is that a generic coregulatory protein is subsequently bound to the AHR-ARNT dimer. Varying the amount of coregulator available within the nucleus altered both the potency and efficacy of TCDD for inducing for transcription of CYP1A1 mRNA, a commonly used marker for activation of the AHR. Lowering the amount of available cofactor slightly increased the EC50 for the transcriptional response without changing the efficacy or maximal response. Further reduction in the amount of cofactor reduced the efficacy and produced non-monotonic dose-response curves (NMDRCs) at higher ligand concentrations. The shapes of these NMDRCs were reminiscent of the phenomenon of squelching. Resource limitations for transcriptional machinery are becoming apparent in eukaryotic cells. Within single cells, nuclear receptor-mediated gene expression appears to be a stochastic process; however, intercellular communication and other aspects of tissue coordination may represent a compensatory process to maintain an organism’s ability to respond on a phenotypic level to various stimuli within an inconstant environment. PMID:26039703

  9. The O2 gene which regulates zein deposition in maize endosperm encodes a protein with structural homologies to transcriptional activators.

    PubMed Central

    Hartings, H; Maddaloni, M; Lazzaroni, N; Di Fonzo, N; Motto, M; Salamini, F; Thompson, R


    The structure of the zein regulatory gene Opaque 2 of Zea mays has been determined by sequence analysis of genomic and cDNA clones. The size of O2 mRNA is 1751 bp [poly(A) tail not included] containing a major open reading frame (ORF) of 1380 bp preceded by three short ORFs of 3, 21 and 20 amino acid residues. The main ORF comprises 1362 bp and is composed of six exons ranging in size from 465 to 61 bp and five introns of 678 bp to 83 bp. A putative protein 454 amino acids long was derived by the theoretical translation of the genomic sequences corresponding to exons. The opaque 2 protein contains a domain similar to the leucine zipper motif identified in DNA binding proteins of animal protooncogenes such as fos, jun and myc, and in the transcriptional activators GCN4 and C/EBP. The region of 30 amino acid residues next to the leucine repeats towards the N terminus is rich in basic amino acids and is also homologous to a domain present in fos, jun and GCN4. Moreover, in the carboxy terminal region an amino acid motif closely resembling a metal binding domain is present. Images PMID:2479535

  10. Transcriptional regulation of receptor-like protein genes by environmental stresses and hormones and their overexpression activities in Arabidopsis thaliana

    PubMed Central

    Wu, Jinbin; Liu, Zhijun; Zhang, Zhao; Lv, Yanting; Yang, Nan; Zhang, Guohua; Wu, Menyao; Lv, Shuo; Pan, Lixia; Joosten, Matthieu H. A. J.; Wang, Guodong


    Receptor-like proteins (RLPs) have been implicated in multiple biological processes, including plant development and immunity to microbial infection. Fifty-seven AtRLP genes have been identified in Arabidopsis, whereas only a few have been functionally characterized. This is due to the lack of suitable physiological screening conditions and the high degree of functional redundancy among AtRLP genes. To overcome the functional redundancy and further understand the role of AtRLP genes, we studied the evolution of AtRLP genes and compiled a comprehensive profile of the transcriptional regulation of AtRLP genes upon exposure to a range of environmental stresses and different hormones. These results indicate that the majority of AtRLP genes are differentially expressed under various conditions that were tested, an observation that will help to select certain AtRLP genes involved in a specific biological process for further experimental studies to eventually dissect their function. A large number of AtRLP genes were found to respond to more than one treatment, suggesting that one single AtRLP gene may be involved in multiple physiological processes. In addition, we performed a genome-wide cloning of the AtRLP genes, and generated and characterized transgenic Arabidopsis plants overexpressing the individual AtRLP genes, presenting new insight into the roles of AtRLP genes, as exemplified by AtRLP3, AtRLP11 and AtRLP28. Our study provides an overview of biological processes in which AtRLP genes may be involved, and presents valuable resources for future investigations into the function of these genes. PMID:27099374

  11. Regulation of matrix metalloproteinase-9 transcription in squamous cell carcinoma of uterine cervix: the role of human papillomavirus gene E2 expression and activation of transcription factor NF-kappaB.


    Gasparian, A V; Fedorova, M D; Kisselev, F L


    Matrix metalloproteinase-9 (MMP-9) plays an important role in initiation and progression of squamous cell carcinoma (SCC) of human uterine cervix. Regulation of MMP-9 expression in such tumors is insufficiently studied. Involvement of the human papillomavirus (HPV) gene E2 and transcription factor NF-kappaB in the regulation of MMP-9 transcription has been shown in some model systems and types of malignant tumors. The present work was mainly designed to reveal a possible role of the HPV gene E2 and transcription factor NF-kappaB in the induction of MMP-9 expression in SCC. Specimens of tumor and corresponding adjacent normal tissue from 26 patients with SCC of the uterine cervix were studied. The intact E2 frame was observed in 19 of 26 (73.1%), the E2 gene mRNA was expressed in 10 of 15 (66.7%), NF-kappaB was activated in 17 of 23 (73.9%), and the expression of MMP-9 mRNA was recorded in 10 of 20 (50%) of the informative cases. The MMP-9 transcription did not correlate with gene E2 status, but in all cases correlated with the activation of NF-kappaB transcription factor (10 of 10 vs. 5 of 10 MMP-9-negative cases, p = 0.016). Thus, the NF-kappaB role has been proved in the regulation of MMP-9 transcription in SCC. There was no correlation of the E2 status and MMP-9 expression with clinical/morphological characteristics of the tumors: size, local invasiveness, metastasizing into regional lymph nodes, and level of differentiation. The high intensity of NF-kappaB activation correlated with low degree of differentiation of the tumors studied (p = 0.044). These findings suggested that NF-kappaB should be a molecular factor of the poor prognosis of human SCC.

  12. Genes encoding critical transcriptional activators for murine neural tube development and human spina bifida: a case-control study

    PubMed Central


    Background Spina bifida is a malformation of the neural tube and is the most common of neural tube defects (NTDs). The etiology of spina bifida is largely unknown, although it is thought to be multi-factorial, involving multiple interacting genes and environmental factors. Mutations in transcriptional co-activator genes-Cited2, p300, Cbp, Tfap2α, Carm1 and Cart1 result in NTDs in murine models, thus prompt us to investigate whether homologues of these genes are associated with NTDs in humans. Methods Data and biological samples from 297 spina bifida cases and 300 controls were derived from a population-based case-control study conducted in California. 37 SNPs within CITED2, EP300, CREBBP, TFAP2A, CARM1 and ALX1 were genotyped using an ABI SNPlex assay. Odds ratios and 95% confidence intervals were calculated for alleles, genotypes and haplotypes to evaluate the risk for spina bifida. Results Several SNPs showed increased or decreased risk, including CITED2 rs1131431 (OR = 5.32, 1.04~27.30), EP300 rs4820428 (OR = 1.30, 1.01~1.67), EP300 rs4820429 (OR = 0.50, 0.26~0.50, in whites, OR = 0.7, 0.49~0.99 in all subjects), EP300 rs17002284 (OR = 0.43, 0.22~0.84), TFAP2A rs3798691 (OR = 1.78, 1.13~2.87 in Hispanics), CREBBP rs129986 (OR = 0.27, 0.11~0.69), CARM1 rs17616105 (OR = 0.41, 0.22~0.72 in whites). In addition, one haplotype block in EP300 and one in TFAP2A appeared to be associated with increased risk. Conclusions Modest associations were observed in CITED2, EP300, CREBBP, TFAP2A and CARM1 but not ALX1. However, these modest associations were not statistically significant after correction for multiple comparisons. Searching for potential functional variants and rare causal mutations is warranted in these genes. PMID:20932315

  13. The Papaya Transcription Factor CpNAC1 Modulates Carotenoid Biosynthesis through Activating Phytoene Desaturase Genes CpPDS2/4 during Fruit Ripening.


    Fu, Chang-Chun; Han, Yan-Chao; Fan, Zhong-Qi; Chen, Jian-Ye; Chen, Wei-Xin; Lu, Wang-Jin; Kuang, Jian-Fei


    Papaya fruits accumulate carotenoids during fruit ripening. Although many papaya carotenoid biosynthesis pathway genes have been identified, the transcriptional regulators of these genes have not been characterized. In this study, a NAC transcription factor, designated as CpNAC1, was characterized from papaya fruit. CpNAC1 was localized exclusively in nucleus and possessed transcriptional activation activity. Expression of carotenoid biosynthesis genes phytoene desaturases (CpPDSs) and CpNAC1 was increased during fruit ripening and by propylene treatment, which correlates well with the elevated carotenoid content in papaya. The gel mobility shift assays and transient expression analyses demonstrated that CpNAC1 directly binds to the NAC binding site (NACBS) motifs in CpPDS2/4 promoters and activates them. Collectively, these data suggest that CpNAC1 may act as a positive regulator of carotenoid biosynthesis during papaya fruit ripening possibly via transcriptional activation of CpPDSs such as CpPDS2/4. PMID:27327494

  14. E sub 1 BF is an essential RNA polymerase I transcription factor with an intrinsic protein kinase activity that can modulate rRNA gene transcription

    SciTech Connect

    Ji Zhang; Huifeng Niu; Jacob, S.T. )


    The authors previously described the purification and characterization of E{sub 1}BF, a rat rRNA gene core promoter-binding factor that consists of two polypeptides of 89 and 79 kDa. When this factor was incubated in the absence of any exogenous protein kinase under conditions optimal for protein phosphorylation, the 79-kDa polypeptide of E{sub 1}BF was selectively phosphorylated. The labeled phosphate could be removed from the E{sub 1}BF polypeptide by treatment with calf intestinal alkaline phosphatase or potato acid phosphatase. Elution of the protein from the E{sub 1}BF-promoter complex formed in an electrophoretic mobility-shift assay followed by incubation of the concentrated eluent with ({gamma}-{sup 32}P)ATP resulted in the selective labeling o the 79-kDa band. The E{sub 1}BF-associated protein kinase did not phosphorylate casein or histone H1. These data demonstrate that (1) polymerase I promoter-binding factor E{sub 1}BF contains an intrinsic substrate-specific protein kinase and (2) E{sub 1}BF is an essential polymerase I transcription factor that can modulate rRNA gene transcription by protein phosphorylation. Further, these studies have provided a direct means to identify a protein kinase or any other enzyme that can interact with a specific DNA sequence.

  15. Transgenic mice with cardiac-specific expression of activating transcription factor 3, a stress-inducible gene, have conduction abnormalities and contractile dysfunction.


    Okamoto, Y; Chaves, A; Chen, J; Kelley, R; Jones, K; Weed, H G; Gardner, K L; Gangi, L; Yamaguchi, M; Klomkleaw, W; Nakayama, T; Hamlin, R L; Carnes, C; Altschuld, R; Bauer, J; Hai, T


    Activating transcription factor 3 (ATF3) is a member of the CREB/ATF family of transcription factors. Previously, we demonstrated that the expression of the ATF3 gene is induced by many stress signals. In this report, we demonstrate that expression of ATF3 is induced by cardiac ischemia coupled with reperfusion (ischemia-reperfusion) in both cultured cells and an animal model. Transgenic mice expressing ATF3 under the control of the alpha-myosin heavy chain promoter have atrial enlargement, and atrial and ventricular hypertrophy. Microscopic examination showed myocyte degeneration and fibrosis. Functionally, the transgenic heart has reduced contractility and aberrant conduction. Interestingly, expression of sorcin, a gene whose product inhibits the release of calcium from sarcoplasmic reticulum, is increased in these transgenic hearts. Taken together, our results indicate that expression of ATF3, a stress-inducible gene, in the heart leads to altered gene expression and impaired cardiac function. PMID:11485922

  16. An ortholog of farA of Aspergillus nidulans is implicated in the transcriptional activation of genes involved in fatty acid utilization in the yeast Yarrowia lipolytica

    SciTech Connect

    Poopanitpan, Napapol; Kobayashi, Satoshi; Fukuda, Ryouichi; Horiuchi, Hiroyuki; Ohta, Akinori


    Research highlights: {yields} POR1 is a Yarrowia lipolytica ortholog of farA involved in fatty acid response in A. nidulans. {yields} Deletion of POR1 caused growth defects on fatty acids. {yields} {Delta}por1 strain exhibited defects in the induction of genes involved in fatty acid utilization. -- Abstract: The yeast Yarrowia lipolytica effectively utilizes hydrophobic substrates such as fatty acids and n-alkanes. To identify a gene(s) regulating fatty acid utilization in Y. lipolytica, we first studied homologous genes to OAF1 and PIP2 of Saccharomyces cerevisiae, but their disruption did not change growth on oleic acid at all. We next characterized a Y. lipolytica gene, POR1 (primary oleate regulator 1), an ortholog of farA encoding a transcriptional activator that regulates fatty acid utilization in Aspergillus nidulans. The deletion mutant of POR1 was defective in the growth on various fatty acids, but not on glucose, glycerol, or n-hexadecane. It exhibited slight defect on n-decane. The transcriptional induction of genes involved in {beta}-oxidation and peroxisome proliferation by oleate was distinctly diminished in the {Delta}por1 strains. These data suggest that POR1 encodes a transcriptional activator widely regulating fatty acid metabolism in Y. lipolytica.

  17. Imaging transcription in vivo: distinct regulatory effects of fast and slow activity patterns on promoter elements from vertebrate troponin I isoform genes

    PubMed Central

    Rana, Zaheer A; Gundersen, Kristian; Buonanno, Andres; Vullhorst, Detlef


    Firing patterns typical of slow motor units activate genes for slow isoforms of contractile proteins, but it remains unclear if there is a distinct pathway for fast isoforms or if their expression simply occurs in the absence of slow activity. Here we first show that denervation in adult soleus and EDL muscles reverses the postnatal increase in expression of troponin I (TnI) isoforms, suggesting that high-level transcription of both genes in mature muscles is under neural control. We then use a combination of in vivo transfection, live muscle imaging and fluorescence quantification to investigate the role of patterned electrical activity in the transcriptional control of troponin I slow (TnIs) and fast (TnIf) regulatory sequences by directly stimulating denervated muscles with pattern that mimic fast and slow motor units. Rat soleus muscles were electroporated with green fluorescent protein (GFP) reporter constructs harbouring 2.7 and 2.1 kb of TnIs and TnIf regulatory sequences, respectively. One week later, electrodes were implanted and muscles stimulated for 12 days. The change in GFP fluorescence of individual muscle fibres before and after the stimulation was used as a measure for transcriptional responses to different patterns of action potentials. Our results indicate that the response of TnI promoter sequences to electrical stimulation is consistent with the regulation of the endogenous genes. The TnIf and TnIs enhancers were activated by matching fast and slow activity patterns, respectively. Removal of nerve-evoked activity by denervation, or stimulation with a mismatching pattern reduced transcriptional activity of both enhancers. These results strongly suggest that distinct signalling pathways couple both fast and slow patterns of activity to enhancers that regulate transcription from the fast and slow troponin I isoforms. PMID:15528243

  18. Short-term overcrowding of Atlantic cod, Gadus morhua: effects on serum-mediated antibacterial activity and transcription of glucose transport and antioxidant defense related genes.


    Caipang, Christopher Marlowe A; Brinchmann, Monica F; Kiron, Viswanath


    Serum-mediated control of Listonella anguillarum and transcriptional profiles of selected glucose transport and antioxidant defense genes, following short-term overcrowding in Atlantic cod, Gadus morhua were determined. Fish were subjected to overcrowding by reducing the water level in the tank for 1 h and this was repeated thrice over a 12 h period. Blood samples were collected before overcrowding (initial group) and at 2, 24 and 72 h post-crowding. The sera from fish obtained at 2 h post-crowding caused a significant reduction in L. anguillarum counts compared to the initial samples. There was a transcriptional upregulation of the glucose transport-4 and glyceraldehyde-3-phosphate dehydrogenase genes at 2 h after crowding. Gene transcripts of the antioxidant enzymes, Cu/Zn superoxide dismutase (Cu/Zn SOD), catalase and phospholipid hydroperoxide glutathione peroxidase also significantly increased at 2 h post-crowding, but thereafter they returned to their pre-crowding levels with the exception of Cu/Zn SOD that remained significantly higher than the initial group until 72 h. Thus, short-term overcrowding of Atlantic cod leads to a transient enhancement of in vitro serum antibacterial activity and enhanced transcriptional activity of glucose transport and antioxidant defense genes.

  19. YB-1 gene expression is kept constant during myocyte differentiation through replacement of different transcription factors and then falls gradually under the control of neural activity.


    Kobayashi, Shunsuke; Tanaka, Toru; Moue, Masamitsu; Ohashi, Sachiyo; Nishikawa, Taishi


    We have previously reported that translation of acetylcholine receptor α-subunit (AChR α) mRNA in skeletal muscle cells is regulated by Y-box binding protein 1 (YB-1) in response to neural activity, and that in the postnatal mouse developmental changes in the amount of YB-1 mRNA are similar to those of AChR α mRNA, which is known to be regulated by myogenic transcription factors. Here, we examined transcriptional regulation of the YB-1 gene in mouse skeletal muscle and differentiating C2C12 myocytes. Although neither YB-1 nor AChR α was detected at either the mRNA or protein level in adult hind limb muscle, YB-1 expression was transiently activated in response to denervation of the sciatic nerve and completely paralleled that of AChR α, suggesting that these genes are regulated by the same transcription factors. However, during differentiation of C2C12 cells to myotubes, the level of YB-1 remained constant even though the level of AChR α increased markedly. Reporter gene, gel mobility shift and ChIP assays revealed that in the initial stage of myocyte differentiation, transcription of the YB-1 gene was regulated by E2F1 and Sp1, and was then gradually replaced under the control of both MyoD and myogenin through an E-box sequence in the proximal region of the YB-1 gene promoter. These results suggest that transcription factors for the YB-1 gene are exchanged during skeletal muscle cell differentiation, perhaps playing a role in translational control of mRNAs by YB-1 in both myotube formation and the response of skeletal muscle tissues to neural stimulation.

  20. Distal Interleukin-1β (IL-1β) Response Element of Human Matrix Metalloproteinase-13 (MMP-13) Binds Activator Protein 1 (AP-1) Transcription Factors and Regulates Gene Expression*

    PubMed Central

    Schmucker, Adam C.; Wright, Jason B.; Cole, Michael D.; Brinckerhoff, Constance E.


    The collagenase matrix metalloproteinase-13 (MMP-13) plays an important role in the destruction of cartilage in arthritic joints. MMP-13 expression is strongly up-regulated in arthritis, largely because of stimulation by inflammatory cytokines such as IL-1β. Treatment of chondrocytes with IL-1β induces transcription of MMP-13 in vitro. IL-1β signaling converges upon the activator protein-1 transcription factors, which have been shown to be required for IL-1β-induced MMP-13 gene expression. Using chromatin immunoprecipitation (ChIP), we detected activator protein-1 binding within an evolutionarily conserved DNA sequence ∼20 kb 5′ relative to the MMP-13 transcription start site (TSS). Also using ChIP, we detected histone modifications and binding of RNA polymerase II within this conserved region, all of which are consistent with transcriptional activation. Chromosome conformation capture indicates that chromosome looping brings this region in close proximity with the MMP-13 TSS. Finally, a luciferase reporter construct driven by a component of the conserved region demonstrated an expression pattern similar to that of endogenous MMP-13. These data suggest that a conserved region at 20 kb upstream from the MMP-13 TSS includes a distal transcriptional response element of MMP-13, which contributes to MMP-13 gene expression. PMID:22102411

  1. Transcriptional regulation of tenascin genes

    PubMed Central

    Chiovaro, Francesca; Chiquet-Ehrismann, Ruth; Chiquet, Matthias


    Extracellular matrix proteins of the tenascin family resemble each other in their domain structure, and also share functions in modulating cell adhesion and cellular responses to growth factors. Despite these common features, the 4 vertebrate tenascins exhibit vastly different expression patterns. Tenascin-R is specific to the central nervous system. Tenascin-C is an “oncofetal” protein controlled by many stimuli (growth factors, cytokines, mechanical stress), but with restricted occurrence in space and time. In contrast, tenascin-X is a constituitive component of connective tissues, and its level is barely affected by external factors. Finally, the expression of tenascin-W is similar to that of tenascin-C but even more limited. In accordance with their highly regulated expression, the promoters of the tenascin-C and -W genes contain TATA boxes, whereas those of the other 2 tenascins do not. This article summarizes what is currently known about the complex transcriptional regulation of the 4 tenascin genes in development and disease. PMID:25793574

  2. Transcription dynamics of inducible genes modulated by negative regulations.


    Li, Yanyan; Tang, Moxun; Yu, Jianshe


    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  3. Krüppel-like factor 6 is a co-activator of NF-κB that mediates p65-dependent transcription of selected downstream genes.


    Zhang, Yu; Lei, Cao-Qi; Hu, Yun-Hong; Xia, Tian; Li, Mi; Zhong, Bo; Shu, Hong-Bing


    The transcription factor NF-κB plays a pivotal role in a broad range of physiological and pathological processes, including development, inflammation, and immunity. How NF-κB integrates activating signals to expression of specific sets of target genes is of great interest. Here, we identified Krüppel-like factor 6 (KLF6) as a co-activator of NF-κB after TNFα and IL-1β stimulation. Overexpression of KLF6 enhanced TNFα- and IL-1β-induced activation of NF-κB and transcription of a subset of downstream genes, whereas knockdown of KLF6 had opposite effects. KLF6 interacted with p65 in the nucleus and bound to the promoters of target genes. Upon IL-1β stimulation, KLF6 was recruited to promoters of a subset of NF-κB target genes in a p65-dependent manner, which was in turn required for the optimal binding of p65 to the target gene promoters. Our findings thus identified KLF6 as a previously unknown but essential co-activator of NF-κB and provided new insight into the molecular regulation of p65-dependent gene expression.

  4. Structural basis of transcription activation.


    Feng, Yu; Zhang, Yu; Ebright, Richard H


    Class II transcription activators function by binding to a DNA site overlapping a core promoter and stimulating isomerization of an initial RNA polymerase (RNAP)-promoter closed complex into a catalytically competent RNAP-promoter open complex. Here, we report a 4.4 angstrom crystal structure of an intact bacterial class II transcription activation complex. The structure comprises Thermus thermophilus transcription activator protein TTHB099 (TAP) [homolog of Escherichia coli catabolite activator protein (CAP)], T. thermophilus RNAP σ(A) holoenzyme, a class II TAP-dependent promoter, and a ribotetranucleotide primer. The structure reveals the interactions between RNAP holoenzyme and DNA responsible for transcription initiation and reveals the interactions between TAP and RNAP holoenzyme responsible for transcription activation. The structure indicates that TAP stimulates isomerization through simple, adhesive, stabilizing protein-protein interactions with RNAP holoenzyme. PMID:27284196

  5. Inducible removal of UV-induced pyrimidine dimers from transcriptionally active and inactive genes of Saccharomyces cerevisiae.


    Waters, R; Zhang, R; Jones, N J


    The prior UV irradiation of alpha haploid Saccharomyces cerevisiae with a UV dose of 25 J/m2 substantially increases the repairability of damage subsequently induced by a UV dose of 70 J/m2 given 1 h after the first irradiation. This enhancement of repair is seen at both the MAT alpha and HML alpha loci, which are, respectively, transcriptionally active and inactive in alpha haploid cells. The presence in the medium of the protein synthesis inhibitor, cycloheximide in the period between the two irradiations eliminated this effect. Enhanced repair still occurred if cycloheximide was present only after the final UV irradiation. This indicated that the first result is not due to cycloheximide merely blocking the synthesis of repair enzymes associated with a hypothetical rapid turnover of such molecules. The enhanced repairability is not the result of changes in chromatin accessibility without protein synthesis, merely caused by the repair of the damage induced by the prior irradiation. The data clearly show that a UV-inducible removal of pyrimidine dimers has occurred which involves the synthesis of new proteins. The genes known to possess inducible promoters, and which are involved in excision are RAD2, RAD7, RAD16 and RAD23. Studies with the rad7 and rad16 mutants which are defective in the ability to repair HML alpha and proficient in the repair of MAT alpha showed that in rad7, preirradiation enhanced the repair at MAT alpha, whereas in rad16 this increased repair of MAT alpha was absent. The preirradiation did not modify the inability to repair HML alpha in either strain. Thus RAD16 has a role in this inducible repair.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. Role of Calcineurin, hnRNPA2 and Akt in Mitochondrial Respiratory Stress-Mediated Transcription Activation of Nuclear Gene Targets

    PubMed Central

    Guha, Manti; Tang, Weigang; Sondheimer, Neal; Avadhani, Narayan G.


    Pathophysiological conditions causing mitochondrial dysfunction and altered transmembrane potential (Δψm) initiate a mitochondrial respiratory stress response, also known as mitochondrial retrograde response, in a variety of mammalian cells. An increase in the cytosolic Ca2+ [Ca2+]c as part of this signaling cascade activates Ca2+ responsive phosphatase, Calcineurin (Cn). Activation of IGF1R accompanied by increased glycolysis, invasiveness, and resistance to apoptosis are phenotypic hallmarks of C2C12 rhabdomyoblast cells subjected to this stress. The signaling is associated with activation and increased nuclear translocation of a number of transcription factors including a novel NFκB (cRel: p50) pathway, NFAT, CREB and C/EBPδ. This culminates in the upregulation of a number of nuclear genes including Cathepsin L, RyR1, Glut4 and Akt1. We observed that stress regulated transcription activation of nuclear genes involves a cooperative interplay between NFκB (cRel:p50), C/EBPδ, CREB, NFAT. Our results show that the functional synergy of these factors requires the stress-activated heterogeneous nuclear ribonucleoprotein, hnRNPA2 as a transcriptional co-activator. We report here that mitochondrial stress leads to induced expression and activation of serine threonine kinase Akt1. Interestingly, we observe that Akt1 phosphorylates hnRNPA2 under mitochondrial stress conditions, which is a crucial step for the recruitment of this coactivator to the stress target promoters and culmination in mitochondrial stress-mediated transcription activation of target genes. We propose that mitochondrial stress plays an important role in tumor progression and emergence of invasive phenotypes. PMID:20153290

  7. Signal Transducer and Activator of Transcription 1 (STAT1) is Essential for Chromium Silencing of Gene Induction in Human Airway Epithelial Cells

    PubMed Central

    Nemec, Antonia A.; Barchowsky, Aaron


    Hexavalent chromium (Cr(VI)) promotes lung injury and pulmonary diseases through poorly defined mechanisms that may involve the silencing of inducible protective genes. The current study investigated the hypothesis that Cr(VI) actively signals through a signal transducer and activator of transcription 1 (STAT1)–dependent pathway to silence nickel (Ni)–induced expression of vascular endothelial cell growth factor A (VEGFA), an important mediator of lung injury and repair. In human bronchial airway epithelial (BEAS-2B) cells, Ni-induced VEGFA transcription by stimulating an extracellular regulated kinase (ERK) signaling cascade that involved Src kinase–activated Sp1 transactivation, as well as increased hypoxia-inducible factor-1α (HIF-1α) stabilization and DNA binding. Ni-stimulated ERK, Src, and HIF-1α activities, as well as Ni-induced VEGFA transcript levels were inhibited in Cr(VI)-exposed cells. We previously demonstrated that Cr(VI) stimulates STAT1 to suppress VEGFA expression. In BEAS-2B cells stably expressing STAT1 short hairpin RNA, Cr(VI) increased VEGFA transcript levels and Sp1 transactivation. Moreover, in the absence of STAT1, Cr(VI), and Ni coexposures positively interacted to further increase VEGFA transcripts. This study demonstrates that metal-stimulated signaling cascades interact to regulate transcription and induction of adaptive or repair responses in airway cells. In addition, the data implicate STAT1 as a rate limiting mediator of Cr(VI)-stimulated gene regulation and suggest that cells lacking STAT1, such as many tumor cell lines, have opposite responses to Cr(VI) relative to normal cells. PMID:19403854

  8. TATA-binding protein (TBP)-like protein is required for p53-dependent transcriptional activation of upstream promoter of p21Waf1/Cip1 gene.


    Suzuki, Hidefumi; Ito, Ryo; Ikeda, Kaori; Tamura, Taka-Aki


    TATA-binding protein-like protein (TLP) is involved in development, checkpoint, and apoptosis through potentiation of gene expression. TLP-overexpressing human cells, especially p53-containing cells, exhibited a decreased growth rate and increased proportion of G(1) phase cells. TLP stimulated expression of several growth-related genes including p21 (p21(Waf1/Cip1)). TLP-mediated activation of the p21 upstream promoter in cells was shown by a promoter-luciferase reporter assay. The p53-binding sequence located in the p21 upstream promoter and p53 itself are required for TLP-mediated transcriptional activation. TLP and p53 bound to each other and synergistically enhanced activity of the upstream promoter. TLP specifically activated transcription from the endogenous upstream promoter, and p53 was required for this activation. Etoposide treatment also resulted in activation of the upstream promoter as well as nuclear accumulation of TLP and p53. Moreover, the upstream promoter was associated with endogenous p53 and TLP, and the p53 recruitment was enhanced by TLP. The results of the present study suggest that TLP mediates p53-governed transcriptional activation of the p21 upstream promoter.

  9. Protein kinase-A dependent phosphorylation of transcription enhancer factor-1 represses its DNA-binding activity but enhances its gene activation ability

    PubMed Central

    Gupta, Mahesh P.; Kogut, Paul; Gupta, Madhu


    The cAMP-dependent signaling pathway has been implicated in cardiac cell growth/differentiation and muscle gene transcription. Previously, we have identified a cAMP-inducible E-box/M-CAT hybrid motif in the cardiac α-myosin heavy chain (α-MHC) gene promoter. The two factors, TEF-1 and Max, that bind to this motif are found to physically associate with each other and exert a positive cooperative effect for gene regulation. Here we show that TEF-1, but not Max, is a substrate for protein kinase-A (PK-A)-dependent phosphorylation. TEF-1 is phosphorylated by PK-A at residue serine-102. This post-translational modification of TEF-1 repressed its DNA-binding activity, but not its ability to interact with the Max protein. Replacement of serine-102 in TEF-1 by a neutral or a charged amino acid did not abolish its DNA-binding ability, suggesting that changing a charge at the 102 amino-acid position of TEF-1 was not sufficient to inhibit its DNA-binding activity. We also show that PK-A response of the α-MHC gene is stimulated by the presence of wild-type TEF-1 but not by mutant TEF-1 having serine-102 replaced by alanine, suggesting that phosphorylation at this residue accounts for the cAMP/PK-A response of the gene. Thus, these data demonstrate that TEF-1 is a direct target of cAMP/PK-A signaling in cardiac myocytes. PMID:10931933

  10. The Rel/NF-κB pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity

    PubMed Central

    Chang, Tammy T.; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie


    This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in μg. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that μg was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of μg from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that μg- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in μg. Importantly, several key immediate early genes were inhibited in μg. In particular, transactivation of Rel/NF-κB, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in μg and upon anti-CD3/anti-CD28 stimulation in simulated μg. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in μg and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that μg was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes. PMID:22750545

  11. The Rel/NF-κB pathway and transcription of immediate early genes in T cell activation are inhibited by microgravity.


    Chang, Tammy T; Walther, Isabelle; Li, Chai-Fei; Boonyaratanakornkit, Jim; Galleri, Grazia; Meloni, Maria Antonia; Pippia, Proto; Cogoli, Augusto; Hughes-Fulford, Millie


    This study tested the hypothesis that transcription of immediate early genes is inhibited in T cells activated in μg. Immunosuppression during spaceflight is a major barrier to safe, long-term human space habitation and travel. The goals of these experiments were to prove that μg was the cause of impaired T cell activation during spaceflight, as well as understand the mechanisms controlling early T cell activation. T cells from four human donors were stimulated with Con A and anti-CD28 on board the ISS. An on-board centrifuge was used to generate a 1g simultaneous control to isolate the effects of μg from other variables of spaceflight. Microarray expression analysis after 1.5 h of activation demonstrated that μg- and 1g-activated T cells had distinct patterns of global gene expression and identified 47 genes that were significantly, differentially down-regulated in μg. Importantly, several key immediate early genes were inhibited in μg. In particular, transactivation of Rel/NF-κB, CREB, and SRF gene targets were down-regulated. Expression of cREL gene targets were significantly inhibited, and transcription of cREL itself was reduced significantly in μg and upon anti-CD3/anti-CD28 stimulation in simulated μg. Analysis of gene connectivity indicated that the TNF pathway is a major early downstream effector pathway inhibited in μg and may lead to ineffective proinflammatory host defenses against infectious pathogens during spaceflight. Results from these experiments indicate that μg was the causative factor for impaired T cell activation during spaceflight by inhibiting transactivation of key immediate early genes.

  12. Genome-wide identification and transcriptional expression analysis of mitogen-activated protein kinase and mitogen-activated protein kinase kinase genes in Capsicum annuum.


    Liu, Zhiqin; Shi, Lanping; Liu, Yanyan; Tang, Qian; Shen, Lei; Yang, Sheng; Cai, Jinsen; Yu, Huanxin; Wang, Rongzhang; Wen, Jiayu; Lin, Youquan; Hu, Jiong; Liu, Cailing; Zhang, Yangwen; Mou, Shaoliang; He, Shuilin


    The tripartite mitogen-activated protein kinase (MAPK) signaling cascades have been implicated in plant growth, development, and environment adaptation, but a comprehensive understanding of MAPK signaling at genome-wide level is limited in Capsicum annuum. Herein, genome-wide identification and transcriptional expression analysis of MAPK and MAPK kinase (MAPKK) were performed in pepper. A total of 19 pepper MAPK (CaMAPKs) genes and five MAPKK (CaMAPKKs) genes were identified. Phylogenetic analysis indicated that CaMAPKs and CaMAPKKs could be classified into four groups and each group contains similar exon-intron structures. However, significant divergences were also found. Notably, five members of the pepper MAPKK family were much less conserved than those found in Arabidopsis, and 9 Arabidopsis MAPKs did not have orthologs in pepper. Additionally, 7 MAPKs in Arabidopsis had either two or three orthologs in the pepper genome, and six pepper MAPKs and one MAPKK differing in sequence were found in three pepper varieties. Quantitative real-time RT-PCR analysis showed that the majority of MAPK and MAPKK genes were ubiquitously expressed and transcriptionally modified in pepper leaves after treatments with heat, salt, and Ralstonia solanacearum inoculation as well as exogenously applied salicylic acid, methyl jasmonate, ethephon, and abscisic acid. The MAPKK-MAPK interactome was tested by yeast two-hybrid assay, the results showed that one MAPKK might interact with multiple MAPKs, one MAPK might also interact with more than one MAPKKs, constituting MAPK signaling networks which may collaborate in transmitting upstream signals into appropriate downstream cellular responses and processes. These results will facilitate future functional characterization of MAPK cascades in pepper. PMID:26442088

  13. Genome-wide identification and transcriptional expression analysis of mitogen-activated protein kinase and mitogen-activated protein kinase kinase genes in Capsicum annuum

    PubMed Central

    Liu, Zhiqin; Shi, Lanping; Liu, Yanyan; Tang, Qian; Shen, Lei; Yang, Sheng; Cai, Jinsen; Yu, Huanxin; Wang, Rongzhang; Wen, Jiayu; Lin, Youquan; Hu, Jiong; Liu, Cailing; Zhang, Yangwen; Mou, Shaoliang; He, Shuilin


    The tripartite mitogen-activated protein kinase (MAPK) signaling cascades have been implicated in plant growth, development, and environment adaptation, but a comprehensive understanding of MAPK signaling at genome-wide level is limited in Capsicum annuum. Herein, genome-wide identification and transcriptional expression analysis of MAPK and MAPK kinase (MAPKK) were performed in pepper. A total of 19 pepper MAPK (CaMAPKs) genes and five MAPKK (CaMAPKKs) genes were identified. Phylogenetic analysis indicated that CaMAPKs and CaMAPKKs could be classified into four groups and each group contains similar exon-intron structures. However, significant divergences were also found. Notably, five members of the pepper MAPKK family were much less conserved than those found in Arabidopsis, and 9 Arabidopsis MAPKs did not have orthologs in pepper. Additionally, 7 MAPKs in Arabidopsis had either two or three orthologs in the pepper genome, and six pepper MAPKs and one MAPKK differing in sequence were found in three pepper varieties. Quantitative real-time RT-PCR analysis showed that the majority of MAPK and MAPKK genes were ubiquitously expressed and transcriptionally modified in pepper leaves after treatments with heat, salt, and Ralstonia solanacearum inoculation as well as exogenously applied salicylic acid, methyl jasmonate, ethephon, and abscisic acid. The MAPKK-MAPK interactome was tested by yeast two-hybrid assay, the results showed that one MAPKK might interact with multiple MAPKs, one MAPK might also interact with more than one MAPKKs, constituting MAPK signaling networks which may collaborate in transmitting upstream signals into appropriate downstream cellular responses and processes. These results will facilitate future functional characterization of MAPK cascades in pepper. PMID:26442088

  14. Complementary Activities of TELOMERE REPEAT BINDING Proteins and Polycomb Group Complexes in Transcriptional Regulation of Target Genes[OPEN

    PubMed Central

    Hartwig, Benjamin; James, Geo Velikkakam


    In multicellular organisms, Polycomb Repressive Complex 1 (PRC1) and PRC2 repress target genes through histone modification and chromatin compaction. Arabidopsis thaliana mutants strongly compromised in the pathway cannot develop differentiated organs. LIKE HETEROCHROMATIN PROTEIN1 (LHP1) is so far the only known plant PRC1 component that directly binds to H3K27me3, the histone modification set by PRC2, and also associates genome-wide with trimethylation of lysine 27 of histone H3 (H3K27me3). Surprisingly, lhp1 mutants show relatively mild phenotypic alterations. To explain this paradox, we screened for genetic enhancers of lhp1 mutants to identify novel components repressing target genes together with, or in parallel to, LHP1. Two enhancing mutations were mapped to TELOMERE REPEAT BINDING PROTEIN1 (TRB1) and its paralog TRB3. We show that TRB1 binds to thousands of genomic sites containing telobox or related cis-elements with a significant increase of sites and strength of binding in the lhp1 background. Furthermore, in combination with lhp1, but not alone, trb1 mutants show increased transcription of LHP1 targets, such as floral meristem identity genes, which are more likely to be bound by TRB1 in the lhp1 background. By contrast, expression of a subset of LHP1-independent TRB1 target genes, many involved in primary metabolism, is decreased in the absence of TRB1 alone. Thus, TRB1 is a bivalent transcriptional modulator that maintains downregulation of Polycomb Group (PcG) target genes in lhp1 mutants, while it sustains high expression of targets that are regulated independently of PcG. PMID:26721861

  15. Transcription Activation by NtcA and 2-Oxoglutarate of Three Genes Involved in Heterocyst Differentiation in the Cyanobacterium Anabaena sp. Strain PCC 7120▿

    PubMed Central

    Valladares, Ana; Flores, Enrique; Herrero, Antonia


    In Anabaena sp. strain PCC 7120, differentiation of heterocysts takes place in response to the external cue of combined nitrogen deprivation, allowing the organism to fix atmospheric nitrogen in oxic environments. NtcA, a global transcriptional regulator of cyanobacteria, is required for activation of the expression of multiple genes involved in heterocyst differentiation, including key regulators that are specific to the process. We have set up a fully defined in vitro system, which includes the purified Anabaena RNA polymerase, and have studied the effects of NtcA and its signaling effector 2-oxoglutarate on RNA polymerase binding, open complex formation, and transcript production from promoters of the hetC, nrrA, and devB genes that are activated by NtcA at different stages of heterocyst differentiation. Both RNA polymerase and NtcA could specifically bind to the target DNA in the absence of any effector. 2-Oxoglutarate had a moderate positive effect on NtcA binding, and NtcA had a limited positive effect on RNA polymerase recruitment at the promoters. However, a stringent requirement of both NtcA and 2-oxoglutarate was observed for the detection of open complexes and transcript production at the three investigated promoters. These results support a key role for 2-oxoglutarate in transcription activation in the developing heterocyst. PMID:18658268

  16. TATA-binding Protein (TBP)-like Protein Is Engaged in Etoposide-induced Apoptosis through Transcriptional Activation of Human TAp63 Gene.


    Suenaga, Yusuke; Ozaki, Toshinori; Tanaka, Yuji; Bu, Youquan; Kamijo, Takehiko; Tokuhisa, Takeshi; Nakagawara, Akira; Tamura, Taka-Aki


    Accumulating evidence indicates that TBP (TATA-binding protein)-like protein (TLP) contributes to the regulation of stress-mediated cell cycle checkpoint and apoptotic pathways, although its physiological target genes have remained elusive. In the present study, we have demonstrated that human TAp63 is one of the direct transcriptional target genes of TLP. Enforced expression of TLP results in the transcriptional induction of the endogenous TAp63, but not of the other p53 family members such as TAp73 and p53. Consistent with these results, small interference RNA-mediated knockdown led to a significant down-regulation of the endogenous TAp63. Luciferase reporter assay and chromatin immunoprecipitation analysis revealed that the genomic region located at positions -487 to -29, where +1 represents the transcriptional initiation site of TAp63, is required for TLP-dependent transcriptional activation of TAp63 and also TLP is efficiently recruited onto this region. Additionally, cells treated with anti-cancer drug etoposide underwent apoptosis in association with the transcriptional enhancement of TAp63 in a p53-independent manner, and the knockdown of the endogenous TLP reduced etoposide-induced apoptosis through repression of TAp63 expression. Taken together, our present study identifies a TLP-TAp63 pathway that is further implicated in stress-induced apoptosis.

  17. Expression of the human Hand1 gene in trophoblastic cells is transcriptionally regulated by activating and repressing specificity protein (Sp)-elements.


    Vasicek, Richard; Meinhardt, Gudrun; Haidweger, Eva; Rotheneder, Hans; Husslein, Peter; Knöfler, Martin


    The tissue-specific basic helix-loop-helix protein Hand1 is essential for the formation of trophoblast giant cells of the murine placenta. In humans, Hand1 is detectable in trophoblastic tumour cells suggesting an equivalent role in trophoblast differentiation. To understand its mode of expression we have cloned and characterized the human Hand1 gene promoter. Primer extension analyses suggest that transcription initiates 19 nucleotides downstream of the TATA element of the proximal 5' flanking region. Expression of luciferase reporter constructs harboring deletions of the 9.5 kb Hand1 5' flanking sequence defines a promoter region within 274 bp upstream of the transcriptional start site. Compared to a reporter bearing only the TATA box, the proximal promoter activates transcription up to 30-fold. However, transcriptional activity of the region was observed in both Hand1-expressing and non-expressing cell lines. Sequencing, DNAseI footprint analyses and electrophoretic mobility shift assays reveal the presence of four GC-rich sequences, which show different affinities to the endogenous specificity proteins (Sp), and a CCAAT box. In vitro, the Sp-elements mainly interact with Sp1 and Sp3 while the CCAAT element is recognized by the alpha CAAT binding factor protein. Mutant luciferase reporters bearing single active or inactive recognition sites demonstrate that two of the four Sp-binding sites (I and IV) contribute little to the overall transcription rate. The two other Sp-cognate sequences, II and III, downregulate and activate reporter expression 2.3- and 2.6-fold, respectively. Co-transfections of Sp1/Sp3 expression vectors and mutated reporter constructs in Sp-deficient SL2 cells indicate that the Sp-binding site II and III indeed function as repressing and activating enhancer sequences. In summary, the data suggest that constitutive expression of the Hand1 gene in cultured cells is regulated by a complex interplay of Sp-proteins interacting with activator and

  18. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo

    PubMed Central

    Rijal, Keshab; Maraia, Richard J.


    The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095

  19. The Casuarina NIN gene is transcriptionally activated throughout Frankia root infection as well as in response to bacterial diffusible signals.


    Clavijo, Fernando; Diedhiou, Issa; Vaissayre, Virginie; Brottier, Laurent; Acolatse, Jennifer; Moukouanga, Daniel; Crabos, Amandine; Auguy, Florence; Franche, Claudine; Gherbi, Hassen; Champion, Antony; Hocher, Valerie; Barker, David; Bogusz, Didier; Tisa, Louis S; Svistoonoff, Sergio


    Root nodule symbioses (RNS) allow plants to acquire atmospheric nitrogen by establishing an intimate relationship with either rhizobia, the symbionts of legumes or Frankia in the case of actinorhizal plants. In legumes, NIN (Nodule INception) genes encode key transcription factors involved in nodulation. Here we report the characterization of CgNIN, a NIN gene from the actinorhizal tree Casuarina glauca using both phylogenetic analysis and transgenic plants expressing either ProCgNIN::reporter gene fusions or CgNIN RNAi constructs. We have found that CgNIN belongs to the same phylogenetic group as other symbiotic NIN genes and CgNIN is able to complement a legume nin mutant for the early steps of nodule development. CgNIN expression is correlated with infection by Frankia, including preinfection stages in developing root hairs, and is induced by culture supernatants. Knockdown mutants were impaired for nodulation and early root hair deformation responses were severely affected. However, no mycorrhizal phenotype was observed and no induction of CgNIN expression was detected in mycorrhizas. Our results indicate that elements specifically required for nodulation include NIN and possibly related gene networks derived from the nitrate signalling pathways. PMID:26096779

  20. Transcription activator-like effector nucleases efficiently disrupt the target gene in Iberian ribbed newts (Pleurodeles waltl), an experimental model animal for regeneration.


    Hayashi, Toshinori; Sakamoto, Kousuke; Sakuma, Tetsushi; Yokotani, Naoki; Inoue, Takeshi; Kawaguchi, Eri; Agata, Kiyokazu; Yamamoto, Takashi; Takeuchi, Takashi


    Regeneration of a lost tissue in an animal is an important issue. Although regenerative studies have a history of research spanning more than a century, the gene functions underlying regulation of the regeneration are mostly unclear. Analysis of knockout animals is a very powerful tool with which to elucidate gene function. Recently, transcription activator-like effector nucleases (TALENs) have been developed as an effective technique for genome editing. This technique enables gene targeting in amphibians such as newts that were previously impossible. Here we show that newts microinjected with TALEN mRNAs designed for targeting the tyrosinase gene in single-cell stage embryos revealed an albino phenotype. Sequence analysis revealed that the tyrosinase genes were effectively disrupted in these albino newts. Moreover, precise genome alteration was achieved using TALENs and single strand oligodeoxyribonucleotides. Our results suggest that TALENs are powerful tools for genome editing for regenerative research in newts.

  1. Transcriptional activation of LON Gene by a new form of mitochondrial stress: A role for the nuclear respiratory factor 2 in StAR overload response (SOR).


    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Isaac, Sara; Eden, Amir; Lauria, Ines; Langer, Thomas; Orly, Joseph


    High output of steroid hormone synthesis in steroidogenic cells of the adrenal cortex and the gonads requires the expression of the steroidogenic acute regulatory protein (StAR) that facilitates cholesterol mobilization to the mitochondrial inner membrane where the CYP11A1/P450scc enzyme complex converts the sterol to the first steroid. Earlier studies have shown that StAR is active while pausing on the cytosolic face of the outer mitochondrial membrane while subsequent import of the protein into the matrix terminates the cholesterol mobilization activity. Consequently, during repeated activity cycles, high level of post-active StAR accumulates in the mitochondrial matrix. To prevent functional damage due to such protein overload effect, StAR is degraded by a sequence of three to four ATP-dependent proteases of the mitochondria protein quality control system, including LON and the m-AAA membranous proteases AFG3L2 and SPG7/paraplegin. Furthermore, StAR expression in both peri-ovulatory ovarian cells, or under ectopic expression in cell line models, results in up to 3-fold enrichment of the mitochondrial proteases and their transcripts. We named this novel form of mitochondrial stress as StAR overload response (SOR). To better understand the SOR mechanism at the transcriptional level we analyzed first the unexplored properties of the proximal promoter of the LON gene. Our findings suggest that the human nuclear respiratory factor 2 (NRF-2), also known as GA binding protein (GABP), is responsible for 88% of the proximal promoter activity, including the observed increase of transcription in the presence of StAR. Further studies are expected to reveal if common transcriptional determinants coordinate the SOR induced transcription of all the genes encoding the SOR proteases.

  2. Cohesin modulates transcription of estrogen-responsive genes.


    Antony, Jisha; Dasgupta, Tanushree; Rhodes, Jenny M; McEwan, Miranda V; Print, Cristin G; O'Sullivan, Justin M; Horsfield, Julia A


    The cohesin complex has essential roles in cell division, DNA damage repair and gene transcription. The transcriptional function of cohesin is thought to derive from its ability to connect distant regulatory elements with gene promoters. Genome-wide binding of cohesin in breast cancer cells frequently coincides with estrogen receptor alpha (ER), leading to the hypothesis that cohesin facilitates estrogen-dependent gene transcription. We found that cohesin modulates the expression of only a subset of genes in the ER transcription program, either activating or repressing transcription depending on the gene target. Estrogen-responsive genes most significantly influenced by cohesin were enriched in pathways associated with breast cancer progression such as PI3K and ErbB1. In MCF7 breast cancer cells, cohesin depletion enhanced transcription of TFF1 and TFF2, and was associated with increased ER binding and increased interaction between TFF1 and its distal enhancer situated within TMPRSS3. In contrast, cohesin depletion reduced c-MYC mRNA and was accompanied by reduced interaction between a distal enhancer of c-MYC and its promoters. Our data indicates that cohesin is not a universal facilitator of ER-induced transcription and can even restrict enhancer-promoter communication. We propose that cohesin modulates transcription of estrogen-dependent genes to achieve appropriate directionality and amplitude of expression.

  3. Thyroid active agents T3 and PTU differentially affect immune gene transcripts in the head kidney of rainbow trout (Oncorynchus mykiss).


    Quesada-García, Alba; Encinas, Paloma; Valdehita, Ana; Baumann, Lisa; Segner, Helmut; Coll, Julio M; Navas, José M


    In mammals, numerous reports describe an immunomodulating effect of thyroid-active compounds. In contrast, only few reports have been published on this subject in fish. We previously demonstrated that immune cells of rainbow trout (Oncorhynchus mykiss) possess thyroid hormone receptors (THRs) and that exposure of trout to the thyroid hormone 3,3',5-triiodo-l-thyronine (T3) or the antithyroid drug propylthiouracil (PTU) alters immune cell transcript levels of THR and several immune genes. The present study aims to further characterize the immunomodulating action of thyroid-active compounds in trout immune cells. We report here the use of a custom-designed 60-mer oligo immune-targeted microarray for rainbow trout to analyze the gene expression profiles induced in the head kidney by T3 and PTU. Morphometric analyses of the thyroid showed that PTU exposure increased the size of the epithelial cells, whereas T3 induced no significant effects. Both T3 and PTU had diverse and partly contrasting effects on immune transcript profiles. The strongest differential effects of T3 and PTU on gene expressions were those targeting the Mitogen Associated Protein Kinase (MAPK), NFkB, Natural Killer (NK) and Toll-Like Receptor (TLR) pathways, a number of multipath genes (MPG) such as those encoding pleiotropic transcription factors (atf1, junb, myc), as well as important pro-inflammatory genes (tnfa, tnf6, il1b) and interferon-related genes (ifng, irf10). With these results we show for the first time in a fish species that the in vivo thyroidal status modulates a diversity of immune genes and pathways. This knowledge provides the basis to investigate both mechanisms and consequences of thyroid hormone- and thyroid disruptor-mediated immunomodulation for the immunocompetence of fish. PMID:26963519

  4. Thyroid active agents T3 and PTU differentially affect immune gene transcripts in the head kidney of rainbow trout (Oncorynchus mykiss).


    Quesada-García, Alba; Encinas, Paloma; Valdehita, Ana; Baumann, Lisa; Segner, Helmut; Coll, Julio M; Navas, José M


    In mammals, numerous reports describe an immunomodulating effect of thyroid-active compounds. In contrast, only few reports have been published on this subject in fish. We previously demonstrated that immune cells of rainbow trout (Oncorhynchus mykiss) possess thyroid hormone receptors (THRs) and that exposure of trout to the thyroid hormone 3,3',5-triiodo-l-thyronine (T3) or the antithyroid drug propylthiouracil (PTU) alters immune cell transcript levels of THR and several immune genes. The present study aims to further characterize the immunomodulating action of thyroid-active compounds in trout immune cells. We report here the use of a custom-designed 60-mer oligo immune-targeted microarray for rainbow trout to analyze the gene expression profiles induced in the head kidney by T3 and PTU. Morphometric analyses of the thyroid showed that PTU exposure increased the size of the epithelial cells, whereas T3 induced no significant effects. Both T3 and PTU had diverse and partly contrasting effects on immune transcript profiles. The strongest differential effects of T3 and PTU on gene expressions were those targeting the Mitogen Associated Protein Kinase (MAPK), NFkB, Natural Killer (NK) and Toll-Like Receptor (TLR) pathways, a number of multipath genes (MPG) such as those encoding pleiotropic transcription factors (atf1, junb, myc), as well as important pro-inflammatory genes (tnfa, tnf6, il1b) and interferon-related genes (ifng, irf10). With these results we show for the first time in a fish species that the in vivo thyroidal status modulates a diversity of immune genes and pathways. This knowledge provides the basis to investigate both mechanisms and consequences of thyroid hormone- and thyroid disruptor-mediated immunomodulation for the immunocompetence of fish.

  5. Iron-regulated transcription of the pvdA gene in Pseudomonas aeruginosa: effect of Fur and PvdS on promoter activity.

    PubMed Central

    Leoni, L; Ciervo, A; Orsi, N; Visca, P


    The pvdA gene, encoding the enzyme L-ornithine N5-oxygenase, catalyzes a key step of the pyoverdin biosynthetic pathway in Pseudomonas aeruginosa. Expression studies with a promoter probe vector made it possible to identify three tightly iron-regulated promoter regions in the 5.9-kb DNA fragment upstream of pvdA. The promoter governing pvdA expression was located within the 154-bp sequence upstream of the pvdA translation start site. RNA analysis showed that expression of PvdA is iron regulated at the transcriptional level. Primer extension and S1 mapping experiments revealed two 5'termini of the pvdA transcript, 68 bp (T1) and 43 bp (T2) 5' of the PvdA initiation. The pvdA transcripts were monocystronic, with T1 accounting for 90% of the pvdA mRNA. Fur box-like sequences were apparently absent in the regions 5' of pvdA transcription start sites. A sequence motif resembling the -10 hexamer of AlgU-dependent promoters and the iron starvation box of pyoverdin genes controlled by the sigmaE -like factor PvdS were identified 5' of the T1 start site. The minimum DNA region required for iron-regulated promoter activity was mapped from bp -41 to -154 relative to the ATG translation start site of pvdA. We used pvdA'::lacZ transcriptional fusions and Northern (RNA) analyses to study the involvement of Fur and PvdS in the iron-regulated expression of pvdA. Two fur mutants of P. aeruginosa were much less responsive than wild-type PAO1 to the iron-dependent regulation of pvdA expression. Transcription from the pvdA promoter did not occur in a heterologous host unless in the presence of the pvdS gene in trans and was abrogated in a pvdS mutant of P. aeruginosa. Interaction of the Fur repressor with a 150-bp fragment encompassing the pvdS promoter was demonstrated in vivo by the Fur titration assay and confirmed in vitro by gel retardation experiments with a partially purified Fur preparation. Conversely, the promoter region of pvdA did not interact with Fur. Our results support

  6. Induction of the Gene Encoding Macrophage Chemoattractant Protein 1 by Orientia tsutsugamushi in Human Endothelial Cells Involves Activation of Transcription Factor Activator Protein 1

    PubMed Central

    Cho, Nam-Hyuk; Seong, Seung-Yong; Huh, Myung-Sook; Kim, Na-Hyun; Choi, Myung-sik; Kim, Ik-sang


    Human macrophage chemoattractant protein 1 (MCP-1) is a potent mediator of macrophage migration and therefore plays an essential role in early events of inflammation. In endothelial cells, at least three independent pathways regulate MCP-1 expression by NF-κB and AP-1. Orientia tsutsugamushi causes vasculitis in humans by replicating inside macrophages and endothelial cells. In the present study, we investigated the cis-acting and trans-acting elements involved in O. tsutsugamushi-induced MCP-1 gene expression in human umbilical vein endothelial cells (HUVEC). Although NF-κB activation was observed in HUVEC infected with O. tsutsugamushi, inhibition of NF-κB activation did not affect the MCP-1 expression. However, treatment of HUVEC with extracellular signal-regulated kinase (ERK) kinase inhibitor or p38 mitogen-activated protein kinase (MAPK) inhibitor suppressed expression of MCP-1 mRNA concomitant with downregulation of activator protein 1 (AP-1) activation. Deletion of triphorbol acetate response elements (TRE) at position −69 to −63 of MCP-1 gene abolished inducible promoter activity. Deletion of TRE at position −69 to −63−96 to −90 or deletion of NF-κB-binding site at position −69 to −63−88 to −79 did not affect the inducibility of promoter. Site-directed mutagenesis of the NF-κB binding sites at positions −2640 to −2632, −2612 to −2603 in the enhancer region, or the AP-1 biding site at position −2276 to −2270 decreased the inducible activity of the promoter. Taken together, AP-1 activation by both the ERK pathway and the p38 MAPK pathway as well as their binding to TRE at position −69 to −63 in proximal promoter and TRE at position −2276 to −2270 in enhancer region is altogether essential in induction of MCP-1 mRNA in HUVEC infected with O. tsutsugamushi. Although NF-κB activation is not essential per se, the κB site in the enhancer region is important in MCP-1 induction of HUVEC. This discrepancy in the

  7. Transcriptionally active immediate-early protein of pseudorabies virus binds to specific sites on class II gene promoters.

    PubMed Central

    Cromlish, W A; Abmayr, S M; Workman, J L; Horikoshi, M; Roeder, R G


    In the presence of partially purified pseudorabies virus immediate-early protein, multiple sites of DNase I protection were observed on the adenovirus major late and human hsp 70 promoters. Southwestern (DNA-protein blot) analysis demonstrated that the immediate-early protein bound directly to the sequences contained in these sites. These sequences share only limited homology, differ in their affinities for the immediate-early protein, and are located at different positions on these two promoters. In addition, the site-specific binding of a temperature-sensitive immediate-early protein was eliminated by the same heat treatment which eliminates its transcriptional activating function, whereas the binding of the wild-type protein was unaffected by heat treatment. Thus, site-specific binding requires a functionally active immediate-early protein. Furthermore, immediate-early-protein-dependent in vitro transcription from the major late promoter was preferentially inhibited by oligonucleotides which are homologous to the high-affinity binding sites on the major late or hsp 70 promoters. These observations suggest that transcriptional stimulation by the immediate-early protein involves binding to cis-acting elements. Images PMID:2539489

  8. A Complete Set of Nascent Transcription Rates for Yeast Genes

    PubMed Central

    Pelechano, Vicent; Chávez, Sebastián; Pérez-Ortín, José E.


    The amount of mRNA in a cell is the result of two opposite reactions: transcription and mRNA degradation. These reactions are governed by kinetics laws, and the most regulated step for many genes is the transcription rate. The transcription rate, which is assumed to be exercised mainly at the RNA polymerase recruitment level, can be calculated using the RNA polymerase densities determined either by run-on or immunoprecipitation using specific antibodies. The yeast Saccharomyces cerevisiae is the ideal model organism to generate a complete set of nascent transcription rates that will prove useful for many gene regulation studies. By combining genomic data from both the GRO (Genomic Run-on) and the RNA pol ChIP-on-chip methods we generated a new, more accurate nascent transcription rate dataset. By comparing this dataset with the indirect ones obtained from the mRNA stabilities and mRNA amount datasets, we are able to obtain biological information about posttranscriptional regulation processes and a genomic snapshot of the location of the active transcriptional machinery. We have obtained nascent transcription rates for 4,670 yeast genes. The median RNA polymerase II density in the genes is 0.078 molecules/kb, which corresponds to an average of 0.096 molecules/gene. Most genes have transcription rates of between 2 and 30 mRNAs/hour and less than 1% of yeast genes have >1 RNA polymerase molecule/gene. Histone and ribosomal protein genes are the highest transcribed groups of genes and other than these exceptions the transcription of genes is an infrequent phenomenon in a yeast cell. PMID:21103382

  9. Genome-wide specificity of DNA binding, gene regulation, and chromatin remodeling by TALE- and CRISPR/Cas9-based transcriptional activators.


    Polstein, Lauren R; Perez-Pinera, Pablo; Kocak, D Dewran; Vockley, Christopher M; Bledsoe, Peggy; Song, Lingyun; Safi, Alexias; Crawford, Gregory E; Reddy, Timothy E; Gersbach, Charles A


    Genome engineering technologies based on the CRISPR/Cas9 and TALE systems are enabling new approaches in science and biotechnology. However, the specificity of these tools in complex genomes and the role of chromatin structure in determining DNA binding are not well understood. We analyzed the genome-wide effects of TALE- and CRISPR-based transcriptional activators in human cells using ChIP-seq to assess DNA-binding specificity and RNA-seq to measure the specificity of perturbing the transcriptome. Additionally, DNase-seq was used to assess genome-wide chromatin remodeling that occurs as a result of their action. Our results show that these transcription factors are highly specific in both DNA binding and gene regulation and are able to open targeted regions of closed chromatin independent of gene activation. Collectively, these results underscore the potential for these technologies to make precise changes to gene expression for gene and cell therapies or fundamental studies of gene function.

  10. ZCT1 and ZCT2 transcription factors repress the activity of a gene promoter from the methyl erythritol phosphate pathway in Madagascar periwinkle cells.


    Chebbi, Mouadh; Ginis, Olivia; Courdavault, Vincent; Glévarec, Gaëlle; Lanoue, Arnaud; Clastre, Marc; Papon, Nicolas; Gaillard, Cécile; Atanassova, Rossitza; St-Pierre, Benoit; Giglioli-Guivarc'h, Nathalie; Courtois, Martine; Oudin, Audrey


    In Catharanthus roseus, accumulating data highlighted the existence of a coordinated transcriptional regulation of structural genes that takes place within the secoiridoid biosynthetic branch, including the methyl erythritol phosphate (MEP) pathway and the following steps leading to secologanin. To identify transcription factors acting in these pathways, we performed a yeast one-hybrid screening using as bait a promoter region of the hydroxymethylbutenyl 4-diphosphate synthase (HDS) gene involved in the responsiveness of C. roseus cells to hormonal signals inducing monoterpene indole alkaloid (MIA) production. We identified that ZCT2, one of the three members of the zinc finger Catharanthus protein (ZCT) family, can bind to a HDS promoter region involved in hormonal responsiveness. By trans-activation assays, we demonstrated that ZCT1 and ZCT2 but not ZCT3 repress the HDS promoter activity. Gene expression analyses in C. roseus cells exposed to methyljasmonate revealed a persistence of induction of ZCT2 gene expression suggesting the existence of feed-back regulatory events acting on HDS gene expression in correlation with the MIA production.

  11. CCAAT/enhancer-binding protein delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone

    NASA Technical Reports Server (NTRS)

    Umayahara, Y.; Ji, C.; Centrella, M.; Rotwein, P.; McCarthy, T. L.


    Insulin-like growth factor-I (IGF-I) plays a key role in skeletal growth by stimulating bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other cAMP-activating agents enhanced IGF-I gene transcription in cultured primary rat osteoblasts through promoter 1, the major IGF-I promoter, and identified a short segment of the promoter, termed HS3D, that was essential for hormonal regulation of IGF-I gene expression. We now demonstrate that CCAAT/enhancer-binding protein (C/EBP) delta is a major component of a PGE2-stimulated DNA-protein complex involving HS3D and find that C/EBPdelta transactivates IGF-I promoter 1 through this site. Competition gel shift studies first indicated that a core C/EBP half-site (GCAAT) was required for binding of a labeled HS3D oligomer to osteoblast nuclear proteins. Southwestern blotting and UV-cross-linking studies showed that the HS3D probe recognized a approximately 35-kDa nuclear protein, and antibody supershift assays indicated that C/EBPdelta comprised most of the PGE2-activated gel-shifted complex. C/EBPdelta was detected by Western immunoblotting in osteoblast nuclear extracts after treatment of cells with PGE2. An HS3D oligonucleotide competed effectively with a high affinity C/EBP site from the rat albumin gene for binding to osteoblast nuclear proteins. Co-transfection of osteoblast cell cultures with a C/EBPdelta expression plasmid enhanced basal and PGE2-activated IGF-I promoter 1-luciferase activity but did not stimulate a reporter gene lacking an HS3D site. By contrast, an expression plasmid for the related protein, C/EBPbeta, did not alter basal IGF-I gene activity but did increase the response to PGE2. In osteoblasts and in COS-7 cells, C/EBPdelta, but not C/EBPbeta, transactivated a reporter gene containing four tandem copies of HS3D fused to a minimal promoter; neither transcription factor stimulated a gene with four copies of an HS3D mutant that was unable to bind osteoblast

  12. Gene Transcription Profile of the Detached Retina (An AOS Thesis)

    PubMed Central

    Zacks, David N.


    Purpose: Separation of the neurosensory retina from the retinal pigment epithelium (RPE) yields many morphologic and functional consequences, including death of the photoreceptor cells, Müller cell hypertrophy, and inner retinal rewiring. Many of these changes are due to the separation-induced activation of specific genes. In this work, we define the gene transcription profile within the retina as a function of time after detachment. We also define the early activation of kinases that might be responsible for the detachment-induced changes in gene transcription. Methods: Separation of the retina from the RPE was induced in Brown-Norway rats by the injection of 1% hyaluronic acid into the subretinal space. Retinas were harvested at 1, 7, and 28 days after separation. Gene transcription profiles for each time point were determined using the Affymetrix Rat 230A gene microarray chip. Transcription levels in detached retinas were compared to those of nondetached retinas with the BRB-ArrayTools Version 3.6.0 using a random variance analysis of variance (ANOVA) model. Confirmation of the significant transcriptional changes for a subset of the genes was performed using microfluidic quantitative real-time polymerase chain reaction (qRT-PCR) assays. Kinase activation was explored using Western blot analysis to look for early phosphorylation of any of the 3 main families of mitogen-activated protein kinases (MAPK): the p38 family, the Janus kinase family, and the p42/p44 family. Results: Retinas separated from the RPE showed extensive alterations in their gene transcription profile. Many of these changes were initiated as early as 1 day after separation, with significant increases by 7 days. ANOVA analysis defined 144 genes that had significantly altered transcription levels as a function of time after separation when setting a false discovery rate at ≤0.1. Confirmatory RT-PCR was performed on 51 of these 144 genes. Differential transcription detected on the microarray

  13. Chromatin insulation by a transcriptional activator

    PubMed Central

    Sutter, Nathan B.; Scalzo, David; Fiering, Steven; Groudine, Mark; Martin, David I. K.


    In eukaryotic genomes, transcriptionally active regions are interspersed with silent chromatin that may repress genes in its vicinity. Chromatin insulators are elements that can shield a locus from repressive effects of flanking chromatin. Few such elements have been characterized in higher eukaryotes, but transcriptional activating elements are an invariant feature of active loci and have been shown to suppress transgene silencing. Hence, we have assessed the ability of a transcriptional activator to cause chromatin insulation, i.e., to relieve position effects at transgene integration sites in cultured cells. The transgene contained a series of binding sites for the metal-inducible transcriptional activator MTF, linked to a GFP reporter. Clones carrying single integrated transgenes were derived without selection for expression, and in most clones the transgene was silent. Induction of MTF resulted in transition of the transgene from the silent to the active state, prolongation of the active state, and a marked narrowing of the range of expression levels at different genomic sites. At one genomic site, prolonged induction of MTF resulted in suppression of transgene silencing that persisted after withdrawal of the induction stimulus. These results are consistent with MTF acting as a chromatin insulator and imply that transcriptional activating elements can insulate active loci against chromatin repression. PMID:12547916

  14. Yeast zinc cluster proteins Dal81 and Uga3 cooperate by targeting common coactivators for transcriptional activation of γ-aminobutyrate responsive genes.


    Sylvain, Marc-André; Liang, Xiao Bei; Hellauer, Karen; Turcotte, Bernard


    In Saccharomyces cerevisiae, optimal utilization of various compounds as a nitrogen source is mediated by a complex transcriptional network. The zinc cluster protein Dal81 is a general activator of nitrogen metabolic genes, including those for γ-aminobutyrate (GABA). In contrast, Uga3 (another zinc cluster protein) is an activator restricted to the control of genes involved in utilization of GABA. Uga3 binds to DNA elements found in the promoters of target genes and increases their expression in the presence of GABA. Dal81 appears to act as a coactivator since the DNA-binding activity of this factor is dispensable but its mode of action is not known. In this study, we have mapped a regulatory, as well as an activating, region for Uga3. A LexA-Uga3 chimeric protein activates a lexA reporter in a GABA- and Dal81-dependent manner. Activation by Uga3 requires the SAGA complex as well as Gal11, a component of mediator. ChIP analysis revealed that Uga3 is weakly bound to target promoters. The presence of GABA enhances binding of Uga3 and allows recruitment of Dal81 and Gal11 to target genes. Recruitment of Gal11 is prevented in the absence of Dal81. Importantly, Dal81 by itself is a potent activator when tethered to DNA and its activity depends on SAGA and Gal11 but not Uga3. Overexpression of Uga3 bypasses the requirement for Dal81 but not for SAGA or Gal11. Thus, under artificial conditions, both Dal81 and Uga3 can activate transcription independently of each other. However, under physiological conditions, both factors cooperate by targeting common coactivators.

  15. Gene expression profiling reveals the heterogeneous transcriptional activity of Oct3/4 and its possible interaction with Gli2 in mouse embryonic stem cells.


    Li, Yanzhen; Drnevich, Jenny; Akraiko, Tatiana; Band, Mark; Li, Dong; Wang, Fei; Matoba, Ryo; Tanaka, Tetsuya S


    We examined the transcriptional activity of Oct3/4 (Pou5f1) in mouse embryonic stem cells (mESCs) maintained under standard culture conditions to gain a better understanding of self-renewal in mESCs. First, we built an expression vector in which the Oct3/4 promoter drives the monocistronic transcription of Venus and a puromycin-resistant gene via the foot-and-mouth disease virus self-cleaving peptide T2A. Then, a genetically-engineered mESC line with the stable integration of this vector was isolated and cultured in the presence or absence of puromycin. The cultures were subsequently subjected to Illumina expression microarray analysis. We identified approximately 4600 probes with statistically significant differential expression. The genes involved in nucleic acid synthesis were overrepresented in the probe set associated with mESCs maintained in the presence of puromycin. In contrast, the genes involved in cell differentiation were overrepresented in the probe set associated with mESCs maintained in the absence of puromycin. Therefore, it is suggested with these data that the transcriptional activity of Oct3/4 fluctuates in mESCs and that Oct3/4 plays an essential role in sustaining the basal transcriptional activities required for cell duplication in populations with equal differentiation potential. Heterogeneity in the transcriptional activity of Oct3/4 was dynamic. Interestingly, we found that genes involved in the hedgehog signaling pathway showed unique expression profiles in mESCs and validated this observation by RT-PCR analysis. The expression of Gli2, Ptch1 and Smo was consistently detected in other types of pluripotent stem cells examined in this study. Furthermore, the Gli2 protein was heterogeneously detected in mESC nuclei by immunofluorescence microscopy and this result correlated with the detection of the Oct3/4 protein. Finally, forced activation of Gli2 in mESCs increased their proliferation rate. Collectively, it is suggested with these results

  16. Decreased sucrase and lactase activity in iron deficiency is accompanied by reduced gene expression and upregulation of the transcriptional repressor PDX-1.


    West, Adrian R; Oates, Phillip S


    Disaccharidases are important digestive enzymes whose activities can be reduced by iron deficiency. We hypothesise that this is due to reduced gene expression, either by impairment to enterocyte differentiation or by iron-sensitive mechanisms that regulate mRNA levels in enterocytes. Iron-deficient Wistar rats were generated by dietary means. The enzyme activities and kinetics of sucrase and lactase were tested as well as the activity of intestinal alkaline phosphatase (IAP)-II because it is unrelated to carbohydrate digestion. mRNA levels of beta-actin, sucrase, lactase, and the associated transcription factors pancreatic duodenal homeobox (PDX)-1, caudal-related homeobox (CDX)-2, GATA-binding protein (GATA)-4, and hepatocyte nuclear factor (HNF)-1 were measured by real-time PCR. Spatial patterns of protein and gene expression were assessed by immunofluorescence and in situ hybridization, respectively. It was found that iron-deficient rats had significantly lower sucrase (19.5% lower) and lactase (56.8% lower) but not IAP-II activity than control rats. Kinetic properties of both enzymes remained unchanged from controls, suggesting a decrease in the quantity of enzyme present. Sucrase and lactase mRNA levels were reduced by 44.5% and 67.9%, respectively, by iron deficiency, suggesting that enzyme activity is controlled primarily by gene expression. Iron deficiency did not affect the pattern of protein and gene expression along the crypt to villus axis. Expression of PDX-1, a repressor of sucrase and lactase promoters, was 4.5-fold higher in iron deficiency, whereas CDX-2, GATA-4, and HNF-1 levels were not significantly different. These data suggest that decreases in sucrase and lactase activities result from a reduction in gene expression, following from increased levels of the transcriptional repressor PDX-1.

  17. Role of Flightless-I (Drosophila) homolog in the transcription activation of type I collagen gene mediated by transforming growth factor beta

    SciTech Connect

    Lim, Mi-Sun; Jeong, Kwang Won


    Highlights: • FLII activates TGFβ-mediated expression of COL1A2 gene. • TGFβ induces the association of FLII with SMAD3 and BRG1 in A549 cells. • FLII is required for the recruitment of SWI/SNF complex and chromatin accessibility to COL1A2 promoter. - Abstract: Flightless-I (Drosophila) homolog (FLII) is a nuclear receptor coactivator that is known to interact with other transcriptional regulators such as the SWI/SNF complex, an ATP-dependent chromatin-remodeling complex, at the promoter or enhancer region of estrogen receptor (ER)-α target genes. However, little is known about the role of FLII during transcription initiation in the transforming growth factor beta (TGFβ)/SMAD-dependent signaling pathway. Here, we demonstrate that FLII functions as a coactivator in the expression of type I collagen gene induced by TGFβ in A549 cells. FLII activates the reporter gene driven by COL1A2 promoter in a dose-dependent manner. Co-expression of GRIP1, CARM1, or p300 did not show any synergistic activation of transcription. Furthermore, the level of COL1A2 expression correlated with the endogenous level of FLII mRNA level. Depletion of FLII resulted in a reduction of TGFβ-induced expression of COL1A2 gene. In contrast, over-expression of FLII caused an increase in the endogenous expression of COL1A2. We also showed that FLII is associated with Brahma-related gene 1 (BRG1) as well as SMAD in A549 cells. Notably, the recruitment of BRG1 to the COL1A2 promoter region was decreased in FLII-depleted A549 cells, suggesting that FLII is required for TGFβ-induced chromatin remodeling, which is carried out by the SWI/SNF complex. Furthermore, formaldehyde-assisted isolation of regulatory elements (FAIRE)-quantitative polymerase chain reaction (qPCR) experiments revealed that depletion of FLII caused a reduction in chromatin accessibility at the COL1A2 promoter. These results suggest that FLII plays a critical role in TGFβ/SMAD-mediated transcription of the COL1A2 gene

  18. Transcription Activation by NtcA in the Absence of Consensus NtcA-Binding Sites in an Anabaena Heterocyst Differentiation Gene Promoter

    PubMed Central

    Camargo, Sergio; Valladares, Ana; Flores, Enrique


    Heterocyst differentiation is orchestrated by the N control transcriptional regulator NtcA and the differentiation-specific factor HetR. In Anabaena sp. strain PCC 7120, the devBCA operon is expressed from two different promoters activated upon N stepdown. The distal devB promoter (transcription start point [TSP] located at position −704) represents a canonical class II NtcA-activated promoter, including a consensus NtcA-binding site centered 39.5 nucleotides upstream from the TSP. Transcription activation from a second TSP (−454) requires NtcA and is impaired in hetR mutants. In a wild-type background, three different DNA fragments, including both or each individual promoter, directed gfp expression localized mainly to proheterocysts and heterocysts. Expression was undetectable in an ntcA background and, for the fragment including the proximal promoter alone, also in a hetR background. In spite of the absence of consensus NtcA-binding sequences between the two TSPs, NtcA was shown to interact with this DNA region, and NtcA and its effector, 2-oxoglutarate, were necessary and sufficient for in vitro transcription from the −454 TSP. No HetR binding to the DNA or in vitro transcription from the proximal devB TSP promoted by HetR alone were detected. However, a moderate positive effect of HetR on NtcA binding to the DNA between the two devB TSPs was observed. The proximal devB promoter appears to represent a suboptimal NtcA-activated promoter for which HetR may act as a coactivator, with the physiological effect of restricting gene activation to conditions of prevalence of high NtcA and HetR levels, such as those taking place during heterocyst differentiation. PMID:22467790

  19. Deficiency in p53 is required for doxorubicin induced transcriptional activation of NF-κB target genes in human breast cancer

    PubMed Central

    Dalmases, Alba; González, Irene; Menendez, Silvia; Arpí, Oriol; Corominas, Josep Maria; Servitja, Sonia; Tusquets, Ignasi; Chamizo, Cristina; Rincón, Raúl; Espinosa, Lluis; Bigas, Anna; Eroles, Pilar; Furriol, Jessica; Lluch, Anna; Rovira, Ana; Albanell, Joan; Rojo, Federico


    NF-κB has been linked to doxorubicin resistance in breast cancer patients. NF-κB nuclear translocation and DNA binding in doxorubicin treated-breast cancer cells have been extensively examined; however its functional relevance at transcriptional level on NF-κB -dependent genes and the biological consequences are unclear. We studied NF-κB -dependent gene expression induced by doxorubicin in breast cancer cells and fresh human cancer specimens with different genetic backgrounds focusing on their p53 status. NF-κB -dependent signature of doxorubicin was identified by gene expression microarrays in breast cancer cells treated with doxorubicin and the IKKβ-inhibitor MLN120B, and confirmed ex vivo in human cancer samples. The association with p53 was functionally validated. Finally, NF-κB activation and p53 status was determined in a cohort of breast cancer patients treated with adjuvant doxorubicin-based chemotherapy. Doxorubicin treatment in the p53-mutated MDA-MB-231 cells resulted in NF NF-κB driven-gene transcription signature. Modulation of genes related with invasion, metastasis and chemoresistance (ICAM-1, CXCL1, TNFAIP3, IL8) were confirmed in additional doxorubicin-treated cell lines and fresh primary human breast tumors. In both systems, p53-defcient background correlated with the activation of the NF-κB -dependent signature. Furthermore, restoration of p53WT in the mutant p53 MDA-MB-231 cells impaired NF-κB driven transcription induced by doxorubicin. Moreover, a p53 deficient background and nuclear NF-κB /p65 in breast cancer patients correlated with reduced disease free-survival. This study supports that p53 deficiency is necessary for a doxorubicin driven NF-κB -response that limits doxorubicin cytotoxicity in breast cancer and is linked to an aggressive clinical behavior. PMID:24344116

  20. Single molecule real-time sequencing of Xanthomonas oryzae genomes reveals a dynamic structure and complex TAL (transcription activator-like) effector gene relationships

    PubMed Central

    Booher, Nicholas J.; Carpenter, Sara C. D.; Sebra, Robert P.; Wang, Li; Salzberg, Steven L.; Leach, Jan E.; Bogdanove, Adam J.


    Pathogen-injected, direct transcriptional activators of host genes, TAL (transcription activator-like) effectors play determinative roles in plant diseases caused by Xanthomonas spp. A large domain of nearly identical, 33–35 aa repeats in each protein mediates DNA recognition. This modularity makes TAL effectors customizable and thus important also in biotechnology. However, the repeats render TAL effector (tal) genes nearly impossible to assemble using next-generation, short reads. Here, we demonstrate that long-read, single molecule real-time (SMRT) sequencing solves this problem. Taking an ensemble approach to first generate local, tal gene contigs, we correctly assembled de novo the genomes of two strains of the rice pathogen X. oryzae completed previously using the Sanger method and even identified errors in those references. Sequencing two more strains revealed a dynamic genome structure and a striking plasticity in tal gene content. Our results pave the way for population-level studies to inform resistance breeding, improve biotechnology and probe TAL effector evolution. PMID:27148456

  1. Sp5 and Sp8 recruit β-catenin and Tcf1-Lef1 to select enhancers to activate Wnt target gene transcription

    PubMed Central

    Kennedy, Mark W.; Chalamalasetty, Ravindra B.; Thomas, Sara; Garriock, Robert J.; Jailwala, Parthav; Yamaguchi, Terry P.


    The ancient, highly conserved, Wnt signaling pathway regulates cell fate in all metazoans. We have previously shown that combined null mutations of the specificity protein (Sp) 1/Klf-like zinc-finger transcription factors Sp5 and Sp8 (i.e., Sp5/8) result in an embryonic phenotype identical to that observed when core components of the Wnt/β-catenin pathway are mutated; however, their role in Wnt signal transduction is unknown. Here, we show in mouse embryos and differentiating embryonic stem cells that Sp5/8 are gene-specific transcriptional coactivators in the Wnt/β-catenin pathway. Sp5/8 bind directly to GC boxes in Wnt target gene enhancers and to adjacent, or distally positioned, chromatin-bound T-cell factor (Tcf) 1/lymphoid enhancer factor (Lef) 1 to facilitate recruitment of β-catenin to target gene enhancers. Because Sp5 is itself directly activated by Wnt signals, we propose that Sp5 is a Wnt/β-catenin pathway-specific transcripton factor that functions in a feed-forward loop to robustly activate select Wnt target genes. PMID:26969725

  2. Differential activation of transcription versus recombination of transgenic T cell receptor beta variable region gene segments in B and T lineage cells

    PubMed Central


    We have tested the ability of the T cell receptor beta (TCR-beta) transcriptional enhancer (E beta) to confer transcriptional activation and tissue-specific V(D)J recombination of TCR-beta V, D, and J segments in a transgenic minilocus recombination substrate. We find that the minimal E beta element, as previously shown for a DNA segment that contained the E mu element, promotes a high level of substrate D to J beta rearrangement in both B and T cells, but only promotes V beta to DJ beta rearrangement in T cells. Thus, both the E mu and E beta elements similarly direct V(D)J recombination of this substrate in vivo, supporting a general role for transcriptional enhancers in the normal regulation of this rearrangement process. Surprisingly, however, we found that both the V beta and DJ beta portion of the constructs were transcribed in an enhancer-dependent fashion (conferred by either E mu or E beta) in both B and T lineage cells, including normal precursor B cells propagated in culture. These findings indicate that, at least in some contexts, transcriptional activation, per se, is not sufficient to confer V(D)J recombinational accessibility to a substrate V gene segment. PMID:8006587

  3. Combining modelling and experimental approaches to explain how calcium signatures are decoded by calmodulin-binding transcription activators (CAMTAs) to produce specific gene expression responses.


    Liu, Junli; Whalley, Helen J; Knight, Marc R


    Experimental data show that Arabidopsis thaliana is able to decode different calcium signatures to produce specific gene expression responses. It is also known that calmodulin-binding transcription activators (CAMTAs) have calmodulin (CaM)-binding domains. Therefore, the gene expression responses regulated by CAMTAs respond to calcium signals. However, little is known about how different calcium signatures are decoded by CAMTAs to produce specific gene expression responses. A dynamic model of Ca(2+) -CaM-CAMTA binding and gene expression responses is developed following thermodynamic and kinetic principles. The model is parameterized using experimental data. Then it is used to analyse how different calcium signatures are decoded by CAMTAs to produce specific gene expression responses. Modelling analysis reveals that: calcium signals in the form of cytosolic calcium concentration elevations are nonlinearly amplified by binding of Ca(2+) , CaM and CAMTAs; amplification of Ca(2+) signals enables calcium signatures to be decoded to give specific CAMTA-regulated gene expression responses; gene expression responses to a calcium signature depend upon its history and accumulate all the information during the lifetime of the calcium signature. Information flow from calcium signatures to CAMTA-regulated gene expression responses has been established by combining experimental data with mathematical modelling.

  4. Combining modelling and experimental approaches to explain how calcium signatures are decoded by calmodulin-binding transcription activators (CAMTAs) to produce specific gene expression responses.


    Liu, Junli; Whalley, Helen J; Knight, Marc R


    Experimental data show that Arabidopsis thaliana is able to decode different calcium signatures to produce specific gene expression responses. It is also known that calmodulin-binding transcription activators (CAMTAs) have calmodulin (CaM)-binding domains. Therefore, the gene expression responses regulated by CAMTAs respond to calcium signals. However, little is known about how different calcium signatures are decoded by CAMTAs to produce specific gene expression responses. A dynamic model of Ca(2+) -CaM-CAMTA binding and gene expression responses is developed following thermodynamic and kinetic principles. The model is parameterized using experimental data. Then it is used to analyse how different calcium signatures are decoded by CAMTAs to produce specific gene expression responses. Modelling analysis reveals that: calcium signals in the form of cytosolic calcium concentration elevations are nonlinearly amplified by binding of Ca(2+) , CaM and CAMTAs; amplification of Ca(2+) signals enables calcium signatures to be decoded to give specific CAMTA-regulated gene expression responses; gene expression responses to a calcium signature depend upon its history and accumulate all the information during the lifetime of the calcium signature. Information flow from calcium signatures to CAMTA-regulated gene expression responses has been established by combining experimental data with mathematical modelling. PMID:25917109

  5. Nuclear factor of activated T cell (NFAT) transcription proteins regulate genes involved in adipocyte metabolism and lipolysis

    SciTech Connect

    Holowachuk, Eugene W. . E-mail:


    NFAT involvement in adipocyte physiological processes was examined by treatment with CsA and/or GSK3{beta} inhibitors (Li{sup +} or TZDZ-8), which prevent or increase NFAT nuclear translocation, respectively. CsA treatment reduced basal and TNF{alpha}-induced rates of lipolysis by 50%. Adipocytes preincubated with Li{sup +} or TZDZ-8 prior to CsA and/or TNF{alpha}, exhibited enhanced basal rates of lipolysis and complete inhibition of CsA-mediated decreased rates of lipolysis. CsA treatment dramatically reduced the mRNA levels of adipocyte-specific genes (aP2, HSL, PPAR{gamma}, ACS and Adn), compared with control or TNF{alpha}-treatment, whereas Li{sup +} pretreatment blocked the inhibitory effects of CsA, and mRNA levels of aP2, HSL, PPAR{gamma}, and ACS were found at or above control levels. NFAT nuclear localization, assessed by EMSA, confirmed that CsA or Li{sup +} treatments inhibited or increased NFAT nuclear translocation, respectively. These results show that NFAT proteins in mature adipocytes participate in the transcriptional control of genes involved in adipocyte metabolism and lipolysis.

  6. Budesonide epimer R or dexamethasone selectively inhibit platelet-activating factor-induced or interleukin 1β-induced DNA binding activity of cis-acting transcription factors and cyclooxygenase-2 gene expression in human epidermal keratinocytes

    PubMed Central

    Lukiw, Walter J.; Pelaez, Ricardo Palacios; Martinez, Jorge; Bazan, Nicolas G.


    To further understand the molecular mechanism of glucocorticoid action on gene expression, DNA-binding activities of the cis-acting transcription factors activator protein 1 (AP1), AP2, Egr1 (zif268), NF-κB, the signal transducers and activators of transcription proteins gamma interferon activation site (GAS), Sis-inducible element, and the TATA binding protein transcription factor II D (TFIID) were examined in human epidermal keratinocytes. The cytokine interleukin 1β (IL-1β) and platelet-activating factor (PAF), both potent mediators of inflammation, were used as triggers for gene expression. Budesonide epimer R (BUDeR) and dexamethasone (DEX) were studied as potential antagonists. BUDeR or DEX before IL-1β- or PAF-mediated gene induction elicited strong inhibition of AP1-, GAS-, and in particular NF-κB-DNA binding (P < 0.001, ANOVA). Only small effects were noted on AP2, Egr1 (zif268), and Sis-inducible element-DNA binding (P > 0.05). No significant effect was noted on the basal transcription factor TFIID recognition of TATA-containing core promoter sequences (P > 0.68). To test the hypothesis that changing cis-acting transcription factor binding activity may be involved in inflammatory-response related gene transcription, RNA message abundance for human cyclooxygenase (COX)-1 and -2 (E.C. was assessed in parallel by using reverse transcription–PCR. Although the COX-1 gene was found to be expressed at constitutively low levels, the TATA-containing COX-2 gene, which contains AP1-like, GAS, and NF-κB DNA-binding sites in its immediate promoter, was found to be strongly induced by IL-1β or PAF (P < 0.001). BUDeR and DEX both suppressed COX-2 RNA message generation; however, no correlation was associated with TFIID–DNA binding. These results suggest that on stimulation by mediators of inflammation, although the basal transcription machinery remains intact, modulation of cis-activating transcription factor AP1, GAS, and NF-κB-DNA binding by the

  7. Remodeling of global transcription patterns of Cryptococcus neoformans genes mediated by the stress-activated HOG signaling pathways.


    Ko, Young-Joon; Yu, Yeong Man; Kim, Gyu-Bum; Lee, Gir-Won; Maeng, Pil Jae; Kim, Sangsoo; Floyd, Anna; Heitman, Joseph; Bahn, Yong-Sun


    The ability to sense and adapt to a hostile host environment is a crucial element for virulence of pathogenic fungi, including Cryptococcus neoformans. These cellular responses are evoked by diverse signaling cascades, including the stress-activated HOG pathway. Despite previous analysis of central components of the HOG pathway, its downstream signaling network is poorly characterized in C. neoformans. Here we performed comparative transcriptome analysis with HOG signaling mutants to explore stress-regulated genes and their correlation with the HOG pathway in C. neoformans. In this study, we not only provide important insights into remodeling patterns of global gene expression for counteracting external stresses but also elucidate novel characteristics of the HOG pathway in C. neoformans. First, inhibition of the HOG pathway increases expression of ergosterol biosynthesis genes and cellular ergosterol content, conferring a striking synergistic antifungal activity with amphotericin B and providing an excellent opportunity to develop a novel therapeutic method for treatment of cryptococcosis. Second, a number of cadmium-sensitive genes are differentially regulated by the HOG pathway, and their mutation causes resistance to cadmium. Finally, we have discovered novel stress defense and HOG-dependent genes, which encode a sodium/potassium efflux pump, protein kinase, multidrug transporter system, and elements of the ubiquitin-dependent system.

  8. Transforming growth factor-alpha-induced transcriptional activation of the vascular permeability factor (VPF/VEGF) gene requires AP-2-dependent DNA binding and transactivation.

    PubMed Central

    Gille, J; Swerlick, R A; Caughman, S W


    The endothelial cell-specific mitogen vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) represents a central regulator of cutaneous angiogenesis. Increased VPF/VEGF expression has recently been reported in psoriatic skin and healing wounds, both conditions in which transforming growth factor-alpha (TGF alpha) and its ligand, the epidermal growth factor receptor, are markedly up-regulated. Since TGF alpha strongly induces VPF/VEGF synthesis in keratinocytes, TGF alpha-mediated VPF/VEGF expression is likely to play a significant role in the initiation and maintenance of increased vascular hyperpermeability and hyperproliferation in skin biology. The objectives of the present studies were to determine the molecular mechanisms responsible for TGF alpha-induced transcriptional activation of the VPF/VEGF gene. We have identified a GC-rich TGF alpha-responsive region between -88 bp and -65 bp of the VPF/VEGF promoter that is necessary for constitutive and TGF alpha-inducible transcriptional activation. In electrophoretic mobility shift assays, this region binds Sp1-dependent protein complexes constitutively and an additional TGF alpha-inducible protein complex that is distinct from Sp1 protein. Both AP-2 and Egr-1 transcription factors were detected as components of the TGF alpha-inducible protein complex in supershift EMSA studies. In co-transfection studies, an AP-2 but not an Egr-1 expression vector activated VPF/VEGF transcription, thus indicating that AP-2 protein is functionally important in TGF alpha-induced VPF/VEGF gene expression. By clarifying regulatory mechanisms that are critical for angiogenic processes in the skin, these studies may form the basis for new therapeutic strategies to modulate VPF/VEGF expression in cutaneous inflammation and wound healing. PMID:9049304

  9. A cluster region of AP-1 responsive elements is required for transcriptional activity of mouse ODC gene by hepatocyte growth factor.


    Bianchi, Laura; Tacchini, Lorenza; Matteucci, Emanuela; Desiderio, Maria Alfonsina


    Ornithine decarboxylase (ODC) activity is regulated by a variety of mechanisms including transcription, translation, and RNA and protein half-life. Since in mouse B16-F1 melanoma cells an early and remarkable (about 6-fold) increase in steady state mRNA levels was observed after hepatocyte growth factor (HGF) treatment, we investigated the transcriptional regulation of mouse ODC promoter. Transient transfection of various ODC-luciferase promoter constructs into the B16-Fl cells in combination with electrophoretic mobility shift assays identified the HGF-responsive element as a cluster of three AP-1 binding sites (-1660 to -1572). Even if each site differs from the canonical TPA responsive element for one nucleotide, only the first two AP-1 consensus sequences seemed to be functional since allowed DNA-binding activity of nuclear proteins after HGF treatment. Comparison of the results of transfection assays with the pOD2.5-luc (2.5 kb gene fragment) and with the construct deprived of the AP-1 cluster pOD-B-luc showed that this 50 bp region was required for ODC transactivating activity in response to HGF. Since in B16-F1 cells HGF increased AP-1 activity and the mRNA expression of various AP-1 subunits, we may conclude that HGF-induced transcription of mouse ODC was largely due to triggering of AP-1 pathway. PMID:12054494

  10. Gene target specificity of the Super Elongation Complex (SEC) family: how HIV-1 Tat employs selected SEC members to activate viral transcription.


    Lu, Huasong; Li, Zichong; Zhang, Wei; Schulze-Gahmen, Ursula; Xue, Yuhua; Zhou, Qiang


    The AF4/FMR2 proteins AFF1 and AFF4 act as a scaffold to assemble the Super Elongation Complex (SEC) that strongly activates transcriptional elongation of HIV-1 and cellular genes. Although they can dimerize, it is unclear whether the dimers exist and function within a SEC in vivo. Furthermore, it is unknown whether AFF1 and AFF4 function similarly in mediating SEC-dependent activation of diverse genes. Providing answers to these questions, our current study shows that AFF1 and AFF4 reside in separate SECs that display largely distinct gene target specificities. While the AFF1-SEC is more potent in supporting HIV-1 transactivation by the viral Tat protein, the AFF4-SEC is more important for HSP70 induction upon heat shock. The functional difference between AFF1 and AFF4 in Tat-transactivation has been traced to a single amino acid variation between the two proteins, which causes them to enhance the affinity of Tat for P-TEFb, a key SEC component, with different efficiency. Finally, genome-wide analysis confirms that the genes regulated by AFF1-SEC and AFF4-SEC are largely non-overlapping and perform distinct functions. Thus, the SEC represents a family of related complexes that exist to increase the regulatory diversity and gene control options during transactivation of diverse cellular and viral genes.

  11. Two distinct alpha-interferon-dependent signal transduction pathways may contribute to activation of transcription of the guanylate-binding protein gene

    SciTech Connect

    Decker, T.; Lew, D.J.; Darnell, J.E. Jr. )


    The promoter of the gene encoding a cytoplasmic guanylate-binding (GBP) contains two overlapping elements: the interferon stimulation response element (ISRE), which mediates alpha interferon (IFN-{alpha})-dependent transcription, and the IFN-{gamma} activation site (GAS), which is required for INF-{gamma}-mediated stimulation. The ISRE binds a factor called ISGF-3 that is activated by IFN-{alpha} but not by IFN-{gamma}. The GAS binds a protein that is activated by IFN-{gamma}, which the authors have termed GAF. The authors now find that the GAS is also an IFN-{alpha}-responsive element in vivo and that IFN-{alpha} (in addition to activating ISGF-3) rapidly activates a GAS-binding factor, the IFN-{alpha} activation factor (AAF). The AAF has characteristics very similar to those of the previously described GAF. Through the use of inhibitors of protein synthesis and inhibitors of protein kinases, the activation conditions of AAF, GAF, and ISGF-3 could be distinguished. Therefore, not only do IFN-{alpha} and IFN-{gamma} stimulate transcription of GBP through different receptors linked to different signaling molecules, but occupation of the IFN-{alpha} receptor apparently leads to the rapid activation of two different DNA-binding proteins through the use of different intracellular pathways.

  12. Transcriptional Activity of the MADS Box ARLEQUIN/TOMATO AGAMOUS-LIKE1 Gene Is Required for Cuticle Development of Tomato Fruit1

    PubMed Central

    Giménez, Estela; Dominguez, Eva; Pineda, Benito; Heredia, Antonio; Moreno, Vicente; Angosto, Trinidad


    Fruit development and ripening entail key biological and agronomic events, which ensure the appropriate formation and dispersal of seeds and determine productivity and yield quality traits. The MADS box gene ARLEQUIN/TOMATO AGAMOUS-LIKE1 (hereafter referred to as TAGL1) was reported as a key regulator of tomato (Solanum lycopersicum) reproductive development, mainly involved in flower development, early fruit development, and ripening. It is shown here that silencing of the TAGL1 gene (RNA interference lines) promotes significant changes affecting cuticle development, mainly a reduction of thickness and stiffness, as well as a significant decrease in the content of cuticle components (cutin, waxes, polysaccharides, and phenolic compounds). Accordingly, overexpression of TAGL1 significantly increased the amount of cuticle and most of its components while rendering a mechanically weak cuticle. Expression of the genes involved in cuticle biosynthesis agreed with the biochemical and biomechanical features of cuticles isolated from transgenic fruits; it also indicated that TAGL1 participates in the transcriptional control of cuticle development mediating the biosynthesis of cuticle components. Furthermore, cell morphology and the arrangement of epidermal cell layers, on whose activity cuticle formation depends, were altered when TAGL1 was either silenced or constitutively expressed, indicating that this transcription factor regulates cuticle development, probably through the biosynthetic activity of epidermal cells. Our results also support cuticle development as an integrated event in the fruit expansion and ripening processes that characterize fleshy-fruited species such as tomato. PMID:26019301

  13. Transcriptional Activity of the MADS Box ARLEQUIN/TOMATO AGAMOUS-LIKE1 Gene Is Required for Cuticle Development of Tomato Fruit.


    Giménez, Estela; Dominguez, Eva; Pineda, Benito; Heredia, Antonio; Moreno, Vicente; Lozano, Rafael; Angosto, Trinidad


    Fruit development and ripening entail key biological and agronomic events, which ensure the appropriate formation and dispersal of seeds and determine productivity and yield quality traits. The MADS box gene Arlequin/tomato Agamous-like1 (hereafter referred to as TAGL1) was reported as a key regulator of tomato (Solanum lycopersicum) reproductive development, mainly involved in flower development, early fruit development, and ripening. It is shown here that silencing of the TAGL1 gene (RNA interference lines) promotes significant changes affecting cuticle development, mainly a reduction of thickness and stiffness, as well as a significant decrease in the content of cuticle components (cutin, waxes, polysaccharides, and phenolic compounds). Accordingly, overexpression of TAGL1 significantly increased the amount of cuticle and most of its components while rendering a mechanically weak cuticle. Expression of the genes involved in cuticle biosynthesis agreed with the biochemical and biomechanical features of cuticles isolated from transgenic fruits; it also indicated that TAGL1 participates in the transcriptional control of cuticle development mediating the biosynthesis of cuticle components. Furthermore, cell morphology and the arrangement of epidermal cell layers, on whose activity cuticle formation depends, were altered when TAGL1 was either silenced or constitutively expressed, indicating that this transcription factor regulates cuticle development, probably through the biosynthetic activity of epidermal cells. Our results also support cuticle development as an integrated event in the fruit expansion and ripening processes that characterize fleshy-fruited species such as tomato.

  14. Ascorbic acid-dependent gene expression in Streptococcus pneumoniae and the activator function of the transcriptional regulator UlaR2

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P.


    In this study, we have explored the impact of ascorbic acid on the transcriptome of Streptococcus pneumoniae D39. The expression of several genes and operons, including the ula operon (which has been previously shown to be involved in ascorbic acid utilization), the AdcR regulon (which has been previously shown to be involved in zinc transport and virulence) and a PTS operon (which we denote here as ula2 operon) were altered in the presence of ascorbic acid. The ula2 operon consists of five genes, including the transcriptional activator ulaR2. Our β-galactosidase assay data and transcriptome comparison of the ulaR2 mutant with the wild-type demonstrated that the transcriptional activator UlaR2 in the presence of ascorbic acid activates the expression of the ula2 operon. We further predict a 16-bp regulatory site (5′-ATATTGTGCTCAAATA-3′) for UlaR2 in the Pula2. Furthermore, we have explored the effect of ascorbic acid on the expression of the AdcR regulon. Our ICP-MS analysis showed that addition of ascorbic acid to the medium causes zinc starvation in the cell which leads to the activation of the AdcR regulon. PMID:25717320

  15. Ascorbic acid-dependent gene expression in Streptococcus pneumoniae and the activator function of the transcriptional regulator UlaR2.


    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P


    In this study, we have explored the impact of ascorbic acid on the transcriptome of Streptococcus pneumoniae D39. The expression of several genes and operons, including the ula operon (which has been previously shown to be involved in ascorbic acid utilization), the AdcR regulon (which has been previously shown to be involved in zinc transport and virulence) and a PTS operon (which we denote here as ula2 operon) were altered in the presence of ascorbic acid. The ula2 operon consists of five genes, including the transcriptional activator ulaR2. Our β-galactosidase assay data and transcriptome comparison of the ulaR2 mutant with the wild-type demonstrated that the transcriptional activator UlaR2 in the presence of ascorbic acid activates the expression of the ula2 operon. We further predict a 16-bp regulatory site (5'-ATATTGTGCTCAAATA-3') for UlaR2 in the Pula2. Furthermore, we have explored the effect of ascorbic acid on the expression of the AdcR regulon. Our ICP-MS analysis showed that addition of ascorbic acid to the medium causes zinc starvation in the cell which leads to the activation of the AdcR regulon.

  16. Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

    NASA Technical Reports Server (NTRS)

    Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.


    Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal

  17. A position-dependent transcription-activating domain in TFIIIA.

    PubMed Central

    Mao, X; Darby, M K


    Transcription of the Xenopus 5S RNA gene by RNA polymerase III requires the gene-specific factor TFIIIA. To identify domains within TFIIIA that are essential for transcriptional activation, we have expressed C-terminal deletion, substitution, and insertion mutants of TFIIIA in bacteria as fusions with maltose-binding protein (MBP). The MBP-TFIIIA fusion protein specifically binds to the 5S RNA gene internal control region and complements transcription in a TFIIIA-depleted oocyte nuclear extract. Random, cassette-mediated mutagenesis of the carboxyl region of TFIIIA, which is not required for promoter binding, has defined a 14-amino-acid region that is critical for transcriptional activation. In contrast to activators of RNA polymerase II, the activity of the TFIIIA activation domain is strikingly sensitive to its position relative to the DNA-binding domain. When the eight amino acids that separate the transcription-activating domain from the last zinc finger are deleted, transcriptional activity is lost. Surprisingly, diverse amino acids can replace these eight amino acids with restoration of full transcriptional activity, suggesting that the length and not the sequence of this region is important. Insertion of amino acids between the zinc finger region and the transcription-activating domain causes a reduction in transcription proportional to the number of amino acids introduced. We propose that to function, the transcription-activating domain of TFIIIA must be correctly positioned at a minimum distance from the DNA-binding domain. Images PMID:8246967

  18. Convergent Transcription of Interferon-stimulated Genes by TNF-α and IFN-α Augments Antiviral Activity against HCV and HEV.


    Wang, Wenshi; Xu, Lei; Brandsma, Johannes H; Wang, Yijin; Hakim, Mohamad S; Zhou, Xinying; Yin, Yuebang; Fuhler, Gwenny M; van der Laan, Luc J W; van der Woude, C Janneke; Sprengers, Dave; Metselaar, Herold J; Smits, Ron; Poot, Raymond A; Peppelenbosch, Maikel P; Pan, Qiuwei


    IFN-α has been used for decades to treat chronic hepatitis B and C, and as an off-label treatment for some cases of hepatitis E virus (HEV) infection. TNF-α is another important cytokine involved in inflammatory disease, which can interact with interferon signaling. Because interferon-stimulated genes (ISGs) are the ultimate antiviral effectors of the interferon signaling, this study aimed to understand the regulation of ISG transcription and the antiviral activity by IFN-α and TNF-α. In this study, treatment of TNF-α inhibited replication of HCV by 71 ± 2.4% and HEV by 41 ± 4.9%. Interestingly, TNF-α induced the expression of a panel of antiviral ISGs (2-11 fold). Blocking the TNF-α signaling by Humira abrogated ISG induction and its antiviral activity. Chip-seq data analysis and mutagenesis assay further revealed that the NF-κB protein complex, a key downstream element of TNF-α signaling, directly binds to the ISRE motif in the ISG promoters and thereby drives their transcription. This process is independent of interferons and JAK-STAT cascade. Importantly, when combined with IFN-α, TNF-α works cooperatively on ISG induction, explaining their additive antiviral effects. Thus, our study reveals a novel mechanism of convergent transcription of ISGs by TNF-α and IFN-α, which augments their antiviral activity against HCV and HEV. PMID:27150018

  19. Convergent Transcription of Interferon-stimulated Genes by TNF-α and IFN-α Augments Antiviral Activity against HCV and HEV

    PubMed Central

    Wang, Wenshi; Xu, Lei; Brandsma, Johannes H.; Wang, Yijin; Hakim, Mohamad S.; Zhou, Xinying; Yin, Yuebang; Fuhler, Gwenny M.; van der Laan, Luc J. W.; van der Woude, C. Janneke; Sprengers, Dave; Metselaar, Herold J.; Smits, Ron; Poot, Raymond A.; Peppelenbosch, Maikel P.; Pan, Qiuwei


    IFN-α has been used for decades to treat chronic hepatitis B and C, and as an off-label treatment for some cases of hepatitis E virus (HEV) infection. TNF-α is another important cytokine involved in inflammatory disease, which can interact with interferon signaling. Because interferon-stimulated genes (ISGs) are the ultimate antiviral effectors of the interferon signaling, this study aimed to understand the regulation of ISG transcription and the antiviral activity by IFN-α and TNF-α. In this study, treatment of TNF-α inhibited replication of HCV by 71 ± 2.4% and HEV by 41 ± 4.9%. Interestingly, TNF-α induced the expression of a panel of antiviral ISGs (2-11 fold). Blocking the TNF-α signaling by Humira abrogated ISG induction and its antiviral activity. Chip-seq data analysis and mutagenesis assay further revealed that the NF-κB protein complex, a key downstream element of TNF-α signaling, directly binds to the ISRE motif in the ISG promoters and thereby drives their transcription. This process is independent of interferons and JAK-STAT cascade. Importantly, when combined with IFN-α, TNF-α works cooperatively on ISG induction, explaining their additive antiviral effects. Thus, our study reveals a novel mechanism of convergent transcription of ISGs by TNF-α and IFN-α, which augments their antiviral activity against HCV and HEV. PMID:27150018

  20. Synergistic activation of Arg1 gene by retinoic acid and IL-4 involves chromatin remodeling for transcription initiation and elongation coupling

    PubMed Central

    Lee, Bomi; Wu, Cheng-Ying; Lin, Yi-Wei; Park, Sung Wook; Wei, Li-Na


    All-trans Retinoic acid (RA) and its derivatives are potent therapeutics for immunological functions including wound repair. However, the molecular mechanism of RA modulation in innate immunity is poorly understood, especially in macrophages. We found that topical application of RA significantly improves wound healing and that RA and IL-4 synergistically activate Arg1, a critical gene for tissue repair, in M2 polarized macrophages. This involves feed forward regulation of Raldh2, a rate-limiting enzyme for RA biosynthesis, and requires Med25 to coordinate RAR, STAT6 and chromatin remodeler, Brg1 to remodel the +1 nucleosome of Arg1 for transcription initiation. By recruiting elongation factor TFIIS, Med25 also facilitates transcriptional initiation-elongation coupling. This study uncovers synergistic activation of Arg1 by RA and IL-4 in M2 macrophages that involves feed forward regulation of RA synthesis and dual functions of Med25 in nucleosome remodeling and transcription initiation-elongation coupling that underlies robust modulatory activity of RA in innate immunity. PMID:27166374

  1. Activation of the Yeast UBI4 Polyubiquitin Gene by Zap1 Transcription Factor via an Intragenic Promoter Is Critical for Zinc-deficient Growth.


    MacDiarmid, Colin W; Taggart, Janet; Jeong, Jeeyon; Kerdsomboon, Kittikhun; Eide, David J


    Stability of many proteins requires zinc. Zinc deficiency disrupts their folding, and the ubiquitin-proteasome system may help manage this stress. In Saccharomyces cerevisiae, UBI4 encodes five tandem ubiquitin monomers and is essential for growth in zinc-deficient conditions. Although UBI4 is only one of four ubiquitin-encoding genes in the genome, a dramatic decrease in ubiquitin was observed in zinc-deficient ubi4Δ cells. The three other ubiquitin genes were strongly repressed under these conditions, contributing to the decline in ubiquitin. In a screen for ubi4Δ suppressors, a hypomorphic allele of the RPT2 proteasome regulatory subunit gene (rpt2(E301K)) suppressed the ubi4Δ growth defect. The rpt2(E301K) mutation also increased ubiquitin accumulation in zinc-deficient cells, and by using a ubiquitin-independent proteasome substrate we found that proteasome activity was reduced. These results suggested that increased ubiquitin supply in suppressed ubi4Δ cells was a consequence of more efficient ubiquitin release and recycling during proteasome degradation. Degradation of a ubiquitin-dependent substrate was restored by the rpt2(E301K) mutation, indicating that ubiquitination is rate-limiting in this process. The UBI4 gene was induced ∼5-fold in low zinc and is regulated by the zinc-responsive Zap1 transcription factor. Surprisingly, Zap1 controls UBI4 by inducing transcription from an intragenic promoter, and the resulting truncated mRNA encodes only two of the five ubiquitin repeats. Expression of a short transcript alone complemented the ubi4Δ mutation, indicating that it is efficiently translated. Loss of Zap1-dependent UBI4 expression caused a growth defect in zinc-deficient conditions. Thus, the intragenic UBI4 promoter is critical to preventing ubiquitin deficiency in zinc-deficient cells. PMID:27432887

  2. Regulation of Lactobacillus casei Sorbitol Utilization Genes Requires DNA-Binding Transcriptional Activator GutR and the Conserved Protein GutM▿

    PubMed Central

    Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J.


    Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTSGut). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIBGat domain) and a mannitol/fructose-specific EIIA-like domain (EIIAMtl domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBCGut negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710

  3. Regulation of Lactobacillus casei sorbitol utilization genes requires DNA-binding transcriptional activator GutR and the conserved protein GutM.


    Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J


    Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTS(Gut)). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIB(Gat) domain) and a mannitol/fructose-specific EIIA-like domain (EIIA(Mtl) domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBC(Gut) negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710

  4. DNA dynamics play a role as a basal transcription factor in the positioning and regulation of gene transcription initiation

    PubMed Central

    Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim Ø.; Usheva, Anny


    We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA contacts. We use this effect to establish the separate contributions of transcription factor binding and DNA dynamics to transcriptional activity. Our results argue against a purely ‘transcription factor-centric’ view of transcription initiation, suggesting that both DNA dynamics and transcription factor binding are necessary conditions for transcription initiation. PMID:20019064

  5. Mammary cell-activating factor regulates the hormone-independent transcription of the early lactation protein (ELP) gene in a marsupial.


    Pharo, Elizabeth A; Renfree, Marilyn B; Cane, Kylie N


    The regulation of the tammar wallaby (Macropus eugenii) early lactation protein (ELP) gene is complex. ELP is responsive to the lactogenic hormones; insulin (I), hydrocortisone (HC) and prolactin (PRL) in mammary gland explants but could not be induced with lactogenic hormones in tammar primary mammary gland cells, nor in KIM-2 conditionally immortalised murine mammary epithelial cells. Similarly, ELP promoter constructs transiently-transfected into human embryonic kidney (HEK293T) cells constitutively expressing the prolactin receptor (PRLR) and Signal Transducer and Activator of Transcription (STAT)5A were unresponsive to prolactin, unlike the rat and mouse β-casein (CSN2) promoter constructs. Identification of the minimal promoter required for the hormone-independent transcription of tammar ELP in HEK293Ts and comparative analysis of the proximal promoters of marsupial ELP and the orthologous eutherian colostrum trypsin inhibitor (CTI) gene suggests that mammary cell-activating factor (MAF), an E26 transformation-specific (ETS) factor, may bind to an AGGAAG motif and activate tammar ELP. PMID:27452799

  6. Mammary cell-activating factor regulates the hormone-independent transcription of the early lactation protein (ELP) gene in a marsupial.


    Pharo, Elizabeth A; Renfree, Marilyn B; Cane, Kylie N


    The regulation of the tammar wallaby (Macropus eugenii) early lactation protein (ELP) gene is complex. ELP is responsive to the lactogenic hormones; insulin (I), hydrocortisone (HC) and prolactin (PRL) in mammary gland explants but could not be induced with lactogenic hormones in tammar primary mammary gland cells, nor in KIM-2 conditionally immortalised murine mammary epithelial cells. Similarly, ELP promoter constructs transiently-transfected into human embryonic kidney (HEK293T) cells constitutively expressing the prolactin receptor (PRLR) and Signal Transducer and Activator of Transcription (STAT)5A were unresponsive to prolactin, unlike the rat and mouse β-casein (CSN2) promoter constructs. Identification of the minimal promoter required for the hormone-independent transcription of tammar ELP in HEK293Ts and comparative analysis of the proximal promoters of marsupial ELP and the orthologous eutherian colostrum trypsin inhibitor (CTI) gene suggests that mammary cell-activating factor (MAF), an E26 transformation-specific (ETS) factor, may bind to an AGGAAG motif and activate tammar ELP.

  7. Functional analysis of 14 genes that constitute the purine catabolic pathway in Bacillus subtilis and evidence for a novel regulon controlled by the PucR transcription activator.


    Schultz, A C; Nygaard, P; Saxild, H H


    The soil bacterium Bacillus subtilis has developed a highly controlled system for the utilization of a diverse array of low-molecular-weight compounds as a nitrogen source when the preferred nitrogen sources, e.g., glutamate plus ammonia, are exhausted. We have identified such a system for the utilization of purines as nitrogen source in B. subtilis. Based on growth studies of strains with knockout mutations in genes, complemented with enzyme analysis, we could ascribe functions to 14 genes encoding enzymes or proteins of the purine degradation pathway. A functional xanthine dehydrogenase requires expression of five genes (pucA, pucB, pucC, pucD, and pucE). Uricase activity is encoded by the pucL and pucM genes, and a uric acid transport system is encoded by pucJ and pucK. Allantoinase is encoded by the pucH gene, and allantoin permease is encoded by the pucI gene. Allantoate amidohydrolase is encoded by pucF. In a pucR mutant, the level of expression was low for all genes tested, indicating that PucR is a positive regulator of puc gene expression. All 14 genes except pucI are located in a gene cluster at 284 to 285 degrees on the chromosome and are contained in six transcription units, which are expressed when cells are grown with glutamate as the nitrogen source (limiting conditions), but not when grown on glutamate plus ammonia (excess conditions). Our data suggest that the 14 genes and the gde gene, encoding guanine deaminase, constitute a regulon controlled by the pucR gene product. Allantoic acid, allantoin, and uric acid were all found to function as effector molecules for PucR-dependent regulation of puc gene expression. When cells were grown in the presence of glutamate plus allantoin, a 3- to 10-fold increase in expression was seen for most of the genes. However, expression of the pucABCDE unit was decreased 16-fold, while expression of pucR was decreased 4-fold in the presence of allantoin. We have identified genes of the purine degradation pathway in B

  8. Conserved Structural Domains in FoxD4L1, a Neural Forkhead Box Transcription Factor, Are Required to Repress or Activate Target Genes

    PubMed Central

    Klein, Steven L.; Neilson, Karen M.; Orban, John; Yaklichkin, Sergey; Hoffbauer, Jennifer; Mood, Kathy; Daar, Ira O.; Moody, Sally A.


    FoxD4L1 is a forkhead transcription factor that expands the neural ectoderm by down-regulating genes that promote the onset of neural differentiation and up-regulating genes that maintain proliferative neural precursors in an immature state. We previously demonstrated that binding of Grg4 to an Eh-1 motif enhances the ability of FoxD4L1 to down-regulate target neural genes but does not account for all of its repressive activity. Herein we analyzed the protein sequence for additional interaction motifs and secondary structure. Eight conserved motifs were identified in the C-terminal region of fish and frog proteins. Extending the analysis to mammals identified a high scoring motif downstream of the Eh-1 domain that contains a tryptophan residue implicated in protein-protein interactions. In addition, secondary structure prediction programs predicted an α-helical structure overlapping with amphibian-specific Motif 6 in Xenopus, and similarly located α-helical structures in other vertebrate FoxD proteins. We tested functionality of this site by inducing a glutamine-to-proline substitution expected to break the predicted α-helical structure; this significantly reduced FoxD4L1’s ability to repress zic3 and irx1. Because this mutation does not interfere with Grg4 binding, these results demonstrate that at least two regions, the Eh-1 motif and a more C-terminal predicted α-helical/Motif 6 site, additively contribute to repression. In the N-terminal region we previously identified a 14 amino acid motif that is required for the up-regulation of target genes. Secondary structure prediction programs predicted a short β-strand separating two acidic domains. Mutant constructs show that the β-strand itself is not required for transcriptional activation. Instead, activation depends upon a glycine residue that is predicted to provide sufficient flexibility to bring the two acidic domains into close proximity. These results identify conserved predicted motifs with secondary

  9. Aeromonas hydrophila Lateral Flagellar Gene Transcriptional Hierarchy

    PubMed Central

    Wilhelms, Markus; Gonzalez, Victor; Merino, Susana


    Aeromonas hydrophila AH-3 lateral flagella are not assembled when bacteria grow in liquid media; however, lateral flagellar genes are transcribed. Our results indicate that A. hydrophila lateral flagellar genes are transcribed at three levels (class I to III genes) and share some similarities with, but have many important differences from, genes of Vibrio parahaemolyticus. A. hydrophila lateral flagellum class I gene transcription is σ70 dependent, which is consistent with the fact that lateral flagellum is constitutively transcribed, in contrast to the characteristics of V. parahaemolyticus. The fact that multiple genes are included in class I highlights that lateral flagellar genes are less hierarchically transcribed than polar flagellum genes. The A. hydrophila lafK-fliEJL gene cluster (where the subscript L distinguishes genes for lateral flagella from those for polar flagella) is exclusively from class I and is in V. parahaemolyticus class I and II. Furthermore, the A. hydrophila flgAMNL cluster is not transcribed from the σ54/LafK-dependent promoter and does not contain class II genes. Here, we propose a gene transcriptional hierarchy for the A. hydrophila lateral flagella. PMID:23335410

  10. Gene transcription and electromagnetic fields

    SciTech Connect

    Henderson, A.S.


    Our overall aim is to obtain sufficient information to allow us to ultimately determine whether ELF EM field exposure is an initiating factor in neoplastic transformation and/or if exposure can mimic characteristics of the second-step counterpart in neoplastic disease. This aim is based on our previous findings that levels of some transcripts are increased in cells exposed to EM fields. While the research is basic in nature, the ramifications have bearing on the general safety of exposure to EM fields in industrial and everyday life. A large array of diverse biological effects are reported to occur as the result of exposure to elf EM fields, suggesting that the cell response to EM fields is at a basic level, presumably initiated by molecular and/or biophysical events at the cell membrane. The hypothesized route is a signal transduction pathway involving membrane calcium fluxes. Information flow resulting from signal transduction can mediate the induction of regulatory factors in the cell, and directly affect how transcription is regulated.

  11. GenR, an IclR-type regulator, activates and represses the transcription of gen genes involved in 3-hydroxybenzoate and gentisate catabolism in Corynebacterium glutamicum.


    Chao, Hongjun; Zhou, Ning-Yi


    The genes required for 3-hydroxybenzoate and gentisate catabolism in Corynebacterium glutamicum are closely clustered in three operons. GenR, an IclR-type regulator, can activate the transcription of genKH and genDFM operons in response to 3-hydroxybenzoate and gentisate, and it can repress its own expression. Footprinting analyses demonstrated that GenR bound to four sites with different affinities. Two GenR-binding sites (DFMn01 and DFMn02) were found to be located between positions --41 and --84 upstream of the --35 and --10 regions of the genDFM promoter, which was involved in positive regulation of genDFM transcription. The GenR binding site R-KHn01 (located between positions --47 and --16) overlapped the --35 region of the genKH promoter sequence and is involved in positive regulation of its transcription. The binding site R-KHn02, at which GenR binds to its own promoter, was found within a footprint extending from position --44 to --67. It appeared to be involved in negative regulation of the activity of the genR promoter. A consensus motif with a 5-bp imperfect palindromic sequence [ATTCC-N(7(5))-GGAAT] was identified among all four GenR binding sites and found to be necessary to GenR regulation through site-directed mutagenesis. The results reveal a new regulatory function of the IclR family in the catabolism of aromatic compounds.

  12. ZBRK1, a novel tumor suppressor, activates VHL gene transcription through formation of a complex with VHL and p300 in renal cancer

    PubMed Central

    Gumireddy, Kiranmai; Li, Anping; Yao, Weimin; Gao, Lu; Chen, Shuliang; Hao, Jun; Wang, Ji; Huang, Qihong; Xu, Hua; Ye, Zhangqun


    Inactivation or mutation of the VHL gene causes various tumors, including clear cell renal cell carcinoma (ccRCC). In the present study, we identified ZBRK1 as a novel VHL interacting protein by yeast two-hybrid screening, and found a single ZBRK1-binding site located in the VHL promoter region. Ectopic expression of ZBRK1 increases transcriptional activity of the VHL, whereas the depletion of endogenous ZBRK1 by shRNA leads to reduction of VHL expression. We also demonstrate that the inhibition of VEGF transcription by ZBRK1 overexpression is dependent on VHL/HIF pathway. Moreover, VHL is confirmed to serve as a bridge component for the association of ZBRK1 and p300, which leads to an increase in ZBRK1 transcriptional activity in the VHL promoter. We further provide striking evidences that ZBRK1 acts as a tumor suppressor in renal carcinoma by a variety of in vitro and in vivo assays, and ZBRK1 may represent a molecular marker to distinguish patients with ccRCC at high risk from those with a better survival prognosis. Taken together, these findings suggest that ZBRK1 suppresses renal cancer progression perhaps by regulating VHL expression. PMID:25749518

  13. Involvement of a NF-kappa B-like transcription factor in the activation of the interleukin-6 gene by inflammatory lymphokines.

    PubMed Central

    Shimizu, H; Mitomo, K; Watanabe, T; Okamoto, S; Yamamoto, K


    Interleukin-6 (IL-6) is one of the major mediators of inflammation, and its expression is inducible by the other inflammatory lymphokines, interleukin-1 (IL-1) and tumor necrosis factor alpha (TNF-alpha). We demonstrate that a common IL-6 promoter element, termed inflammatory lymphokine-responsive element (ILRE), is important for induction of IL-6 gene expression by IL-1 and TNF-alpha despite possible differences in the mechanisms of action of these lymphokines. Remarkably, the ILRE sequence, located between -73 to -63 relative to the mRNA cap site, is highly homologous to NF-kappa B transcription factor-binding motifs and binds an IL-1-TNF-alpha-inducible nuclear factor; the sequence specificities, binding characteristics, and subcellular localizations of this factor are indistinguishable from those of NF-kappa B. In addition, mutations of the ILRE sequence which impair the binding of this nuclear factor abolished the induction of IL-6 gene expression by IL-1 and TNF-alpha in vivo. These results indicate that a nuclear factor indistinguishable from NF-kappa B is involved in the transcriptional activation of the IL-6 gene by IL-1 and TNF-alpha. Images PMID:2405250

  14. The human papillomavirus type 16 E7 gene product interacts with and trans-activates the AP1 family of transcription factors.

    PubMed Central

    Antinore, M J; Birrer, M J; Patel, D; Nader, L; McCance, D J


    The E7 gene product of human papillomavirus type 16 (HPV16) binds to the retinoblastoma gene product (pRb) and dissociates pRb-E2F complexes. However, the observation that the ability of E7 to bind pRb is not required for the HPV16-induced immortalization of primary keratinocytes prompted a search for other cellular factors bound by E7. Using a glutathione-S-transferase (GST) fusion protein system, we show that E7 complexes with AP1 transcription factors including c-Jun, JunB, JunD and c-Fos. The ability of E7 to complex with c-Jun in vivo is demonstrated by co-immunoprecipitation and the yeast two-hybrid system. An analysis of E7 point mutants in the GST system indicates that the E7 zinc-finger motif, but not the pRb binding domain, is involved in these interactions. Using c-Jun deletion mutants, E7 binding maps between amino acids 224 and 286 of c-Jun. E7 trans-activates c-Jun-induced transcription from a Jun responsive promoter, and this activity correlates with the ability of E7 mutants to bind Jun proteins. Finally, a transcriptionally inactive c-Jun deletion, which can bind E7, interferes with the E7-induced transformation of rat embryo fibroblasts in cooperation with an activated ras, indicating that the Jun-E7 interaction is physiologically relevant and that Jun factors may be targeted in the E7 transformation pathway. Images PMID:8617242

  15. Molecular and functional characterization of the promoter region of the mouse LDH/C gene: enhancer-assisted, Sp1-mediated transcriptional activation.

    PubMed Central

    Yang, J; Thomas, K


    Molecular and functional studies of the LDH/C 5' upstream promoter elements were undertaken to elucidate the molecular mechanisms involved in temporal activation of LDH/C gene expression in differentiating germ cells. Ligation mediated-PCR (LM-PCR) gene walking techniques were exploited to isolate a 2.1 kb fragment of the mouse LDH/C 5' promoter region. DNA sequence analysis of this isolated genomic fragment indicated that the mouse LDH/C promoter contained TATA and CCAT boxes as well as a GC-box (Sp1-binding site) situated upstream from the transcription start site. PCR-based in vivo DNase I footprinting analysis of a 600 bp fragment of the proximal LDH/C promoter region (-524/+38) in isolated mouse pachytene spermatocytes identified a single footprint over the GC-box motif. Three DNase I hypersensitive sites were also detectable in vivo, in a region containing (CT)n(GA)n repeats upstream from the CCAT box domain. Functional characterization of the promoter region was carried out in a rat C6 glioma cell line and an SV40 transformed germ cell line (GC-1 spg) using wild-type and mutated LDH/C promoter CAT reporter constructs. These studies provide experimental evidence suggesting that transcriptional activation of the LDH/C promoter is regulated by enhancer-mediated coactivation of the Sp1 proteins bound to the GC-box motif footprinted in vivo in pachytene spermatocytes. PMID:9153323

  16. MaJAZ1 Attenuates the MaLBD5-Mediated Transcriptional Activation of Jasmonate Biosynthesis Gene MaAOC2 in Regulating Cold Tolerance of Banana Fruit.


    Ba, Liang-jie; Kuang, Jian-fei; Chen, Jian-ye; Lu, Wang-jin


    Previous studies indicated that methyl jasmonate (MeJA) treatment could effectively reduce the chilling injury of many fruits, including banana, but the underlying mechanism is poorly understood. In this study, one lateral organ boundaries (LOB) domain (LBD) gene, designated as MaLBD5, was isolated and characterized from banana fruit. Expression analysis revealed that accumulation of MaLBD5 was induced by cold temperature and MeJA treatment. Subcellular localization and transactivation assays showed that MaLBD5 was localized to the nucleus and possessed transcriptional activation activity. Protein-protein interaction analysis demonstrated that MaLBD5 physically interacted with MaJAZ1, a potential repressor of jasmonate signaling. Furthermore, transient expression assays indicated that MaLBD5 transactivated a jasmonate biosynthesis gene, termed MaAOC2, which was also induced by cold and MeJA. More interestingly, MaJAZ1 attenuated the MaLBD5-mediated transactivation of MaAOC2. These results suggest that MaLBD5 and MaJAZ1 might act antagonistically in relation to MeJA-induced cold tolerance of banana fruit, at least partially via affecting jasmonate biosynthesis. Collectively, our findings expand the knowledge of the transcriptional regulatory network of MeJA-mediated cold tolerance of banana fruit.

  17. Novel [NiFe]- and [FeFe]-hydrogenase gene transcripts indicative of active facultative aerobes and obligate anaerobes in earthworm gut contents.


    Schmidt, Oliver; Wüst, Pia K; Hellmuth, Susanne; Borst, Katharina; Horn, Marcus A; Drake, Harold L


    The concomitant occurrence of molecular hydrogen (H(2)) and organic acids along the alimentary canal of the earthworm is indicative of ongoing fermentation during gut passage. Fermentative H(2) production is catalyzed by [FeFe]-hydrogenases and group 4 [NiFe]-hydrogenases in obligate anaerobes (e.g., Clostridiales) and facultative aerobes (e.g., Enterobacteriaceae), respectively, functional groups that might respond differently to contrasting redox conditions. Thus, the objectives of this study were to assess the redox potentials of the alimentary canal of Lumbricus terrestris and analyze the hydrogenase transcript diversities of H(2) producers in glucose-supplemented gut content microcosms. Although redox potentials in the core of the alimentary canal were variable on an individual worm basis, average redox potentials were similar. The lowest redox potentials occurred in the foregut and midgut regions, averaging 40 and 110 mV, respectively. Correlation plots between hydrogenase amino acid sequences and 16S rRNA gene sequences indicated that closely related hydrogenases belonged to closely related taxa, whereas distantly related hydrogenases did not necessarily belong to distantly related taxa. Of 178 [FeFe]-hydrogenase gene transcripts, 177 clustered in 12 Clostridiales-affiliated operational taxonomic units, the majority of which were indicative of heretofore unknown hydrogenases. Of 86 group 4 [NiFe]-hydrogenase gene transcripts, 79% and 21% were affiliated with organisms in the Enterobacteriaceae and Aeromonadaceae, respectively. The collective results (i) suggest that fermenters must cope with variable and moderately oxidative redox conditions along the alimentary canal, (ii) demonstrate that heretofore undetected hydrogenases are present in the earthworm gut, and (iii) corroborate previous findings implicating Clostridiaceae and Enterobacteriaceae as active fermentative taxa in earthworm gut content. PMID:21784904

  18. Novel [NiFe]- and [FeFe]-Hydrogenase Gene Transcripts Indicative of Active Facultative Aerobes and Obligate Anaerobes in Earthworm Gut Contents▿†

    PubMed Central

    Schmidt, Oliver; Wüst, Pia K.; Hellmuth, Susanne; Borst, Katharina; Horn, Marcus A.; Drake, Harold L.


    The concomitant occurrence of molecular hydrogen (H2) and organic acids along the alimentary canal of the earthworm is indicative of ongoing fermentation during gut passage. Fermentative H2 production is catalyzed by [FeFe]-hydrogenases and group 4 [NiFe]-hydrogenases in obligate anaerobes (e.g., Clostridiales) and facultative aerobes (e.g., Enterobacteriaceae), respectively, functional groups that might respond differently to contrasting redox conditions. Thus, the objectives of this study were to assess the redox potentials of the alimentary canal of Lumbricus terrestris and analyze the hydrogenase transcript diversities of H2 producers in glucose-supplemented gut content microcosms. Although redox potentials in the core of the alimentary canal were variable on an individual worm basis, average redox potentials were similar. The lowest redox potentials occurred in the foregut and midgut regions, averaging 40 and 110 mV, respectively. Correlation plots between hydrogenase amino acid sequences and 16S rRNA gene sequences indicated that closely related hydrogenases belonged to closely related taxa, whereas distantly related hydrogenases did not necessarily belong to distantly related taxa. Of 178 [FeFe]-hydrogenase gene transcripts, 177 clustered in 12 Clostridiales-affiliated operational taxonomic units, the majority of which were indicative of heretofore unknown hydrogenases. Of 86 group 4 [NiFe]-hydrogenase gene transcripts, 79% and 21% were affiliated with organisms in the Enterobacteriaceae and Aeromonadaceae, respectively. The collective results (i) suggest that fermenters must cope with variable and moderately oxidative redox conditions along the alimentary canal, (ii) demonstrate that heretofore undetected hydrogenases are present in the earthworm gut, and (iii) corroborate previous findings implicating Clostridiaceae and Enterobacteriaceae as active fermentative taxa in earthworm gut content. PMID:21784904

  19. The DOF protein, SAD, interacts with GAMYB in plant nuclei and activates transcription of endosperm-specific genes during barley seed development.


    Diaz, Isabel; Martinez, Manuel; Isabel-LaMoneda, Ines; Rubio-Somoza, Ignacio; Carbonero, Pilar


    The DOF protein, SAD, previously shown to be a transcriptional activator in barley aleurone cells upon seed germination, also has an important role in gene regulation during endosperm development. mRNA was detected in early (10 days after flowering) developing barley seeds where it accumulated in the starchy endosperm, aleurone cells, nucellar projection, vascular tissues and the immature embryo, as shown by RT-PCR and in situ hybridization analyses. The SAD protein, expressed in bacteria, binds to oligonucleotides containing the prolamine box, 5'-A/TAAAG-3'sequence, derived from the promoter regions of the endosperm-specific genes Hor2 and Itr1, encoding a B-hordein and trypsin-inhibitor BTI-CMe, respectively. SAD competed for the same binding sites with another endosperm-expressed DOF protein, BPBF. Transient expression experiments in co-bombarded developing endosperms demonstrated that SAD trans-activated transcription from Hor2 and Itr1 promoters through binding to the intact DOF motifs. When the two DOF factors are co-bombarded together an additive effect was observed upon the expression of the Itr1 gene. In-frame fusion of the Sad ORF to the reporter green fluorescent protein gene directs the fluorescence expression to the nucleus in transiently transformed onion epidermal layers. The visualization of fluorescence in the nucleus of onion cells, using the bimolecular fluorescent complex (BiFC) approach, has shown the in vivo interaction between SAD and the R2R3MYB protein GAMYB. The interaction in plant cells has also been documented for the DOF protein BPBF and GAMYB, but nuclear interaction could not be detected between BPBF and SAD by this procedure. PMID:15918880

  20. The g.-165 T>C Rather than Methylation Is Associated with Semen Motility in Chinese Holstein Bulls by Regulating the Transcriptional Activity of the HIBADH Gene

    PubMed Central

    Ju, Zhihua; Wang, Xiuge; Jiang, Qiang; Sun, Yan; Huang, Jinming; Zhong, Jifeng; Wang, Changfa


    The 3-hydroxyisobutyrate dehydrogenase (HIBADH) is regarded as a human sperm-motility marker. However, the molecular mechanisms involved in the regulation of expression of the HIBADH gene in bulls remain largely unknown. HIBADH was detected in the testis, epididymis, and sperm via reverse transcription polymerase chain reaction and Western blot analysis. It is also expressed in the seminiferous epithelium, spermatids, and the entire epididymis, as detected by immunohistochemistry. Furthermore, HIBADH was expressed in the neck-piece and mid-piece of bull spermatids, as shown in the immunofluorescence assay. Using serially truncated bovine HIBADH promoters and luciferase constructs, we discovered an 878 bp (-703 bp to +175 bp) fragment that constitutes the core promoter region. One SNP g.-165 T>C of HIBADH was identified and genotyped in 307 Chinese Holstein bulls. Correlation analysis revealed that bulls with the TT genotype had higher initial sperm motility than those with the CC genotype (P < 0.05). Furthermore, the T- or C-containing loci (designated as pGL3-T and pGL3-C) were transiently transfected into MLTC-1 to test the effect of SNP on HIBADH expression. The luciferase reporter assay showed that the pGL3-T genotype exhibited 58% higher transcriptional activity than the pGL3-C genotype (P < 0.05). The bisulfite sequencing analysis revealed that the methylation pattern of the core promoter presented hypomethylation in the ejaculated semen in high-motility and low-motility bulls. The results demonstrated for the first time that the g.-165 T>C rather than methylation in the 5'-flanking region could affect the bovine sperm motility through the regulation of HIBADH gene transcriptional activity. PMID:26133183

  1. Transcriptional wiring of cell wall-related genes in Arabidopsis.


    Mutwil, Marek; Ruprecht, Colin; Giorgi, Federico M; Bringmann, Martin; Usadel, Björn; Persson, Staffan


    Transcriptional coordination, or co-expression, of genes may signify functional relatedness of the corresponding proteins. For example, several genes involved in secondary cell wall cellulose biosynthesis are co-expressed with genes engaged in the synthesis of xylan, which is a major component of the secondary cell wall. To extend these types of analyses, we investigated the co-expression relationships of all Carbohydrate-Active enZYmes (CAZy)-related genes for Arabidopsis thaliana. Thus, the intention was to transcriptionally link different cell wall-related processes to each other, and also to other biological functions. To facilitate easy manual inspection, we have displayed these interactions as networks and matrices, and created a web-based interface ( containing downloadable files for all the transcriptional associations.

  2. Entinostat up-regulates the CAMP gene encoding LL-37 via activation of STAT3 and HIF-1α transcription factors

    PubMed Central

    Miraglia, Erica; Nylén, Frank; Johansson, Katarina; Arnér, Elias; Cebula, Marcus; Farmand, Susan; Ottosson, Håkan; Strömberg, Roger; Gudmundsson, Gudmundur H.; Agerberth, Birgitta; Bergman, Peter


    Bacterial resistance against classical antibiotics is a growing problem and the development of new antibiotics is limited. Thus, novel alternatives to antibiotics are warranted. Antimicrobial peptides (AMPs) are effector molecules of innate immunity that can be induced by several compounds, including vitamin D and phenyl-butyrate (PBA). Utilizing a luciferase based assay, we recently discovered that the histone deacetylase inhibitor Entinostat is a potent inducer of the CAMP gene encoding the human cathelicidin LL-37. Here we investigate a mechanism for the induction and also find that Entinostat up-regulates human β-defensin 1. Analysis of the CAMP promoter sequence revealed binding sites for the transcription factors STAT3 and HIF-1α. By using short hairpin RNA and selective inhibitors, we found that both transcription factors are involved in Entinostat-induced expression of LL-37. However, only HIF-1α was found to be recruited to the CAMP promoter, suggesting that Entinostat activates STAT3, which promotes transcription of CAMP by increasing the expression of HIF-1α. Finally, we provide in vivo relevance to our findings by showing that Entinostat-elicited LL-37 expression was impaired in macrophages from a patient with a STAT3-mutation. Combined, our findings support a role for STAT3 and HIF-1α in the regulation of LL-37 expression. PMID:27633343

  3. Entinostat up-regulates the CAMP gene encoding LL-37 via activation of STAT3 and HIF-1α transcription factors.


    Miraglia, Erica; Nylén, Frank; Johansson, Katarina; Arnér, Elias; Cebula, Marcus; Farmand, Susan; Ottosson, Håkan; Strömberg, Roger; Gudmundsson, Gudmundur H; Agerberth, Birgitta; Bergman, Peter


    Bacterial resistance against classical antibiotics is a growing problem and the development of new antibiotics is limited. Thus, novel alternatives to antibiotics are warranted. Antimicrobial peptides (AMPs) are effector molecules of innate immunity that can be induced by several compounds, including vitamin D and phenyl-butyrate (PBA). Utilizing a luciferase based assay, we recently discovered that the histone deacetylase inhibitor Entinostat is a potent inducer of the CAMP gene encoding the human cathelicidin LL-37. Here we investigate a mechanism for the induction and also find that Entinostat up-regulates human β-defensin 1. Analysis of the CAMP promoter sequence revealed binding sites for the transcription factors STAT3 and HIF-1α. By using short hairpin RNA and selective inhibitors, we found that both transcription factors are involved in Entinostat-induced expression of LL-37. However, only HIF-1α was found to be recruited to the CAMP promoter, suggesting that Entinostat activates STAT3, which promotes transcription of CAMP by increasing the expression of HIF-1α. Finally, we provide in vivo relevance to our findings by showing that Entinostat-elicited LL-37 expression was impaired in macrophages from a patient with a STAT3-mutation. Combined, our findings support a role for STAT3 and HIF-1α in the regulation of LL-37 expression. PMID:27633343

  4. [The Effect of Transcription on Enhancer Activity in Drosophila melanogaster].


    Erokhin, M M; Davydova, A I; Lomaev, D V; Georgiev, P G; Chetverina, D A


    In higher eukaryotes, the level of gene transcription is under the control of DNA regulatory elements, such as promoter, from which transcription is initiated with the participation of RNA polymerase II and general transcription factors, as well as the enhancer, which increase the rate of transcription with the involvement of activator proteins and cofactors. It was demonstrated that enhancers are often located in the transcribed regions of the genome. We showed earlier that transcription negatively affected the activity of enhancers in Drosophila in model transgenic systems. In this study, we tested the effect of the distance between the leading promoter, enhancer, and target promoter on the inhibitory effect of transcriptions of different strengths. It was demonstrated that the negative effect of transcription remained, but weakened with increased distance between the leading promoter and enhancer and with decreased distance between the enhancer and target promoter. Thus, transcription can modulate the activity of enhancers by controlling its maximum level.

  5. Cooperative activation of Xenopus rhodopsin transcription by paired-like transcription factors

    PubMed Central


    Background In vertebrates, rod photoreceptor-specific gene expression is regulated by the large Maf and Pax-like transcription factors, Nrl/LNrl and Crx/Otx5. The ubiquitous occurrence of their target DNA binding sites throughout rod-specific gene promoters suggests that multiple transcription factor interactions within the promoter are functionally important. Cooperative action by these transcription factors activates rod-specific genes such as rhodopsin. However, a quantitative mechanistic explanation of transcriptional rate determinants is lacking. Results We investigated the contributions of various paired-like transcription factors and their cognate cis-elements to rhodopsin gene activation using cultured cells to quantify activity. The Xenopus rhodopsin promoter (XOP) has a bipartite structure, with ~200 bp proximal to the start site (RPP) coordinating cooperative activation by Nrl/LNrl-Crx/Otx5 and the adjacent 5300 bp upstream sequence increasing the overall expression level. The synergistic activation by Nrl/LNrl-Crx/Otx5 also occurred when XOP was stably integrated into the genome. We determined that Crx/Otx5 synergistically activated transcription independently and additively through the two Pax-like cis-elements, BAT1 and Ret4, but not through Ret1. Other Pax-like family members, Rax1 and Rax2, do not synergistically activate XOP transcription with Nrl/LNrl and/or Crx/Otx5; rather they act as co-activators via the Ret1 cis-element. Conclusions We have provided a quantitative model of cooperative transcriptional activation of the rhodopsin promoter through interaction of Crx/Otx5 with Nrl/LNrl at two paired-like cis-elements proximal to the NRE and TATA binding site. Further, we have shown that Rax genes act in cooperation with Crx/Otx5 with Nrl/LNrl as co-activators of rhodopsin transcription. PMID:24499263

  6. Role of an expansin-like molecule in Dictyostelium morphogenesis and regulation of its gene expression by the signal transducer and activator of transcription protein Dd-STATa.


    Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi


    Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.

  7. Transcriptional link between blood and bone: the stem cell leukemia gene and its +19 stem cell enhancer are active in bone cells.


    Pimanda, John E; Silberstein, Lev; Dominici, Massimo; Dekel, Benjamin; Bowen, Mark; Oldham, Scott; Kallianpur, Asha; Brandt, Stephen J; Tannahill, David; Göttgens, Berthold; Green, Anthony R


    Blood and vascular cells are generated during early embryogenesis from a common precursor, the hemangioblast. The stem cell leukemia gene (SCL/tal 1) encodes a basic helix-loop-helix transcription factor that is essential for the normal development of blood progenitors and blood vessels. We have previously characterized a panel of SCL enhancers including the +19 element, which directs expression to hematopoietic stem cells and endothelium. Here we demonstrate that SCL is expressed in bone primordia during embryonic development and in adult osteoblasts. Despite consistent expression in cells of the osteogenic lineage, SCL protein is not required for bone specification of embryonic stem cells. In transgenic mice, the SCL +19 core enhancer directed reporter gene expression to vascular smooth muscle and bone in addition to blood and endothelium. A 644-bp fragment containing the SCL +19 core enhancer was active in both blood and bone cell lines and was bound in vivo by a common array of Ets and GATA transcription factors. Taken together with the recent observation that a common progenitor can give rise to blood and bone cells, our results suggest that the SCL +19 enhancer targets a mesodermal progenitor capable of generating hematopoietic, vascular, and osteoblastic progeny.

  8. Transcriptional enhancer from milk protein genes


    Casperson, Gerald F.; Schmidhauser, Christian T.; Bissell, Mina J.


    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  9. Production of the 2400 kb Duchenne muscular dystrophy (DMD) gene transcript; transcription time and cotranscriptional splicing

    SciTech Connect

    Tennyson, C.N.; Worton, R.G.


    The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.

  10. TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.


    Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J


    TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

  11. Role of Specificity Protein-1 and Activating Protein-2 Transcription Factors in the Regulation of the Gap Junction Protein Beta-2 Gene in the Epididymis of the Rat.


    Adam, Cécile; Cyr, Daniel G


    In prepubertal rats, connexin 26 (GJB2) is expressed between adjacent columnar cells of the epididymis. At 28 days of age, when columnar cells differentiate into adult epithelial cell types, Gjb2 mRNA levels decrease to barely detectable levels. There is no information on the regulation of GJB2 in the epididymis. The present study characterized regulation of the Gjb2 gene promoter in the epididymis. A single transcription start site at position -3829 bp relative to the ATG was identified. Computational analysis revealed several TFAP2A, SP1, and KLF4 putative binding sites. A 1.5-kb fragment of the Gjb2 promoter was cloned into a vector containing a luciferase reporter gene. Transfection of the construct into immortalized rat caput epididymal (RCE-1) cells indicated that the promoter contained sufficient information to drive expression of the reporter gene. Deletion constructs showed that the basal activity of the promoter resides in the first -230 bp of the transcriptional start site. Two response elements necessary for GJB2 expression were identified: an overlapping TFAP2A/SP1 site (-136 to -126 bp) and an SP1 site (-50 bp). Chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assays confirmed that SP1 and TFAP2A were bound to the promoter. ChIP analysis of chromatin from young and pubertal rats indicated that TFAP2A and SP1 binding decreased with age. SP1 and TFAP2A knockdown indicated that SP1 is necessary for Gjb2 expression. DNA methylation did not appear to be involved in the regulation of Gjb2 expression. Results indicate that SP1 and TFAP2A regulate Gjb2 promoter activity during epididymal differentiation in rat. PMID:27053364

  12. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.


    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio


    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  13. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor.


    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio


    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light-oxygen-voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na(+)-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na(+) currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases.

  14. Regulation of neural gene transcription by optogenetic inhibition of the RE1-silencing transcription factor

    PubMed Central

    Paonessa, Francesco; Criscuolo, Stefania; Sacchetti, Silvio; Amoroso, Davide; Scarongella, Helena; Pecoraro Bisogni, Federico; Carminati, Emanuele; Pruzzo, Giacomo; Maragliano, Luca; Cesca, Fabrizia; Benfenati, Fabio


    Optogenetics provides new ways to activate gene transcription; however, no attempts have been made as yet to modulate mammalian transcription factors. We report the light-mediated regulation of the repressor element 1 (RE1)-silencing transcription factor (REST), a master regulator of neural genes. To tune REST activity, we selected two protein domains that impair REST-DNA binding or recruitment of the cofactor mSin3a. Computational modeling guided the fusion of the inhibitory domains to the light-sensitive Avena sativa light–oxygen–voltage-sensing (LOV) 2-phototrophin 1 (AsLOV2). By expressing AsLOV2 chimeras in Neuro2a cells, we achieved light-dependent modulation of REST target genes that was associated with an improved neural differentiation. In primary neurons, light-mediated REST inhibition increased Na+-channel 1.2 and brain-derived neurotrophic factor transcription and boosted Na+ currents and neuronal firing. This optogenetic approach allows the coordinated expression of a cluster of genes impinging on neuronal activity, providing a tool for studying neuronal physiology and correcting gene expression changes taking place in brain diseases. PMID:26699507

  15. Disruption of Transcriptional Coactivator Sub1 Leads to Genome-Wide Re-distribution of Clustered Mutations Induced by APOBEC in Active Yeast Genes.


    Lada, Artem G; Kliver, Sergei F; Dhar, Alok; Polev, Dmitrii E; Masharsky, Alexey E; Rogozin, Igor B; Pavlov, Youri I


    Mutations in genomes of species are frequently distributed non-randomly, resulting in mutation clusters, including recently discovered kataegis in tumors. DNA editing deaminases play the prominent role in the etiology of these mutations. To gain insight into the enigmatic mechanisms of localized hypermutagenesis that lead to cluster formation, we analyzed the mutational single nucleotide variations (SNV) data obtained by whole-genome sequencing of drug-resistant mutants induced in yeast diploids by AID/APOBEC deaminase and base analog 6-HAP. Deaminase from sea lamprey, PmCDA1, induced robust clusters, while 6-HAP induced a few weak ones. We found that PmCDA1, AID, and APOBEC1 deaminases preferentially mutate the beginning of the actively transcribed genes. Inactivation of transcription initiation factor Sub1 strongly reduced deaminase-induced can1 mutation frequency, but, surprisingly, did not decrease the total SNV load in genomes. However, the SNVs in the genomes of the sub1 clones were re-distributed, and the effect of mutation clustering in the regions of transcription initiation was even more pronounced. At the same time, the mutation density in the protein-coding regions was reduced, resulting in the decrease of phenotypically detected mutants. We propose that the induction of clustered mutations by deaminases involves: a) the exposure of ssDNA strands during transcription and loss of protection of ssDNA due to the depletion of ssDNA-binding proteins, such as Sub1, and b) attainment of conditions favorable for APOBEC action in subpopulation of cells, leading to enzymatic deamination within the currently expressed genes. This model is applicable to both the initial and the later stages of oncogenic transformation and explains variations in the distribution of mutations and kataegis events in different tumor cells. PMID:25941824

  16. Disruption of Transcriptional Coactivator Sub1 Leads to Genome-Wide Re-distribution of Clustered Mutations Induced by APOBEC in Active Yeast Genes.


    Lada, Artem G; Kliver, Sergei F; Dhar, Alok; Polev, Dmitrii E; Masharsky, Alexey E; Rogozin, Igor B; Pavlov, Youri I


    Mutations in genomes of species are frequently distributed non-randomly, resulting in mutation clusters, including recently discovered kataegis in tumors. DNA editing deaminases play the prominent role in the etiology of these mutations. To gain insight into the enigmatic mechanisms of localized hypermutagenesis that lead to cluster formation, we analyzed the mutational single nucleotide variations (SNV) data obtained by whole-genome sequencing of drug-resistant mutants induced in yeast diploids by AID/APOBEC deaminase and base analog 6-HAP. Deaminase from sea lamprey, PmCDA1, induced robust clusters, while 6-HAP induced a few weak ones. We found that PmCDA1, AID, and APOBEC1 deaminases preferentially mutate the beginning of the actively transcribed genes. Inactivation of transcription initiation factor Sub1 strongly reduced deaminase-induced can1 mutation frequency, but, surprisingly, did not decrease the total SNV load in genomes. However, the SNVs in the genomes of the sub1 clones were re-distributed, and the effect of mutation clustering in the regions of transcription initiation was even more pronounced. At the same time, the mutation density in the protein-coding regions was reduced, resulting in the decrease of phenotypically detected mutants. We propose that the induction of clustered mutations by deaminases involves: a) the exposure of ssDNA strands during transcription and loss of protection of ssDNA due to the depletion of ssDNA-binding proteins, such as Sub1, and b) attainment of conditions favorable for APOBEC action in subpopulation of cells, leading to enzymatic deamination within the currently expressed genes. This model is applicable to both the initial and the later stages of oncogenic transformation and explains variations in the distribution of mutations and kataegis events in different tumor cells.

  17. A Novel Transcription Mechanism Activated by Ethanol

    PubMed Central

    Lin, Xinghua; Yang, Hong; Zhang, Hongfeng; Zhou, LiChun; Guo, ZhongMao


    Solute carrier family 7, member 11 (Slc7a11) is a plasma membrane cystine/glutamate exchanger that provides intracellular cystine to produce glutathione, a major cellular antioxidant. Oxidative and endoplasmic reticulum stresses up-regulate Slc7a11 expression by activation of nuclear factor erythroid 2-related factor 2 and transcription factor 4. This study examined the effect of ethanol on Slc7a11 expression and the underlying mechanism involved. Treatment of mouse hepatic stellate cells with ethanol significantly increased Slc7a11 mRNA and protein levels. Deletion of a 20-bp DNA sequence between −2044 to −2024 upstream of the transcription start site significantly increased basal activity and completely abolished the ethanol-induced activity of the Slc7a11 promoter. This deletion did not affect Slc7a11 promoter activity induced by oxidative or endoplasmic reticulum stress. DNA sequence analysis revealed a binding motif for octamer-binding transcription factor 1 (OCT-1) in the deleted fragment. Mutation of this OCT-1 binding motif resulted in a similar effect as the deletion experiment, i.e. it increased the basal promoter activity and abolished the response to ethanol. Ethanol exposure significantly inhibited OCT-1 binding to the Slc7a11 promoter region, although it did not alter OCT-1 mRNA and protein levels. OCT-1 reportedly functions as either a transcriptional enhancer or repressor, depending on the target genes. Results from this study suggest that OCT-1 functions as a repressor on the Slc7a11 promoter and that ethanol inhibits OCT-1 binding to the Slc7a11 promoter, thereby increasing Slc7a11 expression. Taken together, inhibition of the DNA binding activity of transcriptional repressor OCT-1 is a mechanism by which ethanol up-regulates Slc711 expression. PMID:23592778

  18. Impact of ACTH Signaling on Transcriptional Regulation of Steroidogenic Genes

    PubMed Central

    Ruggiero, Carmen; Lalli, Enzo


    The trophic peptide hormone adrenocorticotropic (ACTH) stimulates steroid hormone biosynthesis evoking both a rapid, acute response and a long-term, chronic response, via the activation of cAMP/protein kinase A (PKA) signaling. The acute response is initiated by the mobilization of cholesterol from lipid stores and its delivery to the inner mitochondrial membrane, a process that is mediated by the steroidogenic acute regulatory protein. The chronic response results in the increased coordinated transcription of genes encoding steroidogenic enzymes. ACTH binding to its cognate receptor, melanocortin 2 receptor (MC2R), stimulates adenylyl cyclase, thus inducing cAMP production, PKA activation, and phosphorylation of specific nuclear factors, which bind to target promoters and facilitate coactivator protein recruitment to direct steroidogenic gene transcription. This review provides a general view of the transcriptional control exerted by the ACTH/cAMP system on the expression of genes encoding for steroidogenic enzymes in the adrenal cortex. Special emphasis will be given to the transcription factors required to mediate ACTH-dependent transcription of steroidogenic genes. PMID:27065945

  19. bldA-dependent expression of the Streptomyces exfoliatus M11 lipase gene (lipA) is mediated by the product of a contiguous gene, lipR, encoding a putative transcriptional activator.

    PubMed Central

    Servín-González, L; Castro, C; Pérez, C; Rubio, M; Valdez, F


    Extracellular lipase synthesis by Streptomyces lividans 66 carrying the cloned lipase gene (lipA) from Streptomyces exfoliatus M11 was found to be growth phase dependent, since lipase was secreted into the medium mainly during the stationary phase; S1 nuclease protection experiments revealed abundant lipA transcripts in RNA preparations obtained during the stationary phase but not in those obtained during exponential growth. Transcription from the lipA promoter was dependent on the presence of lipR, a contiguous downstream gene with a very high guanine-plus-cytosine content (80.2%). The deduced lipR product consists of a protein of 934 amino acids that shows similarity to known transcriptional activators and has a strong helix-turn-helix motif at its C terminus; this motif is part of a domain homologous to DNA-binding domains of bacterial regulators of the UhpA/LuxR superfamily. The lipR sequence revealed the presence of a leucine residue, encoded by the rare TTA codon, which caused bldA dependence of lipA transcription in Streptomyces coelicolor A3(2); replacement of the TTA codon by the alternate CTC leucine codon alleviated bidA dependence but not the apparent growth phase-dependent regulation of lipA transcription. When lipR expression was induced in a controlled fashion during the exponential growth phase, by placing it under the inducible tipA promoter, lipase synthesis was shifted to the exponential growth phase, indicating that the timing of lipR expression, and not its bldA dependence, is the main cause for stationary-phase transcription of lipA. PMID:9401043

  20. Transcription factor ZBED6 mediates IGF2 gene expression by regulating promoter activity and DNA methylation in myoblasts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were up regulated during C2C12 differentiation. The IGF2 expression levels wer...

  1. GenR, an IclR-Type Regulator, Activates and Represses the Transcription of gen Genes Involved in 3-Hydroxybenzoate and Gentisate Catabolism in Corynebacterium glutamicum

    PubMed Central

    Chao, Hongjun


    The genes required for 3-hydroxybenzoate and gentisate catabolism in Corynebacterium glutamicum are closely clustered in three operons. GenR, an IclR-type regulator, can activate the transcription of genKH and genDFM operons in response to 3-hydroxybenzoate and gentisate, and it can repress its own expression. Footprinting analyses demonstrated that GenR bound to four sites with different affinities. Two GenR-binding sites (DFMn01 and DFMn02) were found to be located between positions −41 and −84 upstream of the −35 and −10 regions of the genDFM promoter, which was involved in positive regulation of genDFM transcription. The GenR binding site R-KHn01 (located between positions −47 and −16) overlapped the −35 region of the genKH promoter sequence and is involved in positive regulation of its transcription. The binding site R-KHn02, at which GenR binds to its own promoter, was found within a footprint extending from position −44 to −67. It appeared to be involved in negative regulation of the activity of the genR promoter. A consensus motif with a 5-bp imperfect palindromic sequence [ATTCC-N7(5)-GGAAT] was identified among all four GenR binding sites and found to be necessary to GenR regulation through site-directed mutagenesis. The results reveal a new regulatory function of the IclR family in the catabolism of aromatic compounds. PMID:23354754

  2. A transcriptional activator, homologous to the Bacillus subtilis PurR repressor, is required for expression of purine biosynthetic genes in Lactococcus lactis.


    Kilstrup, M; Martinussen, J


    A purR::pGh9:ISS1 mutant of Lactococcus lactis was obtained following transposon mutagenesis of strain MG1363 and selection for purine auxotrophs. After determination of the nucleotide sequence and deduction of the purR reading frame, the PurR product was found to be highly similar to the purR-encoded repressor from Bacillus subtilis. The wild-type purR gene complemented the purine auxotrophy of a purR::ISS1 mutant, and it was shown that the purR::ISS1 mutation lowered the level of transcription from the purine-regulated L. lactis purD promoter. In a parallel study on the regulation of purC and purD expression in L. lactis (M. Kilstrup, S. G. Jessing, S. B. Wichmand-Jorgensen, M. Madsen, and D. Nilsson, J. Bacteriol. 180:3900-3906, 1998), we identified regions (PurBox sequences: AWWWCCGAACWWT) upstream of the promoters with a central G residue at exactly position -76 relative to the transcriptional start site. The PurBox sequences were found to be required for high-level promoter activity and purine regulation. We identified a PurBox sequence overlapping the -35 region of the L. lactis purR promoter and found, by studies of a purR-lacLM fusion plasmid, that purR is autoregulated. Because of the high degree of similarity of the PurR proteins from B. subtilis and L. lactis, we looked for PurBox sequences in the promoter regions of the PurR-regulated genes in B. subtilis and identified a perfectly matching PurBox sequence in the purA promoter region and slightly degenerate PurBox-like sequences in the promoter regions for the pur operon and the purR gene. Interestingly, the PurBox in the pur operon of B. subtilis is located almost identically, with respect to the promoter, to the PurBox sequences located in front of purC and purD in L. lactis. We present a hypothesis to explain how an ancestral PurR protein in B. subtilis could have evolved from an activator of the pur operon into a repressor which regulates transcription initiation from the same pur promoter by using

  3. Bidirectional transcription of lipooligosaccharide synthesis genes from Campylobacter jejuni.


    Phongsisay, Vongsavanh; Fry, Benjamin N


    The lipooligosaccharide (LOS) molecules of Campylobacter jejuni are involved in virulence and induction of the Guillain-Barré syndrome (GBS). This study analysed the transcription of the LOS synthesis genes from the GBS-inducing C. jejuni strain HB 93-13 under microaerobic conditions. Fourteen consecutive genes Cj1132c, waaC, htrB, wlaNC, wlaND, cgtA, cgtB, cstII, neuB, neuC, neuA, wlaVA, wlaQA, and waaF were included. The results of rapid amplification of cDNA ends and single-stranded ligation of complementary ends showed initiation sites with potential promoter regions on both DNA strands in the Cj1132c/waaC, cgtB/cstII, and wlaQA/waaF strand-switch regions. Other termini without recognisable promoter region were also found throughout the LOS gene cluster, suggesting a low specificity of the polymerase during transcription. In addition, all gene junction regions were cloned into the shuttle vector pMW10 carrying the promoterless lacZ gene to identify functional promoter sites. Bidirectional active promoters were found in the strand-switch regions. The results of RT-PCR and cDNA blotting indicated that transcriptional linkage occurred between different operons, indicating a lack of transcription termination within the LOS gene cluster. Moreover, the results of semi-quantitative RT-PCR and real-time RT-PCR showed that both DNA strands were transcribed but transcription of the coding strand was at a higher rate. The results presented here provide an insight into transcription of the LOS synthesis gene cluster of C. jejuni.

  4. Regulation of gene transcription by Polycomb proteins

    PubMed Central

    Aranda, Sergi; Mas, Gloria; Di Croce, Luciano


    The Polycomb group (PcG) of proteins defines a subset of factors that physically associate and function to maintain the positional identity of cells from the embryo to adult stages. PcG has long been considered a paradigmatic model for epigenetic maintenance of gene transcription programs. Despite intensive research efforts to unveil the molecular mechanisms of action of PcG proteins, several fundamental questions remain unresolved: How many different PcG complexes exist in mammalian cells? How are PcG complexes targeted to specific loci? How does PcG regulate transcription? In this review, we discuss the diversity of PcG complexes in mammalian cells, examine newly identified modes of recruitment to chromatin, and highlight the latest insights into the molecular mechanisms underlying the function of PcGs in transcription regulation and three-dimensional chromatin conformation. PMID:26665172

  5. Triiodothyronine (T3) induces proinsulin gene expression by activating PI3K: possible roles for GSK-3β and the transcriptional factor PDX-1.


    Goulart-Silva, F; Serrano-Nascimento, C; Texeira, S S; Nunes, M T


    Thyroid hormone (TH) activates PI3K and Akt, leading to glucose uptake in rat skeletal muscle cells and proliferation of insulinoma cells, respectively. However, TH actions on pancreatic beta cells have been little explored, which lead us to evaluate the TH eff ects on proinsulin gene expression, and the involvement of PI3K/Akt/GSK-3β signaling pathway, and a transcriptional factor for insulin (PDX-1). INS-1E cells were sorted into 3 groups: control and TH-depleted treated or not with T3 for 30 min. Cells were also previously treated with actinomycin D (ActD), cycloheximide (CHX), wortmannin or Akt inhibitor. Proinsulin mRNA expression was evaluated by real time PCR, and pGSK-3β and PDX-1 protein content was analyzed by Western blotting. TH depletion decreased proinsulin mRNA content, which was restored after acute T3 treatment. ActD, CHX and wortmannin, but not Akt inhibitor, prevented the rapid stimulatory eff ect of T3 on proinsulin mRNA expression. TH depletion did not affect the phosphorylated GSK-3β and PDX-1 protein content; but T3 treatment led to an increase in the content of these proteins. These data indicate that T3 acutely increases proinsulin mRNA expression, by mechanisms which depends on the activation of PI3K, but not of Akt, and may involve the inactivation of GSK-3β by phosphorylation. Since GSK-3β enhances PDX-1 degradation rate, the GSK-3β inactivation could explain the increase of PDX-1 content in T3-treated cells. Considering that PDX-1 is one of the most important transcriptional factors for proinsulin gene expression, its enhancement may underlie the increased proinsulin mRNA content acutely induced by T3.

  6. Thermodynamics-based models of transcriptional regulation with gene sequence.


    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing


    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  7. TaMYB13 is a transcriptional activator of fructosyltransferase genes involved in β-2,6-linked fructan synthesis in wheat.


    Xue, Gang-Ping; Kooiker, Maarten; Drenth, Janneke; McIntyre, C Lynne


    Fructans are soluble fructosyl-oligosaccharides deposited in many cool-season grass species as a carbon reserve; they are synthesised by fructosyltransferases. In wheat and barley fructans can accumulate in mature stems at a very high level and serve as an important carbon source for grain filling. Fructan synthesis in temperate cereals is regulated by sucrose level and developmental signals, and functions as a metabolic adjustment for carbon balance between carbon supply and sink demand. In this study the expression levels of a highly homologous group of Triticum aestivumMYB genes (TaMYB13-1, TaMYB13-2 and TaMYB13-3) were found to be positively correlated with the mRNA levels of sucrose:sucrose 1-fructosyltransferase (1-SST) and sucrose:fructan 6-fructosyltransferase (6-SFT) in wheat stems among recombinant inbred lines with a wide range of fructan concentrations through Affymetrix array expression analysis. This expression correction extended to expression profiles during stem development. TaMYB13 contains an R2R3-type MYB domain. In vitro random DNA-binding site selection followed by base substitution mutagenesis revealed that TaMYB13 bound to a (A/G/T)TT(A/T/C)GGT core sequence, which was present in the promoters of wheat Ta1-SST and Ta6-SFT genes as well as a barley Hv6-SFT gene. Transactivation analysis showed that TaMYB13 was a transcriptional activator and could markedly enhance the expression of 1-SST and 6-SFT promoter-driven reporter genes in wheat. Elimination of TaMYB13-binding sites in Ta6-SFT and Ta1-SST promoters markedly reduced TaMYB13-mediated reporter gene transactivation. These data suggest that TaMYB13 and its orthologues are positive regulators for controlling the expression of major fructosyltransferases involved in the fructan synthetic pathway in temperate cereals.

  8. Targeting of the Plzf Gene in the Rat by Transcription Activator-Like Effector Nuclease Results in Caudal Regression Syndrome in Spontaneously Hypertensive Rats

    PubMed Central

    Liška, František; Peterková, Renata; Peterka, Miroslav; Landa, Vladimír; Zídek, Václav; Mlejnek, Petr; Šilhavý, Jan; Šimáková, Miroslava; Křen, Vladimír; Starker, Colby G.; Voytas, Daniel F.; Izsvák, Zsuzsanna; Pravenec, Michal


    Recently, it has been found that spontaneous mutation Lx (polydactyly-luxate syndrome) in the rat is determined by deletion of a conserved intronic sequence of the Plzf (Promyelocytic leukemia zinc finger protein) gene. In addition, Plzf is a prominent candidate gene for quantitative trait loci (QTLs) associated with cardiac hypertrophy and fibrosis in the spontaneously hypertensive rat (SHR). In the current study, we tested the effects of Plzf gene targeting in the SHR using TALENs (transcription activator-like effector nucleases). SHR ova were microinjected with constructs pTAL438/439 coding for a sequence-specific endonuclease that binds to target sequence in the first coding exon of the Plzf gene. Out of 43 animals born after microinjection, we detected a single male founder. Sequence analysis revealed a deletion of G that resulted in frame shift mutation starting in codon 31 and causing a premature stop codon at position of amino acid 58. The Plzftm1Ipcv allele is semi-lethal since approximately 95% of newborn homozygous animals died perinatally. All homozygous animals exhibited manifestations of a caudal regression syndrome including tail anomalies and serious size reduction and deformities of long bones, and oligo- or polydactyly on the hindlimbs. The heterozygous animals only exhibited the tail anomalies. Impaired development of the urinary tract was also revealed: one homozygous and one heterozygous rat exhibited a vesico-ureteric reflux with enormous dilatation of ureters and renal pelvis. In the homozygote, this was combined with a hypoplastic kidney. These results provide evidence for the important role of Plzf gene during development of the caudal part of a body—column vertebrae, hindlimbs and urinary system in the rat. PMID:27727328

  9. [Immunoglobulin genes in lymphoid cells and regulation of their transcription].


    Stepchenko, A G; Urakov, D N; Luchina, N N; Deev, S M; Polianovskiĭ, O L


    The hybridoma genomes contain polyploid sets of immunoglobulin genes. We have shown, that the hybridoma PTF-02 genome contains three genes of heavy chains and two genes of light chains. The genes responsible for antibody synthesis were cloned and their structure were determined. Investigation of the kappa gene transcription and its fragments which contain regulatory sequences revealed a nuclear factor. The latter interacts with the octanucleotide localized at the promoter region of the kappa gene. The purified factor activates the transcription of the kappa gene in a heterologous cell-free system. Together with the tissue-specific factor there is also an universal factor interacting with the octanucleotide sequence. We have shown an additional factor in lymphoid cells interact with the protein which binds to the octanucleotide sequence. We have shown an additional factor in lymphoid cells interacting with the protein which binds to the octanucleotide sequence. As a result, there is a family of factors which interact with ATTTGCAT sequence. One major factor (m.w. 60 +/- 2 kDa) is an obligatory component for the initiation of immunoglobulin genes transcription.

  10. MONOPTEROS directly activates the auxin-inducible promoter of the Dof5.8 transcription factor gene in Arabidopsis thaliana leaf provascular cells

    PubMed Central

    Konishi, Mineko; Donner, Tyler J.; Scarpella, Enrico; Yanagisawa, Shuichi


    MONOPTEROS (MP) is an auxin-responsive transcription factor that is required for primary root formation and vascular development, whereas Dof5.8 is a Dof-class transcription factor whose gene is expressed in embryos as well as the pre- and procambial cells in the leaf primordium in Arabidopsis thaliana. In this study, it is shown that MP directly activates the Dof5.8 promoter. Although no apparent phenotype of the single dof5.8 mutants was found, phenotypic analysis with the mp dof5.8 double mutants revealed that mutations within Dof5.8 enhanced the phenotype of a weak allele of mp, with an increase in the penetrance of the ‘rootless’ phenotype and a reduction in the number of cotyledons. Furthermore, interestingly, although mp mutants showed reduced vascular pattern complexity in cotyledons, the mp dof5.8 double mutants displayed both more simplex and more complex vascular patterns in individual cotyledons. These results imply that the product of Dof5.8 whose expression is regulated by MP at least in part might be involved in multiple processes controlled by MP. PMID:25336688

  11. Combinatorial Transcription Control in Gene Regulation

    NASA Astrophysics Data System (ADS)

    Hwa, Terence; Buchler, Nicolas E.; Gerland, Ulrich


    We develop a simple thermodynamic model for the regulation of gene transcription and explore the limits of combinatorial control. Our model is based on the ``regulated recruitment'' mechanism [M. Ptashne and A. Gann, Nature 386 (1997) 569], assuming weak contact interaction between the regulatory proteins together with specific protein-DNA interactions. We further assume "programmability" in the strengths of these interactions within a biophysically allowed range [U. Gerland, J.D. Moroz, and T.Hwa, PNAS 99 (2002) 12015], through the choices and the locations of the protein-binding DNA sequences in the regulatory region. Within our thermodynamic model, we demonstrate the implementability of various binary logic functions (including XOR) by computing the degree of gene transcription (output) for all combinations of regulatory protein concentrations (input).

  12. Conditional enhancement of liver-specific gene transcription.

    PubMed Central

    Zaret, K S; DiPersio, C M; Jackson, D A; Montigny, W J; Weinstat, D L


    We sought to develop a cell line in which liver-specific transcription could be induced at will, to facilitate the study of factors that cause hepatocyte-specific transcription of the serum albumin gene in mice. We therefore created the H2.35 cell line from mouse hepatocytes infected with a temperature-sensitive strain of simian virus 40. During routine propagation at the permissive temperature, H2.35 cells exhibit extremely low levels of albumin transcription and mRNA. Albumin mRNA increases at least 100-fold when H2.35 cells are cultured at the restrictive temperature and in serum-free medium on a collagen substratum; the two latter conditions maintain the differentiated state of primary hepatocyte cultures. Although a major cause of the mRNA increase is posttranscriptional, the transcription rates of albumin and other liver-specific genes increase significantly. Transient-transfection experiments demonstrated that an induction of transcription is caused by activation of an albumin upstream sequence that was previously shown to enhance liver-specific transcription in transgenic mice. Thus, hepatocyte differentiation appears to be maintained in part by extracellular signals that stimulate the activity of a tissue-specific enhancer element. Images PMID:3194409

  13. Theta-Burst Stimulation of Hippocampal Slices Induces Network-Level Calcium Oscillations and Activates Analogous Gene Transcription to Spatial Learning

    PubMed Central

    O'Connor, John J.; Murphy, Keith J.


    Over four decades ago, it was discovered that high-frequency stimulation of the dentate gyrus induces long-term potentiation (LTP) of synaptic transmission. LTP is believed to underlie how we process and code external stimuli before converting it to salient information that we store as 'memories'. It has been shown that rats performing spatial learning tasks display theta-frequency (3–12 Hz) hippocampal neural activity. Moreover, administering theta-burst stimulation (TBS) to hippocampal slices can induce LTP. TBS triggers a sustained rise in intracellular calcium [Ca2+]i in neurons leading to new protein synthesis important for LTP maintenance. In this study, we measured TBS-induced [Ca2+]i oscillations in thousands of cells at increasing distances from the source of stimulation. Following TBS, a calcium wave propagates radially with an average speed of 5.2 µm/s and triggers multiple and regular [Ca2+]i oscillations in the hippocampus. Interestingly, the number and frequency of [Ca2+]i fluctuations post-TBS increased with respect to distance from the electrode. During the post-tetanic phase, 18% of cells exhibited 3 peaks in [Ca2+]i with a frequency of 17 mHz, whereas 2.3% of cells distributed further from the electrode displayed 8 [Ca2+]i oscillations at 33 mHz. We suggest that these observed [Ca2+]i oscillations could lead to activation of transcription factors involved in synaptic plasticity. In particular, the transcription factor, NF-κB, has been implicated in memory formation and is up-regulated after LTP induction. We measured increased activation of NF-κB 30 min post-TBS in CA1 pyramidal cells and also observed similar temporal up-regulation of NF-κB levels in CA1 neurons following water maze training in rats. Therefore, TBS of hippocampal slice cultures in vitro can mimic the cell type-specific up-regulations in activated NF-κB following spatial learning in vivo. This indicates that TBS may induce similar transcriptional changes to spatial learning

  14. Long-term pancreatic beta cell exposure to high levels of glucose but not palmitate induces DNA methylation within the insulin gene promoter and represses transcriptional activity.


    Ishikawa, Kota; Tsunekawa, Shin; Ikeniwa, Makoto; Izumoto, Takako; Iida, Atsushi; Ogata, Hidetada; Uenishi, Eita; Seino, Yusuke; Ozaki, Nobuaki; Sugimura, Yoshihisa; Hamada, Yoji; Kuroda, Akio; Shinjo, Keiko; Kondo, Yutaka; Oiso, Yutaka


    Recent studies have implicated epigenetics in the pathophysiology of diabetes. Furthermore, DNA methylation, which irreversibly deactivates gene transcription, of the insulin promoter, particularly the cAMP response element, is increased in diabetes patients. However, the underlying mechanism remains unclear. We aimed to investigate insulin promoter DNA methylation in an over-nutrition state. INS-1 cells, the rat pancreatic beta cell line, were cultured under normal-culture-glucose (11.2 mmol/l) or experimental-high-glucose (22.4 mmol/l) conditions for 14 days, with or without 0.4 mmol/l palmitate. DNA methylation of the rat insulin 1 gene (Ins1) promoter was investigated using bisulfite sequencing and pyrosequencing analysis. Experimental-high-glucose conditions significantly suppressed insulin mRNA and increased DNA methylation at all five CpG sites within the Ins1 promoter, including the cAMP response element, in a time-dependent and glucose concentration-dependent manner. DNA methylation under experimental-high-glucose conditions was unique to the Ins1 promoter; however, palmitate did not affect DNA methylation. Artificial methylation of Ins1 promoter significantly suppressed promoter-driven luciferase activity, and a DNA methylation inhibitor significantly improved insulin mRNA suppression by experimental-high-glucose conditions. Experimental-high-glucose conditions significantly increased DNA methyltransferase activity and decreased ten-eleven-translocation methylcytosine dioxygenase activity. Oxidative stress and endoplasmic reticulum stress did not affect DNA methylation of the Ins1 promoter. High glucose but not palmitate increased ectopic triacylglycerol accumulation parallel to DNA methylation. Metformin upregulated insulin gene expression and suppressed DNA methylation and ectopic triacylglycerol accumulation. Finally, DNA methylation of the Ins1 promoter increased in isolated islets from Zucker diabetic fatty rats. This study helps to clarify the

  15. The Transcription Factor AmrZ Utilizes Multiple DNA Binding Modes to Recognize Activator and Repressor Sequences of Pseudomonas aeruginosa Virulence Genes

    PubMed Central

    Pryor, Edward E.; Waligora, Elizabeth A.; Xu, Binjie; Dellos-Nolan, Sheri; Wozniak, Daniel J.; Hollis, Thomas


    AmrZ, a member of the Ribbon-Helix-Helix family of DNA binding proteins, functions as both a transcriptional activator and repressor of multiple genes encoding Pseudomonas aeruginosa virulence factors. The expression of these virulence factors leads to chronic and sustained infections associated with worsening prognosis. In this study, we present the X-ray crystal structure of AmrZ in complex with DNA containing the repressor site, amrZ1. Binding of AmrZ to this site leads to auto-repression. AmrZ binds this DNA sequence as a dimer-of-dimers, and makes specific base contacts to two half sites, separated by a five base pair linker region. Analysis of the linker region shows a narrowing of the minor groove, causing significant distortions. AmrZ binding assays utilizing sequences containing variations in this linker region reveals that secondary structure of the DNA, conferred by the sequence of this region, is an important determinant in binding affinity. The results from these experiments allow for the creation of a model where both intrinsic structure of the DNA and specific nucleotide recognition are absolutely necessary for binding of the protein. We also examined AmrZ binding to the algD promoter, which results in activation of the alginate exopolysaccharide biosynthetic operon, and found the protein utilizes different interactions with this site. Finally, we tested the in vivo effects of this differential binding by switching the AmrZ binding site at algD, where it acts as an activator, for a repressor binding sequence and show that differences in binding alone do not affect transcriptional regulation. PMID:22511872

  16. Viral DNA synthesis-dependent titration of a cellular repressor activates transcription of the human adenovirus type 2 IVa2 gene.


    Iftode, C; Flint, S J


    Synthesis of progeny DNA genomes in cells infected by human subgroup C adenoviruses leads to several changes in viral gene expression. These changes include transcription from previously silent, late promoters, such as the IV(a2) promoter, and a large increase in the efficiency of major-late (ML) transcription. Some of these changes appear to take place sequentially, because the product of the IV(a2) gene has been implicated in stimulation of ML transcription. Our previous biochemical studies suggested that IV(a2) transcription is regulated by viral DNA synthesis-dependent relief of transcriptional repression by a cellular protein that we termed IV(a2)-RF. To test the relevance of such a repressor-titration mechanism during the viral infectious cycle, we introduced into the endogenous IV(a2) promoter two mutations that impair in vitro-binding of IV(a2)-RF, but introduce no change (Rep7) or one conservative amino acid substitution (Rep6) into the overlapping coding sequence for the viral DNA polymerase. The results of run-on transcription assays indicated that both mutations induced earlier-than-normal and more efficient IV(a2) transcription. Both mutations were also observed to result in modest increases in the efficiency of viral DNA synthesis. However, measurement of the concentration of IV(a2) transcripts as a function of IV(a2) template concentration demonstrated that the Rep mutations increased by up to 60-fold the efficiency with which IV(a2) templates were used during the initial period of the late phase of infection, as predicted by the repressor titration hypothesis. These mutations also increased the efficiency of ML transcription in infected cells.

  17. Gene expression and metabolite profiling of developing highbush blueberry fruit indicates transcriptional regulation of flavonoid metabolism and activation of abscisic acid metabolism.


    Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A; Zaharia, L Irina; Schernthaner, Johann P; Gesell, Andreas; Abrams, Suzanne R; Kennedy, James A; Constabel, C Peter


    Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3'-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3'5'-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation of

  18. Gene expression profiling of cultured human NF1 heterozygous (NF1+/-) melanocytes reveals downregulation of a transcriptional cis-regulatory network mediating activation of the melanocyte-specific dopachrome tautomerase (DCT) gene.


    Boucneau, Joachim; De Schepper, Sofie; Vuylsteke, Marnik; Van Hummelen, Paul; Naeyaert, Jean-Marie; Lambert, Jo


    One of the major primary features of the neurocutaneous genetic disorder Neurofibromatosis type 1 are the hyperpigmentary café-au-lait macules where disregulation of melanocyte biology is supposed to play a key etiopathogenic role. To gain better insight into the possible role of the tumor suppressor gene NF1, a transcriptomic microarray analysis was performed on human NF1 heterozygous (NF1+/-) melanocytes of a Neurofibromatosis type 1 patient and NF1 wild type (NF1+/+) melanocytes of a healthy control patient, both cultured from normally pigmented skin and hyperpigmented lesional café-au-lait skin. From the magnitude of gene effects, we found that gene expression was affected most strongly by genotype and less so by lesional type. A total of 137 genes had a significant twofold or more up- (72) or downregulated (65) expression in NF1+/- melanocytes compared with NF1+/+ melanocytes. Melanocytes cultured from hyperpigmented café-au-lait skin showed 37 upregulated genes whereas only 14 were downregulated compared with normal skin melanocytes. In addition, significant genotype xlesional type interactions were observed for 465 genes. Differentially expressed genes were mainly involved in regulating cell proliferation and cell adhesion. A high number of transcription factor genes, among which a specific subset important in melanocyte lineage development, were downregulated in the cis-regulatory network governing the activation of the melanocyte-specific dopachrome tautomerase (DCT) gene. Although the results presented have been obtained with a restricted number of patients (one NF1 patient and one control) and using cDNA microarrays that may limit their interpretation, the data nevertheless addresses for the first time the effect of a heterozygous NF1 gene on the expression of the human melanocyte transcriptome and has generated several interesting candidate genes helpful in elucidating the etiopathology of café-au-lait macules in NF1 patients.

  19. Transcriptional activation of a MYB gene controls the tissue-specific anthocyanin accumulation in a purple cauliflower mutant

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Flavonoids such as anthocyanins possess significant health benefits to humans and play important physiological roles in plants. An interesting Purple gene mutation in cauliflower confers an abnormal pattern of anthocyanin accumulation, giving intense purple color in very young leaves, curds, and see...

  20. Enhancing effect of 4-hydroxy-3-nitrophenylacetic acid on transcription of the ice nucleation-active gene of Xanthomonas campestris.


    Watanabe, M; Watanabe, J; Michigami, Y


    Cultivation of an ice nucleation-active strain of Xanthomonas campestris in the presence (1 ppm) of 4-hydroxy-3-nitrophenylacetic acid resulted in enhancement of its ice-nucleation activity. Both the ice-nucleation-active protein, InaX, and its mRNA were effectively expressed in the bacterial cells cultured in the presence of this compound. This indicates that this compound stimulated the biosynthesis of the ice-nucleation-active protein. PMID:7765721

  1. The transcriptional activators AraR and XlnR from Aspergillus niger regulate expression of pentose catabolic and pentose phosphate pathway genes.


    Battaglia, Evy; Zhou, Miaomiao; de Vries, Ronald P


    The pentose catabolic pathway (PCP) and the pentose phosphate pathway (PPP) are required for the conversion of pentose sugars in fungi and are linked via d-xylulose-5-phosphate. Previously, it was shown that the PCP is regulated by the transcriptional activators XlnR and AraR in Aspergillus niger. Here we assessed whether XlnR and AraR also regulate the PPP. Expression of two genes, rpiA and talB, was reduced in the ΔaraR/ΔxlnR strain and increased in the xylulokinase negative strain (xkiA1) on d-xylose and/or l-arabinose. Bioinformatic analysis of the 1 kb promoter regions of rpiA and talB showed the presence of putative XlnR binding sites. Combining all results in this study, it strongly suggests that these two PPP genes are under regulation of XlnR in A. niger.

  2. The transcription factor Pou3f1 promotes neural fate commitment via activation of neural lineage genes and inhibition of external signaling pathways.


    Zhu, Qingqing; Song, Lu; Peng, Guangdun; Sun, Na; Chen, Jun; Zhang, Ting; Sheng, Nengyin; Tang, Wei; Qian, Cheng; Qiao, Yunbo; Tang, Ke; Han, Jing-Dong Jackie; Li, Jinsong; Jing, Naihe


    The neural fate commitment of pluripotent stem cells requires the repression of extrinsic inhibitory signals and the activation of intrinsic positive transcription factors. However, how these two events are integrated to ensure appropriate neural conversion remains unclear. In this study, we showed that Pou3f1 is essential for the neural differentiation of mouse embryonic stem cells (ESCs), specifically during the transition from epiblast stem cells (EpiSCs) to neural progenitor cells (NPCs). Chimeric analysis showed that Pou3f1 knockdown leads to a markedly decreased incorporation of ESCs in the neuroectoderm. By contrast, Pou3f1-overexpressing ESC derivatives preferentially contribute to the neuroectoderm. Genome-wide ChIP-seq and RNA-seq analyses indicated that Pou3f1 is an upstream activator of neural lineage genes, and also is a repressor of BMP and Wnt signaling. Our results established that Pou3f1 promotes the neural fate commitment of pluripotent stem cells through a dual role, activating internal neural induction programs and antagonizing extrinsic neural inhibitory signals.

  3. Essential role of NF-E2 in remodeling of chromatin structure and transcriptional activation of the epsilon-globin gene in vivo by 5' hypersensitive site 2 of the beta-globin locus control region.

    PubMed Central

    Gong, Q H; McDowell, J C; Dean, A


    Much of our understanding of the process by which enhancers activate transcription has been gained from transient-transfection studies in which the DNA is not assembled with histones and other chromatin proteins as it is in the cell nucleus. To study the activation of a mammalian gene in a natural chromatin context in vivo, we constructed a minichromosome containing the human epsilon-globin gene and portions of the beta-globin locus control region (LCR). The minichromosomes replicate and are maintained at stable copy number in human erythroid cells. Expression of the minichromosomal epsilon-globin gene requires the presence of beta-globin LCR elements in cis, as is the case for the chromosomal gene. We determined the chromatin structure of the epsilon-globin gene in both the active and inactive states. The transcriptionally inactive locus is covered by an array of positioned nucleosomes extending over 1,400 bp. In minichromosomes with a (mu)LCR or DNase I-hypersensitive site 2 (HS2) which actively transcribe the epsilon-globin gene, the nucleosome at the promoter is altered or disrupted while positioning of nucleosomes in the rest of the locus is retained. All or virtually all minichromosomes are simultaneously hypersensitive to DNase I both at the promoter and at HS2. Transcriptional activation and promoter remodeling, as well as formation of the HS2 structure itself, depended on the presence of the NF-E2 binding motif in HS2. The nucleosome at the promoter which is altered upon activation is positioned over the transcriptional elements of the epsilon-globin gene, i.e., the TATA, CCAAT, and CACCC elements, and the GATA-1 site at -165. The simple availability of erythroid transcription factors that recognize these motifs is insufficient to allow expression. As in the chromosomal globin locus, regulation also occurs at the level of chromatin structure. These observations are consistent with the idea that one role of the beta-globin LCR is to maintain promoters free

  4. Specificity protein 1 (Sp1)-dependent activation of the synapsin I gene (SYN1) is modulated by RE1-silencing transcription factor (REST) and 5'-cytosine-phosphoguanine (CpG) methylation.


    Paonessa, Francesco; Latifi, Shahrzad; Scarongella, Helena; Cesca, Fabrizia; Benfenati, Fabio


    The development and function of the nervous system are directly dependent on a well defined pattern of gene expression. Indeed, perturbation of transcriptional activity or epigenetic modifications of chromatin can dramatically influence neuronal phenotypes. The phosphoprotein synapsin I (Syn I) plays a crucial role during axonogenesis and synaptogenesis as well as in synaptic transmission and plasticity of mature neurons. Abnormalities in SYN1 gene expression have been linked to important neuropsychiatric disorders, such as epilepsy and autism. SYN1 gene transcription is suppressed in non-neural tissues by the RE1-silencing transcription factor (REST); however, the molecular mechanisms that allow the constitutive expression of this genetic region in neurons have not been clarified yet. Herein we demonstrate that a conserved region of human and mouse SYN1 promoters contains cis-sites for the transcriptional activator Sp1 in close proximity to REST binding motifs. Through a series of functional assays, we demonstrate a physical interaction of Sp1 on the SYN1 promoter and show that REST directly inhibits Sp1-mediated transcription, resulting in SYN1 down-regulation. Upon differentiation of neuroblastoma Neuro2a cells, we observe a decrease in endogenous REST and a higher stability of Sp1 on target GC boxes, resulting in an increase of SYN1 transcription. Moreover, methylation of Sp1 cis-sites in the SYN1 promoter region could provide an additional level of transcriptional regulation. Our results introduce Sp1 as a fundamental activator of basal SYN1 gene expression, whose activity is modulated by the neural master regulator REST and CpG methylation.

  5. Plant NAC-type transcription factor proteins contain a NARD domain for repression of transcriptional activation.


    Hao, Yu-Jun; Song, Qing-Xin; Chen, Hao-Wei; Zou, Hong-Feng; Wei, Wei; Kang, Xu-Sheng; Ma, Biao; Zhang, Wan-Ke; Zhang, Jin-Song; Chen, Shou-Yi


    Plant-specific transcription factor NAC proteins play essential roles in many biological processes such as development, senescence, morphogenesis, and stress signal transduction pathways. In the NAC family, some members function as transcription activators while others act as repressors. In the present study we found that though the full-length GmNAC20 from soybean did not have transcriptional activation activity, the carboxy-terminal activation domain of GmNAC20 had high transcriptional activation activity in the yeast assay system. Deletion experiments revealed an active repression domain with 35 amino acids, named NARD (NAC Repression Domain), in the d subdomain of NAC DNA-binding domain. NARD can reduce the transcriptional activation ability of diverse transcription factors when fused to either the amino-terminal or the carboxy-terminal of the transcription factors. NARD-like sequences are also present in other NAC family members and they are functional repression domain when fused to VP16 in plant protoplast assay system. Mutation analysis of conserved amino acid residues in NARD showed that the hydrophobic LVFY motif may partially contribute to the repression function. It is hypothesized that the interactions between the repression domain NARD and the carboxy-terminal activation domain may finally determine the ability of NAC family proteins to regulate downstream gene expressions.

  6. ROMA: an in vitro approach to defining target genes for transcription regulators

    PubMed Central

    MacLellan, Shawn R.; Eiamphungporn, Warawan; Helmann, John D.


    We describe an in vitro transcription-based method called ROMA (run-off transcription-microarray analysis) for the genome-wide analysis of transcription regulated by sigma factors and other transcriptional regulators. ROMA uses purified RNA polymerase with and without a regulatory protein to monitor products of transcription from a genomic DNA template. Transcribed RNA is converted to cDNA and hybridized to gene arrays allowing for the identification of genes that are specifically activated by the regulator. We discuss the use of ROMA to define sigma factor regulons in Bacillus subtilis and its broad application to defining regulons for other transcriptional regulators in various species. PMID:18948201

  7. Evidence for an early gene duplication event in the evolution of the mitochondrial transcription factor B family and maintenance of rRNA methyltransferase activity in human mtTFB1 and mtTFB2.


    Cotney, Justin; Shadel, Gerald S


    Most metazoans have two nuclear genes encoding orthologues of the well-characterized Saccharomyces cerevisiae mitochondrial transcription factor B (sc-mtTFB). This class of transcription factors is homologous to the bacterial KsgA family of rRNA methyltransferases, which in Escherichia coli dimethylates adjacent adenine residues in a stem-loop of the 16S rRNA. This posttranscriptional modification is conserved in most metazoan cytoplasmic and mitochondrial rRNAs. Homo sapiens mitochondrial transcription factor B1 (h-mtTFB1) possesses this enzymatic activity, implicating it as a dual-function protein involved in mitochondrial transcription and translation. Here we demonstrate that h-mtTFB2 also has rRNA methyltransferase activity but is a less efficient enzyme than h-mtTFB1. In contrast, sc-mtTFB has no detectable rRNA methyltransferase activity, correlating with the lack of the corresponding modification in the mitochondrial rRNA of budding yeast. Based on these results, and reports that Drosophila melanogaster mtTFB1 and mtTFB2 do not have completely overlapping functions, we propose a model for human mtDNA regulation that takes into account h-mtTFB1 and h-mtTFB2 likely having partially redundant transcription factor and rRNA methyltransferase functions. Finally, phylogenetic analyses of this family of proteins strongly suggest that the presence of two mtTFB homologues in metazoans is the result of a gene duplication event that occurred early in eukaryotic evolution prior to the divergence of fungi and metazoans. This model suggests that, after the gene duplication event, differential selective pressures on the rRNA methyltransferase and transcription factor activities of mtTFB genes occurred, with extreme cases culminating in the loss of one of the paralogous genes in certain species.

  8. Activation of heat shock gene transcription by heat shock factor 1 involves oligomerization, acquisition of DNA-binding activity, and nuclear localization and can occur in the absence of stress.

    PubMed Central

    Sarge, K D; Murphy, S P; Morimoto, R I


    The existence of multiple heat shock factor (HSF) genes in higher eukaryotes has promoted questions regarding the functions of these HSF family members, especially with respect to the stress response. To address these questions, we have used polyclonal antisera raised against mouse HSF1 and HSF2 to examine the biochemical, physical, and functional properties of these two factors in unstressed and heat-shocked mouse and human cells. We have identified HSF1 as the mediator of stress-induced heat shock gene transcription. HSF1 displays stress-induced DNA-binding activity, oligomerization, and nuclear localization, while HSF2 does not. Also, HSF1 undergoes phosphorylation in cells exposed to heat or cadmium sulfate but not in cells treated with the amino acid analog L-azetidine-2-carboxylic acid, indicating that phosphorylation of HSF1 is not essential for its activation. Interestingly, HSF1 and HSF2 overexpressed in transfected 3T3 cells both display constitutive DNA-binding activity, oligomerization, and transcriptional activity. These results demonstrate that HSF1 can be activated in the absence of physiological stress and also provide support for a model of regulation of HSF1 and HSF2 activity by a titratable negative regulatory factor. Images PMID:8441385

  9. Transcriptional regulation of genes related to progesterone production.


    Mizutani, Tetsuya; Ishikane, Shin; Kawabe, Shinya; Umezawa, Akihiro; Miyamoto, Kaoru


    Steroid hormones are synthesized from cholesterol in various tissues, mainly in the adrenal glands and gonads. Because these lipid-soluble steroid hormones immediately diffuse through the cells in which they are produced, their secretion directly reflects the activity of the genes related to their production. Progesterone is important not only for luteinization and maintenance of pregnancy, but also as a substrate for most other steroids. Steroidogenic acute regulatory protein (STAR), cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase/Δ(5)-Δ(4) isomerase (3β-HSD) are well-known proteins essential for progesterone production. In addition to them, glutathione S-transferase A1-1 and A3-3 are shown to exert Δ(5)-Δ(4) isomerization activity to produce progesterone in a cooperative fashion with 3β-HSD. 5-Aminolevulinic acid synthase 1, ferredoxin 1, and ferredoxin reductase also play a role in steroidogenesis as accessory factors. Members of the nuclear receptor 5A (NR5A) family (steroidogenic factor 1 and liver receptor homolog 1) play a crucial role in the transcriptional regulation of these genes. The NR5A family activates these genes by binding to NR5A responsive elements present within their promoter regions, as well as to the elements far from their promoters. In addition, various NR5A-interacting proteins including peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), nuclear receptor subfamily 0, group B, member 1 (DAX-1), and CCAAT/enhancer-binding proteins (C/EBP) are involved in the transcription of NR5A target genes and regulate the transcription either positively or negatively under both basal and tropic hormone-stimulated conditions. In this review, we describe the transcriptional regulation of genes related to progesterone production. PMID:26135521

  10. Promyelocytic leukemia nuclear bodies associate with transcriptionally active genomic regions

    PubMed Central

    Wang, Jayson; Shiels, Carol; Sasieni, Peter; Wu, Pei Jun; Islam, Suhail A.; Freemont, Paul S.; Sheer, Denise


    The promyelocytic leukemia (PML) protein is aggregated into nuclear bodies that are associated with diverse nuclear processes. Here, we report that the distance between a locus and its nearest PML body correlates with the transcriptional activity and gene density around the locus. Genes on the active X chromosome are more significantly associated with PML bodies than their silenced homologues on the inactive X chromosome. We also found that a histone-encoding gene cluster, which is transcribed only in S-phase, is more strongly associated with PML bodies in S-phase than in G0/G1 phase of the cell cycle. However, visualization of specific RNA transcripts for several genes showed that PML bodies were not themselves sites of transcription for these genes. Furthermore, knock-down of PML bodies by RNA interference did not preferentially change the expression of genes closely associated with PML bodies. We propose that PML bodies form in nuclear compartments of high transcriptional activity, but they do not directly regulate transcription of genes in these compartments. PMID:14970191

  11. Transcriptional activation of human adult alpha-globin genes by hypersensitive site-40 enhancer: function of nuclear factor-binding motifs occupied in erythroid cells.

    PubMed Central

    Rombel, I; Hu, K Y; Zhang, Q; Papayannopoulou, T; Stamatoyannopoulos, G; Shen, C K


    The developmental stage- and erythroid lineage-specific activation of the human embryonic zeta- and fetal/adult alpha-globin genes is controlled by an upstream regulatory element [hypersensitive site (HS)-40] with locus control region properties, a process mediated by multiple nuclear factor-DNA complexes. In vitro DNase I protection experiments of the two G+C-rich, adult alpha-globin promoters have revealed a number of binding sites for nuclear factors that are common to HeLa and K-562 extracts. However, genomic footprinting analysis has demonstrated that only a subset of these sites, clustered between -130 and +1, is occupied in an erythroid tissue-specific manner. The function of these in vivo-occupied motifs of the alpha-globin promoters, as well as those previously mapped in the HS-40 region, is assayed by site-directed mutagenesis and transient expression in embryonic/fetal erythroid K-562 cells. These studies, together with our expression data on the human embryonic zeta-globin promoter, provide a comprehensive view of the functional roles of individual nuclear factor-DNA complexes in the final stages of transcriptional activation of the human alpha-like globin promoters by the HS-40 element. Images Fig. 2 Fig. 3 Fig. 5 Fig. 6 PMID:7604012

  12. The OsCYP19-4 Gene Is Expressed as Multiple Alternatively Spliced Transcripts Encoding Isoforms with Distinct Cellular Localizations and PPIase Activities under Cold Stress

    PubMed Central

    Lee, Areum; Lee, Sang Sook; Jung, Won Yong; Park, Hyun Ji; Lim, Bo Ra; Kim, Hyun-Soon; Ahn, Jun Cheul; Cho, Hye Sun


    Alternative splicing (AS) is an important molecular mechanism by which single genes can generate multiple mRNA isoforms. We reported previously that, in Oryza sativa, the cyclophilin 19-4 (OsCYP19-4.1) transcript was significantly upregulated in response to cold stress, and that transgenic plants were cold tolerant. Here we show that, under cold stress, OsCYP19-4 produces eight transcript variants by intron retention and exon skipping, resulting in production of four distinct protein isoforms. The OsCYP19-4 AS isoforms exhibited different cellular localizations in the epidermal cells: in contrast to OsCYP19-4.1, the OsCYP19-4.2 and OsCYP19-4.3 proteins were primarily targeted to guard and subsidiary cells, whereas OsCYP19-4.5, which consists largely of an endoplasmic reticulum (ER) targeting signal, was co-localized with the RFP-BiP marker in the ER. In OsCYP19-4.2, the key residues of the PPIase domain are altered; consistent with this, recombinant OsCYP19-4.2 had significantly lower PPIase activity than OsCYP19-4.1 in vitro. Specific protein-protein interactions between OsCYP19-4.2/3 and AtRCN1 were verified in yeast two-hybrid (Y2H) and bimolecular fluoresence complementation (BiFC assays), although the OsCYP19-4 isoforms could not bind each other. Based on these results, we propose that two OsCYP19-4 AS isoforms, OsCYP19-4.2 and OsCYP19-4.3, play roles linking auxin transport and cold stress via interactions with RCN1. PMID:27447607

  13. The OsCYP19-4 Gene Is Expressed as Multiple Alternatively Spliced Transcripts Encoding Isoforms with Distinct Cellular Localizations and PPIase Activities under Cold Stress.


    Lee, Areum; Lee, Sang Sook; Jung, Won Yong; Park, Hyun Ji; Lim, Bo Ra; Kim, Hyun-Soon; Ahn, Jun Cheul; Cho, Hye Sun


    Alternative splicing (AS) is an important molecular mechanism by which single genes can generate multiple mRNA isoforms. We reported previously that, in Oryza sativa, the cyclophilin 19-4 (OsCYP19-4.1) transcript was significantly upregulated in response to cold stress, and that transgenic plants were cold tolerant. Here we show that, under cold stress, OsCYP19-4 produces eight transcript variants by intron retention and exon skipping, resulting in production of four distinct protein isoforms. The OsCYP19-4 AS isoforms exhibited different cellular localizations in the epidermal cells: in contrast to OsCYP19-4.1, the OsCYP19-4.2 and OsCYP19-4.3 proteins were primarily targeted to guard and subsidiary cells, whereas OsCYP19-4.5, which consists largely of an endoplasmic reticulum (ER) targeting signal, was co-localized with the RFP-BiP marker in the ER. In OsCYP19-4.2, the key residues of the PPIase domain are altered; consistent with this, recombinant OsCYP19-4.2 had significantly lower PPIase activity than OsCYP19-4.1 in vitro. Specific protein-protein interactions between OsCYP19-4.2/3 and AtRCN1 were verified in yeast two-hybrid (Y2H) and bimolecular fluoresence complementation (BiFC assays), although the OsCYP19-4 isoforms could not bind each other. Based on these results, we propose that two OsCYP19-4 AS isoforms, OsCYP19-4.2 and OsCYP19-4.3, play roles linking auxin transport and cold stress via interactions with RCN1. PMID:27447607

  14. Differential sensitivities of transcription factor target genes underlie cell type-specific gene expression profiles

    PubMed Central

    Johnson, Kirby D.; Kim, Shin-Il; Bresnick, Emery H.


    Changes in transcription factor levels and activities dictate developmental fate. Such a change might affect the full ensemble of target genes for a factor or only uniquely sensitive targets. We investigated the relationship among activity of the hematopoietic transcription factor GATA-1, chromatin occupancy, and target gene sensitivity. Graded activation of GATA-1 in GATA-1-null cells revealed high-, intermediate-, and low-sensitivity targets. GATA-1 activity requirements for occupancy and transcription often correlated. A GATA-1 amino-terminal deletion mutant severely deregulated the low-sensitivity gene Tac-2. Thus, cells expressing different levels of a cell type-specific activator can have qualitatively distinct target gene expression patterns, and factor mutations preferentially deregulate low-sensitivity genes. Unlike other target genes, GATA-1-mediated Tac-2 regulation was bimodal, with activation followed by repression, and the coregulator Friend of GATA-1 (FOG-1) selectively mediated repression. A GATA-1 mutant defective in FOG-1 binding occupied a Tac-2 regulatory region at levels higher than wild-type GATA-1, whereas FOG-1 facilitated chromatin occupancy at a distinct target site. These results indicate that FOG-1 is a determinant of GATA factor target gene sensitivity by either facilitating or opposing chromatin occupancy. PMID:17043224

  15. The Heterochromatic Rolled Gene of Drosophila Melanogaster Is Extensively Polytenized and Transcriptionally Active in the Salivary Gland Chromocenter

    PubMed Central

    Berghella, L.; Dimitri, P.


    This paper reports a cytogenetic and molecular study of the structural and functional organization of the Drosophila melanogaster chromocenter. The relations between mitotic (constitutive) heterochromatin and α- and β-heterochromatin are not fully understood. In the present work, we have studied the polytenization of the rolled (rl) locus, a 100-kb genomic region that maps to the proximal heterochromatin of chromosome 2 and has been previously thought to contribute to α-heterochromatin. We show that rolled undergoes polytenization in salivary gland chromosomes to a degree comparable to that of euchromatic genes, despite its deep heterochromatic location. In contrast, both the Bari-1 sequences and the AAGAC satellite repeats, located respectively to the left and right of rl, are severely underrepresented and thus both appear to be α-heterochromatic. In addition, we found that rl is transcribed in polytene tissues. Together, the results reported here indicate that functional sequences located within the proximal constitutive heterochromatin can undergo polytenization, contributing to the formation of β-heterochromatin. The implications of this finding to chromocenter structure are discussed. PMID:8878678

  16. Osteogenic transcription factors and proto-oncogene regulate bone sialoprotein gene transcription.


    Takai, Hideki; Mezawa, Masaru; Choe, Jin; Nakayama, Yohei; Ogata, Yorimasa


    Runt homeodomain protein 2 (Runx2), distalless 5 (Dlx5) and Smad1 are transcription factors that play critical roles in controlling the differentiation of osteoblasts and mineralization of bone. Proto-oncogene tyrosine-protein kinase, Src, is an enzyme encoded by the Src gene. The normal cellular gene is called cellular-Src (c-Src). Bone sialoprotein (BSP), a protein implicated in the initial mineralization of newly formed bone, is an early phenotypic marker of differentiated osteoblasts. In this study, we used overexpression plasmids with Runx2, Dlx5, Smad1 or c-Src inserts to search for the effects of these transcription factors and proto-oncogene on BSP gene expression using rat osteoblast-like ROS 17/2.8. When we used Runx2, Dlx5 or c-Src overexpression plasmids for the transfection, BSP and Runx2 mRNA levels were increased in ROS 17/2.8 cells. However, overexpression of Smad1 did not induce BSP and Runx2 mRNA. Transient transfection analyses were performed using chimeric constructs of the rat BSP gene promoter linked to a luciferase reporter gene. Transfection of ROS 17/2.8 cells with Runx2, Dlx5 or c-Src overexpression plasmid increased the luciferase activities of the constructs, pLUC3 (-116 to +60), pLUC4 (-425 to +60) and pLUC5 (-801 to +60). However, Smad1 overexpression had no effect on the luciferase activities. These results demonstrate that overexpression of Runx2, Dlx5 or c-Src stimulates BSP transcription, and suggest that Runx2, Dlx5 and c-Src might be crucial transcriptional regulators of mineralization and bone formation.

  17. Transcriptional Regulation in Saccharomyces cerevisiae: Transcription Factor Regulation and Function, Mechanisms of Initiation, and Roles of Activators and Coactivators

    PubMed Central

    Hahn, Steven; Young, Elton T.


    Here we review recent advances in understanding the regulation of mRNA synthesis in Saccharomyces cerevisiae. Many fundamental gene regulatory mechanisms have been conserved in all eukaryotes, and budding yeast has been at the forefront in the discovery and dissection of these conserved mechanisms. Topics covered include upstream activation sequence and promoter structure, transcription factor classification, and examples of regulated transcription factor activity. We also examine advances in understanding the RNA polymerase II transcription machinery, conserved coactivator complexes, transcription activation domains, and the cooperation of these factors in gene regulatory mechanisms. PMID:22084422

  18. Post-transcriptional gene silencing, transcriptional gene silencing and human immunodeficiency virus

    PubMed Central

    Méndez, Catalina; Ahlenstiel, Chantelle L; Kelleher, Anthony D


    While human immunodeficiency virus 1 (HIV-1) infection is controlled through continuous, life-long use of a combination of drugs targeting different steps of the virus cycle, HIV-1 is never completely eradicated from the body. Despite decades of research there is still no effective vaccine to prevent HIV-1 infection. Therefore, the possibility of an RNA interference (RNAi)-based cure has become an increasingly explored approach. Endogenous gene expression is controlled at both, transcriptional and post-transcriptional levels by non-coding RNAs, which act through diverse molecular mechanisms including RNAi. RNAi has the potential to control the turning on/off of specific genes through transcriptional gene silencing (TGS), as well as fine-tuning their expression through post-transcriptional gene silencing (PTGS). In this review we will describe in detail the canonical RNAi pathways for PTGS and TGS, the relationship of TGS with other silencing mechanisms and will discuss a variety of approaches developed to suppress HIV-1 via manipulation of RNAi. We will briefly compare RNAi strategies against other approaches developed to target the virus, highlighting their potential to overcome the major obstacle to finding a cure, which is the specific targeting of the HIV-1 reservoir within latently infected cells. PMID:26279984

  19. The involvement of Opaque 2 on beta-prolamin gene regulation in maize and Coix suggests a more general role for this transcriptional activator.


    Cord Neto, G; Yunes, J A; da Silva, M J; Vettore, A L; Arruda, P; Leite, A


    The maize opaque 2 (o2) mutation is known to have numerous pleiotropic effects. Some polypeptides have their expression depressed while others are enhanced. The best characterized effects of the o2 mutation are those exerted on endosperm genes encoding the storage protein class of the 22 kDa alpha-zeins and the ribosome inactivating protein b-32. The Opaque 2 (O2) locus encodes a basic domain-leucine zipper DNA-binding factor, O2, which transcriptionally regulates these genes. In the maize-related grass Coix lacryma-jobi, an O2-homologous protein regulates the 25 kDa alpha-coixin family. We show in this paper that O2 transcriptionally regulates the structurally and developmentally different class of the beta-prolamins. A new O2-binding box was identified in beta-prolamin genes from maize and Coix that, together with the boxes previously identified in other endosperm expressed genes, forms a curious collection of O2 cis elements. This may have regulatory implications on the role of O2 in the mechanism that controls coordinated gene expression in the developing endosperm. Considering that the O2 locus controls at least three distinct classes of genes in maize endosperm, we propose that the O2 protein may play a more general role in maize endosperm development than previously conceived.

  20. Simian virus 40 T antigen can transcriptionally activate and mediate viral DNA replication in cells which lack the retinoblastoma susceptibility gene product.

    PubMed Central

    Trifillis, P; Picardi, J; Alwine, J C


    Simian virus 40 T antigen is a multifunctional protein which has recently been shown to form a complex with the retinoblastoma susceptibility gene product (Rb protein) (J.A. DeCaprio, J.W. Ludlow, J. Figge, J.-Y. Shaw, C.-M. Huang, W.-H. Lee, E. Marsilio, E. Paucha, and D.M. Livingston, Cell 54:275-283, 1988; P. Whyte, K.J. Buchkovich, J.M. Horowitz, S.H. Friend, M. Raybuck, R.A. Weinberg, and E. Harlow, Nature (London) 334:124-129, 1988). This interaction may facilitate some of the functions of T antigen. The ability of simian virus 40 T antigen to mediate transcriptional activation and viral DNA replication was tested in human osteosarcoma cell lines U-2OS and Saos-2, which are Rb positive and Rb negative, respectively. Both functions of T antigen were efficient in both cell lines. Hence, these functions can occur in the absence of Rb protein. Images PMID:2154611

  1. Identification of single nucleotide polymorphisms of the signal transducer and activator of transcription 3 gene (STAT3) associated with body measurement and carcass quality traits in beef cattle.


    Song, N; Gui, L S; Xu, H C; Wu, S; Zan, L S


    Previous studies have shown that the signal transducer and activator of transcription 3 gene (STAT3) is involved in lipid storage and energy metabolism, suggesting that STAT3 is a potential candidate gene that affects body measurement and carcass quality traits in animals. Therefore, the aim of this study was to identify polymorphisms in bovine STAT3 and to analyze their possible associations with body measurement and carcass quality traits in 493 individuals of 2 native Chinese cattle breeds: Qinchuan (N = 371) and Jiaxian cattle (N = 122). DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) were employed to detect STAT3 single nucleotide polymorphisms (SNPs). We found 5 SNPs: 1 in an exon (g.65812G>A: exon 16) and 4 in introns (g.43591G>A: 13 intron, g.67492T>G: 19 intron, g.67519T>C: 19 intron, and g.68964G>A: 20 intron). Both g.65812G>A and g.68964G>A were not in Hardy- Weinberg equilibrium (HWE), whereas individual frequencies of each genotype were consistent with HWE for other SNPs in Qinchuan cattle populations. For the Jiaxian cattle, the genotype distributions of the 4 mutations were in HWE except for g.67519T>C. The results indicate that these SNPs have a significant association with some body measurements and carcass quality traits (P < 0.05 or P < 0.01). Therefore, STAT3 might have potential effects on production traits in beef cattle populations and could be used for marker-assisted selection.

  2. Characterization of four heat-shock protein genes from Nile tilapia (Oreochromis niloticus) and demonstration of the inducible transcriptional activity of Hsp70 promoter.


    Zhang, Lili; Sun, Chengfei; Ye, Xing; Zou, Shuming; Lu, Maixin; Liu, Zhigang; Tian, Yuanyuan


    Heat-shock proteins (Hsps), known as stress proteins and extrinsic chaperones, play important roles in the folding, translocation, and refolding/degradation of proteins. In this study, we identified four Hsps in Nile tilapia (Oreochromis niloticus), which display conserved Hsp characteristics in their predicted amino acid sequences. Further analyses on the structures, homology, and phylogenetics revealed that the four Hsps belong to Hsp70 family. One of them does not contain introns and is named Hsp70, while all the other three contain introns and are named Hsc70-1, Hsc70-2, and Hsc70-3. Expressions of the four Hsp proteins were observed in all examined tissues. Six hours after infection of Streptococcus agalactiae in Nile tilapia, the expression of Hsp70 was significantly increased in the liver, head kidney, spleen and gill, while Hsc70s' expression was unchanged in all examined tissues except the head kidney that showed significantly reduced expression of both Hsc70-2 and Hsc70-3. These results suggest that Hsp70 may participate in the defense against S. agalactiae infection. We then isolated the promoter of Hsp70 gene and inserted it into the donor plasmid of Tgf2 transposon system containing green fluorescent protein (GFP) gene. The plasmid was microinjected into zebrafish embryos, where the expression of GFP was induced by heat shock, S. agalactiae immersion challenge, indicating that the isolated Hsp70 promoter has transcriptional activity and is inducible by both heat shock and bacterial challenge. This promoter may facilitate the future construction of disease-resistant transgenic fish. The work also contributes to the further study of immune response of tilapia after bacterial infection.

  3. Activity of the upstream TATA-less promoter of the p21(Waf1/Cip1) gene depends on transcription factor IIA (TFIIA) in addition to TFIIA-reactive TBP-like protein.


    Suzuki, Hidefumi; Maeda, Ryo; Nakadai, Tomoyoshi; Tamura, Taka-aki


    TATA-binding protein-like protein (TLP) binds to transcription factor IIA (TFIIA) with high affinity, although the significance of this binding is poorly understood. In this study, we investigated the role of TFIIA in transcriptional regulation of the p21(Waf1/Cip1) (p21) gene. It has been shown that TLP is indispensable for p53-activated transcription from an upstream TATA-less promoter of the p21 gene. We found that mutant TLPs having decreased TFIIA-binding ability exhibited weakened transcriptional activation function for the upstream promoter. Activity of the upstream promoter was enhanced considerably by an increased amount of TFIIA in a p53-dependent manner, whereas activity of the TATA-containing downstream promoter was enhanced only slightly. TFIIA potentiated the upstream promoter additively with TLP. Although TFIIA is recruited to both promoters, activity of the upstream promoter was much more dependent on TFIIA. Recruitment of TFIIA and TLP to the upstream promoter was augmented in etoposide-treated cells, in which the amount of TFIIA-TLP complex is increased, and TFIIA-reactive TLP was required for the recruitment of both factors. It was confirmed that etoposide-stimulated transcription depends on TLP. We also found that TFIIA-reactive TLP acts to decrease cell growth rate, which can be explained by interaction of the p21 promoter with the transcription factors that we examined. The results of the present study suggest that the upstream TATA-less promoter of p21 needs TFIIA and TFIIA-reactive TLP for p53-dependent transcriptional enhancement.

  4. Stochastic model for gene transcription on Drosophila melanogaster embryos

    NASA Astrophysics Data System (ADS)

    Prata, Guilherme N.; Hornos, José Eduardo M.; Ramos, Alexandre F.


    We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ˜1 % of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes.

  5. Transcriptional regulation of human thromboxane synthase gene expression

    SciTech Connect

    Lee, K.D.; Baek, S.J.; Fleischer, T


    The human thromboxane synthase (TS) gene encodes a microsomal enzyme catalyzing the conversion of prostaglandin endoperoxide into thromboxane A{sub 2}(TxA{sub 2}), a potent inducer of vasoconstriction and platelet aggregation. A deficiency in platelet TS activity results in bleeding disorders, but the underlying molecular mechanism remains to be elucidated. Increased TxA{sub 2} has been associated with many pathophysiological conditions such as cardiovascular disease, pulmonary hypertension, pre-eclampsia, and thrombosis in sickle cell patients. Since the formation of TxA{sub 2} is dependent upon TS, the regulation of TS gene expression may presumably play a crucial role in vivo. Abrogation of the regulatory mechanism in TS gene expression might contribute, in part, to the above clinical manifestations. To gain insight into TS gene regulation, a 1.7 kb promoter of the human TS gene was cloned and sequenced. RNase protection assay and 5{prime} RACE protocols were used to map the transcription initiation site to nucleotide A, 30 bp downstream from a canonical TATA box. Several transcription factor binding sites, including AP-1, PU.1, and PEA3, were identified within this sequence. Transient expression studies in HL-60 cells transfected with constructs containing various lengths (0.2 to 5.5 kb) of the TS promoter/luciferase fusion gene indicated the presence of multiple repressor elements within the 5.5 kb TS promoter. However, a lineage-specific up-regulation of TS gene expression was observed in HL-60 cells induced by TPA to differentiate along the macrophage lineage. The increase in TS transcription was not detectable until 36 hr after addition of the inducer. These results suggest that expression of the human TS gene may be regulated by a mechanism involving repression and derepression of the TS promoter.

  6. Activation of the MAPK11/12/13/14 (p38 MAPK) pathway regulates the transcription of autophagy genes in response to oxidative stress induced by a novel copper complex in HeLa cells.


    Zhong, Wu; Zhu, Haichuan; Sheng, Fugeng; Tian, Yonglu; Zhou, Jun; Chen, Yingyu; Li, Song; Lin, Jian


    Transition metal copper (Cu) can exist in oxidized or reduced states in cells, leading to cytotoxicity in cancer cells through oxidative stress. Recently, copper complexes are emerging as a new class of anticancer compounds. Here, we report that a novel anticancer copper complex (HYF127c/Cu) induces oxidative stress-dependent cell death in cancer cells. Further, transcriptional analysis revealed that oxidative stress elicits broad transcriptional changes of genes, in which autophagy-related genes are significantly changed in HYF127c/Cu-treated cells. Consistently, autophagy was induced in HYF127c/Cu-treated cells and inhibitors of autophagy promoted cell death induced by HYF127c/Cu. Further analysis identified that the MAPK11/12/13/14 (formerly known as p38 MAPK) pathway was also activated in HYF127c/Cu-treated cells. Meanwhile, the MAPK11/12/13/14 inhibitor SB203580 downregulated autophagy by inhibiting the transcription of the autophagy genes MAP1LC3B, BAG3, and HSPA1A, and promoted HYF127c/Cu-induced cell death. These data suggest that copper-induced oxidative stress will induce protective autophagy through transcriptional regulation of autophagy genes by activation of the MAPK11/12/13/14 pathway in HeLa cells.

  7. The elicitor-responsive gene for a GRAS family protein, CIGR2, suppresses cell death in rice inoculated with rice blast fungus via activation of a heat shock transcription factor, OsHsf23.


    Tanabe, Shigeru; Onodera, Haruko; Hara, Naho; Ishii-Minami, Naoko; Day, Brad; Fujisawa, Yukiko; Hagio, Takashi; Toki, Seiichi; Shibuya, Naoto; Nishizawa, Yoko; Minami, Eiichi


    We show that a rice GRAS family protein, CIGR2, is a bonafide transcriptional activator, and through this function, targets the B-type heat shock protein-encoding gene OsHsf23 (Os09g0456800). CIGR2 (Os07g0583600) is an N-acetylchitooligosaccharide elicitor-responsive gene whose activity, through the direct transcriptional control of OsHsf23, is required for mediating hypersensitive cell death activation during pathogen infection. RNAi lines of CIGR2 and OsHsf23 similarly exhibited the higher level of granulation in the epidermal cells of leaf sheath inoculated with an avirulent isolate of rice blast fungus. Interestingly, we did not observe altered levels of resistance, suggesting that CIGR2 suppresses excessive cell death in the incompatible interaction with blast fungus via activation of OsHsf23. PMID:26287768

  8. Transcriptional regulation of the human papillomavirus-16 E6-E7 promoter by a keratinocyte-dependent enhancer, and by viral E2 trans-activator and repressor gene products: implications for cervical carcinogenesis.


    Cripe, T P; Haugen, T H; Turk, J P; Tabatabai, F; Schmid, P G; Dürst, M; Gissmann, L; Roman, A; Turek, L P


    The transcriptional promoter of the candidate E6-E7 transforming gene region of human papillomavirus (HPV)-16 (P97) was active in transiently transfected cervical carcinoma cells when linked to the HSV-1 tk or bacterial cat genes. Sequences 5' to P97 contain a short enhancer element responding to cellular factor(s) in uninfected human foreskin keratinocytes and in cervical carcinoma cells, but not in human or animal fibroblasts. The E2 trans-activator products of HPV-16 or of the related bovine papillomavirus (BPV)-1 further elevated HPV-16-driven transcripts in co-transfections, and required the presence of E2-binding ACC(N)6GGT cores in cis. A 'short E2' C-terminal repressor gene product (sE2) of HPV-16 or the BPV-1 sE2 repressor not only inhibited viral E2 trans-activation, but also suppressed enhancer response to keratinocytic factors. Suppression by the sE2 products was abolished by deletion of the E2-binding cores in cis or by a mutation in the sE2 DNA binding domain. The keratinocyte-dependent enhancer is likely to contribute to the epithelial cell tropism of HPV-16, and may direct persistent E6-E7 gene transcription in response to cellular factors in cervical carcinoma cells in which the viral E2 genes are inactive. PMID:2448139

  9. The effect of aluminium-stress and exogenous spermidine on chlorophyll degradation, glutathione reductase activity and the photosystem II D1 protein gene (psbA) transcript level in lichen Xanthoria parietina.


    Sen, Gulseren; Eryilmaz, Isil Ezgi; Ozakca, Dilek


    In this study, the effects of short-term aluminium toxicity and the application of spermidine on the lichen Xanthoria parietina were investigated at the physiological and transcriptional levels. Our results suggest that aluminium stress leads to physiological processes in a dose-dependent manner through differences in lipid peroxidation rate, chlorophyll content and glutathione reductase (EC activity in aluminium and spermidine treated samples. The expression of the photosystem II D1 protein (psbA) gene was quantified using semi-quantitative RT-PCR. Increased glutathione reductase activity and psbA mRNA transcript levels were observed in the X. parietina thalli that were treated with spermidine before aluminium-stress. The results showed that the application of spermidine could mitigate aluminium-induced lipid peroxidation and chlorophyll degradation on lichen X. parietina thalli through an increase in psbA transcript levels and activity of glutathione reductase (GR) enzymes.

  10. Nongenic transcription, gene regulation and action at a distance.


    Cook, Peter R


    In eukaryotes, motifs such as silencers, enhancers and locus control regions act over thousands of base pairs to regulate adjacent genes; insulators limit such effects, and barriers confine repressive heterochromatin to particular chromosomal segments. Recent results show that many of these motifs are nongenic transcription units, and two of them directly contact their targets lying further down the chromosome to loop the intervening DNA: the barriers (scs and scs') flanking the 87A7 heat-shock locus in the fly contact each other, and a locus control region touches the beta-globin gene in the mouse. I hypothesize that the act of transcription underlies the function of these regulators; active polymerizing complexes tend to cluster into 'factories' and this facilitates molecular contact between the transcribed regulator and its distant (and transcribed) target. PMID:14576342

  11. The obesity-associated Fto gene is a transcriptional coactivator.


    Wu, Qiong; Saunders, Rudel A; Szkudlarek-Mikho, Maria; Serna, Ivana de la; Chin, Khew-Voon


    The fat mass and obesity associated, FTO, gene has been shown to be associated with obesity in human in several genome-wide association scans. In vitro studies suggest that Fto may function as a single-stranded DNA demethylase. In addition, homologous recombination-targeted knockout of Fto in mice resulted in growth retardation, loss of white adipose tissue, and increase energy metabolism and systemic sympathetic activation. Despite these intense investigations, the exact function of Fto remains unclear. We show here that Fto is a transcriptional coactivator that enhances the transactivation potential of the CCAAT/enhancer binding proteins (C/EBPs) from unmethylated as well as methylation-inhibited gene promoters. Fto also exhibits nuclease activity. We showed further that Fto enhances the binding C/EBP to unmethylated and methylated DNA. The coactivator role of FTO in modulating the transcriptional regulation of adipogenesis by C/EBPs is consistent with the temporal progressive loss of adipose tissue in the Fto-deficient mice, thus suggesting a role for Fto in the epigenetic regulation of the development and maintenance of fat tissue. How FTO reactivates transcription from methyl-repressed gene needs to be further investigated.

  12. A Mitogen-activated Protein Kinase/Extracellular Signal-regulated Kinase Kinase (MEK)-dependent Transcriptional Program Controls Activation of the Early Growth Response 1 (EGR1) Gene during Amino Acid Limitation*

    PubMed Central

    Shan, Jixiu; Balasubramanian, Mukundh N.; Donelan, William; Fu, Lingchen; Hayner, Jaclyn; Lopez, Maria-Cecilia; Baker, Henry V.; Kilberg, Michael S.


    Amino acid (AA) limitation in mammalian cells triggers a collection of signaling cascades jointly referred to as the AA response (AAR). In human HepG2 hepatocellular carcinoma, the early growth response 1 (EGR1) gene was induced by either AA deprivation or endoplasmic reticulum stress. AAR-dependent EGR1 activation was discovered to be independent of the well characterized GCN2-ATF4 pathway and instead dependent on MEK-ERK signaling, one of the MAPK pathways. ChIP showed that constitutively bound ELK1 at the EGR1 proximal promoter region was phosphorylated after AAR activation. Increased p-ELK1 binding was associated with increased de novo recruitment of RNA polymerase II to the EGR1 promoter. EGR1 transcription was not induced in HEK293T cells lacking endogenous MEK activity, but overexpression of exogenous constitutively active MEK in HEK293T cells resulted in increased basal and AAR-induced EGR1 expression. ChIP analysis of the human vascular endothelial growth factor A (VEGF-A) gene, a known EGR1-responsive gene, revealed moderate increases in AAR-induced EGR1 binding within the proximal promoter and highly inducible binding to a site within the first intron. Collectively, these data document a novel AA-activated MEK-ERK-ELK1 signaling mechanism. PMID:25028509

  13. Molecular genetic responses to lysergic acid diethylamide include transcriptional activation of MAP kinase phosphatase-1, C/EBP-beta and ILAD-1, a novel gene with homology to arrestins.


    Nichols, Charles D; Sanders-Bush, Elaine


    We recently demonstrated that the potent hallucinogenic drug lysergic acid diethylamide (LSD) dynamically influences the expression of a small collection of genes within the mammalian prefrontal cortex. Towards generating a greater understanding of the molecular genetic effects of hallucinogens and how they may relate to alterations in behavior, we have identified and characterized expression patterns of a new collection of three genes increased in expression by acute LSD administration. These genes were identified through additional screens of Affymetrix DNA microarrays and examined in experiments to assess dose-response, time course and the receptor mediating the expression changes. The first induced gene, C/EBP-beta, is a transcription factor. The second gene, MKP-1, suggests that LSD activates the MAP (mitogen activated protein) kinase pathway. The third gene, ILAD-1, demonstrates sequence similarity to the arrestins. The increase in expression of each gene was partially mediated through LSD interactions at 5-HT2A (serotonin) receptors. There is evidence of alternative splicing at the ILAD-1 locus. Furthermore, data suggests that various splice isoforms of ILAD-1 respond differently at the transcriptional level to LSD. The genes thus far found to be responsive to LSD are beginning to give a more complete picture of the complex intracellular events initiated by hallucinogens.

  14. Cloning, molecular characterization, and expression analysis of the signal transducer and activator of transcription 3 (STAT₃) gene from grass carp (Ctenopharyngodon idellus).


    Guo, Ting; Leng, Xiang-Jun; Wu, Xiao-Feng; Li, Jia-Le; Gao, Jian-Zhong; Li, Xiao-Qin; Gan, Tian; Wei, Jing


    Signal transducer and activator of transcription 3 (STAT₃) binds to Janus kinase 2 (JAK₂) to initiate the JAK₂/STAT₃ signal transduction pathway, which plays an important role in cancer cell proliferation, immune regulation, reproduction, lipid metabolism, and other physiological processes of the organism. In this study, the cDNA sequence of the STAT₃ gene from grass carp was cloned using RACE (rapid-amplification of cDNA ends). Twelve characteristics of the STAT₃ gene and its encoded protein sequence were predicted and analyzed using bioinformatics methods; these features included the general physical and chemical properties, the hydrophobicity, the secondary structure and the three-dimensional structure of the protein. Quantitative real-time PCR was employed to detect grass carp STAT₃ expression pattern in different tissues. The results showed that the full-length STAT₃ gene from grass carp is 2739-bp long and contains a 216-bp 5'UTR, a 300-bp 3'UTR, and a 2223-bp open reading frame (ORF) that encodes a 740-amino acid peptide. The deduced protein exhibited 99%∼94% homology to the STAT₃ protein of zebrafish (Danio rerio), medaka (Oryzias latipes), turbot (Scophthalmus maximus), white-spotted char (Salvelinus leucomaenis), mandarin fish (Siniperca chuatsi), rainbow trout (Oncorhynchus mykiss), and green pufferfish (Tetraodon fluviatilis). The deduced grass carp STAT₃ protein contains a protein interaction domain, an alpha domain, a DNA binding domain, and an SH2 domain. The STAT₃ protein of grass carp is a hydrophilic and non-secretory protein, and its molecular mass and isoeletronic point were found to be 98,5412.1 Da and 6.39, respectively. The structural elements of STAT₃ included α-helixes, β-sheets, and loops. The grass carp STAT₃ is expressed in all of the six tissues tested, which were the liver, spleen, gill, muscle, heart, and brain. The highest expression level was found in the liver (P < 0.05), whereas a significantly

  15. Thyroid-specific transcription factors control Hex promoter activity

    PubMed Central

    Puppin, Cinzia; D'Elia, Angela V.; Pellizzari, Lucia; Russo, Diego; Arturi, Franco; Presta, Ivan; Filetti, Sebastiano; Bogue, Clifford W.; Denson, Lee A.; Damante, Giuseppe


    The homeobox-containing gene Hex is expressed in several cell types, including thyroid follicular cells, in which it regulates the transcription of tissue- specific genes. In this study the regulation of Hex promoter activity was investigated. Using co- transfection experiments, we demonstrated that the transcriptional activity of the Hex gene promoter in rat thyroid FRTL-5 cells is ∼10-fold greater than that observed in HeLa and NIH 3T3 cell lines (which do not normally express the Hex gene). To identify the molecular mechanisms underlying these differences, we evaluated the effect of the thyroid- specific transcription factor TTF-1 on the Hex promoter activity. TTF-1 produced 3–4-fold increases in the Hex promoter activity. Gel- retardation assays and mutagenesis experiments revealed the presence of functionally relevant TTF-1 binding sites in the Hex promoter region. These in vitro data may also have functional relevance in vivo, since a positive correlation between TTF-1 and Hex mRNAs was demonstrated in human thyroid tissues by means of RT–PCR analysis. The TTF-1 effect, however, is not sufficient to explain the difference in Hex promoter activity between FRTL-5 and cells that do not express the Hex gene. For this reason, we tested whether Hex protein is able to activate the Hex promoter. Indeed, co-transfection experiments indicate that Hex protein is able to increase the activity of its own promoter in HeLa cells ∼4-fold. TTF-1 and Hex effects are additive: when transfected together in HeLa cells, the Hex promoter activity is increased 6–7-fold. Thus, the contemporary presence of both TTF-1 and Hex could be sufficient to explain the higher transcriptional activity of the Hex promoter in thyroid cells with respect to cell lines that do not express the Hex gene. These findings demonstrate the existence of direct cross-regulation between thyroid-specific transcription factors. PMID:12655000

  16. ATP-binding cassette transporter A1 gene transcription is downregulated by activator protein 2alpha. Doxazosin inhibits activator protein 2alpha and increases high-density lipoprotein biogenesis independent of alpha1-adrenoceptor blockade.


    Iwamoto, Noriyuki; Abe-Dohmae, Sumiko; Ayaori, Makoto; Tanaka, Nobukiyo; Kusuhara, Masatoshi; Ohsuzu, Fumitaka; Yokoyama, Shinji


    ATP-binding cassette transporter A1 (ABCA1) is a rate-limiting factor for high-density lipoprotein (HDL) biogenesis. The ABCA1 gene expression is known to be upregulated by various transcriptional factors. However, negative regulation factors would be better targets for pharmacological modulation of HDL biogenesis. Doxazosin, an alpha(1)-adrenoceptor blocker, increased ABCA1 mRNA, its protein, and apolipoprotein A-I-mediated HDL biogenesis in THP-1 macrophages and CHO-K1 cells, independent of alpha(1)-adrenoceptor blockade. Analysis of the human ABCA1 promoter indicated that the region between the positions -368 and -147 that contains an activator protein (AP)2-binding site responsible for the effects of doxazosin. Overexpression of AP2alpha inhibited ABCA1 transcription in a dose-dependent fashion. Mutation in the AP2-binding site caused increase of the basal promoter activity and cancelling both the transactivation by doxazosin and the trans-repression by AP2alpha. Doxazosin had no effect on ABCA1 mRNA level in HepG2 cells, which lack endogenous AP2alpha, and it reversed the inhibitory effect of AP2alpha expression in this type of cells. Chromatin immunoprecipitation and gel shift assays revealed that doxazosin reduced specific binding of AP2alpha to the ABCA1 promoter, as it suppressed phosphorylation of AP2alpha. Finally, doxazosin increased ABCA1 expression and plasma HDL in mice. We thus concluded that AP2alpha negatively regulates the ABCA1 gene transcription. Doxazosin inhibits AP2alpha activity independent of alpha(1)-adrenoceptor blockade and increases the ABCA1 expression and HDL biogenesis. AP2alpha is a potent pharmacological target for the increase of HDL.

  17. Ectopic expression of MYB46 identifies transcriptional regulatory genes involved in secondary wall biosynthesis in Arabidopsis.


    Ko, Jae-Heung; Kim, Won-Chan; Han, Kyung-Hwan


    MYB46 functions as a transcriptional switch that turns on the genes necessary for secondary wall biosynthesis. Elucidating the transcriptional regulatory network immediately downstream of MYB46 is crucial to our understanding of the molecular and biochemical processes involved in the biosynthesis and deposition of secondary walls in plants. To gain insights into MYB46-mediated transcriptional regulation, we first established an inducible secondary wall thickening system in Arabidopsis by expressing MYB46 under the control of dexamethasone-inducible promoter. Then, we used an ATH1 GeneChip microarray and Illumina digital gene expression system to obtain a series of transcriptome profiles with regard to the induction of secondary wall development. These analyses allowed us to identify a group of transcription factors whose expression coincided with or preceded the induction of secondary wall biosynthetic genes. A transient transcriptional activation assay was used to confirm the hierarchical relationships among the transcription factors in the network. The in vivo assay showed that MYB46 transcriptionally activates downstream target transcription factors, three of which (AtC3H14, MYB52 and MYB63) were shown to be able to activate secondary wall biosynthesis genes. AtC3H14 activated the transcription of all of the secondary wall biosynthesis genes tested, suggesting that AtC3H14 may be another master regulator of secondary wall biosynthesis. The transcription factors identified here may include direct activators of secondary wall biosynthesis genes. The present study discovered novel hierarchical relationships among the transcription factors involved in the transcriptional regulation of secondary wall biosynthesis, and generated several testable hypotheses.

  18. Sug1 modulates yeast transcription activation by Cdc68.

    PubMed Central

    Xu, Q; Singer, R A; Johnston, G C


    The Cdc68 protein is required for the transcription of a variety of genes in the yeast Saccharomyces cerevisiae. In a search for proteins involved in the activity of the Cdc68 protein, we identified four suppressor genes in which mutations reverse the temperature sensitivity caused by the cdc68-1 allele. We report here the molecular characterization of mutations in one suppressor gene, the previously identified SUG1 gene. The Sug1 protein has been implicated in both transcriptional regulation and proteolysis. sug1 suppressor alleles reversed most aspects of the cdc68-1 mutant phenotype but did not suppress the lethality of a cdc68 null allele, indicating that sug1 suppression is by restoration of Cdc68 activity. Our evidence suggests that suppression by sug1 is unlikely to be due to increased stability of mutant Cdc68 protein, despite the observation that Sug1 affected proteolysis of mutant Cdc68. We report here that attenuated Sug1 activity strengthens mutant Cdc68 activity, whereas increased Sug1 activity further inhibits enfeebled Cdc68 activity, suggesting that Sug1 antagonizes the activator function of Cdc68 for transcription. Consistent with this hypothesis, we find that Sug1 represses transcription in vivo. PMID:7565755

  19. Transcript profile analyses of maize silks reveal effective activation of genes involved in microtubule-based movement, ubiquitin-dependent protein degradation, and transport in the pollination process.


    Xu, Xiao Hui; Wang, Fang; Chen, Hao; Sun, Wei; Zhang, Xian Sheng


    Pollination is the first crucial step of sexual reproduction in flowering plants, and it requires communication and coordination between the pollen and the stigma. Maize (Zea mays) is a model monocot with extraordinarily long silks, and a fully sequenced genome, but little is known about the mechanism of its pollen-stigma interactions. In this study, the dynamic gene expression of silks at four different stages before and after pollination was analyzed. The expression profiles of immature silks (IMS), mature silks (MS), and silks at 20 minutes and 3 hours after pollination (20MAP and 3HAP, respectively) were compared. In total, we identified 6,337 differentially expressed genes in silks (SDEG) at the four stages. Among them, the expression of 172 genes were induced upon pollination, most of which participated in RNA binding, processing and transcription, signal transduction, and lipid metabolism processes. Genes in the SDEG dataset could be divided into 12 time-course clusters according to their expression patterns. Gene Ontology (GO) enrichment analysis revealed that many genes involved in microtubule-based movement, ubiquitin-mediated protein degradation, and transport were predominantly expressed at specific stages, indicating that they might play important roles in the pollination process of maize. These results add to current knowledge about the pollination process of grasses and provide a foundation for future studies on key genes involved in the pollen-silk interaction in maize.

  20. PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.


    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng; Jiang, Jiandong


    The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  1. PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

    PubMed Central

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng


    The 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1T by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  2. Post-transcriptional regulation of the chicken thymidine kinase gene.


    Groudine, M; Casimir, C


    In attempting to understand the molecular basis of the control of chicken thymidine kinase (cTK) gene expression, we have examined the steady state cTK RNA content, and the patterns of DNA methylation, chromatin structure and endogenous nuclear runoff transcription of this gene in dividing and non-dividing cells. Our results reveal that the steady state level of cTK poly A+ RNA is correlated with the divisional activity of normal avian cells and tissues. However, no differences in the pattern of Hpa II site methylation or chromatin structure are found among cells containing high or undetectable levels of steady state cTK RNA. In addition, no differences in cTK transcription as assayed by nuclear runoff experiments are detectable in isolated nuclei derived from dividing or non-dividing cells containing high or low levels of steady state cTK RNA. These results suggest that the principal control of chicken thymidine kinase gene expression is post-transcriptional in nature.

  3. Fungal mediator tail subunits contain classical transcriptional activation domains.


    Liu, Zhongle; Myers, Lawrence C


    Classical activation domains within DNA-bound eukaryotic transcription factors make weak interactions with coactivator complexes, such as Mediator, to stimulate transcription. How these interactions stimulate transcription, however, is unknown. The activation of reporter genes by artificial fusion of Mediator subunits to DNA binding domains that bind to their promoters has been cited as evidence that the primary role of activators is simply to recruit Mediator. We have identified potent classical transcriptional activation domains in the C termini of several tail module subunits of Saccharomyces cerevisiae, Candida albicans, and Candida dubliniensis Mediator, while their N-terminal domains are necessary and sufficient for their incorporation into Mediator but do not possess the ability to activate transcription when fused to a DNA binding domain. This suggests that Mediator fusion proteins actually are functioning in a manner similar to that of a classical DNA-bound activator rather than just recruiting Mediator. Our finding that deletion of the activation domains of S. cerevisiae Med2 and Med3, as well as C. dubliniensis Tlo1 (a Med2 ortholog), impairs the induction of certain genes shows these domains function at native promoters. Activation domains within coactivators are likely an important feature of these complexes and one that may have been uniquely leveraged by a common fungal pathogen.

  4. Transcriptional regulation of cathelicidin genes in chicken bone marrow cells.


    Lee, Sang In; Jang, Hyun June; Jeon, Mi-hyang; Lee, Mi Ock; Kim, Jeom Sun; Jeon, Ik-Soo; Byun, Sung June


    Cathelicidins form a family of vertebrate-specific immune molecules with an evolutionarily conserved gene structure. We analyzed the expression patterns of cathelicidin genes (CAMP, CATH3, and CATHB1) in chicken bone marrow cells (BMCs) and chicken embryonic fibroblasts (CEFs). We found that CAMP and CATHB1 were significantly up-regulated in BMCs, whereas the expression of CATH3 did not differ significantly between BMCs and CEFs. To study the mechanism underlying the up-regulation of cathelicidin genes in BMCs, we predicted the transcription factors (TFs) that bind to the 5'-flanking regions of cathelicidin genes. CEBPA, EBF1, HES1, MSX1, and ZIC3 were up-regulated in BMCs compared to CEFs. Subsequently, when a siRNA-mediated knockdown assay was performed for MSX1, the expression of CAMP and CATHB1 was decreased in BMCs. We also showed that the transcriptional activity of the CAMP promoter was decreased by mutation of the MSX1-binding sites present within the 5'-flanking region of CAMP. These results increase our understanding of the regulatory mechanisms controlling cathelicidin genes in BMCs.

  5. Digital gene expression analysis of male and female bud transition in Metasequoia reveals high activity of MADS-box transcription factors and hormone-mediated sugar pathways

    PubMed Central

    Zhao, Ying; Liang, Haiying; Li, Lan; Tang, Sha; Han, Xiao; Wang, Congpeng; Xia, Xinli; Yin, Weilun


    Metasequoia glyptostroboides is a famous redwood tree of ecological and economic importance, and requires more than 20 years of juvenile-to-adult transition before producing female and male cones. Previously, we induced reproductive buds using a hormone solution in juvenile Metasequoia trees as young as 5-to-7 years old. In the current study, hormone-treated shoots found in female and male buds were used to identify candidate genes involved in reproductive bud transition in Metasequoia. Samples from hormone-treated cone reproductive shoots and naturally occurring non-cone setting shoots were analyzed using 24 digital gene expression (DGE) tag profiles using Illumina, generating a total of 69,520 putative transcripts. Next, 32 differentially and specifically expressed transcripts were determined using quantitative real-time polymerase chain reaction, including the upregulation of MADS-box transcription factors involved in male bud transition and flowering time control proteins involved in female bud transition. These differentially expressed transcripts were associated with 243 KEGG pathways. Among the significantly changed pathways, sugar pathways were mediated by hormone signals during the vegetative-to-reproductive phase transition, including glycolysis/gluconeogenesis and sucrose and starch metabolism pathways. Key enzymes were identified in these pathways, including alcohol dehydrogenase (NAD) and glutathione dehydrogenase for the glycolysis/gluconeogenesis pathway, and glucanphosphorylase for sucrose and starch metabolism pathways. Our results increase our understanding of the reproductive bud transition in gymnosperms. In addition, these studies on hormone-mediated sugar pathways increase our understanding of the relationship between sugar and hormone signaling during female and male bud initiation in Metasequoia. PMID:26157452

  6. Estrogen Signaling Multiple Pathways to Impact Gene Transcription

    PubMed Central

    Marino, Maria; Galluzzo, Paola; Ascenzi, Paolo


    Steroid hormones exert profound effects on cell growth, development, differentiation, and homeostasis. Their effects are mediated through specific intracellular steroid receptors that act via multiple mechanisms. Among others, the action mechanism starting upon 17β-estradiol (E2) binds to its receptors (ER) is considered a paradigmatic example of how steroid hormones function. Ligand-activated ER dimerizes and translocates in the nucleus where it recognizes specific hormone response elements located in or near promoter DNA regions of target genes. Behind the classical genomic mechanism shared with other steroid hormones, E2 also modulates gene expression by a second indirect mechanism that involves the interaction of ER with other transcription factors which, in turn, bind their cognate DNA elements. In this case, ER modulates the activities of transcription factors such as the activator protein (AP)-1, nuclear factor-κB (NF-κB) and stimulating protein-1 (Sp-1), by stabilizing DNA-protein complexes and/or recruiting co-activators. In addition, E2 binding to ER may also exert rapid actions that start with the activation of a variety of signal transduction pathways (e.g. ERK/MAPK, p38/MAPK, PI3K/AKT, PLC/PKC). The debate about the contribution of different ER-mediated signaling pathways to coordinate the expression of specific sets of genes is still open. This review will focus on the recent knowledge about the mechanism by which ERs regulate the expression of target genes and the emerging field of integration of membrane and nuclear receptor signaling, giving examples of the ways by which the genomic and non-genomic actions of ERs on target genes converge. PMID:18369406

  7. Heterogeneity of Calcium Channel/cAMP-Dependent Transcriptional Activation.


    Kobrinsky, Evgeny


    The major function of the voltage-gated calcium channels is to provide the Ca(2+) flux into the cell. L-type voltage-gated calcium channels (Cav1) serve as voltage sensors that couple membrane depolarization to many intracellular processes. Electrical activity in excitable cells affects gene expression through signaling pathways involved in the excitation-transcription (E-T) coupling. E-T coupling starts with activation of the Cav1 channel and results in initiation of the cAMP-response element binding protein (CREB)-dependent transcription. In this review we discuss the new quantitative approaches to measuring E-T signaling events. We describe the use of wavelet transform to detect heterogeneity of transcriptional activation in nuclei. Furthermore, we discuss the properties of discovered microdomains of nuclear signaling associated with the E-T coupling and the basis of the frequency-dependent transcriptional regulation.

  8. Distinct regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID.


    Bhaumik, Sukesh R


    A growing number of human diseases are linked to abnormal gene expression which is largely controlled at the level of transcriptional initiation. The gene-specific activator promotes the initiation of transcription through its interaction with one or more components of the transcriptional initiation machinery, hence leading to stimulated transcriptional initiation or activation. However, all activator proteins do not target the same component(s) of the transcriptional initiation machinery. Rather, they can have different target specificities, and thus, can lead to distinct mechanisms of transcriptional activation. Two such distinct mechanisms of transcriptional activation in yeast are mediated by the SAGA (Spt-Ada-Gcn5-Acetyltransferase) and TFIID (Transcription factor IID) complexes, and are termed as "SAGA-dependent" and "TFIID-dependent" transcriptional activation, respectively. SAGA is the target of the activator in case of SAGA-dependent transcriptional activation, while the targeting of TFIID by the activator leads to TFIID-dependent transcriptional activation. Both the SAGA and TFIID complexes are highly conserved from yeast to human, and play crucial roles in gene activation among eukaryotes. The regulatory mechanisms of eukaryotic transcriptional activation by SAGA and TFIID are discussed here. This article is part of a Special Issue entitled The 26S Proteasome: When degradation is just not enough!

  9. Transcriptional activity of transposable elements in maize

    PubMed Central


    Background Mobile genetic elements represent a high proportion of the Eukaryote genomes. In maize, 85% of genome is composed by transposable elements of several families. First step in transposable element life cycle is the synthesis of an RNA, but few is known about the regulation of transcription for most of the maize transposable element families. Maize is the plant from which more ESTs have been sequenced (more than two million) and the third species in total only after human and mice. This allowed us to analyze the transcriptional activity of the maize transposable elements based on EST databases. Results We have investigated the transcriptional activity of 56 families of transposable elements in different maize organs based on the systematic search of more than two million expressed sequence tags. At least 1.5% maize ESTs show sequence similarity with transposable elements. According to these data, the patterns of expression of each transposable element family is variable, even within the same class of elements. In general, transcriptional activity of the gypsy-like retrotransposons is higher compared to other classes. Transcriptional activity of several transposable elements is specially high in shoot apical meristem and sperm cells. Sequence comparisons between genomic and transcribed sequences suggest that only a few copies are transcriptionally active. Conclusions The use of powerful high-throughput sequencing methodologies allowed us to elucidate the extent and character of repetitive element transcription in maize cells. The finding that some families of transposable elements have a considerable transcriptional activity in some tissues suggests that, either transposition is more frequent than previously expected, or cells can control transposition at a post-transcriptional level. PMID:20973992

  10. Human MAF1 targets and represses active RNA polymerase III genes by preventing recruitment rather than inducing long-term transcriptional arrest

    PubMed Central

    Orioli, Andrea; Praz, Viviane; Lhôte, Philippe; Hernandez, Nouria


    RNA polymerase III (Pol III) is tightly controlled in response to environmental cues, yet a genomic-scale picture of Pol III regulation and the role played by its repressor MAF1 is lacking. Here, we describe genome-wide studies in human fibroblasts that reveal a dynamic and gene-specific adaptation of Pol III recruitment to extracellular signals in an mTORC1-dependent manner. Repression of Pol III recruitment and transcription are tightly linked to MAF1, which selectively localizes at Pol III loci, even under serum-replete conditions, and increasingly targets transcribing Pol III in response to serum starvation. Combining Pol III binding profiles with EU-labeling and high-throughput sequencing of newly synthesized small RNAs, we show that Pol III occupancy closely reflects ongoing transcription. Our results exclude the long-term, unproductive arrest of Pol III on the DNA as a major regulatory mechanism and identify previously uncharacterized, differential coordination in Pol III binding and transcription under different growth conditions. PMID:26941251

  11. Requirement of gene VII in cis for the expression of downstream genes on the major transcript of figwort mosaic virus.


    Gowda, S; Scholthof, H B; Wu, F C; Shepherd, R J


    The six major conserved genes of figwort mosaic virus (FMV), a caulimovirus, appear in tandem array on an RNA transcript that spans the entire viral genome. Gene VI, the only cistron that appears as a separate subgenomic RNA, has been reported to transactivate the expression of downstream genes of the full-length transcript. This transcript has a long 5'-leader of about 600 nucleotides followed by a small nonconserved region (gene VII), a smaller intergenic region (57 nucleotides), and the major conserved genes in a closely spaced array. In our present experiments we have constructed expression units containing the promoter for the full-length transcript followed by the 5' leader region, gene VII, and a reporter gene. These have been tested for expression with and without gene VI as a separate plasmid by electroporation into plant protoplasts. A series of these expression units containing truncated versions of the 5' leader region placed upstream of a reporter gene (CAT) showed that gene VI transactivation occurred only when gene VII sequences were present in cis between the leader region and the reporter gene. In addition, a more complete version of the FMV genome containing the reporter gene further downstream (in viral gene IV) showed CAT expression only when gene VII sequences were present in an upstream position. A similar construct failed to express CAT activity when gene VII was absent.

  12. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.


    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F


    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.

  13. ChlR Protein of Synechococcus sp. PCC 7002 Is a Transcription Activator That Uses an Oxygen-sensitive [4Fe-4S] Cluster to Control Genes involved in Pigment Biosynthesis*

    PubMed Central

    Ludwig, Marcus; Pandelia, Maria-Eirini; Chew, Chyue Yie; Zhang, Bo; Golbeck, John H.; Krebs, Carsten; Bryant, Donald A.


    Synechococcus sp. PCC 7002 and many other cyanobacteria have two genes that encode key enzymes involved in chlorophyll a, biliverdin, and heme biosynthesis: acsFI/acsFII, ho1/ho2, and hemF/hemN. Under atmospheric O2 levels, AcsFI synthesizes 3,8-divinyl protochlorophyllide from Mg-protoporphyrin IX monomethyl ester, Ho1 oxidatively cleaves heme to form biliverdin, and HemF oxidizes coproporphyrinogen III to protoporphyrinogen IX. Under microoxic conditions, another set of genes directs the synthesis of alternative enzymes AcsFII, Ho2, and HemN. In Synechococcus sp. PCC 7002, open reading frame SynPCC7002_A1993 encodes a MarR family transcriptional regulator, which is located immediately upstream from the operon comprising acsFII, ho2, hemN, and desF (the latter encodes a putative fatty acid desaturase). Deletion and complementation analyses showed that this gene, denoted chlR, is a transcriptional activator that is essential for transcription of the acsFII-ho2-hemN-desF operon under microoxic conditions. Global transcriptome analyses showed that ChlR controls the expression of only these four genes. Co-expression of chlR with a yfp reporter gene under the control of the acsFII promoter from Synechocystis sp. PCC 6803 in Escherichia coli demonstrated that no other cyanobacterium-specific components are required for proper functioning of this regulatory circuit. A combination of analytical methods and Mössbauer and EPR spectroscopies showed that reconstituted, recombinant ChlR forms homodimers that harbor one oxygen-sensitive [4Fe-4S] cluster. We conclude that ChlR is a transcriptional activator that uses a [4Fe-4S] cluster to sense O2 levels and thereby control the expression of the acsFII-ho2-hemN-desF operon. PMID:24782315

  14. Modular composition of gene transcription networks.


    Gyorgy, Andras; Del Vecchio, Domitilla


    Predicting the dynamic behavior of a large network from that of the composing modules is a central problem in systems and synthetic biology. Yet, this predictive ability is still largely missing because modules display context-dependent behavior. One cause of context-dependence is retroactivity, a phenomenon similar to loading that influences in non-trivial ways the dynamic performance of a module upon connection to other modules. Here, we establish an analysis framework for gene transcription networks that explicitly accounts for retroactivity. Specifically, a module's key properties are encoded by three retroactivity matrices: internal, scaling, and mixing retroactivity. All of them have a physical interpretation and can be computed from macroscopic parameters (dissociation constants and promoter concentrations) and from the modules' topology. The internal retroactivity quantifies the effect of intramodular connections on an isolated module's dynamics. The scaling and mixing retroactivity establish how intermodular connections change the dynamics of connected modules. Based on these matrices and on the dynamics of modules in isolation, we can accurately predict how loading will affect the behavior of an arbitrary interconnection of modules. We illustrate implications of internal, scaling, and mixing retroactivity on the performance of recurrent network motifs, including negative autoregulation, combinatorial regulation, two-gene clocks, the toggle switch, and the single-input motif. We further provide a quantitative metric that determines how robust the dynamic behavior of a module is to interconnection with other modules. This metric can be employed both to evaluate the extent of modularity of natural networks and to establish concrete design guidelines to minimize retroactivity between modules in synthetic systems.

  15. NF-Y transcriptionally regulates the Drosophila p53 gene.


    Tue, Nguyen Trong; Yoshioka, Yasuhide; Yamaguchi, Masamitsu


    The p53 protein is important in multicellular organisms, where it regulates the cell cycle and thus functions as a tumor suppressor that contributes to preventing cancer. However, molecular regulation of p53 gene expression is not fully understood. NF-YA is a subunit of the NF-Y trimeric complex, a transcription factor that binds to CCAAT motifs in the promoter regions of a variety of genes playing key roles in cell cycle regulation. We have identified four potential Drosophila NF-Y (dNF-Y)-binding sites located in the 5'-flanking region of the Drosophila p53 (dmp53) gene. Chromatin immunoprecipitation analyses using anti-dNF-YA antibodies confirmed that dNF-YA binds specifically to the genomic region containing CCAAT boxes in the dmp53 gene promoter in vivo. Furthermore, the thorax disclosed phenotype of dNF-YA knockdown flies can be enhanced by dmp53 mutation. In addition, the level of dmp53 mRNA was found to be decreased in the dNF-YA knockdown cells and transient expression of the luciferase gene revealed that wild-type dmp53 gene promoter activity is much stronger than mutated promoter activity in S2 cells. The requirement of CCAAT boxes for dmp53 promoter activity was further confirmed by expression of EGFP in various tissues from transgenic flies carrying wild-type and CCAAT box-mutated versions of dmp53 promoter-GFP fusion genes. These results taken together indicate that dNF-Y is necessary for dmp53 gene promoter activity.

  16. Transcriptional and posttranscriptional control of hepatitis B virus gene expression

    PubMed Central

    Uprichard, Susan L.; Wieland, Stefan F.; Althage, Alana; Chisari, Francis V.


    Hepatitis B virus (HBV) infects humans and certain nonhuman primates. Viral clearance and acute disease are associated with a strong, polyclonal, multispecific cytotoxic T lymphocyte response. Infiltrating T cells, as well as other activated inflammatory cells, produce cytokines that can regulate hepatocellular gene expression. Using an HBV transgenic mouse model, our laboratory has previously demonstrated that adoptive transfer of HBV-specific cytotoxic T lymphocytes or injection of IL-2 can noncytopathically inhibit HBV gene expression by a posttranscriptional IFN-γ- and/or tumor necrosis factor α-dependent mechanism. Here, we report that HBV gene expression can also be controlled at the posttranscriptional level during persistent lymphocytic choriomeningitis virus infection. In contrast, it is controlled at the transcriptional level during acute murine cytomegalovirus infection or after repetitive polyinosinic-polycytidylic acid injection. Finally, we show that transcriptional inhibition of HBV is associated with changes in liver-specific gene expression. These results elucidate pathways that regulate the viral life cycle and suggest additional approaches for the treatment of chronic HBV infection. PMID:12552098

  17. Galactose and Lactose Genes from the Galactose-Positive Bacterium Streptococcus salivarius and the Phylogenetically Related Galactose-Negative Bacterium Streptococcus thermophilus: Organization, Sequence, Transcription, and Activity of the gal Gene Products

    PubMed Central

    Vaillancourt, Katy; Moineau, Sylvain; Frenette, Michel; Lessard, Christian; Vadeboncoeur, Christian


    Streptococcus salivarius is a lactose- and galactose-positive bacterium that is phylogenetically closely related to Streptococcus thermophilus, a bacterium that metabolizes lactose but not galactose. In this paper, we report a comparative characterization of the S. salivarius and S. thermophilus gal-lac gene clusters. The clusters have the same organization with the order galR (codes for a transcriptional regulator and is transcribed in the opposite direction), galK (galactokinase), galT (galactose-1-P uridylyltransferase), galE (UDP-glucose 4-epimerase), galM (galactose mutarotase), lacS (lactose transporter), and lacZ (β-galactosidase). An analysis of the nucleotide sequence as well as Northern blotting and primer extension experiments revealed the presence of four promoters located upstream from galR, the gal operon, galM, and the lac operon of S. salivarius. Putative promoters with virtually identical nucleotide sequences were found at the same positions in the S. thermophilus gal-lac gene cluster. An additional putative internal promoter at the 3′ end of galT was found in S. thermophilus but not in S. salivarius. The results clearly indicated that the gal-lac gene cluster was efficiently transcribed in both species. The Shine-Dalgarno sequences of galT and galE were identical in both species, whereas the ribosome binding site of S. thermophilus galK differed from that of S. salivarius by two nucleotides, suggesting that the S. thermophilus galK gene might be poorly translated. This was confirmed by measurements of enzyme activities. PMID:11790749

  18. WRKY transcription factor genes in wild rice Oryza nivara

    PubMed Central

    Xu, Hengjian; Watanabe, Kenneth A.; Zhang, Liyuan; Shen, Qingxi J.


    The WRKY transcription factor family is one of the largest gene families involved in plant development and stress response. Although many WRKY genes have been studied in cultivated rice (Oryza sativa), the WRKY genes in the wild rice species Oryza nivara, the direct progenitor of O. sativa, have not been studied. O. nivara shows abundant genetic diversity and elite drought and disease resistance features. Herein, a total of 97 O. nivara WRKY (OnWRKY) genes were identified. RNA-sequencing demonstrates that OnWRKY genes were generally expressed at higher levels in the roots of 30-day-old plants. Bioinformatic analyses suggest that most of OnWRKY genes could be induced by salicylic acid, abscisic acid, and drought. Abundant potential MAPK phosphorylation sites in OnWRKYs suggest that activities of most OnWRKYs can be regulated by phosphorylation. Phylogenetic analyses of OnWRKYs support a novel hypothesis that ancient group IIc OnWRKYs were the original ancestors of only some group IIc and group III WRKYs. The analyses also offer strong support that group IIc OnWRKYs containing the HVE sequence in their zinc finger motifs were derived from group Ia WRKYs. This study provides a solid foundation for the study of the evolution and functions of WRKY genes in O. nivara. PMID:27345721

  19. Activation of Archaeal Transcription Mediated by Recruitment of Transcription Factor B*

    PubMed Central

    Ochs, Simon M.; Thumann, Sybille; Richau, Renate; Weirauch, Matt T.; Lowe, Todd M.; Thomm, Michael; Hausner, Winfried


    Archaeal promoters consist of a TATA box and a purine-rich adjacent upstream sequence (transcription factor B (TFB)-responsive element (BRE)), which are bound by the transcription factors TATA box-binding protein (TBP) and TFB. Currently, only a few activators of archaeal transcription have been experimentally characterized. The best studied activator, Ptr2, mediates activation by recruitment of TBP. Here, we present a detailed biochemical analysis of an archaeal transcriptional activator, PF1088, which was identified in Pyrococcus furiosus by a bioinformatic approach. Operon predictions suggested that an upstream gene, pf1089, is polycistronically transcribed with pf1088. We demonstrate that PF1088 stimulates in vitro transcription by up to 7-fold when the pf1089 promoter is used as a template. By DNase I and hydroxyl radical footprinting experiments, we show that the binding site of PF1088 is located directly upstream of the BRE of pf1089. Mutational analysis indicated that activation requires the presence of the binding site for PF1088. Furthermore, we show that activation of transcription by PF1088 is dependent upon the presence of an imperfect BRE and is abolished when the pf1089 BRE is replaced with a BRE from a strong archaeal promoter. Gel shift experiments showed that TFB recruitment to the pf1089 operon is stimulated by PF1088, and TFB seems to stabilize PF1088 operator binding even in the absence of TBP. Taken together, these results represent the first biochemical evidence for a transcriptional activator working as a TFB recruitment factor in Archaea, for which the designation TFB-RF1 is suggested. PMID:22496454

  20. Assessment of the Role of MAP Kinase in Mediating Activity-Dependent Transcriptional Activation of the Immediate Early Gene "Arc/Arg3.1" in the Dentate Gyrus in Vivo

    ERIC Educational Resources Information Center

    Chotiner, Jennifer K.; Nielson, Jessica; Farris, Shannon; Lewandowski, Gail; Huang, Fen; Banos, Karla; de Leon, Ray; Steward, Oswald


    Different physiological and behavioral events activate transcription of "Arc/Arg3.1" in neurons in vivo, but the signal transduction pathways that mediate induction in particular situations remain to be defined. Here, we explore the relationships between induction of "Arc/Arg3.1" transcription in dentate granule cells in vivo and activation of…

  1. Transcriptional and post-transcriptional regulation of chloroplast gene expression in Petunia hybrida.


    van Grinsven, M Q; Gielen, J J; Zethof, J L; Nijkamp, H J; Kool, A J


    To study the control of differential gene expression during plastid biogenesis in Petunia hybrida, we have investigated the in vivo translation and transcription of the rbc L gene, coding for the large subunit of ribulose bisphosphate carboxylase (LSU), and the psa A gene, coding for P700 chlorophyll-a apoprotein (AP700). Differential expression of these plastid-encoded genes was studied in two developmentally different plastid systems, proplastid-like organelles from the green cell suspension AK2401 and mature chloroplasts from green leaves. In vivo translation of rbc L and psa A transcripts was analysed using specific antibodies. Specific transcript levels were analysed using internal fragments of the rbc L and psa A genes. A standardization procedure was used so that a direct correlation could be made between the amount of products and gene copy number. In Petunia hybrida the amount of LSU polypeptides present in both plastid types does not correspond to the amount of specific mRNA for the gene. Although the rbc L transcripts are present in both plastid types, the LSU protein is only present in green leaf plastids and not in cell culture plastids. In vitro translation of isolated rbc L transcripts give similar results, thereby suggesting that differences in the primary structure of the transcripts are responsible for the observed discrepancy. In contrast to this, the amount of AP700 polypeptides does correspond to the amount of the psa A transcripts. Therefore, our results indicate that the expression of chloroplast genes during plastid biogenesis takes place on at least two different levels: expression of the rbc L gene is regulated post-transcriptionally while expression of the psa A gene is regulated at the transcriptional level.

  2. Oxygen-evoked changes in transcriptional activity of the 5'-flanking region of the human amiloride-sensitive sodium channel (alphaENaC) gene: role of nuclear factor kappaB.

    PubMed Central

    Baines, Deborah L; Janes, Mandy; Newman, David J; Best, Oliver G


    Expression of the alpha-subunit of the amiloride-sensitive sodium channel (alphaENaC) is regulated by a number of factors in the lung, including oxygen partial pressure (PO2). As transcriptional activation is a mechanism for raising cellular mRNA levels, we investigated the effect of physiological changes in PO2 on the activity of the redox-sensitive transcription factor nuclear factor kappaB (NF-kappaB) and transcriptional activity of 5'-flanking regions of the human alphaENaC gene using luciferase reporter-gene vectors transiently transfected into human adult alveolar carcinoma A549 cells. By Western blotting we confirmed the presence of NF-kappaB p65 but not p50 in these cells. Transiently increasing PO2 from 23 to 42 mmHg for 24 h evoked a significant increase in NF-kappaB DNA-binding activity and transactivation of a NF-kappaB-driven luciferase construct (pGLNF-kappaBpro), which was blocked by the NF-kappaB activation inhibitor sulphasalazine (5 mM). Transcriptional activity of alphaENaC-luciferase constructs containing 5'-flanking sequences (including the NF-kappaB consensus) were increased by raising PO2 from 23 to 142 mmHg if they contained transcriptional initiation sites (TIS) for exons 1A and 1B (pGL3E2.2) or the 3' TIS of exon 1B alone (pGL3E0.8). Sulphasalazine had no significant effect on the activity of these constructs, suggesting that the PO2-evoked rise in activity was not a direct consequence of NF-kappaB activation. Conversely, the relative luciferase activity of a construct that lacked the 3' TIS, a 3' intron and splice site but still retained the 5' TIS and NF-kappaB consensus sequence was suppressed significantly by raising PO2. This effect was reversed by sulphasalazine, suggesting that activation of NF-kappaB mediated PO2-evoked suppression of transcription from the exon 1A TIS of alphaENaC. PMID:12023897

  3. The relationship between gene transcription and combinations of histone modifications

    NASA Astrophysics Data System (ADS)

    Cui, Xiangjun; Li, Hong; Luo, Liaofu


    Histone modification is an important subject of epigenetics which plays an intrinsic role in transcriptional regulation. It is known that multiple histone modifications act in a combinatorial fashion. In this study, we demonstrated that the pathways within constructed Bayesian networks can give an indication for the combinations among 12 histone modifications which have been studied in the TSS+1kb region in S. cerevisiae. After Bayesian networks for the genes with high transcript levels (H-network) and low transcript levels (L-network) were constructed, the combinations of modifications within the two networks were analyzed from the view of transcript level. The results showed that different combinations played dissimilar roles in the regulation of gene transcription when there exist differences for gene expression at transcription level.

  4. Transcriptional mapping of the DNA polymerase gene of vaccinia virus

    SciTech Connect

    Traktman, P.; Sridhar, P.; Condit, R.C.; Roberts, B.E.


    Vaccinia virus DNA polymerase, a single-subunit enzyme of 110,000 molecular weight, is induced early after infection. Genetic analysis suggests that the gene encoding the enzyme maps within a 15-kilobase HindIII fragment located 45 kilobases from the left-hand end of the genome. The authors identified the in vitro translation product with these propeties and mapped the transcript by hybrid selection, RNA filter hybridization, and S1 nuclease mapping. Two mRNAs from this region, 3.4 and 3.9 kilobases in size, could be translated in vitro to yield a 110K polypeptide. The two RNAs shared a common 5' terminus and had staggered 3' ends. Sequences mapping entirely within the gene were shown to be biologically active in rescuing mutants with temperature-sensitive or drug-resistant polymerase activity to the wild-type phenotype.

  5. The molecular clock regulates circadian transcription of tissue factor gene.


    Oishi, Katsutaka; Koyanagi, Satoru; Ohkura, Naoki


    Tissue factor (TF) is involved in endotoxin-induced inflammation and mortality. We found that the circadian expression of TF mRNA, which peaked at the day to night transition (activity onset), was damped in the liver of Clock mutant mice. Luciferase reporter and chromatin immunoprecipitation analyses using embryonic fibroblasts derived from wild-type or Clock mutant mice showed that CLOCK is involved in transcription of the TF gene. Furthermore, the results of real-time luciferase reporter experiments revealed that the circadian expression of TF mRNA is regulated by clock molecules through a cell-autonomous mechanism via an E-box element located in the promoter region.

  6. NM23-H2 may play an indirect role in transcriptional activation of c-myc gene expression but does not cleave the nuclease hypersensitive element III[subscript 1

    SciTech Connect

    Dexheimer, Thomas S.; Carey, Steven S.; Zuohe, Song; Gokhale, Vijay M.; Hu, Xiaohui; Murata, Lauren B.; Maes, Estelle M.; Weichsel, Andrzej; Sun, Daekyu; Meuillet, Emmanuelle J.; Montfort, William R.; Hurley, Laurence H.


    The formation of G-quadruplex structures within the nuclease hypersensitive element (NHE) III{sub 1} region of the c-myc promoter and the ability of these structures to repress c-myc transcription have been well established. However, just how these extremely stable DNA secondary structures are transformed to activate c-myc transcription is still unknown. NM23-H2/nucleoside diphosphate kinase B has been recognized as an activator of c-myc transcription via interactions with the NHE III{sub 1} region of the c-myc gene promoter. Through the use of RNA interference, we confirmed the transcriptional regulatory role of NM23-H2. In addition, we find that further purification of NM23-H2 results in loss of the previously identified DNA strand cleavage activity, but retention of its DNA binding activity. NM23-H2 binds to both single-stranded guanine- and cytosine-rich strands of the c-myc NHE III{sub 1} and, to a lesser extent, to a random single-stranded DNA template. However, it does not bind to or cleave the NHE III{sub 1} in duplex form. Significantly, potassium ions and compounds that stabilize the G-quadruplex and i-motif structures have an inhibitory effect on NM23-H2 DNA-binding activity. Mutation of Arg{sup 88} to Ala{sup 88} (R88A) reduced both DNA and nucleotide binding but had minimal effect on the NM23-H2 crystal structure. On the basis of these data and molecular modeling studies, we have proposed a stepwise trapping-out of the NHE III{sub 1} region in a single-stranded form, thus allowing single-stranded transcription factors to bind and activate c-myc transcription. Furthermore, this model provides a rationale for how the stabilization of the G-quadruplex or i-motif structures formed within the c-myc gene promoter region can inhibit NM23-H2 from activating c-myc gene expression.

  7. Analysis of p53 mutants for transcriptional activity.

    PubMed Central

    Raycroft, L; Schmidt, J R; Yoas, K; Hao, M M; Lozano, G


    The wild-type p53 protein functions to suppress transformation, but numerous mutant p53 proteins are transformation competent. To examine the role of p53 as a transcription factor, we made fusion proteins containing human or mouse p53 sequences fused to the DNA binding domain of a known transcription factor, GAL4. Human and mouse wild-type p53/GAL4 specifically transactivated expression of a chloramphenicol acetyltransferase reporter in HeLa, CHO, and NIH 3T3 cells. Several mutant p53 proteins, including a mouse p53 mutant which is temperature sensitive for suppression, were also analyzed. A p53/GAL4 fusion protein with this mutation was also transcriptionally active only at the permissive temperature. Another mutant p53/GAL4 fusion protein analyzed mimics the mutation inherited in Li-Fraumeni patients. This fusion protein was as active as wild-type p53/GAL4 in our assay. Two human p53 mutants that arose from alterations of the p53 gene in colorectal carcinomas were 30- to 40-fold less effective at activating transcription than wild-type p53/GAL4 fusion proteins. Thus, functional wild-type p53/GAL4 fusion proteins activate transcription, while several transformation competent mutants do so poorly or not at all. Only one mutant p53/GAL4 fusion protein remained transcriptionally active. Images PMID:1944276

  8. A functional analysis of ACP-20, an adult-specific cuticular protein gene from the beetle Tenebrio: role of an intronic sequence in transcriptional activation during the late metamorphic period.


    Lemoine, A; Mathelin, J; Braquart-Varnier, C; Everaerts, C; Delachambre, J


    A gene encoding the adult cuticular protein ACP-20 was isolated in Tenebrio. It consists of three exons interspersed by two introns, intron 1 interrupting the signal peptide. To understand the regulatory mechanisms of ACP-20 expression, ACP-20 promoter-luciferase reporter gene constructs were transfected into cultured pharate adult wing epidermis. Transfection assays needed the presence of 20-hydroxyecdysone, confirming that ACP-20 is up-regulated by ecdysteroids. Analysis of 5' deletion constructs revealed that three regions are necessary for high levels of transcription. Interaction experiments between intronic fragments and epidermal nuclear proteins confirmed the importance of intron 1 in ACP-20 transcriptional control, which results from the combined activity of regulatory cis-acting elements of the promoter and those of intron 1.

  9. Transcript length mediates developmental timing of gene expression across Drosophila.


    Artieri, Carlo G; Fraser, Hunter B


    The time required to transcribe genes with long primary transcripts may limit their ability to be expressed in cells with short mitotic cycles, a phenomenon termed intron delay. As such short cycles are a hallmark of the earliest stages of insect development, we tested the impact of intron delay on the Drosophila developmental transcriptome. We find that long zygotically expressed genes show substantial delay in expression relative to their shorter counterparts, which is not observed for maternally deposited transcripts. Patterns of RNA-seq coverage along transcripts show that this delay is consistent with their inability to completely transcribe long transcripts, but not with transcriptional initiation-based regulatory control. We further show that highly expressed zygotic genes maintain compact transcribed regions across the Drosophila phylogeny, allowing conservation of embryonic expression patterns. We propose that the physical constraints of intron delay affect patterns of expression and the evolution of gene structure of a substantial portion of the Drosophila transcriptome.

  10. Transcriptional and post-transcriptional regulation of tyrosine hydroxylase gene by protein kinase C.

    PubMed Central

    Vyas, S; Faucon Biguet, N; Mallet, J


    The role played by protein kinase C (PKC) in TH gene regulation was investigated at transcriptional and post-transcriptional levels using PC12 cells. The cells were treated with the phorbol ester TPA, which not only activates PKC but also causes down-regulation. PKC levels were monitored by [3H]PDBU binding assay and by using an anti-PKC antibody that detected intact PKC (79 kd) as well as its catalytic and regulatory domains. The [3H]PDBU binding to the membrane-associated PKC increased within 15-30 min of TPA treatment; thereafter total cellular [3H]PDBU binding decreased to a minimum of 20% of the control at 8 h. The rate of decrease in binding was greater than the decrease in the intensity of the staining of PKC holo enzyme visualized by anti-PKC antibody. TH mRNA levels, measured over the same time period, rose within 15 min of TPA treatment to peak at 4 h and subsequently declined below control level, paralleling the depletion of PKC. If cells depleted of PKC were reincubated in the normal medium, a recovery in PKC level was seen and, in parallel, TH mRNA levels increased to above control level. Furthermore, if down-regulation of PKC was prevented by incubating the cells with the protease inhibitor leupeptin, a decrease beyond control level in TH mRNA was not observed. TPA rapidly induced TH gene transcription; a maximal increase of two-fold was observed at 15 min, but the transcriptional rate then declined although it did not decrease beyond control values after 8 and 24 h of TPA treatment.(ABSTRACT TRUNCATED AT 250 WORDS) Images Fig.2 Fig.3 Fig.6 PMID:1976513

  11. Transcriptional and Post-Transcriptional Regulation of Nucleotide Excision Repair Genes in Human Cells

    PubMed Central

    Lefkofsky, Hailey B.; Veloso, Artur; Ljungman, Mats


    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death. PMID:26255935

  12. NanoScript: A Nanoparticle-Based Artificial Transcription Factor for Effective Gene Regulation

    PubMed Central


    Transcription factor (TF) proteins are master regulators of transcriptional activity and gene expression. TF-based gene regulation is a promising approach for many biological applications; however, several limitations hinder the full potential of TFs. Herein, we developed an artificial, nanoparticle-based transcription factor, termed NanoScript, which is designed to mimic the structure and function of TFs. NanoScript was constructed by tethering functional peptides and small molecules called synthetic transcription factors, which mimic the individual TF domains, onto gold nanoparticles. We demonstrate that NanoScript localizes within the nucleus and initiates transcription of a reporter plasmid by over 15-fold. Moreover, NanoScript can effectively transcribe targeted genes on endogenous DNA in a nonviral manner. Because NanoScript is a functional replica of TF proteins and a tunable gene-regulating platform, it has great potential for various stem cell applications. PMID:25133310

  13. Transcriptional regulation of gilthead seabream bone morphogenetic protein (BMP) 2 gene by bone- and cartilage-related transcription factors.


    Marques, Cátia L; Cancela, M Leonor; Laizé, Vincent


    Bone morphogenetic protein (BMP) 2 belongs to the transforming growth factor β (TGFβ) superfamily of cytokines and growth factors. While it plays important roles in embryo morphogenesis and organogenesis, BMP2 is also critical to bone and cartilage formation. Protein structure and function have been remarkably conserved throughout evolution and BMP2 transcription has been proposed to be tightly regulated, although few data is available. In this work we report the cloning and functional analysis of gilthead seabream BMP2 promoter. As in other vertebrates, seabream BMP2 gene has a 5′ non-coding exon, a feature already present in DPP gene, the fruit fly ortholog of vertebrate BMP2 gene, and maintained throughout evolution. In silico analysis of seabream BMP2 promoter revealed several binding sites for bone and cartilage related transcription factors (TFs) and their functionality was evaluated using promoter-luciferase constructions and TF-expressing vectors. Runt-related transcription factor 3 (RUNX3) was shown to negatively regulate BMP2 transcription and combination with the core binding factor β (CBFβ) further reduced transcriptional activity of the promoter. Although to a lesser extent, myocyte enhancer factor 2C (MEF2C) had also a negative effect on the regulation of BMP2 gene transcription, when associated with SRY (sex determining region Y)-box 9 (SOX9b). Finally, v-ets avian erythroblastosis virus E26 oncogene homolog 1 (ETS1) was able to slightly enhance BMP2 transcription. Data reported here provides new insights toward the better understanding of the transcriptional regulation of BMP2 gene in a bone and cartilage context. PMID:26456102

  14. Transforming growth factor beta 1-responsive element: closely associated binding sites for USF and CCAAT-binding transcription factor-nuclear factor I in the type 1 plasminogen activator inhibitor gene.

    PubMed Central

    Riccio, A; Pedone, P V; Lund, L R; Olesen, T; Olsen, H S; Andreasen, P A


    Transforming growth factor beta (TGF-beta) is the name of a group of closely related polypeptides characterized by a multiplicity of effects, including regulation of extracellular proteolysis and turnover of the extracellular matrix. Its cellular mechanism of action is largely unknown. TGF-beta 1 is a strong and fast inducer of type 1 plasminogen activator inhibitor gene transcription. We have identified a TGF-beta 1-responsive element in the 5'-flanking region of the human type 1 plasminogen activator inhibitor gene and shown that it is functional both in its natural context and when fused to a heterologous nonresponsive promoter. Footprinting and gel retardation experiments showed that two different nuclear factors, present in extracts from both TGF-beta 1-treated and nontreated cells, bind to adjacent sequences contained in the responsive unit. A palindromic sequence binds a trans-acting factor(s) of the CCAAT-binding transcription factor-nuclear factor I family. A partially overlapping dyad symmetry interacts with a second protein that much evidence indicates to be USF. USF is a transactivator belonging to the basic helix-loop-helix family of transcription factors. Mutations which abolish the binding of either CCAAT-binding transcription factor-nuclear factor I or USF result in reduction of transcriptional activation upon exposure to TGF-beta 1, thus showing that both elements of the unit are necessary for the TGF-beta 1 response. We discuss the possible relationship of these findings to the complexity of the TGF-beta action. Images PMID:1549130

  15. Oxytocin Regulates Stress-Induced Crf Gene Transcription through CREB-Regulated Transcription Coactivator 3

    PubMed Central

    Jurek, Benjamin; Slattery, David A.; Hiraoka, Yuichi; Liu, Ying; Nishimori, Katsuhiko; Aguilera, Greti; van den Burg, Erwin H.


    The major regulator of the neuroendocrine stress response in the brain is corticotropin releasing factor (CRF), whose transcription is controlled by CREB and its cofactors CRTC2/3 (TORC2/3). Phosphorylated CRTCs are sequestered in the cytoplasm, but rapidly dephosphorylated and translocated into the nucleus following a stressful stimulus. As the stress response is attenuated by oxytocin (OT), we tested whether OT interferes with CRTC translocation and, thereby, Crf expression. OT (1 nmol, i.c.v.) delayed the stress-induced increase of nuclear CRTC3 and Crf hnRNA levels in the paraventricular nucleus of male rats and mice, but did not affect either parameter in the absence of the stressor. The increase in Crf hnRNA levels at later time points was parallel to elevated nuclear CRTC2/3 levels. A direct effect of Thr4 Gly7-OT (TGOT) on CRTC3 translocation and Crf expression was found in rat primary hypothalamic neurons, amygdaloid (Ar-5), hypothalamic (H32), and human neuroblastoma (Be(2)M17) cell lines. CRTC3, but not CRCT2, knockdown using siRNA in Be(2)M17 cells prevented the effect of TGOT on Crf hnRNA levels. Chromatin-immunoprecipitation demonstrated that TGOT reduced CRTC3, but not CRTC2, binding to the Crf promoter after 10 min of forskolin stimulation. Together, the results indicate that OT modulates CRTC3 translocation, the binding of CRTC3 to the Crf promoter and, ultimately, transcription of the Crf gene. SIGNIFICANCE STATEMENT The neuropeptide oxytocin has been proposed to reduce hypothalamic-pituitary-adrenal (HPA) axis activation during stress. The underlying mechanisms are, however, elusive. In this study we show that activation of the oxytocin receptor in the paraventricular nucleus delays transcription of the gene encoding corticotropin releasing factor (Crf), the main regulator of the stress response. It does so by sequestering the coactivator of the transcription factor CREB, CRTC3, in the cytosol, resulting in reduced binding of CRTC3 to the Crf

  16. Substrate-Induced Transcriptional Activation of the MoCel7C Cellulase Gene Is Associated with Methylation of Histone H3 at Lysine 4 in the Rice Blast Fungus Magnaporthe oryzae

    PubMed Central

    Vu, Ba Van; Pham, Kieu Thi Minh


    The mechanisms involved in substrate-dependent regulation of a Magnaporthe oryzae gene encoding a cellulase which we designate MoCel7C (MGG_14954) were investigated. The levels of MoCel7C transcript were dramatically increased more than 1,000-fold, 16 to 24 h after transfer to a medium containing 2% carboxymethylcellulose (CMC), while levels were very low or undetectable in conventional rich medium. Green fluorescent protein reporter assays showed that the MoCel7C promoter was activated by cello-oligosaccharides larger than a pentamer. CMC-induced activation of the MoCel7C promoter was suppressed by glucose and cellobiose. Chromatin immunoprecipitation assays revealed that histone H3 methylation on lysine 4 (H3K4) at the MoCel7C locus was associated with activation of the gene by CMC. Consistently, CMC-induced MoCel7C gene activation was drastically diminished in a knockout (KO) mutant of the MoSET1 gene, which encodes a histone lysine methyltransferase that catalyzes H3K4 methylation in M. oryzae. Interestingly, however, MoCel7C transcript levels under noninducing conditions were significantly increased in the MoSET1 KO mutant, suggesting that MoSET1 directly or indirectly plays a role in both activation and suppression of the MoCel7C gene in response to environmental signals. In addition, gene expression and silencing vectors using the MoCel7C promoter were constructed. PMID:23995923

  17. Moonlighting transcriptional activation function of a fungal sulfur metabolism enzyme.


    Levati, Elisabetta; Sartini, Sara; Bolchi, Angelo; Ottonello, Simone; Montanini, Barbara


    Moonlighting proteins, including metabolic enzymes acting as transcription factors (TF), are present in a variety of organisms but have not been described in higher fungi so far. In a previous genome-wide analysis of the TF repertoire of the plant-symbiotic fungus Tuber melanosporum, we identified various enzymes, including the sulfur-assimilation enzyme phosphoadenosine-phosphosulfate reductase (PAPS-red), as potential transcriptional activators. A functional analysis performed in the yeast Saccharomyces cerevisiae, now demonstrates that a specific variant of this enzyme, PAPS-red A, localizes to the nucleus and is capable of transcriptional activation. TF moonlighting, which is not present in the other enzyme variant (PAPS-red B) encoded by the T. melanosporum genome, relies on a transplantable C-terminal polypeptide containing an alternating hydrophobic/hydrophilic amino acid motif. A similar moonlighting activity was demonstrated for six additional proteins, suggesting that multitasking is a relatively frequent event. PAPS-red A is sulfur-state-responsive and highly expressed, especially in fruitbodies, and likely acts as a recruiter of transcription components involved in S-metabolism gene network activation. PAPS-red B, instead, is expressed at low levels and localizes to a highly methylated and silenced region of the genome, hinting at an evolutionary mechanism based on gene duplication, followed by epigenetic silencing of this non-moonlighting gene variant. PMID:27121330

  18. Moonlighting transcriptional activation function of a fungal sulfur metabolism enzyme

    PubMed Central

    Levati, Elisabetta; Sartini, Sara; Bolchi, Angelo; Ottonello, Simone; Montanini, Barbara


    Moonlighting proteins, including metabolic enzymes acting as transcription factors (TF), are present in a variety of organisms but have not been described in higher fungi so far. In a previous genome-wide analysis of the TF repertoire of the plant-symbiotic fungus Tuber melanosporum, we identified various enzymes, including the sulfur-assimilation enzyme phosphoadenosine-phosphosulfate reductase (PAPS-red), as potential transcriptional activators. A functional analysis performed in the yeast Saccharomyces cerevisiae, now demonstrates that a specific variant of this enzyme, PAPS-red A, localizes to the nucleus and is capable of transcriptional activation. TF moonlighting, which is not present in the other enzyme variant (PAPS-red B) encoded by the T. melanosporum genome, relies on a transplantable C-terminal polypeptide containing an alternating hydrophobic/hydrophilic amino acid motif. A similar moonlighting activity was demonstrated for six additional proteins, suggesting that multitasking is a relatively frequent event. PAPS-red A is sulfur-state-responsive and highly expressed, especially in fruitbodies, and likely acts as a recruiter of transcription components involved in S-metabolism gene network activation. PAPS-red B, instead, is expressed at low levels and localizes to a highly methylated and silenced region of the genome, hinting at an evolutionary mechanism based on gene duplication, followed by epigenetic silencing of this non-moonlighting gene variant. PMID:27121330

  19. Transcriptional networks driving enhancer function in the CFTR gene.


    Kerschner, Jenny L; Harris, Ann


    A critical cis-regulatory element for the CFTR (cystic fibrosis transmembrane conductance regulator) gene is located in intron 11, 100 kb distal to the promoter, with which it interacts. This sequence contains an intestine-selective enhancer and associates with enhancer signature proteins, such as p300, in addition to tissue-specific TFs (transcription factors). In the present study we identify critical TFs that are recruited to this element and demonstrate their importance in regulating CFTR expression. In vitro DNase I footprinting and EMSAs (electrophoretic mobility-shift assays) identified four cell-type-selective regions that bound TFs in vitro. ChIP (chromatin immunoprecipitation) identified FOXA1/A2 (forkhead box A1/A2), HNF1 (hepatocyte nuclear factor 1) and CDX2 (caudal-type homeobox 2) as in vivo trans-interacting factors. Mutation of their binding sites in the intron 11 core compromised its enhancer activity when measured by reporter gene assay. Moreover, siRNA (small interfering RNA)-mediated knockdown of CDX2 caused a significant reduction in endogenous CFTR transcription in intestinal cells, suggesting that this factor is critical for the maintenance of high levels of CFTR expression in these cells. The ChIP data also demonstrate that these TFs interact with multiple cis-regulatory elements across the CFTR locus, implicating a more global role in intestinal expression of the gene.

  20. Regulation of the interferon regulatory factor-8 (IRF-8) tumor suppressor gene by the signal transducer and activator of transcription 5 (STAT5) transcription factor in chronic myeloid leukemia.


    Waight, Jeremy D; Banik, Debarati; Griffiths, Elizabeth A; Nemeth, Michael J; Abrams, Scott I


    Tyrosine kinase inhibitors such as imatinib can effectively target the BCR-ABL oncoprotein in a majority of patients with chronic myeloid leukemia (CML). Unfortunately, some patients are resistant primarily to imatinib and others develop drug resistance, prompting interest in the discovery of new drug targets. Although much of this resistance can be explained by the presence of mutations within the tyrosine kinase domain of BCR-ABL, such mutations are not universally identified. Interferon regulatory factor-8 (IRF-8) is a transcription factor that is essential for myelopoiesis. Depressed IRF-8 levels are observed in a majority of CML patients and Irf-8(-/-) mice exhibit a CML-like disease. The underlying mechanisms of IRF-8 loss in CML are unknown. We hypothesized that BCR-ABL suppresses transcription of IRF-8 through STAT5, a proximal BCR-ABL target. Treatment of primary cells from newly diagnosed CML patients in chronic phase as well as BCR-ABL(+) cell lines with imatinib increased IRF-8 transcription. Furthermore, IRF-8 expression in cell line models was necessary for imatinib-induced antitumor responses. We have demonstrated that IRF-8 is a direct target of STAT5 and that silencing of STAT5 induced IRF-8 expression. Conversely, activating STAT5 suppressed IRF-8 transcription. Finally, we showed that STAT5 blockade using a recently discovered antagonist increased IRF-8 expression in patient samples. These data reveal a previously unrecognized BCR-ABL-STAT5-IRF-8 network, which widens the repertoire of potentially new anti-CML targets.

  1. Contraction-induced Interleukin-6 Gene Transcription in Skeletal Muscle Is Regulated by c-Jun Terminal Kinase/Activator Protein-1*

    PubMed Central

    Whitham, Martin; Chan, M. H. Stanley; Pal, Martin; Matthews, Vance B.; Prelovsek, Oja; Lunke, Sebastian; El-Osta, Assam; Broenneke, Hella; Alber, Jens; Brüning, Jens C.; Wunderlich, F. Thomas; Lancaster, Graeme I.; Febbraio, Mark A.


    Exercise increases the expression of the prototypical myokine IL-6, but the precise mechanism by which this occurs has yet to be identified. To mimic exercise conditions, C2C12 myotubes were mechanically stimulated via electrical pulse stimulation (EPS). We compared the responses of EPS with the pharmacological Ca2+ carrier calcimycin (A23187) because contraction induces marked increases in cytosolic Ca2+ levels or the classical IκB kinase/NFκB inflammatory response elicited by H2O2. We demonstrate that, unlike H2O2-stimulated increases in IL-6 mRNA, neither calcimycin- nor EPS-induced IL-6 mRNA expression is under the transcriptional control of NFκB. Rather, we show that EPS increased the phosphorylation of JNK and the reporter activity of the downstream transcription factor AP-1. Furthermore, JNK inhibition abolished the EPS-induced increase in IL-6 mRNA and protein expression. Finally, we observed an exercise-induced increase in both JNK phosphorylation and IL-6 mRNA expression in the skeletal muscles of mice after 30 min of treadmill running. Importantly, exercise did not increase IL-6 mRNA expression in skeletal muscle-specific JNK-deficient mice. These data identify a novel contraction-mediated transcriptional regulatory pathway for IL-6 in skeletal muscle. PMID:22351769

  2. Transcriptional activity of Pannier is regulated negatively by heterodimerization of the GATA DNA-binding domain with a cofactor encoded by the u-shaped gene of Drosophila

    PubMed Central

    Haenlin, Marc; Cubadda, Yolande; Blondeau, Francois; Heitzler, Pascal; Lutz, Yves; Simpson, Pat; Ramain, Philippe


    The genes pannier (pnr) and u-shaped (ush) are required for the regulation of achaete-scute during establishment of the bristle pattern in Drosophila. pnr encodes a protein belonging to the GATA family of transcription factors, whereas ush encodes a novel zinc finger protein. Genetic interactions between dominant pnr mutants bearing lesions situated in the amino-terminal zinc finger of the GATA domain and ush mutants have been described. We show here that both wild-type Pannier and the dominant mutant form activate transcription from the heterologous α globin promoter when transfected into chicken embryonic fibroblasts. Furthermore, Pnr and Ush are found to heterodimerize through the amino-terminal zinc finger of Pnr and when associated with Ush, the transcriptional activity of Pnr is lost. In contrast, the mutant pnr protein with lesions in this finger associates only poorly with Ush and activates transcription even when cotransfected with Ush. These interactions have been investigated in vivo by overexpression of the mutant and wild-type proteins. The results suggest an antagonistic effect of Ush on Pnr function and reveal a new mode of regulation of GATA factors during development. PMID:9367990

  3. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y


    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  4. Binding sequences for RdgB, a DNA damage-responsive transcriptional activator, and temperature-dependent expression of bacteriocin and pectin lyase genes in Pectobacterium carotovorum subsp. carotovorum.


    Yamada, Kazuteru; Kaneko, Jun; Kamio, Yoshiyuki; Itoh, Yoshifumi


    Pectobacterium carotovorum subsp. carotovorum strain Er simultaneously produces the phage tail-like bacteriocin carotovoricin (Ctv) and pectin lyase (Pnl) in response to DNA-damaging agents. The regulatory protein RdgB of the Mor/C family of proteins activates transcription of pnl through binding to the promoter. However, the optimal temperature for the synthesis of Ctv (23 degrees C) differs from that for synthesis of Pnl (30 degrees C), raising the question of whether RdgB directly activates ctv transcription. Here we report that RdgB directly regulates Ctv synthesis. Gel mobility shift assays demonstrated RdgB binding to the P(0), P(1), and P(2) promoters of the ctv operons, and DNase I footprinting determined RdgB-binding sequences (RdgB boxes) on these and on the pnl promoters. The RdgB box of the pnl promoter included a perfect 7-bp inverted repeat with high binding affinity to the regulator (K(d) [dissociation constant] = 150 nM). In contrast, RdgB boxes of the ctv promoters contained an imperfect inverted repeat with two or three mismatches that consequently reduced binding affinity (K(d) = 250 to 350 nM). Transcription of the rdgB and ctv genes was about doubled at 23 degrees C compared with that at 30 degrees C. In contrast, the amount of pnl transcription tripled at 30 degrees C. Thus, the inverse synthesis of Ctv and Pnl as a function of temperature is apparently controlled at the transcriptional level, and reduced rdgB expression at 30 degrees C obviously affected transcription from the ctv promoters with low-affinity RdgB boxes. Pathogenicity toward potato tubers was reduced in an rdgB knockout mutant, suggesting that the RdgAB system contributes to the pathogenicity of this bacterium, probably by activating pnl expression.

  5. The 5' flanking region of the gene for the Epstein-Barr virus-encoded nuclear antigen 2 contains a cell type specific cis-acting regulatory element that activates transcription in transfected B-cells.

    PubMed Central

    Ricksten, A; Olsson, A; Andersson, T; Rymo, L


    We have recently identified the promoter that positions the initiation (cap) site for RNA encoding the Epstein-Barr virus (EBV) determined nuclear antigen 2 (EBNA2) in transfected COS-1 cells. The cells were transfected with recombinant vectors that contained the BamHI WYH region of the EBV genome. In order to delineate regulatory DNA sequences required for the expression of EBNA2 the 5' flanking region of the gene was linked to reporter genes in expression vectors and transfected into EBV genome-negative lymphoid DG75 cells. We demonstrate that several cis-acting elements contribute to a transcriptional enhancer activity found in the region between nucleotides-553 and -86 relative to the cap site. The enhancer was active in lymphoid DG75 cells but not in HeLa cells and stimulated transcription also from the heterologous thymidine kinase (TK) and beta-globin promoters. Nuclear extracts of lymphoid cells contained protein factors that bound to the enhancer. The in vitro introduction of a mutation in the enhancer sequence that substantially reduced the transcription stimulatory activity concurrently blocked the binding of one of the factors. Images PMID:2843816

  6. Use of the heteroduplex mobility assay and cell sorting to select genome sequences of the CCR5 gene in HEK 293T cells edited by transcription activator-like effector nucleases.


    Nerys-Junior, Arildo; Costa, Lendel C; Braga-Dias, Luciene P; Oliveira, Márcia; Rossi, Atila D; da Cunha, Rodrigo Delvecchio; Gonçalves, Gabriel S; Tanuri, Amilcar


    Engineered nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN) are one of the most promising tools for modifying genomes. These site-specific enzymes cause double-strand breaks that allow gene disruption or gene insertion, thereby facilitating genetic manipulation. The major problem associated with this approach is the labor-intensive procedures required to screen and confirm the cellular modification by nucleases. In this work, we produced a TALEN that targets the human CCR5 gene and developed a heteroduplex mobility assay for HEK 293T cells to select positive colonies for sequencing. This approach provides a useful tool for the quick detection and easy assessment of nuclease activity.

  7. Use of the heteroduplex mobility assay and cell sorting to select genome sequences of the CCR5 gene in HEK 293T cells edited by transcription activator-like effector nucleases

    PubMed Central

    Nerys-Junior, Arildo; Costa, Lendel C.; Braga-Dias, Luciene P.; Oliveira, Márcia; Rossi, Átila D.; da Cunha, Rodrigo Delvecchio; Gonçalves, Gabriel S.; Tanuri, Amilcar


    Engineered nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN) are one of the most promising tools for modifying genomes. These site-specific enzymes cause double-strand breaks that allow gene disruption or gene insertion, thereby facilitating genetic manipulation. The major problem associated with this approach is the labor-intensive procedures required to screen and confirm the cellular modification by nucleases. In this work, we produced a TALEN that targets the human CCR5 gene and developed a heteroduplex mobility assay for HEK 293T cells to select positive colonies for sequencing. This approach provides a useful tool for the quick detection and easy assessment of nuclease activity. PMID:24688299

  8. Regulation of the Osem gene by abscisic acid and the transcriptional activator VP1: analysis of cis-acting promoter elements required for regulation by abscisic acid and VP1.


    Hattori, T; Terada, T; Hamasuna, S


    Osem, a rice gene homologous to the wheat Em gene, which encodes one of the late-embryogenesis abundant proteins was isolated. The gene was characterized with respect to control of transcription by abscisic acid (ABA) and the transcriptional activator VP1, which is involved in the ABA-regulated gene expression during late embryo-genesis. A fusion gene (Osem-GUS) consisting of the Osem promoter and the bacterial beta-glucuronidase (GUS) gene was constructed and tested in a transient expression system, using protoplasts derived from a suspension-cultured line of rice cells, for activation by ABA and by co-transfection with an expression vector (35S-Osvp1) for the rice VP1 (OSVP1) cDNA. The expression of Osem-GUS was strongly (40- to 150-fold) activated by externally applied ABA and by over-expression of (OS)VP1. The Osem promoter has three ACGTG-containing sequences, motif A, motif B and motif A', which resemble the abscisic acid-responsive element (ABRE) that was previously identified in the wheat Em and the rice Rab16. There is also a CATGCATG sequence, which is known as the Sph box and is shown to be essential for the regulation by VP1 of the maize anthocyanin regulatory gene C1. Focusing on these sequence elements, various mutant derivatives of the Osem promoter in the transient expression system were assayed. The analysis revealed that motif A functions not only as an ABRE but also as a sequence element required for the regulation by (OS)VP1.

  9. Analyzing phosphorylation-dependent regulation of subcellular localization and transcriptional activity of transcriptional coactivator NT-PGC-1α.


    Chang, Ji Suk; Gettys, Thomas W


    Peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PGC-1α) is a nuclear transcriptional coactivator that regulates the genes involved in energy metabolism. Recent evidence has been provided that alternative splicing of PPARGC1A gene produces a functional but predominantly cytosolic isoform of PGC-1α (NT-PGC-1α). We have demonstrated that transcriptional coactivation capacity of NT-PGC-1α is directly correlated with its nuclear localization in a PKA phosphorylation-dependent manner. In this chapter, we describe quantitative imaging analysis methods that are developed to measure the relative fluorescence intensity of the protein of interest in the nucleus and cytoplasm in a single cell and the frequency distribution of nuclear/cytoplasmic intensity ratios in the population of cells, respectively. This chapter also describes transient cotransfection and dual-luciferase reporter gene assay that examine the ability of coactivators to activate the transcriptional activity of transcription factors.

  10. The Post-transcriptional Regulator rsmA/csrA Activates T3SS by Stabilizing the 5′ UTR of hrpG, the Master Regulator of hrp/hrc Genes, in Xanthomonas

    PubMed Central

    Andrade, Maxuel O.; Farah, Chuck S.; Wang, Nian


    The RsmA/CsrA family of the post-transcriptional regulators of bacteria is involved in the regulation of many cellular processes, including pathogenesis. In this study, we demonstrated that rsmA not only is required for the full virulence of the phytopathogenic bacterium Xanthomonas citri subsp. citri (XCC) but also contributes to triggering the hypersensitive response (HR) in non-host plants. Deletion of rsmA resulted in significantly reduced virulence in the host plant sweet orange and a delayed and weakened HR in the non-host plant Nicotiana benthamiana. Microarray, quantitative reverse-transcription PCR, western-blotting, and GUS assays indicated that RsmA regulates the expression of the type 3 secretion system (T3SS) at both transcriptional and post-transcriptional levels. The regulation of T3SS by RsmA is a universal phenomenon in T3SS-containing bacteria, but the specific mechanism seems to depend on the interaction between a particular bacterium and its hosts. For Xanthomonads, the mechanism by which RsmA activates T3SS remains unknown. Here, we show that RsmA activates the expression of T3SS-encoding hrp/hrc genes by directly binding to the 5′ untranslated region (UTR) of hrpG, the master regulator of the hrp/hrc genes in XCC. RsmA stabilizes hrpG mRNA, leading to increased accumulation of HrpG proteins and subsequently, the activation of hrp/hrc genes. The activation of the hrp/hrc genes by RsmA via HrpG was further supported by the observation that ectopic overexpression of hrpG in an rsmA mutant restored its ability to cause disease in host plants and trigger HR in non-host plants. RsmA also stabilizes the transcripts of another T3SS-associated hrpD operon by directly binding to the 5′ UTR region. Taken together, these data revealed that RsmA primarily activates T3SS by acting as a positive regulator of hrpG and that this regulation is critical to the pathogenicity of XCC. PMID:24586158

  11. Transcription mediated insulation and interference direct gene cluster expression switches.


    Nguyen, Tania; Fischl, Harry; Howe, Françoise S; Woloszczuk, Ronja; Serra Barros, Ana; Xu, Zhenyu; Brown, David; Murray, Struan C; Haenni, Simon; Halstead, James M; O'Connor, Leigh; Shipkovenska, Gergana; Steinmetz, Lars M; Mellor, Jane


    In yeast, many tandemly arranged genes show peak expression in different phases of the metabolic cycle (YMC) or in different carbon sources, indicative of regulation by a bi-modal switch, but it is not clear how these switches are controlled. Using native elongating transcript analysis (NET-seq), we show that transcription itself is a component of bi-modal switches, facilitating reciprocal expression in gene clusters. HMS2, encoding a growth-regulated transcription factor, switches between sense- or antisense-dominant states that also coordinate up- and down-regulation of transcription at neighbouring genes. Engineering HMS2 reveals alternative mono-, di- or tri-cistronic and antisense transcription units (TUs), using different promoter and terminator combinations, that underlie state-switching. Promoters or terminators are excluded from functional TUs by read-through transcriptional interference, while antisense TUs insulate downstream genes from interference. We propose that the balance of transcriptional insulation and interference at gene clusters facilitates gene expression switches during intracellular and extracellular environmental change.

  12. Transcription mediated insulation and interference direct gene cluster expression switches

    PubMed Central

    Nguyen, Tania; Brown, David; Murray, Struan C; Haenni, Simon; Halstead, James M; O'Connor, Leigh; Shipkovenska, Gergana; Steinmetz, Lars M; Mellor, Jane


    In yeast, many tandemly arranged genes show peak expression in different phases of the metabolic cycle (YMC) or in different carbon sources, indicative of regulation by a bi-modal switch, but it is not clear how these switches are controlled. Using native elongating transcript analysis (NET-seq), we show that transcription itself is a component of bi-modal switches, facilitating reciprocal expression in gene clusters. HMS2, encoding a growth-regulated transcription factor, switches between sense- or antisense-dominant states that also coordinate up- and down-regulation of transcription at neighbouring genes. Engineering HMS2 reveals alternative mono-, di- or tri-cistronic and antisense transcription units (TUs), using different promoter and terminator combinations, that underlie state-switching. Promoters or terminators are excluded from functional TUs by read-through transcriptional interference, while antisense TUs insulate downstream genes from interference. We propose that the balance of transcriptional insulation and interference at gene clusters facilitates gene expression switches during intracellular and extracellular environmental change. DOI: PMID:25407679

  13. Bypassing the Requirements for Epigenetic Modifications in Gene Transcription by Increasing Enhancer Strength▿

    PubMed Central

    Koutroubas, George; Merika, Menie; Thanos, Dimitris


    Our current concept postulates that histone acetylation is required for the recruitment of bromodomain-containing transcription complexes, such as the chromatin-remodeling machine SWI/SNF and the basal transcription factor TFIID. We generated simple NF-κB-dependent enhancers of increasing transcriptional strengths and found that the histone acetylation requirements for activation of transcription depended on the strengths of these enhancers. All enhancers function by recruiting SWI/SNF and TFIID to induce nucleosome sliding, a prerequisite for transcriptional activation. However, histone acetylation, although it occurs, is dispensable for TFIID and SWI/SNF recruitment by the strong enhancers, indicating that strong activators can overcome the chromatin barrier by directly recruiting the necessary transcriptional complexes. Weak enhancers depend on histone acetylation for recruitment, and this requirement is independent of a histone acetylation code. Thus, the need for nucleosome modifications is imposed on genes and translated according to the quality and strengths of the activators. PMID:18025106

  14. Activating Transcription Factor 3 and the Nervous System

    PubMed Central

    Hunt, David; Raivich, Gennadij; Anderson, Patrick Norval


    Activating transcription factor 3 (ATF3) belongs to the ATF/cyclic AMP responsive element binding family of transcription factors and is often described as an adaptive response gene whose activity is usually regulated by stressful stimuli. Although expressed in a number of splice variants and generally recognized as a transcriptional repressor, ATF3 has the ability to interact with a number of other transcription factors including c-Jun to form complexes which not only repress, but can also activate various genes. ATF3 expression is modulated mainly at the transcriptional level and has markedly different effects in different types of cell. The levels of ATF3 mRNA and protein are normally very low in neurons and glia but their expression is rapidly upregulated in response to injury. ATF3 expression in neurons is closely linked to their survival and the regeneration of their axons following axotomy, and that in peripheral nerves correlates with the generation of a Schwann cell phenotype that is conducive to axonal regeneration. ATF3 is also induced by Toll-like receptor (TLR) ligands but acts as a negative regulator of TLR signaling, suppressing the innate immune response which is involved in immuno-surveillance and can enhance or reduce the survival of injured neurons and promote the regeneration of their axons. PMID:22347845

  15. Gene targeting technologies in rats: zinc finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeats.


    Mashimo, Tomoji


    The laboratory rat has been widely used as an animal model in biomedical science for more than 150 years. Applying zinc-finger nucleases or transcription activator-like effector nucleases to rat embryos via microinjection is an efficient genome editing tool for generating targeted knockout rats. Recently, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated endonucleases have been used as an effective tool for precise and multiplex genome editing in mice and rats. In this review, the advantages and disadvantages of these site-specific nuclease technologies for genetic analysis and manipulation in rats are discussed.

  16. [Transcription activator-like effectors(TALEs)based genome engineering].


    Zhao, Mei-Wei; Duan, Cheng-Li; Liu, Jiang


    Systematic reverse-engineering of functional genome architecture requires precise modifications of gene sequences and transcription levels. The development and application of transcription activator-like effectors(TALEs) has created a wealth of genome engineering possibilities. TALEs are a class of naturally occurring DNA-binding proteins found in the plant pathogen Xanthomonas species. The DNA-binding domain of each TALE typically consists of tandem 34-amino acid repeat modules rearranged according to a simple cipher to target new DNA sequences. Customized TALEs can be used for a wide variety of genome engineering applications, including transcriptional modulation and genome editing. Such "genome engineering" has now been established in human cells and a number of model organisms, thus opening the door to better understanding gene function in model organisms, improving traits in crop plants and treating human genetic disorders.

  17. Somatic hypermutation of immunoglobulin genes is linked to transcription initiation.


    Peters, A; Storb, U


    To identify DNA sequences that target the somatic hypermutation process, the immunoglobulin gene promoter located upstream of the variable (V) region was duplicated upstream of the constant (C) region of a kappa transgene. Normally, kappa genes are somatically mutated only in the VJ region, but not in the C region. In B cell hybridomas from mice with this kappa transgene (P5'C), both the VJ region and the C region, but not the region between them, were mutated at similar frequencies, suggesting that the mutation mechanism is related to transcription. The downstream promoter was not occluded by transcripts from the upstream promoter. In fact, the levels of transcripts originating from the two promoters were similar, supporting a mutation model based on initiation of transcripts. Several "hot-spots" of somatic mutation were noted, further demonstrating that this transgene has the hallmarks of somatic mutation of endogenous immunoglobulin genes. A model linking somatic mutation to transcription-coupled DNA repair is proposed.

  18. Activation of the Ustilagic Acid Biosynthesis Gene Cluster in Ustilago maydis by the C2H2 Zinc Finger Transcription Factor Rua1▿

    PubMed Central

    Teichmann, Beate; Liu, Lidan; Schink, Kay Oliver; Bölker, Michael


    The phytopathogenic basidiomycetous fungus Ustilago maydis secretes, under conditions of nitrogen starvation, large amounts of the biosurfactant ustilagic acid (UA). This secreted cellobiose glycolipid is toxic for many microorganisms and confers biocontrol activity to U. maydis. Recently, a large gene cluster that is responsible for UA biosynthesis was identified. Here, we show that expression of all cluster genes depends on Rua1, a nuclear protein of the C2H2 zinc finger family, whose gene is located within the gene cluster. While deletion of rua1 results in complete loss of UA production, overexpression of rua1 promotes increased UA synthesis even in the presence of a good nitrogen source. Bioinformatic analysis allowed us to identify a conserved sequence element that is present in the promoters of all structural genes involved in UA biosynthesis. Deletion analysis of several promoters within the cluster revealed that this DNA element serves as an upstream activating sequence (UAS) and mediates Rua1-dependent expression. We used the yeast one-hybrid system to demonstrate specific recognition of this DNA element by Rua1. Introduction of nucleotide exchanges into the consensus sequence interfered with Rua1-dependent activation, suggesting that this sequence element acts as a direct binding site for Rua1. PMID:20173069

  19. Activation of the ustilagic acid biosynthesis gene cluster in Ustilago maydis by the C2H2 zinc finger transcription factor Rua1.


    Teichmann, Beate; Liu, Lidan; Schink, Kay Oliver; Bölker, Michael


    The phytopathogenic basidiomycetous fungus Ustilago maydis secretes, under conditions of nitrogen starvation, large amounts of the biosurfactant ustilagic acid (UA). This secreted cellobiose glycolipid is toxic for many microorganisms and confers biocontrol activity to U. maydis. Recently, a large gene cluster that is responsible for UA biosynthesis was identified. Here, we show that expression of all cluster genes depends on Rua1, a nuclear protein of the C(2)H(2) zinc finger family, whose gene is located within the gene cluster. While deletion of rua1 results in complete loss of UA production, overexpression of rua1 promotes increased UA synthesis even in the presence of a good nitrogen source. Bioinformatic analysis allowed us to identify a conserved sequence element that is present in the promoters of all structural genes involved in UA biosynthesis. Deletion analysis of several promoters within the cluster revealed that this DNA element serves as an upstream activating sequence (UAS) and mediates Rua1-dependent expression. We used the yeast one-hybrid system to demonstrate specific recognition of this DNA element by Rua1. Introduction of nucleotide exchanges into the consensus sequence interfered with Rua1-dependent activation, suggesting that this sequence element acts as a direct binding site for Rua1. PMID:20173069

  20. Characterizing transcriptional heterogeneity through pathway and gene set overdispersion analysis

    PubMed Central

    Fan, Jean; Salathia, Neeraj; Liu, Rui; Kaeser, Gwendolyn E.; Yung, Yun C.; Herman, Joseph L.; Kaper, Fiona; Fan, Jian-Bing; Zhang, Kun; Chun, Jerold; Kharchenko, Peter V.


    The transcriptional state of a cell reflects a variety of biological factors, from persistent cell-type specific features to transient processes such as cell cycle. Depending on biological context, all such aspects of transcriptional heterogeneity may be of interest, but detecting them from noisy single-cell RNA-seq data remains challenging. We developed PAGODA to resolve multiple, potentially overlapping aspects of transcriptional heterogeneity by testing gene sets for coordinated variability amongst measured cells. PMID:26780092

  1. Bipartite functions of the CREB co-activators selectively direct alternative splicing or transcriptional activation.


    Amelio, Antonio L; Caputi, Massimo; Conkright, Michael D


    The CREB regulated transcription co-activators (CRTCs) regulate many biological processes by integrating and converting environmental inputs into transcriptional responses. Although the mechanisms by which CRTCs sense cellular signals are characterized, little is known regarding how CRTCs contribute to the regulation of cAMP inducible genes. Here we show that these dynamic regulators, unlike other co-activators, independently direct either pre-mRNA splice-site selection or transcriptional activation depending on the cell type or promoter context. Moreover, in other scenarios, the CRTC co-activators coordinately regulate transcription and splicing. Mutational analyses showed that CRTCs possess distinct functional domains responsible for regulating either pre-mRNA splicing or transcriptional activation. Interestingly, the CRTC1-MAML2 oncoprotein lacks the splicing domain and is incapable of altering splice-site selection despite robustly activating transcription. The differential usage of these distinct domains allows CRTCs to selectively mediate multiple facets of gene regulation, indicating that co-activators are not solely restricted to coordinating alternative splicing with increase in transcriptional activity.

  2. Bidirectional Transcription Arises from Two Distinct Hubs of Transcription Factor Binding and Active Chromatin.


    Scruggs, Benjamin S; Gilchrist, Daniel A; Nechaev, Sergei; Muse, Ginger W; Burkholder, Adam; Fargo, David C; Adelman, Karen


    Anti-sense transcription originating upstream of mammalian protein-coding genes is a well-documented phenomenon, but remarkably little is known about the regulation or function of anti-sense promoters and the non-coding RNAs they generate. Here we define at nucleotide resolution the divergent transcription start sites (TSSs) near mouse mRNA genes. We find that coupled sense and anti-sense TSSs precisely define the boundaries of a nucleosome-depleted region (NDR) that is highly enriched in transcription factor (TF) motifs. Notably, as the distance between sense and anti-sense TSSs increases, so does the size of the NDR, the level of signal-dependent TF binding, and gene activation. We further discover a group of anti-sense TSSs in macrophages with an enhancer-like chromatin signature. Interestingly, this signature identifies divergent promoters that are activated during immune challenge. We propose that anti-sense promoters serve as platforms for TF binding and establishment of active chromatin to further regulate or enhance sense-strand mRNA expression.

  3. Immediate-Early Gene Transcriptional Activation in Hippocampus Ca1 and Ca3 Does Not Accurately Reflect Rapid, Pattern Completion-Based Retrieval of Context Memory

    ERIC Educational Resources Information Center

    Pevzner, Aleksandr; Guzowski, John F.


    No studies to date have examined whether immediate-early gene (IEG) activation is driven by context memory recall. To address this question, we utilized the context preexposure facilitation effect (CPFE) paradigm. In CPFE, animals acquire contextual fear conditioning through hippocampus-dependent rapid retrieval of a previously formed contextual…

  4. Stochastic models of gene expression and post-transcriptional regulation

    NASA Astrophysics Data System (ADS)

    Pendar, Hodjat; Kulkarni, Rahul; Jia, Tao


    The intrinsic stochasticity of gene expression can give rise to phenotypic heterogeneity in a population of genetically identical cells. Correspondingly, there is considerable interest in understanding how different molecular mechanisms impact the 'noise' in gene expression. Of particular interest are post-transcriptional regulatory mechanisms involving genes called small RNAs, which control important processes such as development and cancer. We propose and analyze general stochastic models of gene expression and derive exact analytical expressions quantifying the noise in protein distributions [1]. Focusing on specific regulatory mechanisms, we analyze a general model for post-transcriptional regulation of stochastic gene expression [2]. The results obtained provide new insights into the role of post-transcriptional regulation in controlling the noise in gene expression. [4pt] [1] T. Jia and R. V. Kulkarni, Phys. Rev. Lett.,106, 058102 (2011) [0pt] [2] T. Jia and R. V. Kulkarni, Phys. Rev. Lett., 105, 018101 (2010)

  5. Transcription factor trapping by RNA in gene regulatory elements.


    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A


    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs.

  6. Higher plant mitochondrial DNA: Genomes, genes, mutants, transcription, translation

    SciTech Connect

    Not Available


    This volume contains brief summaries of 63 presentations given at the International Workshop on Higher Plant Mitochondrial DNA. The presentations are organized into topical discussions addressing plant genomes, mitochondrial genes, cytoplasmic male sterility, transcription, translation, plasmids and tissue culture. (DT)

  7. Characterization of the transcriptional activation domains of human TEF3-1 (transcription enhancer factor 3 isoform 1).


    Qiao, Cheng; Jiang, Yajie; Deng, Cuilan; Huang, Zebo; Teng, Kaixuan; Chen, Lan; Liu, Xin


    TEF3-1 (transcription enhancer factor 3 isoform 1) is a human transcriptional factor, which has a N-terminal TEA/ATTS domain supposedly for DNA binding and C-terminal PRD and STY domains for transcriptional activation. Taking advantage of the efficient reporter design of yeast two-hybrid system, we characterized the TEF3-1 domains in activating gene expression. Previously study usually mentioned that the C-terminal domain of TEF3-1 has the transcriptional activity, however, our data shows that the peptides TEF3-11-66 and TEF3-1197-434 functioned as two independent activation domains, suggesting that N-terminal domain of TEF3-1 also has transcriptional activation capacity. Additionally, more deletions of amino acids 197-434 showed that only the peptides TEF3-1197-265 contained the minimum sequences for the C-terminal transcriptional activation domain. The protein structure is predicted to contain a helix-turn-helix structure in TEF3-11-66 and four β sheets in TEF3-1197-265. Finally, after the truncated fragments of TEF3-1 were expressed in HUVEC cells, the whole TEF3-1 and the two activation domains could increase F-actin stress fiber, cell proliferation, migration and targeted gene expression. Further analysis and characterization of the activation domains in TEF3-1 may broaden our understanding of the gene involved in angiogenesis and other pathological processes.

  8. Transcriptional activation of a geranylgeranyl diphosphate synthase gene, GGPPS2, isolated from Scoparia dulcis by treatment with methyl jasmonate and yeast extract.


    Yamamura, Y; Mizuguchi, Y; Taura, F; Kurosaki, F


    A cDNA clone, designated SdGGPPS2, was isolated from young seedlings of Scoparia dulcis. The putative amino acid sequence of the translate of the gene showed high homology with geranylgeranyl diphosphate synthase (GGPPS) from various plant sources, and the N-terminal residues exhibited the characteristics of chloroplast targeting sequence. An appreciable increase in the transcriptional level of SdGGPPS2 was observed by exposure of the leaf tissues of S. dulcis to methyl jasmonate, yeast extract or Ca(2+) ionophore A23187. In contrast, SdGGPPS1, a homologous GGPPS gene of the plant, showed no or only negligible change in the expression level upon treatment with these stimuli. The truncated protein heterologously expressed in Escherichia coli in which the putative targeting domain was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to liberate geranylgeranyl diphosphate. These results suggested that SdGGPPS2 plays physiological roles in methyl jasmonate and yeast extract-induced metabolism in the chloroplast of S. dulcis cells. PMID:25027024

  9. Intracompartmental and Intercompartmental Transcriptional Networks Coordinate the Expression of Genes for Organellar Functions1[W

    PubMed Central

    Leister, Dario; Wang, Xi; Haberer, Georg; Mayer, Klaus F.X.; Kleine, Tatjana


    Genes for mitochondrial and chloroplast proteins are distributed between the nuclear and organellar genomes. Organelle biogenesis and metabolism, therefore, require appropriate coordination of gene expression in the different compartments to ensure efficient synthesis of essential multiprotein complexes of mixed genetic origin. Whereas organelle-to-nucleus signaling influences nuclear gene expression at the transcriptional level, organellar gene expression (OGE) is thought to be primarily regulated posttranscriptionally. Here, we show that intracompartmental and intercompartmental transcriptional networks coordinate the expression of genes for organellar functions. Nearly 1,300 ATH1 microarray-based transcriptional profiles of nuclear and organellar genes for mitochondrial and chloroplast proteins in the model plant Arabidopsis (Arabidopsis thaliana) were analyzed. The activity of genes involved in organellar energy production (OEP) or OGE in each of the organelles and in the nucleus is highly coordinated. Intracompartmental networks that link the OEP and OGE gene sets serve to synchronize the expression of nucleus- and organelle-encoded proteins. At a higher regulatory level, coexpression of organellar and nuclear OEP/OGE genes typically modulates chloroplast functions but affects mitochondria only when chloroplast functions are perturbed. Under conditions that induce energy shortage, the intercompartmental coregulation of photosynthesis genes can even override intracompartmental networks. We conclude that dynamic intracompartmental and intercompartmental transcriptional networks for OEP and OGE genes adjust the activity of organelles in response to the cellular energy state and environmental stresses, and we identify candidate cis-elements involved in the transcriptional coregulation of nuclear genes. Regarding the transcriptional regulation of chloroplast genes, novel tentative target genes of σ factors are identified. PMID:21775496