Science.gov

Sample records for active hcmv infection

  1. Suppressive effects of sirtinol on human cytomegalovirus (hCMV) infection and hCMV-induced activation of molecular mechanisms of senescence and production of reactive oxygen species.

    PubMed

    Mao, Genxiang; Li, Huifen; Ding, Xiang; Meng, Xin; Wang, Guofu; Leng, Sean X

    2016-09-01

    Substantial evidence suggests that chronic human cytomegalovirus (hCMV) infection contributes significantly to T-cell immunosenescence and adverse health outcomes in older adults. As such, it is important to search for compounds with anti-hCMV properties. Studies have shown that resveratrol, a sirtuin activator, suppresses hCMV infection. Here we report suppressive effects of sirtinol, a sirtuin antagonist, on hCMV infection and its cellular and molecular consequences. Human diploid fibroblast WI-38 cells were infected by hCMV Towne strain in the absence or presence of sirtinol. hCMV replication was measured using qPCR. Senescent phenotype was determined by senescence-associated β galactosidase (SA-β-Gal) activity. Expression of hCMV immediate early (IE) and early (E) proteins and senescence-associated proteins (pRb and Rb, p16(INK4), and p53) and production of reactive oxygen species (ROS) were assessed using standard laboratory assays. The results demonstrated that sirtinol suppressed hCMV infection as well as hCMV-induced activation of molecular mechanisms of senescence and ROS production. While underlying molecular mechanisms remain to be elucidated, these findings indicate sirtinol as a novel and potent anti-hCMV agent with the potential to be developed as an effective treatment for chronic hCMV infection and its cellular and molecular consequences that are important to ageing and health of older adults. PMID:26763147

  2. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.

    PubMed Central

    Koedood, M; Fichtel, A; Meier, P; Mitchell, P J

    1995-01-01

    Congenital human cytomegalovirus (HCMV) infection is a common cause of deafness and neurological disabilities. Many aspects of this prenatal infection, including which cell types are infected and how infection proceeds, are poorly understood. Transcription of HCMV immediate-early (IE) genes is required for expression of all other HCMV genes and is dependent on host cell transcription factors. Cell type-specific differences in levels of IE transcription are believed to underlie differences in infection permissivity. However, DNA transfection experiments have paradoxically suggested that the HCMV major IE enhancer/promoter is a broadly active transcriptional element with little cell type specificity. In contrast, we show here that expression of a lacZ gene driven by the HCMV major IE enhancer/promoter -524 to +13 segment is restricted in transgenic mouse embryos to sites that correlate with known sites of congenital HCMV infection in human fetuses. This finding suggests that the IE enhancer/promoter is a major determinant of HCMV infection sites in humans and that transcription factors responsible for its regulation are cell type-specifically conserved between humans and mice. The lacZ expression patterns of these transgenic embryos yield insight into congenital HCMV pathogenesis by providing a spatiotemporal map of the sets of vascular, neural, and epithelial cells that are likely targets of infection. These transgenic mice may constitute a useful model system for investigating IE enhancer/promoter regulation in vivo and for identifying factors that modulate active and latent HCMV infections in humans. PMID:7884867

  3. US28 Is a Potent Activator of Phospholipase C during HCMV Infection of Clinically Relevant Target Cells

    PubMed Central

    Miller, William E.; Zagorski, William A.; Brenneman, Joanna D.; Avery, Diana; Miller, Jeanette L. C.; O’Connor, Christine M.

    2012-01-01

    Members of the cytomegalovirus family each encode two or more genes with significant homology to G-protein coupled receptors (GPCRs). In rodent models of pathogenesis, these viral encoded GPCRs play functionally significant roles, as their deletion results in crippled viruses that cannot traffic properly and/or replicate in virally important target cells. Of the four HCMV encoded GPCRs, US28 has garnered the most attention due to the fact that it exhibits both agonist-independent and agonist-dependent signaling activity and has been demonstrated to promote cellular migration and proliferation. Thus, it appears that the CMV GPCRs play important roles in viral replication in vivo as well as promote the development of virus-associated pathology. In the current study we have utilized a series of HCMV/US28 recombinants to investigate the expression profile and signaling activities of US28 in a number of cell types relevant to HCMV infection including smooth muscle cells, endothelial cells and cells derived from glioblastoma multiforme (GBM) tumors. The results indicate that US28 is expressed and exhibits constitutive agonist-independent signaling activity through PLC-β in all cell types tested. Moreover, while CCL5/RANTES and CX3CL1/Fractalkine both promote US28-dependent Ca++ release in smooth muscle cells, this agonist-dependent effect appears to be cell-specific as we fail to detect US28 driven Ca++ release in the GBM cells. We have also investigated the effects of US28 on signaling via endogenous GPCRs including those in the LPA receptor family. Our data indicate that US28 can enhance signaling via endogenous LPA receptors. Taken together, our results indicate that US28 induces a variety of signaling events in all cell types tested suggesting that US28 signaling likely plays a significant role during HCMV infection and dissemination in vivo. PMID:23209769

  4. US28 actions in HCMV infection: lessons from a versatile hijacker.

    PubMed

    Boomker, J M; van Luyn, M J A; The, T H; de Leij, L F M H; Harmsen, M C

    2005-01-01

    Mimicking host proteins is a strategy adopted by several herpesviruses to exploit the host cell for their own benefit. In this respect the human cytomegalovirus (HCMV) chemokine receptor homologue US28, has been extensively studied. Molecular pirates such as US28 can teach us about crucial events in HCMV infection and may either offer a potential target for antiviral therapy or provide an alternative strategy to immune suppression. Despite elaborate research into the chemokine binding affinity, signalling properties, intracellular trafficking and expression kinetics of US28, a solid hypothesis about the role of US28 in HCMV infection has not yet been proposed. It appears that US28 may behave as a molecular pirate that employs smart strategies for cell entry, host gene regulation and immune evasion. This review will elaborate on these aspects of US28 biology and discuss possible implications for HCMV infection. PMID:15861487

  5. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients

    PubMed Central

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John

    2015-01-01

    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R− group. PMID:25312585

  6. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients.

    PubMed

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John; Van Loock, Marnix

    2015-01-01

    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R- group. PMID:25312585

  7. The HCMV gH/gL/UL128-131 Complex Triggers the Specific Cellular Activation Required for Efficient Viral Internalization into Target Monocytes

    PubMed Central

    Nogalski, Maciej T.; Chan, Gary C. T.; Stevenson, Emily V.; Collins-McMillen, Donna K.; Yurochko, Andrew D.

    2013-01-01

    We have established that HCMV acts as a specific ligand engaging and activating cellular integrins on monocytes. As a result, integrin signaling via Src activation leads to the functional activation of paxillin required for efficient viral entry and for the biological changes in monocytes needed for viral dissemination. These biological/molecular changes allow HCMV to use monocytes as “vehicles” for systemic spread and the establishment of lifelong persistence. However, it remains unresolved how HCMV specifically induces this observed monocyte activation. It was previously demonstrated that the HCMV gH/gL/UL128-131 glycoprotein complex facilitates viral entry into biologically relevant cell types. Nevertheless, the mechanism by which the gH/gL/UL128-131 complex promotes this process is unknown. We now show that only HCMV virions possessing the gH/gL/UL128-131 complex are capable of activating integrin/Src/paxillin-signaling in monocytes. In fibroblasts, this signaling is reversed, such that virus lacking the gH/gL/UL128-131 complex is the only virus able to induce the paxillin activation cascade. The presence of the gH/gL/UL128-131 complex also may have an inhibitory effect on integrin-mediated signaling pathway in fibroblasts. Furthermore, we demonstrate that the presence of the gH/gL/UL128-131 complex on the viral envelope, through its activation of the integrin/Src/paxillin pathway, is necessary for efficient HCMV internalization into monocytes and that appropriate actin and dynamin regulation is critical for this entry process. Importantly, productive infection in monocyte-derived macrophages was seen only in cells exposed to HCMV expressing the gH/gL/UL128-131 complex. From our data, the HCMV gH/gL/U128-131 complex emerges as the specific ligand driving the activation of the receptor-mediated signaling required for the regulation of the actin cytoskeleton and, consequently, for efficient and productive internalization of HCMV into monocytes. To our

  8. Congenital HCMV infection: a collaborative and comparative study of virus detection in amniotic fluid by culture and by PCR.

    PubMed

    Gouarin, S; Palmer, P; Cointe, D; Rogez, S; Vabret, A; Rozenberg, F; Denis, F; Freymuth, F; Lebon, P; Grangeot-Keros, L

    2001-04-01

    Cytomegalovirus (HCMV) infection is the leading cause of congenital virus infection in developed countries, affecting an estimated 1% of births. This antenatal infection can cause serious sequelae. Strategies for prevention and treatment must, therefore, be agreed upon, entailing a preliminary performance assessment of antenatal virus diagnosis techniques. Between 1992 and 1999, HCMV serology status was established for 19456 pregnant women in four French hospitals. Seronegative patients (55.4%) were given serology screening, and antenatal diagnosis was given to 152 women who had shown seroconversion during their pregnancies (1.4%). The detection of HCMV transmission from mother to fetus was finally established in 95 cases, using polymerase chain reaction (PCR) and viral culture methods for detecting HCMV in the amniotic fluid. These results were compared with viral culture of children's urine after birth, enabling us to distinguish between children really infected in utero (30%) and non-infected children (70%). The results of the virus culture and those of PCR were identical in 94 of the 95 cases, with one discrepancy (culture-/PCR+). The two diagnosis techniques had identical sensitivity (72%), with culture proving slightly more specific than PCR (98.4% as opposed to 96.9%). Positive prediction values for culture and for PCR were, respectively, 95.6 and 91.3%. Antenatal virus diagnosis on amniotic fluid was negative with both techniques in 8 out of 29 cases of children born with HCMV infection (VPN=89%). Over half of these wrongly negative results can be explained by amniocentesis carried out too early in the pregnancy or too early with respect to the mother's primary infection. PMID:11255097

  9. Single Chain Antibodies Against gp55 of Human Cytomegalovirus (HCMV) for Prophylaxis and Treatment of HCMV Infections

    PubMed Central

    Moazen, Bahareh; Ebrahimi, Elahe; Nejatollahi, Foroogh

    2016-01-01

    Background: Immunotherapy is a promising prospective new treatment for cytomegalovirus (CMV) infections. Neutralizing effects have been reported using monoclonal antibodies. Recombinant single chain antibodies (scFvs) due to their advantages over monoclonal antibodies are potential alternatives and provide valuable clinical agents. Objectives: The aim of this study was to select specific single chain antibodies against gp55 of CMV and to evaluate their neutralizing effects. In the present study, we selected specific single chain antibodies against glycoprotein 55 (gp55) of CMV for their use in treatment and diagnosis. Materials and Methods: Single chain antibodies specific against an epitope located in the C-terminal part of gp55 were selected from a phage antibody display library. After four rounds of panning, twenty clones were amplified by the polymerase chain reaction (PCR) and fingerprinted by MvaI restriction enzyme. The reactivities of the specific clones were tested by the enzyme-linked immunosorbent assay (ELISA) and the neutralizing effects were evaluated by the plaque reduction assay. Results: Fingerprinting of selected clones revealed three specific single chain antibodies (scFv1, scFv2 and scFv3) with frequencies 25%, 20 and 20%. The clones produced positive ELISA with the corresponding peptide. The percentages of plaque reduction for scFv1, scFv2 and scFv3 were 23.7, 68.8 and 11.6, respectively. Conclusions: Gp55 of human CMV is considered as an important candidate for immunotherapy. In this study, we selected three specific clones against gp55. The scFvs reacted only with the corresponding peptide in a positive ELISA. The scFv2 with 68.8% neutralizing effect showed the potential to be considered for prophylaxis and treatment of CMV infections, especially in solid organ transplant recipients, for whom treatment of CMV is urgently needed. The scFv2 with neutralizing effect of 68.8%, has the potential to be considered for treatment of these patients

  10. HCMV pUS28 initiates pro-migratory signaling via activation of Pyk2 kinase

    SciTech Connect

    Vomaske, Jennifer; Varnum, Susan M.; Melnychuk, Ryan; Smith, Patricia; Pasa-Tolic, Ljiljana; Shutthanandan, Janani I.; Streblow, Daniel N.

    2010-12-10

    The HCMV-encoded chemokine receptor US28 mediates smooth muscle cell (SMC) and macrophage motility and this activity has been implicated in the acceleration of vascular disease. US28 induced SMC migration involves the activation of the protein tyrosine kinases (PTKs) Src and Focal adhesion kinase as well as the small GTPase RhoA. In the current study, we examined the involvement of the PTK Pyk2 in US28-induced cellular motility. Expression of a Pyk2 lacking the autophosphorylation site (Tyr-402) blocks US28-mediated SMC migration in response to RANTES, while the kinase-inactive mutant failed to elicit the same negative effect on migration. US28 stimulation with RANTES results in ligand-dependent and calcium-dependent phosphorylation of Pyk2 Tyr-402 and induced the formation of an active Pyk2 kinase complex containing several novel Pyk2 binding proteins. Interestingly, expression of the autophosphorylation site mutant Pyk2 F402Y did not abrogate the formation of an active Pyk2 kinase complex, but instead prevented US28-mediated activation of RhoA. These findings represent the first demonstration that US28 signals through Pyk2 and that this PTK participates in US28-mediated cellular motility via activation of RhoA. Additionally, US28 activated RhoA via Pyk2 in the U373 glioblastoma cells. Interestingly, the Pyk2 kinase complex in U373 contained several proteins known to participate in glioma tumorigenesis. These results provide a potential mechanistic link between HCMV-US28 and glioblastoma cell activation and motility.

  11. HCMV pUL135 Remodels the Actin Cytoskeleton to Impair Immune Recognition of Infected Cells

    PubMed Central

    Stanton, Richard J.; Prod’homme, Virginie; Purbhoo, Marco A.; Moore, Melanie; Aicheler, Rebecca J.; Heinzmann, Marcus; Bailer, Susanne M.; Haas, Jürgen; Antrobus, Robin; Weekes, Michael P.; Lehner, Paul J.; Vojtesek, Borivoj; Miners, Kelly L.; Man, Stephen; Wilkie, Gavin S.; Davison, Andrew J.; Wang, Eddie C.Y.; Tomasec, Peter; Wilkinson, Gavin W.G.

    2014-01-01

    Summary Immune evasion genes help human cytomegalovirus (HCMV) establish lifelong persistence. Without immune pressure, laboratory-adapted HCMV strains have undergone genetic alterations. Among these, the deletion of the UL/b’ domain is associated with loss of virulence. In a screen of UL/b’, we identified pUL135 as a protein responsible for the characteristic cytopathic effect of clinical HCMV strains that also protected from natural killer (NK) and T cell attack. pUL135 interacted directly with abl interactor 1 (ABI1) and ABI2 to recruit the WAVE2 regulatory complex to the plasma membrane, remodel the actin cytoskeleton and dramatically reduce the efficiency of immune synapse (IS) formation. An intimate association between F-actin filaments in target cells and the IS was dispelled by pUL135 expression. Thus, F-actin in target cells plays a critical role in synaptogenesis, and this can be exploited by pathogens to protect against cytotoxic immune effector cells. An independent interaction between pUL135 and talin disrupted cell contacts with the extracellular matrix. PMID:25121749

  12. Humoral immune response against human cytomegalovirus (HCMV)-specific proteins after HCMV infection in lung transplantation as detected with recombinant and naturally occurring proteins.

    PubMed Central

    van Zanten, J; Harmsen, M C; van der Giessen, M; van der Bij, W; Prop, J; de Leij, L; The, T H

    1995-01-01

    The humoral immune response to four intracellularly located cytomegalovirus (CMV) proteins was studied in 15 lung transplant recipients experiencing active CMV infections. Five patients had primary infections, and 10 had secondary infections. Antibodies of the immunoglobulin M (IgM) and IgG classes were measured in an enzyme-linked immunosorbent assay (ELISA) system in which procaryotically expressed recombinant proteins were used as a substrate and also in a monoclonal antibody-based capture ELISA which uses naturally occurring proteins as a substrate. The proteins investigated were the lower matrix protein pp65 (ppUL83), the major DNA-binding protein p52 (ppUL44), and the two immediate early proteins IE1 and IE2 (different splicing products of UL123). Higher levels of antibodies were found to pp65 and especially to p52 than to the immediate early antigens. Antibody levels detected in the recombinant protein-based ELISAs were generally lower than antibody responses detected with the matching antigen capture ELISA. Moreover, some patients appeared to have antibodies mainly to epitopes present on naturally occurring proteins. The antibody responses detected in both assays were related to the viral load during infection as assessed by the CMV antigenemia test, which is a quantitative marker for CMV load. It was found that although epitopes on naturally occurring proteins induce higher antibody responses and responses in more patients, antibodies directed to epitopes present on the recombinant proteins were inversely related to the viral load during a CMV infection. Therefore, antibodies to epitopes on the recombinant proteins might be more clinically relevant in this group of lung transplant recipients. PMID:7535179

  13. HCMV Infection of Human Trophoblast Progenitor Cells of the Placenta Is Neutralized by a Human Monoclonal Antibody to Glycoprotein B and Not by Antibodies to the Pentamer Complex

    PubMed Central

    Zydek, Martin; Petitt, Matthew; Fang-Hoover, June; Adler, Barbara; Kauvar, Lawrence M.; Pereira, Lenore; Tabata, Takako

    2014-01-01

    Human cytomegalovirus (HCMV) is the major viral cause of congenital infection and birth defects. Primary maternal infection often results in virus transmission, and symptomatic babies can have permanent neurological deficiencies and deafness. Congenital infection can also lead to intrauterine growth restriction, a defect in placental transport. HCMV replicates in primary cytotrophoblasts (CTBs), the specialized cells of the placenta, and inhibits differentiation/invasion. Human trophoblast progenitor cells (TBPCs) give rise to the mature cell types of the chorionic villi, CTBs and multi-nucleated syncytiotrophoblasts (STBs). Here we report that TBPCs are fully permissive for pathogenic and attenuated HCMV strains. Studies with a mutant virus lacking a functional pentamer complex (gH/gL/pUL128-131A) showed that virion entry into TBPCs is independent of the pentamer. In addition, infection is blocked by a potent human neutralizing monoclonal antibody (mAb), TRL345, reactive with glycoprotein B (gB), but not mAbs to the pentamer proteins pUL130/pUL131A. Functional studies revealed that neutralization of infection preserved the capacity of TBPCs to differentiate and assemble into trophospheres composed of CTBs and STBs in vitro. Our results indicate that mAbs to gB protect trophoblast progenitors of the placenta and could be included in antibody treatments developed to suppress congenital infection and prevent disease. PMID:24651029

  14. Microgravity Analogues of Herpes Virus Pathogenicity: Human Cytomegalovirus (hCMV) and Varicella Zoster (VZV) Infectivity in Human Tissue Like Assemblies (TLAs)

    NASA Technical Reports Server (NTRS)

    Goodwin, T. J.; McCarthy, M.; Albrecht, T.; Cohrs, R.

    2009-01-01

    The old adage we are our own worst enemies may perhaps be the most profound statement ever made when applied to man s desire for extraterrestrial exploration and habitation of Space. Consider the immune system protects the integrity of the entire human physiology and is comprised of two basic elements the adaptive or circulating and the innate immune system. Failure of the components of the adaptive system leads to venerability of the innate system from opportunistic microbes; viral, bacteria, and fungal, which surround us, are transported on our skin, and commonly inhabit the human physiology as normal and imunosuppressed parasites. The fine balance which is maintained for the preponderance of our normal lives, save immune disorders and disease, is deregulated in microgravity. Thus analogue systems to study these potential Risks are essential for our progress in conquering Space exploration and habitation. In this study we employed two known physiological target tissues in which the reactivation of hCMV and VZV occurs, human neural and lung systems created for the study and interaction of these herpes viruses independently and simultaneously on the innate immune system. Normal human neural and lung tissue analogues called tissue like assemblies (TLAs) were infected with low MOIs of approximately 2 x 10(exp -5) pfu hCMV or VZV and established active but prolonged low grade infections which spanned .7-1.5 months in length. These infections were characterized by the ability to continuously produce each of the viruses without expiration of the host cultures. Verification and quantification of viral replication was confirmed via RT_PCR, IHC, and confocal spectral analyses of the respective essential viral genomes. All host TLAs maintained the ability to actively proliferate throughout the entire duration of the experiments as is analogous to normal in vivo physiological conditions. These data represent a significant advance in the ability to study the triggering

  15. Interleukin-2 from Adaptive T Cells Enhances Natural Killer Cell Activity against Human Cytomegalovirus-Infected Macrophages

    PubMed Central

    Wu, Zeguang; Frascaroli, Giada; Bayer, Carina; Schmal, Tatjana

    2015-01-01

    ABSTRACT Control of human cytomegalovirus (HCMV) requires a continuous immune surveillance, thus HCMV is the most important viral pathogen in severely immunocompromised individuals. Both innate and adaptive immunity contribute to the control of HCMV. Here, we report that peripheral blood natural killer cells (PBNKs) from HCMV-seropositive donors showed an enhanced activity toward HCMV-infected autologous macrophages. However, this enhanced response was abolished when purified NK cells were applied as effectors. We demonstrate that this enhanced PBNK activity was dependent on the interleukin-2 (IL-2) secretion of CD4+ T cells when reexposed to the virus. Purified T cells enhanced the activity of purified NK cells in response to HCMV-infected macrophages. This effect could be suppressed by IL-2 blocking. Our findings not only extend the knowledge on the immune surveillance in HCMV—namely, that NK cell-mediated innate immunity can be enhanced by a preexisting T cell antiviral immunity—but also indicate a potential clinical implication for patients at risk for severe HCMV manifestations due to immunosuppressive drugs, which mainly suppress IL-2 production and T cell responsiveness. IMPORTANCE Human cytomegalovirus (HCMV) is never cleared by the host after primary infection but instead establishes a lifelong latent infection with possible reactivations when the host′s immunity becomes suppressed. Both innate immunity and adaptive immunity are important for the control of viral infections. Natural killer (NK) cells are main innate effectors providing a rapid response to virus-infected cells. Virus-specific T cells are the main adaptive effectors that are critical for the control of the latent infection and limitation of reinfection. In this study, we found that IL-2 secreted by adaptive CD4+ T cells after reexposure to HCMV enhances the activity of NK cells in response to HCMV-infected target cells. This is the first direct evidence that the adaptive T cells can

  16. Active human cytomegalovirus infection and glycoprotein b genotypes in brazilian pediatric renal or hematopoietic stem cell transplantation patients.

    PubMed

    de Campos Dieamant, Débora; Bonon, Sandra Helena Alves; Prates, Liliane Cury; Belangelo, Vera Maria Santoro; Pontes, Erika R; Costa, Sandra Cecília Botelho

    2010-01-01

    A prospective analysis of active Human Cytomegalovirus infection (HCMV) was conducted on 33 pediatric renal or hematopoietic stem cell post-transplant patients. The HCMV-DNA positive samples were evaluated for the prevalence of different gB subtypes and their subsequent correlation with clinical signs. The surveillance of HCMV active infection was based on the monitoring of antigenemia (AGM) and on a nested polymerase chain reaction (N-PCR) for the detection of HCMV in the patients studied. Using restriction analysis of the gB gene sequence by PCR-RFLP (Restriction Fragment Length Polymorphism), different HCMV strains could be detected and classified in at least four HCMV genotypes. Thirty-three pediatric recipients of renal or bone marrow transplantation were monitored. Twenty out of thirty-three (60.6%) patients demonstrated active HCMV infection. gB1 and gB2 genotypes were more frequent in this population. In this study, we observed that gB2 had correlation with reactivation of HCMV infection and that patients with mixture of genotypes did not show any symptoms of HCMV disease. Future studies has been made to confirm this. PMID:24031463

  17. HCMV Encoded Glycoprotein M (UL100) Interacts with Rab11 Effector Protein FIP4

    PubMed Central

    Krzyzaniak, Magdalena A.; Mach, Michael; Britt, William J.

    2009-01-01

    The envelope of human cytomegalovirus (HCMV) consists of a large number of glycoproteins. The most abundant glycoprotein in the HCMV envelope is the glycoprotein M (UL100) which together with glycoprotein N (UL73) form the gM/gN protein complex. Using yeast two hybrid screening, we found that the gM carboxy-terminal cytoplasmic tail (gM-CT) interacts with FIP4, a Rab11-GTPase effector protein. Depletion of FIP4 expression in HCMV infected cells resulted in a decrease of infectious virus production that was also associated with an alteration of the HCMV assembly compartment (AC) phenotype. A similar phenotype was also observed in HCMV infected cells that expressed dominant negative Rab11(S25N). Recently, it has been shown that FIP4 interactions with Rab11 and additionally with Arf6/Arf5 are important for the vesicular transport of proteins in the endosomal recycling compartment (ERC) and during cytokinesis. Surprisingly, FIP4 interaction with gM-CT limited binding of FIP4 with Arf5/Arf6, however, FIP4 interaction with gM-CT did not prevent recruitment of Rab11 into the ternary complex. These data argued for a contribution of the ERC during cytoplasmic envelopment of HCMV and revealed a novel FIP4 function independent of Arf5 or Arf6 activity. PMID:19761540

  18. A Viral Pilot for HCMV Navigation?

    PubMed Central

    Adler, Barbara

    2015-01-01

    gH/gL virion envelope glycoprotein complexes of herpesviruses serve as entry complexes and mediate viral cell tropism. By binding additional viral proteins, gH/gL forms multimeric complexes which bind to specific host cell receptors. Both Epstein–Barr virus (EBV) and human cytomegalovirus (HCMV) express alternative multimeric gH/gL complexes. Relative amounts of these alternative complexes in the viral envelope determine which host cells are preferentially infected. Host cells of EBV can modulate the gH/gL complex complement of progeny viruses by cell type-dependent degradation of one of the associating proteins. Host cells of HCMV modulate the tropism of their virus progenies by releasing or not releasing virus populations with a specific gH/gL complex complement out of a heterogeneous pool of virions. The group of Jeremy Kamil has recently shown that the HCMV ER-resident protein UL148 controls integration of one of the HCMV gH/gL complexes into virions and thus creates a pool of virions which can be routed by different host cells. This first mechanistic insight into regulation of the gH/gL complex complement of HCMV progenies presents UL148 as a pilot candidate for HCMV navigation in its infected host. PMID:26184287

  19. PPARγ Is Activated during Congenital Cytomegalovirus Infection and Inhibits Neuronogenesis from Human Neural Stem Cells

    PubMed Central

    Rolland, Maude; Li, Xiaojun; Perez-Berezo, Teresa; Rauwel, Benjamin; Benchoua, Alexandra; Bessières, Bettina; Aziza, Jacqueline; Cenac, Nicolas; Luo, Minhua; Casper, Charlotte; Peschanski, Marc; Gonzalez-Dunia, Daniel; Leruez-Ville, Marianne; Davrinche, Christian; Chavanas, Stéphane

    2016-01-01

    Congenital infection by human cytomegalovirus (HCMV) is a leading cause of permanent sequelae of the central nervous system, including sensorineural deafness, cerebral palsies or devastating neurodevelopmental abnormalities (0.1% of all births). To gain insight on the impact of HCMV on neuronal development, we used both neural stem cells from human embryonic stem cells (NSC) and brain sections from infected fetuses and investigated the outcomes of infection on Peroxisome Proliferator-Activated Receptor gamma (PPARγ), a transcription factor critical in the developing brain. We observed that HCMV infection dramatically impaired the rate of neuronogenesis and strongly increased PPARγ levels and activity. Consistent with these findings, levels of 9-hydroxyoctadecadienoic acid (9-HODE), a known PPARγ agonist, were significantly increased in infected NSCs. Likewise, exposure of uninfected NSCs to 9-HODE recapitulated the effect of infection on PPARγ activity. It also increased the rate of cells expressing the IE antigen in HCMV-infected NSCs. Further, we demonstrated that (1) pharmacological activation of ectopically expressed PPARγ was sufficient to induce impaired neuronogenesis of uninfected NSCs, (2) treatment of uninfected NSCs with 9-HODE impaired NSC differentiation and (3) treatment of HCMV-infected NSCs with the PPARγ inhibitor T0070907 restored a normal rate of differentiation. The role of PPARγ in the disease phenotype was strongly supported by the immunodetection of nuclear PPARγ in brain germinative zones of congenitally infected fetuses (N = 20), but not in control samples. Altogether, our findings reveal a key role for PPARγ in neurogenesis and in the pathophysiology of HCMV congenital infection. They also pave the way to the identification of PPARγ gene targets in the infected brain. PMID:27078877

  20. Alveolar Macrophages Isolated Directly From Human Cytomegalovirus (HCMV)–Seropositive Individuals Are Sites of HCMV Reactivation In Vivo

    PubMed Central

    Poole, Emma; Juss, Jatinder K.; Krishna, Benjamin; Herre, Jurgen; Chilvers, Edwin R.; Sinclair, John

    2015-01-01

    Human cytomegalovirus (HCMV) causes significant morbidity in the immunocompromised host. Following primary infection, the virus establishes latent infection in progenitor cells of the myeloid lineage. These cells exhibit limited viral gene transcription and no evidence of de novo virion production. It is well recognized that differentiation of latently infected myeloid progenitor cells to dendritic or macrophage-like cells permits viral reactivation in vitro. This has been used to support the concept that viral reactivation in HCMV carriers routinely occurs from such terminally differentiated myeloid cells in vivo. However, to date this has not been shown for in vivo–differentiated macrophages. This study is the first to demonstrate that alveolar macrophages from HCMV carriers express immediate early lytic genes and produce infectious virus. This supports the view, until now based on in vitro data, that terminally differentiated myeloid cells in vivo are sites of HCMV reactivation and potential centers of viral dissemination in latently infected individuals with no evidence of virus disease or dissemination. PMID:25552371

  1. Modulation of Radiation-Induced Genetic Damage by HCMV in Peripheral Blood Lymphocytes from a Brain Tumor Case-Control Study

    PubMed Central

    Rourke, Elizabeth A.; Lopez, Mirtha S.; Monroy, Claudia M.; Scheurer, Michael E.; Etzel, Carol J.; Albrecht, Thomas; Bondy, Melissa L.; El-Zein, Randa A.

    2010-01-01

    Human cytomegalovirus (HCMV) infection occurs early in life and viral persistence remains through life. An association between HCMV infection and malignant gliomas has been reported, suggesting that HCMV may play a role in glioma pathogenesis and could facilitate an accrual of genotoxic damage in the presence of γ-radiation; an established risk factor for gliomas. We tested the hypothesis that HCMV infection modifies the sensitivity of cells to γ-radiation-induced genetic damage. We used peripheral blood lymphocytes (PBLs) from 110 glioma patients and 100 controls to measure the level of chromosome damage and cell death. We evaluated baseline, HCMV-, γ-radiation and HCMV + γ-radiation induced genetic instability with the comprehensive Cytokinesis-Blocked Micronucleus Cytome (CBMN-CYT). HCMV, similar to radiation, induced a significant increase in aberration frequency among cases and controls. PBLs infected with HCMV prior to challenge with γ-radiation led to a significant increase in aberrations as compared to baseline, γ-radiation and HCMV alone. With regards to apoptosis, glioma cases showed a lower percentage of induction following in vitro exposure to γ-radiation and HCMV infection as compared to controls. This strongly suggests that, HCMV infection enhances the sensitivity of PBLs to γ-radiation-induced genetic damage possibly through an increase in chromosome damage and decrease in apoptosis. PMID:24281077

  2. IL-12–producing monocytes and HLA-E control HCMV-driven NKG2C+ NK cell expansion

    PubMed Central

    Rölle, Alexander; Pollmann, Julia; Ewen, Eva-Maria; Le, Vu Thuy Khanh; Halenius, Anne; Hengel, Hartmut; Cerwenka, Adelheid

    2014-01-01

    Human cytomegalovirus (HCMV) infection is the most common cause of congenital viral infections and a major source of morbidity and mortality after organ transplantation. NK cells are pivotal effector cells in the innate defense against CMV. Recently, hallmarks of adaptive responses, such as memory-like features, have been recognized in NK cells. HCMV infection elicits the expansion of an NK cell subset carrying an activating receptor heterodimer, comprising CD94 and NKG2C (CD94/NKG2C), a response that resembles the clonal expansion of adaptive immune cells. Here, we determined that expansion of this NKG2C+ subset and general NK cell recovery rely on signals derived from CD14+ monocytes. In a coculture system, a subset of CD14+ cells with inflammatory monocyte features produced IL-12 in response to HCMV-infected fibroblasts, and neutralization of IL-12 in this model substantially reduced CD25 upregulation and NKG2C+ subset expansion. Finally, blockade of CD94/NKG2C on NK cells or silencing of the cognate ligand HLA-E in infected fibroblasts greatly impaired expansion of NKG2C+ NK cells. Together, our results reveal that IL-12, CD14+ cells, and the CD94/NKG2C/HLA-E axis are critical for the expansion of NKG2C+ NK cells in response to HCMV infection. Moreover, strategies targeting the NKG2C+ NK cell subset have the potential to be exploited in NK cell–based intervention strategies against viral infections and cancer. PMID:25384219

  3. Human Cytomegalovirus (HCMV)-Specific CD4+ and CD8+ T Cells Are Both Required for Prevention of HCMV Disease in Seropositive Solid-Organ Transplant Recipients

    PubMed Central

    Gabanti, Elisa; Bruno, Francesca; Lilleri, Daniele; Fornara, Chiara; Zelini, Paola; Cane, Ilaria; Migotto, Clara; Sarchi, Eleonora; Furione, Milena; Gerna, Giuseppe

    2014-01-01

    In solid-organ transplant recipients (SOTR) the protective role of human cytomegalovirus (HCMV)-specific CD4+, CD8+ and γδ T-cells vs. HCMV reactivation requires better definition. The aim of this study was to investigate the relevant role of HCMV-specific CD4+, CD8+ and γδ T-cells in different clinical presentations during the post-transplant period. Thirty-nine SOTR underwent virologic and immunologic follow-up for about 1 year after transplantation. Viral load was determined by real-time PCR, while immunologic monitoring was performed by measuring HCMV-specific CD4+ and CD8+ T cells (following stimulation with autologous HCMV-infected dendritic cells) and γδ T-cells by flow cytometry. Seven patients had no infection and 14 had a controlled infection, while both groups maintained CD4+ T-cell numbers above the established cut-off (0.4 cell/µL blood). Of the remaining patients, 9 controlled the infection temporarily in the presence of HCMV-specific CD8+ only, until CD4+ T-cell appearance; while 9 had to be treated preemptively due to a viral load greater than the established cut-off (3×105 DNA copies/mL blood) in the absence of specific CD4+ T-cells. Polyfunctional CD8+ T-cells as well as Vδ2− γδ T-cells were not associated with control of infection. In conclusion, in the absence of HCMV-specific CD4+ T-cells, no long-term protection is conferred to SOTR by either HCMV-specific CD8+ T-cells alone or Vδ2− γδ T-cell expansion. PMID:25166270

  4. Toll-like receptor 4 is involved in the cell cycle modulation and required for effective human cytomegalovirus infection in THP-1 macrophages

    SciTech Connect

    Arcangeletti, Maria-Cristina; Germini, Diego; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Medici, Maria-Cristina; Gatti, Rita; Chezzi, Carlo; Calderaro, Adriana

    2013-05-25

    Suitable host cell metabolic conditions are fundamental for the effective development of the human cytomegalovirus (HCMV) lytic cycle. Indeed, several studies have demonstrated the ability of this virus to interfere with cell cycle regulation, mainly by blocking proliferating cells in G1 or G1/S. In the present study, we demonstrate that HCMV deregulates the cell cycle of THP-1 macrophages (a cell line irreversibly arrested in G0) by pushing them into S and G2 phases. Moreover, we show that HCMV infection of THP-1 macrophages leads to Toll-like receptor 4 (TLR4) activation. Since various studies have indicated TLR4 to be involved in promoting cell proliferation, here we investigate the possible role of TLR4 in the observed HCMV-induced cell cycle perturbation. Our data strongly support TLR4 as a mediator of HCMV-triggered cell cycle activation in THP-1 macrophages favouring, in turn, the development of an efficient viral lytic cycle. - Highlights: ► We studied HCMV infection impact on THP-1 macrophage cell cycle. ► We analysed the role played by Toll-like receptor (TLR) 4 upon HCMV infection. ► HCMV pushes THP-1 macrophages (i.e. resting cells) to re-enter the cell cycle. ► TLR4 pathway inhibition strongly affects the effectiveness of HCMV replication. ► TLR4 pathway inhibition significantly decreases HCMV-induced cell cycle re-entry.

  5. Molecular Detection of Human Cytomegalovirus (HCMV) Among Infants with Congenital Anomalies in Khartoum State, Sudan

    PubMed Central

    Ebrahim, Maha G.; Ali, Aisha S.; Mustafa, Mohamed O.; Musa, Dalal F.; El Hussein, Abdel Rahim M.; Elkhidir, Isam M.; Enan, Khalid A.

    2015-01-01

    Human Cytomegalovirus (HCMV) infection still represents the most common potentially serious viral complication in humans and is a major cause of congenital anomalies in infants. This study is aimed to detect HCMV in infants with congenital anomalies. Study subjects consisted of infants born with neural tube defect, hydrocephalus and microcephaly. Fifty serum specimens (20 males, 30 females) were collected from different hospitals in Khartoum State. The sera were investigated for cytomegalovirus specific immunoglobin M (IgM) antibodies using enzyme-linked immunosorbent assay (ELISA), and for Cytomegalovirus DNA using polymerase chain reaction (PCR). Out of the 50 sera tested, one patient’s (2%) sample showed HCMV IgM, but with no detectable DNA, other 4(8.2 %) sera were positive for HCMV DNA but with no detectable IgM. Various diagnostic techniques should be considered to evaluate HCMV disease and routine screening for HCMV should be introduced for pregnant women in this setting. It is vital to initiate further research work with many samples from different area to assess prevalence and characterize HCMV and evaluate its maternal health implications. PMID:26862356

  6. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus

    PubMed Central

    Luganini, Anna; Terlizzi, Maria E.; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host’s lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  7. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus.

    PubMed

    Luganini, Anna; Terlizzi, Maria E; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host's lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  8. Human Cytomegalovirus Inhibits the PARsylation Activity of Tankyrase—A Potential Strategy for Suppression of the Wnt Pathway

    PubMed Central

    Roy, Sujayita; Liu, Fengjie; Arav-Boger, Ravit

    2015-01-01

    Human cytomegalovirus (HCMV) was reported to downregulate the Wnt/β-catenin pathway. Induction of Axin1, the negative regulator of the Wnt pathway, has been reported as an important mechanism for inhibition of β-catenin. Since Tankyrase (TNKS) negatively regulates Axin1, we investigated the effect of HCMV on TNKS expression and poly-ADP ribose polymerase (PARsylation) activity, during virus replication. Starting at 24 h post infection, HCMV stabilized the expression of TNKS and reduced its PARsylation activity, resulting in accumulation of Axin1 and reduction in its PARsylation as well. General PARsylation was not changed in HCMV-infected cells, suggesting specific inhibition of TNKS PARsylation. Similarly, treatment with XAV939, a chemical inhibitor of TNKS’ activity, resulted in the accumulation of TNKS in both non-infected and HCMV-infected cell lines. Reduction of TNKS activity or knockdown of TNKS was beneficial for HCMV, evidenced by its improved growth in fibroblasts. Our results suggest that HCMV modulates the activity of TNKS to induce Axin1, resulting in inhibition of the β-catenin pathway. Since HCMV replication is facilitated by TNKS knockdown or inhibition of its activity, TNKS may serve as an important virus target for control of a variety of cellular processes. PMID:26729153

  9. Identification of Proteins in Human Cytomegalovirus (HCMV) Particles: the HCMV Proteome

    SciTech Connect

    Varnum, Susan M.; Streblow, Daniel N.; Monroe, Matthew E.; Smith, Patricia; Auberry, Kenneth J.; Pasa-Tolic, Liljiana; Wang, Dai; Camp, David G.; Rodland, Karin D.; Wiley, H S.; Britt, William; Shenk, Thomas; Smith, Richard D.; Nelson, Jay

    2004-10-15

    Human cytomegalovirus (HCMV), a member of the herpes virus family, is a large complex enveloped virus composed of both viral and cellular gene products. While the sequence of the HCMV genome has been known for over a decade, the full set of viral and cellular proteins that compose the HCMV virion are unknown. To approach this problem we have utilized gel-free two-dimensional capillary liquid chromatography-tandem mass spectrometry (MS/MS) and Fourier transform ion cyclotron resonance MS to identify and determine the relative abundances of viral and cellular proteins in purified HCMV AD169 virions and dense bodies. Analysis of the proteins from purified HCMV virion preparations has indicated that the particle contains significantly more viral proteins than previously known. In this study, we identified 71 HCMV-encoded proteins that included 12 proteins encoded by known viral open reading frames (ORFs) previously not associated with virions and 12 proteins from novel viral ORFs. Analysis of the relative abundance of HCMV proteins indicated that the predominant virion protein was the pp65 tegument protein and that gM rather than gB was the most abundant glycoprotein. We have also identified over 70 host cellular proteins in HCMV virions, which include cellular structural proteins, enzymes, and chaperones. In addition, analysis of HCMV dense bodies indicated that these viral particles are composed of 29 viral proteins with a reduced quantity of cellular proteins in comparison to HCMV virions. This study provides the first comprehensive quantitative analysis of the viral and cellular proteins that compose infectious particles of a large complex virus.

  10. Structure of HCMV glycoprotein B in the postfusion conformation bound to a neutralizing human antibody

    PubMed Central

    Chandramouli, Sumana; Ciferri, Claudio; Nikitin, Pavel A.; Caló, Stefano; Gerrein, Rachel; Balabanis, Kara; Monroe, James; Hebner, Christy; Lilja, Anders E.; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human cytomegalovirus (HCMV) poses a significant threat to immunocompromised individuals and neonates infected in utero. Glycoprotein B (gB), the herpesvirus fusion protein, is a target for neutralizing antibodies and a vaccine candidate due to its indispensable role in infection. Here we show the crystal structure of the HCMV gB ectodomain bound to the Fab fragment of 1G2, a neutralizing human monoclonal antibody isolated from a seropositive subject. The gB/1G2 interaction is dominated by aromatic residues in the 1G2 heavy chain CDR3 protruding into a hydrophobic cleft in the gB antigenic domain 5 (AD-5). Structural analysis and comparison with HSV gB suggest the location of additional neutralizing antibody binding sites on HCMV gB. Finally, immunoprecipitation experiments reveal that 1G2 can bind to HCMV virion gB suggesting that its epitope is exposed and accessible on the virus surface. Our data will support the development of vaccines and therapeutic antibodies against HCMV infection. PMID:26365435

  11. Regulation of CCAAT/enhancer-binding protein (C/EBP) α in human-cytomegalovirus-infected fibroblasts.

    PubMed

    Lee, Junsub; Kim, Sunyoung

    2016-05-01

    CCAAT/enhancer-binding protein (C/EBP) α, a member of the C/EBP family of transcription factors, is known to be involved in gene expression and DNA replication of human cytomegalovirus (HCMV). This study aimed to understand the regulation of endogenous C/EBPα during HCMV infection using an in vitro infection model. The expression and localization of C/EBPα were investigated in fibroblasts infected with HCMV. The overexpression of C/EBP homologous protein (CHOP), the endogenous inhibitor of C/EBP, was also employed to test the involvement of C/EBPα during HCMV infection. Our data showed that HCMV infection increases the expression of the full-length C/EBPα isoform (p42) especially during the late stage of infection at the transcriptional and post-translational levels. The increased p42 accumulated in the viral DNA replication compartment. p42 expression was not induced in cells treated with UV-irradiated virus or in cells infected with normal virus in the presence of ganciclovir. CHOP-mediated inhibition of C/EBP activity suppressed viral gene expression and DNA replication, which lowered the level of viral production. Together, our data suggest that HCMV-mediated C/EBPα regulation might play a beneficial role in the lytic cycle of HCMV. PMID:26831934

  12. Aminobisphosphonates Synergize with Human Cytomegalovirus To Activate the Antiviral Activity of Vγ9Vδ2 Cells.

    PubMed

    Daguzan, Charline; Moulin, Morgane; Kulyk-Barbier, Hanna; Davrinche, Christian; Peyrottes, Suzanne; Champagne, Eric

    2016-03-01

    Human Vγ9Vδ2 T cells are activated through their TCR by neighboring cells producing phosphoantigens. Zoledronate (ZOL) treatment induces intracellular accumulation of the phosphoantigens isopentenyl pyrophosphate and ApppI. Few attempts have been made to use immunomanipulation of Vγ9Vδ2 lymphocytes in chronic viral infections. Although Vγ9Vδ2 T cells seem to ignore human CMV (HCMV)-infected cells, we examined whether they can sense HCMV when a TCR stimulus is provided with ZOL. Fibroblasts treated with ZOL activate Vγ9Vδ2 T cells to produce IFN-γ but not TNF. Following the same treatment, HCMV-infected fibroblasts stimulate TNF secretion and an increased production of IFN-γ, indicating that Vγ9Vδ2 cells can sense HCMV infection. Increased lymphokine production was observed with most clinical isolates and laboratory HCMV strains, HCMV-permissive astrocytoma, or dendritic cells, as well as "naive" and activated Vγ9Vδ2 cells. Quantification of intracellular isopentenyl pyrophosphate/ApppI following ZOL treatment showed that HCMV infection boosts their accumulation. This was explained by an increased capture of ZOL and by upregulation of HMG-CoA synthase and reductase transcription. Using an experimental setting where infected fibroblasts were cocultured with γδ cells in submicromolar concentrations of ZOL, we show that Vγ9Vδ2 cells suppressed substantially the release of infectious particles while preserving uninfected cells. Vγ9Vδ2 cytotoxicity was decreased by HCMV infection of targets whereas anti-IFN-γ and anti-TNF Abs significantly blocked the antiviral effect. Our experiments indicate that cytokines produced by Vγ9Vδ2 T cells have an antiviral potential in HCMV infection. This should lead to in vivo studies to explore the possible antiviral effect of immunostimulation with ZOL in this context. PMID:26819204

  13. Human Cytomegalovirus Promotes Survival of Infected Monocytes via a Distinct Temporal Regulation of Cellular Bcl-2 Family Proteins

    PubMed Central

    Collins-McMillen, Donna; Kim, Jung Heon; Nogalski, Maciej T.; Stevenson, Emily V.; Caskey, Joshua R.; Cieply, Stephen J.

    2015-01-01

    ABSTRACT Monocytes play a key role in the hematogenous dissemination of human cytomegalovirus (HCMV) to target organ systems. To infect monocytes and reprogram them to deliver infectious virus, HCMV must overcome biological obstacles, including the short life span of monocytes and their antiviral proapoptotic response to infection. We have shown that virally induced upregulation of cellular Mcl-1 promotes early survival of HCMV-infected monocytes, allowing cells to overcome an early apoptotic checkpoint at around 48 h postinfection (hpi). Here, we demonstrate an HCMV-dependent shift from Mcl-1 as the primary antiapoptotic player to the related protein, Bcl-2, later during infection. Bcl-2 was upregulated in HCMV-infected monocytes beginning at 48 hpi. Treatment with the Bcl-2 antagonist ABT-199 only reduced the prosurvival effects of HCMV in target monocytes beginning at 48 hpi, suggesting that Mcl-1 controls survival prior to 48 hpi, while Bcl-2 promotes survival after 48 hpi. Although Bcl-2 was upregulated following viral binding/signaling through cellular integrins (compared to Mcl-1, which is upregulated through binding/activation of epidermal growth factor receptor [EGFR]), it functioned similarly to Mcl-1, adopting the early role of Mcl-1 in preventing caspase-3 cleavage/activation. This distinct, HCMV-induced shift from Mcl-1 to Bcl-2 occurs in response to a cellular upregulation of proapoptotic Bax, as small interfering RNA (siRNA)-mediated knockdown of Bax reduced the upregulation of Bcl-2 in infected monocytes and rescued the cells from the apoptotic effects of Bcl-2 inhibition. Our data demonstrate a distinct survival strategy whereby HCMV induces a biphasic regulation of cellular Bcl-2 proteins to promote host cell survival, leading to viral dissemination and the establishment of persistent HCMV infection. IMPORTANCE Hematogenous dissemination of HCMV via infected monocytes is a crucial component of the viral survival strategy and is required for the

  14. In vivo expression of human cytomegalovirus (HCMV) microRNAs during latency.

    PubMed

    Meshesha, Mesfin K; Bentwich, Zvi; Solomon, Semaria A; Avni, Yonat Shemer

    2016-01-01

    Viral encoded microRNAs play key roles in regulating gene expression and the life cycle of human herpes viruses. Latency is one of the hallmarks of the human cytomegalovirus (HCMV or HHV5) life cycle, and its control may have immense practical applications. The present study aims to identify HCMV encoded microRNAs during the latency phase of the virus. We used a highly sensitive real time PCR (RTPCR) assay that involves a pre-amplification step before RTPCR. It can detect HCMV encoded microRNAs (miRNAs) during latency in purified monocytes and PBMCs from HCMV IgG positive donors and in latently infected monocytic THP-1 cell lines. During the latency phase, only eight HCMV encoded microRNAs were detected in PBMCs, monocytes and in the THP-1 cells. Five originated from the UL region of the virus genome and three from the US region. Reactivation of the virus from latency, in monocytes obtained from the same donor, using dexamethasone restored the expression of all known HCMV encoded miRNAs including those that were absent during latency. We observed a shift in the abundance of the two arms of mir-US29 between the productive and latency stages of the viral life cycle, suggesting that the star "passenger" form of this microRNA is preferentially expressed during latency. As a whole, our study demonstrates that HCMV expresses during the latency phase, both in vivo and in vitro, only a subset of its microRNAs, which may indicate that they play an important role in maintenance and reactivation of latency. PMID:26302752

  15. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  16. Characterization of the HCMV-Specific CD4 T Cell Responses that Are Associated with Protective Immunity.

    PubMed

    Wunsch, Marie; Zhang, Wenji; Hanson, Jodi; Caspell, Richard; Karulin, Alexey Y; Recks, Mascha S; Kuerten, Stefanie; Sundararaman, Srividya; Lehmann, Paul V

    2015-08-01

    Most humans become infected with human cytomegalovirus (HCMV). Typically, the immune system controls the infection, but the virus persists and can reactivate in states of immunodeficiency. While substantial information is available on the contribution of CD8 T cells and antibodies to anti-HCMV immunity, studies of the TH1, TH2, and TH17 subsets have been limited by the low frequency of HCMV-specific CD4 T cells in peripheral blood mononuclear cell (PBMC). Using the enzyme-linked Immunospotr assay (ELISPOT) that excels in low frequency measurements, we have established these in a sizable cohort of healthy HCMV controllers. Cytokine recall responses were seen in all seropositive donors. Specifically, interferon (IFN)- and/or interleukin (IL)-17 were seen in isolation or with IL-4 in all test subjects. IL-4 recall did not occur in isolation. While the ratios of TH1, TH2, and TH17 cells exhibited substantial variations between different individuals these ratios and the frequencies were relatively stable when tested in samples drawn up to five years apart. IFN- and IL-2 co-expressing polyfunctional cells were seen in most subjects. Around half of the HCMV-specific CD4 cells were in a reversible state of exhaustion. The data provided here established the TH1, TH2, and TH17 characteristic of the CD4 cells that convey immune protection for successful immune surveillance against which reactivity can be compared when the immune surveillance of HCMV fails. PMID:26258786

  17. Activation of Nucleotide Oligomerization Domain 2 (NOD2) by Human Cytomegalovirus Initiates Innate Immune Responses and Restricts Virus Replication

    PubMed Central

    Kapoor, Arun; Forman, Michael; Arav-Boger, Ravit

    2014-01-01

    Nucleotide-binding oligomerization domain 2 (NOD2) is an important innate immune sensor of bacterial pathogens. Its induction results in activation of the classic NF-κB pathway and alternative pathways including type I IFN and autophagy. Although the importance of NOD2 in recognizing RNA viruses has recently been identified, its role in sensing DNA viruses has not been studied. We report that infection with human cytomegalovirus (HCMV) results in significant induction of NOD2 expression, beginning as early as 2 hours post infection and increasing steadily 24 hours post infection and afterwards. Infection with human herpesvirus 1 and 2 does not induce NOD2 expression. While the HCMV-encoded glycoprotein B is not required for NOD2 induction, a replication competent virion is necessary. Lentivirus-based NOD2 knockdown in human foreskin fibroblasts (HFFs) and U373 glioma cells leads to enhanced HCMV replication along with decreased levels of interferon beta (IFN-β) and the pro-inflammatory cytokine, IL8. NOD2 induction in HCMV-infected cells activates downstream NF-κB and interferon pathways supported by reduced nuclear localization of NF-κB and pIRF3 in NOD2 knockdown HFFs. Stable overexpression of NOD2 in HFFs restricts HCMV replication in association with increased levels of IFN-β and IL8. Similarly, transient overexpression of NOD2 in U373 cells or its downstream kinase, RIPK2, results in decreased HCMV replication and enhanced cytokine responses. However, overexpression of a mutant NOD2, 3020insC, associated with severe Crohn's disease, results in enhanced HCMV replication and decreased levels of IFN-β in U373 cells. These results show for the first time that NOD2 plays a significant role in HCMV replication and may provide a model for studies of HCMV recognition by the host cell and HCMV colitis in Crohn's disease. PMID:24671169

  18. Plasma membrane profiling defines an expanded class of cell surface proteins selectively targeted for degradation by HCMV US2 in cooperation with UL141.

    PubMed

    Hsu, Jye-Lin; van den Boomen, Dick J H; Tomasec, Peter; Weekes, Michael P; Antrobus, Robin; Stanton, Richard J; Ruckova, Eva; Sugrue, Daniel; Wilkie, Gavin S; Davison, Andrew J; Wilkinson, Gavin W G; Lehner, Paul J

    2015-04-01

    Human cytomegalovirus (HCMV) US2, US3, US6 and US11 act in concert to prevent immune recognition of virally infected cells by CD8+ T-lymphocytes through downregulation of MHC class I molecules (MHC-I). Here we show that US2 function goes far beyond MHC-I degradation. A systematic proteomic study using Plasma Membrane Profiling revealed US2 was unique in downregulating additional cellular targets, including: five distinct integrin α-chains, CD112, the interleukin-12 receptor, PTPRJ and thrombomodulin. US2 recruited the cellular E3 ligase TRC8 to direct the proteasomal degradation of all its targets, reminiscent of its degradation of MHC-I. Whereas integrin α-chains were selectively degraded, their integrin β1 binding partner accumulated in the ER. Consequently integrin signaling, cell adhesion and migration were strongly suppressed. US2 was necessary and sufficient for degradation of the majority of its substrates, but remarkably, the HCMV NK cell evasion function UL141 requisitioned US2 to enhance downregulation of the NK cell ligand CD112. UL141 retained CD112 in the ER from where US2 promoted its TRC8-dependent retrotranslocation and degradation. These findings redefine US2 as a multifunctional degradation hub which, through recruitment of the cellular E3 ligase TRC8, modulates diverse immune pathways involved in antigen presentation, NK cell activation, migration and coagulation; and highlight US2's impact on HCMV pathogenesis. PMID:25875600

  19. Plasma Membrane Profiling Defines an Expanded Class of Cell Surface Proteins Selectively Targeted for Degradation by HCMV US2 in Cooperation with UL141

    PubMed Central

    Antrobus, Robin; Stanton, Richard J.; Ruckova, Eva; Sugrue, Daniel; Wilkie, Gavin S.; Davison, Andrew J.; Wilkinson, Gavin W. G.; Lehner, Paul J.

    2015-01-01

    Human cytomegalovirus (HCMV) US2, US3, US6 and US11 act in concert to prevent immune recognition of virally infected cells by CD8+ T-lymphocytes through downregulation of MHC class I molecules (MHC-I). Here we show that US2 function goes far beyond MHC-I degradation. A systematic proteomic study using Plasma Membrane Profiling revealed US2 was unique in downregulating additional cellular targets, including: five distinct integrin α-chains, CD112, the interleukin-12 receptor, PTPRJ and thrombomodulin. US2 recruited the cellular E3 ligase TRC8 to direct the proteasomal degradation of all its targets, reminiscent of its degradation of MHC-I. Whereas integrin α-chains were selectively degraded, their integrin β1 binding partner accumulated in the ER. Consequently integrin signaling, cell adhesion and migration were strongly suppressed. US2 was necessary and sufficient for degradation of the majority of its substrates, but remarkably, the HCMV NK cell evasion function UL141 requisitioned US2 to enhance downregulation of the NK cell ligand CD112. UL141 retained CD112 in the ER from where US2 promoted its TRC8-dependent retrotranslocation and degradation. These findings redefine US2 as a multifunctional degradation hub which, through recruitment of the cellular E3 ligase TRC8, modulates diverse immune pathways involved in antigen presentation, NK cell activation, migration and coagulation; and highlight US2’s impact on HCMV pathogenesis. PMID:25875600

  20. THY-1 Cell Surface Antigen (CD90) Has an Important Role in the Initial Stage of Human Cytomegalovirus Infection.

    PubMed

    Li, Qingxue; Wilkie, Adrian R; Weller, Melodie; Liu, Xueqiao; Cohen, Jeffrey I

    2015-07-01

    Human cytomegalovirus (HCMV) infects about 50% of the US population, is the leading infectious cause of birth defects, and is considered the most important infectious agent in transplant recipients. The virus infects many cell types in vivo and in vitro. While previous studies have identified several cellular proteins that may function at early steps of infection in a cell type dependent manner, the mechanism of virus entry is still poorly understood. Using a computational biology approach, correlating gene expression with virus infectivity in 54 cell lines, we identified THY-1 as a putative host determinant for HCMV infection in these cells. With a series of loss-of-function, gain-of-function and protein-protein interaction analyses, we found that THY-1 mediates HCMV infection at the entry step and is important for infection that occurs at a low m.o.i. THY-1 antibody that bound to the cell surface blocked HCMV during the initial 60 minutes of infection in a dose-dependent manner. Down-regulation of THY-1 with siRNA impaired infectivity occurred during the initial 60 minutes of inoculation. Both THY-1 antibody and siRNA inhibited HCMV-induced activation of the PI3-K/Akt pathway required for entry. Soluble THY-1 protein blocked HCMV infection during, but not after, virus internalization. Expression of exogenous THY-1 enhanced entry in cells expressing low levels of the protein. THY-1 interacted with HCMV gB and gH and may form a complex important for entry. However, since gB and gH have previously been shown to interact, it is uncertain if THY-1 directly binds to both of these proteins. Prior observations that THY-1 (a) interacts with αVβ3 integrin and recruits paxillin (implicated in HCMV entry), (b) regulates leukocyte extravasation (critical for HCMV viremia), and (c) is expressed on many cells targeted for HCMV infection including epithelial and endothelial cells, fibroblast, and CD34+/CD38- stem cells, all support a role for THY-1 as an HCMV entry mediator in

  1. THY-1 Cell Surface Antigen (CD90) Has an Important Role in the Initial Stage of Human Cytomegalovirus Infection

    PubMed Central

    Li, Qingxue; Wilkie, Adrian R.; Weller, Melodie; Liu, Xueqiao; Cohen, Jeffrey I.

    2015-01-01

    Human cytomegalovirus (HCMV) infects about 50% of the US population, is the leading infectious cause of birth defects, and is considered the most important infectious agent in transplant recipients. The virus infects many cell types in vivo and in vitro. While previous studies have identified several cellular proteins that may function at early steps of infection in a cell type dependent manner, the mechanism of virus entry is still poorly understood. Using a computational biology approach, correlating gene expression with virus infectivity in 54 cell lines, we identified THY-1 as a putative host determinant for HCMV infection in these cells. With a series of loss-of-function, gain-of-function and protein-protein interaction analyses, we found that THY-1 mediates HCMV infection at the entry step and is important for infection that occurs at a low m.o.i. THY-1 antibody that bound to the cell surface blocked HCMV during the initial 60 minutes of infection in a dose-dependent manner. Down-regulation of THY-1 with siRNA impaired infectivity occurred during the initial 60 minutes of inoculation. Both THY-1 antibody and siRNA inhibited HCMV-induced activation of the PI3-K/Akt pathway required for entry. Soluble THY-1 protein blocked HCMV infection during, but not after, virus internalization. Expression of exogenous THY-1 enhanced entry in cells expressing low levels of the protein. THY-1 interacted with HCMV gB and gH and may form a complex important for entry. However, since gB and gH have previously been shown to interact, it is uncertain if THY-1 directly binds to both of these proteins. Prior observations that THY-1 (a) interacts with αVβ3 integrin and recruits paxillin (implicated in HCMV entry), (b) regulates leukocyte extravasation (critical for HCMV viremia), and (c) is expressed on many cells targeted for HCMV infection including epithelial and endothelial cells, fibroblast, and CD34+/CD38- stem cells, all support a role for THY-1 as an HCMV entry mediator in

  2. A High-Affinity Native Human Antibody Neutralizes Human Cytomegalovirus Infection of Diverse Cell Types

    PubMed Central

    Liu, Keyi; Park, Minha; DeChene, Neal; Stephenson, Robert; Tenorio, Edgar; Ellsworth, Stote L.; Tabata, Takako; Petitt, Matthew; Tsuge, Mitsuru; Fang-Hoover, June; Adler, Stuart P.; Cui, Xiaohong; McVoy, Michael A.; Pereira, Lenore

    2014-01-01

    Human cytomegalovirus (HCMV) is the most common infection causing poor outcomes among transplant recipients. Maternal infection and transplacental transmission are major causes of permanent birth defects. Although no active vaccines to prevent HCMV infection have been approved, passive immunization with HCMV-specific immunoglobulin has shown promise in the treatment of both transplant and congenital indications. Antibodies targeting the viral glycoprotein B (gB) surface protein are known to neutralize HCMV infectivity, with high-affinity binding being a desirable trait, both to compete with low-affinity antibodies that promote the transmission of virus across the placenta and to displace nonneutralizing antibodies binding nearby epitopes. Using a miniaturized screening technology to characterize secreted IgG from single human B lymphocytes, 30 antibodies directed against gB were previously cloned. The most potent clone, TRL345, is described here. Its measured affinity was 1 pM for the highly conserved site I of the AD-2 epitope of gB. Strain-independent neutralization was confirmed for 15 primary HCMV clinical isolates. TRL345 prevented HCMV infection of placental fibroblasts, smooth muscle cells, endothelial cells, and epithelial cells, and it inhibited postinfection HCMV spread in epithelial cells. The potential utility for preventing congenital transmission is supported by the blockage of HCMV infection of placental cell types central to virus transmission to the fetus, including differentiating cytotrophoblasts, trophoblast progenitor cells, and placental fibroblasts. Further, TRL345 was effective at controlling an ex vivo infection of human placental anchoring villi. TRL345 has been utilized on a commercial scale and is a candidate for clinical evaluation. PMID:25534746

  3. Activating KIRs and NKG2C in Viral Infections: Toward NK Cell Memory?

    PubMed Central

    Della Chiesa, Mariella; Sivori, Simona; Carlomagno, Simona; Moretta, Lorenzo; Moretta, Alessandro

    2015-01-01

    Natural killer (NK) cells are important players in the immune defense against viral infections. The contribution of activating killer immunoglobulin-like receptors (KIRs) and CD94/NKG2C in regulating anti-viral responses has recently emerged. Thus, in the hematopoietic stem cell transplantation setting, the presence of donor activating KIRs (aKIRs) may protect against viral infections, while in HIV-infected individuals, KIR3DS1, in combination with HLA-Bw4-I80, results in reduction of viral progression. Since, studies have been performed mainly at the genetic or transcriptional level, the effective size, the function, and the “licensing” status of NK cells expressing aKIRs, as well as the nature of their viral ligands, require further investigation. Certain viral infections, mainly due to Human cytomegalovirus (HCMV), can deeply influence the NK cell development and function by inducing a marked expansion of mature NKG2C+ NK cells expressing self-activating KIRs. This suggests that NKG2C and/or aKIRs are involved in the selective proliferation of this subset. The persistent, HCMV-induced, imprinting suggests that NK cells may display unexpected adaptive immune traits. The role of aKIRs and NKG2C in regulating NK cell responses and promoting a memory-like response to certain viruses is discussed. PMID:26617607

  4. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection.

    PubMed

    Goodier, Martin R; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M; Darboe, Alansana; Moldoveanu, Ana L; White, Matthew J; Behrens, Ron; Riley, Eleanor M

    2016-07-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2-dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV(-)) individuals than in HCMV-seropositive (HCMV(+)) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV(+) and HCMV(-) subjects. In addition to these IL-2-dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57(-) NK cells and was most evident in HCMV(+) subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  5. An animal model of human cytomegalovirus infection.

    PubMed

    Gao, L; Qian, S; Zeng, L; Wang, R; Wei, G; Fan, J; Zheng, S

    2007-12-01

    To develop a rat model that allowed in vivo progressive human cytomegalovirus (HCMV) infection, allogeneic liver transplantation was performed across a rat combination of Dark Agouti (DA) to Brown Norway (BN). AD169, a well-characterized laboratory strain of HCMV, was used to establish a rat model of HCMV infection by injection of 0.4 mL (30.0 logTCID50) supernate into the rat peritoneum. Histological and blood specimens were obtained from animals sacrificed at predetermined timepoints. We performed immunohistochemical staining in liver, heart, kidney, spleen, and lung for HCMV immediate-early antigen (IE), lower matrix protein (pp65) detection in peripheral blood leukocytes, and HCMV early antigen (EA) and late antigen (LA). We compared survival rates. Our results showed positive HCMV IE and pp65 antigenemia detected in peripheral blood leukocytes in transplanted recipients from day 1 to day 30. Positive HCMV EA and LA staining cells were only detected in sections 10 days after liver transplantation, namely, in hepatocytes, mononuclear cells, bile duct epithelial cells, and endothelial cells. Successful HCMV replication was due to the combination of liver transplantation and cyclosporine (CsA) immunosuppression. Survival analysis showed no significant differences between the HCMV-infected group and HCMV-uninfected group. This new rat model of HCMV infection may be helpful to understand immune system modulation of HCMV infection. PMID:18089401

  6. Trehalose, an mTOR-Independent Inducer of Autophagy, Inhibits Human Cytomegalovirus Infection in Multiple Cell Types

    PubMed Central

    Belzile, Jean-Philippe; Sabalza, Maite; Craig, Megan; Clark, Elizabeth; Morello, Christopher S.

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is the major viral cause of birth defects and a serious problem in immunocompromised individuals and has been associated with atherosclerosis. Previous studies have shown that the induction of autophagy can inhibit the replication of several different types of DNA and RNA viruses. The goal of the work presented here was to determine whether constitutive activation of autophagy would also block replication of HCMV. Most prior studies have used agents that induce autophagy via inhibition of the mTOR pathway. However, since HCMV infection alters the sensitivity of mTOR kinase-containing complexes to inhibitors, we sought an alternative method of inducing autophagy. We chose to use trehalose, a nontoxic naturally occurring disaccharide that is found in plants, insects, microorganisms, and invertebrates but not in mammals and that induces autophagy by an mTOR-independent mechanism. Given the many different cell targets of HCMV, we proceeded to determine whether trehalose would inhibit HCMV infection in human fibroblasts, aortic artery endothelial cells, and neural cells derived from human embryonic stem cells. We found that in all of these cell types, trehalose induces autophagy and inhibits HCMV gene expression and production of cell-free virus. Treatment of HCMV-infected neural cells with trehalose also inhibited production of cell-associated virus and partially blocked the reduction in neurite growth and cytomegaly. These results suggest that activation of autophagy by the natural sugar trehalose or other safe mTOR-independent agents might provide a novel therapeutic approach for treating HCMV disease. IMPORTANCE HCMV infects multiple cell types in vivo, establishes lifelong persistence in the host, and can cause serious health problems for fetuses and immunocompromised individuals. HCMV, like all other persistent pathogens, has to finely tune its interplay with the host cellular machinery to replicate efficiently and evade

  7. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

    2016-01-01

    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  8. Cross-presentation of HCMV chimeric protein enables generation and measurement of polyclonal T cells.

    PubMed

    Nguyen, Thi H O; Sullivan, Lucy C; Kotsimbos, Tom C; Schwarer, Anthony P; Mifsud, Nicole A

    2010-08-01

    CD8(+) T cell immunity has a critical function in controlling human cytomegalovirus (HCMV) infection. In immunocompromized individuals, HCMV reactivation or disease can lead to increased morbidity and mortality, particularly in transplant recipients. In this setting, adoptive transfer of HCMV-specific CD8(+) T cells is a promising vaccine strategy to restore viral immunity, with most clinical approaches focussing on the use of peptides for the generation of single epitope-specific CD8(+) T cells. We show that using an IE1-pp65 chimeric protein as the antigen source promotes effective cross-presentation, by monocyte-derived dendritic cells (MoDCs), to generate polyclonal CD8(+) T cell epitopes. By exploring human leukocyte antigen (HLA)-restricted immunodominance hierarchies both within and across two immunodominant proteins, we show that HLA-B7 epitopes elicit higher CD8(+) T cell responses compared with HLA-A1, -A2 or -B8. This study provides important evidence highlighting both the efficacy of the IE1-pp65 chimeric protein and the importance of immunodominance in designing future therapeutic vaccines. PMID:20195281

  9. Vaccine-Derived Neutralizing Antibodies to the Human Cytomegalovirus gH/gL Pentamer Potently Block Primary Cytotrophoblast Infection

    PubMed Central

    Chiuppesi, Flavia; Wussow, Felix; Johnson, Erica; Bian, Chao; Zhuo, Meng; Rajakumar, Augustine; Barry, Peter A.; Britt, William J.; Chakraborty, Rana

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) elicits neutralizing antibodies (NAb) of various potencies and cell type specificities to prevent HCMV entry into fibroblasts (FB) and epithelial/endothelial cells (EpC/EnC). NAb targeting the major essential envelope glycoprotein complexes gB and gH/gL inhibit both FB and EpC/EnC entry. In contrast to FB infection, HCMV entry into EpC/EnC is additionally blocked by extremely potent NAb to conformational epitopes of the gH/gL/UL128/130/131A pentamer complex (PC). We recently developed a vaccine concept based on coexpression of all five PC subunits by a single modified vaccinia virus Ankara (MVA) vector, termed MVA-PC. Vaccination of mice and rhesus macaques with MVA-PC resulted in a high titer and sustained NAb that blocked EpC/EnC infection and lower-titer NAb that inhibited FB entry. However, antibody function responsible for the neutralizing activity induced by the MVA-PC vaccine is uncharacterized. Here, we demonstrate that MVA-PC elicits NAb with cell type-specific neutralization potency and antigen recognition pattern similar to human NAb targeting conformational and linear epitopes of the UL128/130/131A subunits or gH. In addition, we show that the vaccine-derived PC-specific NAb are significantly more potent than the anti-gH NAb to prevent HCMV spread in EpC and infection of human placental cytotrophoblasts, cell types thought to be of critical importance for HCMV transmission to the fetus. These findings further validate MVA-PC as a clinical vaccine candidate to elicit NAb that resembles those induced during HCMV infection and provide valuable insights into the potency of PC-specific NAb to interfere with HCMV cell-associated spread and infection of key placental cells. IMPORTANCE As a consequence of the leading role of human cytomegalovirus (HCMV) in causing permanent birth defects, developing a vaccine against HCMV has been assigned a major public health priority. We have recently introduced a vaccine strategy based

  10. The 6-Aminoquinolone WC5 Inhibits Human Cytomegalovirus Replication at an Early Stage by Interfering with the Transactivating Activity of Viral Immediate-Early 2 Protein ▿ †

    PubMed Central

    Loregian, Arianna; Mercorelli, Beatrice; Muratore, Giulia; Sinigalia, Elisa; Pagni, Silvana; Massari, Serena; Gribaudo, Giorgio; Gatto, Barbara; Palumbo, Manlio; Tabarrini, Oriana; Cecchetti, Violetta; Palù, Giorgio

    2010-01-01

    WC5 is a 6-aminoquinolone that potently inhibits the replication of human cytomegalovirus (HCMV) but has no activity, or significantly less activity, against other herpesviruses. Here we investigated the nature of its specific anti-HCMV activity. Structure-activity relationship studies on a small series of analogues showed that WC5 possesses the most suitable pattern of substitutions around the quinolone scaffold to give potent and selective anti-HCMV activity. Studies performed to identify the possible target of WC5 indicated that it prevents viral DNA synthesis but does not significantly affect DNA polymerase activity. In yield reduction experiments with different multiplicities of infection, the anti-HCMV activity of WC5 appeared to be highly dependent on the viral inoculum, suggesting that WC5 may act at an initial stage of virus replication. Consistently, time-of-addition and time-of-removal studies demonstrated that WC5 affects a phase of the HCMV replicative cycle that precedes viral DNA synthesis. Experiments to monitor the effects of the compound on virus attachment and entry showed that it does not inhibit either process. Evaluation of viral mRNA and protein expression revealed that WC5 targets an event of the HCMV replicative cycle that follows the transcription and translation of immediate-early genes and precedes those of early and late genes. In cell-based assays to test the effects of WC5 on the transactivating activity of the HCMV immediate-early 2 (IE2) protein, WC5 markedly interfered with IE2-mediated transactivation of viral early promoters. Finally, WC5 combined with ganciclovir in checkerboard experiments exhibited highly synergistic activity. These findings suggest that WC5 deserves further investigation as a candidate anti-HCMV drug with a novel mechanism of action. PMID:20194695

  11. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  12. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection

    PubMed Central

    Goodier, Martin R.; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M.; Darboe, Alansana; Moldoveanu, Ana L.; White, Matthew J.; Behrens, Ron

    2016-01-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2–dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV−) individuals than in HCMV-seropositive (HCMV+) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV+ and HCMV− subjects. In addition to these IL-2–dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57− NK cells and was most evident in HCMV+ subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  13. 3D Analysis of HCMV Induced-Nuclear Membrane Structures by FIB/SEM Tomography: Insight into an Unprecedented Membrane Morphology

    PubMed Central

    Villinger, Clarissa; Neusser, Gregor; Kranz, Christine; Walther, Paul; Mertens, Thomas

    2015-01-01

    We show that focused ion beam/scanning electron microscopy (FIB/SEM) tomography is an excellent method to analyze the three-dimensional structure of a fibroblast nucleus infected with human cytomegalovirus (HCMV). We found that the previously described infoldings of the inner nuclear membrane, which are unique among its kind, form an extremely complex network of membrane structures not predictable by previous two-dimensional studies. In all cases they contained further invaginations (2nd and 3rd order infoldings). Quantification revealed 5498 HCMV capsids within two nuclear segments, allowing an estimate of 15,000 to 30,000 capsids in the entire nucleus five days post infection. Only 0.8% proved to be enveloped capsids which were exclusively detected in 1st order infoldings (perinuclear space). Distribution of the capsids between 1st, 2nd and 3rd order infoldings is in complete agreement with the envelopment/de-envelopment model for egress of HCMV capsids from the nucleus and we confirm that capsid budding does occur at the large infoldings. Based on our results we propose the pushing membrane model: HCMV infection induces local disruption of the nuclear lamina and synthesis of new membrane material which is pushed into the nucleoplasm, forming complex membrane infoldings in a highly abundant manner, which then may be also used by nucleocapsids for budding. PMID:26556360

  14. 3D Analysis of HCMV Induced-Nuclear Membrane Structures by FIB/SEM Tomography: Insight into an Unprecedented Membrane Morphology.

    PubMed

    Villinger, Clarissa; Neusser, Gregor; Kranz, Christine; Walther, Paul; Mertens, Thomas

    2015-11-01

    We show that focused ion beam/scanning electron microscopy (FIB/SEM) tomography is an excellent method to analyze the three-dimensional structure of a fibroblast nucleus infected with human cytomegalovirus (HCMV). We found that the previously described infoldings of the inner nuclear membrane, which are unique among its kind, form an extremely complex network of membrane structures not predictable by previous two-dimensional studies. In all cases they contained further invaginations (2nd and 3rd order infoldings). Quantification revealed 5498HCMV capsids within two nuclear segments, allowing an estimate of 15,000 to 30,000 capsids in the entire nucleus five days post infection. Only 0.8% proved to be enveloped capsids which were exclusively detected in 1st order infoldings (perinuclear space). Distribution of the capsids between 1st, 2nd and 3rd order infoldings is in complete agreement with the envelopment/de-envelopment model for egress of HCMV capsids from the nucleus and we confirm that capsid budding does occur at the large infoldings. Based on our results we propose the pushing membrane model: HCMV infection induces local disruption of the nuclear lamina and synthesis of new membrane material which is pushed into the nucleoplasm, forming complex membrane infoldings in a highly abundant manner, which then may be also used by nucleocapsids for budding. PMID:26556360

  15. Structural and biochemical studies of HCMV gH/gL/gO and Pentamer reveal mutually exclusive cell entry complexes

    PubMed Central

    Ciferri, Claudio; Chandramouli, Sumana; Donnarumma, Danilo; Nikitin, Pavel A.; Cianfrocco, Michael A.; Gerrein, Rachel; Feire, Adam L.; Barnett, Susan W.; Lilja, Anders E.; Rappuoli, Rino; Norais, Nathalie; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and the leading viral cause of birth defects after congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are key targets of the human humoral response against HCMV and are required for HCMV entry into fibroblasts and endothelial/epithelial cells, respectively. We expressed and characterized soluble forms of gH/gL, gH/gL/gO, and Pentamer. Mass spectrometry and mutagenesis analysis revealed that gL-Cys144 forms disulfide bonds with gO-Cys351 in gH/gL/gO and with UL128-Cys162 in the Pentamer. Notably, Pentamer harboring the UL128-Cys162Ser/gL-Cys144Ser mutations had impaired syncytia formation and reduced interference of HCMV entry into epithelial cells. Electron microscopy analysis showed that HCMV gH/gL resembles HSV gH/gL and that gO and UL128/UL130/UL131A bind to the same site at the gH/gL N terminus. These data are consistent with gH/gL/gO and Pentamer forming mutually exclusive cell entry complexes and reveal the overall location of gH/gL-, gH/gL/gO-, and Pentamer-specific neutralizing antibody binding sites. Our results provide, to our knowledge, the first structural view of gH/gL/gO and Pentamer supporting the development of vaccines and antibody therapeutics against HCMV. PMID:25624487

  16. Absence of human cytomegalovirus infection in childhood brain tumors.

    PubMed

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients' neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  17. Absence of human cytomegalovirus infection in childhood brain tumors

    PubMed Central

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients’ neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  18. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  19. HCMV vCXCL1 Binds Several Chemokine Receptors and Preferentially Attracts Neutrophils over NK Cells by Interacting with CXCR2.

    PubMed

    Yamin, Rachel; Lecker, Laura S M; Weisblum, Yiska; Vitenshtein, Alon; Le-Trilling, Vu Thuy Khanh; Wolf, Dana G; Mandelboim, Ofer

    2016-05-17

    HCMV is a highly sophisticated virus that has developed various mechanisms for immune evasion and viral dissemination throughout the body (partially mediated by neutrophils). NK cells play an important role in elimination of HCMV-infected cells. Both neutrophils and NK cells utilize similar sets of chemokine receptors to traffic, to and from, various organs. However, the mechanisms by which HCMV attracts neutrophils and not NK cells are largely unknown. Here, we show a unique viral protein, vCXCL1, which targets three chemokine receptors: CXCR1 and CXCR2 expressed on neutrophils and CXCR1 and CX3CR1 expressed on NK cells. Although vCXCL1 attracted both cell types, neutrophils migrated faster and more efficiently than NK cells through the binding of CXCR2. Therefore, we propose that HCMV has developed vCXCL1 to orchestrate its rapid systemic dissemination through preferential attraction of neutrophils and uses alternative mechanisms to counteract the later attraction of NK cells. PMID:27160907

  20. Activity of trifluorothymidine against cytomegalovirus.

    PubMed Central

    Wingard, J R; Stuart, R K; Saral, R; Burns, W H

    1981-01-01

    Trifluorothymidine (TFT) was tested for antiviral activity against mouse cytomegalovirus (MCMV) and human cytomegalovirus (HCMV) in one-step replication assays. The TFT concentration required to reduce virus yield by 50% (ID50) was 0.22 microM for MCMV and 0.012 microM for HCMV. The antiviral activity of TFT against MCMV was reversed by addition of equimolar thymidine, and no antiviral activity was demonstrable in a host cell line lacking thymidine kinase. Thus, TFT's anti-MCMV activity is dependent on a host cell TK since this herpesvirus lacks thymidine kinase. A continuous subcutaneous infusion of TFT achieving a serum concentration of 1 microM failed to protect mice from lethal MCMV infection, perhaps because serum levels of thymidine were comparable to the drug level. Comparison of the ID50 against HCMV and the ID50 against human bone marrow progenitor cells resulted in an in vitro therapeutic ratio of 108, suggesting that TFT might offer some promise as a clinically useful anti-HCMV agent. PMID:6272627

  1. Antigenic Characterization of the HCMV gH/gL/gO and Pentamer Cell Entry Complexes Reveals Binding Sites for Potently Neutralizing Human Antibodies

    PubMed Central

    Ciferri, Claudio; Chandramouli, Sumana; Leitner, Alexander; Donnarumma, Danilo; Cianfrocco, Michael A.; Gerrein, Rachel; Friedrich, Kristian; Aggarwal, Yukti; Palladino, Giuseppe; Aebersold, Ruedi; Norais, Nathalie; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human Cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and in fetuses following congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are required for HCMV entry in fibroblasts and endothelial/epithelial cells, respectively, and are targeted by potently neutralizing antibodies in the infected host. Using purified soluble forms of gH/gL/gO and Pentamer as well as a panel of naturally elicited human monoclonal antibodies, we determined the location of key neutralizing epitopes on the gH/gL/gO and Pentamer surfaces. Mass Spectrometry (MS) coupled to Chemical Crosslinking or to Hydrogen Deuterium Exchange was used to define residues that are either in proximity or part of neutralizing epitopes on the glycoprotein complexes. We also determined the molecular architecture of the gH/gL/gO- and Pentamer-antibody complexes by Electron Microscopy (EM) and 3D reconstructions. The EM analysis revealed that the Pentamer specific neutralizing antibodies bind to two opposite surfaces of the complex, suggesting that they may neutralize infection by different mechanisms. Together, our data identify the location of neutralizing antibodies binding sites on the gH/gL/gO and Pentamer complexes and provide a framework for the development of antibodies and vaccines against HCMV. PMID:26485028

  2. Human cytomegalovirus and Epstein-Barr virus infection in inflammatory bowel disease: Need for mucosal viral load measurement

    PubMed Central

    Ciccocioppo, Rachele; Racca, Francesca; Paolucci, Stefania; Campanini, Giulia; Pozzi, Lodovica; Betti, Elena; Riboni, Roberta; Vanoli, Alessandro; Baldanti, Fausto; Corazza, Gino Roberto

    2015-01-01

    AIM: To evaluate the best diagnostic technique and risk factors of the human Cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) infection in inflammatory bowel disease (IBD). METHODS: A cohort of 40 IBD patients (17 refractory) and 40 controls underwent peripheral blood and endoscopic colonic mucosal sample harvest. Viral infection was assessed by quantitative real-time polymerase chain reaction and immunohistochemistry, and correlations with clinical and endoscopic indexes of activity, and risk factors were investigated. RESULTS: All refractory patients carried detectable levels of HCMV and/or EBV mucosal load as compared to 13/23 (56.5%) non-refractory and 13/40 (32.5%) controls. The median DNA value was significantly higher in refractory (HCMV 286 and EBV 5.440 copies/105 cells) than in non-refractory (HCMV 0 and EBV 6 copies/105 cells; P < 0.05 and < 0.001) IBD patients and controls (HCMV and EBV 0 copies/105 cells; P < 0.001 for both). Refractory patients showed DNA peak values ≥ 103 copies/105 cells in diseased mucosa in comparison to non-diseased mucosa (P < 0.0121 for HCMV and < 0.0004 for EBV), while non-refractory patients and controls invariably displayed levels below this threshold, thus allowing us to differentiate viral colitis from mucosal infection. Moreover, the mucosal load positively correlated with the values found in the peripheral blood, whilst no correlation with the number of positive cells at immunohistochemistry was found. Steroid use was identified as a significant risk factor for both HCMV (P = 0.018) and EBV (P = 0.002) colitis. Finally, a course of specific antiviral therapy with ganciclovir was successful in all refractory patients with HCMV colitis, whilst refractory patients with EBV colitis did not show any improvement despite steroid tapering and discontinuation of the other medications. CONCLUSION: Viral colitis appeared to contribute to mucosal lesions in refractory IBD, and its correct diagnosis and management require

  3. Poly(A) binding protein abundance regulates eukaryotic translation initiation factor 4F assembly in human cytomegalovirus-infected cells.

    PubMed

    McKinney, Caleb; Perez, Cesar; Mohr, Ian

    2012-04-10

    By commandeering cellular translation initiation factors, or destroying those dispensable for viral mRNA translation, viruses often suppress host protein synthesis. In contrast, cellular protein synthesis proceeds in human cytomegalovirus (HCMV)-infected cells, forcing viral and cellular mRNAs to compete for limiting translation initiation factors. Curiously, inactivating the host translational repressor 4E-BP1 in HCMV-infected cells stimulates synthesis of the cellular poly(A) binding protein (PABP), significantly increasing PABP abundance. Here, we establish that new PABP synthesis is translationally controlled by the HCMV-encoded UL38 mammalian target of rapamycin complex 1-activator. The 5' UTR within the mRNA encoding PABP contains a terminal oligopyrimidine (TOP) element found in mRNAs, the translation of which is stimulated in response to mitogenic, growth, and nutritional stimuli, and proteins encoded by TOP-containing mRNAs accumulated in HCMV-infected cells. Furthermore, UL38 expression was necessary and sufficient to regulate expression of a PABP TOP-containing reporter. Remarkably, preventing the rise in PABP abundance by RNAi impaired eIF4E binding to eIF4G, thereby reducing assembly of the multisubunit initiation factor eIF4F, viral protein production, and replication. This finding demonstrates that viruses can increase host translation initiation factor concentration to foster their replication and defines a unique mechanism whereby control of PABP abundance regulates eIF4F assembly. PMID:22431630

  4. Strategies to control human cytomegalovirus infection in adult hematopoietic stem cell transplant recipients.

    PubMed

    Lilleri, Daniele; Gerna, Giuseppe

    2016-09-01

    Human cytomegalovirus (HCMV) represents the major viral complication after hematopoietic stem cell transplantation. HCMV infection may be controlled by the reconstituting immune system and remain subclinical or can lead to severe systemic and/or organ disease (mainly pneumonia and gastroenteritis) when immune reconstitution is delayed or impaired. In order to prevent the occurrence of HCMV disease, a prompt diagnosis of HCMV infection is mandatory. The adoption of pre-emptive therapy strategies guided by virological monitoring dramatically reduced the occurrence of HCMV disease. However, late-onset end-organ disease may occur in some patients with apparent immune reconstitution. In the near future, introduction of immunological monitoring and immunotherapies could markedly improve management of HCMV infection. PMID:27485084

  5. Acute Cytomegalovirus Infection as a Cause of Venous Thromboembolism

    PubMed Central

    Rinaldi, Francesca; Lissandrin, Raffaella; Mojoli, Francesco; Baldanti, Fausto; Brunetti, Enrico; Pascarella, Michela; Giordani, Maria Teresa

    2014-01-01

    Acute Human Cytomegalovirus (HCMV) infection is an unusual cause of venous thromboembolism, a potentially life-threatening condition. Thrombus formation can occur at the onset of the disease or later during the recovery and may also occur in the absence of acute HCMV hepatitis. It is likely due to both vascular endothelium damage caused by HCMV and impairment of the clotting balance caused by the virus itself. Here we report on two immunocompetent women with splanchnic thrombosis that occurred during the course of acute HCMV infection. Although the prevalence of venous thrombosis in patients with acute HCMV infection is unknown, physicians should be aware of its occurrence, particularly in immunocompetent patients presenting with fever and unexplained abdominal pain. PMID:24959338

  6. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    SciTech Connect

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A. . E-mail: lfort@uidaho.edu

    2006-04-25

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection.

  7. The switch from latent to productive infection in epstein-barr virus-infected B cells is associated with sensitization to NK cell killing.

    PubMed

    Pappworth, Isabel Y; Wang, Eddie C; Rowe, Martin

    2007-01-01

    Following activation of Epstein-Barr virus (EBV)-infected B cells from latent to productive (lytic) infection, there is a concomitant reduction in the level of cell surface major histocompatibility complex (MHC) class I molecules and an impaired antigen-presenting function that may facilitate evasion from EBV-specific CD8+ cytotoxic T cells. In some other herpesviruses studied, most notably human cytomegalovirus (HCMV), evasion of virus-specific CD8+ effector responses via downregulation of surface MHC class I molecules is supplemented with specific mechanisms for evading NK cells. We now report that EBV differs from HCMV in this respect. While latently infected EBV-positive B cells were resistant to lysis by two NK lines and by primary polyclonal NK cells from peripheral blood, these effectors efficiently killed cells activated into the lytic cycle. Susceptibility to NK lysis coincided not only with downregulation of HLA-A, -B, and -C molecules that bind to the KIR family of inhibitory receptors on NK cells but also with downregulation of HLA-E molecules binding the CD94/NKG2A inhibitory receptors. Conversely, ULBP-1 and CD112, ligands for the NK cell-activating receptors NKG2D and DNAM-1, respectively, were elevated. Susceptibility of the virus-producing target cells to NK cell lysis was partially reversed by blocking ULBP-1 or CD112 with specific antibodies. These results highlight a fundamental difference between EBV and HCMV with regards to evasion of innate immunity. PMID:17079298

  8. Chromatin structure regulates human cytomegalovirus gene expression during latency, reactivation and lytic infection.

    PubMed

    Sinclair, John

    2010-01-01

    Infection of cells with human cytomegalovirus (HCMV) has two potential outcomes. For instance, infection of fibroblasts results in extensive viral gene expression, viral DNA replication and release of progeny virus. In contrast, in undifferentiated myeloid cells, the lytic transcription programme of HCMV is effectively suppressed and cells undergo latent infection. It is now accepted that the suppression of viral lytic gene expression observed during latency in myeloid cells is a result of the inability of undifferentiated cell types to support robust viral immediate early (IE) gene expression--crucial genes responsible for driving the lytic cycle. The repression of IE gene expression in undifferentiated myeloid cells, at least in part, results from specific post-translational modifications of histones associated with the viral major immediate early promoter (MIEP). In cells of the early myeloid lineage, the histone modifications present on the MIEP impart on it a repressive chromatin structure preventing transcriptional activity. Reactivation of HCMV lytic infection is correlated to changes in histone modifications around the MIEP resulting in a chromatin structure conducive to transcriptional activity. These changes are intimately linked with the differentiation of myeloid cells - a phenomenon known to reactivate latent virus in vivo. Chromatin structure of the viral MIEP, therefore, plays a crucial role in latency and reactivation of this persistent human herpesvirus. Whether chromatin-mediated regulation of viral lytic gene expression also occurs, is only beginning to be addressed. However, recent work suggests that all classes of lytic HCMV promoters are subjected to regulation by post-translational modification of their associated histones throughout the time course of infection. Incoming viral genomes appear to be the targets of intrinsic cellular defence mechanisms which attempt to silence viral gene expression through chromatinisation. Viral functions

  9. Peptide inhibition of human cytomegalovirus infection

    PubMed Central

    2011-01-01

    Background Human cytomegalovirus (HCMV) is the most prevalent congenital viral infection in the United States and Europe causing significant morbidity and mortality to both mother and child. HCMV is also an opportunistic pathogen in immunocompromised individuals, including human immunodeficiency virus (HIV)- infected patients with AIDS, and solid organ and allogeneic stem cell transplantation recipients. Current treatments for HCMV-associated diseases are insufficient due to the emergence of drug-induced resistance and cytotoxicity, necessitating novel approaches to limit HCMV infection. The aim of this study was to develop therapeutic peptides targeting glycoprotein B (gB), a major glycoprotein of HCMV that is highly conserved across the Herpesviridae family, that specifically inhibit fusion of the viral envelope with the host cell membrane preventing HCMV entry and infection. Results Using the Wimley-White Interfacial Hydrophobicity Scale (WWIHS), several regions within gB were identified that display a high potential to interact with lipid bilayers of cell membranes and hydrophobic surfaces within proteins. The ability of synthetic peptides analogous to WWIHS-positive sequences of HCMV gB to inhibit viral infectivity was evaluated. Human foreskin fibroblasts (HFF) were infected with the Towne-GFP strain of HCMV (0.5 MOI), preincubated with peptides at a range of concentrations (78 nm to 100 μM), and GFP-positive cells were visualized 48 hours post-infection by fluorescence microscopy and analyzed quantitatively by flow cytometry. Peptides that inhibited HCMV infection demonstrated different inhibitory concentration curves indicating that each peptide possesses distinct biophysical properties. Peptide 174-200 showed 80% inhibition of viral infection at a concentration of 100 μM, and 51% and 62% inhibition at concentrations of 5 μM and 2.5 μM, respectively. Peptide 233-263 inhibited infection by 97% and 92% at concentrations of 100 μM and 50 μM, respectively

  10. Cytomegalovirus Infection Drives Adaptive Epigenetic Diversification of NK Cells with Altered Signaling and Effector Function

    PubMed Central

    Schlums, Heinrich; Cichocki, Frank; Tesi, Bianca; Theorell, Jakob; Beziat, Vivien; Holmes, Tim D.; Han, Hongya; Chiang, Samuel C.C.; Foley, Bree; Mattsson, Kristin; Larsson, Stella; Schaffer, Marie; Malmberg, Karl-Johan; Ljunggren, Hans-Gustaf; Miller, Jeffrey S.; Bryceson, Yenan T.

    2015-01-01

    SUMMARY The mechanisms underlying human natural killer (NK) cell phenotypic and functional heterogeneity are unknown. Here, we describe the emergence of diverse subsets of human NK cells selectively lacking expression of signaling proteins after human cytomegalovirus (HCMV) infection. The absence of B and myeloid cell-related signaling protein expression in these NK cell subsets correlated with promoter DNA hyperme-thylation. Genome-wide DNA methylation patterns were strikingly similar between HCMV-associated adaptive NK cells and cytotoxic effector T cells but differed from those of canonical NK cells. Functional interrogation demonstrated altered cytokine responsiveness in adaptive NK cells that was linked to reduced expression of the transcription factor PLZF. Furthermore, subsets of adaptive NK cells demonstrated significantly reduced functional responses to activated autologous T cells. The present results uncover a spectrum of epigenetically unique adaptive NK cell subsets that diversify in response to viral infection and have distinct functional capabilities compared to canonical NK cell subsets. PMID:25786176

  11. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells.

    PubMed

    Krishna, B A; Lau, B; Jackson, S E; Wills, M R; Sinclair, J H; Poole, E

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  12. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells

    PubMed Central

    Krishna, B. A.; Lau, B.; Jackson, S. E.; Wills, M. R.; Sinclair, J. H.; Poole, E.

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  13. Human cytomegalovirus gene expression in long-term infected glioma stem cells.

    PubMed

    Fiallos, Estefania; Judkins, Jonathon; Matlaf, Lisa; Prichard, Mark; Dittmer, Dirk; Cobbs, Charles; Soroceanu, Liliana

    2014-01-01

    The most common adult primary brain tumor, glioblastoma (GBM), is characterized by fifteen months median patient survival and has no clear etiology. We and others have identified the presence of human cytomegalovirus (HCMV) gene products endogenously expressed in GBM tissue and primary cells, with a subset of viral genes being consistently expressed in most samples. Among these viral genes, several have important oncomodulatory properties, regulating tumor stemness, proliferation, immune evasion, invasion and angiogenesis. These findings lead us to hypothesize that a specific HCMV gene signature may be associated with GBM pathogenesis. To investigate this hypothesis, we used glioma cell lines and primary glioma stem-like cells (GSC) infected with clinical and laboratory HCMV strains and measured relative viral gene expression levels along several time points up to 15 weeks post-infection. While HCMV gene expression was detected in several infected glioma lines through week 5 post-infection, only HCMV-infected GSC expressed viral gene products 15 weeks post-infection. Efficiency of infection across time was higher in GSC compared to cell lines. Importantly, HCMV-infected GSC outlived their uninfected counterparts, and this extended survival was paralleled by increased tumorsphere frequency and upregulation of stemness regulators, such as SOX2, p-STAT3, and BMX (a novel HCMV target identified in this study). Interleukin 6 (IL-6) treatment significantly upregulated HCMV gene expression in long-term infected glioma cultures, suggesting that pro-inflammatory signaling in the tumor milieu may further augment HCMV gene expression and subsequent tumor progression driven by viral-induced cellular signaling. Together, our data support a critical role for long-term, low-level HCMV infection in promoting survival, stemness, and proliferation of GSC that could significantly contribute to GBM pathogenesis. PMID:25549333

  14. Metabolism of Cyclopropavir and Ganciclovir in Human Cytomegalovirus-Infected Cells

    PubMed Central

    Drach, John C.

    2014-01-01

    Human cytomegalovirus (HCMV) is a widespread pathogen that can cause severe disease in immunologically immature and immunocompromised patients. The current standard of therapy for the treatment of HCMV infections is ganciclovir (GCV). However, high incidence rates of adverse effects are prevalent and limit the use of this drug. Cyclopropavir (CPV) is 10-fold more effective against HCMV in vitro than GCV (50% effective concentrations [EC50s] = 0.46 and 4.1 μM, respectively) without any observed increase in cytotoxicity (S. Zhou, J. M. Breitenbach, K. Z. Borysko, J. C. Drach, E. R. Kern, E. Gullen, Y. C. Cheng, and J. Zemlicka, J. Med. Chem. 47:566–575, 2004, doi:10.1021/jm030316s). We have previously determined that the viral protein kinase pUL97 and endogenous cellular kinases are responsible for the conversion of CPV to a triphosphate (TP), the active compound responsible for inhibiting viral DNA synthesis and viral replication. However, this conversion has not been observed in HCMV-infected cells. To that end, we subjected HCMV-infected cells to equivalently effective concentrations (∼5 times the EC50) of either CPV or GCV and observed a time-dependent increase in triphosphate levels for both compounds (CPV-TP = 121 ± 11 pmol/106 cells; GCV-TP = 43.7 ± 0.4 pmol/106 cells). A longer half-life was observed for GCV-TP (48.2 ± 5.7 h) than for CPV-TP (23.8 ± 5.1 h). The area under the curve for CPV-TP produced from incubation with 2.5 μM CPV was 8,680 ± 930 pmol · h/106 cells, approximately 2-fold greater than the area under the curve for GCV-TP of 4,520 ± 420 pmol · h/106 cells produced from incubation with 25 μM GCV. We therefore conclude that the exposure of HCMV-infected cells to CPV-TP is greater than that of GCV-TP under these experimental conditions. PMID:24514084

  15. Bone-marrow-derived mesenchymal stem cells as a target for cytomegalovirus infection: Implications for hematopoiesis, self-renewal and differentiation potential

    SciTech Connect

    Smirnov, Sergey V.; Harbacheuski, Ryhor; Lewis-Antes, Anita; Zhu Hua; Rameshwar, Pranela; Kotenko, Sergei V. . E-mail: kotenkse@umdnj.edu

    2007-03-30

    Mesenchymal stem cells (MSCs) in bone marrow (BM) regulate the differentiation and proliferation of adjacent hematopoietic precursor cells and contribute to the regeneration of mesenchymal tissues, including bone, cartilage, fat and connective tissue. BM is an important site for the pathogenesis of human cytomegalovirus (HCMV) where the virus establishes latency in hematopoietic progenitors and can transmit after reactivation to neighboring cells. Here we demonstrate that BM-MSCs are permissive to productive HCMV infection, and that HCMV alters the function of MSCs: (i) by changing the repertoire of cell surface molecules in BM-MSCs, HCMV modifies the pattern of interaction between BM-MSCs and hematopoietic cells; (ii) HCMV infection of BM-MSCs undergoing adipogenic or osteogenic differentiation impaired the process of differentiation. Our results suggest that by altering BM-MSC biology, HCMV may contribute to the development of various diseases.

  16. Phased activity in Heterorhabditis megidis infective juveniles.

    PubMed

    Dempsey, C M; Griffin, C T

    2002-06-01

    The infectivity of Heterorhabditis megidis infective juveniles (IJs) increases during storage in water. We investigated whether this change can be related to other features of the IJs' behaviour. IJs were stored in water for 4 weeks at 20 degrees C, and the following parameters were assessed at intervals: infectivity for Galleria mellonella, dispersal in sand, host-finding on agar, and the percentage of IJs active in water. In addition, the behaviour of the IJs in water was described using 7 categories. Immediately after emerging from the host cadaver, IJs were highly active (99% of IJs in water were active and 65% displayed 'waving', the normal method of forward movement). Maximum responsiveness to host volatiles in an agar plate assay was recorded on day 2 (69% of IJs moved from the point of application and 44% of all IJs in the agar arena moved towards a host) and maximum dispersal in sand (5.8 cm) on day 0. These tendencies declined gradually with age, while infectivity underwent a significant increase from 11 nematodes per insect on day 0 to 38 nematodes per insect on day 9. Three phases could be distinguished in the behaviour of H. megidis IJs: an initial dispersal phase, during which infectivity was low; an infective phase, during which dispersal tendency was declining, and a third phase during which all behaviours (dispersal, infectivity and activity) were declining. Over the 4-week storage period, infectivity of H. megidis IJs was correlated (R2 = 0.83) with the percentage time IJs engaged in 'head thrusting' (a behaviour that resembles penetration). There is no evidence that the observed increase in infectivity of H. megidis strain UK211 could be accounted for by a generally greater level of motor activity, nor by an increase in responsiveness to volatile host cues, and it is suggested that it is due to an increased tendency to attempt penetration. PMID:12118716

  17. EBV, HCMV, HHV6, and HHV7 Screening in Bone Marrow Samples from Children with Acute Lymphoblastic Leukemia

    PubMed Central

    Morales-Sánchez, A.; Pompa-Mera, E. N.; Fajardo-Gutiérrez, A.; Alvarez-Rodríguez, F. J.; Bekker-Méndez, V. C.; Flores-Chapa, J. de Diego; Flores-Lujano, J.; Jiménez-Hernández, E.; Peñaloza-González, J. G.; Rodríguez-Zepeda, M. C.; Torres-Nava, J. R.; Velázquez-Aviña, M. M.; Amador-Sánchez, R.; Alvarado-Ibarra, M.; Reyes-Zepeda, N.; Espinosa-Elizondo, R. M.; Pérez-Saldivar, M. L.; Núñez-Enríquez, J. C.; Mejía-Aranguré, J. M.; Fuentes-Pananá, E. M.

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer in childhood worldwide and Mexico has reported one of the highest incidence rates. An infectious etiology has been suggested and supported by epidemiological evidences; however, the identity of the involved agent(s) is not known. We considered that early transmitted lymphotropic herpes viruses were good candidates, since transforming mechanisms have been described for them and some are already associated with human cancers. In this study we interrogated the direct role of EBV, HCMV, HHV6, and HHV7 human herpes viruses in childhood ALL. Viral genomes were screened in 70 bone marrow samples from ALL patients through standard and a more sensitive nested PCR. Positive samples were detected only by nested PCR indicating a low level of infection. Our result argues that viral genomes were not present in all leukemic cells, and, hence, infection most likely was not part of the initial genetic lesions leading to ALL. The high statistical power of the study suggested that these agents are not involved in the genesis of ALL in Mexican children. Additional analysis showed that detected infections or coinfections were not associated with prognosis. PMID:25309913

  18. Impaired lymphoid chemokine-mediated migration due to a block on the chemokine receptor switch in human cytomegalovirus-infected dendritic cells.

    PubMed

    Moutaftsi, Magdalena; Brennan, Paul; Spector, Stephen A; Tabi, Zsuzsanna

    2004-03-01

    Dendritic cell (DC) migration from the site of infection to the site of T-cell priming is a crucial event in the generation of antiviral T-cell responses. Here we present to our knowledge the first functional evidence that human cytomegalovirus (HCMV) blocks the migration of infected monocyte-derived DCs toward lymphoid chemokines CCL19 and CCL21. DC migration is blocked by viral impairment of the chemokine receptor switch at the level of the expression of CCR7 molecules. The inhibition occurs with immediate-early-early kinetics, and viral interference with NF-kappaB signaling is likely to be at least partially responsible for the lack of CCR7 expression. DCs which migrate from the infected cultures are HCMV antigen negative, and consequently they do not stimulate HCMV-specific CD8(+) T cells, while CD4(+)-T-cell activation is not impaired. Although CD8(+) T cells can also be activated by alternative antigen presentation mechanisms, the spatial segregation of naive T cells and infected DCs seems a potent mechanism of delaying the generation of primary CD8(+)-T-cell responses and aiding early viral spread. PMID:14990723

  19. Impaired Lymphoid Chemokine-Mediated Migration due to a Block on the Chemokine Receptor Switch in Human Cytomegalovirus-Infected Dendritic Cells

    PubMed Central

    Moutaftsi, Magdalena; Brennan, Paul; Spector, Stephen A.; Tabi, Zsuzsanna

    2004-01-01

    Dendritic cell (DC) migration from the site of infection to the site of T-cell priming is a crucial event in the generation of antiviral T-cell responses. Here we present to our knowledge the first functional evidence that human cytomegalovirus (HCMV) blocks the migration of infected monocyte-derived DCs toward lymphoid chemokines CCL19 and CCL21. DC migration is blocked by viral impairment of the chemokine receptor switch at the level of the expression of CCR7 molecules. The inhibition occurs with immediate-early-early kinetics, and viral interference with NF-κB signaling is likely to be at least partially responsible for the lack of CCR7 expression. DCs which migrate from the infected cultures are HCMV antigen negative, and consequently they do not stimulate HCMV-specific CD8+ T cells, while CD4+-T-cell activation is not impaired. Although CD8+ T cells can also be activated by alternative antigen presentation mechanisms, the spatial segregation of naive T cells and infected DCs seems a potent mechanism of delaying the generation of primary CD8+-T-cell responses and aiding early viral spread. PMID:14990723

  20. IL-12 and type I IFN response of neonatal myeloid DC to human CMV infection.

    PubMed

    Renneson, Joelle; Dutta, Binita; Goriely, Stanislas; Danis, Bénédicte; Lecomte, Sandra; Laes, Jean-François; Tabi, Zsuzsanna; Goldman, Michel; Marchant, Arnaud

    2009-10-01

    Following congenital human CMV (HCMV) infection, 15-20% of infected newborns develop severe health problems whereas infection in immunocompetent adults rarely causes illness. The immaturity of neonatal antigen presenting cells could play a pivotal role in this susceptibility. Neonatal myeloid DC were shown to be deficient in IFN-beta and IL-12 synthesis in response to TLR triggering. We studied the response of cord and adult blood-derived myeloid DC to HCMV infection. Neonatal and adult DC were equally susceptible to in vitro HCMV infection. Among immunomodulatory cytokines, IL-12, IFN-beta and IFN-lambda1 were produced at lower levels by neonatal as compared with adult DC. In contrast, neonatal and adult DC produced similar levels of IFN-alpha and IFN-inducible genes. Microarray analysis indicated that among the more than thousand genes up- or down-regulated by HCMV infection of myeloid DC, 88 were differently regulated between adult and neonatal DC. We conclude that neonatal and adult DC trigger a partly different response to HCMV infection. The deficient IL-12 and mature IFN-alpha production by neonatal DC exposed to HCMV are likely to influence the quality of the T lymphocyte response to HCMV infection in early life. PMID:19637227

  1. A novel flow cytometry-based tool for determining the efficiency of human cytomegalovirus infection in THP-1 derived macrophages.

    PubMed

    Li, Huifen; Mao, Genxiang; Carlson, Joshua; Leng, Sean X

    2015-09-01

    Human cytomegalovirus (hCMV) is a ubiquitous pathogen that causes congenital infection and severe infections in immunocompromised patients. Chronic hCMV infection may also play an important role in immunosenescence and adverse health outcomes in older adults. THP-1, a human monocytic cell line and its derived macrophages serve as a useful cell culture model for mechanistic studies of hCMV infection and its underlying biology. A major methodological challenge is the lack of a quick and reliable tool to accurately determine the efficiency of hCMV infection in THP-1 derived macrophages. In this study, we developed a flow cytometry based method using commercially available monoclonal antibody (MAb) against hCMV immediate early (IE) antigen that can accurately determine infection efficiency. We used 0.5% formaldehyde for fixation, 90% methanol for permeabilization, and incubation with FITC conjugated MAb at 37°C. The method was tested by hCMV infection with laboratory Towne strain in the presence or absence of hydrocortisone. It was also compared with the routine flow cytometry protocol using Cytofix/Cytoperm solution and with immunofluorescence. The results indicate that this new method is reliable and time saving for accurate determination of infection efficiency. It may facilitate further investigations into the underlying biological mechanisms of hCMV infection. PMID:25958130

  2. Cis and Trans Acting Factors Involved in Human Cytomegalovirus Experimental and Natural Latent Infection of CD14 (+) Monocytes and CD34 (+) Cells

    PubMed Central

    Pari, Gregory S.

    2013-01-01

    The parameters involved in human cytomegalovirus (HCMV) latent infection in CD14 (+) and CD34 (+) cells remain poorly identified. Using next generation sequencing we deduced the transcriptome of HCMV latently infected CD14 (+) and CD34 (+) cells in experimental as well as natural latency settings. The gene expression profile from natural infection in HCMV seropositive donors closely matched experimental latency models, and included two long non-coding RNAs (lncRNAs), RNA4.9 and RNA2.7 as well as the mRNAs encoding replication factors UL84 and UL44. Chromatin immunoprecipitation assays on experimentally infected CD14 (+) monocytes followed by next generation sequencing (ChIP-Seq) were employed to demonstrate both UL84 and UL44 proteins interacted with the latent viral genome and overlapped at 5 of the 8 loci identified. RNA4.9 interacts with components of the polycomb repression complex (PRC) as well as with the MIE promoter region where the enrichment of the repressive H3K27me3 mark suggests that this lncRNA represses transcription. Formaldehyde Assisted Isolation of Regulatory Elements (FAIRE), which identifies nucleosome-depleted viral DNA, was used to confirm that latent mRNAs were associated with actively transcribed, FAIRE analysis also showed that the terminal repeat (TR) region of the latent viral genome is depleted of nucleosomes suggesting that this region may contain an element mediating viral genome maintenance. ChIP assays show that the viral TR region interacts with factors associated with the pre replication complex and a plasmid subclone containing the HCMV TR element persisted in latently infected CD14 (+) monocytes, strongly suggesting that the TR region mediates viral chromosome maintenance. PMID:23717203

  3. The Cationic Cytokine IL-26 Differentially Modulates Virus Infection in Culture

    PubMed Central

    Braum, Oliver; Klages, Michael; Fickenscher, Helmut

    2013-01-01

    Interleukin-26 (IL-26) belongs to the IL-10 cytokine family, is produced by activated T cells, and targets epithelial target cells for signal transduction. Here, we describe the IL-26 effects on the infection of culture cells with recombinant vesicular stomatitis virus (VSV), human cytomegalovirus (HCMV), and herpes simplex virus type 1 (HSV-1) expressing green fluorescent protein. After pre-incubation with recombinant IL-26 and at low multiplicity of infection, VSV showed strongly enhanced infection and replication rates as measured for infectivity, for transcript levels, and for protein expression. Control proteins did not affect VSV infection. The IL-26 effect was independent of the IL-26 receptor and neutralized by anti-IL-26 serum. Pre-incubation of VSV was much more efficient than pre-incubation of the target cells to enhance virus infection. IL-26 increased virus adsorption to target cells as shown by quantitative reverse-transcription PCR. In contrast, the infection of IL-26-treated human fibroblasts with HCMV was inhibited and the infection by HSV-1 was not altered by IL-26. Thus, IL-26 differentially modulates the infection by different enveloped viruses. PMID:23875025

  4. The life cycle and pathogenesis of human cytomegalovirus infection: lessons from proteomics

    PubMed Central

    Beltran, Pierre M. Jean; Cristea, Ileana M.

    2015-01-01

    Viruses have co-evolved with their hosts, acquiring strategies to subvert host cellular pathways for effective viral replication and spread. Human cytomegalovirus (HCMV), a widely-spread β-herpesvirus, is a major cause of birth defects and opportunistic infections in HIV-1/AIDS patients. HCMV displays an intricate system-wide modulation of the human cell proteome. An impressive array of virus–host protein interactions occurs throughout the infection. To investigate the virus life cycle, proteomics has recently become a significant component of virology studies. Here, we review the mass spectrometry-based proteomics approaches used in HCMV studies, as well as their contribution to understanding the HCMV life cycle and the virus-induced changes to host cells. The importance of the biological insights gained from these studies clearly demonstrate the impact that proteomics has had and can continue to have on understanding HCMV biology and identifying new therapeutic targets. PMID:25327590

  5. Guinea pig cytomegalovirus GP84 is a functional homolog of the human cytomegalovirus (HCMV) UL84 gene that can complement for the loss of UL84 in a chimeric HCMV.

    PubMed

    McGregor, A; Choi, K Y; Schleiss, M R

    2011-02-01

    The guinea pig cytomegalovirus (GPCMV) co-linear gene and potential functional homolog of HCMV UL84 (GP84) was investigated. The GP84 gene had delayed early transcription kinetics and transient expression studies of GP84 protein (pGP84) demonstrated that it targeted the nucleus and co-localized with the viral DNA polymerase accessory protein as described for HCMV pUL84. Additionally, pGP84 exhibited a transdominant inhibitory effect on viral growth as described for HCMV. The inhibitory domain could be localized to a minimal peptide sequence of 99 aa. Knockout of GP84 generated virus with greatly impaired growth kinetics. Lastly, the GP84 ORF was capable of complementing for the loss of the UL84 coding sequence in a chimeric HCMV. Based on this research and previous studies we conclude that GPCMV is similar to HCMV by encoding single copy co-linear functional homologs of HCMV UL82 (pp71), UL83 (pp65) and UL84 genes. PMID:21094510

  6. Impact of persistent cytomegalovirus infection on human neuroblastoma cell gene expression.

    PubMed

    Hoever, Gerold; Vogel, Jens-Uwe; Lukashenko, Polina; Hofmann, Wolf-Karsten; Komor, Martina; Doerr, Hans Wilhelm; Cinatl, Jindrich

    2005-01-14

    In a model of human neuroblastoma (NB) cell lines persistently infected with human cytomegalovirus (HCMV) we previously showed that persistent HCMV infection is associated with an increased malignant phenotype, enhanced drug resistance, and invasive properties. To gain insights into the mechanisms of increased malignancy we analyzed the global changes in cellular gene expression induced by persistent HCMV infection of human neuroblastoma cells by use of high-density oligonucleotide microarrays (HG-U133A, Affymetrix) and RT-PCR. Comparing the gene expression of different NB cell lines with persistently infected cell sub-lines revealed 11 host cell genes regulated in a similar manner throughout all infected samples. Nine of these 11 genes may contribute to the previously observed changes in malignant phenotype of persistently HCMV infected NB cells by influencing invasive growth, apoptosis, angiogenesis, and proliferation. Thus, this work provides the basis for further functional studies. PMID:15582591

  7. VCL-CB01, an injectable bivalent plasmid DNA vaccine for potential protection against CMV disease and infection

    PubMed Central

    Schleiss, Mark R

    2010-01-01

    Vaccines for the prevention of human CMV (hCMV) infection and disease are a major public health priority. Immunization with DNA vaccines encoding key proteins involved in the immune response to hCMV has emerged as a major focus of hCMV vaccine research. Validation of the protective effect of DNA vaccination in animal models has provided support for clinical trials. VCL-CB01, under development byVical Inc for the prevention of hCMV infection and disease, is a poloxamer-formulated, bivalent DNA vaccine that contains plasmids encoding hCMV tegument phosphoprotein 65 and the major hCMV surface glycoprotein B. In a phase I trial in healthy adults, VCL-CB01 was well tolerated. In interim results from a phase II trial in hCMV-seropositive hematopoietic cell transplant recipients, VCL-CB01 increased T-cell responses compared with placebo. The final results from the phase II trial will be of value for developing strategies to prevent hCMV disease in hCMV-seropositive transplant recipients, and may lead to other trials of VCL-CB01 or related vaccines for the prevention of congenital hCMV infection. PMID:19806506

  8. Real-time analysis of the transcriptional regulation of HIV and hCMV promoters in single mammalian cells.

    PubMed

    White, M R; Masuko, M; Amet, L; Elliott, G; Braddock, M; Kingsman, A J; Kingsman, S M

    1995-02-01

    The regulation of human cytomegalovirus (hCMV) and human immunodeficiency virus (HIV) gene expression has been studied in single intact mammalian cells. Viral promoters were placed upstream of the firefly luciferase reporter gene and the resulting hybrid reporter constructs were stably integrated into the HeLa cell genome. A highly sensitive photon-counting camera system was used to study the level of gene expression in single intact cells. Luciferase expression was studied in the absence of activators of viral gene expression, in the presence of the HIV-1 TAT transactivator protein, or in the presence of sodium butyrate, a non-viral activator of gene expression. In the absence of any activator of gene expression, while expression was undetectable in most cells, significant levels of basal luciferase activity were observed in a few cells, indicating heterogeneity in gene expression in the cell population. In the presence of the general activator of viral gene expression, sodium butyrate, transcriptional activation from the viral promoters gave rise to significant and relatively homogeneous levels of luciferase expression in a majority of cells. The luciferase imaging technology was used for the real-time analysis of changes of gene expression within a single cell. This non-invasive reporter assay should become important for studies of the temporal regulation of gene expression in single cells. PMID:7768992

  9. A Neutralizing Anti-gH/gL Monoclonal Antibody Is Protective in the Guinea Pig Model of Congenital CMV Infection

    PubMed Central

    Auerbach, Marcy R.; Yan, Donghong; Vij, Rajesh; Hongo, Jo-Anne; Nakamura, Gerald; Vernes, Jean-Michel; Meng, Y. Gloria; Lein, Samantha; Chan, Pamela; Ross, Jed; Carano, Richard; Deng, Rong; Lewin-Koh, Nicholas; Xu, Min; Feierbach, Becket

    2014-01-01

    Human cytomegalovirus (HCMV) is the most common cause of congenital virus infection. Congenital HCMV infection occurs in 0.2–1% of all births, and causes birth defects and developmental abnormalities, including sensorineural hearing loss and developmental delay. Several key studies have established the guinea pig as a tractable model for the study of congenital HCMV infection and have shown that polyclonal antibodies can be protective [1]–[3]. In this study, we demonstrate that an anti-guinea pig CMV (GPCMV) glycoprotein H/glycoprotein L neutralizing monoclonal antibody protects against fetal infection and loss in the guinea pig. Furthermore, we have delineated the kinetics of GPCMV congenital infection, from maternal infection (salivary glands, seroconversion, placenta) to fetal infection (fetus and amniotic fluid). Our studies support the hypothesis that a neutralizing monoclonal antibody targeting an envelope GPCMV glycoprotein can protect the fetus from infection and may shed light on the therapeutic intervention of HCMV congenital infection in humans. PMID:24722349

  10. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner.

    PubMed

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins. PMID:27375569

  11. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner

    PubMed Central

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins. PMID:27375569

  12. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.

    PubMed

    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus

    2016-08-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  13. Cytomegalovirus infection induces a stem cell phenotype in human primary glioblastoma cells: prognostic significance and biological impact.

    PubMed

    Fornara, O; Bartek, J; Rahbar, A; Odeberg, J; Khan, Z; Peredo, I; Hamerlik, P; Bartek, J; Stragliotto, G; Landázuri, N; Söderberg-Nauclér, C

    2016-02-01

    Glioblastoma (GBM) is associated with poor prognosis despite aggressive surgical resection, chemotherapy, and radiation therapy. Unfortunately, this standard therapy does not target glioma cancer stem cells (GCSCs), a subpopulation of GBM cells that can give rise to recurrent tumors. GBMs express human cytomegalovirus (HCMV) proteins, and previously we found that the level of expression of HCMV immediate-early (IE) protein in GBMs is a prognostic factor for poor patient survival. In this study, we investigated the relation between HCMV infection of GBM cells and the presence of GCSCs. Primary GBMs were characterized by their expression of HCMV-IE and GCSCs marker CD133 and by patient survival. The extent to which HCMV infection of primary GBM cells induced a GCSC phenotype was evaluated in vitro. In primary GBMs, a large fraction of CD133-positive cells expressed HCMV-IE, and higher co-expression of these two proteins predicted poor patient survival. Infection of GBM cells with HCMV led to upregulation of CD133 and other GSCS markers (Notch1, Sox2, Oct4, Nestin). HCMV infection also promoted the growth of GBM cells as neurospheres, a behavior typically displayed by GCSCs, and this phenotype was prevented by either chemical inhibition of the Notch1 pathway or by treatment with the anti-viral drug ganciclovir. GBM cells that maintained expression of HCMV-IE failed to differentiate into neuronal or astrocytic phenotypes. Our findings imply that HCMV infection induces phenotypic plasticity of GBM cells to promote GCSC features and may thereby increase the aggressiveness of this tumor. PMID:26138445

  14. Activity of andrographolide against chikungunya virus infection

    PubMed Central

    Wintachai, Phitchayapak; Kaur, Parveen; Lee, Regina Ching Hua; Ramphan, Suwipa; Kuadkitkan, Atichat; Wikan, Nitwara; Ubol, Sukathida; Roytrakul, Sittiruk; Chu, Justin Jang Hann; Smith, Duncan R.

    2015-01-01

    Chikungunya virus (CHIKV) is a re-emerging mosquito-borne alphavirus that has recently engendered large epidemics around the world. There is no specific antiviral for treatment of patients infected with CHIKV, and development of compounds with significant anti-CHIKV activity that can be further developed to a practical therapy is urgently required. Andrographolide is derived from Andrographis paniculata, a herb traditionally used to treat a number of conditions including infections. This study sought to determine the potential of andrographolide as an inhibitor of CHIKV infection. Andrographolide showed good inhibition of CHIKV infection and reduced virus production by approximately 3log10 with a 50% effective concentration (EC50) of 77 μM without cytotoxicity. Time-of-addition and RNA transfection studies showed that andrographolide affected CHIKV replication and the activity of andrographolide was shown to be cell type independent. This study suggests that andrographolide has the potential to be developed further as an anti-CHIKV therapeutic agent. PMID:26384169

  15. Activity of andrographolide against chikungunya virus infection.

    PubMed

    Wintachai, Phitchayapak; Kaur, Parveen; Lee, Regina Ching Hua; Ramphan, Suwipa; Kuadkitkan, Atichat; Wikan, Nitwara; Ubol, Sukathida; Roytrakul, Sittiruk; Chu, Justin Jang Hann; Smith, Duncan R

    2015-01-01

    Chikungunya virus (CHIKV) is a re-emerging mosquito-borne alphavirus that has recently engendered large epidemics around the world. There is no specific antiviral for treatment of patients infected with CHIKV, and development of compounds with significant anti-CHIKV activity that can be further developed to a practical therapy is urgently required. Andrographolide is derived from Andrographis paniculata, a herb traditionally used to treat a number of conditions including infections. This study sought to determine the potential of andrographolide as an inhibitor of CHIKV infection. Andrographolide showed good inhibition of CHIKV infection and reduced virus production by approximately 3log10 with a 50% effective concentration (EC50) of 77 μM without cytotoxicity. Time-of-addition and RNA transfection studies showed that andrographolide affected CHIKV replication and the activity of andrographolide was shown to be cell type independent. This study suggests that andrographolide has the potential to be developed further as an anti-CHIKV therapeutic agent. PMID:26384169

  16. Human papillomavirus infections in nonsexually active perinatally HIV infected children.

    PubMed

    Moscicki, Anna-Barbara; Puga, Ana; Farhat, Sepideh; Ma, Yifei

    2014-02-01

    Although human papillomavirus (HPV) infections are common in HIV-infected adults, little is known about children. Our objective was to examine the prevalence of and risks for HPV of the oral mucosal and external genital areas in nonsexually active (NSA) perinatally (P) HIV+ children and compare with HIV-exposed but uninfected (HEU) children. A convenience sample attending a pediatric clinic were enrolled. Samples for HPV were obtained from the oral and anogenital areas and tested for one of 37 HPV types. The mean age of the 48 PHIV+ children was 14.3±3.9 years vs. 6.2±4.8 for the 52 HEU (p<0.001). Of the 23 PHIV+ girls, 30.4% had anogenital and 17% had oral HPV, and of the 27 HEU girls, 2 (7.4%) anogenital and 0 had oral HPV. Of the boys, 4/23 (17.4%) and 1/25 (4%) PHIV+ had anogenital and oral HPV, respectively, and 3/24 (12.5%) and 1/25 (4%) HEU had anogenital and oral HPV, respectively. Rates of HPV did not differ by age among the PHIV+, whereas older HEU were more likely to have HPV than younger HEU (p=0.07). This large age gap precluded statistical comparison by HIV status. The presence of HPV in NSA PHIV+ children may have implications regarding HPV vaccination efficacy. PMID:24460009

  17. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.

    1981-04-01

    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  18. Rotavirus infection activates the UPR but modulates its activity

    PubMed Central

    2011-01-01

    Background Rotaviruses are known to modulate the innate antiviral defense response driven by IFN. The purpose of this study was to identify changes in the cellular proteome in response to rotavirus infection in the context of the IFN response. We also sought to identify proteins outside the IFN induction and signaling pathway that were modulated by rotavirus infection. Methods 2D-DIGE and image analysis were used to identify cellular proteins that changed in levels of expression in response to rotavirus infection, IFN treatment, or IFN treatment prior to infection. Immunofluorescence microscopy was used to determine the subcellular localization of proteins associated with the unfolded protein response (UPR). Results The data show changes in the levels of multiple proteins associated with cellular stress in infected cells, including levels of ER chaperones GRP78 and GRP94. Further investigations showed that GRP78, GRP94 and other proteins with roles in the ER-initiated UPR including PERK, CHOP and GADD34, were localized to viroplasms in infected cells. Conclusions Together the results suggest rotavirus infection activates the UPR, but modulates its effects by sequestering sensor, transcription factor, and effector proteins in viroplasms. The data consequently also suggest that viroplasms may directly or indirectly play a fundamental role in regulating signaling pathways associated with cellular defense responses. PMID:21774819

  19. Deletion of the Human Cytomegalovirus US17 Gene Increases the Ratio of Genomes per Infectious Unit and Alters Regulation of Immune and Endoplasmic Reticulum Stress Response Genes at Early and Late Times after Infection

    PubMed Central

    Gurczynski, Stephen J.; Das, Subhendu

    2014-01-01

    Human cytomegalovirus (HCMV) employs numerous strategies to combat, subvert, or co-opt host immunity. One evolutionary strategy for this involves capture of a host gene and then its successive duplication and divergence, forming a family of genes, many of which have immunomodulatory activities. The HCMV US12 family consists of 10 tandemly arranged sequence-related genes in the unique short (US) region of the HCMV genome (US12 to US21). Each gene encodes a protein possessing seven predicted transmembrane domains, patches of sequence similarity with cellular G-protein-coupled receptors, and the Bax inhibitor 1 family of antiapoptotic proteins. We show that one member, US17, plays an important role during virion maturation. Microarray analysis of cells infected with a recombinant HCMV isolate with a US17 deletion (the ΔUS17 mutant virus) revealed blunted host innate and interferon responses at early times after infection (12 h postinfection [hpi]), a pattern opposite that previously seen in the absence of the immunomodulatory tegument protein pp65 (pUL83). Although the ΔUS17 mutant virus produced numbers of infectious particles in fibroblasts equal to the numbers produced by the parental virus, it produced >3-fold more genome-containing noninfectious viral particles and delivered increased amounts of pp65 to newly infected cells. These results suggest that US17 has evolved to control virion composition, to elicit an appropriately balanced host immune response. At later time points (96 hpi), ΔUS17 mutant-infected cells displayed aberrant expression of several host endoplasmic reticulum stress response genes and chaperones, some of which are important for the final stages of virion assembly and egress. Our results suggest that US17 modulates host pathways to enable production of virions that elicit an appropriately balanced host immune response. PMID:24335296

  20. HCMV gB shares structural and functional properties with gB proteins from other herpesviruses

    SciTech Connect

    Sharma, Sapna; Wisner, Todd W.; Johnson, David C.; Heldwein, Ekaterina E.

    2013-01-20

    Glycoprotein B (gB) facilitates HCMV entry into cells by binding receptors and mediating membrane fusion. The crystal structures of gB ectodomains from HSV-1 and EBV are available, but little is known about the HCMV gB structure. Using multiangle light scattering and electron microscopy, we show here that HCMV gB ectodomain is a trimer with the overall shape similar to HSV-1 and EBV gB ectodomains. HCMV gB ectodomain forms rosettes similar to rosettes formed by EBV gB and the postfusion forms of other viral fusogens. Substitution of several bulky hydrophobic residues within the putative fusion loops with more hydrophilic residues reduced rosette formation and abolished cell fusion. We propose that like gB proteins from HSV-1 and EBV, HCMV gB has two internal hydrophobic fusion loops that likely interact with target membranes. Our work establishes structural and functional similarities between gB proteins from three subfamilies of herpesviruses.

  1. Inhibition of p53 transcriptional activity by human cytomegalovirus UL44.

    PubMed

    Kwon, Yejin; Kim, Mi-Na; Young Choi, Eun; Heon Kim, Jung; Hwang, Eung-Soo; Cha, Chang-Yong

    2012-05-01

    Human cytomegalovirus (HCMV) stimulates cellular synthesis of DNA and proteins and induces transition of the cell cycle from G(1) to S and G(2) /M phase, in spite of increased amounts of p53 in the infected cells. The immediate early protein IE2-86  kDa (IE86) tethers a transcriptional repression domain to p53; however, its repression of p53 function is not enough to abrogate the G(1) checkpoint function of p53. Other HCMV proteins that suppress the activity of p53 were investigated in this study. Of the HCMV proteins that bind to p53 when assessed by immunoprecipitation and immunoblot analysis, HCMV UL44 was chosen as a candidate protein. It was found that reporter gene containing p53 consensus sequence was activated by transfection with wild type p53, but when plasmids of p53 with IE86 or UL44 were co-transfected, p53 transcriptional activity was decreased to 3-7% of the p53 control in a dose-dependent manner. When the deletion mutant of UL44 was co-transected with p53, the carboxyl one-third portion of UL44 had little effect on inhibition of p53 transcriptional activity. The amount of mRNA p21 was measured in H1299 by real time PCR after transfection of the combination of p53 and UL44 vectors and it was found that p21 transcription by p53 was inhibited dose-dependently by UL44. Increased G0/G1 and decreased S phases in p53 wild type-transfected H1299 cells were recovered to the level of p53 mutant type-transfected ones by the additional transfection of UL44 in a dose-dependent manner. In conclusion, the transcriptional activity of p53 is suppressed by UL44 as well as by IE86. PMID:22376288

  2. Circulating human cytomegalovirus-encoded HCMV-miR-US4-1 as an indicator for predicting the efficacy of IFNα treatment in chronic hepatitis B patients

    PubMed Central

    Pan, Yi; Wang, Nan; Zhou, Zhenxian; Liang, Hongwei; Pan, Chaoyun; Zhu, Dihan; Liu, Fenyong; Zhang, Chen-Yu; Zhang, Yujing; Zen, Ke

    2016-01-01

    The efficacy of interferon α (IFNα) therapy for chronic hepatitis B (CHB) patients is about 40% and often associates with adverse side-effects, thus identification of an easy accessible biomarker that can predict the outcome of IFNα treatment for individual CHB patients would be greatly helpful. Recent reports by us and others show that microRNAs encoded by human cytomegalovirus (HCMV) were readily detected in human serum and can interfere with lymphocyte responses required by IFNα therapeutic effect. We thus postulate that differential expression profile of serum HCMV miRNAs in CHB patients may serve as indicator to predict the efficacy of IFNα treatment for CHB patients. Blood was drawn from 56 individual CHB patients prior to IFNα treatment. By quantifying 13 HCMV miRNAs in serum samples, we found that the levels of HCMV-miR-US4-1 and HCMV-miR-UL-148D were significantly higher in IFNα-responsive group than in IFNα-non-responsive group. In a prospective study of 96 new CHB patients, serum level of HCMV-miR-US4-1 alone classified those who were and were not responsive to IFN-α treatment with correct rate of 84.00% and 71.74%, respectively. In conclusion, our results demonstrate that serum HCMV-miR-US4-1 can serve as a novel biomarker for predicting the outcome of IFNα treatment in CHB patients. PMID:26961899

  3. Infection of Vascular Endothelial Cells with Human Cytomegalovirus under Fluid Shear Stress Reveals Preferential Entry and Spread of Virus in Flow Conditions Simulating Atheroprone Regions of the Artery

    PubMed Central

    DuRose, Jenny B.; Li, Julie; Chien, Shu

    2012-01-01

    Atherosclerosis is a major pathogenic factor in cardiovascular diseases, which are the leading cause of mortality in developed countries. While risk factors for atherosclerosis tend to be systemic, the distribution of atherosclerotic plaques within the vasculature is preferentially located at branch points and curves where blood flow is disturbed and shear stress is low. It is now widely accepted that hemodynamic factors can modulate endothelial gene expression and function and influence the pathophysiological changes associated with atherosclerosis. Human cytomegalovirus (HCMV), a ubiquitous pathogen, has long been proposed as a risk factor for atherosclerosis. To date, the role of HCMV in atherogenesis has been explored only in static conditions, and it is not known how HCMV infection is influenced by the physiological context of flow. In this study, we utilized a parallel-plate flow system to simulate the effects of shear stresses in different regions of the vasculature in vitro. We found that endothelial cells cultured under low shear stress, which simulates the flow condition of atheroprone regions in vivo, are more permissive to HCMV infection than cells experiencing high shear stress or static conditions. Cells exposed to low shear stress show increased entry of HCMV compared to cells exposed to high shear stress or static conditions. Viral structural gene expression, viral titers, and viral spread are also enhanced in endothelial cells exposed to low shear stress. These results suggest that hemodynamic factors modulate HCMV infection of endothelial cells, thus providing new insights into the induction/acceleration of atherosclerosis by HCMV. PMID:23055562

  4. MAIT cells are activated during human viral infections.

    PubMed

    van Wilgenburg, Bonnie; Scherwitzl, Iris; Hutchinson, Edward C; Leng, Tianqi; Kurioka, Ayako; Kulicke, Corinna; de Lara, Catherine; Cole, Suzanne; Vasanawathana, Sirijitt; Limpitikul, Wannee; Malasit, Prida; Young, Duncan; Denney, Laura; Moore, Michael D; Fabris, Paolo; Giordani, Maria Teresa; Oo, Ye Htun; Laidlaw, Stephen M; Dustin, Lynn B; Ho, Ling-Pei; Thompson, Fiona M; Ramamurthy, Narayan; Mongkolsapaya, Juthathip; Willberg, Christian B; Screaton, Gavin R; Klenerman, Paul

    2016-01-01

    Mucosal-associated invariant T (MAIT) cells are abundant in humans and recognize bacterial ligands. Here, we demonstrate that MAIT cells are also activated during human viral infections in vivo. MAIT cells activation was observed during infection with dengue virus, hepatitis C virus and influenza virus. This activation-driving cytokine release and Granzyme B upregulation-is TCR-independent but dependent on IL-18 in synergy with IL-12, IL-15 and/or interferon-α/β. IL-18 levels and MAIT cell activation correlate with disease severity in acute dengue infection. Furthermore, HCV treatment with interferon-α leads to specific MAIT cell activation in vivo in parallel with an enhanced therapeutic response. Moreover, TCR-independent activation of MAIT cells leads to a reduction of HCV replication in vitro mediated by IFN-γ. Together these data demonstrate MAIT cells are activated following viral infections, and suggest a potential role in both host defence and immunopathology. PMID:27337592

  5. TLR9 -1486T/C and 2848C/T SNPs Are Associated with Human Cytomegalovirus Infection in Infants

    PubMed Central

    Paradowska, Edyta; Jabłońska, Agnieszka; Studzińska, Mirosława; Skowrońska, Katarzyna; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Woźniakowska-Gęsicka, Teresa; Nowakowska, Dorota; Gaj, Zuzanna; Wilczyński, Jan; Leśnikowski, Zbigniew J.

    2016-01-01

    Toll-like receptor 9 (TLR9) recognizes non-methylated viral CpG-containing DNA and serves as a pattern recognition receptor that signals the presence of human cytomegalovirus (HCMV). Here, we present the genotype distribution of single-nucleotide polymorphisms (SNPs) of the TLR9 gene in infants and the relationship between TLR9 polymorphisms and HCMV infection. Four polymorphisms (-1237T/C, rs5743836; -1486T/C, rs187084; 1174G/A, rs352139; and 2848C/T, rs352140) in the TLR9 gene were genotyped in 72 infants with symptomatic HCMV infection and 70 healthy individuals. SNP genotyping was performed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Digested fragments were separated and identified by capillary electrophoresis. The HCMV DNA copy number was measured by a quantitative real-time PCR assay. We found an increased frequency of heterozygous genotypes TLR9 -1486T/C and 2848C/T in infants with HCMV infection compared with uninfected cases. Heterozygous variants of these two SNPs increased the risk of HCMV disease in children (P = 0.044 and P = 0.029, respectively). In infants with a mutation present in at least one allele of -1486T/C and 2848C/T SNPs, a trend towards increased risk of cytomegaly was confirmed after Bonferroni’s correction for multiple testing (Pc = 0.063). The rs352139 GG genotype showed a significantly reduced relative risk for HCMV infection (Pc = 0.006). In contrast, the -1237T/C SNP was not related to viral infection. We found no evidence for linkage disequilibrium with the four examined TLR9 SNPs. The findings suggest that the TLR9 -1486T/C and 2848C/T polymorphisms could be a genetic risk factor for the development of HCMV disease. PMID:27105145

  6. MAIT cells are activated during human viral infections

    PubMed Central

    van Wilgenburg, Bonnie; Scherwitzl, Iris; Hutchinson, Edward C.; Leng, Tianqi; Kurioka, Ayako; Kulicke, Corinna; de Lara, Catherine; Cole, Suzanne; Vasanawathana, Sirijitt; Limpitikul, Wannee; Malasit, Prida; Young, Duncan; Denney, Laura; Barnes, Eleanor; Ball, Jonathan; Burgess, Gary; Cooke, Graham; Dillon, John; Gore, Charles; Foster, Graham; Guha, Neil; Halford, Rachel; Herath, Cham; Holmes, Chris; Howe, Anita; Hudson, Emma; Irving, William; Khakoo, Salim; Koletzki, Diana; Martin, Natasha; Mbisa, Tamyo; McKeating, Jane; McLauchlan, John; Miners, Alec; Murray, Andrea; Shaw, Peter; Simmonds, Peter; Spencer, Chris; Targett-Adams, Paul; Thomson, Emma; Vickerman, Peter; Zitzmann, Nicole; Moore, Michael D.; Fabris, Paolo; Giordani, Maria Teresa; Oo, Ye Htun; Laidlaw, Stephen M.; Dustin, Lynn B.; Ho, Ling-Pei; Thompson, Fiona M.; Ramamurthy, Narayan; Mongkolsapaya, Juthathip; Willberg, Christian B.; Screaton, Gavin R.; Klenerman, Paul

    2016-01-01

    Mucosal-associated invariant T (MAIT) cells are abundant in humans and recognize bacterial ligands. Here, we demonstrate that MAIT cells are also activated during human viral infections in vivo. MAIT cells activation was observed during infection with dengue virus, hepatitis C virus and influenza virus. This activation—driving cytokine release and Granzyme B upregulation—is TCR-independent but dependent on IL-18 in synergy with IL-12, IL-15 and/or interferon-α/β. IL-18 levels and MAIT cell activation correlate with disease severity in acute dengue infection. Furthermore, HCV treatment with interferon-α leads to specific MAIT cell activation in vivo in parallel with an enhanced therapeutic response. Moreover, TCR-independent activation of MAIT cells leads to a reduction of HCV replication in vitro mediated by IFN-γ. Together these data demonstrate MAIT cells are activated following viral infections, and suggest a potential role in both host defence and immunopathology. PMID:27337592

  7. Rhesus and Human Cytomegalovirus Glycoprotein L Are Required for Infection and Cell-to-Cell Spread of Virus but Cannot Complement Each Other▿

    PubMed Central

    Bowman, J. Jason; Lacayo, Juan C.; Burbelo, Peter; Fischer, Elizabeth R.; Cohen, Jeffrey I.

    2011-01-01

    Rhesus cytomegalovirus (RhCMV), the homolog of human cytomegalovirus (HCMV), serves as a model for understanding the pathogenesis of HCMV and for developing candidate vaccines. In order to develop a replication-defective virus as a vaccine candidate, we constructed RhCMV with glycoprotein L (gL) deleted. RhCMV gL was essential for viral replication, and virus with gL deleted could only replicate in cells expressing RhCMV gL. Noncomplementing cells infected with RhCMV with gL deleted released intact, noninfectious RhCMV particles that were indistinguishable from wild-type RhCMV by electron microscopy and could be rescued by treatment of cells with polyethylene glycol. In addition, noncomplementing cells infected with RhCMV with gL deleted produced levels of gB, the major target of neutralizing antibodies, at levels similar to those observed in cells infected with wild-type RhCMV. Since RhCMV and HCMV gL share 53% amino acid identity, we determined whether the two proteins could complement the heterologous virus. Cells transfected with an HCMV bacterial artificial chromosome with gL deleted yielded virus that could replicate in human cells expressing HCMV gL. This is the second HCMV mutant with an essential glycoprotein deleted that has been complemented in cell culture. Finally, we found that HCMV gL could not complement the replication of RhCMV with gL deleted and that RhCMV gL could not complement the replication of HCMV with gL deleted. These data indicate that RhCMV and HCMV gL are both essential for replication of their corresponding viruses and, although the two gLs are highly homologous, they are unable to complement each another. PMID:21191007

  8. Microglial activation induces neuronal death in Chandipura virus infection

    PubMed Central

    Verma, Abhishek Kumar; Ghosh, Sourish; Pradhan, Sreeparna; Basu, Anirban

    2016-01-01

    Neurotropic viruses induce neurodegeneration either directly by activating host death domains or indirectly through host immune response pathways. Chandipura Virus (CHPV) belonging to family Rhabdoviridae is ranked among the emerging pathogens of the Indian subcontinent. Previously we have reported that CHPV induces neurodegeneration albeit the root cause of this degeneration is still an open question. In this study we explored the role of microglia following CHPV infection. Phenotypic analysis of microglia through lectin and Iba-1 staining indicated cells were in an activated state post CHPV infection in cortical region of the infected mouse brain. Cytokine Bead Array (CBA) analysis revealed comparatively higher cytokine and chemokine levels in the same region. Increased level of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), Nitric Oxide (NO) and Reactive Oxygen species (ROS) in CHPV infected mouse brain indicated a strong inflammatory response to CHPV infection. Hence it was hypothesized through our analyses that this inflammatory response may stimulate the neuronal death following CHPV infection. In order to validate our hypothesis supernatant from CHPV infected microglial culture was used to infect neuronal cell line and primary neurons. This study confirmed the bystander killing of neurons due to activation of microglia post CHPV infection. PMID:26931456

  9. Human Cytomegalovirus Infection Interferes with the Maintenance and Differentiation of Trophoblast Progenitor Cells of the Human Placenta

    PubMed Central

    Tabata, Takako; Petitt, Matthew; Zydek, Martin; Fang-Hoover, June; Larocque, Nicholas; Tsuge, Mitsuru; Gormley, Matthew; Kauvar, Lawrence M.

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is a major cause of birth defects that include severe neurological deficits, hearing and vision loss, and intrauterine growth restriction. Viral infection of the placenta leads to development of avascular villi, edema, and hypoxia associated with symptomatic congenital infection. Studies of primary cytotrophoblasts (CTBs) revealed that HCMV infection impedes terminal stages of differentiation and invasion by various molecular mechanisms. We recently discovered that HCMV arrests earlier stages involving development of human trophoblast progenitor cells (TBPCs), which give rise to the mature cell types of chorionic villi—syncytiotrophoblasts on the surfaces of floating villi and invasive CTBs that remodel the uterine vasculature. Here, we show that viral proteins are present in TBPCs of the chorion in cases of symptomatic congenital infection. In vitro studies revealed that HCMV replicates in continuously self-renewing TBPC lines derived from the chorion and alters expression and subcellular localization of proteins required for cell cycle progression, pluripotency, and early differentiation. In addition, treatment with a human monoclonal antibody to HCMV glycoprotein B rescues differentiation capacity, and thus, TBPCs have potential utility for evaluation of the efficacies of novel antiviral antibodies in protecting and restoring placental development. Our results suggest that HCMV replicates in TBPCs in the chorion in vivo, interfering with the earliest steps in the growth of new villi, contributing to virus transmission and impairing compensatory development. In cases of congenital infection, reduced responsiveness of the placenta to hypoxia limits the transport of substances from maternal blood and contributes to fetal growth restriction. IMPORTANCE Human cytomegalovirus (HCMV) is a leading cause of birth defects in the United States. Congenital infection can result in permanent neurological defects, mental retardation

  10. Pseudorabies Virus Infection Alters Neuronal Activity and Connectivity In Vitro

    PubMed Central

    McCarthy, Kelly M.; Tank, David W.; Enquist, Lynn W.

    2009-01-01

    Alpha-herpesviruses, including human herpes simplex virus 1 & 2, varicella zoster virus and the swine pseudorabies virus (PRV), infect the peripheral nervous system of their hosts. Symptoms of infection often include itching, numbness, or pain indicative of altered neurological function. To determine if there is an in vitro electrophysiological correlate to these characteristic in vivo symptoms, we infected cultured rat sympathetic neurons with well-characterized strains of PRV known to produce virulent or attenuated symptoms in animals. Whole-cell patch clamp recordings were made at various times after infection. By 8 hours of infection with virulent PRV, action potential (AP) firing rates increased substantially and were accompanied by hyperpolarized resting membrane potentials and spikelet-like events. Coincident with the increase in AP firing rate, adjacent neurons exhibited coupled firing events, first with AP-spikelets and later with near identical resting membrane potentials and AP firing. Small fusion pores between adjacent cell bodies formed early after infection as demonstrated by transfer of the low molecular weight dye, Lucifer Yellow. Later, larger pores formed as demonstrated by transfer of high molecular weight Texas red-dextran conjugates between infected cells. Further evidence for viral-induced fusion pores was obtained by infecting neurons with a viral mutant defective for glycoprotein B, a component of the viral membrane fusion complex. These infected neurons were essentially identical to mock infected neurons: no increased AP firing, no spikelet-like events, and no electrical or dye transfer. Infection with PRV Bartha, an attenuated circuit-tracing strain delayed, but did not eliminate the increased neuronal activity and coupling events. We suggest that formation of fusion pores between infected neurons results in electrical coupling and elevated firing rates, and that these processes may contribute to the altered neural function seen in PRV-infected

  11. Antagonistic Determinants Controlling Replicative and Latent States of Human Cytomegalovirus Infection

    PubMed Central

    Umashankar, Mahadevaiah; Rak, Michael; Bughio, Farah; Zagallo, Patricia; Caviness, Katie

    2014-01-01

    ABSTRACT The mechanisms by which viruses persist and particularly those by which viruses actively contribute to their own latency have been elusive. Here we report the existence of opposing functions encoded by genes within a polycistronic locus of the human cytomegalovirus (HCMV) genome that regulate cell type-dependent viral fates: replication and latency. The locus, referred to as the UL133-UL138 (UL133/8) locus, encodes four proteins, pUL133, pUL135, pUL136, and pUL138. As part of the ULb′ region of the genome, the UL133/8 locus is lost upon serial passage of clinical strains of HCMV in cultured fibroblasts and is therefore considered dispensable for replication in this context. Strikingly, we could not reconstitute infection in permissive fibroblasts from bacterial artificial chromosome clones of the HCMV genome where UL135 alone was disrupted. The loss of UL135 resulted in complex phenotypes and could ultimately be overcome by infection at high multiplicities. The requirement for UL135 but not the entire locus led us to hypothesize that another gene in this locus suppressed virus replication in the absence of UL135. The defect associated with the loss of UL135 was largely rescued by the additional disruption of the UL138 latency determinant, indicating a requirement for UL135 for virus replication when UL138 is expressed. In the CD34+ hematopoietic progenitor model of latency, viruses lacking only UL135 were defective for viral genome amplification and reactivation. Taken together, these data indicate that UL135 and UL138 comprise a molecular switch whereby UL135 is required to overcome UL138-mediated suppression of virus replication to balance states of latency and reactivation. IMPORTANCE Mechanisms by which viruses persist in their host remain one of the most poorly understood phenomena in virology. Herpesviruses, including HCMV, persist in an incurable, latent state that has profound implications for immunocompromised individuals, including transplant

  12. Pyrimidinergic Receptor Activation Controls Toxoplasma gondii Infection in Macrophages

    PubMed Central

    Moreira-Souza, Aline Cristina Abreu; Marinho, Ygor; Correa, Gladys; Santoro, Giani França; Coutinho, Claudia Mara Lara Melo; Vommaro, Rossiane Claudia; Coutinho-Silva, Robson

    2015-01-01

    Infection by the protozoan parasite Toxoplasma gondii is highly prevalent worldwide and may have serious clinical manifestations in immunocompromised patients. T. gondii is an obligate intracellular parasite that infects almost any cell type in mammalian hosts, including immune cells. The immune cells express purinergic P2 receptors in their membrane – subdivided into P2Y and P2X subfamilies - whose activation is important for infection control. Here, we examined the effect of treatment with UTP and UDP in mouse peritoneal macrophages infected with T. gondii tachyzoites. Treatment with these nucleotides reduced parasitic load by 90%, but did not increase the levels of the inflammatory mediators NO and ROS, nor did it modulate host cell death by apoptosis or necrosis. On the other hand, UTP and UDP treatments induced early egress of tachyzoites from infected macrophages, in a Ca2+-dependent manner, as shown by scanning electron microscopy analysis, and videomicroscopy. In subsequent infections, prematurely egressed parasites had reduced infectivity, and could neither replicate nor inhibit the fusion of lysosomes to the parasitophorous vacuole. The use of selective agonists and antagonists of the receptor subtypes P2Y2 and P2Y4 and P2Y6 showed that premature parasite egress may be mediated by the activation of these receptor subtypes. Our results suggest that the activity of P2Y host cell receptors controls T. gondii infection in macrophages, highlighting the importance of pyrimidinergic signaling for innate immune system response against infection. Finally the P2Y receptors should be considered as new target for the development of drugs against T. gondii infection. PMID:26192447

  13. Increased Viral Dissemination in the Brain and Lethality in MCMV-Infected, Dicer-Deficient Neonates

    PubMed Central

    Ostermann, Eleonore; Macquin, Cécile; Krezel, Wojciech; Bahram, Seiamak; Georgel, Philippe

    2015-01-01

    Among Herpesviruses, Human Cytomegalovirus (HCMV or HHV-5) represents a major threat during congenital or neonatal infections, which may lead to encephalitis with serious neurological consequences. However, as opposed to other less prevalent pathogens, the mechanisms and genetic susceptibility factors for CMV encephalitis are poorly understood. This lack of information considerably reduces the prognostic and/or therapeutic possibilities. To easily monitor the effects of genetic defects on brain dissemination following CMV infection we used a recently developed in vivo mouse model based on the neonatal inoculation of a MCMV genetically engineered to express Luciferase. Here, we further validate this protocol for live imaging, and demonstrate increased lethality associated with viral infection and encephalitis in mutant mice lacking Dicer activity. Our data indicate that miRNAs are important players in the control of MCMV pathogenesis and suggest that miRNA-based endothelial functions and integrity are crucial for CMV encephalitis. PMID:25955106

  14. Dynamics of the NK-cell subset redistribution induced by cytomegalovirus infection in preterm infants.

    PubMed

    Noyola, Daniel E; Alarcón, Ana; Noguera-Julian, Antoni; Muntasell, Aura; Muñoz-Almagro, Carmen; García, Jordi; Mur, Antonio; Fortuny, Claudia; López-Botet, Miguel

    2015-03-01

    Human cytomegalovirus (HCMV) infection promotes an expansion of NK-cells expressing the CD94/NKG2C receptor. We prospectively monitored the effects of HCMV on the NK-cell receptor (NKG2C, NKG2A, KIR, LILRB1) distribution in preterm infants. As compared to non-infected moderately preterm newborns (n=19, gestational age: 32-37 weeks), very preterm infants (n=5, gestational age: <32 weeks) suffering symptomatic postnatal HCMV infection displayed increased numbers of NKG2C+, KIR+ NK-cells, encompassed by a reduction of NKG2A+ NK-cells. A similar profile was observed in HCMV-negative newborns (n=4) with asymptomatic infection, during follow-up at ~4 and 10 months of age. Of note, viremia remained detectable in three symptomatic cases at ~10 months despite the persistent expansion of NKG2C+ NK-cells. Our study provides original insights on the dynamics of the imprint exerted by primary HCMV infection on the NK-cell compartment, revealing that the expansion of NKG2C+ NK-cells may be insufficient to control viral replication in very preterm infants. PMID:25636568

  15. Frank Stinchfield Award. Titanium surface with biologic activity against infection.

    PubMed

    Parvizi, Javad; Wickstrom, Eric; Zeiger, Allen R; Adams, Christopher S; Shapiro, Irving M; Purtill, James J; Sharkey, Peter F; Hozack, William J; Rothman, Richard H; Hickok, Noreen J

    2004-12-01

    Despite immense improvements, periprosthetic infection continues to compromise the result of otherwise successful joint arthroplasty. There are various limitations in the treatment of periprosthetic infection, the most important of which is the inability to deliver antibiotics to the local tissue without the need for intravenous administration. We have developed a novel route to covalently tether vancomycin to a metal (titanium) surface, which showed effective bactericidal activity because of a vancomycin coupling. The chemistry of tethering does not affect the biological activity of the biofactors that are attached to the metal surface. This technology holds great promise for the manufacturing of "smart" implants that can be self protective against periprosthetic infection, or can be used for the treatment of periprosthetic infections when they occur. PMID:15577462

  16. Enveloped Virus-Like Particle Expression of Human Cytomegalovirus Glycoprotein B Antigen Induces Antibodies with Potent and Broad Neutralizing Activity

    PubMed Central

    Kirchmeier, Marc; Fluckiger, Anne-Catherine; Soare, Catalina; Bozic, Jasminka; Ontsouka, Barthelemy; Ahmed, Tanvir; Diress, Abebaw; Pereira, Lenore; Schödel, Florian; Plotkin, Stanley; Dalba, Charlotte; Klatzmann, David

    2014-01-01

    A prophylactic vaccine to prevent the congenital transmission of human cytomegalovirus (HCMV) in newborns and to reduce life-threatening disease in immunosuppressed recipients of HCMV-infected solid organ transplants is highly desirable. Neutralizing antibodies against HCMV confer significant protection against infection, and glycoprotein B (gB) is a major target of such neutralizing antibodies. However, one shortcoming of past HCMV vaccines may have been their failure to induce high-titer persistent neutralizing antibody responses that prevent the infection of epithelial cells. We used enveloped virus-like particles (eVLPs), in which particles were produced in cells after the expression of murine leukemia virus (MLV) viral matrix protein Gag, to express either full-length CMV gB (gB eVLPs) or the full extracellular domain of CMV gB fused with the transmembrane and cytoplasmic domains from vesicular stomatitis virus (VSV)-G protein (gB-G eVLPs). gB-G-expressing eVLPs induced potent neutralizing antibodies in mice with a much greater propensity toward epithelial cell-neutralizing activity than that induced with soluble recombinant gB protein. An analysis of gB antibody binding titers and T-helper cell responses demonstrated that high neutralizing antibody titers were not simply due to enhanced immunogenicity of the gB-G eVLPs. The cells transiently transfected with gB-G but not gB plasmid formed syncytia, consistent with a prefusion gB conformation like those of infected cells and viral particles. Two of the five gB-G eVLP-induced monoclonal antibodies we examined in detail had neutralizing activities, one of which possessed particularly potent epithelial cell-neutralizing activity. These data differentiate gB-G eVLPs from gB antigens used in the past and support their use in a CMV vaccine candidate with improved neutralizing activity against epithelial cell infection. PMID:24334684

  17. Enveloped virus-like particle expression of human cytomegalovirus glycoprotein B antigen induces antibodies with potent and broad neutralizing activity.

    PubMed

    Kirchmeier, Marc; Fluckiger, Anne-Catherine; Soare, Catalina; Bozic, Jasminka; Ontsouka, Barthelemy; Ahmed, Tanvir; Diress, Abebaw; Pereira, Lenore; Schödel, Florian; Plotkin, Stanley; Dalba, Charlotte; Klatzmann, David; Anderson, David E

    2014-02-01

    A prophylactic vaccine to prevent the congenital transmission of human cytomegalovirus (HCMV) in newborns and to reduce life-threatening disease in immunosuppressed recipients of HCMV-infected solid organ transplants is highly desirable. Neutralizing antibodies against HCMV confer significant protection against infection, and glycoprotein B (gB) is a major target of such neutralizing antibodies. However, one shortcoming of past HCMV vaccines may have been their failure to induce high-titer persistent neutralizing antibody responses that prevent the infection of epithelial cells. We used enveloped virus-like particles (eVLPs), in which particles were produced in cells after the expression of murine leukemia virus (MLV) viral matrix protein Gag, to express either full-length CMV gB (gB eVLPs) or the full extracellular domain of CMV gB fused with the transmembrane and cytoplasmic domains from vesicular stomatitis virus (VSV)-G protein (gB-G eVLPs). gB-G-expressing eVLPs induced potent neutralizing antibodies in mice with a much greater propensity toward epithelial cell-neutralizing activity than that induced with soluble recombinant gB protein. An analysis of gB antibody binding titers and T-helper cell responses demonstrated that high neutralizing antibody titers were not simply due to enhanced immunogenicity of the gB-G eVLPs. The cells transiently transfected with gB-G but not gB plasmid formed syncytia, consistent with a prefusion gB conformation like those of infected cells and viral particles. Two of the five gB-G eVLP-induced monoclonal antibodies we examined in detail had neutralizing activities, one of which possessed particularly potent epithelial cell-neutralizing activity. These data differentiate gB-G eVLPs from gB antigens used in the past and support their use in a CMV vaccine candidate with improved neutralizing activity against epithelial cell infection. PMID:24334684

  18. Members of the HCMV US12 family of predicted heptaspanning membrane proteins have unique intracellular distributions, including association with the cytoplasmic virion assembly complex

    SciTech Connect

    Das, Subhendu; Pellett, Philip E. . E-mail: pelletp@ccf.org

    2007-05-10

    The human cytomegalovirus (HCMV) US12 gene family is a group of 10 predicted seven-transmembrane domain proteins that have some features in common with G-protein-coupled receptors. Little is known of their patterns of expression, localization, or functional interactions. Here, we studied the intracellular localization of three US12 family members, US14, US17, and US18, with respect to various intracellular markers and the cytoplasmic virion assembly compartment (AC). The three proteins have distinct patterns of expression, which include associations with the AC. US14 is often distributed in a uniform granular manner throughout the cytoplasm, concentrating in the AC in some cells. US17 is expressed in a segmented manner, with its N-terminal domain localizing to the periphery of what we show here to be the AC and the C-terminal domain localizing to nuclei and the cytoplasm [Das, S., Skomorovska-Prokvolit, Y., Wang, F. Z., Pellett, P.E., 2006. Infection-dependent nuclear localization of US17, a member of the US12 family of human cytomegalovirus-encoded seven-transmembrane proteins. J. Virol. 80, 1191-1203]. Here, we show that the C-terminal domain is present at the center of the AC, in close association with markers of early endosomes; the N-terminal staining corresponds to an area stained by markers for the Golgi and trans-Golgi. US18 is distributed throughout the cytoplasm, concentrating in the AC at later stages of infection; it is localized more to the periphery of the AC than are US14 and US17C, in association with markers of the trans-Golgi. Although not detected in virions, their structures and localization in various zones within the AC suggest possible roles for these proteins in the process of virion maturation and egress.

  19. Coincident Helminth Infection Modulates Systemic Inflammation and Immune Activation in Active Pulmonary Tuberculosis

    PubMed Central

    George, Parakkal Jovvian; Kumar, Nathella Pavan; Sridhar, Rathinam; Hanna, Luke E.; Nair, Dina; Banurekha, Vaithilingam V.; Nutman, Thomas B.; Babu, Subash

    2014-01-01

    Background Helminth infections are known to modulate innate and adaptive immune responses in active and latent tuberculosis (TB). However, the role of helminth infections in modulating responses associated with inflammation and immune activation (reflecting disease activity and/or severity) in TB is not known. Methodology We measured markers of inflammation and immune activation in active pulmonary TB individuals (ATB) with co-incidental Strongyloides stercoralis (Ss) infection. These included systemic levels of acute phase proteins, matrix metalloproteinases and their endogenous inhibitors and immune activation markers. As a control, we measured the systemic levels of the same molecules in TB-uninfected individuals (NTB) with or without Ss infection. Principal Findings Our data confirm that ATB is associated with elevated levels of the various measured molecules when compared to those seen in NTB. Our data also reveal that co-incident Ss infection in ATB individuals is associated with significantly decreased circulating levels of acute phase proteins, matrix metalloproteinases, tissue inhibitors of matrix metalloproteinases as well as the systemic immune activation markers, sCD14 and sCD163. These changes are specific to ATB since they are absent in NTB individuals with Ss infection. Conclusions Our data therefore reveal a profound effect of Ss infection on the markers associated with TB disease activity and severity and indicate that co-incidental helminth infections might dampen the severity of TB disease. PMID:25375117

  20. Bioactive activities of natural products against herpesvirus infection.

    PubMed

    Son, Myoungki; Lee, Minjung; Sung, Gi-Ho; Lee, Taeho; Shin, Yu Su; Cho, Hyosun; Lieberman, Paul M; Kang, Hyojeung

    2013-10-01

    More than 90% of adults have been infected with at least one human herpesvirus, which establish long-term latent infection for the life of the host. While anti-viral drugs exist that limit herpesvirus replication, many of these are ineffective against latent infection. Moreover, drug-resistant strains of herpesvirus emerge following chemotherapeutic treatment. For example, resistance to acyclovir and related nucleoside analogues can occur when mutations arise in either HSV thymidine kinase or DNA polymerases. Thus, there exists an unmet medical need to develop new anti-herpesvirus agents with different mechanisms of action. In this Review, we discuss the promise of anti-herpetic substances derived from natural products including extracts and pure compounds from potential herbal medicines. One example is Glycyrrhizic acid isolated from licorice that shows promising antiviral activity towards human gammaherpesviruses. Secondly, we discuss anti-herpetic mechanisms utilized by several natural products in molecular level. While nucleoside analogues inhibit replicating herpesviruses in lytic replication, some natural products can disrupt the herpesvirus latent infection in the host cell. In addition, natural products can stimulate immune responses against herpesviral infection. These findings suggest that natural products could be one of the best choices for development of new treatments for latent herpesvirus infection, and may provide synergistic anti-viral activity when supplemented with nucleoside analogues. Therefore, it is important to identify which natural products are more efficacious anti-herpetic agents, and to understand the molecular mechanism in detail for further advance in the anti-viral therapies. PMID:24173639

  1. Rapid Inflammasome Activation following Mucosal SIV Infection of Rhesus Monkeys.

    PubMed

    Barouch, Dan H; Ghneim, Khader; Bosche, William J; Li, Yuan; Berkemeier, Brian; Hull, Michael; Bhattacharyya, Sanghamitra; Cameron, Mark; Liu, Jinyan; Smith, Kaitlin; Borducchi, Erica; Cabral, Crystal; Peter, Lauren; Brinkman, Amanda; Shetty, Mayuri; Li, Hualin; Gittens, Courtney; Baker, Chantelle; Wagner, Wendeline; Lewis, Mark G; Colantonio, Arnaud; Kang, Hyung-Joo; Li, Wenjun; Lifson, Jeffrey D; Piatak, Michael; Sekaly, Rafick-Pierre

    2016-04-21

    The earliest events following mucosal HIV-1 infection, prior to measurable viremia, remain poorly understood. Here, by detailed necropsy studies, we show that the virus can rapidly disseminate following mucosal SIV infection of rhesus monkeys and trigger components of the inflammasome, both at the site of inoculation and at early sites of distal virus spread. By 24 hr following inoculation, a proinflammatory signature that lacked antiviral restriction factors was observed in viral RNA-positive tissues. The early innate response included expression of NLRX1, which inhibits antiviral responses, and activation of the TGF-β pathway, which negatively regulates adaptive immune responses. These data suggest a model in which the virus triggers specific host mechanisms that suppress the generation of antiviral innate and adaptive immune responses in the first few days of infection, thus facilitating its own replication. These findings have important implications for the development of vaccines and other strategies to prevent infection. PMID:27085913

  2. Cataract surgery during active methicillin-resistant Staphylococcus aureus infection

    PubMed Central

    Mansour, Ahmad M; Salti, Haytham I

    2014-01-01

    We present two patients with active, foul-smelling, methicillin-resistant Staphylococcus aureus (MRSA) wounds of the forehead and sternum following craniotomy or open heart surgery. Both had debilitating cataracts and were told by the infectious diseases team that cataract surgery is very risky. Both underwent sequential bilateral phacoemulsification with no sign of infection. Patients with active MRSA wound infections may safely undergo cataract surgery with additional precautions observed intraoperatively (good wound construction) and postoperatively (topical antibiotics and close observation). Banning such surgeries can unnecessarily jeopardize the lifestyles of such patients. PMID:24790402

  3. LL-37 immunomodulatory activity during Mycobacterium tuberculosis infection in macrophages.

    PubMed

    Torres-Juarez, Flor; Cardenas-Vargas, Albertina; Montoya-Rosales, Alejandra; González-Curiel, Irma; Garcia-Hernandez, Mariana H; Enciso-Moreno, Jose A; Hancock, Robert E W; Rivas-Santiago, Bruno

    2015-12-01

    Tuberculosis is one of the most important infectious diseases worldwide. The susceptibility to this disease depends to a great extent on the innate immune response against mycobacteria. Host defense peptides (HDP) are one of the first barriers to counteract infection. Cathelicidin (LL-37) is an HDP that has many immunomodulatory effects besides its weak antimicrobial activity. Despite advances in the study of the innate immune response in tuberculosis, the immunological role of LL-37 during M. tuberculosis infection has not been clarified. Monocyte-derived macrophages were infected with M. tuberculosis strain H37Rv and then treated with 1, 5, or 15 μg/ml of exogenous LL-37 for 4, 8, and 24 h. Exogenous LL-37 decreased tumor necrosis factor alpha (TNF-α) and interleukin-17 (IL-17) while inducing anti-inflammatory IL-10 and transforming growth factor β (TGF-β) production. Interestingly, the decreased production of anti-inflammatory cytokines did not reduce antimycobacterial activity. These results are consistent with the concept that LL-37 can modulate the expression of cytokines during mycobacterial infection and this activity was independent of the P2X7 receptor. Thus, LL-37 modulates the response of macrophages during infection, controlling the expression of proinflammatory and anti-inflammatory cytokines. PMID:26351280

  4. LL-37 Immunomodulatory Activity during Mycobacterium tuberculosis Infection in Macrophages

    PubMed Central

    Torres-Juarez, Flor; Cardenas-Vargas, Albertina; Montoya-Rosales, Alejandra; González-Curiel, Irma; Garcia-Hernandez, Mariana H.; Enciso-Moreno, Jose A.; Hancock, Robert E. W.

    2015-01-01

    Tuberculosis is one of the most important infectious diseases worldwide. The susceptibility to this disease depends to a great extent on the innate immune response against mycobacteria. Host defense peptides (HDP) are one of the first barriers to counteract infection. Cathelicidin (LL-37) is an HDP that has many immunomodulatory effects besides its weak antimicrobial activity. Despite advances in the study of the innate immune response in tuberculosis, the immunological role of LL-37 during M. tuberculosis infection has not been clarified. Monocyte-derived macrophages were infected with M. tuberculosis strain H37Rv and then treated with 1, 5, or 15 μg/ml of exogenous LL-37 for 4, 8, and 24 h. Exogenous LL-37 decreased tumor necrosis factor alpha (TNF-α) and interleukin-17 (IL-17) while inducing anti-inflammatory IL-10 and transforming growth factor β (TGF-β) production. Interestingly, the decreased production of anti-inflammatory cytokines did not reduce antimycobacterial activity. These results are consistent with the concept that LL-37 can modulate the expression of cytokines during mycobacterial infection and this activity was independent of the P2X7 receptor. Thus, LL-37 modulates the response of macrophages during infection, controlling the expression of proinflammatory and anti-inflammatory cytokines. PMID:26351280

  5. In vitro activity evaluation of Parkia pendula seed lectin against human cytomegalovirus and herpes virus 6.

    PubMed

    Favacho, Alexsandra R M; Cintra, Elizabete A; Coelho, Luana C B B; Linhares, Maria Iêda S

    2007-06-01

    Human cytomegalovirus (HCMV) in vitro infectivity was inhibited by Parkia pendula seed lectin (PpeL) in contrast to human herpes virus 6 (HHV-6) which was not affected. The antiviral activity was detected for HCMV in human embryo lung (HEL) cells using a microtechnique in culture plates. The assay showed a reduction of cellular infectivity from approximately 95%, at a concentration of 150microg/mL with minimal cytotoxicity (25%). Also, a reduction of 75% was observed in HEL cells at a concentration of 75microg/mL without toxic effect. The reduction on infectivity was observed even after virus pre-adsorption to cells suggesting that this action should occur after virus penetration, in the intracellular replication phase. MT4 lymphocytes and cord blood mononuclear cells (CBMC) were used to evaluate the lectin effect on HHV-6 following the same technique. Lectin concentrations with few or no toxic effects on lymphocytes did not show inhibitory action of HHV-6 cytopathic effect. The results obtained with PpeL demonstrate that it may have an impact in the design of pharmacological strategies to infection of cytomegalovirus. PMID:17254798

  6. Toxoplasma gondii Actively Inhibits Neuronal Function in Chronically Infected Mice

    PubMed Central

    Haroon, Fahad; Händel, Ulrike; Angenstein, Frank; Goldschmidt, Jürgen; Kreutzmann, Peter; Lison, Holger; Fischer, Klaus-Dieter; Scheich, Henning; Wetzel, Wolfram; Schlüter, Dirk; Budinger, Eike

    2012-01-01

    Upon infection with the obligate intracellular parasite Toxoplasma gondii, fast replicating tachyzoites infect a broad spectrum of host cells including neurons. Under the pressure of the immune response, tachyzoites convert into slow-replicating bradyzoites, which persist as cysts in neurons. Currently, it is unclear whether T. gondii alters the functional activity of neurons, which may contribute to altered behaviour of T. gondii–infected mice and men. In the present study we demonstrate that upon oral infection with T. gondii cysts, chronically infected BALB/c mice lost over time their natural fear against cat urine which was paralleled by the persistence of the parasite in brain regions affecting behaviour and odor perception. Detailed immunohistochemistry showed that in infected neurons not only parasitic cysts but also the host cell cytoplasm and some axons stained positive for Toxoplasma antigen suggesting that parasitic proteins might directly interfere with neuronal function. In fact, in vitro live cell calcium (Ca2+) imaging studies revealed that tachyzoites actively manipulated Ca2+ signalling upon glutamate stimulation leading either to hyper- or hypo-responsive neurons. Experiments with the endoplasmatic reticulum Ca2+ uptake inhibitor thapsigargin indicate that tachyzoites deplete Ca2+ stores in the endoplasmatic reticulum. Furthermore in vivo studies revealed that the activity-dependent uptake of the potassium analogue thallium was reduced in cyst harbouring neurons indicating their functional impairment. The percentage of non-functional neurons increased over time In conclusion, both bradyzoites and tachyzoites functionally silence infected neurons, which may significantly contribute to the altered behaviour of the host. PMID:22530040

  7. Toxoplasma gondii actively inhibits neuronal function in chronically infected mice.

    PubMed

    Haroon, Fahad; Händel, Ulrike; Angenstein, Frank; Goldschmidt, Jürgen; Kreutzmann, Peter; Lison, Holger; Fischer, Klaus-Dieter; Scheich, Henning; Wetzel, Wolfram; Schlüter, Dirk; Budinger, Eike

    2012-01-01

    Upon infection with the obligate intracellular parasite Toxoplasma gondii, fast replicating tachyzoites infect a broad spectrum of host cells including neurons. Under the pressure of the immune response, tachyzoites convert into slow-replicating bradyzoites, which persist as cysts in neurons. Currently, it is unclear whether T. gondii alters the functional activity of neurons, which may contribute to altered behaviour of T. gondii-infected mice and men. In the present study we demonstrate that upon oral infection with T. gondii cysts, chronically infected BALB/c mice lost over time their natural fear against cat urine which was paralleled by the persistence of the parasite in brain regions affecting behaviour and odor perception. Detailed immunohistochemistry showed that in infected neurons not only parasitic cysts but also the host cell cytoplasm and some axons stained positive for Toxoplasma antigen suggesting that parasitic proteins might directly interfere with neuronal function. In fact, in vitro live cell calcium (Ca(2+)) imaging studies revealed that tachyzoites actively manipulated Ca(2+) signalling upon glutamate stimulation leading either to hyper- or hypo-responsive neurons. Experiments with the endoplasmatic reticulum Ca(2+) uptake inhibitor thapsigargin indicate that tachyzoites deplete Ca(2+) stores in the endoplasmatic reticulum. Furthermore in vivo studies revealed that the activity-dependent uptake of the potassium analogue thallium was reduced in cyst harbouring neurons indicating their functional impairment. The percentage of non-functional neurons increased over time In conclusion, both bradyzoites and tachyzoites functionally silence infected neurons, which may significantly contribute to the altered behaviour of the host. PMID:22530040

  8. Disseminated rhodococcus equi infection in HIV infection despite highly active antiretroviral therapy

    PubMed Central

    2011-01-01

    Background Rhodococcus equi (R.equi) is an acid fast, GRAM + coccobacillus, which is widespread in the soil and causes pulmonary and extrapulmonary infections in immunocompromised people. In the context of HIV infection, R.equi infection (rhodococcosis) is regarded as an opportunistic disease, and its outcome is influenced by highly active antiretroviral therapy (HAART). Case presentation We report two cases of HIV-related rhodococcosis that disseminated despite suppressive HAART and anti-rhodococcal treatment; in both cases there was no immunological recovery, with CD4+ cells count below 200/μL. In the first case, pulmonary rhodococcosis presented 6 months after initiation of HAART, and was followed by an extracerebral intracranial and a cerebral rhodococcal abscess 1 and 8 months, respectively, after onset of pulmonary infection. The second case was characterized by a protracted course with spread of infection to various organs, including subcutaneous tissue, skin, colon and other intra-abdominal tissues, and central nervous system; the spread started 4 years after clinical resolution of a first pulmonary manifestation and progressed over a period of 2 years. Conclusions Our report highlights the importance of an effective immune recovery, despite fully suppressive HAART, along with anti-rhodococcal therapy, in order to clear rhodococcal infection. PMID:22168333

  9. Comparative magnitude and kinetics of human cytomegalovirus-specific CD4(+) and CD8(+) T-cell responses in pregnant women with primary versus remote infection and in transmitting versus non-transmitting mothers: Its utility for dating primary infection in pregnancy.

    PubMed

    Fornara, Chiara; Furione, Milena; Arossa, Alessia; Gerna, Giuseppe; Lilleri, Daniele

    2016-07-01

    To discriminate between primary (PI) and remote (RI) human cytomegalovirus (HCMV) infection, several immunological parameters were monitored for a 2-year period in 53 pregnant women with PI, and 33 pregnant women experiencing HCMV PI at least 5 years prior. Cytokine (IFN-γ and IL-2) production by and phenotype (effector/memory CD45RA(+) ) of HCMV-specific CD4(+) and CD8(+) T-cells as well as the lymphoproliferative responses (LPR) were evaluated, with special reference to the comparison between a group of women transmitting (T) and a group of non-transmitting (NT) the infection to fetus. While HCMV-specific CD4(+) T-cells reached at 90 days post-infection (p.i.) values comparable to RI, CD8(+) T-cells reached at 60 days p.i. levels significantly higher and persisting throughout the entire follow-up. Instead, IL-2 production and lymphoproliferative responses were lower in PI than RI for the entire follow-up period. Effector memory CD45RA(+) CD4(+) and CD8(+) HCMV-specific T-cells increased until 90 days p.i., reaching and maintaining levels higher than RI. The comparison between T and NT women showed that, at 30 days p.i., in NT women there was a significantly higher IL-2 production by HCMV-specific CD4(+) T-cells, and at 60 days p.i. a significantly higher frequency of both specific CD4(+) and CD8(+) CD45RA(+) T-cells. HCMV T-cell response appears to correlate with virus transmission to fetus and some parameters (CD4(+) lymphoproliferation, and frequency of HCMV-specific CD8(+) IL2(+) T-cells) may help in dating PI during pregnancy. J. Med. Virol. 88:1238-1246, 2016. © 2015 Wiley Periodicals, Inc. PMID:26680747

  10. Cytomegalovirus infection does not impact on survival or time to first treatment in patients with chronic lymphocytic leukemia.

    PubMed

    Parry, Helen Marie; Damery, Sarah; Hudson, Christopher; Maurer, Matthew J; Cerhan, James R; Pachnio, Annette; Begum, Jusnara; Slager, Susan L; Fegan, Christopher; Man, Stephen; Pepper, Christopher; Shanafelt, Tait D; Pratt, Guy; Moss, Paul A H

    2016-08-01

    Human cytomegalovirus (HCMV) is a widely prevalent herpes virus which establishes a state of chronic infection. The establishment of CMV-specific immunity controls viral reactivation and leads to the accumulation of very large numbers of virus-specific T cells which come to dominate the immune repertoire. There is concern that this may reduce the immune response to heterologous infections and HCMV infection has been associated with reduced survival in elderly people. Patients with chronic lymphocytic leukemia (B-CLL) suffer from a state of immune suppression but have a paradoxical increase in the magnitude of the CMV-specific T cell and humoral immune response. As such, there is now considerable interest in how CMV infection impacts on the clinical outcome of patients with B-CLL. Utilizing a large prospective cohort of patients with B-CLL (n = 347) we evaluated the relationship between HCMV seropositivity and patient outcome. HCMV seropositive patients had significantly worse overall survival than HCMV negative patients in univariate analysis (HR = 2.28, 95% CI: 1.34-3.88; P = 0.002). However, CMV seropositive patients were 4 years older than seronegative donors and this survival difference was lost in multivariate modeling adjusted for age and other validated prognostic markers (P = 0.34). No significant difference was found in multivariate modeling between HCMV positive and negative patients in relation to the time to first treatment (HR = 1.12, 95% CI: 0.68-1.84; P = 0.65). These findings in a second independent cohort of 236 B-CLL patients were validated. In conclusion no evidence that HCMV impacts on the clinical outcome of patients with B-CLL was found. Am. J. Hematol. 91:776-781, 2016. © 2016 Wiley Periodicals, Inc. PMID:27124884

  11. Impact of Persistent Cytomegalovirus Infection on Dynamic Changes in Human Immune System Profile

    PubMed Central

    Vescovini, Rosanna; Telera, Anna Rita; Pedrazzoni, Mario; Abbate, Barbara; Rossetti, Pietro; Verzicco, Ignazio; Arcangeletti, Maria Cristina; Medici, Maria Cristina; Calderaro, Adriana; Volpi, Riccardo; Sansoni, Paolo; Fagnoni, Francesco Fausto

    2016-01-01

    Human cytomegalovirus (HCMV) imprints the immune system after primary infection, however its effect during chronic infection still needs to be deciphered. In this study we report the variation of blood cell count along with anti-HCMV IgG and T cell responses to pp-65 and IE-1 antigens, that occurred after an interval of five years in a cohort of 25 seropositive healthy adults. We found increased anti-viral IgG antibody responses and intracellular interferon-gamma secreting CD8+ T cell responses to pp-65: a result consistent with memory inflation. With the only exception of shortage in naive CD8+ T cells most memory T cell subsets as well as total CD8+ T cells, T cells, lymphocytes, monocytes and leukocytes had increased. By contrast, none of the cell types tested were found to have increased in 14 subjects stably seronegative. Rather, in addition to a shortage in naive CD8+ T cells, also memory T cell subsets and most other cell types decreased, either in a statistically significant or non-significant manner. The trend of T cell pool representation with regard to CD4/CD8 ratio was in the opposing directions depending on HCMV serology. Globally, this study demonstrates different dynamic changes of most blood cell types depending on presence or absence of HCMV infection. Therefore, HCMV plays a continual role in modulating homeostasis of blood T cells and a broader expanding effect on other cell populations of lymphoid and myeloid origin. PMID:26990192

  12. LAG3 Expression in Active Mycobacterium tuberculosis Infections

    PubMed Central

    Phillips, Bonnie L.; Mehra, Smriti; Ahsan, Muhammad H.; Selman, Moises; Khader, Shabaana A.; Kaushal, Deepak

    2016-01-01

    Mycobacterium tuberculosis (MTB) is a highly successful pathogen because of its ability to persist in human lungs for long periods of time. MTB modulates several aspects of the host immune response. Lymphocyte-activation gene 3 (LAG3) is a protein with a high affinity for the CD4 receptor and is expressed mainly by regulatory T cells with immunomodulatory functions. To understand the function of LAG3 during MTB infection, a nonhuman primate model of tuberculosis, which recapitulates key aspects of natural human infection in rhesus macaques (Macaca mulatta), was used. We show that the expression of LAG3 is highly induced in the lungs and particularly in the granulomatous lesions of macaques experimentally infected with MTB. Furthermore, we show that LAG3 expression is not induced in the lungs and lung granulomas of animals exhibiting latent tuberculosis infection. However, simian immunodeficiency virus–induced reactivation of latent tuberculosis infection results in an increased expression of LAG3 in the lungs. This response is not observed in nonhuman primates infected with non-MTB bacterial pathogens, nor with simian immunodeficiency virus alone. Our data show that LAG3 was expressed primarily on CD4+ T cells, presumably by regulatory T cells but also by natural killer cells. The expression of LAG3 coincides with high bacterial burdens and changes in the host type 1 helper T-cell response. PMID:25549835

  13. High-Molecular-Weight Protein (pUL48) of Human Cytomegalovirus Is a Competent Deubiquitinating Protease: Mutant Viruses Altered in Its Active-Site Cysteine or Histidine Are Viable†

    PubMed Central

    Wang, Jianlei; Loveland, Amy N.; Kattenhorn, Lisa M.; Ploegh, Hidde L.; Gibson, Wade

    2006-01-01

    We show here that the high-molecular-weight protein (HMWP or pUL48; 253 kDa) of human cytomegalovirus (HCMV) is a functionally competent deubiquitinating protease (DUB). By using a suicide substrate probe specific for ubiquitin-binding cysteine proteases (DUB probe) to screen lysates of HCMV-infected cells, we found just one infected-cell-specific DUB. Characteristics of this protein, including its large size, expression at late times of infection, presence in extracellular virus particles, and reactivity with an antiserum to the HMWP, identified it as the HMWP. This was confirmed by constructing mutant viruses with substitutions in two of the putative active-site residues, Cys24Ile and His162Ala. HMWP with these mutations either failed to bind the DUB probe (C24I) or had significantly reduced reactivity with it (H162A). More compellingly, the deubiquitinating activity detected in wild-type virus particles was completely abolished in both the C24I and H162A mutants, thereby directly linking HMWP with deubiquitinating enzyme activity. Mutations in these active-site residues were not lethal to virus replication but slowed production of infectious virus relative to wild type and mutations of other conserved residues. Initial studies, by electron microscopy, of cells infected with the mutants revealed no obvious differences at late times of replication in the general appearance of the cells or in the distribution, relative numbers, or appearance of virus particles in the cytoplasm or nucleus. PMID:16731939

  14. Neuropathogenesis of Chikungunya infection: astrogliosis and innate immune activation.

    PubMed

    Inglis, Fiona M; Lee, Kim M; Chiu, Kevin B; Purcell, Olivia M; Didier, Peter J; Russell-Lodrigue, Kasi; Weaver, Scott C; Roy, Chad J; MacLean, Andrew G

    2016-04-01

    Chikungunya, "that which bends up" in the Makonde dialect, is an emerging global health threat, with increasing incidence of neurological complications. Until 2013, Chikungunya infection had been largely restricted to East Africa and the Indian Ocean, with cases within the USA reported to be from foreign travel. However, in 2014, over 1 million suspected cases were reported in the Americas, and a recently infected human could serve as an unwitting reservoir for the virus resulting in an epidemic in the continental USA. Chikungunya infection is increasingly being associated with neurological sequelae. In this study, we sought to understand the role of astrocytes in the neuropathogenesis of Chikungunya infection. Even after virus has been cleared form the circulation, astrocytes were activated with regard to TLR2 expression. In addition, white matter astrocytes were hypertrophic, with increased arbor volume in gray matter astrocytes. Combined, these would alter the number and distribution of synapses that each astrocyte would be capable of forming. These results provide the first evidence that Chikungunya infection induces morphometric and innate immune activation of astrocytes in vivo. Perturbed glia-neuron signaling could be a major driving factor in the development of Chikungunya-associated neuropathology. PMID:26419894

  15. RNase L Activates the NLRP3 Inflammasome During Viral Infections

    PubMed Central

    Chakrabarti, Arindam; Banerjee, Shuvojit; Franchi, Luigi; Loo, Yueh-Ming; Gale, Michael; Núñez, Gabriel; Silverman, Robert H.

    2015-01-01

    SUMMARY The NLRP3 inflammasome assembles in response to danger signals, triggering self-cleavage of procaspase-1 and production of the proinflammatory cytokine IL-1β. Although virus infection activates the NLRP3 inflammasome, the underlying events remain incompletely understood. We report that virus activation of the NLRP3 inflammasome involves the 2′,5′-oligoadenylate (2-5A) synthetase (OAS)/RNase L system, a component of the interferon-induced antiviral response that senses double stranded RNA and activates endoribonuclease RNase L to cleave viral and cellular RNAs. The absence of RNase L reduces IL-1β production in influenza A virus-infected mice. RNA cleavage products generated by RNase L enhance IL-1β production but require the presence of 2′,3′-cyclic phosphorylated termini characteristic of RNase L activity. Additionally, these cleavage products stimulate NLRP3 complex formation with the DExD/H-box helicase, DHX33, and mitochondrial adapter protein, MAVS, which are each required for effective NLRP3 inflammasome activation. Thus, RNA cleavage events catalyzed by RNase L are required for optimal inflammasome activation during viral infections. PMID:25816776

  16. Activated mouse eosinophils protect against lethal respiratory virus infection

    PubMed Central

    Percopo, Caroline M.; Dyer, Kimberly D.; Ochkur, Sergei I.; Luo, Janice L.; Fischer, Elizabeth R.; Lee, James J.; Lee, Nancy A.; Domachowske, Joseph B.

    2014-01-01

    Eosinophils are recruited to the airways as a prominent feature of the asthmatic inflammatory response where they are broadly perceived as promoting pathophysiology. Respiratory virus infections exacerbate established asthma; however, the role of eosinophils and the nature of their interactions with respiratory viruses remain uncertain. To explore these questions, we established acute infection with the rodent pneumovirus, pneumonia virus of mice (PVM), in 3 distinct mouse models of Th2 cytokine–driven asthmatic inflammation. We found that eosinophils recruited to the airways of otherwise naïve mice in response to Aspergillus fumigatus, but not ovalbumin sensitization and challenge, are activated by and degranulate specifically in response to PVM infection. Furthermore, we demonstrate that activated eosinophils from both Aspergillus antigen and cytokine-driven asthma models are profoundly antiviral and promote survival in response to an otherwise lethal PVM infection. Thus, although activated eosinophils within a Th2-polarized inflammatory response may have pathophysiologic features, they are also efficient and effective mediators of antiviral host defense. PMID:24297871

  17. Marine Peptides and Their Anti-Infective Activities

    PubMed Central

    Kang, Hee Kyoung; Seo, Chang Ho; Park, Yoonkyung

    2015-01-01

    Marine bioresources are a valuable source of bioactive compounds with industrial and nutraceutical potential. Numerous clinical trials evaluating novel chemotherapeutic agents derived from marine sources have revealed novel mechanisms of action. Recently, marine-derived bioactive peptides have attracted attention owing to their numerous beneficial effects. Moreover, several studies have reported that marine peptides exhibit various anti-infective activities, such as antimicrobial, antifungal, antimalarial, antiprotozoal, anti-tuberculosis, and antiviral activities. In the last several decades, studies of marine plants, animals, and microbes have revealed tremendous number of structurally diverse and bioactive secondary metabolites. However, the treatments available for many infectious diseases caused by bacteria, fungi, and viruses are limited. Thus, the identification of novel antimicrobial peptides should be continued, and all possible strategies should be explored. In this review, we will present the structures and anti-infective activity of peptides isolated from marine sources (sponges, algae, bacteria, fungi and fish) from 2006 to the present. PMID:25603351

  18. Antimicrobial activity of Acanthus ilicifolius: Skin infection pathogens

    PubMed Central

    Govindasamy, Chinnavenkataraman; Arulpriya, Mani

    2013-01-01

    Objective To investigate the antimicrobial activity of Acanthus ilicifolius against the skin infecting bacterial and fungal pathogens. Through the literature survey, the mangrove plant Acanthus ilicifolius was used in skin infection diseases and have potential anti-inflammatory activity. Methods Antimicrobial activity of the leaf extracts was tested using agar well diffusion method. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were carried out. Results Among the different extracts, chloroform extract showed maximum activity against the bacterial pathogens methicillin-resistant Staphylococcus aureus, Streptococcus pyogenes, Pseudomonas aeruginosa, Candida albicans and Trichophyton rubrum. Methanol and acetone extracts showed maximum activity against Staphylococcus epidermis and Lactobacillus plantarum respectively. Chloroform extracts showed the lowest MIC (0.5 mg/mL) and MBC (2 mg/mL) values against the skin pathogens compared with other extracts. Phytochemical screening revealed the presence of resins, steroids, tannins, glycosides, sugars, carbohydrates, saponins, sterols, terpenoids, phenol, alkaloids, cardiac glycosides and catechol. Conclusions Further, the separation of potential compounds from the crude extracts will be useful for control the skin infection pathogens.

  19. Gelsolin activity controls efficient early HIV-1 infection

    PubMed Central

    2013-01-01

    Background HIV-1 entry into target lymphocytes requires the activity of actin adaptors that stabilize and reorganize cortical F-actin, like moesin and filamin-A. These alterations are necessary for the redistribution of CD4-CXCR4/CCR5 to one pole of the cell, a process that increases the probability of HIV-1 Envelope (Env)-CD4/co-receptor interactions and that generates the tension at the plasma membrane necessary to potentiate fusion pore formation, thereby favouring early HIV-1 infection. However, it remains unclear whether the dynamic processing of F-actin and the amount of cortical actin available during the initial virus-cell contact are required to such events. Results Here we show that gelsolin restructures cortical F-actin during HIV-1 Env-gp120-mediated signalling, without affecting cell-surface expression of receptors or viral co-receptor signalling. Remarkably, efficient HIV-1 Env-mediated membrane fusion and infection of permissive lymphocytes were impaired when gelsolin was either overexpressed or silenced, which led to a loss or gain of cortical actin, respectively. Indeed, HIV-1 Env-gp120-induced F-actin reorganization and viral receptor capping were impaired under these experimental conditions. Moreover, gelsolin knockdown promoted HIV-1 Env-gp120-mediated aberrant pseudopodia formation. These perturbed-actin events are responsible for the inhibition of early HIV-1 infection. Conclusions For the first time we provide evidence that through its severing of cortical actin, and by controlling the amount of actin available for reorganization during HIV-1 Env-mediated viral fusion, entry and infection, gelsolin can constitute a barrier that restricts HIV-1 infection of CD4+ lymphocytes in a pre-fusion step. These findings provide important insights into the complex molecular and actin-associated dynamics events that underlie early viral infection. Thus, we propose that gelsolin is a new factor that can limit HIV-1 infection acting at a pre-fusion step

  20. Viral binding-induced signaling drives a unique and extended intracellular trafficking pattern during infection of primary monocytes.

    PubMed

    Kim, Jung Heon; Collins-McMillen, Donna; Caposio, Patrizia; Yurochko, Andrew D

    2016-08-01

    We initiated experiments to examine the infection of monocytes postentry. New data show that human cytomegalovirus (HCMV) DNA is detected in the nucleus beginning only at 3 d postinfection in monocytes, compared with 30 min postinfection in fibroblasts and endothelial cells, suggesting that HCMV nuclear translocation in monocytes is distinct from that seen in other cell types. We now show that HCMV is initially retained in early endosomes and then moves sequentially to the trans-Golgi network (TGN) and recycling endosomes before nuclear translocation. HCMV is retained initially as a mature particle before deenvelopment in recycling endosomes. Disruption of the TGN significantly reduced nuclear translocation of viral DNA, and HCMV nuclear translocation in infected monocytes was observed only when correct gH/gL/UL128-131/integrin/c-Src signaling occurred. Taken together, our findings show that viral binding of the gH/gL/UL128-131 complex to integrins and the ensuing c-Src signaling drive a unique nuclear translocation pattern that promotes productive infection and avoids viral degradation, suggesting that it represents an additional viral evasion/survival strategy. PMID:27432979

  1. Localised mitogenic activity in horses following infection with Streptococcus equi.

    PubMed

    McLean, R; Rash, N L; Robinson, C; Waller, A S; Paillot, R

    2015-06-01

    Streptococcus equi subspecies equi (S. equi) is the causative agent of strangles, a highly contagious upper respiratory disease of equids. Streptococcus equi produces superantigens (sAgs), which are thought to contribute to strangles pathogenicity through non-specific T-cell activation and pro-inflammatory response. Streptococcus equi infection induces abscesses in the lymph nodes of the head and neck. In some individuals, some abscess material remains into the guttural pouch and inspissates over time to form chondroids which can harbour live S. equi. The aim of this study was to determine the sites of sAg production during infection and therefore improve our understanding of their role. Abscess material, chondroids and serum collected from Equidae with signs of strangles were tested in mitogenic assays. Mitogenic sAg activity was only detected in abscess material and chondroids. Our data support the localised in vivo activity of sAg during both acute and carrier phases of S. equi infection. PMID:25841794

  2. Macrophage Activation by Ursolic and Oleanolic Acids during Mycobacterial Infection.

    PubMed

    López-García, Sonia; Castañeda-Sanchez, Jorge Ismael; Jiménez-Arellanes, Adelina; Domínguez-López, Lilia; Castro-Mussot, Maria Eugenia; Hernández-Sanchéz, Javier; Luna-Herrera, Julieta

    2015-01-01

    Oleanolic (OA) and ursolic acids (UA) are triterpenes that are abundant in vegetables, fruits and medicinal plants. They have been described as active moieties in medicinal plants used for the treatment of tuberculosis. In this study, we analyzed the effects of these triterpenes on macrophages infected in vitro with Mycobacterium tuberculosis (MTB). We evaluated production of nitric oxide (NO), reactive oxygen species (ROS), and cytokines (TNF-α and TGF-β) as well as expression of cell membrane receptors (TGR5 and CD36) in MTB-infected macrophages following treatment with OA and UA. Triterpenes caused reduced MTB growth in macrophages, stimulated production of NO and ROS in the early phase, stimulated TNF-α, suppressed TGF-β and caused over-expression of CD36 and TGR5 receptors. Thus, our data suggest immunomodulatory properties of OA and UA on MTB infected macrophages. In conclusion, antimycobacterial effects induced by these triterpenes may be attributable to the conversion of macrophages from stage M2 (alternatively activated) to M1 (classically activated). PMID:26287131

  3. 5-Lipoxygenase Activity Increases Susceptibility to Experimental Paracoccidioides brasiliensis Infection

    PubMed Central

    Tristão, Fabrine Sales Massafera; Rocha, Fernanda Agostini; Moreira, Ana Paula; Cunha, Fernando Queiroz; Rossi, Marcos Antonio

    2013-01-01

    Paracoccidioidomycosis (PCM) is a systemic mycosis caused by the thermodimorphic fungus Paracoccidioides brasiliensis. Leukotrienes and lipoxins are lipid mediators produced after 5-lipoxygenase (5-LO) activation that exhibit pro- and anti-inflammatory roles, respectively. Here, we have investigated the contribution of 5-LO enzymatic activity in PCM using an experimental model of P. brasiliensis infection. B6.129 wild-type (B6.129) and 5-LO-deficient (5-LO−/−) mice were intravenously inoculated with a virulent strain of P. brasiliensis (Pb18), and the survival rate of the infected mice was investigated on different days after yeast infection. 5-LO−/− mice exhibited an increased survival rate associated with a decreased number of CFU. The resistance of 5-LO−/− during PCM was associated with augmented nitric oxide (NO) production and the formation of compact granulomas. In addition, the absence of 5-LO was associated with a diminished number of CD4+ CD25+ regulatory T cells, higher levels of gamma interferon and interleukin-12, and increased T-bet (a T-box transcription factor that directs Th1 lineage commitment) mRNA levels in the lungs. Taken together, our results show for the first time that 5-LO enzymatic activity increases susceptibility to P. brasiliensis, suggesting that this pathway may be a potential target for therapeutic intervention during PCM. PMID:23381993

  4. Maintenance of Large Numbers of Virus Genomes in Human Cytomegalovirus-Infected T98G Glioblastoma Cells

    PubMed Central

    Duan, Ying-Liang; Ye, Han-Qing; Zavala, Anamaria G.; Yang, Cui-Qing; Miao, Ling-Feng; Fu, Bi-Shi; Seo, Keun Seok; Davrinche, Christian

    2014-01-01

    ABSTRACT After infection, human cytomegalovirus (HCMV) persists for life. Primary infections and reactivation of latent virus can both result in congenital infection, a leading cause of central nervous system birth defects. We previously reported long-term HCMV infection in the T98G glioblastoma cell line (1). HCMV infection has been further characterized in T98Gs, emphasizing the presence of HCMV DNA over an extended time frame. T98Gs were infected with either HCMV Towne or AD169-IE2-enhanced green fluorescent protein (eGFP) strains. Towne infections yielded mixed IE1 antigen-positive and -negative (Ag+/Ag−) populations. AD169-IE2-eGFP infections also yielded mixed populations, which were sorted to obtain an IE2− (Ag−) population. Viral gene expression over the course of infection was determined by immunofluorescent analysis (IFA) and reverse transcription-PCR (RT-PCR). The presence of HCMV genomes was determined by PCR, nested PCR (n-PCR), and fluorescence in situ hybridization (FISH). Compared to the HCMV latency model, THP-1, Towne-infected T98Gs expressed IE1 and latency-associated transcripts for longer periods, contained many more HCMV genomes during early passages, and carried genomes for a greatly extended period of passaging. Large numbers of HCMV genomes were also found in purified Ag− AD169-infected cells for the first several passages. Interestingly, latency transcripts were observed from very early times in the Towne-infected cells, even when IE1 was expressed at low levels. Although AD169-infected Ag− cells expressed no detectable levels of either IE1 or latency transcripts, they also maintained large numbers of genomes within the cell nuclei for several passages. These results identify HCMV-infected T98Gs as an attractive new model in the study of the long-term maintenance of virus genomes in the context of neural cell types. IMPORTANCE Our previous work showed that T98G glioblastoma cells were semipermissive to HCMV infection; virus

  5. Anticoccidial activities of Chitosan on Eimeria papillata-infected mice.

    PubMed

    Abdel-Latif, Mahmoud; Abdel-Haleem, Heba M; Abdel-Baki, Abdel-Azeem S

    2016-07-01

    Eimeria spp. multiply within the intestinal tract causing severe inflammatory responses. Chitosan (CS), meanwhile, has been shown to exhibit anti-inflammatory activities in different experimental models. Here, we investigated the effect of CS on the outcome of inflammation caused by Eimeria papillata in the mouse intestine. Investigations were undertaken into the oocyst output in feces and developmental stages and goblet cells in intestinal tissue. Assays for lipid peroxidation, nitric oxide (NO), and myeloperoxidase (MPO) were also performed. T cells in intestinal tissue were counted using immunohistochemistry while total IgA in serum or intestinal wash was assayed using ELISA. In addition, mRNA expression of tumor necrosis factor alpha (TNF-α), transforming growth factor β (TGF-β), interleukin (IL)-10, and IL-4 were detected using real-time PCR. The data indicated a reduction in both oocyst output and in the number of parasite developmental stages following CS treatment, while the goblet cell hypoplasia in infected mice was also inhibited. CS decreased lipid peroxidation, NO, and MPO but did not alter the T cell count or IgA levels in comparison to the infected group. The expression of TNF-α and TGF-β decreased but IL-10 and IL-4 increased after CS treatment in comparison to the non-treated infected group. In conclusion, CS showed anti-inflammatory and protective effects against E. papillata infection. PMID:27041340

  6. Epstein-Barr virus infection induces bone resorption in apical periodontitis via increased production of reactive oxygen species.

    PubMed

    Jakovljevic, Aleksandar; Andric, Miroslav; Miletic, Maja; Beljic-Ivanovic, Katarina; Knezevic, Aleksandra; Mojsilovic, Slavko; Milasin, Jelena

    2016-09-01

    Chronic inflammatory processes in periapical tissues caused by etiological agents of endodontic origin lead to apical periodontitis. Apart from bacteria, two herpesviruses, Epstein-Barr virus (EBV) and Human cytomegalovirus (HCMV) are recognized as putative pathogens in apical periodontitis. Although previous reports suggest the involvement of EBV in the pathogenesis of apical periodontitis, its exact role in periapical bone resorption has not yet been fully elucidated. We hypothesize that EBV infection in apical periodontitis is capable of inducing periapical bone resorption via stimulation of reactive oxygen species (ROS) overproduction. Increased levels of ROS induce expression of receptor activator of nuclear factor kappa B (NF-κB) ligand (RANKL). RANKL binding to receptor activator of nuclear factor κB (RANK) present on the surface of preosteoclasts induces their maturation and activation which consequently leads to bone resorption. The potential benefit of antiviral and antioxidant-based therapies in periapical bone resorption treatment remains to be assessed. PMID:27515196

  7. Laboratory and clinical aspects of human herpesvirus 6 infections.

    PubMed

    Agut, Henri; Bonnafous, Pascale; Gautheret-Dejean, Agnès

    2015-04-01

    Human herpesvirus 6 (HHV-6) is a widespread betaherpesvirus which is genetically related to human cytomegalovirus (HCMV) and now encompasses two different species: HHV-6A and HHV-6B. HHV-6 exhibits a wide cell tropism in vivo and, like other herpesviruses, induces a lifelong latent infection in humans. As a noticeable difference with respect to other human herpesviruses, genomic HHV-6 DNA is covalently integrated into the subtelomeric region of cell chromosomes (ciHHV-6) in about 1% of the general population. Although it is infrequent, this may be a confounding factor for the diagnosis of active viral infection. The diagnosis of HHV-6 infection is performed by both serologic and direct methods. The most prominent technique is the quantification of viral DNA in blood, other body fluids, and organs by means of real-time PCR. Many active HHV-6 infections, corresponding to primary infections, reactivations, or exogenous reinfections, are asymptomatic. However, the virus may be the cause of serious diseases, particularly in immunocompromised individuals. As emblematic examples of HHV-6 pathogenicity, exanthema subitum, a benign disease of infancy, is associated with primary infection, whereas further virus reactivations can induce severe encephalitis cases, particularly in hematopoietic stem cell transplant recipients. Generally speaking, the formal demonstration of the causative role of HHV-6 in many acute and chronic human diseases is difficult due to the ubiquitous nature of the virus, chronicity of infection, existence of two distinct species, and limitations of current investigational tools. The antiviral compounds ganciclovir, foscarnet, and cidofovir are effective against active HHV-6 infections, but the indications for treatment, as well as the conditions of drug administration, are not formally approved to date. There are still numerous pending questions about HHV-6 which should stimulate future research works on the pathophysiology, diagnosis, and therapy of

  8. Laboratory and Clinical Aspects of Human Herpesvirus 6 Infections

    PubMed Central

    Bonnafous, Pascale; Gautheret-Dejean, Agnès

    2015-01-01

    SUMMARY Human herpesvirus 6 (HHV-6) is a widespread betaherpesvirus which is genetically related to human cytomegalovirus (HCMV) and now encompasses two different species: HHV-6A and HHV-6B. HHV-6 exhibits a wide cell tropism in vivo and, like other herpesviruses, induces a lifelong latent infection in humans. As a noticeable difference with respect to other human herpesviruses, genomic HHV-6 DNA is covalently integrated into the subtelomeric region of cell chromosomes (ciHHV-6) in about 1% of the general population. Although it is infrequent, this may be a confounding factor for the diagnosis of active viral infection. The diagnosis of HHV-6 infection is performed by both serologic and direct methods. The most prominent technique is the quantification of viral DNA in blood, other body fluids, and organs by means of real-time PCR. Many active HHV-6 infections, corresponding to primary infections, reactivations, or exogenous reinfections, are asymptomatic. However, the virus may be the cause of serious diseases, particularly in immunocompromised individuals. As emblematic examples of HHV-6 pathogenicity, exanthema subitum, a benign disease of infancy, is associated with primary infection, whereas further virus reactivations can induce severe encephalitis cases, particularly in hematopoietic stem cell transplant recipients. Generally speaking, the formal demonstration of the causative role of HHV-6 in many acute and chronic human diseases is difficult due to the ubiquitous nature of the virus, chronicity of infection, existence of two distinct species, and limitations of current investigational tools. The antiviral compounds ganciclovir, foscarnet, and cidofovir are effective against active HHV-6 infections, but the indications for treatment, as well as the conditions of drug administration, are not formally approved to date. There are still numerous pending questions about HHV-6 which should stimulate future research works on the pathophysiology, diagnosis, and

  9. Antimicrobial activity of Lactobacillus against microbial flora of cervicovaginal infections

    PubMed Central

    Dasari, Subramanyam; Shouri, Raju Naidu Devanaboyaina; Wudayagiri, Rajendra; Valluru, Lokanatha

    2014-01-01

    Objective To assess the probiotic nature of Lactobacillus in preventing cervical pathogens by studying the effectiveness of antimicrobial activity against vaginal pathogens. Methods Lactobacilli were isolated from healthy vaginal swabs on selective media and different pathogenic bacteria were isolated by using different selective media. The Lactobacillus strains were tested for the production of hydrogen peroxide and antimicrobial compounds along with probiotic properties. Results Of the 10 isolated Lactobacillus strains, strain 1, 3 and 6 are high hydrogen peroxide producers and the rest were low producers. Results of pH and amines tests indicated that pH increased with fishy odour in the vaginal fluids of cervicovaginal infection patients when compared with vaginal fluids of healthy persons. The isolates were found to be facultative anaerobic, Gram-positive, non-spore-forming, non-capsule forming and catalase-negative bacilli. The results of antimicrobial activity of compounds indicated that 280 and 140 µg/mL was the minimum concentration to inhibit the growth of both pathogens and test organisms respectively. Conclusions The results demonstrated that Lactobacillus producing antimicrobial compounds inhibits the growth of cervical pathogens, revealing that the hypothesis of preventing vaginal infection by administering probiotic organisms has a great appeal to patients, which colonize the vagina to help, restore and maintain healthy vagina.

  10. Discordant humoral and cellular immune responses to Cytomegalovirus (CMV) in glioblastoma patients whose tumors are positive for CMV

    PubMed Central

    Rahbar, Afsar; Peredo, Inti; Solberg, Nina Wolmer; Taher, Chato; Dzabic, Mensur; Xu, Xinling; Skarman, Petra; Fornara, Olesja; Tammik, Charlotte; Yaiw, Koon; Wilhelmi, Vanessa; Assinger, Alice; Stragliotto, Giuseppe; Söderberg-Naucler, Cecilia

    2015-01-01

    Background. Glioblastoma (GBM) is the most common malignant brain tumor in adults and is nearly always fatal. Emerging evidence suggests that human Cytomegalovirus (HCMV) is present in 90–100% of GBMs and that add-on antiviral treatment for HCMV show promise to improve survival. Methods. In a randomized, placebo-controlled trial of valganciclovir in 42 GBM patients, blood samples were collected for analyses of HCMV DNA, RNA, reactivity against HCMV peptides, IgG, and IgM at baseline and at 3, 12, and 24 weeks of treatment. Results. All 42 tumors were positive for HCMV protein. All patients examined had at least one blood sample positive for HCMV DNA, 63% were HCMV RNA positive, and 21% were IgM positive. However, 29% of GBM patients were IgG negative for HCMV. Five of these samples were positive in an enzyme-linked immunosorbent assay (ELISA) that used antigens derived from a clinical isolate. Blood T cells from 11 of 13 (85%) HCMV IgG-negative GBM patients reacted against HCMV peptides. Valganciclovir did not affect IgG titers, DNA, or RNA levels of the HCMV immediate early (HCMV IE) gene in blood. Conclusion. In GBM patients, HCMV activity is higher than in healthy controls and serology is a poor test to define previous or active HCMV infection in these patients. PMID:25949880

  11. Killing of Kaposi's sarcoma-associated herpesvirus-infected fibroblasts during latent infection by activated natural killer cells

    PubMed Central

    Matthews, Nick C; Goodier, Martin R; Robey, Rebecca C; Bower, Mark; Gotch, Frances M

    2011-01-01

    Abstract Kaposi's sarcoma-associated herpesvirus (KSHV) establishes life-long infection by evading clearance by the host immune system. In de novo infection and lytic replication, KSHV escapes cytotoxic T cells and NK cells through downregulation of MHC class-I and ICAM-1 molecules and associated antigens involved in forming and sustaining the immunological synapse. However, the efficacy of such mechanisms in the context of the predominantly latent KSHV infection reported in Kaposi's sarcoma (KS) lesions is unclear. Using primary dermal fibroblasts in a novel in vitro model of chronic latent KSHV infection, we generated target cells with viral loads similar to those in spindle cells extracted from KS lesions. We show that latently KSHV-infected fibroblasts had normal levels of MHC-class I, ICAM-1, HLA-E and NKG2D ligand expression, were resistant to NK-cell natural cytotoxicity and were highly susceptible to killing by cytokine-activated immunocompetent NK cells. KSHV-infected fibroblasts expressed normal levels of IFN-γR1 and responded to exogenous IFN-γ by upregulating MHC class I, ICAM-1 and HLA-E and resisting activated NK-cell killing. These data demonstrate that physiologically relevant levels of latent KSHV infection in primary cells cause limited activation of resting NK cells and confer little specific resistance to control by activated NK cells. PMID:21509779

  12. Diagnosis and management of human cytomegalovirus infection in the mother, fetus, and newborn infant.

    PubMed

    Revello, Maria Grazia; Gerna, Giuseppe

    2002-10-01

    Human cytomegalovirus (HCMV) is the leading cause of congenital viral infection and mental retardation. HCMV infection, while causing asymptomatic infections in most immunocompetent subjects, can be transmitted during pregnancy from the mother with primary (and also recurrent) infection to the fetus. Hence, careful diagnosis of primary infection is required in the pregnant woman based on the most sensitive serologic assays (immunoglobulin M [IgM] and IgG avidity assays) and conventional virologic and molecular procedures for virus detection in blood. Maternal prognostic markers of fetal infection are still under investigation. If primary infection is diagnosed in a timely manner, prenatal diagnosis can be offered, including the search for virus and virus components in fetal blood and amniotic fluid, with fetal prognostic markers of HCMV disease still to be defined. However, the final step for definite diagnosis of congenital HCMV infection is detection of virus in the blood or urine in the first 1 to 2 weeks of life. To date, treatment of congenital infection with antiviral drugs is only palliative both prior to and after birth, whereas the only efficacious preventive measure seems to be the development of a safe and immunogenic vaccine, including recombinant, subunit, DNA, and peptide-based vaccines now under investigation. The following controversial issues are discussed in the light of the most recent advances in the field: the actual perception of the problem; universal serologic screening before pregnancy; the impact of correct counseling on decision making by the couple involved; the role of prenatal diagnosis in ascertaining transmission of virus to the fetus; the impact of preconceptional and periconceptional infections on the prevalence of congenital infection; and the prevalence of congenitally infected babies born to mothers who were immune prior to pregnancy compared to the number born to mothers undergoing primary infection during pregnancy. PMID

  13. Eugenol nanocapsule for enhanced therapeutic activity against periodontal infections.

    PubMed

    Pramod, Kannissery; Aji Alex, M R; Singh, Manisha; Dang, Shweta; Ansari, Shahid H; Ali, Javed

    2016-01-01

    Eugenol is a godsend to dental care due to its analgesic, local anesthetic, and anti-inflammatory and antibacterial effects. The aim of the present research work was to prepare, characterize and evaluate eugenol-loaded nanocapsules (NCs) against periodontal infections. Eugenol-loaded polycaprolactone (PCL) NCs were prepared by solvent displacement method. The nanometric size of the prepared NCs was confirmed by transmission electron microscopy (TEM), scanning electron microscopy (SEM) and atomic force microscopy (AFM). The in vitro drug release was found to follow a biphasic pattern and followed Michaelis-Menten like model. The percentage cell viability values near to 100 in the cell viability assay indicated that the NCs are not cytotoxic. In the in vivo studies, the eugenol NC group displayed significant difference in the continuity of epithelium of the interdental papilla in comparison to the untreated, pure eugenol and placebo groups. The in vivo performance of the eugenol-loaded NCs using ligature-induced periodontitis model in rats indicated that eugenol-loaded NCs could prevent septal bone resorption in periodontitis. On the basis of our research findings it could be concluded that eugenol-loaded PCL NCs could serve as a novel colloidal drug delivery system for enhanced therapeutic activity of eugenol in the treatment of periodontal infections. PMID:26079717

  14. Immune Adaptation to Environmental Influence: The Case of NK Cells and HCMV.

    PubMed

    Rölle, Alexander; Brodin, Petter

    2016-03-01

    The immune system of an individual human is determined by heritable traits and a continuous process of adaptation to a broad variety of extrinsic, non-heritable factors such as viruses, bacteria, dietary components and more. Cytomegalovirus (CMV) successfully infects the majority of the human population and establishes latency, thereby exerting a life-long influence on the immune system of its host. CMV has been shown to influence the majority of immune parameters in healthy individuals. Here we focus on adaptive changes induced by CMV in subsets of Natural Killer (NK) cells, changes that question our very definition of adaptive and innate immunity by suggesting that adaptations of immune cells to environmental influences occur across the entire human immune system and not restricted to the classical adaptive branch of the immune system. PMID:26869205

  15. [Highly Active AntiRetroviral Therapy and opportunistic protozoan infections].

    PubMed

    Pozio, E

    2004-06-01

    Opportunistic parasite infections (OPIs) are an important cause of morbidity and mortality in persons infected with HIV. In industrialised countries, the use of Highly Active AntiRetroviral Therapy (HAART) results to be effective in suppressing the HIV viral load, with a quantitative and qualitative improvement in the CD4+ T-cell count followed by a strong reduction of opportunistic infections including those caused by parasites. These successes have been mainly attributed to the reconstitution of the cell immunity, which play the most important role in controlling OPIs. However, there are many clinical reports and several laboratory results, which suggest that the control of OPIs in HIV-positive persons under HAART is also induced by the anti-HIV protease inhibitors (PIs), which inhibit the aspartyl proteases of the parasites. The non-conventional use of HIV-PIs seems to be an alternative way for the treatment of parasitic infections, which should be deeply investigated. Of five longitudinal studies carried out before and after the introduction of HAART, four studies showed a strong reduction of toxoplasmic encephalitis (TE) in HIV-positive persons under HAART, whereas in another study, no difference was observed in the incidence rate of TE before and after the introduction of HAART. The influence of HAART in reducing TE has been also confirmed in a randomised, controlled clinical trial, which showed that there is no increase in the risk of developing TE after beginning HAART, even though HIV-infected persons with TE had a discontinuing prophylaxis for Toxoplasma gondii. Four HIV protease inhibitors were tested against the T. gondii virulent RH strain in vitro, alone or in association with pyrimethamine or sulfadiazine. Ritonavir and nelfinavir were highly inhibitory for the parasite growth. Furthermore, none of the antiviral drugs negatively affected the anti-Toxoplasma activity of pyrimethamine or sulfadiazine. In HIV-Leishmania co-infections, a changing pattern

  16. Antiviral activity of CYC202 in HIV-1-infected cells.

    PubMed

    Agbottah, Emmanuel; de La Fuente, Cynthia; Nekhai, Sergie; Barnett, Anna; Gianella-Borradori, Athos; Pumfery, Anne; Kashanchi, Fatah

    2005-01-28

    There are currently 40 million individuals in the world infected with human immunodeficiency virus (HIV). The introduction of highly active antiretroviral therapy (HAART) has led to a significant reduction in AIDS-related morbidity and mortality. Unfortunately, up to 25% of patients discontinue their initial HAART regimen. Current HIV-1 inhibitors target the fusion of the virus to the cell and two viral proteins, reverse transcriptase and protease. Here, we examined whether other targets, such as an activated transcription factor, could be targeted to block HIV-1 replication. We specifically asked whether we could target a cellular kinase needed for HIV-1 transcription using CYC202 (R-roscovitine), a pharmacological cyclin-dependent kinase inhibitor. We targeted the cdk2-cyclin E complex in HIV-1-infected cells because both cdk2 and cyclin E are nonessential during mammalian development and are likely replaced by other kinases. We found that CYC202 effectively inhibits wild type and resistant HIV-1 mutants in T-cells, monocytes, and peripheral blood mononuclear cells at a low IC(50) and sensitizes these cells to enhanced apoptosis resulting in a dramatic drop in viral titers. Interestingly, the effect of CYC202 is independent of cell cycle stage and more specific for the cdk2-cyclin E complex. Finally, we show that cdk2-cyclin E is loaded onto the HIV-1 genome in vivo and that CYC202 is able to inhibit the uploading of this cdk-cyclin complex onto HIV-1 DNA. Therefore, targeting cellular enzymes necessary for HIV-1 transcription, which are not needed for cell survival, is a compelling strategy to inhibit wild type and mutant HIV-1 strains. PMID:15531588

  17. Vascular dysfunction in young, mid-aged and aged mice with latent cytomegalovirus infections

    PubMed Central

    Gombos, R. B.; Brown, J. C.; Teefy, J.; Gibeault, R. L.; Conn, K. L.; Schang, L. M.

    2013-01-01

    Human cytomegalovirus (HCMV) is associated with vascular diseases in both immunosuppressed and immunocompetent individuals. CMV infections cycle between active and latent phases throughout life. We and others have shown vascular dysfunction during active mouse CMV (mCMV) infections. Few studies have examined changes in physiology during latent CMV infections, particularly vascular responses or whether the negative effects of aging on vascular function and fertility will be exacerbated under these conditions. We measured vascular responses in intact mesenteric and uterine arteries dissected from young, mid-aged, and aged latently mCMV-infected (mCMV genomes are present but infectious virus is undetectable) and age-matched uninfected mice using a pressure myograph. We tested responses to the α1-adrenergic agonist phenylephrine, the nitric oxide donor sodium nitroprusside, and the endothelium-dependent vasodilator methacholine. In young latently mCMV-infected mice, vasoconstriction was increased and vasodilation was decreased in mesenteric arteries, whereas both vasoconstriction and vasodilation were increased in uterine arteries compared with those in age-matched uninfected mice. In reproductively active mid-aged latently infected mice, mesenteric arteries showed little change, whereas uterine arteries showed greatly increased vasoconstriction. These vascular effects may have contributed to the decreased reproductive success observed in mid-aged latently mCMV-infected compared with age-matched uninfected mice (16.7 vs. 46.7%, respectively). In aged latently infected mice, vasodilation is increased in mesenteric and uterine arteries likely to compensate for increased vasoconstriction to mediators other than phenylephrine. The novel results of this study show that even when active mCMV infections become undetectable, vascular dysfunction continues and differs with age and artery origin. PMID:23125213

  18. Elevated glycosyltransferase activities in infected or traumatized hosts: nonspecific response to inflammation.

    PubMed Central

    Canonico, P G; Little, J S; Powanda, M C; Bostian, K A; Beisel, W R

    1980-01-01

    Streptococcus pneumoniae infection leads to multifold increases in sialyltransferase, galactosyltransferase, alpha 2-fucosyltransferase, and alpha 3-fucosyltransferase activity of rat liver. Such changes may reflect an increased demand for glycosylation of acute-phase proteins synthesized and secreted by the liver during inflammatory processes. Serum sialyltransferase became elevated in bacteria-infected or burned rats and sandfly fever-infected humans, but did not correlate with acute-phase serum protein changes. These data suggest that nonparenchymal liver cells, such as macrophages, may contribute substantially to elevated sialyltransferase activity in the circulation during infection and, as such, represent a general host response to infection and tissue trauma. PMID:6156910

  19. Inhibition of IL-1β Transcription by Peptides Derived from the hCMV IE2 Transactivator

    PubMed Central

    Listman, James; Race, JoAnne E.; Walker-Kopp, Nancy; Unlu, Sebnem; Auron, Philip E.

    2008-01-01

    The immediate early (IE) proteins of human cytomegalovirus (hCMV) have diverse roles in directing viral and host cell transcription. Among these is the ability of IE2 to induce transcription of the IL1B gene that codes for IL-1β in monocytes. This function is partially explained by interaction between IE2 and the host cell transcription factor Spi-1/PU.1 (Spi-1). We now show that maximal IE2 function also depends on productive interactions localizing to two C/EBP sites on the IL1B promoter suggesting either bi- or tri-molecular interactions between IE2, Spi-1 and C/EBPβ at two different locations on the promoter. The IE2 interaction region on Spi-1 was previously mapped to the DNA-binding ETS domain and overlaps the region of Spi-1 that interacts with the transcription factor C/EBPβ, a factor known to be critical for the induction of IL1B in response to Toll/IL-1 receptor (TIR) family signal transduction. The Spi-1 interacting region of IE2 maps to amino acids 315–328, a sequence that also interacts with the bZIP domain of C/EBPβ. An expression vector coding for amino acids 291–364 of IE2 can suppress LPS induction of a cotransfected IL1B enhancer-promoter fragment in a monocyte cell line. This inhibition is likely the result of competition between Spi-1 and C/EBPβ, thus blunting gene induction. PMID:18308397

  20. Aryl-alkyl-lysines: Membrane-Active Small Molecules Active against Murine Model of Burn Infection.

    PubMed

    Ghosh, Chandradhish; Manjunath, Goutham B; Konai, Mohini M; Uppu, Divakara S S M; Paramanandham, Krishnamoorthy; Shome, Bibek R; Ravikumar, Raju; Haldar, Jayanta

    2016-02-12

    Infections caused by drug-resistant Gram-negative pathogens continue to be significant contributors to human morbidity. The recent advent of New Delhi metallo-β-lactamase-1 (blaNDM-1) producing pathogens, against which few drugs remain active, has aggravated the problem even further. This paper shows that aryl-alkyl-lysines, membrane-active small molecules, are effective in treating infections caused by Gram-negative pathogens. One of the compounds of the study was effective in killing planktonic cells as well as dispersing biofilms of Gram-negative pathogens. The compound was extremely effective in disrupting preformed biofilms and did not select resistant bacteria in multiple passages. The compound retained activity in different physiological conditions and did not induce any toxic effect in female Balb/c mice until concentrations of 17.5 mg/kg. In a murine model of Acinetobacter baumannii burn infection, the compound was able to bring the bacterial burden down significantly upon topical application for 7 days. PMID:27624962

  1. IRE1α mediates PKR activation in response to Chlamydia trachomatis infection.

    PubMed

    Webster, Steve J; Ellis, Lou; O'Brien, Louise M; Tyrrell, Beatrice; Fitzmaurice, Timothy J; Elder, Matthew J; Clare, Simon; Chee, Ronnie; Gaston, J S Hill; Goodall, Jane C

    2016-01-01

    Protein kinase RNA activated (PKR) is a crucial mediator of anti-viral responses but is reported to be activated by multiple non-viral stimuli. However, mechanisms underlying PKR activation, particularly in response to bacterial infection, remain poorly understood. We have investigated mechanisms of PKR activation in human primary monocyte-derived dendritic cells in response to infection by Chlamydia trachomatis. Infection resulted in potent activation of PKR that was dependent on TLR4 and MyD88 signalling. NADPH oxidase was dispensable for activation of PKR as cells from chronic granulomatous disease (CGD) patients, or mice that lack NADPH oxidase activity, had equivalent or elevated PKR activation. Significantly, stimulation of cells with endoplasmic reticulum (ER) stress-inducing agents resulted in potent activation of PKR that was blocked by an inhibitor of IRE1α RNAse activity. Crucially, infection resulted in robust IRE1α RNAse activity that was dependent on TLR4 signalling and inhibition of IRE1α RNAse activity prevented PKR activation. Finally, we demonstrate that TLR4/IRE1α mediated PKR activation is required for the enhancement of interferon-β production following C. trachomatis infection. Thus, we provide evidence of a novel mechanism of PKR activation requiring ER stress signalling that occurs as a consequence of TLR4 stimulation during bacterial infection and contributes to inflammatory responses. PMID:27021640

  2. Glycolytic control of vacuolar-type ATPase activity: A mechanism to regulate influenza viral infection

    SciTech Connect

    Kohio, Hinissan P.; Adamson, Amy L.

    2013-09-15

    As new influenza virus strains emerge, finding new mechanisms to control infection is imperative. In this study, we found that we could control influenza infection of mammalian cells by altering the level of glucose given to cells. Higher glucose concentrations induced a dose-specific increase in influenza infection. Linking influenza virus infection with glycolysis, we found that viral replication was significantly reduced after cells were treated with glycolytic inhibitors. Addition of extracellular ATP after glycolytic inhibition restored influenza infection. We also determined that higher levels of glucose promoted the assembly of the vacuolar-type ATPase within cells, and increased vacuolar-type ATPase proton-transport activity. The increase of viral infection via high glucose levels could be reversed by inhibition of the proton pump, linking glucose metabolism, vacuolar-type ATPase activity, and influenza viral infection. Taken together, we propose that altering glucose metabolism may be a potential new approach to inhibit influenza viral infection. - Highlights: • Increased glucose levels increase Influenza A viral infection of MDCK cells. • Inhibition of the glycolytic enzyme hexokinase inhibited Influenza A viral infection. • Inhibition of hexokinase induced disassembly the V-ATPase. • Disassembly of the V-ATPase and Influenza A infection was bypassed with ATP. • The state of V-ATPase assembly correlated with Influenza A infection of cells.

  3. Transcriptional activation of bovine leukemia virus in blood cells from experimentally infected, asymptomatic sheep with latent infections.

    PubMed Central

    Lagarias, D M; Radke, K

    1989-01-01

    Infection by bovine leukemia virus (BLV) is characterized by a long latency period, after which some individuals develop B-cell tumors. The behavior of BLV and related retroviruses during the latency period between initial infection and subsequent tumorigenesis is poorly understood. We used in situ hybridization to detect BLV transcripts in individual peripheral blood mononuclear cells from experimentally infected, asymptomatic sheep with latent infections. Viral RNA was not found in most peripheral blood cells that had been isolated as rapidly as possible from circulating blood, but it was present in rare cells. BLV RNA transcripts increased in a biphasic manner within a few hours after the blood cells were placed in culture. Exposure to fetal bovine serum was identified as the principal cause of this transcriptional activation, which occurred in fewer than 1 in 1,000 cells. Agents known to activate immune cells polyclonally caused a further increase in the number of cells containing BLV RNA within 8 h. In some cases, the numbers of viral transcripts within individual cells also increased. Thus, BLV is not detectably expressed in most resting lymphocytes circulating in the blood, but its transcription is activated by components of fetal bovine serum and can be augmented by molecules that mimic activation of immune cells. This activation, which might occur in lymphoid tissue during an immune response, may lead to the synthesis of viral regulatory proteins that are thought to initiate tumorigenesis through host cell genes. Images PMID:2539506

  4. Seric and hepatic NTPDase and 5' nucleotidase activities of rats experimentally infected by Fasciola hepatica.

    PubMed

    Doleski, Pedro H; Mendes, Ricardo E; Leal, Daniela B R; Bottari, Nathieli B; Piva, Manoela M; DA Silva, Ester S; Gabriel, Mateus E; Lucca, Neuber J; Schwertz, Claiton I; Giacomim, Patrícia; Morsch, Vera M; Schetinger, Maria R C; Baldissera, Matheus D; DA Silva, Aleksandro S

    2016-04-01

    The enzymatic activities of NTPDase and 5'nucleotidase are important to regulate the concentration of adenine nucleotides, known molecules involved in many physiological functions. Therefore, the objective of this study was to evaluate the activity of NTPDase and 5'nucleotidase in serum and liver tissue of rats infected by Fasciola hepatica. Rats were divided into two groups: uninfected control and infected. NTPDase activity for adenosine triphosphate (ATP) and ADP substrates in the liver was higher compared with the control group at 15 days post-infection (PI), while seric activity was lower. In addition, seric and hepatic samples did not show changes for 5'nucleotidase activity at this time. On the other hand, either NTPDase or 5'nucleotidase activities in liver homogenate and serum were higher at 87 days PI. Early in the infection, low NTPDase activity maintains an increase of ATP in the bloodstream in order to activate host immune response, while in hepatic tissue it decreases extracellular ATP to maintain a low inflammatory response in the tissue. As stated, higher NTPDase and 5'nucleotidase activities 87 days after infection in serum and tissue, probably results on an increased concentration of adenosine molecule which stimulates a Th2 immune response. Thus, it is possible to conclude that F. hepatica infections lead to different levels of nucleotide degradation when considering the two stages of infection studied, which influences the inflammatory and pathological processes developed by the purinergic system. PMID:26928238

  5. Microfold Cells Actively Translocate Mycobacterium tuberculosis to Initiate Infection.

    PubMed

    Nair, Vidhya R; Franco, Luis H; Zacharia, Vineetha M; Khan, Haaris S; Stamm, Chelsea E; You, Wu; Marciano, Denise K; Yagita, Hideo; Levine, Beth; Shiloh, Michael U

    2016-08-01

    The prevailing paradigm is that tuberculosis infection is initiated when patrolling alveolar macrophages and dendritic cells within the terminal alveolus ingest inhaled Mycobacterium tuberculosis (Mtb). However, definitive data for this model are lacking. Among the epithelial cells of the upper airway, a specialized epithelial cell known as a microfold cell (M cell) overlies various components of mucosa-associated lymphatic tissue. Here, using multiple mouse models, we show that Mtb invades via M cells to initiate infection. Intranasal Mtb infection in mice lacking M cells either genetically or by antibody depletion resulted in reduced invasion and dissemination to draining lymph nodes. M cell-depleted mice infected via aerosol also had delayed dissemination to lymph nodes and reduced mortality. Translocation of Mtb across two M cell transwell models was rapid and transcellular. Thus, M cell translocation is a vital entry mechanism that contributes to the pathogenesis of Mtb. PMID:27452467

  6. High Human Cytomegalovirus IgG Level is Associated with Increased Incidence of Diabetic Atherosclerosis in Type 2 Diabetes Mellitus Patients

    PubMed Central

    Zhang, Jun; Liu, Yuan-yuan; Sun, Hui-ling; Li, Shan; Xiong, Hai-rong; Yang, Zhan-qiu; Xiang, Guang-da; Jiang, Xiao-jing

    2015-01-01

    Background At present, whether human cytomegalovirus (HCMV) infection is associated with type 2 diabetes mellitus (T2DM) is debatable. The effect of active HCMV infection on glucose regulation has been poorly studied. Although HCMV infection is correlated with atherosclerosis in cardiovascular disease, the role of HCMV infection in the development of diabetic atherosclerosis in T2DM is unclear and is usually neglected by endocrinologists. The aim of this study was to assess the effects of HCMV infection on glucose regulation and the development of diabetic atherosclerosis in T2DM patients. Material/Methods A total of 222 hospitalized T2DM patients were enrolled. Nested polymerase chain reactions were used to detect HCMV DNA extracted from peripheral blood leukocytes. Quantitative real-time PCR was used to determine viral load. HCMV IgG antibody concentrations were analyzed by chemiluminescence immunoassay. Results HCMV active infection, viral load, and HCMV IgG titers were not correlated with glucose regulation. Binary logistic regression demonstrated that the highest quartile of HCMV IgG concentration (>500 U/ml) was correlated with the incidence of diabetic atherosclerosis (OR: 8.0, 95%CI: 2.3–27.2), and that titer >127U/ml of HCMV IgG is an independent predictor for the development of diabetic atherosclerosis in T2DM patients (OR: 4.6, 95%CI: 1.9–11.3) after adjustment for all potential confounding factors. Conclusions Active HCMV infection is unlikely to influence glucose regulation in T2DM. However, HCMV IgG titers are associated with the incidence of diabetic atherosclerosis, and titer >127U/ml of HCMV IgG might be an independent risk factor for the development of diabetic atherosclerosis in T2DM patients. PMID:26717490

  7. NLRP3 Activation Was Regulated by DNA Methylation Modification during Mycobacterium tuberculosis Infection

    PubMed Central

    Wei, Meili; Wang, Lu; Wu, Tao; Xi, Jun; Han, Yuze; Yang, Xingxiang; Zhang, Ding; Fang, Qiang

    2016-01-01

    Mycobacterium tuberculosis (Mtb) infection activates the NLRP3 inflammasome in macrophages and dendritic cells. Much attention has been paid to the mechanisms for regulation of NLRP3 against Mtb. However, whether epigenetic mechanisms participated in NLRP3 activation is still little known. Here we showed that NLRP3 activation was regulated by DNA methylation modification. Mtb infection promoted NLRP3 activation and inflammatory cytokines expression. NLRP3 promoter was cloned and subsequently identified by Dual-Luciferase Reporter System. The results showed that NLRP3 promoter activity was decreased after methylation by DNA methylase Sss I in vitro. Meanwhile, DNA methyltransferases inhibitor DAC could upregulate the expression of NLRP3. Furthermore, promoter region of NLRP3 gene was demethylated after Mtb H37Rv strain infection. These data revealed that DNA methylation was involved in NLRP3 inflammasome activation during Mtb infection and provided a new insight into the relationship between host and pathogens. PMID:27366746

  8. Active NF-kappaB signalling is a prerequisite for influenza virus infection.

    PubMed

    Nimmerjahn, Falk; Dudziak, Diana; Dirmeier, Ulrike; Hobom, Gerd; Riedel, Alexander; Schlee, Martin; Staudt, Louis M; Rosenwald, Andreas; Behrends, Uta; Bornkamm, Georg W; Mautner, Josef

    2004-08-01

    Influenza virus still poses a major threat to human health. Despite widespread vaccination programmes and the development of drugs targeting essential viral proteins, the extremely high mutation rate of influenza virus still leads to the emergence of new pathogenic virus strains. Therefore, it has been suggested that cellular cofactors that are essential for influenza virus infection might be better targets for antiviral therapy. It has previously been reported that influenza virus efficiently infects Epstein-Barr virus-immortalized B cells, whereas Burkitt's lymphoma cells are virtually resistant to infection. Using this cellular system, it has been shown here that an active NF-kappaB signalling pathway is a general prerequisite for influenza virus infection of human cells. Cells with low NF-kappaB activity were resistant to influenza virus infection, but became susceptible upon activation of NF-kappaB. In addition, blocking of NF-kappaB activation severely impaired influenza virus infection of otherwise highly susceptible cells, including the human lung carcinoma cell lines A549 and U1752 and primary human cells. On the other hand, infection with vaccinia virus was not dependent on an active NF-kappaB signalling pathway, demonstrating the specificity of this pathway for influenza virus infection. These results might be of major importance for both the development of new antiviral therapies and the understanding of influenza virus biology. PMID:15269376

  9. Determination of Urinary Neopterin/Creatinine Ratio to Distinguish Active Tuberculosis from Latent Mycobacterium tuberculosis Infection

    PubMed Central

    Eisenhut, Michael; Hargreaves, Dougal S.; Scott, Anne; Housley, David; Walters, Andrew; Mulla, Rohinton

    2016-01-01

    Background. Biomarkers to distinguish latent from active Mycobacterium (M.) tuberculosis infection in clinical practice are lacking. The urinary neopterin/creatinine ratio can quantify the systemic interferon-gamma effect in patients with M. tuberculosis infection. Methods. In a prospective observational study, urinary neopterin levels were measured by enzyme linked immunosorbent assay in patients with active tuberculosis, in people with latent M. tuberculosis infection, and in healthy controls and the urinary neopterin/creatinine ratio was calculated. Results. We included a total of 44 patients with M. tuberculosis infection and nine controls. 12 patients had active tuberculosis (8 of them culture-confirmed). The median age was 15 years (range 4.5 to 49). Median urinary neopterin/creatinine ratio in patients with active tuberculosis was 374.1 micromol/mol (129.0 to 1072.3), in patients with latent M. tuberculosis infection it was 142.1 (28.0 to 384.1), and in controls it was 146.0 (40.3 to 200.0), with significantly higher levels in patients with active tuberculosis (p < 0.01). The receiver operating characteristics curve had an area under the curve of 0.84 (95% CI 0.70 to 0.97) (p < 0.01). Conclusions. Urinary neopterin/creatinine ratios are significantly higher in patients with active tuberculosis compared to patients with latent infection and may be a significant predictor of active tuberculosis in patients with M. tuberculosis infection. PMID:27433370

  10. Association between activities related to routes of infection and clinical manifestations of melioidosis.

    PubMed

    Lim, C; Peacock, S J; Limmathurotsakul, D

    2016-01-01

    We sought associations between route of infection by Burkholderia pseudomallei and clinical manifestations in 330 cases of melioidosis in northeast Thailand using bivariate multivariable logistic regression models. Activities related to skin inoculation were negatively associated with bacteraemia, activities related to ingestion were associated with bacteraemia, and activities related to inhalation were associated with pneumonia. Our study suggests that route of infection is one of the factors related to clinical manifestations of melioidosis. PMID:26417852

  11. Association between activities related to routes of infection and clinical manifestations of melioidosis

    PubMed Central

    Lim, C.; Peacock, S.J.; Limmathurotsakul, D.

    2016-01-01

    We sought associations between route of infection by Burkholderia pseudomallei and clinical manifestations in 330 cases of melioidosis in northeast Thailand using bivariate multivariable logistic regression models. Activities related to skin inoculation were negatively associated with bacteraemia, activities related to ingestion were associated with bacteraemia, and activities related to inhalation were associated with pneumonia. Our study suggests that route of infection is one of the factors related to clinical manifestations of melioidosis. PMID:26417852

  12. Effects of immunomodulators on functional activity of innate immunity cells infected with Streptococcus pneumoniae.

    PubMed

    Plekhova, N G; Kondrashova, N M; Somova, L M; Drobot, E I; Lyapun, I N

    2015-02-01

    Low activity of bactericidal enzymes was found in innate immunity cells infected with S. pneumonia. The death of these cells was fastened under these conditions. On the contrary, treatment with antibiotic maxifloxacin was followed by an increase in activity of bactericidal enzymes in phagocytes and induced their death via necrosis. Analysis of the therapeutic properties of immunomodulators tinrostim and licopid in combination with maxifloxacin showed that these combinations correct functional activity of cells infected with S. pneumonia. PMID:25708326

  13. Salamanders increase their feeding activity when infected with the pathogenic chytrid fungus Batrachochytrium dendrobatidis.

    PubMed

    Hess, Alexandra; McAllister, Caroline; DeMarchi, Joseph; Zidek, Makenzie; Murone, Julie; Venesky, Matthew D

    2015-10-27

    Immune function is a costly line of defense against parasitism. When infected with a parasite, hosts frequently lose mass due to these costs. However, some infected hosts (e.g. highly resistant individuals) can clear infections with seemingly little fitness losses, but few studies have tested how resistant hosts mitigate these costly immune defenses. We explored this topic using eastern red-backed salamanders Plethodon cinereus and the fungal pathogen Batrachochytrium dendrobatidis (Bd). Bd is generally lethal for amphibians, and stereotypical symptoms of infection include loss in mass and deficits in feeding. However, individuals of P. cinereus can clear their Bd infections with seemingly few fitness costs. We conducted an experiment in which we repeatedly observed the feeding activity of Bd-infected and non-infected salamanders. We found that Bd-infected salamanders generally increased their feeding activity compared to non-infected salamanders. The fact that we did not observe any differences in mass change between the treatments suggests that increased feeding might help Bd-infected salamanders minimize the costs of an effective immune response. PMID:26503775

  14. Infection.

    PubMed

    Saigal, Gaurav; Nagornaya, Natalya; Post, M Judith D

    2016-01-01

    Imaging is useful in the diagnosis and management of infections of the central nervous system. Typically, imaging findings at the outset of the disease are subtle and nonspecific, but they often evolve to more definite imaging patterns in a few days, with less rapidity than for stroke but faster than for neoplastic lesions. This timing is similar to that of noninfectious inflammatory brain disease, such as multiple sclerosis. Fortunately, imaging patterns help to distinguish the two kinds of processes. Other than for sarcoidosis, the meninges are seldom involved in noninfectious inflammation; in contrast, many infectious processes involve the meninges, which then enhance with contrast on computed tomography (CT) or magnetic resonance imaging (MRI). However, brain infection causes a vast array of imaging patterns. Although CT is useful when hemorrhage or calcification is suspected or bony detail needs to be determined, MRI is the imaging modality of choice in the investigation of intracranial infections. Imaging sequences such as diffusion-weighted imaging help in accurately depicting the location and characterizing pyogenic infections and are particularly useful in differentiating bacterial infections from other etiologies. Susceptibility-weighted imaging is extremely useful for the detection of hemorrhage. Although MR spectroscopy findings can frequently be nonspecific, certain conditions such as bacterial abscesses show a relatively specific spectral pattern and are useful in diagnosing and constituting immediate therapy. In this chapter we review first the imaging patterns associated with involvement of various brain structures, such as the epidural and subdural spaces, the meninges, the brain parenchyma, and the ventricles. Involvement of these regions is illustrated with bacterial infections. Next we illustrate the patterns associated with viral and prion diseases, followed by mycobacterial and fungal infections, to conclude with a review of imaging findings

  15. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions.

    PubMed

    Tirosh, Osnat; Cohen, Yifat; Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  16. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions

    PubMed Central

    Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  17. Tetherin/BST-2 promotes dendritic cell activation and function during acute retrovirus infection

    PubMed Central

    Li, Sam X.; Barrett, Bradley S.; Guo, Kejun; Kassiotis, George; Hasenkrug, Kim J.; Dittmer, Ulf; Gibbert, Kathrin; Santiago, Mario L.

    2016-01-01

    Tetherin/BST-2 is a host restriction factor that inhibits retrovirus release from infected cells in vitro by tethering nascent virions to the plasma membrane. However, contradictory data exists on whether Tetherin inhibits acute retrovirus infection in vivo. Previously, we reported that Tetherin-mediated inhibition of Friend retrovirus (FV) replication at 2 weeks post-infection correlated with stronger natural killer, CD4+ T and CD8+ T cell responses. Here, we further investigated the role of Tetherin in counteracting retrovirus replication in vivo. FV infection levels were similar between wild-type (WT) and Tetherin KO mice at 3 to 7 days post-infection despite removal of a potent restriction factor, Apobec3/Rfv3. However, during this phase of acute infection, Tetherin enhanced myeloid dendritic cell (DC) function. DCs from infected, but not uninfected, WT mice expressed significantly higher MHC class II and the co-stimulatory molecule CD80 compared to Tetherin KO DCs. Tetherin-associated DC activation during acute FV infection correlated with stronger NK cell responses. Furthermore, Tetherin+ DCs from FV-infected mice more strongly stimulated FV-specific CD4+ T cells ex vivo compared to Tetherin KO DCs. The results link the antiretroviral and immunomodulatory activity of Tetherin in vivo to improved DC activation and MHC class II antigen presentation. PMID:26846717

  18. Activation of Hypoxia Inducible Factor 1 Is a General Phenomenon in Infections with Human Pathogens

    PubMed Central

    Werth, Nadine; Beerlage, Christiane; Rosenberger, Christian; Yazdi, Amir S.; Edelmann, Markus; Amr, Amro; Bernhardt, Wanja; von Eiff, Christof; Becker, Karsten; Schäfer, Andrea; Peschel, Andreas; Kempf, Volkhard A. J.

    2010-01-01

    Background Hypoxia inducible factor (HIF)-1 is the key transcriptional factor involved in the adaptation process of cells and organisms to hypoxia. Recent findings suggest that HIF-1 plays also a crucial role in inflammatory and infectious diseases. Methodology/Principal Findings Using patient skin biopsies, cell culture and murine infection models, HIF-1 activation was determined by immunohistochemistry, immunoblotting and reporter gene assays and was linked to cellular oxygen consumption. The course of a S. aureus peritonitis was determined upon pharmacological HIF-1 inhibition. Activation of HIF-1 was detectable (i) in all ex vivo in biopsies of patients suffering from skin infections, (ii) in vitro using cell culture infection models and (iii) in vivo using murine intravenous and peritoneal S. aureus infection models. HIF-1 activation by human pathogens was induced by oxygen-dependent mechanisms. Small colony variants (SCVs) of S. aureus known to cause chronic infections did not result in cellular hypoxia nor in HIF-1 activation. Pharmaceutical inhibition of HIF-1 activation resulted in increased survival rates of mice suffering from a S. aureus peritonitis. Conclusions/Significance Activation of HIF-1 is a general phenomenon in infections with human pathogenic bacteria, viruses, fungi and protozoa. HIF-1-regulated pathways might be an attractive target to modulate the course of life-threatening infections. PMID:20644645

  19. Activation of Intestinal Epithelial Stat3 Orchestrates Tissue Defense during Gastrointestinal Infection

    PubMed Central

    Wittkopf, Nadine; Pickert, Geethanjali; Billmeier, Ulrike; Mahapatro, Mousumi; Wirtz, Stefan; Martini, Eva; Leppkes, Moritz; Neurath, Markus Friedrich; Becker, Christoph

    2015-01-01

    Gastrointestinal infections with EHEC and EPEC are responsible for outbreaks of diarrheal diseases and represent a global health problem. Innate first-line-defense mechanisms such as production of mucus and antimicrobial peptides by intestinal epithelial cells are of utmost importance for host control of gastrointestinal infections. For the first time, we directly demonstrate a critical role for Stat3 activation in intestinal epithelial cells upon infection of mice with Citrobacter rodentium – a murine pathogen that mimics human infections with attaching and effacing Escherichia coli. C. rodentium induced transcription of IL-6 and IL-22 in gut samples of mice and was associated with activation of the transcription factor Stat3 in intestinal epithelial cells. C. rodentium infection induced expression of several antimicrobial peptides such as RegIIIγ and Pla2g2a in the intestine which was critically dependent on Stat3 activation. Consequently, mice with specific deletion of Stat3 in intestinal epithelial cells showed increased susceptibility to C. rodentium infection as indicated by high bacterial load, severe gut inflammation, pronounced intestinal epithelial cell death and dissemination of bacteria to distant organs. Together, our data implicate an essential role for Stat3 activation in intestinal epithelial cells during C. rodentium infection. Stat3 concerts the host response to bacterial infection by controlling bacterial growth and suppression of apoptosis to maintain intestinal epithelial barrier function. PMID:25799189

  20. In vivo imaging of alphaherpesvirus infection reveals synchronized activity dependent on axonal sorting of viral proteins

    PubMed Central

    Granstedt, Andrea E.; Bosse, Jens B.; Thiberge, Stephan Y.; Enquist, Lynn W.

    2013-01-01

    A clinical hallmark of human alphaherpesvirus infections is peripheral pain or itching. Pseudorabies virus (PRV), a broad host range alphaherpesvirus, causes violent pruritus in many different animals, but the mechanism is unknown. Previous in vitro studies have shown that infected, cultured peripheral nervous system (PNS) neurons exhibited aberrant electrical activity after PRV infection due to the action of viral membrane fusion proteins, yet it is unclear if such activity occurs in infected PNS ganglia in living animals and if it correlates with disease symptoms. Using two-photon microscopy, we imaged autonomic ganglia in living mice infected with PRV strains expressing GCaMP3, a genetically encoded calcium indicator, and used the changes in calcium flux to monitor the activity of many neurons simultaneously with single-cell resolution. Infection with virulent PRV caused these PNS neurons to fire synchronously and cyclically in highly correlated patterns among infected neurons. This activity persisted even when we severed the presynaptic axons, showing that infection-induced firing is independent of input from presynaptic brainstem neurons. This activity was not observed after infections with an attenuated PRV recombinant used for circuit tracing or with PRV mutants lacking either viral glycoprotein B, required for membrane fusion, or viral membrane protein Us9, required for sorting virions and viral glycoproteins into axons. We propose that the viral fusion proteins produced by virulent PRV infection induce electrical coupling in unmyelinated axons in vivo. This action would then give rise to the synchronous and cyclical activity in the ganglia and contribute to the characteristic peripheral neuropathy. PMID:23980169

  1. Activation of MAP kinase pathways in Galleria mellonella infected with Bacillus thuringiensis.

    PubMed

    Wojda, Iwona; Koperwas, Konrad; Jakubowicz, Teresa

    2014-01-01

    We followed changes in the level of phospho-MAP kinases in the greater wax moth Galleria mellonella after infection with Bacillus thuringiensis. We observed an enhanced level of phosphorylated p38 and JNK in fat bodies of the infected larvae. In hemocytes, injection of B. thuringiensis caused the highest increase in phospho-JNK, however, all pathways were activated after aseptic injection. We report that Galleria mellonella larvae exposed to heat shock before infection showed an enhanced level of phosphorylated JNK in fat body. This finding is relevant in the light of our previous reports, which submit evidence that pre-shocked animals are more resistant to infection. PMID:24455757

  2. Adenosine deaminase activity in serum, erythrocytes and lymphocytes of rats infected with Leptospira icterohaemorrhagiae.

    PubMed

    Tonin, Alexandre A; Pimentel, Victor C; da Silva, Aleksandro S; de Azevedo, Maria Isabel; Souza, Viviane C G; Wolkmer, Patrícia; Rezer, João F P; Badke, Manoel R T; Leal, Daniela B R; Schetinger, Maria Rosa C; Monteiro, Silvia G; Lopes, Sonia T A

    2012-04-01

    Leptospirosis is a systemic disease of humans and domestic animals, mainly dogs, cattle and swine. The course of human leptospirosis varies from mild to severe fatal forms and the most severe form of human leptospirosis is principally caused by Leptospira interrogans serovar icterohaemorrhagiae (L. icterohaemorrhagiae). The enzyme adenosine deaminase (ADA) plays an important role in the production and differentiation of blood cells. The aim of this study was to evaluate the activity of ADA in serum, erythrocytes and lymphocytes of rats infected with L. icterohaemorrhagiae, as compared with non-infected rats. Twenty-four adult rats, divided into two uniform groups (A and B) were used for the enzymatic assays. The animals in Group B were inoculated intraperitoneally with 2×10(8) leptospires/rat, and the rodents in Group A (control) were not-inoculated. Blood collection was performed on days 5 and 15 post-infection (PI) and the blood used to assess the ADA activity. The infection by L.icterohaemorrhagiae altered erythrocyte count, hemoglobin concentration and hematocrit, causing a decrease in all these parameters on day 15 PI. Lymphocytes decreased significantly on day 15 PI, and ADA activity in serum was inhibited in infected rats on days 5 and 15 PI and its activity in erythrocytes were increased on day 5 PI. On day 5 PI, we found an increase in ADA activity in erythrocytes of infected rats. No correlation was observed between hematocrit and erythrocyte ADA activity on days 5 and 15 PI. The ADA activity was inhibited in rats infected on day 15 PI. A positive correlation (r(2)=60) was also observed between the number of lymphocytes and ADA activity in lymphocytes on day 15 PI (P<0.05). In conclusion, our results showed that the ADA activity is altered in serum, lymphocytes and erythrocytes in experimental infection by L.icterohaemorrhagiae in rats, concomitantly with hematological parameters. PMID:21320715

  3. Interaction of Nutrition and Infection: Macrophage Activity in Vitamin B12-Deficient Rats Infected with Trypanosoma Lewisi

    PubMed Central

    Thomaskutty, K. G.; Lee, C. M.

    1987-01-01

    Macrophage activity was studied in rats infected with Trypanosoma lewisi in three protocol groups: one group was fed complete diet, a second group was given a vitamin B12-deficient diet, and a third group was fed a pair-fed control (calorically restricted) diet. Throughout the observational period, in animals fed complete and pairfed diets, marked increases in acid phosphatase levels in peritoneal macrophages were directly related to the degree of parasitemia. Acid phosphatase levels in rats deprived of vitamin B12 were approximately one third that of animals with an adequate supply of the vitamin. Irrespective of the diets, the infection with T lewisi also elicited increased macrophage phagocytosis of polystyrene latex particles and macrophage spreading. Both of these activities occurred at a much slower rate in the vitamin B12-deficient animals. PMID:3295263

  4. Effects of malaria (Plasmodium relicturm) on activity budgets of experimentally-infected juvenile Apapane (Himatione sanquinea)

    USGS Publications Warehouse

    Yorinks, N.; Atkinson, C.T.

    2000-01-01

    We used behavioral, physiological, and parasitological measures to document effects of acute malarial infections on activity budgets of experimentally infected juvenile Apapane (Himatione sanguinea). Five of eight birds died within 20 to 32 days after exposure to a single infective mosquito bite. Infected Apapane devoted less time to locomotory activities involving flight, walking or hopping, and stationary activities such as singing, preening, feeding, and probing. The amount of time spent sitting was positively correlated with parasitemia and increased dramatically after infection and between treatment and control groups. Birds that succumbed to infection experienced a significant loss of body mass and subcutaneous fat, whereas surviving Apapane were better able to maintain body condition and fat levels. When rechallenged with the parasite five months after initial infection, surviving birds experienced no increase in parasitemia, indicating that they had become immune to reinfection. Regardless of the outcome, infected birds experienced acute illness that would have left them unable to forage or to escape from predators in the wild.

  5. From Wasting to Obesity: The Contribution of Nutritional Status to Immune Activation in HIV Infection.

    PubMed

    Koethe, John R; Heimburger, Douglas C; PrayGod, George; Filteau, Suzanne

    2016-10-01

    The impact of human immunodeficiency virus (HIV) infection on innate and adaptive immune activation occurs in the context of host factors, which serve to augment or dampen the physiologic response to the virus. Independent of HIV infection, nutritional status, particularly body composition, affects innate immune activation through a variety of conditions, including reduced mucosal barrier defenses and microbiome dysbiosis in malnutrition and the proinflammatory contribution of adipocytes and stromal vascular cells in obesity. Similarly, T-cell activation, proliferation, and cytokine expression are reduced in the setting of malnutrition and increased in obesity, potentially due to adipokine regulatory mechanisms restraining energy-avid adaptive immunity in times of starvation and exerting a paradoxical effect in overnutrition. The response to HIV infection is situated within these complex interactions between host nutritional health and immunologic function, which contribute to the varied phenotypes of immune activation among HIV-infected patients across a spectrum from malnutrition to obesity. PMID:27625434

  6. Activity of fosfomycin in the treatment of bacterial infections.

    PubMed

    Hutzler, R; Fernandes, V; Muñoz, D; Rozentraub, A

    1977-01-01

    30 patients with different infections were treated with fosfomycin: 13 had urinary infections, 14 had pneumonial infections, 2 had staphylococcus osteomyelitis and 1 had staphylococcus septicemia. The antibiotic was administered in doses ranging from 100 to 230 mg/kg/day, with periods of treatment that lasted from 5 to 58 days. The doses were administered every 6 h by the oral or intramuscular route. A total of 35 organisms were isolated: 7 E. coli, 7beta-hemolitic Streptococcus, 6 Proteus sp., 6 S. aureus, 6 S. viridans, 2 Klebsiella sp. and 1 negative coagulase S. aureus. All were sensitive to fosfomycin in vitro, as was revealed by the diffusion in discs method. The therapeutic results were good in 29 of the 30 cases (96.7%). There were no important side effects. A patient complained of a local pain in the area of the injection. The transaminases increased temporarily in 2 patients. One patient had a moderate eosinophilia while under treatment. PMID:832537

  7. Houttuynia cordata blocks HSV infection through inhibition of NF-κB activation.

    PubMed

    Chen, Xiaoqing; Wang, Zhongxia; Yang, Ziying; Wang, Jingjing; Xu, Yunxia; Tan, Ren-Xiang; Li, Erguang

    2011-11-01

    Houttuynia cordata Thunb. is a medicinal plant widely used in folk medicine in several Asian countries. It has been reported that a water extract of H. cordata exhibits activity against herpes simplex virus (HSV) and the virus of severe acute respiratory syndrome (SARS), although the mechanisms are not fully understood yet. Previous studies have demonstrated absolute requirement of NF-κB activation for efficient replication of HSV-1 and HSV-2 and inhibition of NF-κB activation has been shown to suppress HSV infection. Here we show that a hot water extract of H. cordata (HCWE) inhibits HSV-2 infection through inhibition of NF-κB activation. The IC(50) was estimated at 50 μg/ml of lyophilized HCWE powder. At 150 and 450 μg/ml, HCWE blocked infectious HSV-2 production by more than 3 and 4 logs, respectively. The inhibitory activity was concomitant with an inhibition of NF-κB activation by HSV-2 infection. Although activation of NF-κB and Erk MAPK has been implicated for HSV replication and growth, HCWE showed no effect on HSV-2-induced Erk activation. Furthermore, we show that treatment with quercetin, quercitrin or isoquercitrin, major water extractable flavonoids from H. cordata, significantly blocked HSV-2 infection. These results together demonstrated that H. cordata blocks HSV-2 infection through inhibition of NF-κB activation. PMID:21951655

  8. Rift Valley fever virus infection induces activation of the NLRP3 inflammasome

    PubMed Central

    Ermler, Megan E.; Traylor, Zachary; Patel, Krupen; Schattgen, Stefan A.; Vanaja, Sivapriya K.; Fitzgerald, Katherine A.; Hise, Amy G.

    2014-01-01

    Inflammasome activation is gaining recognition as an important mechanism for protection during viral infection. Here, we investigate whether Rift Valley fever virus, a negative-strand RNA virus, can induce inflammasome responses and IL-1β processing in immune cells. We have determined that RVFV induces NLRP3 inflammasome activation in murine dendritic cells, and that this process is dependent upon ASC and caspase-1. Furthermore, absence of the cellular RNA helicase adaptor protein MAVS/IPS-1 significantly reduces extracellular IL-1β during infection. Finally, direct imaging using confocal microscopy shows that the MAVS protein co-localizes with NLRP3 in the cytoplasm of RVFV infected cells. PMID:24418550

  9. Inverse graded relation between alcohol consumption and active infection with Helicobacter pylori.

    PubMed

    Brenner, H; Rothenbacher, D; Bode, G; Adler, G

    1999-03-15

    Alcoholic beverages are known to have strong antibacterial activity. It is unclear, however, to what degree their consumption affects colonization of the human stomach with the bacterium Helicobacter pylori, a risk factor of various chronic diseases. The authors assessed the relation between alcohol consumption and active infection with H. pylori in a cross-sectional study among employees of a health insurance company and their household members (n = 425) in southern Germany. Quantitative information on alcohol consumption by beverage type and other factors that were known or suspected to be related to infection status was collected by a standardized questionnaire, and active infection was measured by the 13C-urea breath test. After control for confounding factors, there was a monotonic inverse graded relation between alcohol consumption and H. pylori infection (p for trend = 0.017). The odds ratio of infection among subjects who consumed more than 75 g of alcohol per week compared with subjects who did not drink alcohol was 0.31 (95 percent confidence interval 0.12-0.81). The inverse relation with H. pylori infection was stronger for alcohol consumed in the form of wine than for alcohol from beer. Notwithstanding its cross-sectional design, this study seems to support the hypothesis that alcohol consumption, particularly wine consumption, may reduce the odds of active infection with H. pylori. PMID:10084247

  10. Anti-infection activity of nanostructured titanium percutaneous implants with a postoperative infection model

    NASA Astrophysics Data System (ADS)

    Tan, Jing; Li, Yiting; Liu, Zhiyuan; Qu, Shuxin; Lu, Xiong; Wang, Jianxin; Duan, Ke; Weng, Jie; Feng, Bo

    2015-07-01

    The titanium percutaneous implants were widely used in clinic; however, they have an increased risk of infection since they breach the skin barrier. Lack of complete skin integration with the implants can cause infection and implant removal. In this work, three titania nanotubes (TNT) with different diameters, 50 nm (TNT-50), 100 nm (TNT-100) and 150 nm (TNT-150) arrays were prepared on titanium surfaces by anodization, pure titanium (pTi) was used as control. Samples were characterized by scanning electron microscopy (SEM), atomic force microscopy (AFM), and contact angle analysis. The antibacterial efficiency of TNT was evaluated in vitro against Staphylococcus aureus under the visible light. The results indicated that TNT-100 had the highest antibacterial efficiency under the visible light. Subsequently, TNT implants and pTi implants were placed subcutaneously to the dorsum of New Zealand White rabbits, 108 CFU S. aureus was inoculated into the implant sites 4 h after surgery. The TNF-alpha and IL-1alpha were determined using enzyme linked immunoassay (ELISA). TNT implants revealed less inflammatory factor release than pTi implants with or without injected S. aureus liquid. According to the histological results, the TNT implants displayed excellent tissue integration. Whereas, pTi implants were surrounded with fibrotic capsule, and the skin tissue was almost separated from the implant surface. Therefore, the TNT significantly inhibited the infection risk and enhanced tissue integration of the percutaneous implants compared to pTi. The immersion test in the culture medium suggested that one of causes be probably more proteins adsorbed on TNT than on pTi.

  11. Bacterial skin infections, active component, U.S. Armed Forces, 2000-2012.

    PubMed

    2013-12-01

    From 2000 through 2012, health care records of the Military Health System documented 998,671 incident cases of bacterial skin infections among active component members of the U.S. Armed Forces. Most cases (97.3%) were identified from records of outpatient medical encounters rather than hospitalizations. Cellulitis accounted for half (50.9%) of all cases of bacterial skin infection but 96 percent of associated hospital bed days. Of all cases, 42.3 percent were "other" skin infections (i.e., folliculitis, impetigo, pyoderma, pyogenic granuloma, other and unspecified infections). The remainder were attributable to carbuncles/furuncles (6.6%) and erysipelas (0.1%). Rates of infection were higher among female service members except for "other" skin infections. In general, the highest rates were associated with youth, recruit trainee status, and junior enlisted rank; however, rates of erysipelas were highest among those 50 years and older. Annual incidence rates of all bacterial skin infections have increased greatly since 2000. During the entire period, such infections required more than 1.4 million health care encounters and 94,000 hospital bed-days (equivalent to 257 years of lost duty time). The prevention, early diagnosis, and treatment of bacterial skin infections, particularly in high risk settings, deserve continued emphasis. PMID:24428536

  12. Hemolytic activity of plasma and urine from rabbits experimentally infected with Legionella pneumophila.

    PubMed

    Baine, W B; Rasheed, J K; Maca, H W; Kaufmann, A F

    1979-01-01

    Rabbits were infected with Legionella pneumophila by intravenous administration of allantoic fluid from eggs infected with this organism. Heated plasma from animals with severe illness caused by L. pneumophila lysed erythrocytes from guinea pigs in a radial hemolysis assay. Plasma from control rabbits did not lyse guinea pig erythrocytes in parallel assays. Urine from two of the infected animals also showed hemolytic activity. Attempts to induce illness in rabbits by intranasal administration of L. pneumohpila were less successful. Allantoic fluid from embrynated hen eggs developed hemolytic activity when maintained eithr in vitro at room temperature or in eggs whose embryos were killed by refrigeration. Hemolytic activity in filtrates of allantoic fluid from eggs infected with L. pneumophila, as previously reported, may not be due to the presence of bacterial hemolysins in the fluid. PMID:399383

  13. Activities of Various 4-Aminoquinolines Against Infections with Chloroquine-Resistant Strains of Plasmodium falciparum1

    PubMed Central

    Schmidt, L. H.; Vaughan, Dennis; Mueller, Donna; Crosby, Ruth; Hamilton, Rebecca

    1977-01-01

    The studies reported here stemmed from a personal report by Geiman on the capacity of the 4-aminoquinoline amodiaquin to inhibit in vitro maturation of ring stages of the chloroquine-resistant Monterey strain of Plasmodium falciparum. This observation, confirmed in owl monkeys infected with this strain, led to a comparison of the activities of chloroquine, amodiaquin, amopyroquin, and dichlorquinazine (12,278 RP) against infections with various chloroquine-susceptible and chloroquine-resistant strains. The results showed that: (i) these 4-aminoquinolines were essentially equally active against infections with chloroquine-susceptible strains and (ii) the activities of amodiaquin, amopyroquin, and dichlorquinazine were reduced significantly in the face of chloroquine resistance, but (iii) well-tolerated doses of these compounds would cure infections with strains that fully resisted treatment with maximally tolerated doses of chloroquine. Two other 4-aminoquinolines, SN-8137 and SN-9584, which also exhibited activity against chloroquine-resistant parasites in vitro, displayed curative activity in monkeys infected with a chloroquine-resistant strain. These observations show that there is cross-resistance among the 4-aminoquinolines, confirming earlier findings, but indicate that the dimensions of this phenomenon are sufficiently limited so that some derivatives are therapeutically effective against infections refractory to maximally tolerated doses of chloroquine. PMID:406829

  14. The activation of p38MAPK and JNK pathways in bovine herpesvirus 1 infected MDBK cells.

    PubMed

    Zhu, Liqian; Yuan, Chen; Huang, Liyuan; Ding, Xiuyan; Wang, Jianye; Zhang, Dong; Zhu, Guoqiang

    2016-01-01

    We have shown previously that BHV-1 infection activates Erk1/2 signaling. Here, we show that BHV-1 provoked an early-stage transient and late-stage sustained activation of JNK, p38MAPK and c-Jun signaling in MDBK cells. C-Jun phosphorylation was dependent on JNK. These early events were partially due to the viral entry process. Unexpectedly, reactive oxygen species were not involved in the later activation phase. Interestingly, only activated JNK facilitated the viral multiplication identified through both chemical inhibitor and siRNA. Collectively, this study provides insight into our understanding of early stages of BHV-1 infection. PMID:27590675

  15. Long term results of mechanical prostheses for treatment of active infective endocarditis

    PubMed Central

    Guerra, J; Tornos, M; Permanyer-Miralda, G; Almirante, B; Murtra, M; Soler-Soler, J

    2001-01-01

    OBJECTIVE—To analyse the long term results of mechanical prostheses for treating active infective endocarditis.
DESIGN—Prospective cohort study of a consecutive series of patients diagnosed with infective endocarditis and operated on in the active phase of the infection for insertion of a mechanical prosthesis.
SETTING—Tertiary referral centre in a metropolitan area.
RESULTS—Between 1975 and 1997, 637 cases of infective endocarditis were diagnosed in the centre. Of these, 436 were left sided (with overall mortality of 20.3%). Surgical treatment in the active phase of the infection was needed in 141 patients (72% native, 28% prosthetic infective endocarditis). Mechanical prostheses were used in 131 patients. Operative mortality was 30.5% (40 patients). Ninety one survivors were followed up prospectively for (mean (SD)) 5.4 (4.5) years. Thirteen patients developed prosthetic valve dysfunction. Nine patients suffered reinfection: four of these (4%) were early and five were late. The median time from surgery for late reinfection was 1.4 years. During follow up, 12 patients died. Excluding operative mortality, actuarial survival was 86.6% at five years and 83.7% at 10 years; actuarial survival free from death, reoperation, and reinfection was 73.1% at five years and 59.8% at 10 years.
CONCLUSIONS—In patients surviving acute infective endocarditis and receiving mechanical prostheses, the rate of early reinfection compares well with reported results of homografts. In addition, prosthesis dysfunction rate is low and long term survival is good. These data should prove useful for comparison with long term studies, when available, using other types of valve surgery in active infective endocarditis.


Keywords: infective endocarditis; surgery; mechanical prosthesis PMID:11410564

  16. Coordinated expansion of both memory T cells and NK cells in response to CMV infection in humans.

    PubMed

    Bayard, Charles; Lepetitcorps, Hélène; Roux, Antoine; Larsen, Martin; Fastenackels, Solène; Salle, Virginie; Vieillard, Vincent; Marchant, Arnaud; Stern, Marc; Boddaert, Jacques; Bajolle, Fanny; Appay, Victor; Sauce, Delphine

    2016-05-01

    NK cells are key players in the fight against persistent viruses. Human cytomegalovirus (HCMV) infection is associated with the presence of a population of CD16(+) CD56(dim) NKG2C(+) NK cells in both acutely and latently infected individuals. Here, we studied the nature of these terminally differentiated NK cells in different human populations infected with HCMV: healthy donors stratified by age, thymectomized individuals, pregnant women suffering from primary CMV infection, and lung transplant patients. Both CD16(+) CD56(dim) NK- and CD8 T-cell phenotypes as well as functional capacities were determined and stratified according to age and/or CMV event. Similarly to T-cell responsiveness, we observe an accumulation over time of NKG2C(+) NK cells, which preferentially expressed CD57. This accumulation is particularly prominent in elderly and amplified further by CMV infection. Latent HCMV infection (without replication) is sufficient for NKG2C(+) CD57(+) NK cells to persist in healthy individuals but is not necessarily required in old age. Collectively, the present work supports the emerging concept that CMV shapes both innate and adaptive immunity in humans. PMID:26910859

  17. Flt3 permits survival during infection by rendering dendritic cells competent to activate NK cells.

    PubMed

    Eidenschenk, Céline; Crozat, Karine; Krebs, Philippe; Arens, Ramon; Popkin, Daniel; Arnold, Carrie N; Blasius, Amanda L; Benedict, Chris A; Moresco, Eva Marie Y; Xia, Yu; Beutler, Bruce

    2010-05-25

    A previously unappreciated signal necessary for dendritic cell (DC)-mediated activation of natural killer (NK) cells during viral infection was revealed by a recessive N-ethyl-N-nitrosourea-induced mutation called warmflash (wmfl). Wmfl homozygotes displayed increased susceptibility to mouse cytomegalovirus (MCMV) infection. In response to MCMV infection in vivo, delayed NK cell activation was observed, but no intrinsic defects in NK cell activation or function were identified. Rather, coculture experiments demonstrated that NK cells are suboptimally activated by wmfl DCs, which showed impaired cytokine production in response to MCMV or synthetic TLR7 and TLR9 ligands. The wmfl mutation was identified in the gene encoding the Fms-like tyrosine kinase 3 (Flt3). Flt3 ligand (Flt3L) is transiently induced in the serum upon infection or TLR activation. However, antibody blockade reveals no acute requirement for Flt3L, suggesting that the Flt3L --> Flt3 axis programs the development of DCs, making them competent to support NK effector function. In the absence of Flt3 signaling, NK cell activation is delayed and survival during MCMV infection is markedly compromised. PMID:20457904

  18. Flt3 permits survival during infection by rendering dendritic cells competent to activate NK cells

    PubMed Central

    Eidenschenk, Céline; Crozat, Karine; Krebs, Philippe; Arens, Ramon; Popkin, Daniel; Arnold, Carrie N.; Blasius, Amanda L.; Benedict, Chris A.; Moresco, Eva Marie Y.; Xia, Yu; Beutler, Bruce

    2010-01-01

    A previously unappreciated signal necessary for dendritic cell (DC)-mediated activation of natural killer (NK) cells during viral infection was revealed by a recessive N-ethyl-N-nitrosourea-induced mutation called warmflash (wmfl). Wmfl homozygotes displayed increased susceptibility to mouse cytomegalovirus (MCMV) infection. In response to MCMV infection in vivo, delayed NK cell activation was observed, but no intrinsic defects in NK cell activation or function were identified. Rather, coculture experiments demonstrated that NK cells are suboptimally activated by wmfl DCs, which showed impaired cytokine production in response to MCMV or synthetic TLR7 and TLR9 ligands. The wmfl mutation was identified in the gene encoding the Fms-like tyrosine kinase 3 (Flt3). Flt3 ligand (Flt3L) is transiently induced in the serum upon infection or TLR activation. However, antibody blockade reveals no acute requirement for Flt3L, suggesting that the Flt3L → Flt3 axis programs the development of DCs, making them competent to support NK effector function. In the absence of Flt3 signaling, NK cell activation is delayed and survival during MCMV infection is markedly compromised. PMID:20457904

  19. HIV-1 integration landscape during latent and active infection

    PubMed Central

    Cohn, Lillian; Silva, Israel T.; Oliveira, Thiago Y.; Rosales, Rafael A.; Parrish, Erica H.; Learn, Gerald H.; Hahn, Beatrice H.; Czartoski, Julie L.; McElrath, M. Juliana; Lehmann, Clara; Klein, Florian; Caskey, Marina; Walker, Bruce D.; Siliciano, Janet D.; Siliciano, Robert F.; Jankovic, Mila; Nussenzweig, Michel C.

    2015-01-01

    SUMMARY The barrier to curing HIV-1 is thought to reside primarily in CD4+ T cells containing silent proviruses. To characterize these latently infected cells, we studied the integration profile of HIV-1 in viremic progressors, individuals receiving antiretroviral therapy, and viremic controllers. Clonally expanded T cells represented the majority of all integrations and increased during therapy. However, none of the 75 expanded T cell clones assayed contained intact virus. In contrast, the cells bearing single integration events decreased in frequency over time on therapy, and the surviving cells were enriched for HIV-1 integration in silent regions of the genome. Finally, there was a strong preference for integration into, or in close proximity to Alu repeats, which were also enriched in local hotspots for integration. The data indicate that dividing clonally expanded T cells contain defective proviruses, and that the replication competent reservoir is primarily found in CD4+ T cells that remain relatively quiescent. PMID:25635456

  20. A transcriptionally active form of TFIIIC is modified in poliovirus-infected HeLa cells.

    PubMed Central

    Clark, M E; Dasgupta, A

    1990-01-01

    In HeLa cells, RNA polymerase III (pol III)-mediated transcription is severely inhibited by poliovirus infection. This inhibition is due primarily to the reduction in transcriptional activity of the pol III transcription factor TFIIIC in poliovirus-infected cells. However, the specific binding of TFIIIC to the VAI gene B-box sequence, as assayed by DNase I footprinting, is not altered by poliovirus infection. We have used gel retardation analysis to analyze TFIIIC-DNA complexes formed in nuclear extracts prepared from mock- and poliovirus-infected cells. In mock-infected cell extracts, two closely migrating TFIIIC-containing complexes, complexes I and II, were detected in the gel retardation assay. The slower migrating complex, complex I, was absent in poliovirus-infected cell extracts, and an increase occurred in the intensity of the faster-migrating complex (complex II). Also, in poliovirus-infected cell extracts, a new, rapidly migrating complex, complex III, was formed. Complex III may have been the result of limited proteolysis of complex I or II. These changes in TFIIIC-containing complexes in poliovirus-infected cell extracts correlated kinetically with the decrease in TFIIIC transcriptional activity. Complexes I, II, and III were chromatographically separated; only complex I was transcriptionally active and specifically restored pol III transcription when added to poliovirus-infected cell extracts. Acid phosphatase treatment partially converted complex I to complex II but did not affect the binding of complex II or III. Dephosphorylation and limited proteolysis of TFIIIC are discussed as possible mechanisms for the inhibition of pol III-mediated transcription by poliovirus. Images PMID:2204807

  1. Therapeutic doses of irradiation activate viral transcription and induce apoptosis in HIV-1 infected cells.

    PubMed

    Iordanskiy, Sergey; Van Duyne, Rachel; Sampey, Gavin C; Woodson, Caitlin M; Fry, Kelsi; Saifuddin, Mohammed; Guo, Jia; Wu, Yuntao; Romerio, Fabio; Kashanchi, Fatah

    2015-11-01

    The highly active antiretroviral therapy reduces HIV-1 RNA in plasma to undetectable levels. However, the virus continues to persist in the long-lived resting CD4(+) T cells, macrophages and astrocytes which form a viral reservoir in infected individuals. Reactivation of viral transcription is critical since the host immune response in combination with antiretroviral therapy may eradicate the virus. Using the chronically HIV-1 infected T lymphoblastoid and monocytic cell lines, primary quiescent CD4(+) T cells and humanized mice infected with dual-tropic HIV-1 89.6, we examined the effect of various X-ray irradiation (IR) doses (used for HIV-related lymphoma treatment and lower doses) on HIV-1 transcription and viability of infected cells. Treatment of both T cells and monocytes with IR, a well-defined stress signal, led to increase of HIV-1 transcription, as evidenced by the presence of RNA polymerase II and reduction of HDAC1 and methyl transferase SUV39H1 on the HIV-1 promoter. This correlated with the increased GFP signal and elevated level of intracellular HIV-1 RNA in the IR-treated quiescent CD4(+) T cells infected with GFP-encoding HIV-1. Exposition of latently HIV-1infected monocytes treated with PKC agonist bryostatin 1 to IR enhanced transcription activation effect of this latency-reversing agent. Increased HIV-1 replication after IR correlated with higher cell death: the level of phosphorylated Ser46 in p53, responsible for apoptosis induction, was markedly higher in the HIV-1 infected cells following IR treatment. Exposure of HIV-1 infected humanized mice with undetectable viral RNA level to IR resulted in a significant increase of HIV-1 RNA in plasma, lung and brain tissues. Collectively, these data point to the use of low to moderate dose of IR alone or in combination with HIV-1 transcription activators as a potential application for the "Shock and Kill" strategy for latently HIV-1 infected cells. PMID:26184775

  2. Nuclease Activity of Legionella pneumophila Cas2 Promotes Intracellular Infection of Amoebal Host Cells

    PubMed Central

    Gunderson, Felizza F.; Mallama, Celeste A.; Fairbairn, Stephanie G.

    2014-01-01

    Legionella pneumophila, the primary agent of Legionnaires' disease, flourishes in both natural and man-made environments by growing in a wide variety of aquatic amoebae. Recently, we determined that the Cas2 protein of L. pneumophila promotes intracellular infection of Acanthamoeba castellanii and Hartmannella vermiformis, the two amoebae most commonly linked to cases of disease. The Cas2 family of proteins is best known for its role in the bacterial and archeal clustered regularly interspaced short palindromic repeat (CRISPR)–CRISPR-associated protein (Cas) system that constitutes a form of adaptive immunity against phage and plasmid. However, the infection event mediated by L. pneumophila Cas2 appeared to be distinct from this function, because cas2 mutants exhibited infectivity defects in the absence of added phage or plasmid and since mutants lacking the CRISPR array or any one of the other cas genes were not impaired in infection ability. We now report that the Cas2 protein of L. pneumophila has both RNase and DNase activities, with the RNase activity being more pronounced. By characterizing a catalytically deficient version of Cas2, we determined that nuclease activity is critical for promoting infection of amoebae. Also, introduction of Cas2, but not its catalytic mutant form, into a strain of L. pneumophila that naturally lacks a CRISPR-Cas locus caused that strain to be 40- to 80-fold more infective for amoebae, unequivocally demonstrating that Cas2 facilitates the infection process independently of any other component encoded within the CRISPR-Cas locus. Finally, a cas2 mutant was impaired for infection of Willaertia magna but not Naegleria lovaniensis, suggesting that Cas2 promotes infection of most but not all amoebal hosts. PMID:25547789

  3. Association between active GB virus-C (hepatitis G) infection and HIV-1 disease in Uganda.

    PubMed

    Yirrell, D L; Wright, E; Shafer, L A; Campbell, E; Van der Paal, L; Kaleebu, P; Grosskurth, H; Whitworth, J A

    2007-04-01

    Although not linked to a disease, GB virus-C viraemia has been associated with an improved prognosis in HIV-1-co-infected individuals. Most studies have been conducted on men (men who have sex with men or injection drug users) infected with HIV-1 subtype B, whereas here we report on both male and female subjects from rural Uganda, predominantly infected via the heterosexual route with HIV-1 subtypes A and D. In a longitudinal study of 272 participants, 47 were GBV-C positive and 181 negative, as determined by reverse transcription-polymerase chain reaction, in both of two plasma samples taken a median of 5.0 years apart. The remainder either acquired (25) or cleared (19) infection. Multilevel regression analyses and Cox survival analyses revealed that participants chronically infected with GBV-C had a slower decline in CD4(+) T cells (P<0.001) and increased survival time (P=0.041) compared with GBV-C RNA-negative, HIV-positive adults. We show that the association between active GBV-C co-infection and improved survival of HIV-1-infected adults is not restricted to HIV subtype B, but is also observed in both males and females infected with HIV subtypes A and D. PMID:17509174

  4. PPARγ-mediated increase in glucose availability sustains chronic Brucella abortus infection in alternatively activated macrophages

    PubMed Central

    Xavier, Mariana N.; Winter, Maria G.; Spees, Alanna M.; den Hartigh, Andreas B.; Nguyen, Kim; Roux, Christelle M.; Silva, Teane M. A.; Atluri, Vidya L.; Kerrinnes, Tobias; Keestra, A. Marijke; Monack, Denise M.; Luciw, Paul A.; Eigenheer, Richard A.; Bäumler, Andreas J.; Santos, Renato L.; Tsolis, Renée M.

    2013-01-01

    SUMMARY Eradication of persistent intracellular bacterial pathogens with antibiotic therapy is often slow or incomplete. However, strategies to augment antibiotics are hampered by our poor understanding of the nutritional environment that sustains chronic infection. Here we show that the intracellular pathogen Brucella abortus survives and replicates preferentially in alternatively activated macrophages (AAM), which are more abundant during chronic infection. A metabolic shift induced by peroxisome proliferator activated receptor γ (PPARγ), which increases intracellular glucose availability, is identified as a causal mechanism promoting enhanced bacterial survival in AAM. Glucose uptake was crucial for increased replication of B. abortus in AAM, and chronic infection, as inactivation of the bacterial glucose transporter gluP reduced both intracellular survival in AAM and persistence in mice. Thus, a shift in intracellular nutrient availability induced by PPARγ promotes chronic persistence of B. abortus within AAM and targeting this pathway may aid in eradicating chronic infection. PMID:23954155

  5. PPARγ-mediated increase in glucose availability sustains chronic Brucella abortus infection in alternatively activated macrophages.

    PubMed

    Xavier, Mariana N; Winter, Maria G; Spees, Alanna M; den Hartigh, Andreas B; Nguyen, Kim; Roux, Christelle M; Silva, Teane M A; Atluri, Vidya L; Kerrinnes, Tobias; Keestra, A Marijke; Monack, Denise M; Luciw, Paul A; Eigenheer, Richard A; Bäumler, Andreas J; Santos, Renato L; Tsolis, Renée M

    2013-08-14

    Eradication of persistent intracellular bacterial pathogens with antibiotic therapy is often slow or incomplete. However, strategies to augment antibiotics are hampered by our poor understanding of the nutritional environment that sustains chronic infection. Here we show that the intracellular pathogen Brucella abortus survives and replicates preferentially in alternatively activated macrophages (AAMs), which are more abundant during chronic infection. A metabolic shift induced by peroxisome proliferator-activated receptor γ (PPARγ), which increases intracellular glucose availability, is identified as a causal mechanism promoting enhanced bacterial survival in AAMs. Glucose uptake was crucial for increased replication of B. abortus in AAMs, and for chronic infection, as inactivation of the bacterial glucose transporter gluP reduced both intracellular survival in AAMs and persistence in mice. Thus, a shift in intracellular nutrient availability induced by PPARγ promotes chronic persistence of B. abortus within AAMs, and targeting this pathway may aid in eradicating chronic infection. PMID:23954155

  6. Tannic acid modified silver nanoparticles show antiviral activity in herpes simplex virus type 2 infection.

    PubMed

    Orlowski, Piotr; Tomaszewska, Emilia; Gniadek, Marianna; Baska, Piotr; Nowakowska, Julita; Sokolowska, Justyna; Nowak, Zuzanna; Donten, Mikolaj; Celichowski, Grzegorz; Grobelny, Jaroslaw; Krzyzowska, Malgorzata

    2014-01-01

    The interaction between silver nanoparticles and herpesviruses is attracting great interest due to their antiviral activity and possibility to use as microbicides for oral and anogenital herpes. In this work, we demonstrate that tannic acid modified silver nanoparticles sized 13 nm, 33 nm and 46 nm are capable of reducing HSV-2 infectivity both in vitro and in vivo. The antiviral activity of tannic acid modified silver nanoparticles was size-related, required direct interaction and blocked virus attachment, penetration and further spread. All tested tannic acid modified silver nanoparticles reduced both infection and inflammatory reaction in the mouse model of HSV-2 infection when used at infection or for a post-infection treatment. Smaller-sized nanoparticles induced production of cytokines and chemokines important for anti-viral response. The corresponding control buffers with tannic acid showed inferior antiviral effects in vitro and were ineffective in blocking in vivo infection. Our results show that tannic acid modified silver nanoparticles are good candidates for microbicides used in treatment of herpesvirus infections. PMID:25117537

  7. Thrombin activation and liver inflammation in advanced hepatitis C virus infection

    PubMed Central

    González-Reimers, Emilio; Quintero-Platt, Geraldine; Martín-González, Candelaria; Pérez-Hernández, Onán; Romero-Acevedo, Lucía; Santolaria-Fernández, Francisco

    2016-01-01

    Hepatitis C virus (HCV) infection is associated with increased thrombotic risk. Several mechanisms are involved including direct endothelial damage by the HCV virus, with activation of tissue factor, altered fibrinolysis and increased platelet aggregation and activation. In advanced stages, chronic HCV infection may evolve to liver cirrhosis, a condition in which alterations in the portal microcirculation may also ultimately lead to thrombin activation, platelet aggregation, and clot formation. Therefore in advanced HCV liver disease there is an increased prevalence of thrombotic phenomena in portal vein radicles. Increased thrombin formation may activate hepatic stellate cells and promote liver fibrosis. In addition, ischemic changes derived from vascular occlusion by microthrombi favor the so called parenchymal extinction, a process that promotes collapse of hepatocytes and the formation of gross fibrous tracts. These reasons may explain why advanced HCV infection may evolve more rapidly to end-stage liver disease than other forms of cirrhosis. PMID:27182154

  8. Bacterial Manipulation of NK Cell Regulatory Activity Increases Susceptibility to Listeria monocytogenes Infection

    PubMed Central

    Guthrie, Brandon S.; Schmidt, Rebecca L.; Jamieson, Amanda; Merkel, Patricia; Knight, Vijaya; Cole, Caroline M.; Raulet, David H.; Lenz, Laurel L.

    2016-01-01

    Natural killer (NK) cells produce interferon (IFN)-γ and thus have been suggested to promote type I immunity during bacterial infections. Yet, Listeria monocytogenes (Lm) and some other pathogens encode proteins that cause increased NK cell activation. Here, we show that stimulation of NK cell activation increases susceptibility during Lm infection despite and independent from robust NK cell production of IFNγ. The increased susceptibility correlated with IL-10 production by responding NK cells. NK cells produced IL-10 as their IFNγ production waned and the Lm virulence protein p60 promoted induction of IL-10 production by mouse and human NK cells. NK cells consequently exerted regulatory effects to suppress accumulation and activation of inflammatory myeloid cells. Our results reveal new dimensions of the role played by NK cells during Lm infection and demonstrate the ability of this bacterial pathogen to exploit the induction of regulatory NK cell activity to increase host susceptibility. PMID:27295349

  9. Thrombin activation and liver inflammation in advanced hepatitis C virus infection.

    PubMed

    González-Reimers, Emilio; Quintero-Platt, Geraldine; Martín-González, Candelaria; Pérez-Hernández, Onán; Romero-Acevedo, Lucía; Santolaria-Fernández, Francisco

    2016-05-14

    Hepatitis C virus (HCV) infection is associated with increased thrombotic risk. Several mechanisms are involved including direct endothelial damage by the HCV virus, with activation of tissue factor, altered fibrinolysis and increased platelet aggregation and activation. In advanced stages, chronic HCV infection may evolve to liver cirrhosis, a condition in which alterations in the portal microcirculation may also ultimately lead to thrombin activation, platelet aggregation, and clot formation. Therefore in advanced HCV liver disease there is an increased prevalence of thrombotic phenomena in portal vein radicles. Increased thrombin formation may activate hepatic stellate cells and promote liver fibrosis. In addition, ischemic changes derived from vascular occlusion by microthrombi favor the so called parenchymal extinction, a process that promotes collapse of hepatocytes and the formation of gross fibrous tracts. These reasons may explain why advanced HCV infection may evolve more rapidly to end-stage liver disease than other forms of cirrhosis. PMID:27182154

  10. Bacterial Manipulation of NK Cell Regulatory Activity Increases Susceptibility to Listeria monocytogenes Infection.

    PubMed

    Clark, Sarah E; Filak, Holly C; Guthrie, Brandon S; Schmidt, Rebecca L; Jamieson, Amanda; Merkel, Patricia; Knight, Vijaya; Cole, Caroline M; Raulet, David H; Lenz, Laurel L

    2016-06-01

    Natural killer (NK) cells produce interferon (IFN)-γ and thus have been suggested to promote type I immunity during bacterial infections. Yet, Listeria monocytogenes (Lm) and some other pathogens encode proteins that cause increased NK cell activation. Here, we show that stimulation of NK cell activation increases susceptibility during Lm infection despite and independent from robust NK cell production of IFNγ. The increased susceptibility correlated with IL-10 production by responding NK cells. NK cells produced IL-10 as their IFNγ production waned and the Lm virulence protein p60 promoted induction of IL-10 production by mouse and human NK cells. NK cells consequently exerted regulatory effects to suppress accumulation and activation of inflammatory myeloid cells. Our results reveal new dimensions of the role played by NK cells during Lm infection and demonstrate the ability of this bacterial pathogen to exploit the induction of regulatory NK cell activity to increase host susceptibility. PMID:27295349

  11. Influence of Ecto-Nucleoside Triphosphate Diphosphohydrolase Activity on Trypanosoma cruzi Infectivity and Virulence

    PubMed Central

    Santos, Ramon F.; Pôssa, Marcela A. S.; Bastos, Matheus S.; Guedes, Paulo M. M.; Almeida, Márcia R.; DeMarco, Ricardo; Verjovski-Almeida, Sergio; Bahia, Maria T.; Fietto, Juliana L. R.

    2009-01-01

    Background The protozoan Trypanosoma cruzi is the causative agent of Chagas disease. There are no vaccines or effective treatment, especially in the chronic phase when most patients are diagnosed. There is a clear necessity to develop new drugs and strategies for the control and treatment of Chagas disease. Recent papers have suggested the ecto-nucleotidases (from CD39 family) from pathogenic agents as important virulence factors. In this study we evaluated the influence of Ecto-Nucleoside-Triphosphate-Diphosphohydrolase (Ecto-NTPDase) activity on infectivity and virulence of T. cruzi using both in vivo and in vitro models. Methodology/Principal Findings We followed Ecto-NTPDase activities of Y strain infective forms (trypomastigotes) obtained during sequential sub-cultivation in mammalian cells. ATPase/ADPase activity ratios of cell-derived trypomastigotes decreased 3- to 6-fold and infectivity was substantially reduced during sequential sub-cultivation. Surprisingly, at third to fourth passages most of the cell-derived trypomastigotes could not penetrate mammalian cells and had differentiated into amastigote-like parasites that exhibited 3- to 4-fold lower levels of Ecto-NTPDase activities. To evidence the participation of T. cruzi Ecto-NTPDase1 in the infective process, we evaluated the effect of known Ecto-ATPDase inhibitors (ARL 67156, Gadolinium and Suramin), or anti-NTPDase-1 polyclonal antiserum on ATPase and ADPase hydrolytic activities in recombinant T. cruzi NTPDase-1 and in live trypomastigotes. All tests showed a partial inhibition of Ecto-ATPDase activities and a marked inhibition of trypomastigotes infectivity. Mice infections with Ecto-NTPDase-inhibited trypomastigotes produced lower levels of parasitemia and higher host survival than with non-inhibited control parasites. Conclusions/Significance Our results suggest that Ecto-ATPDases act as facilitators of infection and virulence in vitro and in vivo and emerge as target candidates in chemotherapy

  12. Arginase Activity in the Blood of Patients with Visceral Leishmaniasis and HIV Infection

    PubMed Central

    Weldegebreal, Teklu; Hailu, Asrat; Hailu, Workagegnehu; Hurissa, Zewdu; Ali, Jemal; Diro, Ermiyas; Sisay, Yifru; Cloke, Tom; Modolell, Manuel; Munder, Markus; Tacchini-Cottier, Fabienne; Müller, Ingrid; Kropf, Pascale

    2013-01-01

    Background Visceral leishmaniasis is a parasitic disease associated with high mortality. The most important foci of visceral leishmaniasis in Ethiopia are in the Northwest and are predominantly associated with high rates of HIV co-infection. Co-infection of visceral leishmaniasis patients with HIV results in higher mortality, treatment failure and relapse. We have previously shown that arginase, an enzyme associated with immunosuppression, was increased in patients with visceral leishmaniasis and in HIV seropositive patients; further our results showed that high arginase activity is a marker of disease severity. Here, we tested the hypothesis that increased arginase activities associated with visceral leishmaniasis and HIV infections synergize in patients co-infected with both pathogens. Methodology/Principal Findings We recruited a cohort of patients with visceral leishmaniasis and a cohort of patients with visceral leishmaniasis and HIV infection from Gondar, Northwest Ethiopia, and recorded and compared their clinical data. Further, we measured the levels of arginase activity in the blood of these patients and identified the phenotype of arginase-expressing cells. Our results show that CD4+ T cell counts were significantly lower and the parasite load in the spleen was significantly higher in co-infected patients. Moreover, our results demonstrate that arginase activity was significantly higher in peripheral blood mononuclear cells and plasma of co-infected patients. Finally, we identified the cells-expressing arginase in the PBMCs as low-density granulocytes. Conclusion Our results suggest that increased arginase might contribute to the poor disease outcome characteristic of patients with visceral leishmaniasis and HIV co-infection. PMID:23349999

  13. Differential activation of a Candida albicans virulence gene family during infection

    PubMed Central

    Staib, Peter; Kretschmar, Marianne; Nichterlein, Thomas; Hof, Herbert; Morschhäuser, Joachim

    2000-01-01

    The yeast Candida albicans is a harmless commensal in most healthy people, but it causes superficial as well as life-threatening systemic infections in immunocompromised patients. C. albicans can colonize or infect virtually all body sites because of its high adaptability to different host niches, which involves the activation of appropriate sets of genes in response to complex environmental signals. We have used an in vivo expression technology that is based on genetic recombination as a reporter of gene expression to monitor the differential activation of individual members of a gene family encoding secreted aspartic proteinases (Saps), which have been implicated in C. albicans virulence, at various stages of the infection process. Our results demonstrate that SAP expression depends on the type of infection, with different SAP isogenes being activated during systemic disease as compared with mucosal infection. In addition, the activation of individual SAP genes depends on the progress of the infection, some members of the gene family being induced immediately after contact with the host, whereas others are expressed only after dissemination into deep organs. In the latter case, the number of invading organisms determines whether induction of a virulence gene is necessary for successful infection. The in vivo expression technology allows the elucidation of gene expression patterns at different stages of the fungus–host interaction, thereby revealing regulatory adaptation mechanisms that make C. albicans the most successful fungal pathogen of humans and, at the same time, identifying the stage of an infection at which certain virulence genes may play a role. PMID:10811913

  14. Antileishmanial activity of licochalcone A in mice infected with Leishmania major and in hamsters infected with Leishmania donovani.

    PubMed Central

    Chen, M; Christensen, S B; Theander, T G; Kharazmi, A

    1994-01-01

    This study was designed to examine the antileishmanial activity of the oxygenated chalcone licochalcone A in mice and hamsters infected with Leishmania parasites. Intraperitoneal administration of licochalcone A at doses of 2.5 and 5 mg/kg of body weight per day completely prevented lesion development in BALB/c mice infected with Leishmania major. Treatment of hamsters infected with L. donovani with intraperitoneal administration of licochalcone A at a dose of 20 mg/kg of body weight per day for 6 consecutive days resulted in a > 96% reduction of parasite load in the liver and the spleen compared with values for untreated control animals. The [3H]thymidine uptake by the parasites isolated from the treated hamsters was only about 1% of that observed in parasites isolated from the controls. Oral administration of licochalcone A at concentrations of 5 to 150 mg/kg of body weight per day for 6 consecutive days resulted in > 65 and 85% reductions of L. donovani parasite loads in the liver and the spleen, respectively, compared with those of untreated control hamsters. These data clearly demonstrate that licochalcone A is a promising lead for the development of a new drug against leishmaniases. PMID:8092835

  15. Increased poly(ADP-ribose)polymerase activity in cells infected by human immunodeficiency virus type-1.

    PubMed

    Furlini, G; Re, M C; La Placa, M

    1991-04-01

    Poly(ADP-ribose)polymerase is a chromatin-bound enzyme which is activated by free DNA ends and is therefore stimulated by a variety of DNA-damaging agents. The enzyme transfers the ADP moiety of NAD to nuclear proteins to create protein-bound ADP-ribose polymers. Under conditions favouring an accelerated poly(ADP-ribose) polymer formation, the enzyme may exhaust cellular NAD pools. At the same time, or shortly thereafter ATP levels drop and cell viability eventually declines. As a series of chemical and physical agents which may play a role in activating latent HIV-1 infection or favouring HIV-1 replication, have a DNA-damaging activity, we investigated the behaviour of poly(ADP-ribose)polymerase activity in various types of HIV-1-infected cells. The results obtained show that HIV-1-infected cells to possess an increased poly(ADP-ribosol)ating activity together with an accentuated fragmentation of cellular DNA which are associated with the time course of HIV-1 replication. These data give circumstantial support to the hypothesis that a NAD-depdendent cellular suicide response to DNA damage, could play a role in the death of HIV-1 infected cells. In this respect, the impared immunocompetence of HIV-1-infected patients could bear some resemblance to immune attribution that sometimes accompanies some inborn errors affecting DNA precursor metabolism and DNA integrity. PMID:1906973

  16. Activation of NLRP3 inflammasome in human neutrophils by Helicobacter pylori infection.

    PubMed

    Pérez-Figueroa, Erandi; Torres, Javier; Sánchez-Zauco, Norma; Contreras-Ramos, Alejandra; Alvarez-Arellano, Lourdes; Maldonado-Bernal, Carmen

    2016-02-01

    TLRs and NLRs participate in the immune system recognition of Helicobacter pylori. However, little is known about the mechanisms leading to inflammasome activation by H. pylori and if NLRs in neutrophils are involved in the process. We studied how NOD-like receptor family, pyrin domain-containing 3 (NLRP3) inflammasome components are involved in IL-1β maturation in human neutrophils in response to the infection and if they are dependent on T4SS (type IV secretion system) and TLRs. Human neutrophils were cultured and infected with the 26695 or the VirD4- H. pylori strains; the IL-1β concentration was analyzed by ELISA, and we also evaluated the activation of TLRs 2 and 4. The infection of neutrophils with both strains of H. pylori induced production of IL-1β and expression of the NLRP3 inflammasome components such as apoptosis-associated speck-like protein with CARD domain and NLRP3 protein. The infection also increased the activity of caspase-1, which is required for the maturation of IL-1β. Our study shows, for the first time, that H. pylori infection induces the expression and activation of components of NLRP3 inflammasomes in human neutrophils and that the activation is independent of a functional T4SS and TLR2 and TLR4. PMID:26610398

  17. Gene expression analysis during acute hepatitis C virus infection associates dendritic cell activation with viral clearance.

    PubMed

    Zabaleta, Aintzane; Riezu-Boj, Jose-Ignacio; Larrea, Esther; Villanueva, Lorea; Lasarte, Juan Jose; Guruceaga, Elizabeth; Fisicaro, Paola; Ezzikouri, Sayeh; Missale, Gabriele; Ferrari, Carlo; Benjelloun, Soumaya; Prieto, Jesús; Sarobe, Pablo

    2016-05-01

    Viral clearance during acute hepatitis C virus (HCV) infection is associated with the induction of potent antiviral T-cell responses. Since dendritic cells (DC) are essential in the activation of primary T-cell responses, gene expression was analyzed in DC from patients during acute HCV infection. By using microarrays, gene expression was compared in resting and activated peripheral blood plasmacytoid (pDC) and myeloid (mDC) DC from acute HCV resolving patients (AR) and from patients who become chronically infected (ANR), as well as in healthy individuals (CTRL) and chronically-infected patients (CHR). For pDC, a high number of upregulated genes was found in AR patients, irrespective of DC stimulation. However, for mDC, most evident differences were detected after DC stimulation, again corresponding to upregulated genes in AR patients. Divergent behavior of ANR was also observed when analyzing DC from CTRL and CHR, with ANR patients clustering again apart from these groups. These differences corresponded to metabolism-associated genes and genes belonging to pathways relevant for DC activation and cytokine responses. Thus, upregulation of relevant genes in DC during acute HCV infection may determine viral clearance, suggesting that dysfunctional DC may be responsible for the lack of efficient T-cell responses which lead to chronic HCV infection. PMID:26447929

  18. Inhibitory activity of S-adenosylhomocysteine hydrolase inhibitors against human cytomegalovirus replication.

    PubMed

    Snoeck, R; Andrei, G; Neyts, J; Schols, D; Cools, M; Balzarini, J; De Clercq, E

    1993-07-01

    Various acyclic and carbocyclic adenosine analogues, which are apparently targeted at the S-adenosylhomocysteine (AdoHcy) hydrolase have been reported to inhibit the replication of a number of pox-, rhabdo-, paramyxo-, arena-, and reoviruses. Here we show that this activity spectrum extends to human cytomegalovirus (HCMV). Of the compounds tested, neplanocin A, 3-deazaneplanocin A, 6'-C-methylneplanocin A and 5'-noraristeromycin were found to be the most potent inhibitors of HCMV replication in vitro. Their 50% inhibitory concentration ranged from 0.05 to 1.35 micrograms/ml. In general, the anti-HCMV activity of the adenosine analogues correlated well with their affinity (Ki) for AdoHcy hydrolase, suggesting that AdoHcy hydrolase may be considered as a target enzyme for anti-HCMV agents. For four compounds (3-deazaneplanocin A, 6'-C-methylneplanocin A (isomers I and II) and 3-deazaadenosine), anti-HCMV potency was greater than could be expected solely from their interaction with AdoHcy hydrolase, suggesting that these compounds may be functioning by an additional mechanism. PMID:8215298

  19. Stepwise Release of Biologically Active HMGB1 during HSV-2 Infection

    PubMed Central

    Borde, Chloé; Barnay-Verdier, Stéphanie; Gaillard, Claire; Hocini, Hakim

    2011-01-01

    Background High mobility group box 1 protein (HMGB1) is a major endogenous danger signal that triggers inflammation and immunity during septic and aseptic stresses. HMGB1 recently emerged as a key soluble factor in the pathogenesis of various infectious diseases, but nothing is known of its behaviour during herpesvirus infection. We therefore investigated the dynamics and biological effects of HMGB1 during HSV-2 infection of epithelial HEC-1 cells. Methodology/Principal Findings Despite a transcriptional shutdown of HMGB1 gene expression during infection, the intracellular pool of HMGB1 protein remained unaffected, indicating its remarkable stability. However, the dynamics of HMGB1 was deeply modified in infected cells. Whereas viral multiplication was concomitant with apoptosis and HMGB1 retention on chromatin, a subsequent release of HMGB1 was observed in response to HSV-2 mediated necrosis. Importantly, extracellular HMGB1 was biologically active. Indeed, HMGB1-containing supernatants from HSV-2 infected cells induced the migration of fibroblasts from murine or human origin, and reactivated HIV-1 from latently infected T lymphocytes. These effects were specifically linked to HMGB1 since they were blocked by glycyrrhizin or by a neutralizing anti-HMGB1 antibody, and were mediated through TLR2 and the receptor for Advanced Glycation End-products (RAGE). Finally, we show that genital HSV-2 active infections also promote HMGB1 release in vivo, strengthening the clinical relevance of our experimental data. Conclusions These observations target HMGB1 as an important actor during HSV-2 genital infection, notably in the setting of HSV-HIV co-infection. PMID:21283827

  20. RAAS Activation Is Associated With Visceral Adiposity and Insulin Resistance Among HIV-infected Patients

    PubMed Central

    Srinivasa, Suman; Fitch, Kathleen V.; Wong, Kimberly; Torriani, Martin; Mayhew, Caitlin; Stanley, Takara; Lo, Janet; Adler, Gail K.

    2015-01-01

    Context: Little is known about renin-angiotensin-aldosterone system (RAAS) activation in relationship to visceral adipose tissue (VAT) accumulation in HIV-infected patients, a population at significant risk for insulin resistance and other metabolic disease. Design: Twenty HIV and 10 non-HIV-infected subjects consumed a standardized low sodium or liberal sodium diet to stimulate or suppress the RAAS, respectively. RAAS parameters were evaluated in response to each diet and a graded angiotensin II infusion. Further analyses were performed after groups were substratified by median VAT measured by magnetic resonance imaging. Results: Aldosterone concentrations during the low-sodium diet were higher in HIV than non-HIV-infected subjects [13.8 (9.7, 30.9) vs 9.2 (7.6, 13.6) ng/dL, P = .03] and increased across groups stratified by visceral adipose tissue (VAT) [8.5 (7.1, 12.8), 9.2 (8.1, 21.5), 11.4 (9.4, 13.8), and 27.2 (13.0, 36.9) ng/dL in non-HIV-infected without increased VAT, non-HIV-infected with increased VAT, HIV-infected without increased VAT, HIV-infected with increased VAT, respectively, overall trend P = .02]. Under this condition, plasma renin activity [3.50 (2.58, 4.65) vs 1.45 (0.58, 2.33) ng/mL · h, P = .002] was higher among the HIV-infected subjects with vs without increased VAT. Differences in the suppressibility of plasma renin activity by graded angiotensin infusion were seen stratifying by VAT among the HIV-infected group (P < .02 at each dose). In addition, aldosterone (P = .007) was an independent predictor of insulin resistance in multivariate modeling, controlling for VAT and adiponectin. Conclusion: These data suggest excess RAAS activation in relationship to visceral adiposity in HIV-infected patients that may independently contribute to insulin resistance. Mineralocorticoid blockade may have therapeutic potential to reduce metabolic complications in HIV-infected patients with increased visceral adiposity. PMID:26086328

  1. Antiviral Drug- and Multidrug Resistance in Cytomegalovirus Infected SCT Patients

    PubMed Central

    Göhring, Katharina; Hamprecht, Klaus; Jahn, Gerhard

    2015-01-01

    In pediatric and adult patients after stem cell transplantation (SCT) disseminated infections caused by human cytomegalovirus (HCMV) can cause life threatening diseases. For treatment, the three antivirals ganciclovir (GCV), foscarnet (PFA) and cidofovir (CDV) are approved and most frequently used. Resistance to all of these antiviral drugs may induce a severe problem in this patient cohort. Responsible for resistance phenomena are mutations in the HCMV phosphotransferase-gene (UL97) and the polymerase-gene (UL54). Most frequently mutations in the UL97-gene are associated with resistance to GCV. Resistance against all three drugs is associated to mutations in the UL54-gene. Monitoring of drug resistance by genotyping is mostly done by PCR-based Sanger sequencing. For phenotyping with cell culture the isolation of HCMV is a prerequisite. The development of multidrug resistance with mutation in both genes is rare, but it is often associated with a fatal outcome. The manifestation of multidrug resistance is mostly associated with combined UL97/UL54-mutations. Normally, mutations in the UL97 gene occur initially followed by UL54 mutation after therapy switch. The appearance of UL54-mutation alone without any detection of UL97-mutation is rare. Interestingly, in a number of patients the UL97 mutation could be detected in specific compartments exclusively and not in blood. PMID:25750703

  2. Exosomes derived from HIV-1-infected cells contain trans-activation response element RNA.

    PubMed

    Narayanan, Aarthi; Iordanskiy, Sergey; Das, Ravi; Van Duyne, Rachel; Santos, Steven; Jaworski, Elizabeth; Guendel, Irene; Sampey, Gavin; Dalby, Elizabeth; Iglesias-Ussel, Maria; Popratiloff, Anastas; Hakami, Ramin; Kehn-Hall, Kylene; Young, Mary; Subra, Caroline; Gilbert, Caroline; Bailey, Charles; Romerio, Fabio; Kashanchi, Fatah

    2013-07-01

    Exosomes are nano-sized vesicles produced by healthy and virus-infected cells. Exosomes derived from infected cells have been shown to contain viral microRNAs (miRNAs). HIV-1 encodes its own miRNAs that regulate viral and host gene expression. The most abundant HIV-1-derived miRNA, first reported by us and later by others using deep sequencing, is the trans-activation response element (TAR) miRNA. In this study, we demonstrate the presence of TAR RNA in exosomes from cell culture supernatants of HIV-1-infected cells and patient sera. TAR miRNA was not in Ago2 complexes outside the exosomes but enclosed within the exosomes. We detected the host miRNA machinery proteins Dicer and Drosha in exosomes from infected cells. We report that transport of TAR RNA from the nucleus into exosomes is a CRM1 (chromosome region maintenance 1)-dependent active process. Prior exposure of naive cells to exosomes from infected cells increased susceptibility of the recipient cells to HIV-1 infection. Exosomal TAR RNA down-regulated apoptosis by lowering Bim and Cdk9 proteins in recipient cells. We found 10(4)-10(6) copies/ml TAR RNA in exosomes derived from infected culture supernatants and 10(3) copies/ml TAR RNA in the serum exosomes of highly active antiretroviral therapy-treated patients or long term nonprogressors. Taken together, our experiments demonstrated that HIV-1-infected cells produced exosomes that are uniquely characterized by their proteomic and RNA profiles that may contribute to disease pathology in AIDS. PMID:23661700

  3. Activation and Recruitment of Regulatory T Cells via Chemokine Receptor Activation in Trichinella spiralis-Infected Mice.

    PubMed

    Ahn, Jeong-Bin; Kang, Shin Ae; Kim, Dong-Hee; Yu, Hak Sun

    2016-04-01

    As most infections by the helminth parasite elicit the recruitment of CD4(+)CD25(+)Foxp3(+) T (Treg) cells, many scientists have suggested that these cells could be used for the treatment of immune-mediated inflammation and associated diseases. In order to investigate the distribution and alteration of activated Treg cells, we compared the expression levels of Treg cell activation markers in the ileum and gastrocnemius tissues 1, 2, and 4 weeks after infection. The number of Treg cells was monitored using GFP-coded Foxp3 transgenic mice. In mice at 1 week after Trichinella spiralis infection, the number of activated Treg cells was higher than in the control group. In mice at 2 weeks after infection, there was a significant increase in the number of cells expressing Foxp3 and CTLA-4 when compared to the control group and mice at 1 week after infection. At 4 weeks after infection, T. spiralis was easily identifiable in nurse cells in mouse muscles. In the intestine, the expression of Gzmb and Klrg1 decreased over time and that of Capg remained unchanged for the first and second week, then decreased in the 4th week. However, in the muscles, the expression of most chemokine genes was increased due to T. spiralis infection, in particular the expression levels of Gzmb, OX40, and CTLA-4 increased until week 4. In addition, increased gene expression of all chemokine receptors in muscle, CXCR3, CCR4, CCR5, CCR9, and CCR10, was observed up until the 4th week. In conclusion, various chemokine receptors showed increased expressions combined with recruitment of Treg cells in the muscle tissue. PMID:27180574

  4. Activation and Recruitment of Regulatory T Cells via Chemokine Receptor Activation in Trichinella spiralis-Infected Mice

    PubMed Central

    Ahn, Jeong-Bin; Kang, Shin Ae; Kim, Dong-Hee; Yu, Hak Sun

    2016-01-01

    As most infections by the helminth parasite elicit the recruitment of CD4+CD25+Foxp3+ T (Treg) cells, many scientists have suggested that these cells could be used for the treatment of immune-mediated inflammation and associated diseases. In order to investigate the distribution and alteration of activated Treg cells, we compared the expression levels of Treg cell activation markers in the ileum and gastrocnemius tissues 1, 2, and 4 weeks after infection. The number of Treg cells was monitored using GFP-coded Foxp3 transgenic mice. In mice at 1 week after Trichinella spiralis infection, the number of activated Treg cells was higher than in the control group. In mice at 2 weeks after infection, there was a significant increase in the number of cells expressing Foxp3 and CTLA-4 when compared to the control group and mice at 1 week after infection. At 4 weeks after infection, T. spiralis was easily identifiable in nurse cells in mouse muscles. In the intestine, the expression of Gzmb and Klrg1 decreased over time and that of Capg remained unchanged for the first and second week, then decreased in the 4th week. However, in the muscles, the expression of most chemokine genes was increased due to T. spiralis infection, in particular the expression levels of Gzmb, OX40, and CTLA-4 increased until week 4. In addition, increased gene expression of all chemokine receptors in muscle, CXCR3, CCR4, CCR5, CCR9, and CCR10, was observed up until the 4th week. In conclusion, various chemokine receptors showed increased expressions combined with recruitment of Treg cells in the muscle tissue. PMID:27180574

  5. Silibinin Inhibits HIV-1 Infection by Reducing Cellular Activation and Proliferation

    PubMed Central

    McClure, Janela; Lovelace, Erica S.; Elahi, Shokrollah; Maurice, Nicholas J.; Wagoner, Jessica; Dragavon, Joan; Mittler, John E.; Kraft, Zane; Stamatatos, Leonidis; Horton, Helen; De Rosa, Stephen C.; Coombs, Robert W.; Polyak, Stephen J.

    2012-01-01

    Purified silymarin-derived natural products from the milk thistle plant (Silybum marianum) block hepatitis C virus (HCV) infection and inhibit T cell proliferation in vitro. An intravenous formulation of silibinin (SIL), a major component of silymarin, displays anti-HCV effects in humans and also inhibits T-cell proliferation in vitro. We show that SIL inhibited replication of HIV-1 in TZM-bl cells, PBMCs, and CEM cells in vitro. SIL suppression of HIV-1 coincided with dose-dependent reductions in actively proliferating CD19+, CD4+, and CD8+ cells, resulting in fewer CD4+ T cells expressing the HIV-1 co-receptors CXCR4 and CCR5. SIL inhibition of T-cell growth was not due to cytotoxicity measured by cell cycle arrest, apoptosis, or necrosis. SIL also blocked induction of the activation markers CD38, HLA-DR, Ki67, and CCR5 on CD4+ T cells. The data suggest that SIL attenuated cellular functions involved in T-cell activation, proliferation, and HIV-1 infection. Silymarin-derived compounds provide cytoprotection by suppressing virus infection, immune activation, and inflammation, and as such may be relevant for both HIV mono-infected and HIV/HCV co-infected subjects. PMID:22848626

  6. Serious Non-AIDS Events: Therapeutic Targets of Immune Activation and Chronic Inflammation in HIV Infection.

    PubMed

    Hsu, Denise C; Sereti, Irini

    2016-04-01

    In the antiretroviral therapy (ART) era, serious non-AIDS events (SNAEs) have become the major causes of morbidity and mortality in HIV-infected persons. Early ART initiation has the strongest evidence for reducing SNAEs and mortality. Biomarkers of immune activation, inflammation and coagulopathy do not fully normalize despite virologic suppression and persistent immune activation is an important contributor to SNAEs. A number of strategies aimed to reduce persistent immune activation including ART intensification to reduce residual viremia; treatment of co-infections to reduce chronic antigen stimulation; the use of anti-inflammatory agents, reducing microbial translocation as well as interventions to improve immune recovery through cytokine administration and reducing lymphoid tissue fibrosis, have been investigated. To date, there is little conclusive evidence on which strategies beyond treatment of hepatitis B and C co-infections and reducing cardiovascular risk factors will result in clinical benefits in patients already on ART with viral suppression. The use of statins seems to show early promise and larger clinical trials are underway to confirm their efficacy. At this stage, clinical care of HIV-infected patients should therefore focus on early diagnosis and prompt ART initiation, treatment of active co-infections and the aggressive management of co-morbidities until further data are available. PMID:26915027

  7. Activated ClpP kills persisters and eradicates a chronic biofilm infection.

    PubMed

    Conlon, B P; Nakayasu, E S; Fleck, L E; LaFleur, M D; Isabella, V M; Coleman, K; Leonard, S N; Smith, R D; Adkins, J N; Lewis, K

    2013-11-21

    Chronic infections are difficult to treat with antibiotics but are caused primarily by drug-sensitive pathogens. Dormant persister cells that are tolerant to killing by antibiotics are responsible for this apparent paradox. Persisters are phenotypic variants of normal cells and pathways leading to dormancy are redundant, making it challenging to develop anti-persister compounds. Biofilms shield persisters from the immune system, suggesting that an antibiotic for treating a chronic infection should be able to eradicate the infection on its own. We reasoned that a compound capable of corrupting a target in dormant cells will kill persisters. The acyldepsipeptide antibiotic (ADEP4) has been shown to activate the ClpP protease, resulting in death of growing cells. Here we show that ADEP4-activated ClpP becomes a fairly nonspecific protease and kills persisters by degrading over 400 proteins, forcing cells to self-digest. Null mutants of clpP arise with high probability, but combining ADEP4 with rifampicin produced complete eradication of Staphylococcus aureus biofilms in vitro and in a mouse model of a chronic infection. Our findings indicate a general principle for killing dormant cells-activation and corruption of a target, rather than conventional inhibition. Eradication of a biofilm in an animal model by activating a protease suggests a realistic path towards developing therapies to treat chronic infections. PMID:24226776

  8. Active hepatitis C infection and HCV genotypes prevalent among the IDUs of Khyber Pakhtunkhwa.

    PubMed

    ur Rehman, Latif; Ullah, Ihasn; Ali, Ijaz; Khan, Imtiaz Ali; Iqbal, Aqib; Khan, Sanaullah; Khan, Sher Hayat; Zaman, Khaleeq Uz; ullah Khan, Najib; Swati, Zahoor Ahmed; Jahangiri, Anila Tariq

    2011-01-01

    Injection drug users (IDUs) are considered as a high risk group to develop hepatitis C due to needle sharing. In this study we have examined 200 injection drug users from various regions of the Khyber Pakhtunkhwa province for the prevalence of active HCV infection and HCV genotypes by Immunochromatographic assays, RT-PCR and Type-specific PCR. Our results indicated that 24% of the IDUs were actively infected with HCV while anti HCV was detected among 31.5% cases. Prevalent HCV genotypes were HCV 2a, 3a, 4 and 1a. Majority of the IDUs were married and had attained primary or middle school education. 95% of the IDUs had a previous history of needle sharing. Our study indicates that the rate of active HCV infection among the IDUs is higher with comparatively more prevalence of the rarely found HCV types in KPK. The predominant mode of HCV transmission turned out to be needle sharing among the IDUs. PMID:21711541

  9. [Functional activity of lymphoblastoid cells infected by human adenovirus type 2 and Epstein-Barr virus].

    PubMed

    Povnitsa, O Iu; Diachenko, N S; Nosach, L N; Olevinskaia, Z M; Zhovnovataia, V L; Polishchuk, V N; Spivak, N Ia

    2005-01-01

    The paper deals with the influence of the adenovirus (Ad) and Epstein-Barr virus (EBV) on functional activity of lymphocytes, in particular, the production of alpha- and gamma-interferons, tumor necrosis factor (TNF) in conditions of mono- or double infection of B- and T-phenotype (CEM) lymphoblastoid cells. It is shown, that Ad, EBV or both viruses induce high enough levels of interferon on both lines of cells and in control epithelial cells. The lymphoblastoid cells infected by viruses deep ability to synthesize alpha- and gamma-interferons under the influence of the corresponding inducers (Newcastle disease virus and hemagglutinine). Nevertheless, the levels of their formation are not high. Rather high parameters of activity of the tumor necrosis factor (TNF) were revealed during a day in the initial B95-8 cells and superinfected Ad after the effect of LPS of E. coli. Their activity in CEM cells also did not depend on the infection type. PMID:16018208

  10. Pythium infection activates conserved plant defense responses in mosses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The moss Physcomitrella patens (P. patens) is a useful model to study abiotic stress responses since it is highly tolerant to drought, salt and osmotic stress. However, little is known about the defense mechanisms activated in this moss after pathogen assault. Here the induction of defense responses...

  11. Dynamics of lung macrophage activation in response to helminth infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most of our understanding of the development and phenotype of alternatively activated macrophages (AAM) has been obtained from studies investigating the response of bone marrow- and peritoneal-derived cells to IL-4 or IL-13 stimulation. Comparatively little is known about the development of the AAM...

  12. Difference Between Latent TB Infection and Active TB Disease

    MedlinePlus

    ... ray, or positive sputum smear or culture • • Has active TB bacteria in his/her body • • Usually feels sick and may have symptoms such as coughing, fever, and weight loss • • May spread TB bacteria to others • • Needs treatment to treat ...

  13. Lysozyme Activity in the Plasma of Rodents Infected With Their Homologous Trypanosomes

    PubMed Central

    Maraghi, S; Molyneux, DH; Wallbanks, KR

    2012-01-01

    Background In this study the concentration of lysozyme in blood plasma of Microtus agrestis, Clethrinomys glareolus, Apodemus sylvaticus, BK rats and outbred white mice before and after infection with culture forms of Trypanosoma microti, T, evotomys, T. grosi, T. lewisi and T. musculi respectively was measured. Methods Blood samples of rodents, Microtus agrestis, Clethrionomys glareolus, Apodemus sylvaticus, BK rats and outbred mice infected with T. microti, T. evotomys, T. grosi, T. lewisi and T. musculi respectively were collected in heparinized micro- tubes immediately before inoculation and 3, 6, 12, 24, 48, 96 and more than 400 days after intra- perituneal inoculation with 5×105of their homologous trypanosome parasites of which more than half were metacyclic trypomastigote in 0.2 ml of culture medium. Micro- tubes were centrifuged and plasma samples were separated and the lysozyme activity was measured by the agar method. Results Levels of lysozyme rose rapidly three to six days after the inoculation to ten to twenty than their pre- infection levels. They then gradually decreased, although after more than one year they were still two to ten folds higher than controls. The highest level measured occurred in rats infected with T. lewisi and the lowest in A. sylvaticus infected with T. grosi. After one year the highest concentration of lysozyme was in mice infected with T. musculi and lowest in A. sylvaticus. Conclusion Persistent enhanced lysozyme levels may prevent re- infection with trypanosomes. PMID:23323096

  14. B Cell Infection and Activation by Rabies Virus-Based Vaccines

    PubMed Central

    Lytle, Andrew G.; Norton, James E.; Dorfmeier, Corin L.; Shen, Shixue

    2013-01-01

    Replication-deficient rabies viruses (RABV) are promising rabies postexposure vaccines due to their prompt and potent stimulation of protective virus neutralizing antibody titers, which are produced in mice by both T-dependent and T-independent mechanisms. To promote such early and robust B cell stimulation, we hypothesized that live RABV-based vaccines directly infect B cells, thereby activating a large pool of antigen-presenting cells (APCs) capable of providing early priming and costimulation to CD4+ T cells. In this report, we show that live RABV-based vaccine vectors efficiently infect naive primary murine and human B cells ex vivo. Infection of B cells resulted in the significant upregulation of early markers of B cell activation and antigen presentation, including CD69, major histocompatibility complex class II (MHC-II), and CD40 in murine B cells or HLA-DR and CD40 in human B cells compared to mock-infected cells or cells treated with an inactivated RABV-based vaccine. Furthermore, primary B cells infected with a live RABV expressing ovalbumin were able to prime and stimulate naive CD4+ OT-II T cells to proliferate and to secrete interleukin-2 (IL-2), demonstrating a functional consequence of B cell infection and activation by live RABV-based vaccine vectors. We propose that this direct B cell stimulation by live RABV-based vaccines is a potential mechanism underlying their induction of early protective T cell-dependent B cell responses, and that designing live RABV-based vaccines to infect and activate B cells represents a promising strategy to develop a single-dose postexposure rabies vaccine where the generation of early protective antibody titers is critical. PMID:23760241

  15. B cell infection and activation by rabies virus-based vaccines.

    PubMed

    Lytle, Andrew G; Norton, James E; Dorfmeier, Corin L; Shen, Shixue; McGettigan, James P

    2013-08-01

    Replication-deficient rabies viruses (RABV) are promising rabies postexposure vaccines due to their prompt and potent stimulation of protective virus neutralizing antibody titers, which are produced in mice by both T-dependent and T-independent mechanisms. To promote such early and robust B cell stimulation, we hypothesized that live RABV-based vaccines directly infect B cells, thereby activating a large pool of antigen-presenting cells (APCs) capable of providing early priming and costimulation to CD4(+) T cells. In this report, we show that live RABV-based vaccine vectors efficiently infect naive primary murine and human B cells ex vivo. Infection of B cells resulted in the significant upregulation of early markers of B cell activation and antigen presentation, including CD69, major histocompatibility complex class II (MHC-II), and CD40 in murine B cells or HLA-DR and CD40 in human B cells compared to mock-infected cells or cells treated with an inactivated RABV-based vaccine. Furthermore, primary B cells infected with a live RABV expressing ovalbumin were able to prime and stimulate naive CD4(+) OT-II T cells to proliferate and to secrete interleukin-2 (IL-2), demonstrating a functional consequence of B cell infection and activation by live RABV-based vaccine vectors. We propose that this direct B cell stimulation by live RABV-based vaccines is a potential mechanism underlying their induction of early protective T cell-dependent B cell responses, and that designing live RABV-based vaccines to infect and activate B cells represents a promising strategy to develop a single-dose postexposure rabies vaccine where the generation of early protective antibody titers is critical. PMID:23760241

  16. Inflammasome Activation Can Mediate Tissue-Specific Pathogenesis or Protection in Staphylococcus aureus Infection.

    PubMed

    Melehani, Jason H; Duncan, Joseph A

    2016-01-01

    Staphylococcus aureus is a Gram-positive coccus that interacts with human hosts on a spectrum from quiet commensal to deadly pathogen. S. aureus is capable of infecting nearly every tissue in the body resulting in cellulitis, pneumonia, osteomyelitis, endocarditis, brain abscesses, bacteremia, and more. S. aureus has a wide range of factors that promote infection, and each site of infection triggers a different response in the human host. In particular, the different patterns of inflammasome activation mediate tissue-specific pathogenesis or protection in S. aureus infection. Although still a nascent field, understanding the unique host-pathogen interactions in each infection and the role of inflammasomes in mediating pathogenesis may lead to novel strategies for treating S. aureus infections. Reviews addressing S. aureus virulence and pathogenesis (Thammavongsa et al. 2015), as well as epidemiology and pathophysiology (Tong et al. 2015), have recently been published. This review will focus on S. aureus factors that activate inflammasomes and their impact on innate immune signaling and bacterial survival. PMID:27460814

  17. PKR Activation Favors Infectious Pancreatic Necrosis Virus Replication in Infected Cells

    PubMed Central

    Gamil, Amr A.A.; Xu, Cheng; Mutoloki, Stephen; Evensen, Øystein

    2016-01-01

    The double-stranded RNA-activated protein kinase R (PKR) is a Type I interferon (IFN) stimulated gene that has important biological and immunological functions. In viral infections, in general, PKR inhibits or promotes viral replication, but PKR-IPNV interaction has not been previously studied. We investigated the involvement of PKR during infectious pancreatic necrosis virus (IPNV) infection using a custom-made rabbit antiserum and the PKR inhibitor C16. Reactivity of the antiserum to PKR in CHSE-214 cells was confirmed after IFNα treatment giving an increased protein level. IPNV infection alone did not give increased PKR levels by Western blot, while pre-treatment with PKR inhibitor before IPNV infection gave decreased eukaryotic initiation factor 2-alpha (eIF2α) phosphorylation. This suggests that PKR, despite not being upregulated, is involved in eIF2α phosphorylation during IPNV infection. PKR inhibitor pre-treatment resulted in decreased virus titers, extra- and intracellularly, concomitant with reduction of cells with compromised membranes in IPNV-permissive cell lines. These findings suggest that IPNV uses PKR activation to promote virus replication in infected cells. PMID:27338445

  18. Activation and lysis of human CD4 cells latently infected with HIV-1

    PubMed Central

    Pegu, Amarendra; Asokan, Mangaiarkarasi; Wu, Lan; Wang, Keyun; Hataye, Jason; Casazza, Joseph P.; Guo, Xiaoti; Shi, Wei; Georgiev, Ivelin; Zhou, Tongqing; Chen, Xuejun; O'Dell, Sijy; Todd, John-Paul; Kwong, Peter D.; Rao, Srinivas S.; Yang, Zhi-yong; Koup, Richard A.; Mascola, John R.; Nabel, Gary J.

    2015-01-01

    The treatment of AIDS with combination antiretroviral therapy (cART) remains lifelong largely because the virus persists in latent reservoirs. Elimination of latently infected cells could therefore reduce treatment duration and facilitate immune reconstitution. Here we report an approach to reduce the viral reservoir by activating dormant viral gene expression and directing T lymphocytes to lyse previously latent, HIV-1-infected cells. An immunomodulatory protein was created that combines the specificity of a HIV-1 broadly neutralizing antibody with that of an antibody to the CD3 component of the T-cell receptor. CD3 engagement by the protein can stimulate T-cell activation that induces proviral gene expression in latently infected T cells. It further stimulates CD8 T-cell effector function and redirects T cells to lyse these previously latent-infected cells through recognition of newly expressed Env. This immunomodulatory protein could potentially help to eliminate latently infected cells and deplete the viral reservoir in HIV-1-infected individuals. PMID:26485194

  19. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells

    PubMed Central

    Ho, Catherine M. K.; Donovan-Banfield, I’ah Z.; Tan, Li; Zhang, Tinghu; Gray, Nathanael S.; Strang, Blair L.

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  20. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells.

    PubMed

    Ho, Catherine M K; Donovan-Banfield, I'ah Z; Tan, Li; Zhang, Tinghu; Gray, Nathanael S; Strang, Blair L

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  1. Mechanistic insights on immunosenescence and chronic immune activation in HIV-tuberculosis co-infection.

    PubMed

    Shankar, Esaki M; Velu, Vijayakumar; Kamarulzaman, Adeeba; Larsson, Marie

    2015-02-12

    Immunosenescence is marked by accelerated degradation of host immune responses leading to the onset of opportunistic infections, where senescent T cells show remarkably higher ontogenic defects as compared to healthy T cells. The mechanistic association between T-cell immunosenescence and human immunodeficiency virus (HIV) disease progression, and functional T-cell responses in HIV-tuberculosis (HIV-TB) co-infection remains to be elaborately discussed. Here, we discussed the association of immunosenescence and chronic immune activation in HIV-TB co-infection and reviewed the role played by mediators of immune deterioration in HIV-TB co-infection necessitating the importance of designing therapeutic strategies against HIV disease progression and pathogenesis. PMID:25674514

  2. Macrophage activation associated with chronic murine cytomegalovirus infection results in more severe experimental choroidal neovascularization.

    PubMed

    Cousins, Scott W; Espinosa-Heidmann, Diego G; Miller, Daniel M; Pereira-Simon, Simone; Hernandez, Eleut P; Chien, Hsin; Meier-Jewett, Courtney; Dix, Richard D

    2012-01-01

    The neovascular (wet) form of age-related macular degeneration (AMD) leads to vision loss due to choroidal neovascularization (CNV). Since macrophages are important in CNV development, and cytomegalovirus (CMV)-specific IgG serum titers in patients with wet AMD are elevated, we hypothesized that chronic CMV infection contributes to wet AMD, possibly by pro-angiogenic macrophage activation. This hypothesis was tested using an established mouse model of experimental CNV. At 6 days, 6 weeks, or 12 weeks after infection with murine CMV (MCMV), laser-induced CNV was performed, and CNV severity was determined 4 weeks later by analysis of choroidal flatmounts. Although all MCMV-infected mice exhibited more severe CNV when compared with control mice, the most severe CNV developed in mice with chronic infection, a time when MCMV-specific gene sequences could not be detected within choroidal tissues. Splenic macrophages collected from mice with chronic MCMV infection, however, expressed significantly greater levels of TNF-α, COX-2, MMP-9, and, most significantly, VEGF transcripts by quantitative RT-PCR assay when compared to splenic macrophages from control mice. Direct MCMV infection of monolayers of IC-21 mouse macrophages confirmed significant stimulation of VEGF mRNA and VEGF protein as determined by quantitative RT-PCR assay, ELISA, and immunostaining. Stimulation of VEGF production in vivo and in vitro was sensitive to the antiviral ganciclovir. These studies suggest that chronic CMV infection may serve as a heretofore unrecognized risk factor in the pathogenesis of wet AMD. One mechanism by which chronic CMV infection might promote increased CNV severity is via stimulation of macrophages to make pro-angiogenic factors (VEGF), an outcome that requires active virus replication. PMID:22570607

  3. Macrophage Activation Associated with Chronic Murine Cytomegalovirus Infection Results in More Severe Experimental Choroidal Neovascularization

    PubMed Central

    Cousins, Scott W.; Espinosa-Heidmann, Diego G.; Miller, Daniel M.; Pereira-Simon, Simone; Hernandez, Eleut P.; Chien, Hsin; Meier-Jewett, Courtney; Dix, Richard D.

    2012-01-01

    The neovascular (wet) form of age-related macular degeneration (AMD) leads to vision loss due to choroidal neovascularization (CNV). Since macrophages are important in CNV development, and cytomegalovirus (CMV)-specific IgG serum titers in patients with wet AMD are elevated, we hypothesized that chronic CMV infection contributes to wet AMD, possibly by pro-angiogenic macrophage activation. This hypothesis was tested using an established mouse model of experimental CNV. At 6 days, 6 weeks, or 12 weeks after infection with murine CMV (MCMV), laser-induced CNV was performed, and CNV severity was determined 4 weeks later by analysis of choroidal flatmounts. Although all MCMV-infected mice exhibited more severe CNV when compared with control mice, the most severe CNV developed in mice with chronic infection, a time when MCMV-specific gene sequences could not be detected within choroidal tissues. Splenic macrophages collected from mice with chronic MCMV infection, however, expressed significantly greater levels of TNF-α, COX-2, MMP-9, and, most significantly, VEGF transcripts by quantitative RT-PCR assay when compared to splenic macrophages from control mice. Direct MCMV infection of monolayers of IC-21 mouse macrophages confirmed significant stimulation of VEGF mRNA and VEGF protein as determined by quantitative RT-PCR assay, ELISA, and immunostaining. Stimulation of VEGF production in vivo and in vitro was sensitive to the antiviral ganciclovir. These studies suggest that chronic CMV infection may serve as a heretofore unrecognized risk factor in the pathogenesis of wet AMD. One mechanism by which chronic CMV infection might promote increased CNV severity is via stimulation of macrophages to make pro-angiogenic factors (VEGF), an outcome that requires active virus replication. PMID:22570607

  4. Monitoring of Vibrio harveyi quorum sensing activity in real time during infection of brine shrimp larvae

    PubMed Central

    Defoirdt, Tom; Sorgeloos, Patrick

    2012-01-01

    Quorum sensing, bacterial cell-to-cell communication, has been linked to the virulence of pathogenic bacteria. Indeed, in vitro experiments have shown that many bacterial pathogens regulate the expression of virulence genes by this cell-to-cell communication process. Moreover, signal molecules have been detected in samples retrieved from infected hosts and quorum sensing disruption has been reported to result in reduced virulence in different host–pathogen systems. However, data on in vivo quorum sensing activity of pathogens during infection of a host are currently lacking. We previously reported that quorum sensing regulates the virulence of Vibrio harveyi in a standardised model system with gnotobiotic brine shrimp (Artemia franciscana) larvae. Here, we monitored quorum sensing activity in Vibrio harveyi during infection of the shrimp, using bioluminescence as a read-out. We found that wild-type Vibrio harveyi shows a strong increase in quorum sensing activity early during infection. In this respect, the bacteria behave remarkably similar in different larvae, despite the fact that only half of them survive the infection. Interestingly, when expressed per bacterial cell, Vibrio harveyi showed around 200-fold higher maximal quorum sensing-regulated bioluminescence when associated with larvae than in the culture water. Finally, the in vivo quorum sensing activity of mutants defective in the production of one of the three signal molecules is consistent with their virulence, with no detectable in vivo quorum sensing activity in AI-2- and CAI-1-deficient mutants. These results indicate that AI-2 and CAI-1 are the dominant signals during infection of brine shrimp. PMID:22673627

  5. Monitoring of Vibrio harveyi quorum sensing activity in real time during infection of brine shrimp larvae.

    PubMed

    Defoirdt, Tom; Sorgeloos, Patrick

    2012-12-01

    Quorum sensing, bacterial cell-to-cell communication, has been linked to the virulence of pathogenic bacteria. Indeed, in vitro experiments have shown that many bacterial pathogens regulate the expression of virulence genes by this cell-to-cell communication process. Moreover, signal molecules have been detected in samples retrieved from infected hosts and quorum sensing disruption has been reported to result in reduced virulence in different host-pathogen systems. However, data on in vivo quorum sensing activity of pathogens during infection of a host are currently lacking. We previously reported that quorum sensing regulates the virulence of Vibrio harveyi in a standardised model system with gnotobiotic brine shrimp (Artemia franciscana) larvae. Here, we monitored quorum sensing activity in Vibrio harveyi during infection of the shrimp, using bioluminescence as a read-out. We found that wild-type Vibrio harveyi shows a strong increase in quorum sensing activity early during infection. In this respect, the bacteria behave remarkably similar in different larvae, despite the fact that only half of them survive the infection. Interestingly, when expressed per bacterial cell, Vibrio harveyi showed around 200-fold higher maximal quorum sensing-regulated bioluminescence when associated with larvae than in the culture water. Finally, the in vivo quorum sensing activity of mutants defective in the production of one of the three signal molecules is consistent with their virulence, with no detectable in vivo quorum sensing activity in AI-2- and CAI-1-deficient mutants. These results indicate that AI-2 and CAI-1 are the dominant signals during infection of brine shrimp. PMID:22673627

  6. Neonatal infection modulates behavioral flexibility and hippocampal activation on a Morris Water Maze task

    PubMed Central

    Williamson, Lauren L.; Bilbo, Staci D.

    2014-01-01

    Neonatal infection has enduring effects on the brain, both at the cellular and behavioral levels. We determined the effects of peripheral infection with Escherichia coli at postnatal day (P) 4 in rats on a water maze task in adulthood, and assessed neuronal activation in the dentate gyrus (DG) following the memory test. Rats were trained and tested on one of 3 distinct water maze task paradigms: 1) minimal training (18 trials/ 3 days), 2) extended training (50 trials/ 10 days) or 3) reversal training (extended training followed by 30 trials/ 3 days with a new platform location). Following a 48HR memory test, brains were harvested to assess neuronal activation using activity-regulated cytoskeleton-associated (Arc) protein in the DG. Following minimal training, rats treated neonatally with E. coli had improved performance and paradoxically reduced Arc expression during the memory test compared to control rats treated with PBS early in life. However, neonatally-infected rats did not differ from control rats in behavior or neuronal activation during the memory test following extended training. Furthermore, rats treated neonatally with E. coli were significantly impaired during the 48HR memory test for a reversal platform location, unlike controls. Specifically, whereas neonatally-infected rats were able to acquire the new location at the same rate as controls, they spent significantly less time in the target quadrant for the reversal platform during a memory test. However, neonatally-infected and control rats had similar levels of Arc expression following the 48HR memory test for reversal. Together, these data indicate that neonatal infection may improve the rate of acquisition on hippocampal-dependent tasks while impairing flexibility on the same tasks; in addition, network activation in the DG during learning may be predictive of future cognitive flexibility on a hippocampal-dependent task. PMID:24576680

  7. Altered invertase activities of symptomatic tissues on Beet severe curly top virus (BSCTV) infected Arabidopsis thaliana.

    PubMed

    Park, Jungan; Kim, Soyeon; Choi, Eunseok; Auh, Chung-Kyun; Park, Jong-Bum; Kim, Dong-Giun; Chung, Young-Jae; Lee, Taek-Kyun; Lee, Sukchan

    2013-09-01

    Arabidopsis thaliana infected with Beet severe curly top virus (BSCTV) exhibits systemic symptoms such as stunting of plant growth, callus induction on shoot tips, and curling of leaves and shoot tips. The regulation of sucrose metabolism is essential for obtaining the energy required for viral replication and the development of symptoms in BSCTV-infected A. thaliana. We evaluated the changed transcript level and enzyme activity of invertases in the inflorescence stems of BSCTV-infected A. thaliana. These results were consistent with the increased pattern of ribulose-1,5-bisphosphate carboxylase/oxygenase activity and photosynthetic pigment concentration in virus-infected plants to supply more energy for BSCTV multiplication. The altered gene expression of invertases during symptom development was functionally correlated with the differential expression patterns of D-type cyclins, E2F isoforms, and invertase-related genes. Taken together, our results indicate that sucrose sensing by BSCTV infection may regulate the expression of sucrose metabolism and result in the subsequent development of viral symptoms in relation with activation of cell cycle regulation. PMID:23589148

  8. NKT cell activation by local α-galactosylceramide administration decreases susceptibility to HSV-2 infection.

    PubMed

    Iversen, Marie Beck; Jensen, Simon Kok; Hansen, Anne Louise; Winther, Henriette; Issazadeh-Navikas, Shohreh; Reinert, Line Sinnathamby; Holm, Christian Kanstrup

    2015-06-01

    NKT cells are a subgroup of T cells, which express a restricted TCR repertoire and are critical for the innate immune responses to viral infections. Activation of NKT cells depends on the major histocompatibility complex-related molecule CD1d, which presents bioactive lipids to NKT cells. The marine sponge derived lipid αGalCer has recently been demonstrated as a specific agonist for activation of human and murine NKT cells. In the present study we investigated the applicability of αGalCer pre-treatment for immune protection against intra-vaginal HSV-2 infection. We found that C57BL/6 WT mice that received local pre-treatment with αGalCer prior to intra-vaginal HSV-2 infection had a lower mean disease score, mortality and viral load in the vagina following infection, compared to mice that did not receive αGalCer pre-treatment. Further, we found increased numbers of CD45 and NK1.1 positive cells in vaginal tissue and elevated levels of IFN-γ in the vaginal tissue and in vaginal fluids 24h after αGalCer pre-treatment. Collectively our data demonstrate a protective effect of αGalCer induced activation of NKT cells in the innate immune protection against viral infection. PMID:25648689

  9. The hepatoprotective activity of blue green algae in Schistosoma mansoni infected mice.

    PubMed

    Mohamed, Azza H; Osman, Gamalat Y; Salem, Tarek A; Elmalawany, Alshimaa M

    2014-10-01

    This study aims to evaluate the immunomodulatory effects of a natural product, blue green algae (BGA) (100 mg/kg BW), alone or combined with praziquantel PZQ (250 mg/kg BW) on granulomatous inflammation, liver histopathology, some biochemical and immunological parameters in mice infected with Schistosoma mansoni. Results showed that the diameter and number of egg granuloma were significantly reduced after treatment of S. mansoni-infected mice with BGA, PZQ and their combination. The histopathological alterations observed in the liver of S. mansoni-infected mice were remarkably inhibited after BGA treatments. BGA decreased the activities of aspartate aminotransferase (AST), alanine aminotransferase (ALT) and alkaline phosphatase (ALP) as well as the level of total protein (TP) while the level of albumin was increased. Treatment of infected mice with BGA, PZQ as well as their combination led to significant elevation in the activities of hepatic antioxidant enzymes glutathione peroxidase (GPX) and glutathione-S-transferase (GST) as compared with control group. Combination of BGA and PZQ resulted in significant reduction in the level of intercellular adhesion molecules-1 (ICAM-1), vascular adhesion molecules-1 (VCAM-1) and tumor necrosis factor-alpha (TNF-α) when compared to those of the S. mansoni-infected group. Overall, BGA significantly inhibited the liver damage accompanied with schistosomiasis, exhibited a potent antioxidant and immunoprotective activities. This study suggests that BGA can be considered as promising for development a complementary and/or alternative medicine against schistosomiasis. PMID:25016189

  10. Pseudomonas aeruginosa wound infection involves activation of its iron acquisition system in response to fascial contact

    PubMed Central

    Kim, M.; Christley, S.; Khodarev, N. N.; Fleming, I.; Huang, Y.; Chang, E.; Zaborina, O.; Alverdy, J.

    2015-01-01

    Background Wound infections are traditionally thought to occur when microbial burden exceeds the innate clearance capacity of host immune system. Here we introduce the idea that the wound environment itself plays a significant contributory role to wound infection. Methods We developed a clinically relevant murine model of soft tissue infection to explore the role of activation of microbial virulence in response to tissue factors as a mechanism by which pathogenic bacteria cause wound infections. Mice underwent abdominal skin incision and light muscle injury with a crushing forceps versus skin incision alone followed by topical inoculation of P. aeruginosa. Mice were sacrificed on postoperative day 6 and abdominal tissues analyzed for clinical signs of wound infection. To determine if specific wound tissues components induce bacterial virulence, P. aeruginosa was exposed to skin, fascia, and muscle. Results Gross wound infection due to P. aeruginosa was observed to be significantly increased in injured tissues vs non-injured (80% vs 10%) tissues (n=20/group, p<0.0001). Exposure of P. aeruginosa to individual tissue components demonstrated that fascia significantly induced bacterial virulence as judged by the production of pyocyanin, a redox-active phenazine compound known to kill immune cells. Whole genome transcriptional profiling of P. aeruginosa exposed to fascia demonstrated activation of multiple genes responsible for the synthesis of the iron scavenging molecule pyochelin. Conclusion We conclude that wound elements, in particular fascia, may play a significant role in enhancing the virulence of P. aeruginosa and may contribute to the pathogenesis of clinical wound infection. PMID:25807409

  11. Activation of IFN-γ/STAT/IRF-1 in Hepatic Responses to Klebsiella pneumoniae Infection

    PubMed Central

    Lin, Yi-Chun; Lu, Min-Chi; Lin, Chingju; Chiang, Ming-Ko; Jan, Ming-Shiou; Tang, Hui-Ling; Liu, Hsu-Chung; Lin, Wea-Lung; Huang, Chih-Yang; Chen, Chuan-Mu; Lai, Yi-Chyi

    2013-01-01

    Background Klebsiella pneumoniae-caused liver abscess (KLA) has become a health problem in Taiwan and is continually reported in other countries. Diabetes mellitus, the most common metabolic disorder, underlies half of the KLA patients in Taiwan. The clinical impact of KLA has been well-documented. Nevertheless, the molecular basis regarding how K. pneumoniae causes liver infection, particularly in diabetic individuals, remains unclear. Methodology/Principle Findings Auto-bioluminescence-expressing K. pneumoniae was inoculated into diabetic mice and age-match naïve control. With the use of in vivo imaging system, translocation of the bioluminescence-expressing K. pneumoniae from intestine to extraintestinal organs, mainly the liver, was noted in 80% of the diabetic mice, whereas the same bacteria causes extraintestinal infections in only 31% of naïve mice. Besides increased morbidity, the severity of hepatic tissue injury was also enhanced in the K. pneumoniae-infected diabetic mice. Upon K. pneumoniae infection, IFN-γ production was significantly evoked in the liver. To mediate IFN-γ signal, STAT (signal transducers and activators of transcription) 1 and 3 were activated in hepatocytes, and so was the expression of IRF (interferon regulatory factor)-1. Moreover, accumulation of neutrophils which was triggered by prolonged production of IL-1β and MIP-2, and significant increases in the level of active caspase 3 and phospho-eIF2α, were exclusively revealed in the K. pneumoniae-infected diabetic mice. Conclusion The activation of IFN-γ/STAT/IRF-1 signaling demonstrated by this work emphasizes the role of IFN-γ for mediating the hepatic response to K. pneumoniae infection. PMID:24223208

  12. Oseltamivir reduces hippocampal abnormal EEG activities after a virus infection (influenza) in isoflurane-anesthetized rats

    PubMed Central

    Cissé, Youssouf; Inoue, Isao; Kido, Hiroshi

    2012-01-01

    Background Oseltamivir phosphate (OP, Tamiflu®) is a widely used drug in the treatment of influenza with fever. However, case reports have associated OP intake with sudden abnormal behaviors. In rats infected by the influenza A virus (IAV), the electroencephalogram (EEG) displayed abnormal high-voltage amplitudes with spikes and theta oscillations at a core temperature of 39.9°C to 41°C. Until now, there has been no information describing the effect of OP on intact brain hippocampal activity of IAV-infected animals during hyperthermia. Objective The aim of the present study was to examine the effect of OP on abnormal EEG activities in the hippocampus using the rat model of influenza-associated encephalopathy. Methods Male Wistar rats aged 3 to 4 weeks were used for the study. Influenza A/WSN/33 strain (1 × 105 plaque forming unit in PBS, 60 µL) was applied intranasally to the rats. To characterize OP effects on the IAV-infected rats, EEG activity was studied more particularly in isoflurane-anesthetized IAV-infected rats during hyperthermia. Results We found that the hippocampal EEG of the OP-administered (10 mg/kg) IAV-infected rats showed significant reduction of the high-voltage amplitudes and spikes, but the theta oscillations, which had been observed only at >40°C in OP non-administered rats, appeared at 38°C core temperature. Atropine (30 mg/kg) blocked the theta oscillations. Conclusion Our data suggest that OP efficiently reduces the abnormal EEG activities after IAV infection during hyperthermia. However, OP administration may stimulate ACh release in rats at normal core temperature.

  13. Activity and local delivery of azithromycin in a mouse model of Haemophilus influenzae lung infection.

    PubMed Central

    Vallée, E; Azoulay-Dupuis, E; Pocidalo, J J; Bergogne-Bérézin, E

    1992-01-01

    We compared the activities of azithromycin and erythromycin against Haemophilus influenzae in a mouse model of nonparenchymatous lower respiratory tract infection. In vitro and in vivo efficacy data for both drugs were analyzed relative to their pharmacokinetics in lungs and in vivo uptake by phagocytes. Aged C57BL/6 mice (mean age, 15.1 +/- 1.9 months) were infected intratracheally with 10(8) CFU of H. influenzae serotype b. Oral drug administration was initiated 4 h after infection by various dosage regimens. In terms of bacterial killing in the lung, azithromycin was much more active than erythromycin (P less than 0.01). Its in vivo activity was also more durable after a single administration relative to the durability of three doses of erythromycin given at 6-h intervals. The MIC of azithromycin was eightfold lower than that of erythromycin, and better penetration and a longer half-life in lung tissue were achieved after a single oral administration. Phagocytes delivered increased amounts of both drugs to the infected lungs, particularly at the site of infection (bronchoalveolar airspaces), and detectable levels of azithromycin were maintained locally for long periods. The fact that the efficacy of azithromycin coincided with the arrival of large numbers of polymorphonuclear leukocytes within the airspaces suggests that active extracellular concentrations were provided by the release of azithromycin from these cells. This further supports the potential value of once-daily azithromycin regimens for the treatment of lower respiratory tract infections in humans, provided that inhibitory concentrations against common pathogens such as H. influenzae are maintained for adequate periods of time. PMID:1324644

  14. Bicaudal D1-Dependent Trafficking of Human Cytomegalovirus Tegument Protein pp150 in Virus-Infected Cells ▿

    PubMed Central

    Indran, Sabarish V.; Ballestas, Mary E.; Britt, William J.

    2010-01-01

    Human cytomegalovirus (HCMV) virion assembly takes place in the nucleus and cytoplasm of infected cells. The HCMV virion tegument protein pp150 (ppUL32) is an essential protein of HCMV and has been suggested to play a role in the cytoplasmic phase of HCMV assembly. To further define its role in viral assembly and to identify host cell proteins that interact with pp150 during viral assembly, we utilized yeast two-hybrid analyses to detect an interaction between pp150 and Bicaudal D1 (BicD1), a protein thought to play a role in trafficking within the secretory pathway. BicD1 is known to interact with the dynein motor complex and the Rab6 GTPase. The interaction between pp150 and BicD1 was confirmed by coimmunoprecipitation and fluorescence resonance energy transfer. Depletion of BicD1 with short hairpin RNA (shRNA) caused decreased virus yield and a defect in trafficking of pp150 to the cytoplasmic viral assembly compartment (AC), without altering trafficking to the AC of another essential tegument protein, pp28, or the viral glycoprotein complex gM/gN. The C terminus of BicD1 has been previously shown to interact with the GTPase Rab6, suggesting a potential role for Rab6-mediated vesicular trafficking in HCMV assembly. Finally, overexpression of the N terminus of truncated BicD1 acts in a dominant-negative manner and leads to disruption of the AC and a decrease in the assembly of infectious virus. This phenotype was similar to that observed following overexpression of dynamitin (p50) and provided additional evidence that morphogenesis of the AC and virus assembly were dynein dependent. PMID:20089649

  15. Proteasome activator REGgamma enhances coxsackieviral infection by facilitating p53 degradation.

    PubMed

    Gao, Guang; Wong, Jerry; Zhang, Jingchun; Mao, Ivy; Shravah, Jayant; Wu, Yan; Xiao, Allen; Li, Xiaotao; Luo, Honglin

    2010-11-01

    Coxsackievirus B3 (CVB3) is a small RNA virus associated with diseases such as myocarditis, meningitis, and pancreatitis. We have previously demonstrated that proteasome inhibition reduces CVB3 replication and attenuates virus-induced myocarditis. However, the underlying mechanisms by which the ubiquitin/proteasome system regulates CVB replication remain unclear. In this study, we investigated the role of REGγ, a member of the 11S proteasome activator, in CVB3 replication. We showed that overexpression of REGγ promoted CVB3 replication but that knockdown of REGγ led to reduced CVB3 replication. We further demonstrated that REGγ-mediated p53 proteolysis contributes, as least in part, to the proviral function of REGγ. Although total protein levels of REGγ remained unaltered after CVB3 infection, virus infection induced a redistribution of REGγ from the nucleus to the cytoplasm, rendering an opportunity for a direct interaction of REGγ with viral proteins and/or host proteins (e.g., p53), which controls viral growth and thereby enhances viral infectivity. Further analyses suggested a potential modification of REGγ by SUMO following CVB3 infection, which was verified by both in vitro and in vivo sumoylation assays. Sumoylation of REGγ may play a role in its nuclear export during CVB3 infection. Taken together, our results present the first evidence that the host REGγ pathway is utilized and modified during CVB3 infection to promote efficient viral replication. PMID:20719955

  16. Lysis of typhus-group rickettsia-infected targets by lymphokine activated killers

    SciTech Connect

    Carl, M.; Dasch, G.A.

    1986-03-01

    The authors recently described a subset of OKT8, OKT3-positive lymphocytes from typhus-group rickettsia immune individuals which were capable of lysing autologous PHA-blasts or Epstein-Barr virus transformed B cells (LCL) infected with typhus-group rickettsiae. In order to determine if killing by these effectors was HLA-restricted, they stimulated peripheral blood mononuclear cells (PBMC) from typhus-group rickettsia immune individuals in vitro with typhus-group rickettsia-derived antigen for one week and then measured lysis of autologous LCL or HLA-mismatched LCL in a 4-6 hour Cr/sup 51/-release assay. There was significant lysis of both the autologous and the HLA-mismatched infected targets as compared to the corresponding uninfected targets. Since this suggested that the effectors were lymphokine activated killers (LAK) rather than cytotoxic T lymphocytes, they then tested this hypothesis by stimulating PBMC from both immune and non-immune individuals in vitro for one week with purified interleukin 2 and measuring lysis of infected, autologous LCL. PBMC thus treated, from both immune and non-immune individuals, were capable of significantly lysing autologous, infected LCL as compared to the non-infected control. They therefore conclude that targets infected with typhus-group rickettsiae are susceptible to lysis to LAK.

  17. Antimicrobial activity of curcumin against Helicobacter pylori isolates from India and during infections in mice.

    PubMed

    De, Ronita; Kundu, Parag; Swarnakar, Snehasikta; Ramamurthy, T; Chowdhury, Abhijit; Nair, G Balakrish; Mukhopadhyay, Asish K

    2009-04-01

    Treatment failure is a major cause of concern for the Helicobacter pylori-related gastroduodenal diseases like gastritis, peptic ulcer, and gastric cancer. Curcumin, diferuloylmethane from turmeric, has recently been shown to arrest H. pylori growth. The antibacterial activity of curcumin against 65 clinical isolates of H. pylori in vitro and during protection against H. pylori infection in vivo was examined. The MIC of curcumin ranges from 5 microg/ml to 50 microg/ml, showing its effectiveness in inhibiting H. pylori growth in vitro irrespective of the genetic makeup of the strains. The nucleotide sequences of the aroE genes, encoding shikimate dehydrogenase, against which curcumin seems to act as a noncompetitive inhibitor, from H. pylori strains presenting differential curcumin MICs showed that curcumin-mediated growth inhibition of Indian H. pylori strains may not be always dependent on the shikimate pathway. The antimicrobial effect of curcumin in H. pylori-infected C57BL/6 mice and its efficacy in reducing the gastric damage due to infection were examined histologically. Curcumin showed immense therapeutic potential against H. pylori infection as it was highly effective in eradication of H. pylori from infected mice as well as in restoration of H. pylori-induced gastric damage. This study provides novel insights into the therapeutic effect of curcumin against H. pylori infection, suggesting its potential as an alternative therapy, and opens the way for further studies on identification of novel antimicrobial targets of curcumin. PMID:19204190

  18. Trichomonas vaginalis infection activates cells through toll-like receptor 4.

    PubMed

    Zariffard, M Reza; Harwani, Sailesh; Novak, Richard M; Graham, Parrie J; Ji, Xin; Spear, Gregory T

    2004-04-01

    While Trichomonas vaginalis infection can cause inflammation and influx of leukocytes into the female genital tract, the molecular pathways important in inducing these effects are not known. This study determined if infection with T. vaginalis activates cells through toll-like receptor 4 (TLR4). Genital tract secretions from infected women stimulated TNF-alpha production by cells with functional TLR4 (350 pg/ml) but significantly less by cells that are unresponsive to TLR4 ligands (44 pg/ml, P = 0.001). Secretions collected after clearance of infection also induced significantly lower responses by cells with functional TLR4 (136 pg/ml, P = 0.008). TNF-alpha responses were not reduced by Polymyxin B and did not correlate with beta(2)-defensin levels, indicating that stimulation of cells was not through lipopolysaccharide or beta(2)-defensin. These studies show that T. vaginalis infection results in the appearance in the genital tract of substance(s) that stimulate cells through TLR4, suggesting a mechanism for the inflammation caused by this infection. PMID:15093558

  19. Does Infection-Induced Immune Activation Contribute to Dementia?

    PubMed Central

    Barichello, Tatiana; Generoso, Jaqueline S; Goularte, Jessica A; Collodel, Allan; Pitcher, Meagan R; Simões, Lutiana R; Quevedo, João; Dal-Pizzol, Felipe

    2015-01-01

    The central nervous system (CNS) is protected by a complex blood-brain barrier system; however, a broad diversity of virus, bacteria, fungi, and protozoa can gain access and cause illness. As pathogens replicate, they release molecules that can be recognized by innate immune cells. These molecules are pathogen-associated molecular patterns (PAMP) and they are identified by pattern-recognition receptors (PRR) expressed on antigen-presenting cells. Examples of PRR include toll-like receptors (TLR), receptors for advanced glycation endproducts (RAGE), nucleotide binding oligomerisation domain (NOD)-like receptors (NLR), c-type lectin receptors (CLR), RIG-I-like receptors (RLR), and intra-cytosolic DNA sensors. The reciprocal action between PAMP and PRR triggers the release of inflammatory mediators that regulate the elimination of invasive pathogens. Damage-associated molecular patterns (DAMP) are endogenous constituents released from damaged cells that also have the ability to activate the innate immune response. An increase of RAGE expression levels on neurons, astrocytes, microglia, and endothelial cells could be responsible for the accumulation of αβ-amyloid in dementia and related to the chronic inflammatory state that is found in neurodegenerative disorders. PMID:26425389

  20. Systemic Immune Activation Profiles of HIV-1 Subtype C-Infected Children and Their Mothers

    PubMed Central

    Makhubele, Tinyiko G.; Steel, Helen C.; Anderson, Ronald; van Dyk, Gisela; Theron, Annette J.; Rossouw, Theresa M.

    2016-01-01

    Little is known about immune activation profiles of children infected with HIV-1 subtype C. The current study compared levels of selected circulating biomarkers of immune activation in HIV-1 subtype C-infected untreated mothers and their children with those of healthy controls. Multiplex bead array, ELISA, and immunonephelometric procedures were used to measure soluble CD14 (sCD14), beta-2 microglobulin (β2M), CRP, MIG, IP-10, and transforming growth factor beta 1 (TGF-β1). Levels of all 6 biomarkers were significantly elevated in the HIV-infected mothers and, with the exception of MIG, in their children (P < 0.01–P < 0.0001). The effects of antiretroviral therapy (ART) and maternal smoking on these biomarkers were also assessed. With the exception of TGF-β1, which was unchanged in the children 12 months after therapy, initiation of ART was accompanied by decreases in the other biomarkers. Regression analysis revealed that although most biomarkers were apparently unaffected by smoking, exposure of children to maternal smoking was associated with a significant increase in IP-10. These findings demonstrate that biomarkers of immune activation are elevated in HIV-infected children pre-ART and decline, with the exception of TGF-β1, after therapy. Although preliminary, elevation of IP-10 in smoke-exposed infants is consistent with a higher level of immune activation in this group. PMID:27019552

  1. In vitro activity of dalbavancin against biofilms of staphylococci isolated from prosthetic joint infections.

    PubMed

    Fernández, Javier; Greenwood-Quaintance, Kerryl E; Patel, Robin

    2016-08-01

    The in vitro activity of dalbavancin was tested against biofilms of 171 staphylococci associated with prosthetic joint infection. Dalbavancin minimum biofilm bactericidal concentration (MBBC) values were: MBBC50 for Staphylococcus aureus and Staphylococcus epidermidis, 1μg/mL; MBBC90 for S. aureus, 2μg/mL; MBBC90 for S. epidermidis, 4μg/mL. PMID:27241369

  2. Molluscum contagiosum and herpes simplex in Maasai pastoralists; refeeding activation of virus infection following famine?

    PubMed

    Murray, M J; Murray, A B; Murray, N J; Murray, M B; Murray, C J

    1980-01-01

    An epidemic of molluscum contagiosum and oro-genital herpes simplex was observed in Maasai pastoralists of the Rift Valley. It coincided with a period of refeeding following famine, when the relief diet was different from normal milk fare. We propose that refeeding may be an important mechanism for activation of certain viral infections previously suppressed by famine. PMID:7434431

  3. Polyomavirus JCV excretion and genotype analysis in HIV-infected patients receiving highly active antiretroviral therapy

    NASA Technical Reports Server (NTRS)

    Lednicky, John A.; Vilchez, Regis A.; Keitel, Wendy A.; Visnegarwala, Fehmida; White, Zoe S.; Kozinetz, Claudia A.; Lewis, Dorothy E.; Butel, Janet S.

    2003-01-01

    OBJECTIVE: To assess the frequency of shedding of polyomavirus JC virus (JCV) genotypes in urine of HIV-infected patients receiving highly active antiretroviral therapy (HAART). METHODS: Single samples of urine and blood were collected prospectively from 70 adult HIV-infected patients and 68 uninfected volunteers. Inclusion criteria for HIV-infected patients included an HIV RNA viral load < 1000 copies, CD4 cell count of 200-700 x 106 cells/l, and stable HAART regimen. PCR assays and sequence analysis were carried out using JCV-specific primers against different regions of the virus genome. RESULTS: JCV excretion in urine was more common in HIV-positive patients but not significantly different from that of the HIV-negative group [22/70 (31%) versus 13/68 (19%); P = 0.09]. HIV-positive patients lost the age-related pattern of JCV shedding (P = 0.13) displayed by uninfected subjects (P = 0.01). Among HIV-infected patients significant differences in JCV shedding were related to CD4 cell counts (P = 0.03). Sequence analysis of the JCV regulatory region from both HIV-infected patients and uninfected volunteers revealed all to be JCV archetypal strains. JCV genotypes 1 (36%) and 4 (36%) were the most common among HIV-infected patients, whereas type 2 (77%) was the most frequently detected among HIV-uninfected volunteers. CONCLUSION: These results suggest that JCV shedding is enhanced by modest depressions in immune function during HIV infection. JCV shedding occurred in younger HIV-positive persons than in the healthy controls. As the common types of JCV excreted varied among ethnic groups, JCV genotypes associated with progressive multifocal leukoencephalopathy may reflect demographics of those infected patient populations.

  4. Concerted activation of the AIM2 and NLRP3 inflammasomes orchestrates host protection against Aspergillus infection

    PubMed Central

    Karki, Rajendra; Man, Si Ming; Malireddi, R.K. Subbarao; Gurung, Prajwal; Vogel, Peter; Lamkanfi, Mohamed; Kanneganti, Thirumala-Devi

    2015-01-01

    SUMMARY Invasive pulmonary aspergillosis is a leading cause of infection-associated mortality in immunocompromised individuals. Aspergillus fumigatus infection produces ligands that could activate inflammasomes but the contribution of these host defenses remains unclear. We show that two inflammasome receptors, AIM2 and NLRP3, recognize intracellular A. fumigatus and collectively induce protective immune responses. Mice lacking both AIM2 and NLRP3 fail to confine Aspergillus hyphae to inflammatory foci, leading to widespread hyphal dissemination to lung blood vessels. These mice succumb to infection more rapidly than WT mice or mice lacking a single inflammasome receptor. AIM2 and NLRP3 activation initiates assembly of a single cytoplasmic inflammasome platform, composed of the adaptor protein ASC along with caspase-1 and caspase-8. Combined actions of caspase-1 and caspase-8 lead to processing of proinflammatory cytokines IL-1β and IL-18 that critically control the infection. Thus, AIM2 and NLRP3 form a dual cytoplasmic surveillance system that orchestrates responses against A. fumigatus infection. PMID:25704009

  5. Altered metabolism of gut microbiota contributes to chronic immune activation in HIV-infected individuals.

    PubMed

    Vázquez-Castellanos, J F; Serrano-Villar, S; Latorre, A; Artacho, A; Ferrús, M L; Madrid, N; Vallejo, A; Sainz, T; Martínez-Botas, J; Ferrando-Martínez, S; Vera, M; Dronda, F; Leal, M; Del Romero, J; Moreno, S; Estrada, V; Gosalbes, M J; Moya, A

    2015-07-01

    Altered interplay between gut mucosa and microbiota during treated HIV infection may possibly contribute to increased bacterial translocation and chronic immune activation, both of which are predictors of morbidity and mortality. Although a dysbiotic gut microbiota has recently been reported in HIV+ individuals, the metagenome gene pool associated with HIV infection remains unknown. The aim of this study is to characterize the functional gene content of gut microbiota in HIV+ patients and to define the metabolic pathways of this bacterial community, which is potentially associated with immune dysfunction. We determined systemic markers of innate and adaptive immunity in a cohort of HIV-infected individuals on successful antiretroviral therapy without comorbidities and in healthy non-HIV-infected subjects. Metagenome sequencing revealed an altered functional profile, with enrichment of the genes involved in various pathogenic processes, lipopolysaccharide biosynthesis, bacterial translocation, and other inflammatory pathways. In contrast, we observed depletion of genes involved in amino acid metabolism and energy processes. Bayesian networks showed significant interactions between the bacterial community, their altered metabolic pathways, and systemic markers of immune dysfunction. This study reveals altered metabolic activity of microbiota and provides novel insight into the potential host-microbiota interactions driving the sustained inflammatory state in successfully treated HIV-infected patients. PMID:25407519

  6. Protection against lethal bacterial infection in mice by monocyte-chemotactic and -activating factor.

    PubMed Central

    Nakano, Y; Kasahara, T; Mukaida, N; Ko, Y C; Nakano, M; Matsushima, K

    1994-01-01

    Chemotactic factors regulate the recruitment of neutrophils, lymphocytes, or monocytes-macrophages to infectious and inflammatory sites. The purpose of this study was to determine whether monocyte-chemotactic and -activating factor (MCAF [MCP-1], a JE gene product) also influences the host defense mechanism against microbial infection. We evaluated the effect of recombinant human MCAF on the survival rate of mice systemically infected with Pseudomonas aeruginosa or Salmonella typhimurium. The administration of 2.5 micrograms of MCAF 6 h before infection completely protected the mice from lethal infection. Mice with cyclophosphamide-induced leukopenia exhibiting increased susceptibility to P. aeruginosa were also endowed with resistance by the same dose of MCAF. Administration of MCAF at -6 h was critical, since MCAF given either earlier or later than -6 h failed to rescue mice from lethal infection. The in vivo effect on the survival of mice paralleled the reduced recovery of viable P. aeruginosa or S. typhimurium from the peritoneal cavity, i.e., the number of recovered bacteria from the MCAF (2.5 micrograms per mouse)-treated mice was reduced to less than 2% of control mice for P. aeruginosa and 4% of control mice for S. typhimurium at 24 h. Since MCAF exhibited chemotaxis on murine macrophages as well as enhanced phagocytosis and killing of bacteria in vitro, the activation of macrophages, followed by the recruitment into the peritoneal cavity, is responsible for eliminating bacteria and thus enhancing the survival rate. PMID:8300198

  7. Schistosoma mansoni: autoantibodies and polyclonal B cell activation in infected mice.

    PubMed Central

    Fischer, E; Camus, D; Santoro, F; Capron, A

    1981-01-01

    The appearance of autoantibodies was investigated during the course of Schistosoma mansoni infection in C57Bl/6 mice. Anti-liver autoantibodies or lymphocyte-reactive alloantibodies were detected respectively without cell-mediated immunity against liver antigen or lymphocytotoxic activity. Anti-liver, anti-DNA, anti-Ig and anti-lymphocyte antibodies were shown 6-7 weeks after the beginning of the infection concomitantly with the increase of immunoglobulin levels and circulating immune complexes. At this period, the antibody response to polyvinylpyrrolidone (PVP) was increased and the injection of spleen cells from day-45-infected mice to uninfected recipients increased the anti-PVP antibody response. Conversely, the injection of spleen cells from uninfected to infected mice did not modify the anti-PVP Ab response. After 6 weeks of infection, the basal thymidine incorporation of spleen cells was increased contrasting with the marked inhibition of spleen cell response to PHA. The present data are consistent with the induction of a polyclonal non-specific B cell activation by S. mansoni. PMID:6978217

  8. Peroxisome Proliferator-Activated Receptor (PPAR): Balance for Survival in Parasitic Infections

    PubMed Central

    Chan, Marion M.; Evans, Kyle W.; Moore, Andrea R.; Fong, Dunne

    2010-01-01

    Parasitic infections induce a magnitude of host responses. At the opposite ends of the spectrum are those that ensure the host's needs to eliminate the invaders and to minimize damage to its own tissues. This review analyzes how parasites would manipulate immunity by activating the immunosuppressive nuclear factor, peroxisome proliferator-activated receptors (PPARs) with type 2 cytokines and free fatty acids from arachidonic acid metabolism. PPARs limit the action of type 1 immunity, in which classically activated macrophages act through the production of proinflammatory signals, to spare the parasites. They also favor the development of alternately activated macrophages which control inflammation so the host would not be destroyed. Possibly, the nuclear factors hold a pivotal role in the establishment of chronic infection by delicately balancing the pro- and anti-inflammatory signaling mechanisms and their ligands may be used as combination therapeutics to limit host pathology. PMID:20169106

  9. Exploiting Innate Immune Cell Activation of a Copper-Dependent Antimicrobial Agent during Infection

    PubMed Central

    Festa, Richard A.; Helsel, Marian E.; Franz, Katherine J.; Thiele, Dennis J.

    2014-01-01

    SUMMARY Recalcitrant microbial infections demand new therapeutic options. Here we present an approach that exploits two prongs of the host immune cell antimicrobial response: the oxidative burst and the compartmentalization of copper (Cu) within phagolysosomes. The prochelator QBP is a nontoxic protected form of 8-hydroxyquinoline (8HQ) in which a pinanediol boronic ester blocks metal ion coordination by 8HQ. QBP is deprotected via reactive oxygen species produced by activated macrophages, creating 8HQ and eliciting Cu-dependent killing of the fungal pathogen Cryptococcus neoformans in vitro and in mouse pulmonary infection. 8HQ ionophoric activity increases intracellular Cu, overwhelming the Cu-resistance mechanisms of C. neoformans to elicit fungal killing. The Cu-dependent antimicrobial activity of 8HQ against a spectrum of microbial pathogens suggests that this strategy may have broad utility. The conditional activation of Cu ionophores by innate immune cells intensifies the hostile antimicrobial environment and represents a promising approach to combat infectious disease. PMID:25088681

  10. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  11. Expansion of highly activated invariant natural killer T cells with altered phenotype in acute dengue infection.

    PubMed

    Kamaladasa, A; Wickramasinghe, N; Adikari, T N; Gomes, L; Shyamali, N L A; Salio, M; Cerundolo, V; Ogg, G S; Malavige, G Neelika

    2016-08-01

    Invariant natural killer T (iNKT) cells are capable of rapid activation and production of cytokines upon recognition of antigenic lipids presented by CD1d molecules. They have been shown to play a significant role in many viral infections and were observed to be highly activated in patients with acute dengue infection. In order to characterize further their role in dengue infection, we investigated the proportion of iNKT cells and their phenotype in adult patients with acute dengue infection. The functionality of iNKT cells in patients was investigated by both interferon (IFN)-γ and interleukin (IL)-4 ex-vivo enzyme-linked immunospot (ELISPOT) assays following stimulation with alpha-galactosyl-ceramide (αGalCer). We found that circulating iNKT cell proportions were significantly higher (P = 0·03) in patients with acute dengue when compared to healthy individuals and were predominantly of the CD4(+) subset. iNKT cells of patients with acute dengue had reduced proportions expressing CD8α and CD161 when compared to healthy individuals. The iNKT cells of patients were highly activated and iNKT activation correlated significantly with dengue virus-specific immunoglobulin (Ig)G antibody levels. iNKT cells expressing Bcl-6 (P = 0·0003) and both Bcl-6 and inducible T cell co-stimulator (ICOS) (P = 0·006) were increased significantly in patients when compared to healthy individuals. Therefore, our data suggest that in acute dengue infection there is an expansion of highly activated CD4(+) iNKT cells, with reduced expression of CD161 markers. PMID:26874822

  12. Hepatitis C Virus Infection Is Associated With an Increased Risk of Active Tuberculosis Disease: A Nationwide Population-Based Study.

    PubMed

    Wu, Ping-Hsun; Lin, Yi-Ting; Hsieh, Kun-Pin; Chuang, Hung-Yi; Sheu, Chau-Chyun

    2015-08-01

    Tuberculosis (TB) and hepatitis C virus (HCV) infection contribute to major disease mortality and morbidity worldwide. However, the causal link between HCV infection and TB risk remains unclear. We conducted a population-based cohort study to elucidate the association between HCV infection and TB disease by analyzing Taiwan National Health Insurance Database. We enrolled 5454 persons with HCV infection and 54,274 age- and sex-matched non-HCV-infected persons between January 1998 and December 2007. Time-dependent Cox proportional hazards regression analysis was used to measure the association between HCV infection and active TB disease. Incidence rate of active TB disease was higher among HCV infection than in control (134.1 vs 89.1 per 100,000 person-years; incidence rate ratio 1.51; P = 0.014). HCV infection was significantly associated with active TB disease in multivariate Cox regression (adjusted hazard ratio [HR] 3.20; 95% confidence interval [CI], 1.85-5.53; P < 0.001) and competing death risk event analysis (adjusted HR 2.11; 95% CI, 1.39-3.20; P < 0.001). Multivariate stratified analysis further revealed that HCV infection was a risk of active TB disease in most strata. This nationwide cohort study suggests that HCV infection is associated with a higher risk of developing active TB disease. PMID:26287416

  13. Aggressive Peripheral CD70-positive T-cell Lymphoma Associated with Severe Chronic Active EBV Infection

    PubMed Central

    Shaffer, Donald R.; Sheehan, Andrea M.; Yi, Zhongzhen; Rodgers, Cheryl C; Bollard, Catherine M; Brenner, Malcolm K; Rooney, Cliona M; Heslop, Helen E; Gottschalk, Stephen

    2011-01-01

    Severe chronic active Epstein-Barr virus infection (CAEBV) in T or NK cells is a rare complication of latent EBV infection. CAEBV associated T-cell lymphoproliferative disease (LPD) consists of polyclonal lesions as well as aggressive lymphomas. Here we report such a patient. In addition, we show that this primary CAEBV associated T-cell lymphoma expresses CD70 and is sensitive to killing by CD70-specific T cells, identifying CD70 as a potential immunotherapeutic target for CAEBV-associated T-cell lymphoma. PMID:21994111

  14. Activity of 5-chloro-pyrazinamide in mice infected with Mycobacterium tuberculosis or Mycobacterium bovis

    PubMed Central

    Ahmad, Zahoor; Tyagi, Sandeep; Minkowski, Austin; Almeida, Deepak; Nuermberger, Eric L.; Peck, Kaitlin M.; Welch, John T.; Baughn, Anthony D.; Jacobs, Williams R.; Grosset, Jacques H.

    2012-01-01

    Background & objectives: Pyrazinamide is an essential component of first line anti-tuberculosis regimen as well as most of the second line regimens. This drug has a unique sterilizing activity against Mycobacterium tuberculosis. Its unique role in tuberculosis treatment has lead to the search and development of its structural analogues. One such analogue is 5-chloro-pyrazinamide (5-Cl-PZA) that has been tested under in vitro conditions against M. tuberculosis. The present study was designed with an aim to assess the activity of 5-Cl-PZA, alone and in combination with first-line drugs, against murine tuberculosis. Methods: The minimum inhibitory concentration (MIC) of 5-Cl-PZA in Middlebrook 7H9 broth (neutral pH) and the inhibitory titre of serum from mice that received a 300 mg/kg oral dose of 5-Cl-PZA 30 min before cardiac puncture were determined. To test the tolerability of orally administered 5-Cl-PZA, uninfected mice received doses up to 300 mg/kg for 2 wk. Four weeks after low-dose aerosol infection either with M. tuberculosis or M. bovis, mice were treated 5 days/wk with 5-Cl-PZA, at doses ranging from 37.5 to 150 mg/kg, either alone or in combination with isoniazid and rifampicin. Antimicrobial activity was assessed by colony-forming unit counts in lungs after 4 and 8 wk of treatment. Results: The MIC of 5-Cl-PZA against M. tuberculosis was between 12.5 and 25 μg/ml and the serum inhibitory titre was 1:4. Under the same experimental conditions, the MIC of pyrazinamide was >100 μg/ml and mouse serum had no inhibitory activity after a 300 mg/kg dose; 5-Cl-PZA was well tolerated in uninfected and infected mice up to 300 and 150 mg/kg, respectively. While PZA alone and in combination exhibited its usual antimicrobial activity in mice infected with M. tuberculosis and no activity in mice infected with M. bovis, 5-Cl-PZA exhibited antimicrobial activity neither in mice infected with M. tuberculosis nor in mice infected with M. bovis. Interpretation

  15. Evaluation of the Microbicidal Activity and Cytokines/Chemokines Profile Released by Neutrophils from HTLV-1-Infected Individuals

    PubMed Central

    Bezerra, Caroline A.; Cardoso, Thiago M.; Giudice, Angela; Porto, Aurélia F.; Santos, Silvane B.; Carvalho, Edgar M.; Bacellar, Olívia

    2011-01-01

    Human T cell lymphotropic virus type-1 (HTLV-1) induces activation and spontaneous proliferation of T cells with production of type-1 pro-inflammatory cytokines. It modifies the immune response to other antigens and increases susceptibility to infectious diseases. However, little is known about innate immunity in HTLV-1 infection. HTLV-1-infected individuals have higher spontaneous neutrophil activation than HTLV-1-seronegative individuals, as shown by the nitroblue tetrazolium (NBT) assay. This study was conducted to evaluate neutrophil function in HTLV-1-infected individuals. Participants in the study included 18 HTLV-1-infected individuals and 14 HTLV-1-seronegative controls. We evaluated the ability of neutrophils (PMNs) to control a parasite infection, to produce peroxynitrite, cytokines and chemokines and to express activation markers in cultures when stimulated with LPS or infected with Leishmania. When compared with the control group, there was no difference in the percentage of PMNs infected with Leishmania or in the number of amastigotes/100 PMNs in HTLV-1-infected individuals. The microbicidal activity of the PMNs and the levels of CXCL8 and CCL4 released by these cells did not show a difference between HTLV-1-infected individuals and the control group. In both the HTLV-1 group and the control group, infection with Leishmania or stimulation of PMNs led to cellular activation. These observations suggest that neutrophils from HTLV-1-infected individuals have preserved their ability to become activated and to produce chemokines and peroxynitrite after stimulation and that the susceptibility to infection by intracellular Leishmania amazonensis in HTLV-1-infected individuals does not depend on impairment of neutrophil function. PMID:21595736

  16. Mycobacterium avium serovars 2 and 8 infections elicit unique activation of the host macrophage immune responses.

    PubMed

    Cebula, B R; Rocco, J M; Maslow, J N; Irani, V R

    2012-12-01

    Mycobacterium avium is an opportunistic pathogen whose pathogenesis is attributed to its serovar-specific glycopeptidolipid (ssGPL), which varies among its 31 serovars. To determine if the presence and type of ssGPLs contribute to M. avium pathogenesis, we infected murine macrophages (mφs) with two M. avium wild type (wt) serovars (2 and 8) and their serovar-null strains. We examined the influence of ssGPL (presence and type) on cytokine production in non-activated (-IFN-γ) and activated (+IFN-γ) mφs, and the bacterial intra-mφ survival over a 6-day infection process. Serovar-2 infections activated TNF-α production that increased over the 6 day period and was capable of controlling the intra-mφ serovar-2 null strain. In contrast, the serovar-8 infection stimulated a strong pro-inflammatory response, but was incapable of removing the invading pathogen, maybe through IL-10 production. It was clear that the intracellular growth of serovar-null in contrast to the wt M. avium strains was easily controlled. Based on our findings and the undisputed fact that M. avium ssGPL is key to its pathogenesis, we conclude that it is not appropriate to dissect the pathogenesis of one M. avium serovar and apply those findings to other serovars. PMID:22991047

  17. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus.

    PubMed

    Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair

    2016-07-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220

  18. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus

    PubMed Central

    McGregor, Alistair

    2016-01-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107–179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220

  19. The efficiency of human cytomegalovirus pp65(495-503) CD8+ T cell epitope generation is determined by the balanced activities of cytosolic and endoplasmic reticulum-resident peptidases.

    PubMed

    Urban, Sabrina; Textoris-Taube, Kathrin; Reimann, Barbara; Janek, Katharina; Dannenberg, Tanja; Ebstein, Frédéric; Seifert, Christin; Zhao, Fang; Kessler, Jan H; Halenius, Anne; Henklein, Petra; Paschke, Julia; Cadel, Sandrine; Bernhard, Helga; Ossendorp, Ferry; Foulon, Thierry; Schadendorf, Dirk; Paschen, Annette; Seifert, Ulrike

    2012-07-15

    Control of human CMV (HCMV) infection depends on the cytotoxic activity of CD8(+) CTLs. The HCMV phosphoprotein (pp)65 is a major CTL target Ag and pp65(495-503) is an immunodominant CTL epitope in infected HLA-A*0201 individuals. As immunodominance is strongly determined by the surface abundance of the specific epitope, we asked for the components of the cellular Ag processing machinery determining the efficacy of pp65(495-503) generation, in particular, for the proteasome, cytosolic peptidases, and endoplasmic reticulum (ER)-resident peptidases. In vitro Ag processing experiments revealed that standard proteasomes and immunoproteasomes generate the minimal 9-mer peptide epitope as well as N-terminal elongated epitope precursors of different lengths. These peptides are largely degraded by the cytosolic peptidases leucine aminopeptidase and tripeptidyl peptidase II, as evidenced by increased pp65(495-503) epitope presentation after leucine aminopeptidase and tripeptidyl peptidase II knockdown. Additionally, with prolyl oligopeptidase and aminopeptidase B we identified two new Ag processing machinery components, which by destroying the pp65(495-503) epitope limit the availability of the specific peptide pool. In contrast to cytosolic peptidases, silencing of ER aminopeptidases 1 and 2 strongly impaired pp65(495-503)-specific T cell activation, indicating the importance of ER aminopeptidases in pp65(495-503) generation. Thus, cytosolic peptidases primarily interfere with the generation of the pp65(495-503) epitope, whereas ER-resident aminopeptidases enhance such generation. As a consequence, our experiments reveal that the combination of cytosolic and ER-resident peptidase activities strongly shape the pool of specific antigenic peptides and thus modulate MHC class I epitope presentation efficiency. PMID:22706083

  20. Downregulation of protein kinase PKR activation by porcine reproductive and respiratory syndrome virus at its early stage infection.

    PubMed

    Xiao, Yueqiang; Ma, Zexu; Wang, Rong; Yang, Liping; Nan, Yuchen; Zhang, Yan-Jin

    2016-05-01

    The interferon-induced double-strand RNA activated protein kinase (PKR) plays an important role in antiviral response. The objective of this study was to assess the effect of porcine reproductive and respiratory syndrome virus (PRRSV) on PKR activation. Here we report that PRRSV inhibited PKR activation during its early stage infection of primary pulmonary alveolar macrophages (PAMs). PRRSV infection led to lower level of phosphorylated PKR in comparison with mock-infected cells. The PKR inhibition was sustained until 10h post infection in the presence of polyI:C, a synthetic analog of double-stranded RNA activating PKR. PKR-mediated phosphorylation of the eukaryotic translation initiation factor eIF2α was also lower in the PRRSV-infected PAMs during the early stage infection. Interestingly, inactivated PRRSV was capable to inhibit the PKR activation until 6h post infection. This suggests that structural components of PRRSV virions were responsible for the inhibition, although PRRSV replication was needed for longer inhibition. These results indicate that the downregulation of PKR activation during early infection stage should be essential for PRRSV to avoid the antiviral response to initiate replication. This finding contributes to our understanding on PRRSV interaction with host innate immune response and reveal a target for control of PRRSV infection. PMID:27066702

  1. Immunomodulating and antiviral activities of Uncaria tomentosa on human monocytes infected with Dengue Virus-2.

    PubMed

    Reis, Sonia Regina I N; Valente, Ligia M M; Sampaio, André L; Siani, Antonio C; Gandini, Mariana; Azeredo, Elzinandes L; D'Avila, Luiz A; Mazzei, José L; Henriques, Maria das Graças M; Kubelka, Claire F

    2008-03-01

    Uncaria tomentosa (Willd.) DC., a large woody vine native to the Amazon and Central American rainforests has been used medicinally by indigenous peoples since ancient times and has scientifically proven immunomodulating, anti-inflammatory, cytotoxic and antioxidant activities. Several inflammatory mediators that are implicated in vascular permeability and shock are produced after Dengue Virus (DENV) infection by monocytes, the primary targets for virus replication. Here we assessed the immunoregulatory and antiviral activities from U. tomentosa-derived samples, which were tested in an in vitro DENV infection model. DENV-2 infected human monocytes were incubated with U. tomentosa hydro-alcoholic extract or either its pentacyclic oxindole alkaloid-enriched or non-alkaloid fractions. The antiviral activity was determined by viral antigen (DENV-Ag) detection in monocytes by flow cytometry. Our results demonstrated an in vitro inhibitory activity by both extract and alkaloidal fraction, reducing DENV-Ag+ cell rates in treated monocytes. A multiple microbead immunoassay was applied for cytokine determination (TNF-alpha, IFN-alpha, IL-6 and IL-10) in infected monocyte culture supernatants. The alkaloidal fraction induced a strong immunomodulation: TNF-alpha and IFN-alpha levels were significantly decreased and there was a tendency towards IL-10 modulation. We conclude that the alkaloidal fraction was the most effective in reducing monocyte infection rates and cytokine levels. The antiviral and immunomodulating in vitro effects from U. tomentosa pentacyclic oxindole alkaloids displayed novel properties regarding therapeutic procedures in Dengue Fever and might be further investigated as a promising candidate for clinical application. PMID:18279801

  2. Ginkgolic acid inhibits HIV protease activity and HIV infection in vitro

    PubMed Central

    Lü, Jian-Ming; Yan, Shaoyu; Jamaluddin, Saha; Weakley, Sarah M.; Liang, Zhengdong; Siwak, Edward B.; Yao, Qizhi; Chen, Changyi

    2012-01-01

    Summary Background Several HIV protease mutations, which are resistant to clinical HIV protease inhibitors (PIs), have been identified. There is a great need for second-generation PIs with different chemical structures and/or with an alternative mode of inhibition. Ginkgolic acid is a natural herbal substance and a major component of the lipid fraction in the nutshells of the Ginkgo biloba tree. The objective of this study was to determine whether ginkgolic acid could inhibit HIV protease activity in a cell free system and HIV infection in human cells. Material/Methods Purified ginkgolic acid and recombinant HIV-1 HXB2 KIIA protease were used for the HIV protease activity assay. Human peripheral blood mononuclear cells (PBMCs) were used for HIV infection (HIV-1SF162 virus), determined by a p24gag ELISA. Cytotoxicity was also determined. Results Ginkgolic acid (31.2 μg/ml) inhibited HIV protease activity by 60%, compared with the negative control, and the effect was concentration-dependent. In addition, ginkgolic acid treatment (50 and 100 μg/ml) effectively inhibited the HIV infection at day 7 in a concentration-dependent manner. Ginkgolic acid at a concentration of up to 150 μg/ml demonstrated very limited cytotoxicity. Conclusions Ginkgolic acid effectively inhibits HIV protease activity in a cell free system and HIV infection in PBMCs without significant cytotoxicity. Ginkgolic acid may inhibit HIV protease through different mechanisms than current FDA-approved HIV PI drugs. These properties of ginkgolic acid make it a promising therapy for HIV infection, especially as the clinical problem of viral resistance to HIV PIs continues to grow. PMID:22847190

  3. Clinical relevance of the plasma load of cytomegalovirus in patients infected with HIV--a survival analysis.

    PubMed

    Aramă, Victoria; Mihăilescu, Raluca; Rădulescu, Mihaela; Aramă, Sorin Ştefan; Streinu-Cercel, Adrian; Youle, Mike

    2014-11-01

    To investigate whether asymptomatic cytomegalovirus (CMV) viraemia impact the course of human immunodeficiency virus (HIV) infection, this study evaluated the effect of CMV replication on progression of newly-diagnosed HIV infected individuals towards AIDS events and death. In a 3-year prospective study on co-infected patients, clinical, immunological, and virological tests were performed in a national reference hospital quarterly. CMV viraemia was quantified by RoboGene® HCMV DNA Quantification Kit (Analytik Jena, Germany), on ABI Prism® 7000 Sequence Detection System (Applied Biosystems, USA). One hundred and five patients were enrolled with a balanced sex distribution and a median age of 30.7 years. Median CD4(+) cell count at enrollment was 164/mm(3) and median HIV RNA 4.6 log10 copies/ml. Detectable CMV viraemia was found in 25.7% of the patients. Kaplan-Meier analysis showed progression of HIV infection to be significantly increased in those with active CMV replication and/or low CD4(+) cell count. Cox regression indicated the risk of developing new AIDS events was 2.6 times greater in patients with detectable CMV viraemia versus those without (CI95% 1-6.6; P = 0.04). Also in multivariate analysis, the overall risk of progression to AIDS events or death was 3-fold higher in those with detectable CMV viraemia (CI95% 1.3-6.7; P = 0.008) and 2.3-fold higher if CD4(+) cell count was below 100/mm(3) (CI95% 1-5.1; P = 0.04). In these young Romanian HIV-seropositives, active CMV replication increased morbidity, even when treated with combination antiretroviral therapy. Further studies are needed to evaluate if serial quantitative CMV-DNA levels might correlate with non-infectious inflammation-related risks in patients with HIV and active CMV infection. PMID:25087866

  4. Influence of tumour condition on the macrophage activity in Candida albicans infection.

    PubMed

    Venturini, J; de Camargo, M R; Félix, M C; Vilani-Moreno, F R; de Arruda, M S P

    2009-07-01

    To better understand the interactions between opportunistic fungi and their hosts, we investigated hydrogen peroxide (H2O2), nitric oxide and TNF-alpha production by peritoneal macrophages from Ehrlich tumour-bearing mice (TBM) during microbial infections. For this purpose, TBM at days 7, 14 and 21 of tumour progression were inoculated intraperitoneally with C. albicans and evaluated after 24 and 72 h. We observed that TBM showed significant increases in H2O2, TNF-alpha levels and fungal clearance at day 7 after C. albicans infection. However, as the tumour advanced, there was a progressive decline in the release of H2O2 and TNF-alpha that was paired with the dissemination of C. albicans. These results demonstrate that protective macrophage activities against Candida albicans are limited to the initial stages of tumour growth; continued solid tumour growth weakened the macrophage response and as a consequence, weakened the host's susceptibility to opportunistic infections. PMID:19522762

  5. Dengue Virus Infection of Mast Cells Triggers Endothelial Cell Activation

    PubMed Central

    Brown, Michael G.; Hermann, Laura L.; Issekutz, Andrew C.; Marshall, Jean S.; Rowter, Derek; Al-Afif, Ayham; Anderson, Robert

    2011-01-01

    Vascular perturbation is a hallmark of severe forms of dengue disease. We show here that antibody-enhanced dengue virus infection of primary human cord blood-derived mast cells (CBMCs) and the human mast cell-like line HMC-1 results in the release of factor(s) which activate human endothelial cells, as evidenced by increased expression of the adhesion molecules ICAM-1 and VCAM-1. Endothelial cell activation was prevented by pretreatment of mast cell-derived supernatants with a tumor necrosis factor (TNF)-specific blocking antibody, thus identifying TNF as the endothelial cell-activating factor. Our findings suggest that mast cells may represent an important source of TNF, promoting vascular endothelial perturbation following antibody-enhanced dengue virus infection. PMID:21068256

  6. Apigenin Restricts FMDV Infection and Inhibits Viral IRES Driven Translational Activity

    PubMed Central

    Qian, Suhong; Fan, Wenchun; Qian, Ping; Zhang, Dong; Wei, Yurong; Chen, Huanchun; Li, Xiangmin

    2015-01-01

    Foot-and-mouth disease (FMD) is a highly contagious disease of domestic and wild ruminants that is caused by FMD virus (FMDV). FMD outbreaks have occurred in livestock-containing regions worldwide. Apigenin, which is a flavonoid naturally existing in plant, possesses various pharmacological effects, including anti-inflammatory, anticancer, antioxidant and antiviral activities. Results show that apigenin can inhibit FMDV-mediated cytopathogenic effect and FMDV replication in vitro. Further studies demonstrate the following: (i) apigenin inhibits FMDV infection at the viral post-entry stage; (ii) apigenin does not exhibit direct extracellular virucidal activity; and (iii) apigenin interferes with the translational activity of FMDV driven by internal ribosome entry site. Studies on applying apigein in vivo are required for drug development and further identification of potential drug targets against FDMV infection. PMID:25835532

  7. [Activity of phenylalanine-ammonia-lyase in callus cultures of sugar beat infected by Acholeplasma].

    PubMed

    Panchenko, L P; Korobkova, E S

    2012-01-01

    The effect of Acholeplasma laidlawii var. granulum 118 on activity of phenylalanine-ammonia-lyase (PAL) in callus cultures of sugar beat was researched. The optimal conditions of enzyme reaction were: using the L-phenilalanine as a substrate, pH 8.4-8.8, the temperature optimum 38-40 degrees C. It was established that at the infecting of sugar beat callus culture by phytopathogenic mollicute the PAL activity was temporarily increased and reached its maximum after 2 h of infecting. Then it gradually decreased and in 24 h reached its initial level. An increase of PAL activity of plant is considered as protective reaction in response to the action of pathogen. PMID:23126015

  8. Glycaemic profile changes by highly active antiretroviral therapy in human immunodeficiency virus-infected patients.

    PubMed

    Duro, M; Rebelo, I; Barreira, S; Sarmento-Castro, R; Medeiros, R; Almeida, C

    2015-10-01

    To study dysglycaemia in human immunodeficiency virus (HIV)-infected patients we conducted a retrospective cohort study of the glucose profile in HIV-infected patients. The fasting blood glucose was analysed taking into consideration conventional risk factors as well as HIV infection and highly active antiretroviral therapy (HAART). One hundred seventy-three cases were selected for this study. Five risk factors had significant effects (p < 0.05) on glucose levels: age, body mass index (BMI), hepatitis C virus/hepatitis B virus (HCV/HBV) co-infection, viral load (VL), and CD4(+) T-lymphocyte count. Fasting blood glucose levels increased with age (0.59 mg/dL/year), decreased with the VL (-4.1 × 10(-6 )mg/dL/number of viral RNA copies) and the CD4(+) T-lymphocyte count (-0.016 mg/dL/cell count). Furthermore, obese patients and those co-infected with HCV/HBV were more prone to develop dysglycaemia having, on average, 15.4 mg/dL and 13.8 mg/dL higher levels, respectively, of fasting blood glucose. Despite an increase of 1.0% and 8.4% in the glucose levels noticed among HIV patients treated with non-nucleotide inhibitors of reverse transcriptase and protease inhibitors, respectively, HAART did not prove to be a significant predictor of fasting glucose levels as well as lipodystrophy and male gender. Age, BMI, HCV/HBV co-infection and HIV-related (VL and CD4(+) T-lymphocyte count) factors seem to be the most influential on fasting blood glucose levels in HIV-infected individuals. PMID:25281540

  9. Activation of pulmonary and lymph node dendritic cells during chronic Pseudomonas aeruginosa lung infection in mice.

    PubMed

    Damlund, Dina Silke Malling; Christophersen, Lars; Jensen, Peter Østrup; Alhede, Morten; Høiby, Niels; Moser, Claus

    2016-06-01

    The majority of cystic fibrosis (CF) patients acquire chronic Pseudomonas aeruginosa lung infection, resulting in increased mortality and morbidity. The chronic P. aeruginosa lung infection is characterized by bacteria growing in biofilm surrounded by polymorphonuclear neutrophils (PMNs). However, the infection is not eradicated and the inflammatory response leads to gradual degradation of the lung tissue. In CF patients, a Th2-dominated adaptive immune response with a pronounced antibody response is correlated with poorer outcome. Dendritic cells (DCs) are crucial in bridging the innate immune system with the adaptive immune response. Once activated, the DCs deliver a set of signals to uncommitted T cells that induce development, such as expansion of regulatory T cells and polarization of Th1, Th2 or Th17 subsets. In this study, we characterized DCs in lungs and regional lymph nodes in BALB/c mice infected using intratracheal installation of P. aeruginosa embedded in seaweed alginate in the lungs. A significantly elevated concentration of DCs was detected earlier in the lungs than in the regional lymph nodes. To evaluate whether the chronic P. aeruginosa lung infection leads to activation of DCs, costimulatory molecules CD80 and CD86 were analyzed. During infection, the DCs showed significant elevation of CD80 and CD86 expression in both the lungs and the regional lymph nodes. Interestingly, the percentage of CD86-positive cells was significantly higher than the percentage of CD80-positive cells in the lymph nodes. In addition, cytokine production from Lipopolysaccharides (LPS)-stimulated DCs was analyzed demonstrating elevated production of IL-6, IL-10 and IL-12. However, production of IL-12 was suppressed earlier than IL-6 and IL-10. These results support that DCs are involved in skewing of the Th1/Th2 balance in CF and may be a possible treatment target. PMID:27009697

  10. Cytomegalovirus Infection in Inflammatory Bowel Disease Is Not Associated with Worsening of Intestinal Inflammatory Activity

    PubMed Central

    do Carmo, Alexandre Medeiros; Santos, Fabiana Maria; Ortiz-Agostinho, Carmen Lucia; Nishitokukado, Iêda; Frota, Cintia S.; Gomes, Flavia Ubeda; de Arruda Leite, André Zonetti; Pannuti, Claudio Sérgio; Boas, Lucy Santos Vilas; Teixeira, Magaly Gemio; Sipahi, Aytan Miranda

    2014-01-01

    Background Cytomegalovirus is highly prevalent virus and usually occurs in immunocompromised patients. The pathophysiology and treatment of inflammatory bowel disease often induce a state of immunosuppression. Because this, there are still doubts and controversies about the relationship between inflammatory bowel disease and cytomegalovirus. Aim Evaluate the frequency of cytomegalovirus in patients with inflammatory bowel disease and identify correlations. Methods Patients with inflammatory bowel disease underwent an interview, review of records and collection of blood and fecal samples. The search for cytomegalovirus was performed by IgG and IgM blood serology, by real-time PCR in the blood and by qualitative PCR in feces. Results were correlated with red blood cell levels, C-reactive protein levels, erythrocyte sedimentation rates and fecal calprotectin levels for each patient. Results Among the 400 eligible patients, 249 had Crohn's disease, and 151 had ulcerative colitis. In the group of Crohn's disease, 67 of the patients had moderate or severe disease, but 126 patients presented with active disease, based on the evaluation of the fecal calprotectin. In patients with ulcerative colitis, only 21 patients had moderate disease, but 76 patients presented with active disease, based on the evaluation of the fecal calprotectin. A large majority of patients had positive CMV IgG. Overall, 10 patients had positive CMV IgM, and 9 patients had a positive qualitative detection of CMV DNA by PCR in the feces. All 400 patients returned negative results after the quantitative detection of CMV DNA in blood by real-time PCR. Analyzing the 19 patients with active infections, we only found that such an association occurred with the use of combined therapy (anti-TNF-alpha + azathioprine) Conclusion The findings show that latent cytomegalovirus infections are frequent and active cytomegalovirus infection is rare. We did not find any association between an active infection of CMV

  11. Therapeutic and prophylactic activity of itraconazole against human rhinovirus infection in a murine model.

    PubMed

    Shim, Aeri; Song, Jae-Hyoung; Kwon, Bo-Eun; Lee, Jeong-Jun; Ahn, Jae-Hee; Kim, Yeon-Jeong; Rhee, Ki-Jong; Chang, Sun-Young; Cha, Younggil; Lee, Yong-Soo; Kweon, Mi-Na; Park, Kwi Sung; Kim, Dong-Eun; Cho, Sungchan; Cho, Hyun-Jong; Ko, Hyun-Jeong

    2016-01-01

    Human rhinovirus (HRV) is the most common viral infectious agent in humans and is the predominant cause of the common cold. There is a need for appropriate vaccines or therapeutic agents to treat HRV infection. In this study, we investigated whether itraconazole (ICZ) can protect cells from HRV-induced cytotoxicity. Replication of HRV1B was reduced by ICZ treatment in the lungs of HRV1B- as compared to vehicle-treated mice. The numbers of immune cells, including granulocytes and monocytes, were reduced in bronchoalveolar lavage fluid (BALF) by ICZ administration after HRV1B infection, corresponding to decreased pro-inflammatory cytokine and chemokine levels in BALF. A histological analysis of lung tissue showed that ICZ suppressed inflammation caused by HRV1B infection. Interestingly, pretreatment of mice with ICZ in the form of a nasal spray had potent prophylactic antiviral activity. Cholesterol accumulation in the plasma membrane was observed upon HRV infection; ICZ blocked cholesterol trafficking to the plasma membrane, as well as resulted in its accumulation in subcellular compartments near the nucleus. These findings suggest that ICZ is a potential antiviral agent for the treatment of HRV infection, which can be adopted preventatively as well as therapeutically. PMID:26976677

  12. Activation-induced apoptosis in peripheral blood mononuclear cells during hepatosplenic Schistosoma mansoni infections.

    PubMed

    Ghoneim, H M; Demian, S R; Heshmat, M G; Ismail, N S; El-Sayed, Laila H

    2008-01-01

    It is well established that programmed cell death (apoptosis) is an important regulator of host responses during infection with a variety of intra- and extra-cellular pathogens. The present work aimed at assessment of in vitro spontaneous and phytohemagglutinin (PHA)-induced apoptosis in mononuclear cells isolated from patients with hepatosplenic form of S. mansoni infections. Cell death data were correlated to the degree of lymphoproliferative responses to PHA as well as to the serum anti-schistosomal antibody titers. A markedly significant increase in PHA-induced apoptosis in lymphocytes isolated from S. mansoni-infected patients was seen when compared to the corresponding healthy controls. However, a slight difference was recorded between the two studied groups regarding the spontaneous apoptosis. This was accompanied with a significant impairment of in vitro PHA-induced lymphoproliferation of T cells from S. mansoni patients. Data of the present study supports the hypothesis that activation-induced cell death (AICD) is a potentially contributing factor in T helper (Th) cell regulation during chronic stages of schistosomiasis, which represents a critically determinant factor in the host-parasite interaction and might influence the destiny of parasitic infections either towards establishment of chronic infection or towards host death. PMID:20306689

  13. Hybrid spreading mechanisms and T cell activation shape the dynamics of HIV-1 infection.

    PubMed

    Zhang, Changwang; Zhou, Shi; Groppelli, Elisabetta; Pellegrino, Pierre; Williams, Ian; Borrow, Persephone; Chain, Benjamin M; Jolly, Clare

    2015-04-01

    HIV-1 can disseminate between susceptible cells by two mechanisms: cell-free infection following fluid-phase diffusion of virions and by highly-efficient direct cell-to-cell transmission at immune cell contacts. The contribution of this hybrid spreading mechanism, which is also a characteristic of some important computer worm outbreaks, to HIV-1 progression in vivo remains unknown. Here we present a new mathematical model that explicitly incorporates the ability of HIV-1 to use hybrid spreading mechanisms and evaluate the consequences for HIV-1 pathogenenesis. The model captures the major phases of the HIV-1 infection course of a cohort of treatment naive patients and also accurately predicts the results of the Short Pulse Anti-Retroviral Therapy at Seroconversion (SPARTAC) trial. Using this model we find that hybrid spreading is critical to seed and establish infection, and that cell-to-cell spread and increased CD4+ T cell activation are important for HIV-1 progression. Notably, the model predicts that cell-to-cell spread becomes increasingly effective as infection progresses and thus may present a considerable treatment barrier. Deriving predictions of various treatments' influence on HIV-1 progression highlights the importance of earlier intervention and suggests that treatments effectively targeting cell-to-cell HIV-1 spread can delay progression to AIDS. This study suggests that hybrid spreading is a fundamental feature of HIV infection, and provides the mathematical framework incorporating this feature with which to evaluate future therapeutic strategies. PMID:25837979

  14. Therapeutic and prophylactic activity of itraconazole against human rhinovirus infection in a murine model

    PubMed Central

    Shim, Aeri; Song, Jae-Hyoung; Kwon, Bo-Eun; Lee, Jeong-Jun; Ahn, Jae-Hee; Kim, Yeon-Jeong; Rhee, Ki-Jong; Chang, Sun-Young; Cha, Younggil; Lee, Yong-Soo; Kweon, Mi-Na; Park, Kwi Sung; Kim, Dong-Eun; Cho, Sungchan; Cho, Hyun-Jong; Ko, Hyun-Jeong

    2016-01-01

    Human rhinovirus (HRV) is the most common viral infectious agent in humans and is the predominant cause of the common cold. There is a need for appropriate vaccines or therapeutic agents to treat HRV infection. In this study, we investigated whether itraconazole (ICZ) can protect cells from HRV-induced cytotoxicity. Replication of HRV1B was reduced by ICZ treatment in the lungs of HRV1B- as compared to vehicle-treated mice. The numbers of immune cells, including granulocytes and monocytes, were reduced in bronchoalveolar lavage fluid (BALF) by ICZ administration after HRV1B infection, corresponding to decreased pro-inflammatory cytokine and chemokine levels in BALF. A histological analysis of lung tissue showed that ICZ suppressed inflammation caused by HRV1B infection. Interestingly, pretreatment of mice with ICZ in the form of a nasal spray had potent prophylactic antiviral activity. Cholesterol accumulation in the plasma membrane was observed upon HRV infection; ICZ blocked cholesterol trafficking to the plasma membrane, as well as resulted in its accumulation in subcellular compartments near the nucleus. These findings suggest that ICZ is a potential antiviral agent for the treatment of HRV infection, which can be adopted preventatively as well as therapeutically. PMID:26976677

  15. Protease-Activated Receptor 2 Is Involved in Th2 Responses against Trichinella spiralis Infection

    PubMed Central

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Yun Seong; Kim, Ki Uk; Ahn, Soon Cheol; Kim, Dong-Hee

    2011-01-01

    In order to get a better understanding of the role of protease-activated receptor 2 (PAR2) in type 2 helper T (Th2) cell responses against Trichinella spiralis infection, we analyzed Th2 responses in T. spiralis-infected PAR2 knockout (KO) mice. The levels of the Th2 cell-secreted cytokines, IL-4, IL-5, and IL-13 were markedly reduced in the PAR2 KO mice as compared to the wild type mice following infection with T. spiralis. The serum levels of parasite-specific IgE increased significantly in the wild type mice as the result of T. spiralis infection, but this level was not significantly increased in PAR2 KO mice. The expression level of thymic stromal lymphopoietin, IL-25, and eotaxin gene (the genes were recently known as Th2 response initiators) of mouse intestinal epithelial cells were increased as the result of treatment with T. spiralis excretory-secretory proteins. However, the expression of these chemokine genes was inhibited by protease inhibitor treatments. In conclusion, PAR2 might involve in Th2 responses against T. spiralis infection. PMID:22072823

  16. Regulatory T cells and chronic immune activation in human immunodeficiency virus 1 (HIV-1)-infected children

    PubMed Central

    Freguja, R; Gianesin, K; Mosconi, I; Zanchetta, M; Carmona, F; Rampon, O; Giaquinto, C; De Rossi, A

    2011-01-01

    The function of CD4+ T cells with regulatory activity (Tregs) is the down-regulation of immune responses. This suppressive activity may limit the magnitude of effector responses, resulting in failure to control human immunodeficiency virus 1 (HIV-1) infection, but may also suppress chronic immune activation, a characteristic feature of HIV-1 disease. We evaluated the correlation between viral load, immune activation and Tregs in HIV-1-infected children. Eighty-nine HIV-1-infected children (aged 6–14 years) were included in the study and analysed for HIV-1 plasmaviraemia, HIV-1 DNA load, CD4 and CD8 cell subsets. Treg cells [CD4+ CD25highCD127lowforkhead box P3 (FoxP3high)] and CD8-activated T cells (CD8+CD38+) were determined by flow cytometry. Results showed that the number of activated CD8+CD38+ T cells increased in relation to HIV-1 RNA plasmaviraemia (r = 0·403, P < 0·0001). The proportion of Tregs also correlated positively with HIV-1 plasmaviraemia (r = 0·323, P = 0·002), but correlated inversely with CD4+ cells (r = −0·312, P = 0·004), thus suggesting a selective expansion along with increased viraemia and CD4+ depletion. Interestingly, a positive correlation was found between the levels of Tregs and CD8+CD38+ T cells (r = 0·305, P = 0·005), and the percentage of Tregs tended to correlate with HIV-1 DNA load (r = 0·224, P = 0·062). Overall, these findings suggest that immune activation contributes to the expansion of Treg cells. In turn, the suppressive activity of Tregs may impair effector responses against HIV-1, but appears to be ineffective in limiting immune activation. PMID:21438872

  17. Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway.

    PubMed

    Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen

    2015-01-01

    Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection. PMID:25499817

  18. Spatial relationships between markers for secretory and endosomal machinery in human cytomegalovirus-infected cells versus those in uninfected cells.

    PubMed

    Das, Subhendu; Pellett, Philip E

    2011-06-01

    Human cytomegalovirus (HCMV) induces extensive remodeling of the secretory apparatus to form the cytoplasmic virion assembly compartment (cVAC), where virion tegumentation and envelopment take place. We studied the structure of the cVAC by confocal microscopy to assess the three-dimensional distribution of proteins specifically associated with individual secretory organelles. In infected cells, early endosome antigen 1 (EEA1)-positive vesicles are concentrated at the center of the cVAC and, as previously seen, are distinct from structures visualized by markers for the endoplasmic reticulum, Golgi apparatus, and trans-Golgi network (TGN). EEA1-positive vesicles can be strongly associated with markers for recycling endosomes, to a lesser extent with markers associated with components of the endosomal sorting complex required for transport III (ESCRT III) machinery, and then with markers of late endosomes. In comparisons of uninfected and infected cells, we found significant changes in the structural associations and colocalization of organelle markers, as well as in net organelle volumes. These results provide new evidence that the HCMV-induced remodeling of the membrane transport apparatus involves much more than simple relocation and expansion of preexisting structures and are consistent with the hypothesis that the shift in identity of secretory organelles in HCMV-infected cells results in new functional profiles. PMID:21471245

  19. Infection of vascular endothelial cells with herpes simplex virus enhances tissue factor activity and reduces thrombomodulin expression.

    PubMed Central

    Key, N S; Vercellotti, G M; Winkelmann, J C; Moldow, C F; Goodman, J L; Esmon, N L; Esmon, C T; Jacob, H S

    1990-01-01

    Latent infection of vascular cells with herpes-viruses may play a pathogenic role in the development of human atherosclerosis. In a previous study, we found that cultured human umbilical vein endothelial cells (HUVECs) infected with herpes simplex virus 1 (HSV-1) became procoagulant, exemplified both by their enhanced assembly of the prothrombinase complex and by their inability to reduce adhesion of platelets. We now report two further procoagulant consequences of endothelial HSV infection: loss of surface thrombomodulin (TM) activity and induction of synthesis of tissue factor. Within 4 hr of infection of HUVECs, TM activity measured by thrombin-dependent protein C activation declined 21 +/- 3% (P less than 0.05) and by 18 hr, 48 +/- 5% (P less than 0.001). Similar significant TM decrements accompanied infection of bovine aortic endothelial cells. Identical TM loss was induced with HSV-2 infection but not with adenovirus infection. Decreased surface expression of TM antigen (measured by the specific binding of a polyclonal antibody to bovine TM) closely paralleled the loss of TM activity. As examined by Northern blotting, these losses apparently reflected rapid onset (within 4 hr of HSV infection) loss of mRNA for TM. In contrast, HSV infection induced a viral-dose-dependent increase in synthesis of tissue factor protein, adding to the procoagulant state. The results indicate that loss of endothelial protein-synthetic capacity is not a universal effect of HSV infection. We suggest that the procoagulant state induced by reduction in TM activity and amplified tissue factor activity accompanying HSV infection of endothelium could contribute to deposition of thrombi on atherosclerotic plaques and to the "coagulant-necrosis" state that characterizes HSV-infected mucocutaneous lesions. Images PMID:2169619

  20. Toso regulates differentiation and activation of inflammatory dendritic cells during persistence-prone virus infection

    PubMed Central

    Lang, P A; Meryk, A; Pandyra, A A; Brenner, D; Brüstle, A; Xu, H C; Merches, K; Lang, F; Khairnar, V; Sharma, P; Funkner, P; Recher, M; Shaabani, N; Duncan, G S; Duhan, V; Homey, B; Ohashi, P S; Häussinger, D; Knolle, P A; Honke, N; Mak, T W; Lang, K S

    2015-01-01

    During virus infection and autoimmune disease, inflammatory dendritic cells (iDCs) differentiate from blood monocytes and infiltrate infected tissue. Following acute infection with hepatotropic viruses, iDCs are essential for re-stimulating virus-specific CD8+ T cells and therefore contribute to virus control. Here we used the lymphocytic choriomeningitis virus (LCMV) model system to identify novel signals, which influence the recruitment and activation of iDCs in the liver. We observed that intrinsic expression of Toso (Faim3, FcμR) influenced the differentiation and activation of iDCs in vivo and DCs in vitro. Lack of iDCs in Toso-deficient (Toso–/–) mice reduced CD8+ T-cell function in the liver and resulted in virus persistence. Furthermore, Toso–/– DCs failed to induce autoimmune diabetes in the rat insulin promoter-glycoprotein (RIP-GP) autoimmune diabetes model. In conclusion, we found that Toso has an essential role in the differentiation and maturation of iDCs, a process that is required for the control of persistence-prone virus infection. PMID:25257173

  1. Toso regulates differentiation and activation of inflammatory dendritic cells during persistence-prone virus infection.

    PubMed

    Lang, P A; Meryk, A; Pandyra, A A; Brenner, D; Brüstle, A; Xu, H C; Merches, K; Lang, F; Khairnar, V; Sharma, P; Funkner, P; Recher, M; Shaabani, N; Duncan, G S; Duhan, V; Homey, B; Ohashi, P S; Häussinger, D; Knolle, P A; Honke, N; Mak, T W; Lang, K S

    2015-01-01

    During virus infection and autoimmune disease, inflammatory dendritic cells (iDCs) differentiate from blood monocytes and infiltrate infected tissue. Following acute infection with hepatotropic viruses, iDCs are essential for re-stimulating virus-specific CD8(+) T cells and therefore contribute to virus control. Here we used the lymphocytic choriomeningitis virus (LCMV) model system to identify novel signals, which influence the recruitment and activation of iDCs in the liver. We observed that intrinsic expression of Toso (Faim3, FcμR) influenced the differentiation and activation of iDCs in vivo and DCs in vitro. Lack of iDCs in Toso-deficient (Toso(-/-)) mice reduced CD8(+) T-cell function in the liver and resulted in virus persistence. Furthermore, Toso(-/-) DCs failed to induce autoimmune diabetes in the rat insulin promoter-glycoprotein (RIP-GP) autoimmune diabetes model. In conclusion, we found that Toso has an essential role in the differentiation and maturation of iDCs, a process that is required for the control of persistence-prone virus infection. PMID:25257173

  2. In Vitro Activity of Quaternary Ammonium Surfactants against Streptococcal, Chlamydial, and Gonococcal Infective Agents.

    PubMed

    Inácio, Ângela S; Nunes, Alexandra; Milho, Catarina; Mota, Luís Jaime; Borrego, Maria J; Gomes, João P; Vaz, Winchil L C; Vieira, Otília V

    2016-06-01

    Quaternary ammonium compounds (QAC) are widely used, cheap, and chemically stable disinfectants and topical antiseptics with wide-spectrum antimicrobial activities. Within this group of compounds, we recently showed that there are significant differences between the pharmacodynamics of n-alkyl quaternary ammonium surfactants (QAS) with a short (C12) alkyl chain when in vitro toxicities toward bacterial and mammalian epithelial cells are compared. These differences result in an attractive therapeutic window that justifies studying short-chain QAS as prophylactics for sexually transmitted infections (STI) and perinatal vertically transmitted urogenital infections (UGI). We have evaluated the antimicrobial activities of short-chain (C12) n-alkyl QAS against several STI and UGI pathogens as well as against commensal Lactobacillus species. Inhibition of infection of HeLa cells by Neisseria gonorrhoeae and Chlamydia trachomatis was studied at concentrations that were not toxic to the HeLa cells. We show that the pathogenic bacteria are much more susceptible to QAS toxic effects than the commensal vaginal flora and that QAS significantly attenuate the infectivity of N. gonorrhoeae and C. trachomatis without affecting the viability of epithelial cells of the vaginal mucosa. N-Dodecylpyridinium bromide (C12PB) was found to be the most effective QAS. Our results strongly suggest that short-chain (C12) n-alkyl pyridinium bromides and structurally similar compounds are promising microbicide candidates for topical application in the prophylaxis of STI and perinatal vertical transmission of UGI. PMID:26976875

  3. The paradox of simian immunodeficiency virus infection in sooty mangabeys: active viral replication without disease progression.

    PubMed

    Chakrabarti, Lisa A

    2004-01-01

    Simian immunodeficiency virus SIVsm causes an asymptomatic infection in its natural host, the sooty mangabey, but induces an immunodeficiency syndrome very similar to human AIDS when transferred to a new host species such as the rhesus macaque. Unexpectedly, SIVsm replication dynamics is comparable in the two species, with rapid accumulation of viral mutations and a high viral load detected in both mangabeys and macaques. In contrast, clear differences are observed in immune parameters. Pathogenic SIV infection in macaques is associated with decreased CD4+ T cell numbers and signs of generalized immune activation, such as increased numbers of cycling and apoptotic T cells, hyperplasic lymphoid tissues, and exacerbated immune responses. Mangabeys with asymptomatic SIV infection show normal T cell regeneration parameters and signs of a moderate immune response, appropriate in the setting of chronic viral infection. The comparative analysis of simian models thus suggests that viral load alone cannot account for progression to disease, and that the capacity of primate lentiviruses to induce abnormal immune activation underlies AIDS pathogenesis. PMID:14766388

  4. Activated ClpP kills persisters and eradicates a chronic biofilm infection.

    SciTech Connect

    Conlon, Brian P.; Nakayasu, Ernesto S.; Fleck, Laura E.; LaFleur, Michael D.; Isabella, Vincent M.; Coleman, K.; Leonard, Steve N.; Smith, Richard D.; Adkins, Joshua N.; Lewis, Kim

    2013-11-21

    The current antibiotic crisis stems from two distinct phenomena-drug resistance, and drug tolerance. Resistance mechanisms such as drug efflux or modification prevent antibiotics from binding to their targets 1, allowing pathogens to grow. Antibiotic tolerance is the property of persister cells, phenotypic variants of regular bacteria 2. Antibiotics kill by corrupting targets, but these are inactive in dormant persisters, leading to tolerance. Persisters were first identified by Joseph Bigger in 1944, when he discovered a surviving sub-population of Staphylococcus following treatment with penicillin3. Persisters are largely responsible for recalcitrance of chronic diseases such as tuberculosis, and various infections associated with biofilms - endocarditis, osteomyelitis, infections of catheters and indwelling devices, and deep-seated infections of soft tissues 4. There are a number of redundant pathways involved in persister formation5,6 precluding development of drugs inhibiting their formation. The acyldepsipeptide antibiotic (ADEP 4) has been shown to activate the ClpP protease resulting in death of growing cells 7. Here we show that ADEP4 activated ClpP becomes a fairly non-specific protease and kills persister cells by degradation of over 400 intracellular targets. clpP mutants are resistant to ADEP4 7, but we find that they display increased susceptibility to killing by a range of conventional antibiotics. Combining ADEP4 with rifampicin leads to eradication of persisters, stationary and biofilm populations of Staphylococcus aureus in vitro and in a deep-seated murine infection. Target corruption/activation provides an approach to killing persisters and eradicating chronic infections.

  5. Mechanisms by Which Interleukin-12 Corrects Defective NK Cell Anticryptococcal Activity in HIV-Infected Patients

    PubMed Central

    Kyei, Stephen K.; Ogbomo, Henry; Li, ShuShun; Timm-McCann, Martina; Xiang, Richard F.; Huston, Shaunna M.; Ganguly, Anutosh; Colarusso, Pina; Gill, M. John

    2016-01-01

    ABSTRACT Cryptococcus neoformans is a pathogenic yeast and a leading cause of life-threatening meningitis in AIDS patients. Natural killer (NK) cells are important immune effector cells that directly recognize and kill C. neoformans via a perforin-dependent cytotoxic mechanism. We previously showed that NK cells from HIV-infected patients have aberrant anticryptococcal killing and that interleukin-12 (IL-12) restores the activity at least partially through restoration of NKp30. However, the mechanisms causing this defect or how IL-12 restores the function was unknown. By examining the sequential steps in NK cell killing of Cryptococcus, we found that NK cells from HIV-infected patients had defective binding of NK cells to C. neoformans. Moreover, those NK cells that bound to C. neoformans failed to polarize perforin-containing granules to the microbial synapse compared to healthy controls, suggesting that binding was insufficient to restore a defect in perforin polarization. We also identified lower expression of intracellular perforin and defective perforin release from NK cells of HIV-infected patients in response to C. neoformans. Importantly, treatment of NK cells from HIV-infected patients with IL-12 reversed the multiple defects in binding, granule polarization, perforin content, and perforin release and restored anticryptococcal activity. Thus, there are multiple defects in the cytolytic machinery of NK cells from HIV-infected patients, which cumulatively result in defective NK cell anticryptococcal activity, and each of these defects can be reversed with IL-12. PMID:27555306

  6. Cerebral microglia activation in hepatitis C virus infection correlates to cognitive dysfunction.

    PubMed

    Pflugrad, H; Meyer, G-J; Dirks, M; Raab, P; Tryc, A B; Goldbecker, A; Worthmann, H; Wilke, F; Boellaard, R; Yaqub, M; Berding, G; Weissenborn, K

    2016-05-01

    Hepatitis C virus (HCV) infection may induce chronic fatigue and cognitive dysfunction. Virus replication was proven within the brain and HCV-positive cells were identified as microglia and astrocytes. We hypothesized that cerebral dysfunction in HCV-afflicted patients is associated with microglia activation. Microglia activation was assessed in vivo in 22 patients with chronic HCV infection compared to six healthy controls using [(11) C]-PK11195 Positron Emission Tomography (PET) combined with magnetic resonance tomography for anatomical localization. Patients were subdivided with regard to their PCR status, Fatigue Impact Scale score (FIS) and attention test sum score (ATS). A total of 12 patients (54.5%) were HCV PCR positive [of which 7 (58.3%) had an abnormal FIS and 7 (58.3%) an abnormal ATS], 10 patients (45.5%) were HCV PCR negative (5 (50%) each with an abnormal FIS or ATS). Patients without attention deficits showed a significantly higher accumulation of [(11) C]-PK11195 in the putamen (P = 0.05), caudate nucleus (P = 0.03) and thalamus (P = 0.04) compared to controls. Patients with and without fatigue did not differ significantly with regard to their specific tracer binding in positron emission tomography. Preserved cognitive function was associated with significantly increased microglia activation with predominance in the basal ganglia. This indicates a probably neuroprotective effect of microglia activation in HCV-infected patients. PMID:26768955

  7. Anti-fungal activity of cathelicidins and their potential role in Candida albicans skin infection.

    PubMed

    López-García, Belén; Lee, Phillip H A; Yamasaki, Kenshi; Gallo, Richard L

    2005-07-01

    Cathelicidins have broad anti-microbial capacity and are important for host defense against skin infections by some bacterial and viral pathogens. This study investigated the activity of cathelicidins against Candida albicans. The human cathelicidin LL-37, and mouse cathelicidin mCRAMP, killed C. albicans, but this fungicidal activity was dependent on culture conditions. Evaluation of the fungal membrane by fluorescent dye penetration after incubation with cathelicidins correlated membrane permeabilization and inhibition of fungal growth. Anti-fungal assays carried out in an ionic environment that mimicked human sweat and with the processed forms of cathelicidin such as are present in sweat found that the cleavage of LL-37 to forms such as RK-31 conferred additional activity against C. albicans. C. albicans also induced an increase in the expression of cathelicidin in mouse skin, but this induction did not confer systemic or subcutaneous resistance as mCRAMP-deficient mice were not more susceptible to C. albicans in blood-killing assays or in an intradermal infection model. Therefore, cathelicidins appear active against C. albicans, but may be most effective as a superficial barrier to infection. PMID:15982310

  8. Non-invasive Imaging of Staphylococcus aureus Infections with a Nuclease-Activated Probe

    PubMed Central

    Hernandez, Frank J.; Huang, Lingyan; Olson, Michael E.; Powers, Kristy M.; Hernandez, Luiza I.; Meyerholz, David K.; Thedens, Daniel R.; Behlke, Mark A.; Horswill, Alexander R.; McNamara, James O.

    2013-01-01

    Technologies that enable the rapid detection and localization of bacterial infections in living animals could address an unmet need for infectious disease diagnostics. We describe a molecular imaging approach for the specific, non-invasive detection of S. aureus based on the activity of its secreted nuclease, micrococcal nuclease (MN). Several short, synthetic oligonucleotides, rendered resistant to mammalian serum nucleases by various chemical modifications, flanked with a fluorophore and quencher, were activated upon degradation by recombinant MN and in S. aureus culture supernatants. A probe consisting of a pair of deoxythymidines flanked by several 2′-O-methyl-modified nucleotides was activated in culture supernatants of S. aureus but not in culture supernatants of several other pathogenic bacteria. Systemic administration of this probe to mice bearing bioluminescent S. aureus muscle infections resulted in probe activation at the infection sites in an MN-dependent manner. This novel bacterial imaging approach has potential clinical applicability for S. aureus and several other medically significant pathogens. PMID:24487433

  9. FOXP3+Helios+ Regulatory T Cells, Immune Activation, and Advancing Disease in HIV-Infected Children.

    PubMed

    Khaitan, Alka; Kravietz, Adam; Mwamzuka, Mussa; Marshed, Fatma; Ilmet, Tiina; Said, Swalehe; Ahmed, Aabid; Borkowsky, William; Unutmaz, Derya

    2016-08-15

    Regulatory T cells (Tregs) are functionally suppressive CD4 T cells, critical for establishing peripheral tolerance and controlling inflammatory responses. Previous reports of Tregs during chronic HIV disease have conflicting results with higher or lower levels compared with controls. Identifying true Tregs with suppressive activity proves challenging during HIV infection, as traditional Treg markers, CD25 and FOXP3, may transiently upregulate expression as a result of immune activation (IA). Helios is an Ikaros family transcription factor that marks natural Tregs with suppressive activity and does not upregulate expression after activation. Coexpression of FOXP3 and Helios has been suggested as a highly specific marker of "bona fide" Tregs. We evaluated Treg subsets by FOXP3 coexpressed with either CD25 or Helios and their association with HIV disease progression in perinatally infected HIV-positive children. Identifying Tregs by FOXP3 coexpression with Helios rather than CD25 revealed markedly higher Treg frequencies, particularly in HIV+ children. Regardless of antiretroviral therapy, HIV-infected children had a selective expansion of memory FOXP3+Helios+ Tregs. The rise in memory Tregs correlated with declining HIV clinical status, indicated by falling CD4 percentages and CD4:CD8 ratios and increasing HIV plasma viremia and IA. In addition, untreated HIV+ children exhibited an imbalance between the levels of Tregs and activated T cells. Finally, memory Tregs expressed IA markers CD38 and Ki67 and exhaustion marker, PD-1, that tightly correlated with a similar phenotype in memory CD4 T cells. Overall, HIV-infected children had significant disruptions of memory Tregs that associated with advancing HIV disease. PMID:27003495

  10. Metabolic Features of Protochlamydia amoebophila Elementary Bodies – A Link between Activity and Infectivity in Chlamydiae

    PubMed Central

    Watzka, Margarete; Wultsch, Anna; Tziotis, Dimitrios; Montanaro, Jacqueline; Richter, Andreas; Schmitt-Kopplin, Philippe; Horn, Matthias

    2013-01-01

    The Chlamydiae are a highly successful group of obligate intracellular bacteria, whose members are remarkably diverse, ranging from major pathogens of humans and animals to symbionts of ubiquitous protozoa. While their infective developmental stage, the elementary body (EB), has long been accepted to be completely metabolically inert, it has recently been shown to sustain some activities, including uptake of amino acids and protein biosynthesis. In the current study, we performed an in-depth characterization of the metabolic capabilities of EBs of the amoeba symbiont Protochlamydia amoebophila. A combined metabolomics approach, including fluorescence microscopy-based assays, isotope-ratio mass spectrometry (IRMS), ion cyclotron resonance Fourier transform mass spectrometry (ICR/FT-MS), and ultra-performance liquid chromatography mass spectrometry (UPLC-MS) was conducted, with a particular focus on the central carbon metabolism. In addition, the effect of nutrient deprivation on chlamydial infectivity was analyzed. Our investigations revealed that host-free P. amoebophila EBs maintain respiratory activity and metabolize D-glucose, including substrate uptake as well as host-free synthesis of labeled metabolites and release of labeled CO2 from 13C-labeled D-glucose. The pentose phosphate pathway was identified as major route of D-glucose catabolism and host-independent activity of the tricarboxylic acid (TCA) cycle was observed. Our data strongly suggest anabolic reactions in P. amoebophila EBs and demonstrate that under the applied conditions D-glucose availability is essential to sustain metabolic activity. Replacement of this substrate by L-glucose, a non-metabolizable sugar, led to a rapid decline in the number of infectious particles. Likewise, infectivity of Chlamydia trachomatis, a major human pathogen, also declined more rapidly in the absence of nutrients. Collectively, these findings demonstrate that D-glucose is utilized by P. amoebophila EBs and provide

  11. Metabolic features of Protochlamydia amoebophila elementary bodies--a link between activity and infectivity in Chlamydiae.

    PubMed

    Sixt, Barbara S; Siegl, Alexander; Müller, Constanze; Watzka, Margarete; Wultsch, Anna; Tziotis, Dimitrios; Montanaro, Jacqueline; Richter, Andreas; Schmitt-Kopplin, Philippe; Horn, Matthias

    2013-01-01

    The Chlamydiae are a highly successful group of obligate intracellular bacteria, whose members are remarkably diverse, ranging from major pathogens of humans and animals to symbionts of ubiquitous protozoa. While their infective developmental stage, the elementary body (EB), has long been accepted to be completely metabolically inert, it has recently been shown to sustain some activities, including uptake of amino acids and protein biosynthesis. In the current study, we performed an in-depth characterization of the metabolic capabilities of EBs of the amoeba symbiont Protochlamydia amoebophila. A combined metabolomics approach, including fluorescence microscopy-based assays, isotope-ratio mass spectrometry (IRMS), ion cyclotron resonance Fourier transform mass spectrometry (ICR/FT-MS), and ultra-performance liquid chromatography mass spectrometry (UPLC-MS) was conducted, with a particular focus on the central carbon metabolism. In addition, the effect of nutrient deprivation on chlamydial infectivity was analyzed. Our investigations revealed that host-free P. amoebophila EBs maintain respiratory activity and metabolize D-glucose, including substrate uptake as well as host-free synthesis of labeled metabolites and release of labeled CO2 from (13)C-labeled D-glucose. The pentose phosphate pathway was identified as major route of D-glucose catabolism and host-independent activity of the tricarboxylic acid (TCA) cycle was observed. Our data strongly suggest anabolic reactions in P. amoebophila EBs and demonstrate that under the applied conditions D-glucose availability is essential to sustain metabolic activity. Replacement of this substrate by L-glucose, a non-metabolizable sugar, led to a rapid decline in the number of infectious particles. Likewise, infectivity of Chlamydia trachomatis, a major human pathogen, also declined more rapidly in the absence of nutrients. Collectively, these findings demonstrate that D-glucose is utilized by P. amoebophila EBs and provide

  12. Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection

    PubMed Central

    Raaben, Matthijs; Einerhand, Alexandra WC; Taminiau, Lucas JA; van Houdt, Michel; Bouma, Janneke; Raatgeep, Rolien H; Büller, Hans A; de Haan, Cornelis AM; Rossen, John WA

    2007-01-01

    Cyclooxygenases (COXs) play a significant role in many different viral infections with respect to replication and pathogenesis. Here we investigated the role of COXs in the mouse hepatitis coronavirus (MHV) infection cycle. Blocking COX activity by different inhibitors or by RNA interference affected MHV infection in different cells. The COX inhibitors reduced MHV infection at a post-binding step, but early in the replication cycle. Both viral RNA and viral protein synthesis were affected with subsequent loss of progeny virus production. Thus, COX activity appears to be required for efficient MHV replication, providing a potential target for anti-coronaviral therapy. PMID:17555580

  13. Ice-Active Substances from the Infective Juveniles of the Freeze Tolerant Entomopathogenic Nematode, Steinernema feltiae

    PubMed Central

    Ali, Farman; Wharton, David A.

    2016-01-01

    Steinernema feltiae is a moderately freezing tolerant nematode, that can withstand intracellular ice formation. We investigated recrystallization inhibition, thermal hysteresis and ice nucleation activities in the infective juveniles of S. feltiae. Both the splat cooling assay and optical recrystallometry indicate the presence of ice active substances that inhibit recrystallization in the nematode extract. The substance is relatively heat stable and largely retains the recrystallization inhibition activity after heating. No thermal hysteresis activity was detected but the extract had a typical hexagonal crystal shape when grown from a single seed crystal and weak ice nucleation activity. An ice active substance is present in a low concentration, which may be involved in the freezing survival of this species by inhibiting ice recrystallization. PMID:27227961

  14. Ice-Active Substances from the Infective Juveniles of the Freeze Tolerant Entomopathogenic Nematode, Steinernema feltiae.

    PubMed

    Ali, Farman; Wharton, David A

    2016-01-01

    Steinernema feltiae is a moderately freezing tolerant nematode, that can withstand intracellular ice formation. We investigated recrystallization inhibition, thermal hysteresis and ice nucleation activities in the infective juveniles of S. feltiae. Both the splat cooling assay and optical recrystallometry indicate the presence of ice active substances that inhibit recrystallization in the nematode extract. The substance is relatively heat stable and largely retains the recrystallization inhibition activity after heating. No thermal hysteresis activity was detected but the extract had a typical hexagonal crystal shape when grown from a single seed crystal and weak ice nucleation activity. An ice active substance is present in a low concentration, which may be involved in the freezing survival of this species by inhibiting ice recrystallization. PMID:27227961

  15. Disaccharidase activities in small intestine of rotavirus-infected suckling mice: a histochemical study.

    PubMed

    Collins, J; Candy, D C; Starkey, W G; Spencer, A J; Osborne, M P; Stephen, J

    1990-10-01

    A histochemical study of the time course of the appearance and location of lactase and alpha-glucosidase (used to detect sucrase and maltase) activities was carried out on control and rotavirus-infected mice from 7 to 14 days old. The overall pattern of enzyme activity was in agreement with previous quantitative studies on the activities of these enzymes. No evidence was obtained to support the idea that lactase deficiency was the result of repopulation of villi (denuded of lactase-producing villus cells) with immature lactase-negative cells. Low lactase activity was more likely to reflect profound changes in metabolically crippled cells, and recovery of lactase activity with recovery of normal metabolic functions. The location of enzyme activity to brush border regions rather than the cytoplasm of villus enterocytes enhances the significance of previous quantitative studies on these enzymes. The timing and duration of diminished lactase activities were such that they were unlikely to cause the induction or perpetuation of diarrhea in murine rotavirus diarrhea. The appearance in infected animals of alpha-glucosidase 3 days earlier than normal indicates that, in addition to reversible changes seen with lactase, developmental changes were accelerated that affected both crypt and villus cells. PMID:2123244

  16. Low Prevalence of Ocular Chlamydia trachomatis Infection and Active Trachoma in the Western Division of Fiji

    PubMed Central

    Mudaliar, Umesh; Natutusau, Kinisimere; Pavluck, Alexandre L.; Willis, Rebecca; Alexander, Neal; Mabey, David C. W.; Cikamatana, Luisa; Kama, Mike; Rafai, Eric; Roberts, Chrissy H.; Solomon, Anthony W.

    2016-01-01

    Background Trachoma is the leading infectious cause of blindness and is caused by ocular infection with the bacterium Chlamydia trachomatis (Ct). While the majority of the global disease burden is found in sub-Saharan Africa, the Western Pacific Region has been identified as trachoma endemic. Population surveys carried out throughout Fiji have shown an abundance of both clinically active trachoma and trachomatous trichiasis in all divisions. This finding is at odds with the clinical experience of local healthcare workers who do not consider trachoma to be highly prevalent. We aimed to determine whether conjunctival infection with Ct could be detected in one administrative division of Fiji. Methods A population-based survey of 2306 individuals was conducted using the Global Trachoma Mapping Project methodology. Population prevalence of active trachoma in children and trichiasis in adults was estimated using the World Health Organization simplified grading system. Conjunctival swabs were collected from 1009 children aged 1–9 years. DNA from swabs was tested for the presence of the Ct plasmid and human endogenous control. Results The prevalence of active trachoma in 1–9 year olds was 3.4%. The age-adjusted prevalence was 2.8% (95% CI: 1.4–4.3%). The unadjusted prevalence of ocular Ct infection in 1–9 year-olds was 1.9% (19/1009), and the age-adjusted infection prevalence was 2.3% (95% CI: 0.4–2.5%). The median DNA load was 41 Ct plasmid copies per swab (min 20, first quartile 32, mean 6665, third quartile 161, max 86354). There was no association between current infection and follicular trachoma. No cases of trachomatous trichiasis were identified. Discussion The Western Division of Fiji has a low prevalence of clinical trachoma. Ocular Ct infections were observed, but they were predominantly low load infections and were not correlated with clinical signs. Our study data suggest that trachoma does not meet the WHO definition of a public health problem in

  17. Serine Peptide Phosphoester Prodrugs of Cyclic Cidofovir: Synthesis, Transport, and Antiviral Activity

    PubMed Central

    Eriksson, Ulrika; Peterson, Larryn W.; Kashemirov, Boris A.; Hilfinger, John M.; Drach, John C.; Borysko, Katherine Z.; Breitenbach, Julie M.; Kim, Jae Seung; Mitchell, Stefanie; Kijek, Paul; McKenna, Charles E.

    2008-01-01

    Cidofovir (HPMPC, 1), a broad-spectrum antiviral agent, is currently used to treat AIDS-related human cytomegalovirus (HCMV) retinitis and has recognized therapeutic potential for orthopox virus infections, but is limited by its low oral bioavailability. Cyclic cidofovir (2) displays decreased nephrotoxicity compared to 1, while also exhibiting potent antiviral activity. Here we describe in detail the synthesis and evaluation as prodrugs of four cHPMPC dipeptide conjugates in which the free POH of 2 is esterified by the Ser side chain alcohol group of an X-l-Ser(OMe) dipeptide: 3 (X = l-Ala), 4 (X = l-Val), 5 (X = l-Leu), and 6 (X = l-Phe). Perfusion studies in the rat establish that the mesenteric permeability to 4 is more than 30-fold greater than to 1, and the bioavailability of 4 is increased 8-fold relative to 1 in an in vivo murine model. In gastrointestinal and liver homogenates, the cHPMPC prodrugs are rapidly hydrolyzed to 2. Prodrugs 3, 4, and 5 are nontoxic at 100 μM in HFF and KB cells and in cell-based plaque reduction assays had IC50 values of 0.1–0.5 μM for HCMV and 10 μM for two orthopox viruses (vaccinia and cowpox). The enhanced transport properties of 3–6, conferred by incorporation of a toxicologically benign dipeptide moiety, and the facile cleavage of the Ser–O–P linkage suggest that these prodrugs represent a promising new approach to enhancing the bioavailability of 2. PMID:18481868

  18. Exploiting viral natural history for vaccine development.

    PubMed

    Barry, Peter A

    2015-06-01

    The partial successes of the Phase 2 gB-based vaccine trials for HCMV highlight the very real likelihood that vaccine-mediated induction of antibodies that neutralize the fusion pathway of fibroblast infection is not sufficient as a singular strategy to confer protective efficacy against primary HCMV infection. Alternative strategies that serve as adjuncts to gB-based vaccines are likely required to target different aspects of the complex lifecycle of HCMV infection. There has been considerable recent interest in targeting the gH/gL/UL128/UL130/UL131 pentamer complex (gH/gL-PC) to neutralize the endocytic pathway of HCMV infection of epithelial and endothelial cells. Since both cell types are critical during primary mucosal infection, intrahost spread, and shedding of HCMV in an infected host, the gH/gL-PC represents a high-value target for vaccination to interrupt the HCMV lifecycle. The natural history of HCMV is exceedingly complex and incompletely resolved, and the protective efficacy generated by gH/gL-PC remains to be validated in clinical trials. Yet, there are salient aspects of its lifecycle that offer clues about how other novel vaccine strategies can be targeted to especially susceptible parts of the viral proteome to significantly disrupt HCMV's ability to infect susceptible hosts. In particular, the protracted evolution of Herpesvirales has endowed HCMV with two remarkable properties of its natural history: (1) lifelong persistence within immune hosts that develop extraordinarily large antiviral immune responses and (2) the ability to reinfect those with prior immunity. The latter phenotype strongly implies that, if HCMV can overcome prior immunity to initiate a new infection, it is likely irrelevant whether prior immunity derives from prior infection or prior vaccination. Both phenotypes are unified by the extensive devotion of the HCMV coding repertoire (~50%) to viral proteins that modulate host cell signaling, trafficking, activation, antigen

  19. Activity of daptomycin against staphylococci collected from bloodstream infections in Spanish medical centers.

    PubMed

    Picazo, Juan J; Betriu, Carmen; Culebras, Esther; Rodríguez-Avial, Iciar; Gómez, María; López, Fátima

    2009-08-01

    We used the broth microdilution method to determine the MICs of daptomycin and 13 comparator agents against 319 methicillin-susceptible Staphylococcus aureus isolates, 201 methicillin-resistant S. aureus (MRSA) isolates, and 183 coagulase-negative staphylococci (CoNS). Isolates were consecutively collected from bloodstream infections in 39 Spanish medical centers during a 3-month period (March through May 2008). Among MRSA, 1 isolate with intermediate susceptibility to vancomycin and 6 isolates resistant to linezolid were found. Nonsusceptibility to teicoplanin was detected in 3.9% of CoNS. Daptomycin was highly active against the staphylococcal blood isolates tested-all were inhibited at the daptomycin susceptibility breakpoint of < or = 1 microg/mL. Daptomycin retained its activity against the isolates that were resistant to teicoplanin or linezolid, or that had reduced susceptibility to vancomycin. These data suggest that daptomycin could be useful for the treatment of bloodstream infections caused by staphylococci. PMID:19631100

  20. Avirulent strains of Toxoplasma gondii infect macrophages by active invasion from the phagosome.

    PubMed

    Zhao, Yanlin; Marple, Andrew H; Ferguson, David J P; Bzik, David J; Yap, George S

    2014-04-29

    Unlike most intracellular pathogens that gain access into host cells through endocytic pathways, Toxoplasma gondii initiates infection at the cell surface by active penetration through a moving junction and subsequent formation of a parasitophorous vacuole. Here, we describe a noncanonical pathway for T. gondii infection of macrophages, in which parasites are initially internalized through phagocytosis, and then actively invade from within a phagosomal compartment to form a parasitophorous vacuole. This phagosome to vacuole invasion (PTVI) pathway may represent an intermediary link between the endocytic and the penetrative routes for host cell entry by intracellular pathogens. The PTVI pathway is preferentially used by avirulent strains of T. gondii and confers an infectious advantage over virulent strains for macrophage tropism. PMID:24733931

  1. Avirulent strains of Toxoplasma gondii infect macrophages by active invasion from the phagosome

    PubMed Central

    Zhao, Yanlin; Marple, Andrew H.; Ferguson, David J. P.; Bzik, David J.; Yap, George S.

    2014-01-01

    Unlike most intracellular pathogens that gain access into host cells through endocytic pathways, Toxoplasma gondii initiates infection at the cell surface by active penetration through a moving junction and subsequent formation of a parasitophorous vacuole. Here, we describe a noncanonical pathway for T. gondii infection of macrophages, in which parasites are initially internalized through phagocytosis, and then actively invade from within a phagosomal compartment to form a parasitophorous vacuole. This phagosome to vacuole invasion (PTVI) pathway may represent an intermediary link between the endocytic and the penetrative routes for host cell entry by intracellular pathogens. The PTVI pathway is preferentially used by avirulent strains of T. gondii and confers an infectious advantage over virulent strains for macrophage tropism. PMID:24733931

  2. Reducing infection in chronic leg ulcers with an activated carbon cloth dressing.

    PubMed

    Murphy, Nina

    2016-06-23

    Zorflex is a new type of antimicrobial dressing composed of 100% activated carbon cloth. It attracts and binds bacteria to its surface, enabling them to be safely removed at dressing change. It has no reported toxic effects and can be used on either a short-or long-term basis. This article describes 4 case studies in which patients with recalcitrant chronic venous leg ulcers that were prone to recurrent infection were treated with the activated carbon cloth dressing. All of the wounds had failed to respond to antimicrobial dressings containing silver, iodine or polyhexamethylene biguanide (PHMB), and were heavily exuding and painful. In all cases, the signs of infection reduced significantly within 4 weeks, resulting in good patient outcomes. PMID:27345081

  3. Polymer-Ag nanocomposites with enhanced antimicrobial activity against bacterial infection.

    PubMed

    Mei, Lin; Lu, Zhentan; Zhang, Xinge; Li, Chaoxing; Jia, Yanxia

    2014-09-24

    Herein, a nontoxic nanocomposite is synthesized by reduction of silver nitrate in the presence of a cationic polymer displaying strong antimicrobial activity against bacterial infection. These nanocomposites with a large concentration of positive charge promote their adsorption to bacterial membranes through electrostatic interaction. Moreover, the synthesized nanocomposites with polyvalent and synergistic antimicrobial effects can effectively kill both Gram-positive and Gram-negative bacteria without the emergence of bacterial resistance. Morphological changes obtained by transmission electron microscope observation show that these nanocomposites can cause leakage and chaos of intracellular contents. Analysis of the antimicrobial mechanism confirms that the lethal action of nanocomposites against the bacteria started with disruption of the bacterial membrane, subsequent cellular internalization of the nanoparticles, and inhibition of intracellular enzymatic activity. This novel antimicrobial material with good cytocompatibility promotes healing of infected wounds in diabetic rats, and has a promising future in the treatment of other infectious diseases. PMID:25170799

  4. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6

    PubMed Central

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R.; Murphy, Eain; Sinclair, John

    2016-01-01

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  5. Buparvaquone is active against Neospora caninum in vitro and in experimentally infected mice

    PubMed Central

    Müller, Joachim; Aguado-Martinez, Adriana; Manser, Vera; Balmer, Vreni; Winzer, Pablo; Ritler, Dominic; Hostettler, Isabel; Arranz-Solís, David; Ortega-Mora, Luis; Hemphill, Andrew

    2015-01-01

    The naphthoquinone buparvaquone is currently the only drug used against theileriosis. Here, the effects of buparvaquone were investigated in vitro and in an experimental mouse model for Neospora caninum infection. In 4-day proliferation assays, buparvaquone efficiently inhibited N. caninum tachyzoite replication (IC50 = 4.9 nM; IC100 = 100 nM). However, in the long term tachyzoites adapted and resumed proliferation in the presence of 100 nM buparvaquone after 20 days of cultivation. Parasiticidal activity was noted after 9 days of culture in 0.5 µM or 6 days in 1 µM buparvaquone. TEM of N. caninum infected fibroblasts treated with 1 µM buparvaquone showed that the drug acted rather slowly, and ultrastructural changes were evident only after 3–5 days of treatment, including severe alterations in the parasite cytoplasm, changes in the composition of the parasitophorous vacuole matrix and a diminished integrity of the vacuole membrane. Treatment of N. caninum infected mice with buparvaquone (100 mg/kg) either by intraperitoneal injection or gavage prevented neosporosis symptoms in 4 out of 6 mice in the intraperitoneally treated group, and in 6 out of 7 mice in the group receiving oral treatment. In the corresponding controls, all 6 mice injected intraperitoneally with corn oil alone died of acute neosporosis, and 4 out of 6 mice died in the orally treated control group. Assessment of infection intensities in the treatment groups showed that, compared to the drug treated groups, the controls showed a significantly higher parasite load in the lungs while cerebral parasite load was higher in the buparvaquone-treated groups. Thus, although buparvaquone did not eliminate the parasites infecting the CNS, the drug represents an interesting lead with the potential to eliminate, or at least diminish, fetal infection during pregnancy. PMID:25941626

  6. Activation of RNase L is dependent on OAS3 expression during infection with diverse human viruses.

    PubMed

    Li, Yize; Banerjee, Shuvojit; Wang, Yuyan; Goldstein, Stephen A; Dong, Beihua; Gaughan, Christina; Silverman, Robert H; Weiss, Susan R

    2016-02-23

    The 2',5'-oligoadenylate (2-5A) synthetase (OAS)-RNase L system is an IFN-induced antiviral pathway. RNase L activity depends on 2-5A, synthesized by OAS. Although all three enzymatically active OAS proteins in humans--OAS1, OAS2, and OAS3--synthesize 2-5A upon binding dsRNA, it is unclear which are responsible for RNase L activation during viral infection. We used clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein-9 nuclease (Cas9) technology to engineer human A549-derived cell lines in which each of the OAS genes or RNase L is knocked out. Upon transfection with poly(rI):poly(rC), a synthetic surrogate for viral dsRNA, or infection with each of four viruses from different groups (West Nile virus, Sindbis virus, influenza virus, or vaccinia virus), OAS1-KO and OAS2-KO cells synthesized amounts of 2-5A similar to those synthesized in parental wild-type cells, causing RNase L activation as assessed by rRNA degradation. In contrast, OAS3-KO cells synthesized minimal 2-5A, and rRNA remained intact, similar to infected RNase L-KO cells. All four viruses replicated to higher titers in OAS3-KO or RNase L-KO A549 cells than in parental, OAS1-KO, or OAS2-KO cells, demonstrating the antiviral effects of OAS3. OAS3 displayed a higher affinity for dsRNA in intact cells than either OAS1 or OAS2, consistent with its dominant role in RNase L activation. Finally, the requirement for OAS3 as the major OAS isoform responsible for RNase L activation was not restricted to A549 cells, because OAS3-KO cells derived from two other human cell lines also were deficient in RNase L activation. PMID:26858407

  7. Activated human valvular interstitial cells sustain interleukin-17 production to recruit neutrophils in infective endocarditis.

    PubMed

    Yeh, Chiou-Yueh; Shun, Chia-Tung; Kuo, Yu-Min; Jung, Chiau-Jing; Hsieh, Song-Chou; Chiu, Yen-Ling; Chen, Jeng-Wei; Hsu, Ron-Bin; Yang, Chia-Ju; Chia, Jean-San

    2015-06-01

    The mechanisms that underlie valvular inflammation in streptococcus-induced infective endocarditis (IE) remain unclear. We previously demonstrated that streptococcal glucosyltransferases (GTFs) can activate human heart valvular interstitial cells (VIC) to secrete interleukin-6 (IL-6), a cytokine involved in T helper 17 (Th17) cell differentiation. Here, we tested the hypothesis that activated VIC can enhance neutrophil infiltration through sustained IL-17 production, leading to valvular damage. To monitor cytokine and chemokine production, leukocyte recruitment, and the induction or expansion of CD4(+) CD45RA(-) CD25(-) CCR6(+) Th17 cells, primary human VIC were cultured in vitro and activated by GTFs. Serum cytokine levels were measured using an enzyme-linked immunosorbent assay (ELISA), and neutrophils and Th17 cells were detected by immunohistochemistry in infected valves from patients with IE. The expression of IL-21, IL-23, IL-17, and retinoic acid receptor-related orphan receptor C (Rorc) was upregulated in GTF-activated VIC, which may enhance the proliferation of memory Th17 cells in an IL-6-dependent manner. Many chemokines, including chemokine (C-X-C motif) ligand 1 (CXCL1), were upregulated in GTF-activated VIC, which might recruit neutrophils and CD4(+) T cells. Moreover, CXCL1 production in VIC was induced in a dose-dependent manner by IL-17 to enhance neutrophil chemotaxis. CXCL1-expressing VIC and infiltrating neutrophils could be detected in infected valves, and serum concentrations of IL-17, IL-21, and IL-23 were increased in patients with IE compared to healthy donors. Furthermore, elevated serum IL-21 levels have been significantly associated with severe valvular damage, including rupture of chordae tendineae, in IE patients. Our findings suggest that VIC are activated by bacterial modulins to recruit neutrophils and that such activities might be further enhanced by the production of Th17-associated cytokines. Together, these factors can amplify

  8. Pharmacologic Activation of the Innate Immune System to Prevent Respiratory Viral Infections

    PubMed Central

    Cheng, Guanjun; Fridlender, Zvi G.; Cheng, Guang-Shing; Chen, Bei; Mangalmurti, Nilam S.; Saloura, Vassiliki; Yu, Zaifang; Kapoor, Veena; Mozdzanowska, Krystyna; Moon, Edmund; Sun, Jing; Kreindler, James L.; Cohen, Noam A.; Caton, Andrew J.; Erikson, Jan; Albelda, Steven M.

    2011-01-01

    Drugs that can rapidly inhibit respiratory infection from influenza or other respiratory pathogens are needed. One approach is to engage primary innate immune defenses against viral infection, such as activating the IFN pathway. In this study, we report that a small, cell-permeable compound called 5,6-di-methylxanthenone-4-acetic acid (DMXAA) can induce protection against vesicular stomatitis virus in vitro and H1N1 influenza A virus in vitro and in vivo through innate immune activation. Using the mouse C10 bronchial epithelial cell line and primary cultures of nasal epithelial cells, we demonstrate DMXAA activates the IFN regulatory factor-3 pathway leading to production of IFN-β and subsequent high-level induction of IFN-β–dependent proteins, such as myxovirus resistance 1 (Mx1) and 2′,5′-oligoadenylate synthetase 1 (OAS1). Mice treated with DMXAA intranasally elevate mRNA/protein expression of Mx1 and OAS1 in the nasal mucosa, trachea, and lung. When challenged intranasally with a lethal dose of H1N1 influenza A virus, DMXAA reduced viral titers in the lungs and protected 80% of mice from death, even when given at 24 hours before infection. These data show that agents, like DMXAA, that can directly activate innate immune pathways, such as the IFN regulatory factor-3/IFN-β system, in respiratory epithelial cells can be used to protect from influenza pneumonia and potentially in other respiratory viral infections. Development of this approach in humans could be valuable for protecting health care professionals and “first responders” in the early stages of viral pandemics or bioterror attacks. PMID:21148741

  9. Ibuprofen Potentiates the In Vivo Antifungal Activity of Fluconazole against Candida albicans Murine Infection

    PubMed Central

    Miranda, Isabel M.; Silva-Dias, Ana; Silva, Ana P.; Rodrigues, Acácio G.; Pina-Vaz, Cidália

    2015-01-01

    Candida albicans is the most prevalent cause of fungemia worldwide. Its ability to develop resistance in patients receiving azole antifungal therapy is well documented. In a murine model of systemic infection, we show that ibuprofen potentiates fluconazole antifungal activity against a fluconazole-resistant strain, drastically reducing the fungal burden and morbidity. The therapeutic combination of fluconazole with ibuprofen may constitute a new approach for the management of antifungal therapeutics to reverse the resistance conferred by efflux pump overexpression. PMID:25845879

  10. Antileishmanial Activity of 1,3,4-Thiadiazolium-2-Aminide in Mice Infected with Leishmania amazonensis▿

    PubMed Central

    Rodrigues, Raquel F.; Charret, Karen S.; da Silva, Edson F.; Echevarria, Áurea; Amaral, Verônica F.; Leon, Leonor L.; Canto-Cavalheiro, Marilene M.

    2009-01-01

    The efficacy of two mesoionic derivatives (MI-H-H and MI-4-OCH3) was evaluated in CBA/J mice infected with Leishmania amazonensis. Treatment with these compounds demonstrated that the MI-4-OCH3 derivative and the reference drug meglumine antimoniate (Glucantime) presented significant activity relative to an untreated control. No apparent hepatic or renal toxicity due to these mesoionic compounds was found. PMID:19015338

  11. Early agr activation correlates with vancomycin treatment failure in multi-clonotype MRSA endovascular infections

    PubMed Central

    Abdelhady, Wessam; Chen, Liang; Bayer, Arnold S.; Seidl, Kati; Yeaman, Michael R.; Kreiswirth, Barry N.; Xiong, Yan Q.

    2015-01-01

    Objectives Persistent MRSA infections are especially relevant to endovascular infections and correlate with suboptimal outcomes. However, the virulence signatures of Staphylococcus aureus that drive such persistence outcomes are not well defined. In the current study, we investigated correlations between accessory gene regulator (agr) activation and the outcome of vancomycin treatment in an experimental model of infective endocarditis (IE) due to MRSA strains with different agr and clonal complex (CC) types. Methods Twelve isolates with the four most common MRSA CC and agr types (CC5-agr II, CC8-agr I, CC30-agr III and CC45-agr I) were evaluated for heterogeneous vancomycin-intermediate S. aureus (hVISA), agr function, agrA and RNAIII transcription, agr locus sequences, virulence and response to vancomycin in the IE model. Results Early agr RNAIII activation (beginning at 2 h of growth) in parallel with strong δ-haemolysin production correlated with persistent outcomes in the IE model following vancomycin therapy. Importantly, such treatment failures occurred across the range of CC/agr types studied. In addition, these MRSA strains: (i) were vancomycin susceptible in vitro; (ii) were not hVISA or vancomycin tolerant; and (iii) did not evolve hVISA phenotypes or perturbed δ-haemolysin activity in vivo following vancomycin therapy. Moreover, agr locus sequence analyses revealed no common point mutations that correlated with either temporal RNAIII transcription or vancomycin treatment outcomes, encompassing different CC and agr types. Conclusions These data suggest that temporal agr RNAIII activation and agr functional profiles may be useful biomarkers to predict the in vivo persistence of endovascular MRSA infections despite vancomycin therapy. PMID:25564565

  12. Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway

    SciTech Connect

    Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen

    2015-01-09

    Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection.

  13. Prolonged Activation of Virus-Specific CD8+T Cells after Acute B19 Infection

    PubMed Central

    2005-01-01

    Background Human parvovirus B19 (B19) is a ubiquitous and clinically significant pathogen, causing erythema infectiosum, arthropathy, transient aplastic crisis, and intrauterine fetal death. The phenotype of CD8+ T cells in acute B19 infection has not been studied previously. Methods and Findings The number and phenotype of B19-specific CD8+ T cell responses during and after acute adult infection was studied using HLA–peptide multimeric complexes. Surprisingly, these responses increased in magnitude over the first year post-infection despite resolution of clinical symptoms and control of viraemia, with T cell populations specific for individual epitopes comprising up to 4% of CD8+ T cells. B19-specific T cells developed and maintained an activated CD38+ phenotype, with strong expression of perforin and CD57 and downregulation of CD28 and CD27. These cells possessed strong effector function and intact proliferative capacity. Individuals tested many years after infection exhibited lower frequencies of B19-specific cytotoxic T lymphocytes, typically 0.05%–0.5% of CD8+ T cells, which were perforin, CD38, and CCR7 low. Conclusion This is the first example to our knowledge of an “acute” human viral infection inducing a persistent activated CD8+ T cell response. The likely explanation—analogous to that for cytomegalovirus infection—is that this persistent response is due to low-level antigen exposure. CD8+ T cells may contribute to the long-term control of this significant pathogen and should be considered during vaccine development. PMID:16253012

  14. Platelet activation and platelet-leukocyte interaction in dogs naturally infected with Babesia rossi.

    PubMed

    Goddard, Amelia; Leisewitz, Andrew L; Kristensen, Annemarie T; Schoeman, Johan P

    2015-09-01

    Using flow cytometry, platelet-leukocyte aggregate (PLA) formation has previously been documented in dogs with a variety of systemic inflammatory disorders and immune-mediated haemolytic anaemia. Platelet activation and subsequent interaction between platelets and leukocytes are important for regulating innate immunity and systemic inflammation. The objective of this study was to investigate PLA formation in canine babesiosis and to determine whether it was associated with outcome. Blood was collected from 36 client-owned dogs diagnosed with Babesia rossi infection and 15 healthy controls using EDTA as anticoagulant. Activated platelets and PLA formation were detected by measuring surface expression of P-selectin (CD62P) on platelets, monocytes and neutrophils. Of the Babesia-infected dogs, 29 survived and seven died. The percentage of CD62P-positive monocytes was significantly higher (P = 0.036) in the Babesia-infected dogs (54%) than in healthy control dogs (35.3%). However, there were no significant differences between the Babesia-infected and control groups for CD62P-positive platelets (4.9% and 1.2%, respectively) and CD62P-positive neutrophils (28.3% and 17.9%, respectively). The percentage of CD62P-positive monocytes was significantly higher (P = 0.019) in the survivors (58.9%) than in healthy control dogs; however, there were no significant differences between the non-survivors (39.2%) and the controls or between survivors and non-survivors. There were no significant differences between groups for the percentage of CD62P-positive platelets (survivors 4.8%; non-survivors 5.3%; controls 1.2%) or CD62P-positive neutrophils (survivors 31.6%; non-survivors 5.6%; controls 17.9%). In conclusion, Babesia-infected dogs, specifically dogs that survived, had a significantly increased percentage of platelet-monocyte aggregates compared to healthy control dogs. PMID:26088270

  15. Immunosuppression associated with the development of chronic infections with Rickettsia tsutsugamushi: adherent suppressor cell activity and macrophage activation.

    PubMed Central

    Jerrells, T R

    1985-01-01

    Measures of general immunocompetency such as lymphocyte responses to mitogens and alloantigens and the ability to produce antibody to T-dependent and T-independent antigens were evaluated during the development of chronic infections with Rickettsia tsutsugamushi resulting from subcutaneous infection of BALB/c mice. It was found that a transient immunosuppression was demonstrable regardless of the infecting strain of rickettsiae; however, the immunosuppression produced by the Karp and Kato strains was more pronounced and longer lived. As a marked splenomegaly resulting from inflammatory macrophage influx accompanied this immunosuppression, mitogen- and antigen-induced lymphocyte proliferation was also evaluated after adherent cell depletion or in the presence of indomethacin, and both treatments significantly improved the responses. Isolated splenic macrophages were shown to suppress the responses of lymphocytes from naive mice as well as to exhibit parameters of activation including tumor cell cytolysis and cytostasis and the ability to inhibit the replication of R. tsutsugamushi in vitro. These data suggest an association between macrophage activation involved in rickettsial clearance and a transient immunosuppression. PMID:2931378

  16. Monitoring of the lactonase activity of paraoxonase-1 enzyme in HIV-1-infection

    PubMed Central

    Dias, Clara; Marinho, Aline; Morello, Judit; Almeida, Gabriela; Caixas, Umbelina; Soto, Karina; Monteiro, Emilia; Pereira, Sofia

    2014-01-01

    Paraoxonase-1 (PON1) is a high-density lipoprotein (HDL)-associated enzyme known as a free radical scavenging system (1). PON-1 has three main activities, responsible for its antioxidant and anti-inflammatory potential: paraoxonase, arylesterase and lactonase (LACase), the latest to be discovered and pointed out to be its native activity (2). Among other physiological roles, the LACase might minimize the deleterious effects of hyperhomocysteinaemia in infection, by detoxifying the highly reactive metabolite homocysteine-thiolactone (HcyTL) (3),4. In the present work, we have developed and applied a method to quantify LACase activity and to explore the role of this enzyme in HIV-infection and virological response. The LACase activity was monitored in a cohort of HIV-1-infected patients, through the titration of 3-(o-hydroxyphenyl) propionic acid, formed upon the LACase-mediated hydrolysis of the substrate dihydrocoumarin. The study protocol was approved by the Ethics Committee of Centro Hospitalar de Lisboa Central and Hospital Prof. Doutor Fernando Fonseca. All patients gave their written informed consent and were adults with documented HIV-1-infection, regardless of combined antiretroviral therapy (cART) use. Naïve patients and patients who had received continuous antiretroviral treatment for more than one month were included. A total of 179 HIV-1-infected patients were included on this study (51% Men, 39% non-Caucasian, 45±13 years old). Patients with non-suppressed viraemia, either from the non-cART (n=89, 12±4 kU/L, p<0.01) or from the cART with detectable viral load (n=11, 10±5 kU/L, p<0.05) groups, had lower activity than the cART with suppressed viraemia (n=79, 15±7 kU/L) (Kruskal–Wallis test). Among naïve patients, higher viral load (> 31,500 cps/mL, Spearman r=−0.535, p=0.003) and lower CD4+ T-cells count (< 500 cell/mm3, Pearson r=0.326, p=0.024) were associated with the LACase activity. The present study suggests that lower LACase activity is

  17. The antiviral activity of ribosomal polynucleotides against encephalomyocarditis virus infection of mice.

    PubMed

    Stewart, A G; Grantham, C A; Dawson, K M; Stebbing, N

    1980-01-01

    Intraperitoneal administration of ribosomal RNA (rRNA) was found to protect mice against subsequent lethal infection by encephalomyocarditis (EMC) virus without induction of detectable amounts of circulating interferon. The nature of this effect was examined in terms of the types of natural polyribonucleotides which could afford such protection. rRNA prepared from E. coli was slightly more effective than chicken liver rRNA which was, in turn, more effective than yeast rRNA. 5S ribosomal RNA was not effective, whereas the slightly smaller 4S transfer RNA was as good as E. coli rRNA, suggesting that molecular size is not the sole criterion for the protective effect. The separated 16S and 23S E. coli rRNAs where each as effective as the unfractionated RNA. Anti-viral activity was lost after complete hydrolysis with alkali and nucleoside monophosphates were also inactive. Digestion of rRNA with pancreatic ribonuclease greatly decreased its antiviral activity whereas digestion with T1 ribonuclease had no effect indicating that fairly short oligonucleotides, but not of random nucleotide sequence, are active components in the protection of mice against infection by EMC virus. In vitro, no antiviral effect against EMC virus infection was observed in treatment of L cells under various conditions. PMID:6160832

  18. CENTRAL ACTIVATION, MUSCLE PERFORMANCE, AND PHYSICAL FUNCTION IN MEN INFECTED WITH HUMAN IMMUNODEFICIENCY VIRUS

    PubMed Central

    Scott, Wayne B.; Oursler, Krisann K.; Katzel, Leslie I.; Ryan, Alice S.; Russ, David W.

    2010-01-01

    Loss of muscle mass and limitations in activity have been reported in persons infected with human immunodeficiency virus (HIV), even those who are otherwise asymptomatic. The extent to which factors other than muscle atrophy impair muscle performance has not been addressed in depth. The purpose of this study was to determine the extent of neuromuscular activation of the knee extensors and ankle dorsiflexors of 27 men infected with HIV receiving antiretroviral therapy and its relationship to muscle performance. The central activation ratio (CAR) was determined using superimposed electrical stimulation during maximum voluntary contractions. In addition to force and power measurements, muscle cross-sectional area and composition was evaluated using computed tomography. Aerobic capacity was determined from treadmill exercise testing. Eleven of the subjects had an impaired ability to activate the knee extensors (CAR = 0.72 ± 0.12) that was associated with weakness and decreased specific force. The reduced central activation was not associated with muscle area, body composition, aerobic capacity, CD4 count, or medication regimen. Those individuals with low central activation had higher HIV-1 viral loads and were more likely to have a history of AIDS-defining illness. These results suggest the possibility of a different mechanism contributing to muscle impairment in the current treatment era that is associated with impairment of central motor function rather than atrophy. Further investigation is warranted in a larger, more diverse population before more definitive claims are made. PMID:17554797

  19. Antibacterial Activity of Medicinal Plants Against Pathogens causing Complicated Urinary Tract Infections.

    PubMed

    Sharma, Anjana; Chandraker, S; Patel, V K; Ramteke, Padmini

    2009-03-01

    Seventeen Indian folklore medicinal plants were investigated to evaluate antibacterial activity of aqueous, ethanol and acetone extracts against 66 multidrug resistant isolates of major urinary tract pathogens (Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis) by disc diffusion method. Ethanol extract of Zingiber officinale and Punica granatum showed strong antibacterial activity against Escherichia coli. Ethanol extracts of Terminalia chebula and Ocimum sanctum exhibited antibacterial activity against Klebsiella pneumoniae. Ethanol extract of Cinnamomum cassia showed maximum antibacterial activity against Pseudomonas aeruginosa while ethanol extract of Azadirachta indica and Ocimum sanctum exhibited antibacterial activity against Enterococcus faecalis. The results support the folkloric use of these plants in the treatment of urinary tract infections by the tribals of Mahakoshal region of central India. PMID:20336211

  20. Impact of genital hygiene and sexual activity on urinary tract infection during pregnancy

    PubMed Central

    Badran, Yaser Ali; El-Kashef, Tarek Ahmed; Abdelaziz, Alsayed Saad; Ali, Mahmoud Mohamad

    2015-01-01

    Introduction: Urinary tract infection (UTI) is a bacterial infection commonly occurring during pregnancy. The incidence of UTI in pregnant women depends on parity, race, and socioeconomic status and can be as high as 8%. Objective: The objective was to determine the association of UTI with genital hygiene practices and sexual activity in pregnant women. Patients and Methods: From January 2011 to June 2014, a total of 200 pregnant women attending prenatal clinics in Al-Zahra Hospital and King Khalid Hospital in Saudia Arabia Kingdom were selected. Eighty pregnant women, who had positive urine cultures (cases), were compared with the remaining 120 healthy pregnant women matched for age, social, economic and education status, and parity (controls). Results: In the present work, Escherichia coli were the infecting organism in 83% of cases. Factors associated with UTI included sexual intercourse ≥ 3 times/week (odds ratio [OR] =5.62), recent UTI (OR = 3.27), not washing genitals precoitus (OR = 2.16), not washing genitals postcoitus (OR = 2.89), not voiding urine postcoitus (OR = 8.62) and washing genitals from back to front (OR = 2.96) [OR = odds ratio]. Conclusion: Urinary tract infection in pregnant women was primarily caused by bacteria from the stool (E. coli) and that hygiene habits, and sexual behavior may play a role in UTI in pregnant women. PMID:26692669

  1. Increased cytotoxicity and streptolysin O activity in group G streptococcal strains causing invasive tissue infections

    PubMed Central

    Siemens, Nikolai; Kittang, Bård R.; Chakrakodi, Bhavya; Oppegaard, Oddvar; Johansson, Linda; Bruun, Trond; Mylvaganam, Haima; Arnell, Per; Hyldegaard, Ole; Nekludov, Michael; Karlsson, Ylva; Svensson, Mattias; Skrede, Steiner; Norrby-Teglund, Anna

    2015-01-01

    Streptococcus dysgalactiae subsp. equisimilis (SDSE) has emerged as an important cause of severe skin and soft tissue infections, but little is known of the pathogenic mechanisms underlying tissue pathology. Patient samples and a collection of invasive and non-invasive group G SDSE strains (n = 69) were analyzed with respect to virulence factor expression and cytotoxic or inflammatory effects on human cells and 3D skin tissue models. SDSE strains efficiently infected the 3D-skin model and severe tissue pathology, inflammatory responses and altered production of host structural framework proteins associated with epithelial barrier integrity were evident already at 8 hours post-infection. Invasive strains were significantly more cytotoxic towards keratinocytes and expressed higher Streptokinase and Streptolysin O (SLO) activities, as compared to non-invasive strains. The opposite was true for Streptolysin S (SLS). Fractionation and proteomic analysis of the cytotoxic fractions implicated SLO as a factor likely contributing to the keratinocyte cytotoxicity and tissue pathology. Analyses of patient tissue biopsies revealed massive bacterial load, high expression of slo, as well as immune cell infiltration and pro-inflammatory markers. Our findings suggest the contribution of SLO to epithelial cytotoxicity and tissue pathology in SDSE tissue infections. PMID:26601609

  2. Roles of phagocytosis activating protein (PAP) in Aeromonas hydrophila infected Cyprinus carpio.

    PubMed

    Wonglapsuwan, Monwadee; Kongmee, Pataraporn; Suanyuk, Naraid; Chotigeat, Wilaiwan

    2016-06-01

    Cyprinus carpio (koi) is one of the most popular ornamental fish. A major problem for C. carpio farming is bacterial infections especially by Aeromonas hydrophila. Previously studies had shown that the Phagocytosis Activating Protein (PAP) gene was involved in the innate immune response of animals. Therefore, we attempted to identify a role for the PAP gene in the immunology of C. carpio. The expression of the PAP was found in C. carpio whole blood and increased when the fish were stimulated by inactivated A. hydrophila. In addition, PAP-phMGFP DNA was injected as an immunostimulant. The survival rate and the phagocytic index were significantly increased in the A. hydrophila infected fish that received the PAP-phMGFP DNA immunostimulant. A chitosan-PAP-phMGFP nanoparticle was then developed and feeded into fish which infected with A. hydrophila. These fish had a significantly lower mortality rate than the control. Therefore, this research confirmed a key role for PAP in protection fish from bacterial infection and the chitosan-PAP-phMGFP nanoparticle could be a good prototype for fish immunostimulant in the future. PMID:26748248

  3. Chitosan based substrates for wound infection detection based on increased lysozyme activity.

    PubMed

    Tegl, Gregor; Rollett, Alexandra; Dopplinger, Jasmin; Gamerith, Clemens; Guebitz, Georg M

    2016-10-20

    There is a strong need of point-of-care diagnostics for early detection of wound infection. In this study, substrates based on functionalized chitosan were developed for visual detection of elevated lysozyme activity, an infection biomarker in wound fluids. For efficient hydrolysis by lysozyme, N-acetyl chitosan with a final degree of acetylation of around 50% was synthesized. N-acetylated chitosan and a chitosan-starch composite were labeled with structurally different dyes resulting in lysozyme-responsive biomaterials. Incubation with lysozyme in buffer and artificial wound fluid lead to a release of colored hydrolysis products already after 2h incubation. Tests in human wound fluid from infected wounds indicated a clear visual color change after 2.5h compared to control samples. A higher degree of swelling of the chitosan/starch containing substrate led to faster hydrolysis by lysozyme. This study demonstrates the potential of the lysozyme-responsive materials for diagnosis of wound infection and provides different diagnostic substrates for potential incorporation in point-of-care devices. PMID:27474566

  4. Autophagy Activated by Bluetongue Virus Infection Plays a Positive Role in Its Replication.

    PubMed

    Lv, Shuang; Xu, Qingyuan; Sun, Encheng; Yang, Tao; Li, Junping; Feng, Yufei; Zhang, Qin; Wang, Haixiu; Zhang, Jikai; Wu, Donglai

    2015-08-01

    Bluetongue virus (BTV) is an important pathogen of wild and domestic ruminants. Despite extensive study in recent decades, the interplay between BTV and host cells is not clearly understood. Autophagy as a cellular adaptive response plays a part in many viral infections. In our study, we found that BTV1 infection triggers the complete autophagic process in host cells, as demonstrated by the appearance of obvious double-membrane autophagosome-like vesicles, GFP-LC3 dots accumulation, the conversion of LC3-I to LC3-II and increased levels of autophagic flux in BSR cells (baby hamster kidney cell clones) and primary lamb lingual epithelial cells upon BTV1 infection. Moreover, the results of a UV-inactivated BTV1 infection assay suggested that the induction of autophagy was dependent on BTV1 replication. Therefore, we investigated the role of autophagy in BTV1 replication. The inhibition of autophagy by pharmacological inhibitors (3-MA, CQ) and RNA interference (siBeclin1) significantly decreased viral protein synthesis and virus yields. In contrast, treating BSR cells with rapamycin, an inducer of autophagy, promoted viral protein expression and the production of infectious BTV1. These findings lead us to conclude that autophagy is activated by BTV1 and contributes to its replication, and provide novel insights into BTV-host interactions. PMID:26287233

  5. Autophagy Activated by Bluetongue Virus Infection Plays a Positive Role in Its Replication

    PubMed Central

    Lv, Shuang; Xu, Qingyuan; Sun, Encheng; Yang, Tao; Li, Junping; Feng, Yufei; Zhang, Qin; Wang, Haixiu; Zhang, Jikai; Wu, Donglai

    2015-01-01

    Bluetongue virus (BTV) is an important pathogen of wild and domestic ruminants. Despite extensive study in recent decades, the interplay between BTV and host cells is not clearly understood. Autophagy as a cellular adaptive response plays a part in many viral infections. In our study, we found that BTV1 infection triggers the complete autophagic process in host cells, as demonstrated by the appearance of obvious double-membrane autophagosome-like vesicles, GFP-LC3 dots accumulation, the conversion of LC3-I to LC3-II and increased levels of autophagic flux in BSR cells (baby hamster kidney cell clones) and primary lamb lingual epithelial cells upon BTV1 infection. Moreover, the results of a UV-inactivated BTV1 infection assay suggested that the induction of autophagy was dependent on BTV1 replication. Therefore, we investigated the role of autophagy in BTV1 replication. The inhibition of autophagy by pharmacological inhibitors (3-MA, CQ) and RNA interference (siBeclin1) significantly decreased viral protein synthesis and virus yields. In contrast, treating BSR cells with rapamycin, an inducer of autophagy, promoted viral protein expression and the production of infectious BTV1. These findings lead us to conclude that autophagy is activated by BTV1 and contributes to its replication, and provide novel insights into BTV-host interactions. PMID:26287233

  6. [Antibacterial activity of essential oils on microorganisms isolated from urinary tract infection].

    PubMed

    Pereira, Rogério Santos; Sumita, Tânia Cristina; Furlan, Marcos Roberto; Jorge, Antonio Olavo Cardoso; Ueno, Mariko

    2004-04-01

    The antibacterial activity of essential oils extracted from medicinal plants (Ocimum gratissimum, L., Cybopogum citratus (DC) Stapf., and Salvia officinalis, L.) was assessed on bacterial strains derived from 100 urine samples. Samples were taken from subjects diagnosed with urinary tract infection living in the community. Microorganisms were plated on Müller Hinton agar. Plant extracts were applied using a Steers replicator and petri dishes were incubated at 37 degrees C for 24 hours. Salvia officinalis, L. showed enhanced inhibitory activity compared to the other two herbs, with 100% efficiency against Klebsiella and Enterobacter species, 96% against Escherichia coli, 83% against Proteus mirabilis, and 75% against Morganella morganii. PMID:15122392

  7. Antibacterial activity of Pinus elliottii against anaerobic bacteria present in primary endodontic infections.

    PubMed

    Caetano da Silva, Sandro Donizete; Mendes de Souza, Maria Gorete; Oliveira Cardoso, Miguel Jorge; da Silva Moraes, Thais; Ambrósio, Sérgio Ricardo; Sola Veneziani, Rodrigo Cássio; Martins, Carlos Henrique G

    2014-12-01

    Endodontic infections have a polymicrobial nature, but anaerobic bacteria prevail among the infectious microbes. Considering that it is easy to eliminate planktonic bacteria, biofilm-forming bacteria still challenge clinicians during the fight against endodontic diseases. The chemical constituents of the oleoresin of Pinus elliottii, a plant belonging to the family Pinaceae, stand out in the search for biologically active compounds based on natural products with potential application in the treatment of endodontic infections. Indeed, plant oleoresins are an abundant natural source of diterpenes that display significant and well-defined biological activities as well as potential antimicrobial action. In this context, this study aimed to (1) evaluate the in vitro antibacterial activity of the oleoresin, fractions, and subfractions of P. elliottii as well as the action of dehydroabietic acid against 11 anaerobic bacteria that cause endodontic infection in both their planktonic and biofilm forms and (2) assess the in vitro antibiofilm activity of dehydroabietic acid against the same group of bacteria. The broth microdilution technique helped to determine the minimum inhibitory concentration (MIC) of the oleoresin and fractions. This same technique aided determination of the MIC values of nine subfractions of Fraction 1, the most active fraction. The MIC, minimum bactericidal concentration, and antibiofilm activity of dehydroabietic acid against the tested anaerobic bacteria were also examined. The oleoresin and fractions, especially fraction PE1, afforded promising MIC values, which ranged from 0.4 to 50 μg/mL. Concerning the nine evaluated subfractions, PE1.3 and PE1.4 furnished the most noteworthy MIC values, between 6.2 and 100 μg/mL. Dehydroabietic acid displayed antibacterial activity, with MIC values lying from 6.2 to 50 μg/mL, as well as bactericidal effect for all the investigated bacteria, except for Prevotella nigrescens. Assessment of the antibiofilm

  8. Antiplasmodial activity of Xanthium strumarium against Plasmodium berghei-infected BALB/c mice.

    PubMed

    Chandel, Sanjeev; Bagai, Upma; Vashishat, Nisha

    2012-03-01

    The present work was undertaken to evaluate the antiplasmodial activity of ethanolic leaves extract of traditional medicinal plant Xanthium strumarium in Plasmodium berghei-infected BALB/c mice along with phytochemical screening and acute toxicity test to support its traditional medicinal use as a malaria remedy. The ethanolic leaves extract of X. strumarium (ELEXS) 150, 250, 350 and 500 mg/kg/day demonstrated dose-dependent chemosuppression during early and established infection long with significant (p < 0.001) repository activity. The oral administration of 500 mg/kg/day concentration showed a maximum of 88.6% chemosuppression during early infection, which was more than that of the standard drug chloroquine (5 mg/kg/day) with 88.3% chemosuppression. However, 60% mortality has been found in this group. The LD(50) of ELEXS was found to be 1.5 g/kg/mouse. The administration of 350 mg/kg/day concentration of extract have been found to exert 90.40% chemosuppression during repository infection, which was well comparable to standard drug pyrimethamine (1.2 mg/kg/day) exerting 92.91% chemosuppression. The extract has been found to enhance mean survival time of mice from 21 to 26 days with 250 and 350 mg/kg/day concentrations, while 150 mg/kg/day concentration has been found to sustain all the mice up to 29 days which was similar to the employed standard drug chloroquine (5 mg/kg/day). All these findings support the ethanopharmacological use of X. strumarium as malarial remedy and indicate the potential of plant for active antiplasmodial components. PMID:21847597

  9. Predictors of Active Injection Drug Use in a Cohort of Patients Infected With Hepatitis C Virus

    PubMed Central

    Reed, Carrie; Bliss, Caleb; Heeren, Timothy; Tumilty, Sheila; Horsburgh, C. Robert; Samet, Jeffrey H.; Cotton, Deborah J.

    2013-01-01

    Objectives. We investigated potential risk factors for active injection drug use (IDU) in an inner-city cohort of patients infected with hepatitis C virus (HCV). Methods. We used log-binomial regression to identify factors independently associated with active IDU during the first 3 years of follow-up for the 289 participants who reported ever having injected drugs at baseline. Results. Overall, 142 (49.1%) of the 289 participants reported active IDU at some point during the follow-up period. In a multivariate model, being unemployed (prevalence ratio [PR] = 1.93; 95% confidence interval [CI] = 1.24, 3.03) and hazardous alcohol drinking (PR = 1.67; 95% CI = 1.34, 2.08) were associated with active IDU. Smoking was associated with IDU but this association was not statistically significant. Patients with all 3 of those factors were 3 times as likely to report IDU during follow-up as those with 0 or 1 factor (PR = 3.3; 95% CI = 2.2, 4.9). Neither HIV coinfection nor history of psychiatric disease was independently associated with active IDU. Conclusions. Optimal treatment of persons with HCV infection will require attention to unemployment, alcohol use, and smoking in conjunction with IDU treatment and prevention. PMID:23153145

  10. Candidacidal Activity of Selected Ceragenins and Human Cathelicidin LL-37 in Experimental Settings Mimicking Infection Sites

    PubMed Central

    Durnaś, Bonita; Wnorowska, Urszula; Pogoda, Katarzyna; Deptuła, Piotr; Wątek, Marzena; Piktel, Ewelina; Głuszek, Stanisław; Gu, Xiaobo; Savage, Paul B.; Niemirowicz, Katarzyna; Bucki, Robert

    2016-01-01

    Fungal infections, especially those caused by antibiotic resistant pathogens, have become a serious public health problem due to the growing number of immunocompromised patients, including those subjected to anticancer treatment or suffering from HIV infection. In this study we assessed fungicidal activity of the ceragenins CSA-13, CSA-131 and CSA-192 against four fluconazole–resistant Candida strains. We found that ceragenins activity against planktonic Candida cells was higher than activity of human LL-37 peptide and synthetic cationic peptide omiganan. Compared to LL-37 peptide, ceragenins in the presence of DNase I demonstrated an increased ability to kill DNA-induced Candida biofilm. Microscopy studies show that treatment with LL-37 or ceragenins causes Candida cells to undergo extensive surface changes indicating surface membrane damage. This conclusion was substantiated by observation of rapid incorporation of FITC-labeled CSA-13, CSA-131 or LL-37 peptide into the more lipophilic environment of the Candida membrane. In addition to activity against Candida spp., ceragenins CSA-131 and CSA-192 display strong fungicidal activity against sixteen clinical isolates including Cryptococcus neoformans and Aspergillus fumigatus. These results indicate the potential of ceragenins for future development as new fungicidal agents. PMID:27315208

  11. Activation of the AMPK-ULK1 pathway plays an important role in autophagy during prion infection

    PubMed Central

    Fan, Xue-Yu; Tian, Chan; Wang, Hui; Xu, Yin; Ren, Ke; Zhang, Bao-Yun; Gao, Chen; Shi, Qi; Meng, Ge; Zhang, Lu-Bin; Zhao, Yang-Jing; Shao, Qi-Xiang; Dong, Xiao-Ping

    2015-01-01

    AMPK is a serine/threonine protein kinase that acts as a positive regulator of autophagy, by phosphorylating ULK1 at specific sites. A previous study demonstrated activation of the macroautophagic system in scrapie-infected experimental rodents and in certain human prion diseases, in which the essential negative regulator mTOR is severely inhibited. In this study, AMPK and ULK1 in the brains of hamsters infected with scrapie strain 263 K and in the scrapie-infected cell line SMB-S15 were analysed. The results showed an up-regulated trend of AMPK and AMPK-Thr172, ULK1 and ULK1-Ser555. Increases in brain AMPK and ULK1 occurred at an early stage of agent 263 K infection. The level of phosphorylated ULK1-Ser757 decreased during mid-infection and was only negligibly present at the terminal stage, a pattern that suggested a close relationship of the phosphorylated protein with altered endogenous mTOR. In addition, the level of LKB1 associated with AMPK activation was selectively increased at the early and middle stages of infection. Knockdown of endogenous ULK1 in SMB-S15 cells inhibited LC3 lipidation. These results showed that, in addition to the abolishment of the mTOR regulatory pathway, activation of the AMPK-ULK1 pathway during prion infection contributes to autophagy activation in prion-infected brain tissues. PMID:26423766

  12. Heligmosomoides polygyrus bakeri infection activates colonic FoxP3+ T cells enhancing their capacity to prevent colitis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Helminthic infections protect mice from colitis in murine models of inflammatory bowel disease and also may protect people. Helminths like Heligmosomoides bakeri (Hpb) can induce Tregs. Experiments explored if Hpb infection could protect mice from colitis through activation of colonic Treg and exam...

  13. Dual mode antibacterial activity of ion substituted calcium phosphate nanocarriers for bone infections.

    PubMed

    Sampath Kumar, T S; Madhumathi, K; Rubaiya, Y; Doble, Mukesh

    2015-01-01

    Nanotechnology has tremendous potential for the management of infectious diseases caused by multi-drug resistant bacteria, through the development of newer antibacterial materials and efficient modes of antibiotic delivery. Calcium phosphate (CaP) bioceramics are commonly used as bone substitutes due to their similarity to bone mineral and are widely researched upon for the treatment of bone infections associated with bone loss. CaPs can be used as local antibiotic delivery agents for bone infections and can be substituted with antibacterial ions in their crystal structure to have a wide spectrum, sustained antibacterial activity even against drug resistant bacteria. In the present work, a dual mode antibiotic delivery system with antibacterial ion substituted calcium deficient hydroxyapatite (CDHA) nanoparticles has been developed. Antibacterial ions such as zinc, silver, and strontium have been incorporated into CDHA at concentrations of 6, 0.25-0.75, and 2.5-7.5 at. %, respectively. The samples were found to be phase pure, acicular nanoparticles of length 40-50 nm and width 5-6 nm approximately. The loading and release profile of doxycycline, a commonly used antibiotic, was studied from the nanocarriers. The drug release was studied for 5 days and the release profile was influenced by the ion concentrations. The release of antibacterial ions was studied over a period of 21 days. The ion substituted CDHA samples were tested for antibacterial efficacy on Staphylococcus aureus and Escherichia coli by MIC/MBC studies and time-kill assay. AgCDHA and ZnCDHA showed high antibacterial activity against both bacteria, while SrCDHA was weakly active against S. aureus. Present study shows that the antibiotic release can provide the initial high antibacterial activity, and the sustained ion release can provide a long-term antibacterial activity. Such dual mode antibiotic and antibacterial ion release offers an efficient and potent way to treat an incumbent drug

  14. Bacterial Muramyl Dipeptide (MDP) Restricts Human Cytomegalovirus Replication via an IFN-β-Dependent Pathway

    PubMed Central

    Kapoor, Arun; Fan, Yi-Hsin; Arav-Boger, Ravit

    2016-01-01

    We recently reported that induction of NOD2 by human Cytomegalovirus (HCMV) resulted in virus inhibition and upregulation of antiviral and inflammatory cytokines. Here we investigated the effects of muramyl dipeptide (MDP), a bacterial cell wall component that activates NOD2, on HCMV replication and antiviral responses. HCMV infection of human foreskin fibroblasts induced NOD2, the downstream receptor-interacting serine/threonine-protein kinase 2 (RIPK2), resulting in phosphorylation of TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3). MDP treatment following infection at low multiplicity (MOI = 0.1 PFU/cell) inhibited HCMV in a dose-dependent manner and further induced phosphorylation of TBK1, IRF3 and expression of IFN-β. None of these effects of MDP were observed following infection at multiplicity of 1. In infected NOD2 knocked-down cells MDP did not induce IFN-β, irrespective of MOI. Treatment with MDP before infection also inhibited HCMV, an effect augmented with treatment duration. Treatment with an IFN-β receptor blocking antibody or knockdown of IFN-β significantly attenuated the inhibitory effect of MDP on HCMV. MDP treatment before or after infection with herpesvirus 1 did not inhibit its replication. Summarized, NOD2 activation exerts anti-HCMV activities predominantly via IFN-β. Since MDP is a bacterial cell wall component, ongoing microbial exposure may influence HCMV replication. PMID:26830977

  15. Immune activation and IL-12 production during acute/early HIV infection in the absence and presence of highly active, antiretroviral therapy.

    PubMed

    Byrnes, Adriana A; Harris, David M; Atabani, Sowsan F; Sabundayo, Beulah P; Langan, Susan J; Margolick, Joseph B; Karp, Christopher L

    2008-12-01

    Suppressed IL-12 production and maladaptive immune activation, both of which are ameliorated by successful highly active antiretroviral therapy (HAART), are thought to play important roles in the immunopathogenesis of chronic HIV infection. Despite the important effects of the immunological and virological events of early HIV infection on subsequent disease progression, IL-12 production and immune activation in early infection remain under-defined. To quantify IL-12 production and immune activation during acute/early HIV infection, in the presence and absence of HAART, we performed a prospective, longitudinal study of participants in the Baltimore site of the Acute Infection and Early Disease Research Program, with cross-sectional comparison to healthy control subjects. PBMC cytokine productive capacity and plasma immune activation markers [soluble CD8 (sCD8), sCD4, granzyme B, neopterin, beta2-microglobulin, sIL-2R, sTNFRI, sTNFRII, and IL-12p70] were quantified by ELISA. Notably, PBMC from patients with acute/early HIV infection exhibited in vivo IL-12p70 production along with increased, maximal in vitro IL-12 production. Further, despite evidence from plasma markers of generalized immune activation, no elevation in plasma levels of sCD4 was observed, suggesting relative blunting of in vivo CD4+ T cell activation from the beginning of HIV infection. Finally, despite successful virological responses to HAART, heightened in vivo CD8+ T cell activation, IL-12 production, and IFN activity were sustained for at least 6 months during primary HIV infection. These data underscore the need for comparative mechanistic analysis of the immunobiology of early and chronic HIV infection. PMID:18806124

  16. Dengue virus infection-enhancing antibody activities against Indonesian strains in inhabitants of central Thailand.

    PubMed

    Yamanaka, Atsushi; Oddgun, Duangjai; Chantawat, Nantarat; Okabayashi, Tamaki; Ramasoota, Pongrama; Churrotin, Siti; Kotaki, Tomohiro; Kameoka, Masanori; Soegijanto, Soegeng; Konishi, Eiji

    2016-04-01

    Dengue virus (DENV) infection-enhancing antibodies are a hypothetic factor to increase the dengue disease severity. In this study, we investigated the enhancing antibodies against Indonesian strains of DENV-1-4 in 50 healthy inhabitants of central Thailand (Bangkok and Uthai Thani). Indonesia and Thailand have seen the highest dengue incidence in Southeast Asia. The infection history of each subject was estimated by comparing his/her neutralizing antibody titers against prototype DENV-1-4 strains. To resolve the difficulty in obtaining foreign live viruses for use as assay antigens, we used a recombinant system to prepare single-round infectious dengue viral particles based on viral sequence information. Irrespective of the previously infecting serotype(s), most serum samples showed significantly higher enhancement titers against Indonesian DENV-2 strains than against Thai DENV-2 strains, whereas the opposite effect was observed for the DENV-3 strains. Equivalent enhancing activities were observed against both DENV-1 and DENV-4. These results suggest that the genotype has an impact on enhancing antibody activities against DENV-2 and DENV-3, because the predominant circulating genotypes of each serotype differ between Indonesia and Thailand. PMID:26645957

  17. Chronic bacterial infection activates autoreactive B cells and induces isotype switching and autoantigen-driven mutations.

    PubMed

    Jung, Sophie; Schickel, Jean-Nicolas; Kern, Aurélie; Knapp, Anne-Marie; Eftekhari, Pierre; Da Silva, Sylvia; Jaulhac, Benoît; Brink, Robert; Soulas-Sprauel, Pauline; Pasquali, Jean-Louis; Martin, Thierry; Korganow, Anne-Sophie

    2016-01-01

    The links between infections and the development of B-cell-mediated autoimmune diseases are still unclear. In particular, it has been suggested that infection-induced stimulation of innate immune sensors can engage low affinity autoreactive B lymphocytes to mature and produce mutated IgG pathogenic autoantibodies. To test this hypothesis, we established a new knock-in mouse model in which autoreactive B cells could be committed to an affinity maturation process. We show that a chronic bacterial infection allows the activation of such B cells and the production of nonmutated IgM autoantibodies. Moreover, in the constitutive presence of their soluble antigen, some autoreactive clones are able to acquire a germinal center phenotype, to induce Aicda gene expression and to introduce somatic mutations in the IgG heavy chain variable region on amino acids forming direct contacts with the autoantigen. Paradoxically, only lower affinity variants are detected, which strongly suggests that higher affinity autoantibodies secreting B cells are counterselected. For the first time, we demonstrate in vivo that a noncross-reactive infectious agent can activate and induce autoreactive B cells to isotype switching and autoantigen-driven mutations, but on a nonautoimmune background, tolerance mechanisms prevent the formation of consequently dangerous autoimmunity. PMID:26474536

  18. Safety and Efficacy of Activated Transfected Killer Cells for Neutropenic Fungal Infections

    PubMed Central

    Lin, Lin; Ibrahim, Ashraf S.; Baquir, Beverlie; Fu, Yue; Applebaum, David; Schwartz, Julie; Wang, Amy; Avanesian, Valentina; Spellberg, Brad

    2010-01-01

    Background Invasive fungal infections cause considerable morbidity and mortality in neutropenic patients. White blood cell transfusions are a promising treatment for such infections, but technical barriers have prevented their widespread use. Methods To recapitulate white blood cell transfusions, we are developing a cell-based immunotherapy using a phagocytic cell line, HL-60. We sought to stably transfect HL-60 cells with a suicide trap (herpes simplex virus thymidine kinase), to enable purging of the cells when desired, and a bioluminescence marker, to track the cells in vivo in mice. Results Transfection was stable despite 20 months of continuous culture or storage in liquid nitrogen. Activation of these transfected cells with retinoic acid and dimethyl sulfamethoxazole enhanced their microbicidal effects. Activated transfected killer (ATAK) cells were completely eliminated after exposure to ganciclovir, confirming function of the suicide trap. ATAK cells improved the survival of neutropenic mice with lethal disseminated candidiasis and inhalational aspergillosis. Bioluminescence and histopathologic analysis confirmed that the cells were purged from surviving mice after ganciclovir treatment. Comprehensive necropsy, histopathology, and metabolomic analysis revealed no toxicity of the cells. Conclusions These results lay the groundwork for continued translational development of this promising, novel technology for the treatment of refractory infections in neutropenic hosts. PMID:20397927

  19. Antiviral activity of Acacia nilotica against Hepatitis C Virus in liver infected cells

    PubMed Central

    2011-01-01

    Hepatitis C virus (HCV) belonging to the family Flaviviridae has infected 3% of the population worldwide and 6% of the population in Pakistan. The only recommended standard treatment is pegylated INF-α plus ribavirin. Due to less compatibility of the standard treatment, thirteen medicinal plants were collected from different areas of Pakistan on the basis of undocumented antiviral reports against different viral infections. Medicinal plants were air dried, extracted and screened out against HCV by infecting HCV inoculums of 3a genotype in liver cells. RT-PCR results demonstrate that acetonic and methanolic extract of Acacia nilotica (AN) showed more than 50% reduction at non toxic concentration. From the above results, it can be concluded that by selecting different molecular targets, specific structure-activity relationship can be achieved by doing mechanistic analysis. So, additional studies are required for the isolation and recognition of antiviral compound in AN to establish its importance as antiviral drug against HCV. For further research, we will scrutinize the synergistic effect of active antiviral compound in combination with standard PEG INF-α and ribavirin which may be helpful in exploring further gateways for antiviral therapy against HCV. PMID:21569385

  20. Increased mortality associated with treated active tuberculosis in HIV-infected adults in Tanzania.

    PubMed

    Kabali, Conrad; Mtei, Lillian; Brooks, Daniel R; Waddell, Richard; Bakari, Muhammad; Matee, Mecky; Arbeit, Robert D; Pallangyo, Kisali; von Reyn, C Fordham; Horsburgh, C Robert

    2013-07-01

    Active tuberculosis (TB) among HIV-infected patients, even when successfully treated, may be associated with excess mortality. We conducted a prospective cohort study nested in a randomized TB vaccine trial to compare mortality between HIV-infected patients diagnosed and treated for TB (TB, n = 77) and HIV-infected patients within the same CD4 range, who were not diagnosed with or treated for active TB (non-TB, n = 308) in the period 2001-2008. Only twenty four subjects (6%) were on antiretroviral therapy at the beginning of this study. After accounting for covariate effects including use of antiretroviral therapy, isoniazid preventive therapy, and receipt of vaccine, we found a four-fold increase in mortality in TB patients compared with non-TB patients (adjusted Hazard Ratio 4.61; 95% Confidence Interval (CI): 1.63, 13.05). These findings suggest that treatment for TB alone is not sufficient to avert the excess mortality associated with HIV-related TB and that prevention of TB may provide a mortality benefit. PMID:23523641

  1. Increased mortality associated with treated active tuberculosis in HIV-infected adults in Tanzania

    PubMed Central

    Kabali, Conrad; Mtei, Lillian; Brooks, Daniel R.; Waddell, Richard; Bakari, Muhammad; Matee, Mecky; Arbeit, Robert D.; Pallangyo, Kisali; von Reyn, C. Fordham; Horsburgh, C. Robert

    2013-01-01

    SUMMARY Active tuberculosis (TB) among HIV-infected patients, even when successfully treated, may be associated with excess mortality. We conducted a prospective cohort study nested in a randomized TB vaccine trial to compare mortality between HIV-infected patients diagnosed and treated for TB (TB, n=77) and HIV-infected patients within the same CD4 range, who were not diagnosed with or treated for active TB (non-TB, n=308) in the period 2001–2008. Only twenty four subjects (6%) were on antiretroviral therapy at the beginning of this study. After accounting for covariate effects including use of antiretroviral therapy, isoniazid preventive therapy, and receipt of vaccine, we found a four-fold increase in mortality in TB patients compared with non-TB patients (adjusted Hazard Ratio 4.61; 95% Confidence Interval (CI): 1.63, 13.05). These findings suggest that treatment for TB alone is not sufficient to avert the excess mortality associated with HIV-related TB and that prevention of TB may provide a mortality benefit. PMID:23523641

  2. 5-Bromo (or chloro)-6-azido-5,6-dihydro-2' -deoxyuridine and -thymidine derivatives with potent antiviral activity.

    PubMed

    Kumar, Rakesh

    2002-02-11

    Synthesis, antiviral, and cytotoxic activities of 5-bromo (or chloro)-6-azido-5,6-dihydro-2' -deoxyuridine (4,5) and -thymidine (6,7) are reported. Compounds 4 and 5 exhibited a broad spectrum of antiherpes activity against (HSV-1, HSV-2, HCMV, and VZV). PMID:11814776

  3. AIDS dementia is associated with massive, activated HIV-1 infection and concomitant expression of several cytokines.

    PubMed Central

    Nuovo, G. J.; Alfieri, M. L.

    1996-01-01

    BACKGROUND: We recently showed that acquired immunodeficiency syndrome (AIDS) dementia is associated with activated infection of microglia, neurons, and astrocytes by HIV-1. However, it is doubtful whether infection per se is responsible for the dramatic symptoms associated with AIDS dementia. The purpose of this study was to determine the histologic distribution of messenger RNAs (mRNAs) of several cytokines that have been implicated in AIDS pathogenesis and to correlate this expression pattern with the in situ localization of polymerase chain reaction (PCR)-amplified HIV-1 nucleic acids in the central nervous system (CNS). MATERIALS AND METHODS: HIV-1 DNA was detected by PCR in situ hybridization. HIV-1 RNA and cytokine expression, including tumor necrosis factor alpha (TNF), inducible nitric oxide synthetase (iNOS), and macrophage inflammatory protein alpha (MIP-1 alpha) and MIP-1 beta mRNA were detected by reverse transcriptase (RT) in situ PCR. RESULTS: Amplified viral DNA was detected in each of the seven HIV-1-positive cases and in none of the five negative controls. In people with AIDS dementia, many HIV-1 DNA-positive cells were detected in regions of the CNS that corresponded to clinical symptomatology. In AIDS patients with minimal CNS involvement, rare HIV-1-infected microglial cells were noted. Viral RNA was detected primarily in cases of AIDS dementia. TNF, iNOS, MIP-1 alpha and MIP-1 beta expression localized to tissues from AIDS dementia cases where HIV-1 infected cells were plentiful. Colocalization experiments showed that these cytokines were transcribed mostly by viral-negative cells. CONCLUSIONS: These results suggest that two key elements in AIDS dementia are massive productive viral infection, involving microglia, neurons, and astrocytes, and concomitant stimulation of cytokine transcription in the neighboring uninfected cells. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 PMID:8784788

  4. PUL21a-Cyclin A2 Interaction is Required to Protect Human Cytomegalovirus-Infected Cells from the Deleterious Consequences of Mitotic Entry

    PubMed Central

    Eifler, Martin; Uecker, Ralf; Weisbach, Henry; Bogdanow, Boris; Richter, Ellen; König, Lydia; Vetter, Barbara; Lenac-Rovis, Tihana; Jonjic, Stipan; Neitzel, Heidemarie; Hagemeier, Christian; Wiebusch, Lüder

    2014-01-01

    Entry into mitosis is accompanied by dramatic changes in cellular architecture, metabolism and gene expression. Many viruses have evolved cell cycle arrest strategies to prevent mitotic entry, presumably to ensure sustained, uninterrupted viral replication. Here we show for human cytomegalovirus (HCMV) what happens if the viral cell cycle arrest mechanism is disabled and cells engaged in viral replication enter into unscheduled mitosis. We made use of an HCMV mutant that, due to a defective Cyclin A2 binding motif in its UL21a gene product (pUL21a), has lost its ability to down-regulate Cyclin A2 and, therefore, to arrest cells at the G1/S transition. Cyclin A2 up-regulation in infected cells not only triggered the onset of cellular DNA synthesis, but also promoted the accumulation and nuclear translocation of Cyclin B1-CDK1, premature chromatin condensation and mitotic entry. The infected cells were able to enter metaphase as shown by nuclear lamina disassembly and, often irregular, metaphase spindle formation. However, anaphase onset was blocked by the still intact anaphase promoting complex/cyclosome (APC/C) inhibitory function of pUL21a. Remarkably, the essential viral IE2, but not the related chromosome-associated IE1 protein, disappeared upon mitotic entry, suggesting an inherent instability of IE2 under mitotic conditions. Viral DNA synthesis was impaired in mitosis, as demonstrated by the abnormal morphology and strongly reduced BrdU incorporation rates of viral replication compartments. The prolonged metaphase arrest in infected cells coincided with precocious sister chromatid separation and progressive fragmentation of the chromosomal material. We conclude that the Cyclin A2-binding function of pUL21a contributes to the maintenance of a cell cycle state conducive for the completion of the HCMV replication cycle. Unscheduled mitotic entry during the course of the HCMV replication has fatal consequences, leading to abortive infection and cell death. PMID

  5. Nuclear Factor of Activated T-cells (NFAT) plays a role in SV40 infection

    PubMed Central

    Manley, Kate; O’Hara, Bethany A; Atwood, Walter J

    2008-01-01

    Recent evidence highlighted a role for the transcription factor, Nuclear Factor of Activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through κB sites located within the 72bp repeated enhancer region. In Vero cells NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter. PMID:18031784

  6. Nuclear factor of activated T-cells (NFAT) plays a role in SV40 infection

    SciTech Connect

    Manley, Kate; O'Hara, Bethany A.; Atwood, Walter J.

    2008-03-01

    Recent evidence highlighted a role for the transcription factor, nuclear factor of activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A, and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through {kappa}B sites located within the 72 bp repeated enhancer region. In Vero cells, NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter.

  7. Human cytomegalovirus pUL97 kinase induces global changes in the infected cell phosphoproteome

    PubMed Central

    Oberstein, Adam; Perlman, David H.; Shenk, Thomas; Terry, Laura J.

    2015-01-01

    Replication of human cytomegalovirus is regulated in part by cellular kinases and the single viral Ser/Thr kinase, pUL97. The virus-coded kinase augments the replication of human cytomegalovirus (HCMV) by enabling nuclear egress and altering cell cycle progression. These roles are accomplished through direct phosphorylation of nuclear lamins and the retinoblastoma protein, respectively. In an effort to identify additional pUL97 substrates, we analyzed the phosphoproteome of SILAC-labeled human fibroblasts during infection with either wild-type HCMV or a pUL97 kinase-dead mutant virus. Phosphopeptides were enriched over a titanium dioxide matrix and analyzed by high resolution mass spectrometry. We identified 157 unambiguous phosphosites from 106 cellular and 17 viral proteins whose phosphorylation required UL97. Analysis of peptides containing these sites allowed the identification of several candidate pUL97 phosphorylation motifs, including a completely novel phosphorylation motif, LxSP. Substrates harboring the LxSP motif were enriched in nucleocytoplasmic transport functions, including a number of components of the nuclear pore complex. These results extend the known functions of pUL97 and suggest that modulation of nuclear pore function may be important during HCMV replication. PMID:25867546

  8. In vitro activity of ceftaroline against staphylococci from prosthetic joint infection.

    PubMed

    Park, Kyung-Hwa; Greenwood-Quaintance, Kerryl E; Patel, Robin

    2016-02-01

    We tested the in vitro activity of ceftaroline by Etest against staphylococci recovered from patients with prosthetic joint infection, including 97 Staphylococcus aureus isolates (36%, oxacillin resistant) and 74 Staphylococcus epidermidis isolates (74%, oxacillin resistant). Ceftaroline inhibited all staphylococci at ≤0.5 μg/mL. The ceftaroline MIC(90/50) values for methicillin-susceptible S. aureus, methicillin-susceptible S. epidermidis, methicillin-resistant S. aureus, and methicillin-resistant S. epidermidis were 0.19/0.125, 0.094/0.047, 0.5/0.38, and 0.38/0.19 μg/mL, respectively. Based on these in vitro findings, ceftaroline should be further evaluated as a potential therapeutic option for the treatment of prosthetic joint infection caused by methicillin-susceptible and methicillin-resistant S. aureus and S. epidermidis. PMID:26602948

  9. Muscles provide protection during microbial infection by activating innate immune response pathways in Drosophila and zebrafish

    PubMed Central

    Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha

    2016-01-01

    ABSTRACT Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. PMID:27101844

  10. VIRUS INFECTION RAPIDLY ACTIVATES THE P58IPK PATHWAY, DELAYING PEAK KINASE ACTIVATION TO ENHANCE VIRAL REPLICATION

    PubMed Central

    GOODMAN, ALAN G.; TANNER, BERTRAND C. W.; CHANG, STEWART T.; ESTEBAN, MARIANO; KATZE, MICHAEL G.

    2011-01-01

    Previously we showed that the cellular protein P58IPK contributes to viral protein synthesis by decreasing the activity of the anti-viral protein, PKR. Here, we constructed a mathematical model to examine the P58IPK pathway and investigated temporal behavior of this biological system. We find that influenza virus infection results in the rapid activation of P58IPK which delays and reduces maximal PKR and eIF2α phosphorylation, leading to increased viral protein levels. We confirmed that the model could accurately predict viral and host protein levels at extended time points by testing it against experimental data. Sensitivity analysis of relative reaction rates describing P58IPK activity and the downstream proteins through which it functions helped identify processes that may be the most beneficial targets to thwart virus replication. Together, our study demonstrates how computational modeling can guide experimental design to further understand a specific metabolic signaling pathway during viral infection in a mammalian system. PMID:21612809

  11. Both Cyclophilin Inhibitors and Direct-Acting Antivirals Prevent PKR Activation in HCV-Infected Cells

    PubMed Central

    Bobardt, Michael; Chatterji, Udayan; Lim, Precious; Gawlik, Katarzyna; Gallay, Philippe

    2014-01-01

    We and others demonstrated that the contact between NS5A and the host factor CypA is critical for HCV replication. CypI, by disrupting NS5A-CypA complexes, block HCV replication both in vitro and in patients. Since NS5A also binds to PKR, a central component of the IFN response, we investigated the possibility of a relationship between CypA, NS5A and PKR in the IFN response to HCV. HCV-infected cells treated with CypI, DAAs or IFN were analyzed for the expression and activation of various components of the innate response. We found that CypI (cyclosporine A, alisporivir, NIM811 and sanglifehrins), drastically prevented the activation/phosphorylation, but not the expression of IFN-induced PKR in HCV-infected cells. CypI had no effect on the expression or phosphorylation of other components of the innate response such as eiF2, NF-kB, IRF3, IRF9, STAT1 and STAT2, suggesting a specific effect on PKR. No significant activation of IFN-induced PKR was observed in the absence of HCV. Importantly, we found that several classes of DAAs such as NS3/4A protease, NS5B polymerase and NS5A inhibitors also prevented PKR activation. Furthermore, we found that PKR activation by the dsRNA mimic poly I:C cannot be prevented by CypI or DAAs. Our findings suggest that CypI do not have a unique effect on PKR activation, but rather the suppression of HCV replication by any anti-HCV inhibitor, abrogates PKR activation induced by IFN. Moreover, they suggest that the accumulation of dsRNA intermediates allows HCV to exploit the activation of PKR to counteract the IFN response. PMID:24799968

  12. Urine soluble urokinase-type plasminogen activator receptor levels correlate with proteinuria in Puumala hantavirus infection

    PubMed Central

    Outinen, Tuula K.; Mäkelä, Satu; Huttunen, Reetta; Mäenpää, Niina; Libraty, Daniel; Vaheri, Antti; Mustonen, Jukka; Aittoniemi, Janne

    2014-01-01

    Objectives Urokinase-type plasminogen activator receptor (uPAR) is upregulated during inflammation and known to bind to β3-integrins, receptors used by pathogenic hantaviruses to enter endothelial cells. It has been proposed that soluble uPAR (suPAR) is a circulating factor that causes focal segmental glomerulosclerosis and proteinuria by activating β3-integrin in kidney podocytes. Proteinuria is also a characteristic feature of hantavirus infections. The aim of this study was to evaluate the relation between urine suPAR levels and disease severity in acute Puumala hantavirus (PUUV) infection. Design A single-centre, prospective cohort study. Subjects and methods Urinary suPAR levels were measured twice during the acute phase and once during convalescence in 36 patients with serologically confirmed PUUV infection. Fractional excretion of suPAR (FE suPAR) and of albumin (FE alb) were calculated. Results The FE suPAR was significantly elevated during the acute phase of PUUV infection compared to the convalescent phase (median 3.2%, range 0.8–52.0%, vs. median 1.9%, range 1.0–5.8%, P = 0.005). Maximum FE suPAR was correlated markedly with maximum FE alb (r = 0.812, P < 0.001), and with several other variables that reflect disease severity. There was a positive correlation with the length of hospitalization (r = 0.455, P = 0.009) and maximum plasma creatinine level (r = 0.780, P < 0.001), and an inverse correlation with minimum urinary output (r = −0.411, P = 0.030). There was no correlation between FE suPAR and plasma suPAR (r = 0.180, P = 0.324). Conclusion Urinary suPAR is markedly increased during acute PUUV infection and is correlated with proteinuria. High urine suPAR level may reflect local production of suPAR in the kidney during the acute infection. PMID:24717117

  13. Sustained Activation of Akt Elicits Mitochondrial Dysfunction to Block Plasmodium falciparum Infection in the Mosquito Host

    PubMed Central

    Drexler, Anna L.; Antonova-Koch, Yevgeniya; Sakaguchi, Danielle; Napoli, Eleonora; Wong, Sarah; Price, Mark S.; Eigenheer, Richard; Phinney, Brett S.; Pakpour, Nazzy; Pietri, Jose E.; Cheung, Kong; Georgis, Martha; Riehle, Michael

    2013-01-01

    The overexpression of activated, myristoylated Akt in the midgut of female transgenic Anopheles stephensi results in resistance to infection with the human malaria parasite Plasmodium falciparum but also decreased lifespan. In the present study, the understanding of mitochondria-dependent midgut homeostasis has been expanded to explain this apparent paradox in an insect of major medical importance. Given that Akt signaling is essential for cell growth and survival, we hypothesized that sustained Akt activation in the mosquito midgut would alter the balance of critical pathways that control mitochondrial dynamics to enhance parasite killing at some cost to survivorship. Toxic reactive oxygen and nitrogen species (RNOS) rise to high levels in the midgut after blood feeding, due to a combination of high NO production and a decline in FOXO-dependent antioxidants. Despite an apparent increase in mitochondrial biogenesis in young females (3 d), energy deficiencies were apparent as decreased oxidative phosphorylation and increased [AMP]/[ATP] ratios. In addition, mitochondrial mass was lower and accompanied by the presence of stalled autophagosomes in the posterior midgut, a critical site for blood digestion and stem cell-mediated epithelial maintenance and repair, and by functional degradation of the epithelial barrier. By 18 d, the age at which An. stephensi would transmit P. falciparum to human hosts, mitochondrial dysfunction coupled to Akt-mediated repression of autophagy/mitophagy was more evident and midgut epithelial structure was markedly compromised. Inhibition of RNOS by co-feeding of the nitric-oxide synthase inhibitor L-NAME at infection abrogated Akt-dependent killing of P. falciparum that begins within 18 h of infection in 3–5 d old mosquitoes. Hence, Akt-induced changes in mitochondrial dynamics perturb midgut homeostasis to enhance parasite resistance and decrease mosquito infective lifespan. Further, quality control of mitochondrial function in the

  14. Sustained activation of Akt elicits mitochondrial dysfunction to block Plasmodium falciparum infection in the mosquito host.

    PubMed

    Luckhart, Shirley; Giulivi, Cecilia; Drexler, Anna L; Antonova-Koch, Yevgeniya; Sakaguchi, Danielle; Napoli, Eleonora; Wong, Sarah; Price, Mark S; Eigenheer, Richard; Phinney, Brett S; Pakpour, Nazzy; Pietri, Jose E; Cheung, Kong; Georgis, Martha; Riehle, Michael

    2013-02-01

    The overexpression of activated, myristoylated Akt in the midgut of female transgenic Anopheles stephensi results in resistance to infection with the human malaria parasite Plasmodium falciparum but also decreased lifespan. In the present study, the understanding of mitochondria-dependent midgut homeostasis has been expanded to explain this apparent paradox in an insect of major medical importance. Given that Akt signaling is essential for cell growth and survival, we hypothesized that sustained Akt activation in the mosquito midgut would alter the balance of critical pathways that control mitochondrial dynamics to enhance parasite killing at some cost to survivorship. Toxic reactive oxygen and nitrogen species (RNOS) rise to high levels in the midgut after blood feeding, due to a combination of high NO production and a decline in FOXO-dependent antioxidants. Despite an apparent increase in mitochondrial biogenesis in young females (3 d), energy deficiencies were apparent as decreased oxidative phosphorylation and increased [AMP]/[ATP] ratios. In addition, mitochondrial mass was lower and accompanied by the presence of stalled autophagosomes in the posterior midgut, a critical site for blood digestion and stem cell-mediated epithelial maintenance and repair, and by functional degradation of the epithelial barrier. By 18 d, the age at which An. stephensi would transmit P. falciparum to human hosts, mitochondrial dysfunction coupled to Akt-mediated repression of autophagy/mitophagy was more evident and midgut epithelial structure was markedly compromised. Inhibition of RNOS by co-feeding of the nitric-oxide synthase inhibitor L-NAME at infection abrogated Akt-dependent killing of P. falciparum that begins within 18 h of infection in 3-5 d old mosquitoes. Hence, Akt-induced changes in mitochondrial dynamics perturb midgut homeostasis to enhance parasite resistance and decrease mosquito infective lifespan. Further, quality control of mitochondrial function in the

  15. Human Cytomegalovirus-Induced NKG2Chi CD57hi Natural Killer Cells Are Effectors Dependent on Humoral Antiviral Immunity

    PubMed Central

    Wu, Zeguang; Sinzger, Christian; Frascaroli, Giada; Reichel, Johanna; Bayer, Carina; Wang, Li; Schirmbeck, Reinhold

    2013-01-01

    Recent studies indicate that expansion of NKG2C-positive natural killer (NK) cells is associated with human cytomegalovirus (HCMV); however, their activity in response to HCMV-infected cells remains unclear. We show that NKG2Chi CD57hi NK cells gated on CD3neg CD56dim cells can be phenotypically identified as HCMV-induced NK cells that can be activated by HCMV-infected cells. Using HCMV-infected autologous macrophages as targets, we were able to show that these NKG2Chi CD57hi NK cells are highly responsive to HCMV-infected macrophages only in the presence of HCMV-specific antibodies, whereas they are functionally poor effectors of natural cytotoxicity. We further demonstrate that NKG2Chi CD57hi NK cells are intrinsically responsive to signaling through CD16 cross-linking. Our findings show that the activity of pathogen-induced innate immune cells can be enhanced by adaptive humoral immunity. Understanding the activity of NKG2Chi CD57hi NK cells against HCMV-infected cells will be of relevance for the further development of adoptive immunotherapy. PMID:23637420

  16. Newcastle disease virus infection induces activation of the NLRP3 inflammasome.

    PubMed

    Wang, Binbin; Zhu, Jie; Li, Dandan; Wang, Yang; Zhan, Yuan; Tan, Lei; Qiu, Xusheng; Sun, Yingjie; Song, Cuiping; Meng, Chunchun; Ying, Liao; Xiang, Mao; Meng, Guangxun; Ding, Chan

    2016-09-01

    Inflammatory responses are important aspects of the innate immune system during virus infection. We found that Newcastle disease virus can induce inflammasome activation in the human macrophage-like cell line THP-1. Viral replication was required for inflammasome activation, and small hairpin RNA knockdown experiments indicated that IL-1β secretion was mediated by the NLRP3 inflammasome. We also verified the results in LPS-primed bone marrow-derived macrophages (BMDMs) from NLRP3-deficient and wild type mice. NDV is considered to be a promising oncolytic virus. Stimulating the immune system has been proposed as a key mechanism of oncolytic specificity, and the inflammasome appears to be an important mechanism by which NDV is controlled. Knockdown of inflammasome components or chemical inhibition of caspase-1 activity shows that cell survival was augmented and benefited NDV replication. This study shows that NLRP3 inflammasome activation is an innate cellular response to NDV infection and offers insights into the oncolytic specificity of NDV. PMID:27269659

  17. Oxidized LDL levels are increased in HIV infection and may drive monocyte activation

    PubMed Central

    Zidar, David A.; Juchnowski, Steven; Ferrari, Brian; Clagett, Brian; Pilch-Cooper, Heather A.; Rose, Shawn; Rodriguez, Benigno; McComsey, Grace A.; Sieg, Scott F.; Mehta, Nehal N.; Lederman, Michael M.; Funderburg, Nicholas T.

    2015-01-01

    Background Human immunodeficiency virus (HIV) infection is associated with increased cardiovascular risk, and this risk correlates with markers of monocyte activation. We have shown that HIV is associated with a prothrombotic monocyte phenotype, which can be partially mitigated by statin therapy. We therefore explored the relationship between oxidized LDL particles and monocyte activation. Methods We performed phenotypic analysis of monocytes using flow cytometry on fresh whole blood in 54 patients with HIV and 24 controls without HIV. Plasma levels of oxLDL, soluble CD14, IL-6, soluble CD163 were measured by ELISA. In vitro experiments were performed using flow cytometry. Results Plasma levels of oxLDL were significantly increased in HIV-infection compared to controls (60.1 units vs 32.1 units, p<0.001). Monocyte expression of the oxLDL receptors, CD36 and Toll-like receptor 4, were also increased in HIV. OxLDL levels correlated with markers of monocyte activation, including soluble CD14, TF expression on inflammatory monocytes, and CD36. In vitro, stimulation with oxLDL, but not to LDL, resulted in expansion of inflammatory monocytes and increased monocyte expression of TF, recapitulating the monocyte profile we find in HIV disease. Conclusions OxLDL may contribute to monocyte activation and further study in the context of HIV disease is warranted. PMID:25647528

  18. BAY 41-2272 activates host defence against local and disseminated Candida albicans infections.

    PubMed

    Soeiro-Pereira, Paulo Vítor; Falcai, Angela; Kubo, Christina Arslanian; Antunes, Edson; Condino-Neto, Antonio

    2015-02-01

    In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation. PMID:25742266

  19. BAY 41-2272 activates host defence against local and disseminated Candida albicans infections

    PubMed Central

    Soeiro-Pereira, Paulo Vítor; Falcai, Angela; Kubo, Christina Arslanian; Antunes, Edson; Condino-Neto, Antonio

    2015-01-01

    In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation. PMID:25742266

  20. Liver Stiffness Is Associated With Monocyte Activation in HIV-Infected Ugandans Without Viral Hepatitis

    PubMed Central

    Wendel, Sarah K.; Grabowski, Mary K.; Ocama, Ponsiano; Kiggundu, Valerian; Bbosa, Francis; Boaz, Iga; Balagopal, Ashwin; Reynolds, Steven J.; Gray, Ronald H.; Serwadda, David; Kirk, Gregory D.; Quinn, Thomas C.; Stabinski, Lara

    2013-01-01

    Abstract A high prevalence of liver stiffness, as determined by elevated transient elastography liver stiffness measurement, was previously found in a cohort of HIV-infected Ugandans in the absence of chronic viral hepatitis. Given the role of immune activation and microbial translocation in models of liver disease, a shared immune mechanism was hypothesized in the same cohort without other overt causes of liver disease. This study examined whether HIV-related liver stiffness was associated with markers of immune activation or microbial translocation (MT). A retrospective case-control study of subjects with evidence of liver stiffness as defined by a transient elastography stiffness measurement ≥9.3 kPa (cases=133) and normal controls (n=133) from Rakai, Uganda was performed. Cases were matched to controls by age, gender, HIV, hepatitis B virus (HBV), and highly active antiretroviral therapy (HAART) status. Lipopolysaccharide (LPS), endotoxin IgM antibody, soluble CD14 (sCD14), C-reactive protein (CRP), and D-dimer levels were measured. Conditional logistic regression was used to estimate adjusted matched odds ratios (adjMOR) and 95% confidence intervals. Higher sCD14 levels were associated with a 19% increased odds of liver stiffness (adjMOR=1.19, p=0.002). In HIV-infected individuals, higher sCD14 levels were associated with a 54% increased odds of having liver stiffness (adjMOR=1.54, p<0.001); however, the opposite was observed in HIV-negative individuals (adjMOR=0.57, p=0.001). No other biomarker was significantly associated with liver stiffness, and only one subject was found to have detectable LPS. Liver stiffness in HIV-infected Ugandans is associated with increased sCD14 indicative of monocyte activation in the absence of viral hepatitis or microbial translocation, and suggests that HIV may be directly involved in liver disease. PMID:23548102

  1. Activation of caspases in intestinal villus epithelial cells of normal and nematode infected rats

    PubMed Central

    Hyoh, Y; Ishizaka, S; Horii, T; Fujiwara, A; Tegoshi, T; Yamada, M; Arizono, N

    2002-01-01

    Background: Small intestinal epithelial cells (IEC) show apoptosis in physiological turnover of cells and in certain inflammatory diseases. Aims: To investigate the role of caspases in the progression of IEC apoptosis in vivo. Methods: IEC were separated along the villus-crypt axis from the jejunum of normal and Nippostrongylus brasiliensis infected rats at 4°C. Caspases were examined by a fluorometric assay method, histochemistry, and immunoblotting. Results: Villus cell rich IEC from normal rats exhibited a high level of caspase-3-like activity whereas activities of caspase-1, -8, and -9 were negligible. Immunoblotting analysis of villus cell rich IEC revealed partial cleavage of procaspase-3 into a 17 kDa molecule as well as cleavage of a caspase-3 substrate, poly(ADP-ribose) polymerase (PARP), whereas in crypt cell rich IEC, caspase-3 cleavage was less significant. Caspase-3 activity was also observed histochemically in villus epithelium on frozen sections of the normal small intestine. IEC prepared at 4°C did not reveal nuclear degradation whereas subsequent incubation in a suspension at 37°C induced intense nuclear degradation within one hour in accordance with increases in active caspase-3. This apoptosis was partially suppressed by the caspase inhibitor Z-VAD-fmk. Nematode infected animals showed villus atrophy together with significant increases in levels of caspase-3 in IEC but not of caspase-1, -8, or -9. Conclusion: Caspase-3 may have an important role in the physiological replacement of IEC as well as in progression of IEC apoptosis induced by nematode infection. PMID:11772970

  2. Rotaviral Enterotoxin Nonstructural Protein 4 Targets Mitochondria for Activation of Apoptosis during Infection*

    PubMed Central

    Bhowmick, Rahul; Halder, Umesh Chandra; Chattopadhyay, Shiladitya; Chanda, Shampa; Nandi, Satabdi; Bagchi, Parikshit; Nayak, Mukti Kant; Chakrabarti, Oishee; Kobayashi, Nobumichi; Chawla-Sarkar, Mamta

    2012-01-01

    Viruses have evolved to encode multifunctional proteins to control the intricate cellular signaling pathways by using very few viral proteins. Rotavirus is known to express six nonstructural and six structural proteins. Among them, NSP4 is the enterotoxin, known to disrupt cellular Ca2+ homeostasis by translocating to endoplasmic reticulum. In this study, we have observed translocation of NSP4 to mitochondria resulting in dissipation of mitochondrial membrane potential during virus infection and NSP4 overexpression. Furthermore, transfection of the N- and C-terminal truncated NSP4 mutants followed by analyzing NSP4 localization by immunofluorescence microscopy identified the 61–83-amino acid region as the shortest mitochondrial targeting signal. NSP4 exerts its proapoptotic effect by interacting with mitochondrial proteins adenine nucleotide translocator and voltage-dependent anion channel, resulting in dissipation of mitochondrial potential, release of cytochrome c from mitochondria, and caspase activation. During early infection, apoptosis activation by NSP4 was inhibited by the activation of cellular survival pathways (PI3K/AKT), because PI3K inhibitor results in early induction of apoptosis. However, in the presence of both PI3K inhibitor and NSP4 siRNA, apoptosis was delayed suggesting that the early apoptotic signal is initiated by NSP4 expression. This proapoptotic function of NSP4 is balanced by another virus-encoded protein, NSP1, which is implicated in PI3K/AKT activation because overexpression of both NSP4 and NSP1 in cells resulted in reduced apoptosis compared with only NSP4-expressing cells. Overall, this study reports on the mechanism by which enterotoxin NSP4 exerts cytotoxicity and the mechanism by which virus counteracts it at the early stage for efficient infection. PMID:22888003

  3. Virion encapsidated HIV-1 Vpr induces NFAT to prime non-activated T cells for productive infection

    PubMed Central

    Höhne, Kristin; Businger, Ramona; van Nuffel, Anouk; Bolduan, Sebastian; Koppensteiner, Herwig; Baeyens, Ann; Vermeire, Jolien; Malatinkova, Eva; Verhasselt, Bruno; Schindler, Michael

    2016-01-01

    The majority of T cells encountered by HIV-1 are non-activated and do not readily allow productive infection. HIV-1 Vpr is highly abundant in progeny virions, and induces signalling and HIV-1 LTR transcription. We hence hypothesized that Vpr might be a determinant of non-activated T-cell infection. Virion-delivered Vpr activated nuclear factor of activated T cells (NFAT) through Ca2+ influx and interference with the NFAT export kinase GSK3β. This leads to NFAT translocation and accumulation within the nucleus and was required for productive infection of unstimulated primary CD4+ T cells. A mutagenesis approach revealed correlation of Vpr-mediated NFAT activation with its ability to enhance LTR transcription and mediate cell cycle arrest. Upon NFAT inhibition, Vpr did not augment resting T-cell infection, and showed reduced G2/M arrest and LTR transactivation. Altogether, Vpr renders unstimulated T cells more permissive for productive HIV-1 infection and stimulates activation of productively infected as well as virus-exposed T cells. Therefore, it could be involved in the establishment and reactivation of HIV-1 from viral reservoirs and might have an impact on the levels of immune activation, which are determinants of HIV-1 pathogenesis. PMID:27383627

  4. Distinct activation of primary human BDCA1(+) dendritic cells upon interaction with stressed or infected β cells.

    PubMed

    Schulte, B M; Kers-Rebel, E D; Bottino, R; Piganelli, J D; Galama, J M D; Engelse, M A; de Koning, E J P; Adema, G J

    2016-06-01

    Derailment of immune responses can lead to autoimmune type 1 diabetes, and this can be accelerated or even induced by local stress caused by inflammation or infection. Dendritic cells (DCs) shape both innate and adaptive immune responses. Here, we report on the responses of naturally occurring human myeloid BDCA1(+) DCs towards differentially stressed pancreatic β cells. Our data show that BDCA1(+) DCs in human pancreas-draining lymph node (pdLN) suspensions and blood-derived BDCA1(+) DCs both effectively engulf β cells, thus mimicking physiological conditions. Upon uptake of enterovirus-infected, but not mock-infected cells, BDCA1(+) DCs induced interferon (IFN)-α/β responses, co-stimulatory molecules and proinflammatory cytokines and chemokines. Notably, induction of stress in β cells by ultraviolet irradiation, culture in serum-free medium or cytokine-induced stress did not provoke strong DC activation, despite efficient phagocytosis. DC activation correlated with the amount of virus used to infect β cells and required RNA within virally infected cells. DCs encountering enterovirus-infected β cells, but not those incubated with mock-infected or stressed β cells, suppressed T helper type 2 (Th2) cytokines and variably induced IFN-γ in allogeneic mixed lymphocyte reaction (MLR). Thus, stressed β cells have little effect on human BDCA1(+) DC activation and function, while enterovirus-infected β cells impact these cells significantly, which could help to explain their role in development of autoimmune diabetes in individuals at risk. PMID:26888163

  5. Comparative analysis of signature genes in PRRSV-infected porcine monocyte-derived dendritic cells at differential activation statuses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Activation statuses of monocytic cells including monocytes, macrophages and dendritic cells (DCs) are critically important for antiviral immunity. In particular, some devastating viruses, including porcine reproductive and respiratory syndrome virus (PRRSV), are capable of directly infecting these c...

  6. [THE IMMUNOMODULATORY ACTIVITY OF PLASMA OF PATIENTS INFECTED WITH HUMAN HIV VIRUS].

    PubMed

    Selimova, L M; Kalnina, L B; Serebrovskaya, L V; Ivanova, L A; Gulyaeva, A N; Nosik, D M

    2015-10-01

    The study was carried out to investigate impact of plasma of patients infected with human HIV virus receiving and not receiving highly active antiviral therapy on: expression of phenotypic markers of lymphocytes (CD3+, CD3+/CD4+, CD3+/CD8+, CD19+, CD3-/CD (16+56)+, CD3+/CD(16+56)+, CD3+/HLA-DR+, CD4+/CD62L+, CD8+/CD38+) in mononuclear cells of blood of donors and secretion of pro-inflammatory (interleukin-1β, interferon-γ, tumor necrosis factor-α, interleukin-4 and interleukin-10) cytokines. After 24 hours of activation of mononuclear cells with plasmas it was demonstrated that as compared with control groups, in of plasmas of patients with highly active antiviral therapy increasing of number of CD4+ T-cells and decreasing of CD8+ T-cells is observed. The plasmas of patients with highly active antiviral therapy activate in most instances CD4+ T-cells whereas plasmas of patients without treatment--CD8+ T-cells. The results of detection of cytokines in blood indicate that in patients without treatment inflammatory potential is increased as compared with group of highly active antiviral therapy. The data concerning accumulation of interleukin-1β under cultivation of mononuclear cells with plasmas indicates at its role in preservation of vitality of natural killers. The analysis of immunomodulatory activity of plasma of patients infected with human HIV virus can be recommended as an additional technique of evaluation of functioning of immune system. PMID:26841673

  7. Identifying the target cell in primary simian immunodeficiency virus (SIV) infection: highly activated memory CD4(+) T cells are rapidly eliminated in early SIV infection in vivo.

    PubMed

    Veazey, R S; Tham, I C; Mansfield, K G; DeMaria, M; Forand, A E; Shvetz, D E; Chalifoux, L V; Sehgal, P K; Lackner, A A

    2000-01-01

    It has recently been shown that rapid and profound CD4(+) T-cell depletion occurs almost exclusively within the intestinal tract of simian immunodeficiency virus (SIV)-infected macaques within days of infection. Here we demonstrate (by three- and four-color flow cytometry) that this depletion is specific to a definable subset of CD4(+) T cells, namely, those having both a highly and/or acutely activated (CD69(+) CD38(+) HLA-DR(+)) and memory (CD45RA(-) Leu8(-)) phenotype. Moreover, we demonstrate that this subset of helper T cells is found primarily within the intestinal lamina propria. Viral tropism for this particular cell type (which has been previously suggested by various studies in vitro) could explain why profound CD4(+) T-cell depletion occurs in the intestine and not in peripheral lymphoid tissues in early SIV infection. Furthermore, we demonstrate that an acute loss of this specific subset of activated memory CD4(+) T cells may also be detected in peripheral blood and lymph nodes in early SIV infection. However, since this particular cell type is present in such small numbers in circulation, its loss does not significantly affect total CD4(+) T cell counts. This finding suggests that SIV and, presumably, human immunodeficiency virus specifically infect, replicate in, and eliminate definable subsets of CD4(+) T cells in vivo. PMID:10590091

  8. Enhanced allergic responsiveness after early childhood infection with respiratory viruses: Are long-lived alternatively activated macrophages the missing link?

    PubMed

    Keegan, Achsah D; Shirey, Kari Ann; Bagdure, Dayanand; Blanco, Jorge; Viscardi, Rose M; Vogel, Stefanie N

    2016-07-01

    Early childhood infection with respiratory viruses, including human rhinovirus, respiratory syncytial virus (RSV) and influenza, is associated with an increased risk of allergic asthma and severe exacerbation of ongoing disease. Despite the long recognition of this relationship, the mechanism linking viral infection and later susceptibility to allergic lung inflammation is still poorly understood. We discuss the literature and provide new evidence demonstrating that these viruses induce the alternative activation of macrophages. Alternatively activated macrophages (AAM) induced by RSV or influenza infection persisted in the lungs of mice up to 90 days after initial viral infection. Several studies suggest that AAM contribute to allergic inflammatory responses, although their mechanism of action is unclear. In this commentary, we propose that virus-induced AAM provide a link between viral infection and enhanced responses to inhaled allergens. PMID:27178560

  9. Modulation of pro- and anti-inflammatory cytokines in active and latent tuberculosis by coexistent Strongyloides stercoralis infection.

    PubMed

    George, Parakkal Jovvian; Pavan Kumar, Nathella; Jaganathan, Jeeva; Dolla, Chandrakumar; Kumaran, Paul; Nair, Dina; Banurekha, Vaithilingam V; Shen, Kui; Nutman, Thomas B; Babu, Subash

    2015-12-01

    Helminth infections are known to induce modulation of both innate and adaptive immune responses in active and latent tuberculosis (TB). However, the role of helminth infections in modulating systemic cytokine responses in active and latent tuberculosis (LTB) is not known. To define the systemic cytokine levels in helminth-TB coinfection, we measured the circulating plasma levels of Type 1, Type 2, Type 17, other pro-inflammatory and regulatory cytokines in individuals with active TB (ATB) with or without coexistent Strongyloides stercoralis (Ss) infection by multiplex ELISA. Similarly, we also measured the same cytokine levels in individuals with LTB with or without concomitant Ss infection in a cross-sectional study. Our data reveal that individuals with ATB or LTB and coexistent Ss infection have significantly lower levels of Type 1 (IFNγ, TNFα and IL-2) and Type 17 (IL-17A and IL-17F) cytokines compared to those without Ss infection. In contrast, those with ATB and LTB with Ss infection have significantly higher levels of the regulatory cytokines (IL-10 and TGFβ), and those with LTB and Ss infection also have significantly higher levels of Type 2 cytokines (IL-4, IL-5 and IL-13) as well. Finally, those with LTB (but not ATB) exhibit significantly lower levels of other pro-inflammatory cytokines (IFNα, IFNβ, IL-6, IL-12 and GM-CSF). Our data therefore reveal a profound effect of Ss infection on the systemic cytokine responses in ATB and LTB and indicate that coincident helminth infections might influence pathogenesis of TB infection and disease. PMID:26542223

  10. Spatial Relationships between Markers for Secretory and Endosomal Machinery in Human Cytomegalovirus-Infected Cells versus Those in Uninfected Cells▿†

    PubMed Central

    Das, Subhendu; Pellett, Philip E.

    2011-01-01

    Human cytomegalovirus (HCMV) induces extensive remodeling of the secretory apparatus to form the cytoplasmic virion assembly compartment (cVAC), where virion tegumentation and envelopment take place. We studied the structure of the cVAC by confocal microscopy to assess the three-dimensional distribution of proteins specifically associated with individual secretory organelles. In infected cells, early endosome antigen 1 (EEA1)-positive vesicles are concentrated at the center of the cVAC and, as previously seen, are distinct from structures visualized by markers for the endoplasmic reticulum, Golgi apparatus, and trans-Golgi network (TGN). EEA1-positive vesicles can be strongly associated with markers for recycling endosomes, to a lesser extent with markers associated with components of the endosomal sorting complex required for transport III (ESCRT III) machinery, and then with markers of late endosomes. In comparisons of uninfected and infected cells, we found significant changes in the structural associations and colocalization of organelle markers, as well as in net organelle volumes. These results provide new evidence that the HCMV-induced remodeling of the membrane transport apparatus involves much more than simple relocation and expansion of preexisting structures and are consistent with the hypothesis that the shift in identity of secretory organelles in HCMV-infected cells results in new functional profiles. PMID:21471245

  11. Involvement of fish signal transducer and activator of transcription 3 (STAT3) in nodavirus infection induced cell death.

    PubMed

    Huang, Youhua; Huang, Xiaohong; Yang, Ying; Wang, Wei; Yu, Yepin; Qin, Qiwei

    2015-03-01

    The Janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway is an important signaling pathway activated by interferons in response to virus infection. Fish STAT3 has been demonstrated to be involved in Singapore grouper iridovirus (SGIV) infection and virus induced paraptosis, but its effects on the replication of other fish viruses still remained uncertain. Here, the roles of grouper STAT3 (Ec-STAT3) in red spotted grouper nervous necrosis virus (RGNNV) infection were investigated. The present data showed that the distribution of phosphorylated Ec-STAT3 was altered in RGNNV infected fish cells, and the promoter activity of STAT3 was significantly increased during virus infection, suggesting that STAT3 activation was involved in RGNNV infection. Using STAT3 specific inhibitor, we found that inhibition of Ec-STAT3 in vitro did not affect the transcription and protein synthesis of RGNNV coat protein (CP), however, the severity of RGNNV induced vacuolation and autophagy was significantly increased. Meanwhile, at the late stage of virus infection, RGNNV induced necrotic cell death was significantly decreased after inhibition of Ec-STAT3. Further studies indicated that Ec-STAT3 inhibition significantly increased the transcript level of autophagy related genes, including UNC-51-like kinase 2 (ULK2) and microtubule-associated protein 1 light chain 3-II (LC3-II) induced by RGNNV infection. Moreover, the expression of several pro-inflammatory factors, including TNFα, IL-1β and IL-8 were mediated by Ec-STAT3 during RGNNV infection. Together, our results not only firstly revealed that STAT3 exerted novel roles in response to fish virus infection, but also provided new insights into understanding the roles of STAT3 in different forms of programmed cell death. PMID:25555814

  12. The ATF6 branch of unfolded protein response and apoptosis are activated to promote African swine fever virus infection

    PubMed Central

    Galindo, I; Hernáez, B; Muñoz-Moreno, R; Cuesta-Geijo, M A; Dalmau-Mena, I; Alonso, C

    2012-01-01

    African swine fever virus (ASFV) infection induces apoptosis in the infected cell; however, the consequences of this activation on virus replication have not been defined. In order to identify the role of apoptosis in ASFV infection, we analyzed caspase induction during the infection and the impact of caspase inhibition on viral production. Caspases 3, 9 and 12 were activated from 16 h post-infection, but not caspase 8. Indeed, caspase 3 activation during the early stages of the infection appeared to be crucial for efficient virus exit. In addition, the inhibition of membrane blebbing reduced the release of virus particles from the cell. ASFV uses the endoplasmic reticulum (ER) as a site of replication and this process can trigger ER stress and the unfolded protein response (UPR) of the host cell. In addition to caspase 12 activation, indicators of ER stress include the upregulation of the chaperones calnexin and calreticulin upon virus infection. Moreover, ASFV induces transcription factor 6 signaling pathway of the UPR, but not the protein kinase-like ER kinase or the inositol-requiring enzyme 1 pathways. Thus, the capacity of ASFV to regulate the UPR may prevent early apoptosis and ensure viral replication. PMID:22764100

  13. Immunotherapy of HIV-infected patients with Gc protein-derived macrophage activating factor (GcMAF).

    PubMed

    Yamamoto, Nobuto; Ushijima, Naofumi; Koga, Yoshihiko

    2009-01-01

    Serum Gc protein (known as vitamin D3-binding protein) is the precursor for the principal macrophage activating factor (MAF). The MAF precursor activity of serum Gc protein of HIV-infected patients was lost or reduced because Gc protein is deglycosylated by alpha-N-acetylgalactosaminidase (Nagalase) secreted from HIV-infected cells. Therefore, macrophages of HIV-infected patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Since Nagalase is the intrinsic component of the envelope protein gp120, serum Nagalase activity is the sum of enzyme activities carried by both HIV virions and envelope proteins. These Nagalase carriers were already complexed with anti-HIV immunoglobulin G (IgG) but retained Nagalase activity that is required for infectivity. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent macrophage activating factor (termed GcMAF), which produces no side effects in humans. Macrophages activated by administration of 100 ng GcMAF develop a large amount of Fc-receptors as well as an enormous variation of receptors that recognize IgG-bound and unbound HIV virions. Since latently HIV-infected cells are unstable and constantly release HIV virions, the activated macrophages rapidly intercept the released HIV virions to prevent reinfection resulting in exhaustion of infected cells. After less than 18 weekly administrations of 100 ng GcMAF for nonanemic patients, they exhibited low serum Nagalase activities equivalent to healthy controls, indicating eradication of HIV-infection, which was also confirmed by no infectious center formation by provirus inducing agent-treated patient PBMCs. No recurrence occurred and their healthy CD + cell counts were maintained for 7 years. PMID:19031451

  14. An altered intestinal mucosal microbiome in HIV-1 infection is associated with mucosal and systemic immune activation and endotoxemia.

    PubMed

    Dillon, S M; Lee, E J; Kotter, C V; Austin, G L; Dong, Z; Hecht, D K; Gianella, S; Siewe, B; Smith, D M; Landay, A L; Robertson, C E; Frank, D N; Wilson, C C

    2014-07-01

    Human immunodeficiency virus-1 (HIV-1) infection disrupts the intestinal immune system, leading to microbial translocation and systemic immune activation. We investigated the impact of HIV-1 infection on the intestinal microbiome and its association with mucosal T-cell and dendritic cell (DC) frequency and activation, as well as with levels of systemic T-cell activation, inflammation, and microbial translocation. Bacterial 16S ribosomal DNA sequencing was performed on colon biopsies and fecal samples from subjects with chronic, untreated HIV-1 infection and uninfected control subjects. Colon biopsies of HIV-1-infected subjects had increased abundances of Proteobacteria and decreased abundances of Firmicutes compared with uninfected donors. Furthermore at the genus level, a significant increase in Prevotella and decrease in Bacteroides was observed in HIV-1-infected subjects, indicating a disruption in the Bacteroidetes bacterial community structure. This HIV-1-associated increase in Prevotella abundance was associated with increased numbers of activated colonic T cells and myeloid DCs. Principal coordinates analysis demonstrated an HIV-1-related change in the microbiome that was associated with increased mucosal cellular immune activation, microbial translocation, and blood T-cell activation. These observations suggest that an important relationship exists between altered mucosal bacterial communities and intestinal inflammation during chronic HIV-1 infection. PMID:24399150

  15. An altered intestinal mucosal microbiome in HIV-1 infection is associated with mucosal and systemic immune activation and endotoxemia

    PubMed Central

    Dillon, SM; Lee, EJ; Kotter, CV; Austin, GL; Dong, Z; Hecht, DK; Gianella, S; Siewe, B; Smith, DM; Landay, AL; Robertson, CE; Frank, DN; Wilson, CC

    2014-01-01

    HIV-1 infection disrupts the intestinal immune system, leading to microbial translocation and systemic immune activation. We investigated the impact of HIV-1 infection on the intestinal microbiome and its association with mucosal T cell and dendritic cell (DC) frequency and activation, as well as with levels of systemic T cell activation, inflammation and microbial translocation. Bacterial 16S ribosomal DNA sequencing was performed on colon biopsies and fecal samples from subjects with chronic, untreated HIV-1 infection and uninfected control subjects. Colon biopsies of HIV-1 infected subjects had increased abundances of Proteobacteria and decreased abundances of Firmicutes compared to uninfected donors. Furthermore at the genus level, a significant increase in Prevotella and decrease in Bacteroides was observed in HIV-1 infected subjects, indicating a disruption in the Bacteroidetes bacterial community structure. This HIV-1-associated increase in Prevotella abundance was associated with increased numbers of activated colonic T cells and myeloid DCs. Principal coordinates analysis demonstrated an HIV-1-related change in the microbiome that was associated with increased mucosal cellular immune activation, microbial translocation and blood T cell activation. These observations suggest that an important relationship exists between altered mucosal bacterial communities and intestinal inflammation during chronic HIV-1 infection. PMID:24399150

  16. Anticestodal activity of Houttuynia cordata leaf extract against Hymenolepis diminuta in experimentally infected rats.

    PubMed

    Yadav, Arun K; Temjenmongla

    2011-10-01

    The leaves of Houttuynia cordata Thunb. (Saururaceae) are considered to have anthelmintic properties in the traditional medicine of Naga tribes in Northeast India and, therefore, are used by the natives to treat the intestinal worm infections. In the present study, the anticestodal activity of H. cordata leaf extract was investigated against Hymenolepis diminuta, a zoonotic cestode, in experimentally infected albino rats. For the assessment of anticestodal efficacy, the eggs per gram (EPG) of faeces counts and worm loads of animals were monitored following treatment with 200, 400 and 800 mg/kg p.o. doses of leaf extract to different groups of rats harbouring larval, immature and mature H. diminuta infections. The efficacy of the extract was found to be dose-dependent (P < 0.05). Further, the extract showed its maximum efficacy against the mature Hymenolepis worms. In this case, the 800 mg/kg dose of extract significantly reduced (P < 0.001) the EPG counts of animals by 57.09% and worm load by 75.00%, at post-treatment. In comparison, the reference drug praziquantel at 5 mg/kg showed a reduction in the EPG counts and worm load of experimental animals by 80.37 and 87.50%, respectively. These findings indicate that leaves of H. cordata possess significant anticestodal property and provide a rationale for their use in traditional medicine as an anthelmintic. PMID:23024502

  17. New paradigms for understanding and step changes in treating active and chronic, persistent apicomplexan infections.

    PubMed

    McPhillie, Martin; Zhou, Ying; El Bissati, Kamal; Dubey, Jitender; Lorenzi, Hernan; Capper, Michael; Lukens, Amanda K; Hickman, Mark; Muench, Stephen; Verma, Shiv Kumar; Weber, Christopher R; Wheeler, Kelsey; Gordon, James; Sanders, Justin; Moulton, Hong; Wang, Kai; Kim, Taek-Kyun; He, Yuqing; Santos, Tatiana; Woods, Stuart; Lee, Patty; Donkin, David; Kim, Eric; Fraczek, Laura; Lykins, Joseph; Esaa, Farida; Alibana-Clouser, Fatima; Dovgin, Sarah; Weiss, Louis; Brasseur, Gael; Wirth, Dyann; Kent, Michael; Hood, Leroy; Meunieur, Brigitte; Roberts, Craig W; Hasnain, S Samar; Antonyuk, Svetlana V; Fishwick, Colin; McLeod, Rima

    2016-01-01

    Toxoplasma gondii, the most common parasitic infection of human brain and eye, persists across lifetimes, can progressively damage sight, and is currently incurable. New, curative medicines are needed urgently. Herein, we develop novel models to facilitate drug development: EGS strain T. gondii forms cysts in vitro that induce oocysts in cats, the gold standard criterion for cysts. These cysts highly express cytochrome b. Using these models, we envisioned, and then created, novel 4-(1H)-quinolone scaffolds that target the cytochrome bc1 complex Qi site, of which, a substituted 5,6,7,8-tetrahydroquinolin-4-one inhibits active infection (IC50, 30 nM) and cysts (IC50, 4 μM) in vitro, and in vivo (25 mg/kg), and drug resistant Plasmodium falciparum (IC50, <30 nM), with clinically relevant synergy. Mutant yeast and co-crystallographic studies demonstrate binding to the bc1 complex Qi site. Our results have direct impact on improving outcomes for those with toxoplasmosis, malaria, and ~2 billion persons chronically infected with encysted bradyzoites. PMID:27412848

  18. New paradigms for understanding and step changes in treating active and chronic, persistent apicomplexan infections

    PubMed Central

    McPhillie, Martin; Zhou, Ying; El Bissati, Kamal; Dubey, Jitender; Lorenzi, Hernan; Capper, Michael; Lukens, Amanda K; Hickman, Mark; Muench, Stephen; Verma, Shiv Kumar; Weber, Christopher R.; Wheeler, Kelsey; Gordon, James; Sanders, Justin; Moulton, Hong; Wang, Kai; Kim, Taek-Kyun; He, Yuqing; Santos, Tatiana; Woods, Stuart; Lee, Patty; Donkin, David; Kim, Eric; Fraczek, Laura; Lykins, Joseph; Esaa, Farida; Alibana-Clouser, Fatima; Dovgin, Sarah; Weiss, Louis; Brasseur, Gael; Wirth, Dyann; Kent, Michael; Hood, Leroy; Meunieur, Brigitte; Roberts, Craig W.; Hasnain, S. Samar; Antonyuk, Svetlana V.; Fishwick, Colin; McLeod, Rima

    2016-01-01

    Toxoplasma gondii, the most common parasitic infection of human brain and eye, persists across lifetimes, can progressively damage sight, and is currently incurable. New, curative medicines are needed urgently. Herein, we develop novel models to facilitate drug development: EGS strain T. gondii forms cysts in vitro that induce oocysts in cats, the gold standard criterion for cysts. These cysts highly express cytochrome b. Using these models, we envisioned, and then created, novel 4-(1H)-quinolone scaffolds that target the cytochrome bc1 complex Qi site, of which, a substituted 5,6,7,8-tetrahydroquinolin-4-one inhibits active infection (IC50, 30 nM) and cysts (IC50, 4 μM) in vitro, and in vivo (25 mg/kg), and drug resistant Plasmodium falciparum (IC50, <30 nM), with clinically relevant synergy. Mutant yeast and co-crystallographic studies demonstrate binding to the bc1 complex Qi site. Our results have direct impact on improving outcomes for those with toxoplasmosis, malaria, and ~2 billion persons chronically infected with encysted bradyzoites. PMID:27412848

  19. Activation of TRPML1 clears intraneuronal Aβ in preclinical models of HIV infection.

    PubMed

    Bae, Mihyun; Patel, Neha; Xu, Haoxing; Lee, Mingwaoh; Tominaga-Yamanaka, Kumiko; Nath, Avindra; Geiger, Jonathan; Gorospe, Myriam; Mattson, Mark P; Haughey, Norman J

    2014-08-20

    Antiretroviral therapy extends the lifespan of human immunodeficiency virus (HIV)-infected patients, but many survivors develop premature impairments in cognition. These residual cognitive impairments may involve aberrant deposition of amyloid β-peptides (Aβ). By unknown mechanisms, Aβ accumulates in the lysosomal and autophagic compartments of neurons in the HIV-infected brain. Here we identify the molecular events evoked by the HIV coat protein gp120 that facilitate the intraneuronal accumulation of Aβ. We created a triple transgenic gp120/APP/PS1 mouse that recapitulates intraneuronal deposition of Aβ in a manner reminiscent of the HIV-infected brain. In cultured neurons, we found that the HIV coat protein gp120 increased the transcriptional expression of BACE1 through repression of PPARγ, and increased APP expression by promoting interaction of the translation-activating RBP heterogeneous nuclear ribonucleoprotein C with APP mRNA. APP and BACE1 were colocalized into stabilized membrane microdomains, where the β-cleavage of APP and Aβ formation were enhanced. Aβ-peptides became localized to lysosomes that were engorged with sphingomyelin and calcium. Stimulating calcium efflux from lysosomes with a TRPM1 agonist promoted calcium efflux, luminal acidification, and cleared both sphingomyelin and Aβ from lysosomes. These findings suggest that therapeutics targeted to reduce lysosomal pH in neurodegenerative conditions may protect neurons by facilitating the clearance of accumulated sphingolipids and Aβ-peptides. PMID:25143627

  20. Activation of TRPML1 Clears Intraneuronal Aβ in Preclinical Models of HIV Infection

    PubMed Central

    Bae, Mihyun; Patel, Neha; Xu, Haoxing; Lee, Mingwaoh; Tominaga-Yamanaka, Kumiko; Nath, Avindra; Geiger, Jonathan; Gorospe, Myriam; Mattson, Mark P.

    2014-01-01

    Antiretroviral therapy extends the lifespan of human immunodeficiency virus (HIV)-infected patients, but many survivors develop premature impairments in cognition. These residual cognitive impairments may involve aberrant deposition of amyloid β-peptides (Aβ). By unknown mechanisms, Aβ accumulates in the lysosomal and autophagic compartments of neurons in the HIV-infected brain. Here we identify the molecular events evoked by the HIV coat protein gp120 that facilitate the intraneuronal accumulation of Aβ. We created a triple transgenic gp120/APP/PS1 mouse that recapitulates intraneuronal deposition of Aβ in a manner reminiscent of the HIV-infected brain. In cultured neurons, we found that the HIV coat protein gp120 increased the transcriptional expression of BACE1 through repression of PPARγ, and increased APP expression by promoting interaction of the translation-activating RBP heterogeneous nuclear ribonucleoprotein C with APP mRNA. APP and BACE1 were colocalized into stabilized membrane microdomains, where the β-cleavage of APP and Aβ formation were enhanced. Aβ-peptides became localized to lysosomes that were engorged with sphingomyelin and calcium. Stimulating calcium efflux from lysosomes with a TRPM1 agonist promoted calcium efflux, luminal acidification, and cleared both sphingomyelin and Aβ from lysosomes. These findings suggest that therapeutics targeted to reduce lysosomal pH in neurodegenerative conditions may protect neurons by facilitating the clearance of accumulated sphingolipids and Aβ-peptides. PMID:25143627

  1. Gene Expression and Antiviral Activity of Interleukin-35 in Response to Influenza A Virus Infection.

    PubMed

    Wang, Li; Zhu, Shengli; Xu, Gang; Feng, Jian; Han, Tao; Zhao, Fanpeng; She, Ying-Long; Liu, Shi; Ye, Linbai; Zhu, Ying

    2016-08-01

    Interleukin-35 (IL-35) is a newly described member of the IL-12 family. It has been reported to inhibit inflammation and autoimmune inflammatory disease and can increase apoptotic sensitivity. Little is known about the role of IL-35 during viral infection. Herein, high levels of IL-35 were found in peripheral blood mononuclear cells and throat swabs from patients with seasonal influenza A virus (IAV) relative to healthy individuals. IAV infection of human lung epithelial and primary cells increased levels of IL-35 mRNA and protein. Further studies demonstrated that IAV-induced IL-35 transcription is regulated by NF-κB. IL-35 expression was significantly suppressed by selective inhibitors of cyclooxygenase-2 (COX-2) and inducible nitric-oxide synthase, indicating their involvement in IL-35 expression. Interestingly, IL-35 production may have suppressed IAV RNA replication and viral protein synthesis via induction of type I and III interferons (IFN), leading to activation of downstream IFN effectors, including double-stranded RNA-dependent protein kinase, 2',5'-oligoadenylate synthetase, and myxovirus resistance protein. IL-35 exhibited extensive antiviral activity against the hepatitis B virus, enterovirus 71, and vesicular stomatitis virus. Our results demonstrate that IL-35 is a novel IAV-inducible cytokine, and its production elicits antiviral activity. PMID:27307042

  2. HIV integration site distributions in resting and activated CD4+ T cells infected in culture

    PubMed Central

    Brady, Troy; Agosto, Luis M.; Malani, Nirav; Berry, Charles C.; O'Doherty, Una; Bushman, Frederic

    2010-01-01

    Objective The goal of this study was to investigate whether the location of HIV integration differs in resting versus activated T cells, a feature that could contribute to the formation of latent viral reservoirs via effects on integration targeting. Design Primary resting or activated CD4+ T cells were infected with purified X4-tropic HIV in the presence and absence of nucleoside triphosphates and genomic locations of integrated provirus determined. Methods We sequenced and analyzed a total of 2661 HIV integration sites using linker-mediated PCR and 454 sequencing. Integration site data sets were then compared to each other and to computationally generated random distributions. Results HIV integration was favored in active transcription units in both cell types, but integration sites from activated cells were found more often in genomic regions that were dense in genes, dense in CpG islands, and enriched in G/C bases. Integration sites from activated cells were also more strongly correlated with histone methylation patterns associated with active genes. Conclusion These data indicate that integration site distributions show modest but significant differences between resting and activated CD4+ T cells, and that integration in resting cells occurs more often in regions that may be suboptimal for proviral gene expression. PMID:19550285

  3. Activator of G-Protein Signaling 3-Induced Lysosomal Biogenesis Limits Macrophage Intracellular Bacterial Infection.

    PubMed

    Vural, Ali; Al-Khodor, Souhaila; Cheung, Gordon Y C; Shi, Chong-Shan; Srinivasan, Lalitha; McQuiston, Travis J; Hwang, Il-Young; Yeh, Anthony J; Blumer, Joe B; Briken, Volker; Williamson, Peter R; Otto, Michael; Fraser, Iain D C; Kehrl, John H

    2016-01-15

    Many intracellular pathogens cause disease by subverting macrophage innate immune defense mechanisms. Intracellular pathogens actively avoid delivery to or directly target lysosomes, the major intracellular degradative organelle. In this article, we demonstrate that activator of G-protein signaling 3 (AGS3), an LPS-inducible protein in macrophages, affects both lysosomal biogenesis and activity. AGS3 binds the Gi family of G proteins via its G-protein regulatory (GoLoco) motif, stabilizing the Gα subunit in its GDP-bound conformation. Elevated AGS3 levels in macrophages limited the activity of the mammalian target of rapamycin pathway, a sensor of cellular nutritional status. This triggered the nuclear translocation of transcription factor EB, a known activator of lysosomal gene transcription. In contrast, AGS3-deficient macrophages had increased mammalian target of rapamycin activity, reduced transcription factor EB activity, and a lower lysosomal mass. High levels of AGS3 in macrophages enhanced their resistance to infection by Burkholderia cenocepacia J2315, Mycobacterium tuberculosis, and methicillin-resistant Staphylococcus aureus, whereas AGS3-deficient macrophages were more susceptible. We conclude that LPS priming increases AGS3 levels, which enhances lysosomal function and increases the capacity of macrophages to eliminate intracellular pathogens. PMID:26667172

  4. In Vitro Protein-Synthesizing Activity of Vesicular Stomatitis Virus-Infected Cell Extracts

    PubMed Central

    Grubman, Marvin J.; Summers, Donald F.

    1973-01-01

    Crude cytoplasmic extracts from vesicular stomatitis virus (VSV)-infected HeLa cells incorporate radioactive amino acids into hot trichloroacetic acid-precipitable material linearly for 10 to 20 min. The material synthesized in vitro corresponds in molecular weight to four of the five VSV structural proteins. However, synthesis of the viral glycoprotein (G) is significantly reduced, whereas the relative amounts of viral structural proteins L and NS synthesized are increased compared with the ratio of the proteins found in the virion. Fractionation of a VSV-infected crude cytoplasmic extract into a cytoplasmic pellet (20,000 × g for 30 min) and a cytoplasmic supernatant results in a significant reduction in protein synthesizing activity of both fractions, although both contain polysomes. The products synthesized by a cytoplasmic supernatant-directed system included all the VSV structural proteins except the glycoprotein, whereas in an in vitro system directed by the cytoplasmic pellet there is a marked reduction in synthesis of the nucleoprotein (N) and also a small relative increase in synthesis of the glycoprotein. Addition of uninfected, preincubated HeLa or L-cell S10 or a HeLa ribosomal fraction to the VSV-infected cytoplasmic pellet results in a 30- to 60-fold stimulation of 35S-methionine incorporation. However, these uninfected extracts do not stimulate 35S-methionine incorporation by the infected crude cytoplasmic extract or the cytoplasmic supernatant. The products synthesized by the stimulated cytoplasmic pellet now include sizeable amounts of the glycoprotein in addition to the other VSV structural proteins. PMID:4355931

  5. Human cytomegalovirus renders cells non-permissive for replication of herpes simplex viruses

    SciTech Connect

    Cockley, K.D.

    1988-01-01

    The herpes simplex virus (HSV) genome during production infection in vitro may be subject to negative regulation which results in modification of the cascade of expression of herpes virus macromolecular synthesis leading to establishment of HSV latency. In the present study, human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of HSV type-1 (HSV-1). A delay in HSV replication of 15 hr as well as a consistent, almost 1000-fold inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 hr after superinfection were observed compared with controls infected with HSV alone. HSV type-2 (HSV-2) replication was similarly inhibited in HCMV-infected HEL cells. Prior ultraviolet-irradiation (UV) of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HCMV deoxyribonucleic acid (DNA) negative temperature-sensitive (ts) mutants inhibited HSV replications as efficiently as wild-type (wt) HCMV at the non-permissive temperature. Evidence for penetration and replication of superinfecting HSV into HCMV-infected cells was provided by blot hybridization of HSV DNA synthesized in HSV-superinfected cell cultures and by cesium chloride density gradient analysis of ({sup 3}H)-labeled HSV-1-superinfected cells.

  6. Activation of Innate Immune-Response Genes in Little Brown Bats (Myotis lucifugus) Infected with the Fungus Pseudogymnoascus destructans

    PubMed Central

    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M.; Bollinger, Trent K.; Willis, Craig K. R.; Voyles, Jamie; Misra, Vikram

    2014-01-01

    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes. PMID:25391018

  7. Activation of innate immune-response genes in little brown bats (Myotis lucifugus) infected with the fungus Pseudogymnoascus destructans.

    PubMed

    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M; Bollinger, Trent K; Willis, Craig K R; Voyles, Jamie; Misra, Vikram

    2014-01-01

    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes. PMID:25391018

  8. Neisseria gonorrhoeae enhances HIV-1 infection of primary resting CD4+ T cells through TLR2 activation.

    PubMed

    Ding, Jian; Rapista, Aprille; Teleshova, Natalia; Mosoyan, Goar; Jarvis, Gary A; Klotman, Mary E; Chang, Theresa L

    2010-03-15

    Sexually transmitted infections increase the likelihood of HIV-1 transmission. We investigated the effect of Neisseria gonorrheae (gonococcus [GC]) exposure on HIV replication in primary resting CD4(+) T cells, a major HIV target cell during the early stage of sexual transmission of HIV. GC and TLR2 agonists, such as peptidylglycan (PGN), Pam(3)CSK(4), and Pam(3)C-Lip, a GC-derived synthetic lipopeptide, but not TLR4 agonists including LPS or GC lipooligosaccharide enhanced HIV-1 infection of primary resting CD4(+) T cells after viral entry. Pretreatment of CD4(+) cells with PGN also promoted HIV infection. Anti-TLR2 Abs abolished the HIV enhancing effect of GC and Pam(3)C-Lip, indicating that GC-mediated enhancement of HIV infection of resting CD4(+) T cells was through TLR2. IL-2 was required for TLR2-mediated HIV enhancement. PGN and GC induced cell surface expression of T cell activation markers and HIV coreceptors, CCR5 and CXCR4. The maximal postentry HIV enhancing effect was achieved when PGN was added immediately after viral exposure. Kinetic studies and analysis of HIV DNA products indicated that GC exposure and TLR2 activation enhanced HIV infection at the step of nuclear import. We conclude that GC enhanced HIV infection of primary resting CD4(+) T cells through TLR2 activation, which both increased the susceptibility of primary CD4(+) T cells to HIV infection as well as enhanced HIV-infected CD4(+) T cells at the early stage of HIV life cycle after entry. This study provides a molecular mechanism by which nonulcerative sexually transmitted infections mediate enhancement of HIV infection and has implication for HIV prevention and therapeutics. PMID:20147631

  9. Active and Secretory IgA-Coated Bacterial Fractions Elucidate Dysbiosis in Clostridium difficile Infection

    PubMed Central

    Moya, Andrés; Vázquez-Castellanos, Jorge F.; Artacho, Alejandro; Chen, Xinhua; Kelly, Ciaran

    2016-01-01

    ABSTRACT The onset of Clostridium difficile infection (CDI) has been associated with treatment with wide-spectrum antibiotics. Antibiotic treatment alters the activity of gut commensals and may result in modified patterns of immune responses to pathogens. To study these mechanisms during CDI, we separated bacteria with high cellular RNA content (the active bacteria) and their inactive counterparts by fluorescence-activated cell sorting (FACS) of the fecal bacterial suspension. The gut dysbiosis due to the antibiotic treatment may result in modification of immune recognition of intestinal bacteria. The immune recognition patterns were assessed by FACS of bacterial fractions either coated or not with intestinal secretory immunoglobulin A (SIgA). We described the taxonomic distributions of these four bacterial fractions (active versus inactive and SIgA coated versus non-SIgA coated) by massive 16S rRNA gene amplicon sequencing and quantified the proportion of C. difficile toxin genes in the samples. The overall gut microbiome composition was more robustly influenced by antibiotics than by the C. difficile toxins. Bayesian networks revealed that the C. difficile cluster was preferentially SIgA coated during CDI. In contrast, in the CDI-negative group Fusobacterium was the characteristic genus of the SIgA-opsonized fraction. Lactobacillales and Clostridium cluster IV were mostly inactive in CDI-positive patients. In conclusion, although the proportion of C. difficile in the gut is very low, it is able to initiate infection during the gut dysbiosis caused by environmental stress (antibiotic treatment) as a consequence of decreased activity of the protective bacteria. IMPORTANCE C. difficile is a major enteric pathogen with worldwide distribution. Its expansion is associated with broad-spectrum antibiotics which disturb the normal gut microbiome. In this study, the DNA sequencing of highly active bacteria and bacteria opsonized by intestinal secretory immunoglobulin

  10. Active and Secretory IgA-Coated Bacterial Fractions Elucidate Dysbiosis in Clostridium difficile Infection.

    PubMed

    Džunková, Mária; Moya, Andrés; Vázquez-Castellanos, Jorge F; Artacho, Alejandro; Chen, Xinhua; Kelly, Ciaran; D'Auria, Giuseppe

    2016-01-01

    The onset of Clostridium difficile infection (CDI) has been associated with treatment with wide-spectrum antibiotics. Antibiotic treatment alters the activity of gut commensals and may result in modified patterns of immune responses to pathogens. To study these mechanisms during CDI, we separated bacteria with high cellular RNA content (the active bacteria) and their inactive counterparts by fluorescence-activated cell sorting (FACS) of the fecal bacterial suspension. The gut dysbiosis due to the antibiotic treatment may result in modification of immune recognition of intestinal bacteria. The immune recognition patterns were assessed by FACS of bacterial fractions either coated or not with intestinal secretory immunoglobulin A (SIgA). We described the taxonomic distributions of these four bacterial fractions (active versus inactive and SIgA coated versus non-SIgA coated) by massive 16S rRNA gene amplicon sequencing and quantified the proportion of C. difficile toxin genes in the samples. The overall gut microbiome composition was more robustly influenced by antibiotics than by the C. difficile toxins. Bayesian networks revealed that the C. difficile cluster was preferentially SIgA coated during CDI. In contrast, in the CDI-negative group Fusobacterium was the characteristic genus of the SIgA-opsonized fraction. Lactobacillales and Clostridium cluster IV were mostly inactive in CDI-positive patients. In conclusion, although the proportion of C. difficile in the gut is very low, it is able to initiate infection during the gut dysbiosis caused by environmental stress (antibiotic treatment) as a consequence of decreased activity of the protective bacteria. IMPORTANCE C. difficile is a major enteric pathogen with worldwide distribution. Its expansion is associated with broad-spectrum antibiotics which disturb the normal gut microbiome. In this study, the DNA sequencing of highly active bacteria and bacteria opsonized by intestinal secretory immunoglobulin A (SIg

  11. Relation between iron metabolism and antioxidants enzymes and δ-ALA-D activity in rats experimentally infected by Fasciola hepatica.

    PubMed

    Bottari, Nathieli B; Mendes, Ricardo E; Baldissera, Matheus D; Bochi, Guilherme V; Moresco, Rafael N; Leal, Marta L R; Morsch, Vera M; Schetinger, Maria R C; Christ, Ricardo; Gheller, Larissa; Marques, Éder J; Da Silva, Aleksandro S

    2016-06-01

    The aim of this study was to evaluate the iron metabolism in serum, as well as antioxidant enzymes, in addition to the Delta-Aminolevulinic Acid Dehydratase (δ-ALA-D) activity in the liver of rats experimentally infected by Fasciola hepatica. Thirty male adult rats (Wistar) specific pathogen free were divided into four groups: two uninfected group (CTRL 1 and CTRL 2) with five animals each and two infected groups (INF 1 and INF 2) with 10 animals each. Infection was performed orally with 20 metacercariae at day 1. On day 15 (CTRL 1 and INF 1 groups) and 87 PI (CTRL 2 and INF 2 groups) blood and bone marrow were collected and the animals were subsequently euthanized for liver sampling. Blood was allocated in tubes without anticoagulant for serum acquisition to measure iron, transferrin and unsaturated iron binding capacity (UIBC). δ-ALA-D, superoxide dismutase (SOD), and catalase (CAT) activities were measured in the liver. A decrease in iron, transferrin and UIBC levels was observed in all infected animals compared to control groups (P < 0.05). Furthermore, iron accumulation was observed in bone marrow of infected mice. Infected animals showed an increase in δ-ALA-D activity at 87 post-infection (PI) (INF 2) as well as in SOD activity at days 15 (INF 1) and 87 PI (INF 2). On the other hand, CAT activity was reduced in rats infected by F. hepatica during acute and chronic phase of fasciolosis (INF 1 and INF 2 groups), when moderate (acute) and severe necrosis in the liver histopathology were observed. These results may suggest that oxidative damage to tissues along with antioxidant mechanisms might have taken part in fasciolosis pathogenesis and are also involved in iron deficiency associated to changes in δ-ALA-D activity during chronic phase of disease. PMID:26995536

  12. NK Cell Activation in Human Hantavirus Infection Explained by Virus-Induced IL-15/IL15Rα Expression

    PubMed Central

    Braun, Monika; Björkström, Niklas K.; Gupta, Shawon; Sundström, Karin; Ahlm, Clas; Klingström, Jonas; Ljunggren, Hans-Gustaf

    2014-01-01

    Clinical infection with hantaviruses cause two severe acute diseases, hemorrhagic fever with renal syndrome (HFRS) and hantavirus pulmonary syndrome (HPS). These diseases are characterized by strong immune activation, increased vascular permeability, and up to 50% case-fatality rates. One prominent feature observed in clinical hantavirus infection is rapid expansion of natural killer (NK) cells in peripheral blood of affected individuals. We here describe an unusually high state of activation of such expanding NK cells in the acute phase of clinical Puumala hantavirus infection. Expanding NK cells expressed markedly increased levels of activating NK cell receptors and cytotoxic effector molecules. In search for possible mechanisms behind this NK cell activation, we observed virus-induced IL-15 and IL-15Rα on infected endothelial and epithelial cells. Hantavirus-infected cells were shown to strongly activate NK cells in a cell-cell contact-dependent way, and this response was blocked with anti-IL-15 antibodies. Surprisingly, the strength of the IL-15-dependent NK cell response was such that it led to killing of uninfected endothelial cells despite expression of normal levels of HLA class I. In contrast, hantavirus-infected cells were resistant to NK cell lysis, due to a combination of virus-induced increase in HLA class I expression levels and hantavirus-mediated inhibition of apoptosis induction. In summary, we here describe a possible mechanism explaining the massive NK cell activation and proliferation observed in HFRS patients caused by Puumala hantavirus infection. The results add further insights into mechanisms behind the immunopathogenesis of hantavirus infections in humans and identify new possible targets for intervention. PMID:25412359

  13. Multiple phosphorylation sites at the C-terminus regulate nuclear import of HCMV DNA polymerase processivity factor ppUL44

    SciTech Connect

    Alvisi, Gualtiero; Marin, Oriano; Pari, Gregory; Mancini, Manuela; Avanzi, Simone; Loregian, Arianna; Jans, David A.; Ripalti, Alessandro

    2011-09-01

    The processivity factor of human cytomegalovirus DNA polymerase, phosphoprotein ppUL44, is essential for viral replication. During viral infection ppUL44 is phosphorylated by the viral kinase pUL97, but neither the target residues on ppUL44 nor the effect of phosphorylation on ppUL44's activity are known. We report here that ppUL44 is phosphorylated when transiently expressed in mammalian cells and coimmunoprecipitates with cellular kinases. Of three potential phosphorylation sites (S413, S415, S418) located upstream of ppUL44's nuclear localization signal (NLS) and one (T427) within the NLS itself, protein kinase CK2 (CK2) specifically phosphorylates S413, to trigger a cascade of phosphorylation of S418 and S415 by CK1 and CK2, respectively. Negative charge at the CK2/CK1 target serine residues facilitates optimal nuclear accumulation of ppUL44, whereas negative charge on T427, a potential cyclin-dependent 1 phosphorylation site, strongly decreases nuclear accumulation. Thus, nuclear transport of ppUL44 is finely tuned during viral infection through complex phosphorylation events.

  14. Distinct MHC class I–dependent NK cell–activating receptors control cytomegalovirus infection in different mouse strains

    PubMed Central

    Pyzik, Michał; Charbonneau, Benoit; Gendron-Pontbriand, Eve-Marie; Babić, Marina; Krmpotić, Astrid; Jonjić, Stipan

    2011-01-01

    Recognition of mouse cytomegalovirus (MCMV)–infected cells by activating NK cell receptors was first described in the context of Ly49H, which confers resistance to C57BL/6 mice. We investigated the ability of other activating Ly49 receptors to recognize MCMV-infected cells in mice from various H-2 backgrounds. We observed that Ly49P1 from NOD/Ltj mice, Ly49L from BALB mice, and Ly49D2 from PWK/Pas mice respond to MCMV-infected cells in the context of H-2Dk and the viral protein m04/gp34. Recognition was also seen in the H-2d and/or H-2f contexts, depending on the Ly49 receptor examined, but never in H-2b. Furthermore, BALB.K (H-2k) mice showed reduced viral loads compared with their H-2d or H-2b congenic partners, a reduction which was dependent on interferon γ secretion by Ly49L+ NK cells early after infection. Adoptive transfer of Ly49L+, but not Ly49L−, NK cells significantly increased resistance against MCMV infection in neonate BALB.K mice. These results suggest that multiple activating Ly49 receptors participate in H-2–dependent recognition of MCMV infection, providing a common mechanism of NK cell–mediated resistance against viral infection. PMID:21518798

  15. In Vivo Antimalarial Activity of Annona muricata Leaf Extract in Mice Infected with Plasmodium berghei

    PubMed Central

    Somsak, Voravuth; Polwiang, Natsuda; Chachiyo, Sukanya

    2016-01-01

    Malaria is one of the most important infectious diseases in the world. The choice for the treatment is highly limited due to drug resistance. Hence, finding the new compounds to treat malaria is urgently needed. The present study was attempted to evaluate the antimalarial activity of the Annona muricata aqueous leaf extract in Plasmodium berghei infected mice. Aqueous leaf extract of A. muricata was prepared and tested for acute toxicity in mice. For efficacy test in vivo, standard 4-day suppressive test was carried out. ICR mice were inoculated with 107 parasitized erythrocytes of P. berghei ANKA by intraperitoneal injection. The extracts (100, 500, and 1000 mg/kg) were then given orally by gavage once a day for 4 consecutive days. Parasitemia, percentage of inhibition, and packed cell volume were subsequently calculated. Chloroquine (10 mg/kg) was given to infected mice as positive control while untreated control was given only distilled water. It was found that A. muricata aqueous leaf extract at doses of 100, 500, and 1000 mg/kg resulted in dose dependent parasitemia inhibition of 38.03%, 75.25%, and 85.61%, respectively. Survival time was prolonged in infected mice treated with the extract. Moreover, no mortality to mice was observed with this extract up to a dose of 4000 mg/kg. In conclusion, the A. muricata aqueous leaf extract exerted significant antimalarial activity with no toxicity and prolonged survival time. Therefore, this extract might contain potential lead molecule for the development of a new drug for malaria treatment. PMID:27092277

  16. Protocatechuic Acid, a Novel Active Substance against Avian Influenza Virus H9N2 Infection

    PubMed Central

    Ou, Changbo; Shi, Ningning; Yang, Qunhui; Zhang, Yu; Wu, Zongxue; Wang, Baozhong; Compans, Richard W.; He, Cheng

    2014-01-01

    Influenza virus H9N2 subtype has triggered co-infection with other infectious agents, resulting in huge economical losses in the poultry industry. Our current study aims to evaluate the antiviral activity of protocatechuic acid (PCA) against a virulent H9N2 strain in a mouse model. 120 BALB/c mice were divided into one control group, one untreated group, one 50 mg/kg amantadine hydrochloride-treated group and three PCA groups treated 12 hours post-inoculation with 40, 20 or 10 mg/kg PCA for 7 days. All the infected animals were inoculated intranasally with 0.2 ml of a A/Chicken/Hebei/4/2008(H9N2) inoculum. A significant body weight loss was found in the 20 mg/kg and 40 mg/kg PCA-treated and amantadine groups as compared to the control group. The 14 day survivals were 94.4%, 100% and 95% in the PCA-treated groups and 94.4% in the amantadine hydrochloride group, compared to less than 60% in the untreated group. Virus loads were less in the PCA-treated groups compared to the amantadine-treated or the untreated groups. Neutrophil cells in BALF were significantly decreased while IFN-γ, IL-2, TNF-α and IL-6 decreased significantly at days 7 in the PCA-treated groups compared to the untreated group. Furthermore, a significantly decreased CD4+/CD8+ ratio and an increased proportion of CD19 cells were observed in the PCA-treated groups and amantadine-treated group compared to the untreated group. Mice administered with PCA exhibited a higher survival rate and greater viral clearance associated with an inhibition of inflammatory cytokines and activation of CD8+ T cell subsets. PCA is a promising novel agent against bird flu infection in the poultry industry. PMID:25337912

  17. In Vivo Antimalarial Activity of Annona muricata Leaf Extract in Mice Infected with Plasmodium berghei.

    PubMed

    Somsak, Voravuth; Polwiang, Natsuda; Chachiyo, Sukanya

    2016-01-01

    Malaria is one of the most important infectious diseases in the world. The choice for the treatment is highly limited due to drug resistance. Hence, finding the new compounds to treat malaria is urgently needed. The present study was attempted to evaluate the antimalarial activity of the Annona muricata aqueous leaf extract in Plasmodium berghei infected mice. Aqueous leaf extract of A. muricata was prepared and tested for acute toxicity in mice. For efficacy test in vivo, standard 4-day suppressive test was carried out. ICR mice were inoculated with 10(7) parasitized erythrocytes of P. berghei ANKA by intraperitoneal injection. The extracts (100, 500, and 1000 mg/kg) were then given orally by gavage once a day for 4 consecutive days. Parasitemia, percentage of inhibition, and packed cell volume were subsequently calculated. Chloroquine (10 mg/kg) was given to infected mice as positive control while untreated control was given only distilled water. It was found that A. muricata aqueous leaf extract at doses of 100, 500, and 1000 mg/kg resulted in dose dependent parasitemia inhibition of 38.03%, 75.25%, and 85.61%, respectively. Survival time was prolonged in infected mice treated with the extract. Moreover, no mortality to mice was observed with this extract up to a dose of 4000 mg/kg. In conclusion, the A. muricata aqueous leaf extract exerted significant antimalarial activity with no toxicity and prolonged survival time. Therefore, this extract might contain potential lead molecule for the development of a new drug for malaria treatment. PMID:27092277

  18. Antigen-dependent and –independent contributions to primary memory CD8 T cell activation and protection following infection

    PubMed Central

    Martin, Matthew D.; Badovinac, Vladimir P.

    2015-01-01

    Memory CD8 T-cell activation, including expression of IFN-γ and granzymeB, can be induced by antigen (Ag)-dependent signals through the T-cell-receptor, or by pathogen-derived inflammatory cytokines in an Ag-independent manner. Recent studies have come to conflicting results regarding the contributions of Ag and/or inflammation to memory CD8 T-cell activation. Additionally, research has indicated that inflammation-driven CD8 T-cell responses during un-related infections (bystander activation) have the potential to provide protection, but whether protection occurs in immuno-competent hosts is unclear. To investigate these questions, we examined activation of virus-specific memory CD8 T-cells following infection with L. monocytogenes either expressing or not cognate Ag. We show that Ag and inflammation act synergistically in vitro to induce memory activation. In vivo, we found that when memory CD8 T-cells significantly contribute to clearance of infection, early activation and continued responses by these cells are enhanced by cognate Ag recognition. Mechanistically, we show that bystander responses by memory are dependent upon the dose of infection and the amount of inflammation elicited following infection and are able to provide protection in IFN-γ deficient mice, but not in immuno-competent hosts. The data elucidate the requirements for memory CD8 T-cell activation and the protective role of bystander responses. PMID:26658291

  19. Three Distinct Regions of the Murine Gammaherpesvirus 68 Genome Are Transcriptionally Active in Latently Infected Mice

    PubMed Central

    Virgin, Herbert W.; Presti, Rachel M.; Li, Xi-Yang; Liu, Carl; Speck, Samuel H.

    1999-01-01

    The program(s) of gene expression operating during murine gammaherpesvirus 68 (γHV68) latency is undefined, as is the relationship between γHV68 latency and latency of primate gammaherpesviruses. We used a nested reverse transcriptase PCR strategy (sensitive to approximately one copy of γHV68 genome for each genomic region tested) to screen for the presence of viral transcripts in latently infected mice. Based on the positions of known latency-associated genes in other gammaherpesviruses, we screened for the presence of transcripts corresponding to 11 open reading frames (ORFs) in the γHV68 genome in RNA from spleens and peritoneal cells of latently infected B-cell-deficient (MuMT) mice which have been shown contain high levels of reactivable latent γHV68 (K. E. Weck, M. L. Barkon, L. I. Yoo, S. H. Speck, and H. W. Virgin, J. Virol. 70:6775–6780, 1996). To control for the possible presence of viral lytic activity, we determined that RNA from latently infected peritoneal and spleen cells contained few or no detectable transcripts corresponding to seven ORFs known to encode viral gene products associated with lytic replication. However, we did detect low-level expression of transcripts arising from the region of gene 50 (encoding the putative homolog of the Epstein-Barr virus BRLF1 transactivator) in peritoneal but not spleen cells. Latently infected peritoneal cells consistently scored for expression of RNA derived from 4 of the 11 candidate latency-associated ORFs examined, including the regions of ORF M2, ORF M11 (encoding v-bcl-2), gene 73 (a homolog of the Kaposi’s sarcoma-associated herpesvirus [human herpesvirus 8] gene encoding latency-associated nuclear antigen), and gene 74 (encoding a G-protein coupled receptor homolog, v-GCR). Latently infected spleen cells consistently scored positive for RNA derived from 3 of the 11 candidate latency-associated ORFs examined, including ORF M2, ORF M3, and ORF M9. To further characterize transcription of these

  20. HIV-infected patients' adherence to highly active antiretroviral therapy: a phenomenological study.

    PubMed

    Mohammadpour, Ali; Yekta, Zohre Parsa; Nikbakht Nasrabadi, Ali R

    2010-12-01

    Adherence to the treatment regimen is essential to the success of highly active antiretroviral therapy for patients who are infected with HIV. The evidence suggests that poor adherence to antiretroviral drug therapy is a major problem that has the potential to diminish effective viral suppression, promote viral resistance, and place patients at risk for hospitalization, opportunistic infections, and an increased risk of HIV transmission. The primary aim of this study was to understand patients' experiences regarding their adherence to antiretroviral drug therapy. Thus, 19 participants were recruited for in-depth interviews regarding their adherence to drug regimens. All the interviews were transcribed verbatim and analyzed by using Benner's phenomenological analysis approach. Four main themes emerged from the data: (i) choosing to live and the decision to start taking medications; (ii) strategies for adhering to the regimen and managing the side-effects; (iii) relationships with healthcare providers; and (iv) advantages of the medications as a motivator to continue one's adherence to the regimen. Studying and understanding the experiences of patients can provide new insights and strategies in order to enhance patients' adherence to highly active antiretroviral therapy. PMID:21210925

  1. Isolation of Enzymatically Active Replication Complexes from Feline Calicivirus-Infected Cells

    PubMed Central

    Green, Kim Y.; Mory, Aaron; Fogg, Mark H.; Weisberg, Andrea; Belliot, Gaël; Wagner, Mariam; Mitra, Tanaji; Ehrenfeld, Ellie; Cameron, Craig E.; Sosnovtsev, Stanislav V.

    2002-01-01

    A membranous fraction that could synthesize viral RNA in vitro in the presence of magnesium salt, ribonucleotides, and an ATP-regenerating system was isolated from feline calicivirus (FCV)-infected cells. The enzymatically active component of this fraction was designated FCV replication complexes (RCs), by analogy to other positive-strand RNA viruses. The newly synthesized RNA was characterized by Northern blot analysis, which demonstrated the production of both full-length (8.0-kb) and subgenomic-length (2.5-kb) RNA molecules similar to those synthesized in FCV-infected cells. The identity of the viral proteins associated with the fraction was investigated. The 60-kDa VP1 major capsid protein was the most abundant viral protein detected. VP2, a minor structural protein encoded by open reading frame 3 (ORF3), was also present. Nonstructural proteins associated with the fraction included the precursor polypeptides Pro-Pol (76 kDa) and p30-VPg (43 kDa), as well as the mature nonstructural proteins p32 (derived from the N-terminal region of the ORF1 polyprotein), p30 (the putative “3A-like” protein), and p39 (the putative nucleoside triphosphatase). The isolation of enzymatically active RCs containing both viral and cellular proteins should facilitate efforts to dissect the contributions of the virus and the host to FCV RNA replication. PMID:12163578

  2. Latent cytomegalovirus infection exacerbates experimental pulmonary fibrosis by activating TGF-β1.

    PubMed

    Li, Yonghuai; Gao, Jian; Wang, Guoliang; Fei, Guanghe

    2016-08-01

    The aim of the present study was to investigate the hypotheses that cytomegalovirus (CMV) may trigger idiopathic pulmonary fibrosis (IPF) in a susceptible host and/or that the presence of CMV may alter IPF in response to a well-defined trigger of pulmonary fibrosis. A mouse model of murine CMV (MCMV) infection was established, and the mice were divided into a control group, bleomycin group and an MCMV+bleomycin group. Changes in the weights of the mice were determined in the three groups. Pulmonary fibrosis was detected using a histopathological method. The activity of transforming growth factor (TGF)‑β1 was measured, and the levels of E‑cadherin, Vimentin and phosphorylated (phospho)‑small mothers against decapentaplegic (SMAD)2 were determined using western blot analysis. MCMV was found to invade the lungs, however, it did not cause pulmonary fibrosis. The progression of fibrosis in the mice treated with MCMV+bleomycin was more rapid, compared with that in the control mice. The protein levels of Vimentin and phospho-SMAD2 were upregulated, whereas the level of E‑cadherin was downregulated in the MCMV+bleomycin group,. The results suggested that latent MCMV infection aggravated pulmonary fibrosis in the mouse model, possibly through the activation of TGF-β1. PMID:27279470

  3. Stress responses in flavivirus-infected cells: activation of unfolded protein response and autophagy

    PubMed Central

    Blázquez, Ana-Belén; Escribano-Romero, Estela; Merino-Ramos, Teresa; Saiz, Juan-Carlos; Martín-Acebes, Miguel A.

    2014-01-01

    The Flavivirus is a genus of RNA viruses that includes multiple long known human, animal, and zoonotic pathogens such as Dengue virus, yellow fever virus, West Nile virus, or Japanese encephalitis virus, as well as other less known viruses that represent potential threats for human and animal health such as Usutu or Zika viruses. Flavivirus replication is based on endoplasmic reticulum-derived structures. Membrane remodeling and accumulation of viral factors induce endoplasmic reticulum stress that results in activation of a cellular signaling response termed unfolded protein response (UPR), which can be modulated by the viruses for their own benefit. Concomitant with the activation of the UPR, an upregulation of the autophagic pathway in cells infected with different flaviviruses has also been described. This review addresses the current knowledge of the relationship between endoplasmic reticulum stress, UPR, and autophagy in flavivirus-infected cells and the growing evidences for an involvement of these cellular pathways in the replication and pathogenesis of these viruses. PMID:24917859

  4. Upregulation in response to infection and antibacterial activity of oyster histone H4.

    PubMed

    Dorrington, Tarquin; Villamil, Luisa; Gómez-chiarri, Marta

    2011-01-01

    Several histones and histone-derived peptides have been shown to have antimicrobial activity and a potential role in innate immune defenses. A histone H4 sequence was identified in a subtractive suppression library containing genes upregulated in American cupped oysters, Crassostrea virginica, in response to challenge with the protozoan parasite Perkinsus marinus. Oyster histone H4 protein levels significantly increased in hemocyte lysates and cell free hemolymph of oysters experimentally challenged with P. marinus. The complete histone H4 coding sequence of C. virginica was cloned into a Saccharomyces cerevisiae yeast expression system and recombinant expression was confirmed using SDS-PAGE analysis and western blot. Delivery of yeast cells expressing recombinant oyster histone H4 into the gut of brine shrimp, Artemia salinas, challenged with a streptomycin resistant strain of Vibrio anguillarum resulted in a significant and dose-dependent decrease in the load of V. anguillarum. Purified recombinant histone H4 showed antimicrobial activity against V. anguillarum and Escherichia coli at micromolar concentrations, but did not affect the viability of P. marinus in culture. These results support the role of histone H4 in the defense of oysters against bacterial infection and validate the use of a novel oyster antimicrobial H4 in a yeast feed-based delivery system for the treatment of bacterial infections in aquaculture applications. PMID:20883794

  5. Autophagy Protein Rubicon Mediates Phagocytic NADPH Oxidase Activation in Response to Microbial Infection or TLR Stimulation

    PubMed Central

    Yang, Chul-Su; Lee, Jong-Soo; Rodgers, Mary; Min, Chan-Ki; Lee, June-Yong; Kim, Hee Jin; Lee, Kwang-Hoon; Kim, Chul-Joong; Oh, Byungha; Zandi, Ebrahim; Yue, Zhenyu; Kramnik, Igor; Liang, Chengyu; Jung, Jae U.

    2013-01-01

    Summary Phagocytosis and autophagy are two important and related arms of the host's first-line defense against microbial invasion. Rubicon is a RUN domain containing cysteine-rich protein that functions as part of a Beclin-1-Vps34-containing autophagy complex. We report that Rubicon is also an essential, positive regulator of the NADPH oxidase complex. Upon microbial infection or Toll-like-receptor 2 (TLR2) activation, Rubicon interacts with the p22phox subunit of the NADPH oxidase complex, facilitating its phagosomal trafficking to induce a burst of reactive oxygen species (ROS) and inflammatory cytokines. Consequently, ectopic expression or depletion of Rubicon profoundly affected ROS, inflammatory cytokine production, and subsequent antimicrobial activity. Rubicon's actions in autophagy and in the NADPH oxidase complex are functionally and genetically separable, indicating that Rubicon functions in two ancient innate immune machineries, autophagy and phagocytosis, depending on the environmental stimulus. Rubicon may thus be pivotal to generating an optimal intracellular immune response against microbial infection. PMID:22423966

  6. Dual Mode Antibacterial Activity of Ion Substituted Calcium Phosphate Nanocarriers for Bone Infections

    PubMed Central

    Sampath Kumar, T. S.; Madhumathi, K.; Rubaiya, Y.; Doble, Mukesh

    2015-01-01

    Nanotechnology has tremendous potential for the management of infectious diseases caused by multi-drug resistant bacteria, through the development of newer antibacterial materials and efficient modes of antibiotic delivery. Calcium phosphate (CaP) bioceramics are commonly used as bone substitutes due to their similarity to bone mineral and are widely researched upon for the treatment of bone infections associated with bone loss. CaPs can be used as local antibiotic delivery agents for bone infections and can be substituted with antibacterial ions in their crystal structure to have a wide spectrum, sustained antibacterial activity even against drug resistant bacteria. In the present work, a dual mode antibiotic delivery system with antibacterial ion substituted calcium deficient hydroxyapatite (CDHA) nanoparticles has been developed. Antibacterial ions such as zinc, silver, and strontium have been incorporated into CDHA at concentrations of 6, 0.25–0.75, and 2.5–7.5 at. %, respectively. The samples were found to be phase pure, acicular nanoparticles of length 40–50 nm and width 5–6 nm approximately. The loading and release profile of doxycycline, a commonly used antibiotic, was studied from the nanocarriers. The drug release was studied for 5 days and the release profile was influenced by the ion concentrations. The release of antibacterial ions was studied over a period of 21 days. The ion substituted CDHA samples were tested for antibacterial efficacy on Staphylococcus aureus and Escherichia coli by MIC/MBC studies and time-kill assay. AgCDHA and ZnCDHA showed high antibacterial activity against both bacteria, while SrCDHA was weakly active against S. aureus. Present study shows that the antibiotic release can provide the initial high antibacterial activity, and the sustained ion release can provide a long-term antibacterial activity. Such dual mode antibiotic and antibacterial ion release offers an efficient and potent way to treat an incumbent

  7. Bovine viral diarrhea virus 2 infection activates the unfolded protein response in MDBK cells, leading to apoptosis.

    PubMed

    Maeda, Kouji; Fujihara, Masatoshi; Harasawa, Ryô

    2009-06-01

    Bovine viral diarrhea virus 2 (BVDV-2) strains are divided into cytopathic and non-cytopathic biotypes based on the ablity to induce cytopathic effects in cultured cells. The mechanism of cytopathogenicity of BVDV-2 is not well understood. We examined cytopathogenesis in MDBK cells resulting from BVDV-2 infections by microscopic examinations and microarray analysis. We found that BVDV-2 activates endoplasmic reticulum (ER) stress signaling pathways that contribute to apoptosis of infected cells. We also monitored the expression of ER stress marker gene by RT-PCR during BVDV-2 infection and demonstrated that infection of MDBK cells with a cytopathic strain of BVDV-2 induces glucose-regulated protein 78 expression. Infection with BVDV-2 also induces DNA-damage-inducible transcript 3 expression and downregulates the lectin-galactoside-binding soluble 1 level. These results show that cytopathic strains of BVDV-2 induce an ER stress response resulting in apoptosis. PMID:19578292

  8. Measuring hospital-wide activity volume for patient safety and infection control: a multi-centre study in Japan

    PubMed Central

    Hayashida, Kenshi; Imanaka, Yuichi; Fukuda, Haruhisa

    2007-01-01

    Background In Japan, as in many other countries, several quality and safety assurance measures have been implemented since the 1990's. This has occurred in spite of cost containment efforts. Although government and hospital decision-makers demand comprehensive analysis of these activities at the hospital-wide level, there have been few studies that actually quantify them. Therefore, the aims of this study were to measure hospital-wide activities for patient safety and infection control through a systematic framework, and to identify the incremental volume of these activities implemented over the last five years. Methods Using the conceptual framework of incremental activity corresponding to incremental cost, we defined the scope of patient safety and infection control activities. We then drafted a questionnaire to analyze these realms. After implementing the questionnaire, we conducted several in-person interviews with managers and other staff in charge of patient safety and infection control in seven acute care teaching hospitals in Japan. Results At most hospitals, nurses and clerical employees acted as the main figures in patient safety practices. The annual amount of activity ranged from 14,557 to 72,996 person-hours (per 100 beds: 6,240; per 100 staff: 3,323) across participant hospitals. Pharmacists performed more incremental activities than their proportional share. With respect to infection control activities, the annual volume ranged from 3,015 to 12,196 person-hours (per 100 beds: 1,141; per 100 staff: 613). For infection control, medical doctors and nurses tended to perform somewhat more of the duties relative to their share. Conclusion We developed a systematic framework to quantify hospital-wide activities for patient safety and infection control. We also assessed the incremental volume of these activities in Japanese hospitals under the reimbursement containment policy. Government and hospital decision makers can benefit from this type of analytic

  9. Immune activation driven by CTLA-4 blockade augments viral replication at mucosal sites in simian immunodeficiency virus infection.

    PubMed

    Cecchinato, Valentina; Tryniszewska, Elzbieta; Ma, Zhong Min; Vaccari, Monica; Boasso, Adriano; Tsai, Wen-Po; Petrovas, Constantinos; Fuchs, Dietmar; Heraud, Jean-Michel; Venzon, David; Shearer, Gene M; Koup, Richard A; Lowy, Israel; Miller, Christopher J; Franchini, Genoveffa

    2008-04-15

    The importance of chronic immune activation in progression to AIDS has been inferred by correlative studies in HIV-infected individuals and in nonhuman primate models of SIV infection. Using the SIV(mac251) macaque model, we directly address the impact of immune activation by inhibiting CTLA-4, an immunoregulatory molecule expressed on activated T cells and a subset of regulatory T cells. We found that CTLA-4 blockade significantly increased T cell activation and viral replicat