Science.gov

Sample records for active hcmv infection

  1. The Downregulation of GFI1 by the EZH2-NDY1/KDM2B-JARID2 Axis and by Human Cytomegalovirus (HCMV) Associated Factors Allows the Activation of the HCMV Major IE Promoter and the Transition to Productive Infection

    PubMed Central

    Sourvinos, George; Morou, Antigoni; Sanidas, Ioannis; Codruta, Ignea; Ezell, Scott A.; Doxaki, Christina; Kampranis, Sotirios C.; Kottakis, Filippos; Tsichlis, Philip N.

    2014-01-01

    Earlier studies had suggested that epigenetic mechanisms play an important role in the control of human cytomegalovirus (HCMV) infection. Here we show that productive HCMV infection is indeed under the control of histone H3K27 trimethylation. The histone H3K27 methyltransferase EZH2, and its regulators JARID2 and NDY1/KDM2B repress GFI1, a transcriptional repressor of the major immediate-early promoter (MIEP) of HCMV. Knocking down EZH2, NDY1/KDM2B or JARID2 relieves the repression and results in the upregulation of GFI1. During infection, the incoming HCMV rapidly downregulates the GFI1 mRNA and protein in both wild-type cells and in cells in which EZH2, NDY1/KDM2B or JARID2 were knocked down. However, since the pre-infection levels of GFI1 in the latter cells are significantly higher, the virus fails to downregulate it to levels permissive for MIEP activation and viral infection. Following the EZH2-NDY1/KDM2B-JARID2-independent downregulation of GFI1 in the early stages of infection, the virus also initiates an EZH2-NDY1/ΚDM2Β-JARID2-dependent program that represses GFI1 throughout the infection cycle. The EZH2 knockdown also delays histone H3K27 trimethylation in the immediate early region of HCMV, which is accompanied by a drop in H3K4 trimethylation that may contribute to the shEZH2-mediated repression of the major immediate early HCMV promoter. These data show that HCMV uses multiple mechanisms to allow the activation of the HCMV MIEP and to prevent cellular mechanisms from blocking the HCMV replication program. PMID:24830456

  2. The downregulation of GFI1 by the EZH2-NDY1/KDM2B-JARID2 axis and by human cytomegalovirus (HCMV) associated factors allows the activation of the HCMV major IE promoter and the transition to productive infection.

    PubMed

    Sourvinos, George; Morou, Antigoni; Sanidas, Ioannis; Codruta, Ignea; Ezell, Scott A; Doxaki, Christina; Kampranis, Sotirios C; Kottakis, Filippos; Tsichlis, Philip N

    2014-05-01

    Earlier studies had suggested that epigenetic mechanisms play an important role in the control of human cytomegalovirus (HCMV) infection. Here we show that productive HCMV infection is indeed under the control of histone H3K27 trimethylation. The histone H3K27 methyltransferase EZH2, and its regulators JARID2 and NDY1/KDM2B repress GFI1, a transcriptional repressor of the major immediate-early promoter (MIEP) of HCMV. Knocking down EZH2, NDY1/KDM2B or JARID2 relieves the repression and results in the upregulation of GFI1. During infection, the incoming HCMV rapidly downregulates the GFI1 mRNA and protein in both wild-type cells and in cells in which EZH2, NDY1/KDM2B or JARID2 were knocked down. However, since the pre-infection levels of GFI1 in the latter cells are significantly higher, the virus fails to downregulate it to levels permissive for MIEP activation and viral infection. Following the EZH2-NDY1/KDM2B-JARID2-independent downregulation of GFI1 in the early stages of infection, the virus also initiates an EZH2-NDY1/ΚDM2Β-JARID2-dependent program that represses GFI1 throughout the infection cycle. The EZH2 knockdown also delays histone H3K27 trimethylation in the immediate early region of HCMV, which is accompanied by a drop in H3K4 trimethylation that may contribute to the shEZH2-mediated repression of the major immediate early HCMV promoter. These data show that HCMV uses multiple mechanisms to allow the activation of the HCMV MIEP and to prevent cellular mechanisms from blocking the HCMV replication program.

  3. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.

    PubMed Central

    Koedood, M; Fichtel, A; Meier, P; Mitchell, P J

    1995-01-01

    Congenital human cytomegalovirus (HCMV) infection is a common cause of deafness and neurological disabilities. Many aspects of this prenatal infection, including which cell types are infected and how infection proceeds, are poorly understood. Transcription of HCMV immediate-early (IE) genes is required for expression of all other HCMV genes and is dependent on host cell transcription factors. Cell type-specific differences in levels of IE transcription are believed to underlie differences in infection permissivity. However, DNA transfection experiments have paradoxically suggested that the HCMV major IE enhancer/promoter is a broadly active transcriptional element with little cell type specificity. In contrast, we show here that expression of a lacZ gene driven by the HCMV major IE enhancer/promoter -524 to +13 segment is restricted in transgenic mouse embryos to sites that correlate with known sites of congenital HCMV infection in human fetuses. This finding suggests that the IE enhancer/promoter is a major determinant of HCMV infection sites in humans and that transcription factors responsible for its regulation are cell type-specifically conserved between humans and mice. The lacZ expression patterns of these transgenic embryos yield insight into congenital HCMV pathogenesis by providing a spatiotemporal map of the sets of vascular, neural, and epithelial cells that are likely targets of infection. These transgenic mice may constitute a useful model system for investigating IE enhancer/promoter regulation in vivo and for identifying factors that modulate active and latent HCMV infections in humans. PMID:7884867

  4. Multivariate data validation for investigating primary HCMV infection in pregnancy.

    PubMed

    Barberini, Luigi; Noto, Antonio; Saba, Luca; Palmas, Francesco; Fanos, Vassilios; Dessì, Angelica; Zavattoni, Maurizio; Fattuoni, Claudia; Mussap, Michele

    2016-12-01

    We reported data concerning the Gas Chromatography-Mass Spectrometry (GC-MS) based metabolomic analysis of amniotic fluid (AF) samples obtained from pregnant women infected with Human Cytomegalovirus (HCMV). These data support the publication "Primary HCMV Infection in Pregnancy from Classic Data towards Metabolomics: an Exploratory analysis" (C. Fattuoni, F. Palmas, A. Noto, L. Barberini, M. Mussap, et al., 2016) [2]. GC-MS and Multivariate analysis allow to recognize the molecular phenotype of HCMV infected fetuses (transmitters) and that of HCMV non-infected fetuses (non-transmitters); moreover, GC-MS and multivariate analysis allow to distinguish and to compare the molecular phenotype of these two groups with a control group consisting of AF samples obtained in HCMV non-infected pregnant women. The obtained data discriminate controls from transmitters as well as from non-transmitters; no statistically significant difference was found between transmitters and non-transmitters. PMID:27656676

  5. Human cytomegalovirus latency-associated protein LUNA is expressed during HCMV infections in vivo.

    PubMed

    Bego, Mariana G; Keyes, Lisa R; Maciejewski, Jarek; St Jeor, Stephen C

    2011-10-01

    Human cytomegalovirus (HCMV) latency is poorly understood. We previously described a novel HCMV latency-associated transcript, UL81-82ast, coding for a protein designated LUNA (latency unique natural antigen). The aim of this study was to confirm the presence of LUNA in HCMV-seropositive donors. Standard co-immunoprecipitation and ELISA assays were used to detect antibodies against the LUNA protein in the sera of HCMV-seropositive donors. Specific antibodies against LUNA were detected in all HCMV-seropositive donors but in none of the seronegative donors. These data confirm that LUNA is expressed during in vivo infections and is capable of eliciting an immune response.

  6. HCMV infection of humanized mice after transplantation of G-CSF-mobilized peripheral blood stem cells from HCMV-seropositive donors.

    PubMed

    Hakki, Morgan; Goldman, Devorah C; Streblow, Daniel N; Hamlin, Kimberly L; Krekylwich, Craig N; Fleming, William H; Nelson, Jay A

    2014-01-01

    Human cytomegalovirus (HCMV) infection, including primary infection resulting from transmission from a seropositive donor to a seronegative recipient (D(+)/R(-)), remains a significant problem in the setting of peripheral blood stem cell transplantation (PBSCT). The lack of a suitable animal model for studying HCMV transmission after PBSCT is a major barrier to understanding this process and, consequently, developing novel interventions to prevent HCMV infection. Our previous work demonstrated that human CD34(+) progenitor cell-engrafted NOD-scid IL2Rγc(null) (NSG) mice support latent HCMV infection after direct inoculation and reactivation after treatment with granulocyte colony-stimulating factor. To more accurately recapitulate HCMV infection in the D(+)/R(-) PBSCT setting, granulocyte colony-stimulating factor-mobilized peripheral blood stem cells from seropositive donors were used to engraft NSG mice. All recipient mice demonstrated evidence of HCMV infection in liver, spleen, and bone marrow. These findings validate the NSG mouse model for studying HCMV transmission during PBSCT.

  7. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients.

    PubMed

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John; Van Loock, Marnix

    2015-01-01

    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R- group. PMID:25312585

  8. HCMV protein LUNA is required for viral reactivation from latently infected primary CD14⁺ cells.

    PubMed

    Keyes, Lisa R; Hargett, Danna; Soland, Melisa; Bego, Mariana G; Rossetto, Cyprian C; Almeida-Porada, Graca; St Jeor, Stephen

    2012-01-01

    Human cytomegalovirus (HCMV) is a member of the Herpesviridae family that infects individuals throughout the world. Following an initial lytic stage, HCMV can persist in the individual for life in a non-active (or latent) form. During latency, the virus resides within cells of the myeloid lineage. The mechanisms controlling HCMV latency are not completely understood. A latency associated transcript, UL81-82ast, encoding the protein LUNA (Latency Unique Natural Antigen) was identified from latently infected donors in vivo. To address the role of the UL81-82ast protein product LUNA, in the context of the viral genome, we developed a recombinant HCMV bacterial artificial chromosome (BAC) that does not express LUNA. This construct, LUNA knockout FIX virus (FIX-ΔLUNA), was used to evaluate LUNA's role in HCMV latency. The FIX-ΔLUNA virus was able to lytically infect Human Fibroblast (HF) cells, showing that LUNA is not required to establish a lytic infection. Interestingly, we observed significantly higher viral copy numbers in HF cells infected with FIX-ΔLUNA when compared to FIX-WT virus. Furthermore, FIX-WT and FIX-ΔLUNA genomic DNA and transcription of UL81-82ast persisted over time in primary monocytes. In contrast, the levels of UL138 transcript expression in FIX-ΔLUNA infected HF and CD14⁺ cells was 100 and 1000 fold lower (respectively) when compared to the levels observed for FIX-WT infection. Moreover, FIX-ΔLUNA virus failed to reactivate from infected CD14⁺ cells following differentiation. This lack of viral reactivation was accompanied by a lack of lytic gene expression, increase in viral copy numbers, and lack of the production of infectious units following differentiation of the cells. Our study suggests that the LUNA protein is involved in regulating HCMV reactivation, and that in the absence of LUNA, HCMV may not be able to enter a proper latent state and therefore cannot be rescued from the established persistent infection in CD14⁺ cells.

  9. Congenital HCMV infection: a collaborative and comparative study of virus detection in amniotic fluid by culture and by PCR.

    PubMed

    Gouarin, S; Palmer, P; Cointe, D; Rogez, S; Vabret, A; Rozenberg, F; Denis, F; Freymuth, F; Lebon, P; Grangeot-Keros, L

    2001-04-01

    Cytomegalovirus (HCMV) infection is the leading cause of congenital virus infection in developed countries, affecting an estimated 1% of births. This antenatal infection can cause serious sequelae. Strategies for prevention and treatment must, therefore, be agreed upon, entailing a preliminary performance assessment of antenatal virus diagnosis techniques. Between 1992 and 1999, HCMV serology status was established for 19456 pregnant women in four French hospitals. Seronegative patients (55.4%) were given serology screening, and antenatal diagnosis was given to 152 women who had shown seroconversion during their pregnancies (1.4%). The detection of HCMV transmission from mother to fetus was finally established in 95 cases, using polymerase chain reaction (PCR) and viral culture methods for detecting HCMV in the amniotic fluid. These results were compared with viral culture of children's urine after birth, enabling us to distinguish between children really infected in utero (30%) and non-infected children (70%). The results of the virus culture and those of PCR were identical in 94 of the 95 cases, with one discrepancy (culture-/PCR+). The two diagnosis techniques had identical sensitivity (72%), with culture proving slightly more specific than PCR (98.4% as opposed to 96.9%). Positive prediction values for culture and for PCR were, respectively, 95.6 and 91.3%. Antenatal virus diagnosis on amniotic fluid was negative with both techniques in 8 out of 29 cases of children born with HCMV infection (VPN=89%). Over half of these wrongly negative results can be explained by amniocentesis carried out too early in the pregnancy or too early with respect to the mother's primary infection.

  10. Single Chain Antibodies Against gp55 of Human Cytomegalovirus (HCMV) for Prophylaxis and Treatment of HCMV Infections

    PubMed Central

    Moazen, Bahareh; Ebrahimi, Elahe; Nejatollahi, Foroogh

    2016-01-01

    Background: Immunotherapy is a promising prospective new treatment for cytomegalovirus (CMV) infections. Neutralizing effects have been reported using monoclonal antibodies. Recombinant single chain antibodies (scFvs) due to their advantages over monoclonal antibodies are potential alternatives and provide valuable clinical agents. Objectives: The aim of this study was to select specific single chain antibodies against gp55 of CMV and to evaluate their neutralizing effects. In the present study, we selected specific single chain antibodies against glycoprotein 55 (gp55) of CMV for their use in treatment and diagnosis. Materials and Methods: Single chain antibodies specific against an epitope located in the C-terminal part of gp55 were selected from a phage antibody display library. After four rounds of panning, twenty clones were amplified by the polymerase chain reaction (PCR) and fingerprinted by MvaI restriction enzyme. The reactivities of the specific clones were tested by the enzyme-linked immunosorbent assay (ELISA) and the neutralizing effects were evaluated by the plaque reduction assay. Results: Fingerprinting of selected clones revealed three specific single chain antibodies (scFv1, scFv2 and scFv3) with frequencies 25%, 20 and 20%. The clones produced positive ELISA with the corresponding peptide. The percentages of plaque reduction for scFv1, scFv2 and scFv3 were 23.7, 68.8 and 11.6, respectively. Conclusions: Gp55 of human CMV is considered as an important candidate for immunotherapy. In this study, we selected three specific clones against gp55. The scFvs reacted only with the corresponding peptide in a positive ELISA. The scFv2 with 68.8% neutralizing effect showed the potential to be considered for prophylaxis and treatment of CMV infections, especially in solid organ transplant recipients, for whom treatment of CMV is urgently needed. The scFv2 with neutralizing effect of 68.8%, has the potential to be considered for treatment of these patients

  11. First Dominique Dormont international conference on "Host-pathogen interactions in chronic infections – viral and host determinants of HCV, HCMV, and HIV infections"

    PubMed Central

    Menu, Elisabeth; Müller-Trutwin, Mickaela C; Pancino, Gianfranco; Saez-Cirion, Asier; Bain, Christine; Inchauspé, Geneviève; Gras, Gabriel S; Mabondzo, Aloïse M; Samri, Assia; Boutboul, Françoise; Grand, Roger Le

    2005-01-01

    The first Dominique Dormont International Conference on "Viral and host determinantsof HCV, HCMV, and HIV infections "was held in Paris, Val-de-Grâce, on December 3–4, 2004. The following is a summary of the scientific sessions of this meeting (). PMID:15813969

  12. HCMV pUS28 initiates pro-migratory signaling via activation of Pyk2 kinase

    SciTech Connect

    Vomaske, Jennifer; Varnum, Susan M.; Melnychuk, Ryan; Smith, Patricia; Pasa-Tolic, Ljiljana; Shutthanandan, Janani I.; Streblow, Daniel N.

    2010-12-10

    The HCMV-encoded chemokine receptor US28 mediates smooth muscle cell (SMC) and macrophage motility and this activity has been implicated in the acceleration of vascular disease. US28 induced SMC migration involves the activation of the protein tyrosine kinases (PTKs) Src and Focal adhesion kinase as well as the small GTPase RhoA. In the current study, we examined the involvement of the PTK Pyk2 in US28-induced cellular motility. Expression of a Pyk2 lacking the autophosphorylation site (Tyr-402) blocks US28-mediated SMC migration in response to RANTES, while the kinase-inactive mutant failed to elicit the same negative effect on migration. US28 stimulation with RANTES results in ligand-dependent and calcium-dependent phosphorylation of Pyk2 Tyr-402 and induced the formation of an active Pyk2 kinase complex containing several novel Pyk2 binding proteins. Interestingly, expression of the autophosphorylation site mutant Pyk2 F402Y did not abrogate the formation of an active Pyk2 kinase complex, but instead prevented US28-mediated activation of RhoA. These findings represent the first demonstration that US28 signals through Pyk2 and that this PTK participates in US28-mediated cellular motility via activation of RhoA. Additionally, US28 activated RhoA via Pyk2 in the U373 glioblastoma cells. Interestingly, the Pyk2 kinase complex in U373 contained several proteins known to participate in glioma tumorigenesis. These results provide a potential mechanistic link between HCMV-US28 and glioblastoma cell activation and motility.

  13. Titration of human cytomegalovirus (HCMV) DNA in urine by combined use of PCR and microplate hybridization in a renal transplant patient with HCMV pneumonitis.

    PubMed

    Meigata, K; Hondo, R; Fujima, A; Shinkai-Shibata, M; Itoh, S; Kikuchi, K; Ando, Y; Ichikawa, N; Nomura, Y; Watanabe, K; Degawa, H; Beck, Y; Tomikawa, S; Nagao, T; Uchida, H

    1996-06-01

    We titrated human cytomegalovirus (HCMV) DNA in urine specimens obtained from 14 healthy individuals and a renal transplant patient with HCMV pneumonitis by modifying the method for titration of varicella-zoster virus DNA previously described (1,2). Of 14 HCMV seropositive healthy individuals, 13 had HCMV DNA under the detection limit of 10(2.0) copies/ml, whereas one person had 10(2.0) copies/ml. The viral DNA in urine samples was at a low level in healthy individuals with latent infection. In a case with HCMV pneumonitis after renal transplantation, the amount of HCMV DNA in urine gradually increased from the level under 10(2.0) copies/ml and reached a peak of 10(4.7) copies/ml one month prior to the manifestation of pneumonitis. It, thereafter, decreased with the course of clinical remission, and finally settled at under 10(2.0) copies/ml. Serial titrations of HCMV DNA in urine specimens proved to be useful in identifying recipients at risk of developing active HCMV infection after renal transplantation and as a guide for treatment of patients.

  14. Microgravity Analogues of Herpes Virus Pathogenicity: Human Cytomegalovirus (hCMV) and Varicella Zoster (VZV) Infectivity in Human Tissue Like Assemblies (TLAs)

    NASA Technical Reports Server (NTRS)

    Goodwin, T. J.; McCarthy, M.; Albrecht, T.; Cohrs, R.

    2009-01-01

    The old adage we are our own worst enemies may perhaps be the most profound statement ever made when applied to man s desire for extraterrestrial exploration and habitation of Space. Consider the immune system protects the integrity of the entire human physiology and is comprised of two basic elements the adaptive or circulating and the innate immune system. Failure of the components of the adaptive system leads to venerability of the innate system from opportunistic microbes; viral, bacteria, and fungal, which surround us, are transported on our skin, and commonly inhabit the human physiology as normal and imunosuppressed parasites. The fine balance which is maintained for the preponderance of our normal lives, save immune disorders and disease, is deregulated in microgravity. Thus analogue systems to study these potential Risks are essential for our progress in conquering Space exploration and habitation. In this study we employed two known physiological target tissues in which the reactivation of hCMV and VZV occurs, human neural and lung systems created for the study and interaction of these herpes viruses independently and simultaneously on the innate immune system. Normal human neural and lung tissue analogues called tissue like assemblies (TLAs) were infected with low MOIs of approximately 2 x 10(exp -5) pfu hCMV or VZV and established active but prolonged low grade infections which spanned .7-1.5 months in length. These infections were characterized by the ability to continuously produce each of the viruses without expiration of the host cultures. Verification and quantification of viral replication was confirmed via RT_PCR, IHC, and confocal spectral analyses of the respective essential viral genomes. All host TLAs maintained the ability to actively proliferate throughout the entire duration of the experiments as is analogous to normal in vivo physiological conditions. These data represent a significant advance in the ability to study the triggering

  15. Design of translactam HCMV protease inhibitors as potent antivirals.

    PubMed

    Borthwick, Alan D

    2005-07-01

    Human cytomegalovirus (HCMV) is an important pathogen for which there is a significant unmet medical need. New HCMV antivirals, active against novel molecular targets, are undoubtedly needed as the currently available drugs ganciclovir, cidofovir, and foscarnet, which are all viral DNA inhibitors, suffer from limited effectiveness, mainly due to the development of drug resistance, poor bioavailability, and toxicity. One of the newer molecular targets that has been exploited in the search for better drug candidates is HCMV protease. Our deltaAla HCMV protease (wild type variant with the internal cleavage site deleted) was cloned and expressed in E. coli. This viral enzyme was used to develop HCMV protease assays to evaluate potential inhibitors. The chirally pure (SRS)-alpha-methyl pyrrolidine-5,5-trans-lactam template was synthesized, which together with the natural substrate requirements of HCMV protease and detailed SAR, was used to design potent and selective mechanism based inhibitors of HCMV protease. The mechanism of action of these inhibitors of HCMV protease was investigated by ESI/MS, and the X-ray crystal structure of the HCMV protease was used to refine our selective viral enzyme inhibitors to obtain plasma stable antivirals. A novel ELISA antiviral assay was developed which, together with a cytotoxicity assay, enabled us to discover anti-HCMV drug candidates equivalent in potency to ganciclovir that had good pharmacokinetics in the dog and good brain and ocular penetration in the guinea pig.

  16. Characterization of membrane antigens on human cytomegalovirus-infected fibroblasts recognized by human antibodies

    SciTech Connect

    van der Voort, L.H.M.; de Leij, L.F.M.H.; The T.H.

    1989-03-01

    The antigens on the surface of human cytomegalovirus (HCMV)-infected fibroblasts which are recognized by human HCMV antibody-positive sera were characterized. Three HCMV-induced polypeptides, with apparent molecular masses of 53 to 63, 94, and 94 to 120 kilodaltons, were precipitated from /sup 125/I-surface-labeled cell extracts with different sera obtained from healthy individuals. Renal transplant recipients who were suffering from active HCMV infections recognized the same set of antigens. By the use of monoclonal antibodies, these antigens were identified as polypeptides belonging to the gcI and gcIII families of HCMV glycoproteins.

  17. Inhibition of cyclophilin A suppresses H2O2-enhanced replication of HCMV through the p38 MAPK signaling pathway.

    PubMed

    Xiao, Jun; Song, Xin; Deng, Jiang; Lv, Liping; Ma, Ping; Gao, Bo; Zhou, Xipeng; Zhang, Yanyu; Xu, Jinbo

    2016-09-01

    Human cytomegalovirus (HCMV) infection can be accelerated by intracellular and extracellular hydrogen peroxide (H2O2) stimulation, mediated by the activation of the p38 mitogen-activated protein kinase (MAPK) pathway. However, it remains unknown whether host gene expression is involved in H2O2-upregulated HCMV replication. Here, we show that the expression of the host gene, cyclophilin A (CyPA), could be facilitated by treatment with H2O2 in a dose-dependent manner. Experiments with CyPA-specific siRNA, or with cyclosporine A, an inhibitor of CyPA, confirmed that H2O2-mediated upregulation of HCMV replication is specifically mediated by upregulation of CyPA expression. Furthermore, depletion or inhibition of CyPA reduced H2O2-induced p38 activation, consistent with that of H2O2-upregulated HCMV lytic replication. These results show that H2O2 is capable of activating ROS-CyPA-p38 MAPK interactions to enhance HCMV replication. PMID:27642560

  18. Inhibition of cyclophilin A suppresses H2O2-enhanced replication of HCMV through the p38 MAPK signaling pathway.

    PubMed

    Xiao, Jun; Song, Xin; Deng, Jiang; Lv, Liping; Ma, Ping; Gao, Bo; Zhou, Xipeng; Zhang, Yanyu; Xu, Jinbo

    2016-09-01

    Human cytomegalovirus (HCMV) infection can be accelerated by intracellular and extracellular hydrogen peroxide (H2O2) stimulation, mediated by the activation of the p38 mitogen-activated protein kinase (MAPK) pathway. However, it remains unknown whether host gene expression is involved in H2O2-upregulated HCMV replication. Here, we show that the expression of the host gene, cyclophilin A (CyPA), could be facilitated by treatment with H2O2 in a dose-dependent manner. Experiments with CyPA-specific siRNA, or with cyclosporine A, an inhibitor of CyPA, confirmed that H2O2-mediated upregulation of HCMV replication is specifically mediated by upregulation of CyPA expression. Furthermore, depletion or inhibition of CyPA reduced H2O2-induced p38 activation, consistent with that of H2O2-upregulated HCMV lytic replication. These results show that H2O2 is capable of activating ROS-CyPA-p38 MAPK interactions to enhance HCMV replication.

  19. Clinical factors influencing phenotype of HCMV-specific CD8+ T cells and HCMV-induced interferon-gamma production after allogeneic stem cells transplantation.

    PubMed

    Gayoso, Inmaculada; Cantisán, Sara; Cerrato, Carolina; Sánchez-García, Joaquín; Martin, Carmen; Solana, Rafael; Torres-Gomez, Antonio; Torre-Cisneros, Julian

    2013-01-01

    Human cytomegalovirus (HCMV) infection causes significant morbidity and mortality after hematopoietic stem cell transplantation (HSCT). In this work, we characterized the phenotype and interferon-gamma (INF-γ) production of HCMV-specific T cells using QuantiFERON-HCMV assay in 26 patients 6 months after HSCT. We analysed whether these two parameters were associated with clinical variables. Our results showed that the patients receiving stem cells from donors ≥40 years old were 12 times more likely to have HCMV-specific CD8+ T cells with "differentiated phenotype" (CD45RA+CCR7+ ≤6.7% and CD28+ ≤30%) than patients grafted from donors <40 years old (OR = 12; P = 0.014). In addition, a detectable IFN-γ production in response to HCMV peptides (cutoff 0.2 IU/mL IFN-γ; "reactive" QuantiFERON-HCMV test) was statistically associated with HCMV replication after transplantation (OR = 11; P = 0.026), recipients ≥40 versus <40 years old (OR = 11; P = 0.026), and the use of peripheral blood versus bone marrow as stem cell source (OR = 17.5; P = 0.024). In conclusion, donor age is the only factor significantly associated with the presence of the "differentiated phenotype" in HCMV-specific CD8+ T cells, whereas HCMV replication after transplantation, recipient age, and stem cell source are the factors associated with the production of IFN-γ in response to HCMV epitopes.

  20. PPARγ Is Activated during Congenital Cytomegalovirus Infection and Inhibits Neuronogenesis from Human Neural Stem Cells

    PubMed Central

    Rolland, Maude; Li, Xiaojun; Perez-Berezo, Teresa; Rauwel, Benjamin; Benchoua, Alexandra; Bessières, Bettina; Aziza, Jacqueline; Cenac, Nicolas; Luo, Minhua; Casper, Charlotte; Peschanski, Marc; Gonzalez-Dunia, Daniel; Leruez-Ville, Marianne; Davrinche, Christian; Chavanas, Stéphane

    2016-01-01

    Congenital infection by human cytomegalovirus (HCMV) is a leading cause of permanent sequelae of the central nervous system, including sensorineural deafness, cerebral palsies or devastating neurodevelopmental abnormalities (0.1% of all births). To gain insight on the impact of HCMV on neuronal development, we used both neural stem cells from human embryonic stem cells (NSC) and brain sections from infected fetuses and investigated the outcomes of infection on Peroxisome Proliferator-Activated Receptor gamma (PPARγ), a transcription factor critical in the developing brain. We observed that HCMV infection dramatically impaired the rate of neuronogenesis and strongly increased PPARγ levels and activity. Consistent with these findings, levels of 9-hydroxyoctadecadienoic acid (9-HODE), a known PPARγ agonist, were significantly increased in infected NSCs. Likewise, exposure of uninfected NSCs to 9-HODE recapitulated the effect of infection on PPARγ activity. It also increased the rate of cells expressing the IE antigen in HCMV-infected NSCs. Further, we demonstrated that (1) pharmacological activation of ectopically expressed PPARγ was sufficient to induce impaired neuronogenesis of uninfected NSCs, (2) treatment of uninfected NSCs with 9-HODE impaired NSC differentiation and (3) treatment of HCMV-infected NSCs with the PPARγ inhibitor T0070907 restored a normal rate of differentiation. The role of PPARγ in the disease phenotype was strongly supported by the immunodetection of nuclear PPARγ in brain germinative zones of congenitally infected fetuses (N = 20), but not in control samples. Altogether, our findings reveal a key role for PPARγ in neurogenesis and in the pathophysiology of HCMV congenital infection. They also pave the way to the identification of PPARγ gene targets in the infected brain. PMID:27078877

  1. Thrombin induces Sp1-mediated antiviral effects in cytomegalovirus-infected human retinal pigment epithelial cells.

    PubMed

    Scholz, Martin; Vogel, Jens-Uwe; Höver, Gerold; Prösch, Susanna; Kotchetkov, Ruslan; Cinatl, Jaroslav; Koch, Frank; Doerr, Hans Wilhelm; Cinatl, Jindrich

    2004-11-01

    Human cytomegalovirus (HCMV) retinitis causing retinal detachment and destruction of the blood-retina barrier is closely related to retinal hemorrhage/coagulation. However, the effects of procoagulants on HCMV (re)activation in retinal cells have not been investigated yet. Therefore, we studied whether thrombin modulates the expression of HCMV immediate early (IE) and late (L) genes in cultured human retinal pigment epithelial cells (RPE). Thrombin specifically stimulated the protease-activated receptor-1 (PAR-1) on RPE and, surprisingly, inhibited basal and 12,0-tetradecanoylphorbol 13-acetate-stimulated HCMV IE gene expression in infected RPE. On the other hand, HCMV strongly induced Sp1 DNA binding activity, which was prevented by thrombin/PAR1-mediated Sp1 hyperphosphorylation. Our data suggest that thrombin/PAR-1 may inhibit Sp1-dependent HCMV replication, which might be an important regulatory mechanism for HCMV persistence and replication in RPE.

  2. On the association of human beta 2 microglobulin with cell culture-grown human cytomegalovirus (HCMV).

    PubMed

    Yamashita, Y; Shimokata, K; Nishiyama, Y

    1992-09-01

    We studied the production of human beta 2 microglobulin (beta 2m) in mock-infected or human cytomegalovirus (HCMV) infected human embryonic lung fibroblasts (HEL) and the association of human beta 2m with HCMV virions. Titration of beta 2m by two-step sandwich enzyme immunoassay revealed that HEL released considerable amounts of human beta 2m into the culture medium and that the production of beta 2m was significantly enhanced by HCMV infection. The concentration of human beta 2m in the culture medium of HCMV-infected HEL reached 500 to 600 ng/ml, which corresponded to 7- to 12-fold of levels found in healthy adult urine. Immunoprecipitation assays showed that HEL-grown HCMV bound a significant amount of endogenous beta 2m, but the viruses were efficiently neutralized by either human hyperimmune anti-HCMV globulin or anti-HCMV monoclonal antibody even when treated with a large amount of human beta 2m or with dialysed urine. Thus it seems unlikely that the binding of beta 2m by HCMV is involved in masking the viral antigenic site necessary for neutralization.

  3. Clinical Factors Influencing Phenotype of HCMV-Specific CD8+ T Cells and HCMV-Induced Interferon-Gamma Production after Allogeneic Stem Cells Transplantation

    PubMed Central

    Cantisán, Sara; Cerrato, Carolina; Sánchez-García, Joaquín; Martin, Carmen; Solana, Rafael; Torres-Gomez, Antonio; Torre-Cisneros, Julian

    2013-01-01

    Human cytomegalovirus (HCMV) infection causes significant morbidity and mortality after hematopoietic stem cell transplantation (HSCT). In this work, we characterized the phenotype and interferon-gamma (INF-γ) production of HCMV-specific T cells using QuantiFERON-HCMV assay in 26 patients 6 months after HSCT. We analysed whether these two parameters were associated with clinical variables. Our results showed that the patients receiving stem cells from donors ≥40 years old were 12 times more likely to have HCMV-specific CD8+ T cells with “differentiated phenotype” (CD45RA+CCR7+ ≤6.7% and CD28+ ≤30%) than patients grafted from donors <40 years old (OR = 12; P = 0.014). In addition, a detectable IFN-γ production in response to HCMV peptides (cutoff 0.2 IU/mL IFN-γ; “reactive” QuantiFERON-HCMV test) was statistically associated with HCMV replication after transplantation (OR = 11; P = 0.026), recipients ≥40 versus <40 years old (OR = 11; P = 0.026), and the use of peripheral blood versus bone marrow as stem cell source (OR = 17.5; P = 0.024). In conclusion, donor age is the only factor significantly associated with the presence of the “differentiated phenotype” in HCMV-specific CD8+ T cells, whereas HCMV replication after transplantation, recipient age, and stem cell source are the factors associated with the production of IFN-γ in response to HCMV epitopes. PMID:23424600

  4. Toll-like receptor 4 is involved in the cell cycle modulation and required for effective human cytomegalovirus infection in THP-1 macrophages

    SciTech Connect

    Arcangeletti, Maria-Cristina; Germini, Diego; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Medici, Maria-Cristina; Gatti, Rita; Chezzi, Carlo; Calderaro, Adriana

    2013-05-25

    Suitable host cell metabolic conditions are fundamental for the effective development of the human cytomegalovirus (HCMV) lytic cycle. Indeed, several studies have demonstrated the ability of this virus to interfere with cell cycle regulation, mainly by blocking proliferating cells in G1 or G1/S. In the present study, we demonstrate that HCMV deregulates the cell cycle of THP-1 macrophages (a cell line irreversibly arrested in G0) by pushing them into S and G2 phases. Moreover, we show that HCMV infection of THP-1 macrophages leads to Toll-like receptor 4 (TLR4) activation. Since various studies have indicated TLR4 to be involved in promoting cell proliferation, here we investigate the possible role of TLR4 in the observed HCMV-induced cell cycle perturbation. Our data strongly support TLR4 as a mediator of HCMV-triggered cell cycle activation in THP-1 macrophages favouring, in turn, the development of an efficient viral lytic cycle. - Highlights: ► We studied HCMV infection impact on THP-1 macrophage cell cycle. ► We analysed the role played by Toll-like receptor (TLR) 4 upon HCMV infection. ► HCMV pushes THP-1 macrophages (i.e. resting cells) to re-enter the cell cycle. ► TLR4 pathway inhibition strongly affects the effectiveness of HCMV replication. ► TLR4 pathway inhibition significantly decreases HCMV-induced cell cycle re-entry.

  5. ChREBP, a glucose-responsive transcriptional factor, enhances glucose metabolism to support biosynthesis in human cytomegalovirus-infected cells.

    PubMed

    Yu, Yongjun; Maguire, Tobi G; Alwine, James C

    2014-02-01

    Carbohydrate-response element binding protein (ChREBP) plays a key role in regulating glucose metabolism and de novo lipogenesis in metabolic tissues and cancer cells. Here we report that ChREBP is also a critical regulator of the metabolic alterations induced during human cytomegalovirus (HCMV) infection. The expression of both ChREBP-α and ChREBP-β is robustly induced in HCMV-infected human fibroblasts; this induction is required for efficient HCMV infection. Depletion of ChREBP in HCMV-infected cells results in reduction of HCMV-induced glucose transporter 4 and glucose transporter 2 expression, leading to inhibition of glucose uptake, lactate production, nucleotide biosynthesis, and NADPH generation. We previously reported that HCMV infection induces lipogenesis through the activation of sterol regulatory element binding protein 1, which is mediated by the induction of PKR-like endoplasmic reticulum kinase. Data from the present study show that HCMV-induced lipogenesis is also controlled by the induction of ChREBP, in a second mechanism involved in the regulation of HCMV-induced de novo lipogenesis. These results suggest that ChREBP plays a key role in reprogramming glucose and lipid metabolism in HCMV infection.

  6. Molecular Detection of Human Cytomegalovirus (HCMV) Among Infants with Congenital Anomalies in Khartoum State, Sudan

    PubMed Central

    Ebrahim, Maha G.; Ali, Aisha S.; Mustafa, Mohamed O.; Musa, Dalal F.; El Hussein, Abdel Rahim M.; Elkhidir, Isam M.; Enan, Khalid A.

    2015-01-01

    Human Cytomegalovirus (HCMV) infection still represents the most common potentially serious viral complication in humans and is a major cause of congenital anomalies in infants. This study is aimed to detect HCMV in infants with congenital anomalies. Study subjects consisted of infants born with neural tube defect, hydrocephalus and microcephaly. Fifty serum specimens (20 males, 30 females) were collected from different hospitals in Khartoum State. The sera were investigated for cytomegalovirus specific immunoglobin M (IgM) antibodies using enzyme-linked immunosorbent assay (ELISA), and for Cytomegalovirus DNA using polymerase chain reaction (PCR). Out of the 50 sera tested, one patient’s (2%) sample showed HCMV IgM, but with no detectable DNA, other 4(8.2 %) sera were positive for HCMV DNA but with no detectable IgM. Various diagnostic techniques should be considered to evaluate HCMV disease and routine screening for HCMV should be introduced for pregnant women in this setting. It is vital to initiate further research work with many samples from different area to assess prevalence and characterize HCMV and evaluate its maternal health implications. PMID:26862356

  7. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus.

    PubMed

    Luganini, Anna; Terlizzi, Maria E; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host's lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  8. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus

    PubMed Central

    Luganini, Anna; Terlizzi, Maria E.; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host’s lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  9. Human Cytomegalovirus Inhibits the PARsylation Activity of Tankyrase--A Potential Strategy for Suppression of the Wnt Pathway.

    PubMed

    Roy, Sujayita; Liu, Fengjie; Arav-Boger, Ravit

    2015-12-29

    Human cytomegalovirus (HCMV) was reported to downregulate the Wnt/β-catenin pathway. Induction of Axin1, the negative regulator of the Wnt pathway, has been reported as an important mechanism for inhibition of β-catenin. Since Tankyrase (TNKS) negatively regulates Axin1, we investigated the effect of HCMV on TNKS expression and poly-ADP ribose polymerase (PARsylation) activity, during virus replication. Starting at 24 h post infection, HCMV stabilized the expression of TNKS and reduced its PARsylation activity, resulting in accumulation of Axin1 and reduction in its PARsylation as well. General PARsylation was not changed in HCMV-infected cells, suggesting specific inhibition of TNKS PARsylation. Similarly, treatment with XAV939, a chemical inhibitor of TNKS' activity, resulted in the accumulation of TNKS in both non-infected and HCMV-infected cell lines. Reduction of TNKS activity or knockdown of TNKS was beneficial for HCMV, evidenced by its improved growth in fibroblasts. Our results suggest that HCMV modulates the activity of TNKS to induce Axin1, resulting in inhibition of the β-catenin pathway. Since HCMV replication is facilitated by TNKS knockdown or inhibition of its activity, TNKS may serve as an important virus target for control of a variety of cellular processes.

  10. Control of human cytomegalovirus gene expression by differential histone modifications during lytic and latent infection of a monocytic cell line.

    PubMed

    Ioudinkova, Elena; Arcangeletti, Maria Cristina; Rynditch, Alla; De Conto, Flora; Motta, Federica; Covan, Silvia; Pinardi, Federica; Razin, Sergey V; Chezzi, Carlo

    2006-12-15

    Non-differentiated THP-1 cells can be infected by human cytomegalovirus (HCMV) Towne strain, which persists in these cells in a non-active (latent) form without undergoing a productive cycle. The same cells become permissive for HCMV lytic infection after induction of cell differentiation by treatment with 12-O-tetradecanoylphorbol-13-acetate. We used this cellular model to study the possible role of histone modifications in the control of HCMV latency. Using chromatin immunoprecipitation with antibodies against histone H3 acetylated or dimethylated in position K9, we demonstrated that in lytically infected cells the HCMV enhancer was associated with heavy acetylated but not dimethylated H3. In the case of latent infection, the HCMV enhancer was associated with neither acetylated nor dimethylated H3. HCMV genes encoding DNA polymerase (early), pp65 (early-late) and pp150 (late) proteins were associated preferentially with acetylated H3 in lytically infected cells and with dimethylated H3 in latently infected cells. These data strongly suggest that K9 methylation of H3 is involved in HCMV gene repression, while association of the above genes with acetylated histones is likely to be necessary for active transcription. It can be postulated that the same histone modifications are used to mark active and repressed genes in both cellular and viral chromatin. PMID:16989963

  11. Identification of Proteins in Human Cytomegalovirus (HCMV) Particles: the HCMV Proteome

    SciTech Connect

    Varnum, Susan M.; Streblow, Daniel N.; Monroe, Matthew E.; Smith, Patricia; Auberry, Kenneth J.; Pasa-Tolic, Liljiana; Wang, Dai; Camp, David G.; Rodland, Karin D.; Wiley, H S.; Britt, William; Shenk, Thomas; Smith, Richard D.; Nelson, Jay

    2004-10-15

    Human cytomegalovirus (HCMV), a member of the herpes virus family, is a large complex enveloped virus composed of both viral and cellular gene products. While the sequence of the HCMV genome has been known for over a decade, the full set of viral and cellular proteins that compose the HCMV virion are unknown. To approach this problem we have utilized gel-free two-dimensional capillary liquid chromatography-tandem mass spectrometry (MS/MS) and Fourier transform ion cyclotron resonance MS to identify and determine the relative abundances of viral and cellular proteins in purified HCMV AD169 virions and dense bodies. Analysis of the proteins from purified HCMV virion preparations has indicated that the particle contains significantly more viral proteins than previously known. In this study, we identified 71 HCMV-encoded proteins that included 12 proteins encoded by known viral open reading frames (ORFs) previously not associated with virions and 12 proteins from novel viral ORFs. Analysis of the relative abundance of HCMV proteins indicated that the predominant virion protein was the pp65 tegument protein and that gM rather than gB was the most abundant glycoprotein. We have also identified over 70 host cellular proteins in HCMV virions, which include cellular structural proteins, enzymes, and chaperones. In addition, analysis of HCMV dense bodies indicated that these viral particles are composed of 29 viral proteins with a reduced quantity of cellular proteins in comparison to HCMV virions. This study provides the first comprehensive quantitative analysis of the viral and cellular proteins that compose infectious particles of a large complex virus.

  12. Structure of HCMV glycoprotein B in the postfusion conformation bound to a neutralizing human antibody

    PubMed Central

    Chandramouli, Sumana; Ciferri, Claudio; Nikitin, Pavel A.; Caló, Stefano; Gerrein, Rachel; Balabanis, Kara; Monroe, James; Hebner, Christy; Lilja, Anders E.; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human cytomegalovirus (HCMV) poses a significant threat to immunocompromised individuals and neonates infected in utero. Glycoprotein B (gB), the herpesvirus fusion protein, is a target for neutralizing antibodies and a vaccine candidate due to its indispensable role in infection. Here we show the crystal structure of the HCMV gB ectodomain bound to the Fab fragment of 1G2, a neutralizing human monoclonal antibody isolated from a seropositive subject. The gB/1G2 interaction is dominated by aromatic residues in the 1G2 heavy chain CDR3 protruding into a hydrophobic cleft in the gB antigenic domain 5 (AD-5). Structural analysis and comparison with HSV gB suggest the location of additional neutralizing antibody binding sites on HCMV gB. Finally, immunoprecipitation experiments reveal that 1G2 can bind to HCMV virion gB suggesting that its epitope is exposed and accessible on the virus surface. Our data will support the development of vaccines and therapeutic antibodies against HCMV infection. PMID:26365435

  13. Regulation of CCAAT/enhancer-binding protein (C/EBP) α in human-cytomegalovirus-infected fibroblasts.

    PubMed

    Lee, Junsub; Kim, Sunyoung

    2016-05-01

    CCAAT/enhancer-binding protein (C/EBP) α, a member of the C/EBP family of transcription factors, is known to be involved in gene expression and DNA replication of human cytomegalovirus (HCMV). This study aimed to understand the regulation of endogenous C/EBPα during HCMV infection using an in vitro infection model. The expression and localization of C/EBPα were investigated in fibroblasts infected with HCMV. The overexpression of C/EBP homologous protein (CHOP), the endogenous inhibitor of C/EBP, was also employed to test the involvement of C/EBPα during HCMV infection. Our data showed that HCMV infection increases the expression of the full-length C/EBPα isoform (p42) especially during the late stage of infection at the transcriptional and post-translational levels. The increased p42 accumulated in the viral DNA replication compartment. p42 expression was not induced in cells treated with UV-irradiated virus or in cells infected with normal virus in the presence of ganciclovir. CHOP-mediated inhibition of C/EBP activity suppressed viral gene expression and DNA replication, which lowered the level of viral production. Together, our data suggest that HCMV-mediated C/EBPα regulation might play a beneficial role in the lytic cycle of HCMV. PMID:26831934

  14. HCMV Displays a Unique Transcriptome of Immunomodulatory Genes in Primary Monocyte-Derived Cell Types

    PubMed Central

    Van Damme, Ellen; Thys, Kim; Tuefferd, Marianne; Van Hove, Carl; Aerssens, Jeroen; Van Loock, Marnix

    2016-01-01

    Human cytomegalovirus (HCMV) is a betaherpesvirus which rarely presents problems in healthy individuals, yet may result in severe morbidity in immunocompromised patients and in immune-naïve neonates. HCMV has a large 235 kb genome with a coding capacity of at least 165 open reading frames (ORFs). This large genome allows complex gene regulation resulting in different sets of transcripts during lytic and latent infection. While latent virus mainly resides within monocytes and CD34+ progenitor cells, reactivation to lytic infection is driven by differentiation towards terminally differentiated myeloid dendritic cells and macrophages. Consequently, it has been suggested that macrophages and dendritic cells contribute to viral spread in vivo. Thus far only limited knowledge is available on the expression of HCMV genes in terminally differentiated myeloid primary cells and whether or not the virus exhibits a different set of lytic genes in primary cells compared with lytic infection in NHDF fibroblasts. To address these questions, we used Illumina next generation sequencing to determine the HCMV transcriptome in macrophages and dendritic cells during lytic infection and compared it to the transcriptome in NHDF fibroblasts. Here, we demonstrate unique expression profiles in macrophages and dendritic cells which significantly differ from the transcriptome in fibroblasts mainly by modulating the expression of viral transcripts involved in immune modulation, cell tropism and viral spread. In a head to head comparison between macrophages and dendritic cells, we observed that factors involved in viral spread and virion composition are differentially regulated suggesting that the plasticity of the virion facilitates the infection of surrounding cells. Taken together, this study provides the full transcript expression analysis of lytic HCMV genes in monocyte-derived type 1 and type 2 macrophages as well as in monocyte-derived dendritic cells. Thereby underlining the potential

  15. Human Cytomegalovirus Promotes Survival of Infected Monocytes via a Distinct Temporal Regulation of Cellular Bcl-2 Family Proteins

    PubMed Central

    Collins-McMillen, Donna; Kim, Jung Heon; Nogalski, Maciej T.; Stevenson, Emily V.; Caskey, Joshua R.; Cieply, Stephen J.

    2015-01-01

    ABSTRACT Monocytes play a key role in the hematogenous dissemination of human cytomegalovirus (HCMV) to target organ systems. To infect monocytes and reprogram them to deliver infectious virus, HCMV must overcome biological obstacles, including the short life span of monocytes and their antiviral proapoptotic response to infection. We have shown that virally induced upregulation of cellular Mcl-1 promotes early survival of HCMV-infected monocytes, allowing cells to overcome an early apoptotic checkpoint at around 48 h postinfection (hpi). Here, we demonstrate an HCMV-dependent shift from Mcl-1 as the primary antiapoptotic player to the related protein, Bcl-2, later during infection. Bcl-2 was upregulated in HCMV-infected monocytes beginning at 48 hpi. Treatment with the Bcl-2 antagonist ABT-199 only reduced the prosurvival effects of HCMV in target monocytes beginning at 48 hpi, suggesting that Mcl-1 controls survival prior to 48 hpi, while Bcl-2 promotes survival after 48 hpi. Although Bcl-2 was upregulated following viral binding/signaling through cellular integrins (compared to Mcl-1, which is upregulated through binding/activation of epidermal growth factor receptor [EGFR]), it functioned similarly to Mcl-1, adopting the early role of Mcl-1 in preventing caspase-3 cleavage/activation. This distinct, HCMV-induced shift from Mcl-1 to Bcl-2 occurs in response to a cellular upregulation of proapoptotic Bax, as small interfering RNA (siRNA)-mediated knockdown of Bax reduced the upregulation of Bcl-2 in infected monocytes and rescued the cells from the apoptotic effects of Bcl-2 inhibition. Our data demonstrate a distinct survival strategy whereby HCMV induces a biphasic regulation of cellular Bcl-2 proteins to promote host cell survival, leading to viral dissemination and the establishment of persistent HCMV infection. IMPORTANCE Hematogenous dissemination of HCMV via infected monocytes is a crucial component of the viral survival strategy and is required for the

  16. In vivo expression of human cytomegalovirus (HCMV) microRNAs during latency.

    PubMed

    Meshesha, Mesfin K; Bentwich, Zvi; Solomon, Semaria A; Avni, Yonat Shemer

    2016-01-01

    Viral encoded microRNAs play key roles in regulating gene expression and the life cycle of human herpes viruses. Latency is one of the hallmarks of the human cytomegalovirus (HCMV or HHV5) life cycle, and its control may have immense practical applications. The present study aims to identify HCMV encoded microRNAs during the latency phase of the virus. We used a highly sensitive real time PCR (RTPCR) assay that involves a pre-amplification step before RTPCR. It can detect HCMV encoded microRNAs (miRNAs) during latency in purified monocytes and PBMCs from HCMV IgG positive donors and in latently infected monocytic THP-1 cell lines. During the latency phase, only eight HCMV encoded microRNAs were detected in PBMCs, monocytes and in the THP-1 cells. Five originated from the UL region of the virus genome and three from the US region. Reactivation of the virus from latency, in monocytes obtained from the same donor, using dexamethasone restored the expression of all known HCMV encoded miRNAs including those that were absent during latency. We observed a shift in the abundance of the two arms of mir-US29 between the productive and latency stages of the viral life cycle, suggesting that the star "passenger" form of this microRNA is preferentially expressed during latency. As a whole, our study demonstrates that HCMV expresses during the latency phase, both in vivo and in vitro, only a subset of its microRNAs, which may indicate that they play an important role in maintenance and reactivation of latency. PMID:26302752

  17. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  18. Role of myeloid human cytomegalovirus infection in children's idiopathic thrombocytopenic purpura.

    PubMed

    Ding, Yan; Zhao, Lei; Mei, Hong; Zhang, Shu-Ling; Huang, Zhi-Hua

    2007-01-01

    This project explores the specificity of myeloid human cytomegalovirus (HCMV) infection in pathogenesis of idiopathic thrombocytopenic purpura (ITP). Eighty-one subjects with ITP were observed. HCMV early antigen and related myeloid cells in bone marrow, and platelet, HCMV IgM, and IgG in blood were tested. The results presented potent evidence that myeloid HCMV infection is a specific factor in children's ITP: patients of ITP with myeloid HCMV infection had a tendency for exacerbation, refractoriness, and chronic advance. However, HCMV did not affect the quantity of megakaryocyte, which showed the complicated relationships between HCMV and ITP.

  19. Modulation of Homology-Directed Repair in T98G Glioblastoma Cells Due to Interactions between Wildtype p53, Rad51 and HCMV IE1-72

    PubMed Central

    Kulkarni, Amit S.; Fortunato, Elizabeth A.

    2014-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous pathogen capable of causing life threatening consequences in neonates and immune-compromised individuals. HCMV inflicts site-specific double strand breaks (DSBs) in the cellular genome. DNA damage infliction raises the corollary question of virus modulation of DNA repair. We recently reported HDR was stimulated in wt human foreskin fibroblasts (HFFs) during fully permissive infection or expression of the HCMV protein IE1-72 (IE72). These studies have been extended into semi-permissive T98G glioblastoma cells. T98Gs encode a mutant p53, which may contribute to their high baseline rate of HDR. We fully expected HCMV infection to increase HDR in T98Gs, similar to its effects in HFFs. Surprisingly in T98Gs HCMV infection, or sole expression of IE72, decreased HDR by two-fold. Transient expression of wt p53 in T98Gs also reduced HDR by two-fold. Dual transient expression of wt p53 and IE72 restored high baseline HDR levels. GST pulldown experiments revealed that both IE72 and wt p53 bound the important HDR protein, Rad51. We conclude that the expression of certain HCMV proteins can modulate HDR in an infected cell, dependent upon p53 status. We propose a model of the protein interactions explaining this behavior. PMID:24576846

  20. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection.

    PubMed

    Goodier, Martin R; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M; Darboe, Alansana; Moldoveanu, Ana L; White, Matthew J; Behrens, Ron; Riley, Eleanor M

    2016-07-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2-dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV(-)) individuals than in HCMV-seropositive (HCMV(+)) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV(+) and HCMV(-) subjects. In addition to these IL-2-dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57(-) NK cells and was most evident in HCMV(+) subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  1. NKp46 and DNAM-1 NK-cell receptors drive the response to human cytomegalovirus-infected myeloid dendritic cells overcoming viral immune evasion strategies.

    PubMed

    Magri, Giuliana; Muntasell, Aura; Romo, Neus; Sáez-Borderías, Andrea; Pende, Daniela; Geraghty, Daniel E; Hengel, Hartmut; Angulo, Ana; Moretta, Alessandro; López-Botet, Miguel

    2011-01-20

    Information on natural killer (NK)-cell receptor-ligand interactions involved in the response to human cytomegalovirus (HCMV) is limited and essentially based on the study of infected fibroblasts. Experimental conditions were set up to characterize the NK response to HCMV-infected myeloid dendritic cells (DCs). Monocyte-derived DCs (moDCs) infected by the TB40/E HCMV strain down-regulated the expression of human leukocyte antigen class I molecules and specifically activated autologous NK-cell populations. NKG2D ligands appeared virtually undetectable in infected moDCs, reflecting the efficiency of immune evasion mechanisms, and explained the lack of antagonistic effects of NKG2D-specific monoclonal antibody. By contrast, DNAM-1 and DNAM-1 ligands (DNAM-1L)-specific monoclonal antibodies inhibited the NK response at 48 hours after infection, although the impact of HCMV-dependent down-regulation of DNAM-1L in infected moDCs was perceived at later stages. moDCs constitutively expressed ligands for NKp46 and NKp30 natural cytotoxicity receptors, which were partially reduced on HCMV infection; yet, only NKp46 appeared involved in the NK response. In contrast to previous reports in fibroblasts, human leukocyte antigen-E expression was not preserved in HCMV-infected moDCs, which triggered CD94/NKG2A(+) NK-cell activation. The results provide an insight on key receptor-ligand interactions involved in the NK-cell response against HCMV-infected moDCs, stressing the importance of the dynamics of viral immune evasion mechanisms.

  2. Cytomegalovirus-mediated activation of pyrimidine biosynthesis drives UDP–sugar synthesis to support viral protein glycosylation

    PubMed Central

    DeVito, Stefanie Renee; Ortiz-Riaño, Emilio; Martínez-Sobrido, Luis; Munger, Joshua

    2014-01-01

    Human cytomegalovirus (HCMV) induces numerous changes to the host metabolic network that are critical for high-titer viral replication. We find that HCMV infection substantially induces de novo pyrimidine biosynthetic flux. This activation is important for HCMV replication because inhibition of pyrimidine biosynthetic enzymes substantially decreases the production of infectious virus, which can be rescued through medium supplementation with pyrimidine biosynthetic intermediates. Metabolomic analysis revealed that pyrimidine biosynthetic inhibition considerably reduces the levels of various UDP–sugar metabolites in HCMV-infected, but not mock-infected, cells. Further, UDP–sugar biosynthesis, which provides the sugar substrates required for glycosylation reactions, was found to be induced during HCMV infection. Pyrimidine biosynthetic inhibition also attenuated the glycosylation of the envelope glycoprotein B (gB). Both glycosylation of gB and viral growth were restored by medium supplementation with either UDP–sugar metabolites or pyrimidine precursors. These results indicate that HCMV drives de novo-synthesized pyrimidines to UDP–sugar biosynthesis to support virion protein glycosylation. The importance of this link between pyrimidine biosynthesis and UDP–sugars appears to be partially shared among diverse virus families, because UDP–sugar metabolites rescued the growth attenuation associated with pyrimidine biosynthetic inhibition during influenza A and vesicular stomatitis virus infection, but not murine hepatitis virus infection. In total, our results indicate that viruses can specifically modulate pyrimidine metabolic flux to provide the glycosyl subunits required for protein glycosylation and production of high titers of infectious progeny. PMID:25472841

  3. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

    2016-01-01

    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  4. The 19S proteasome activator promotes human cytomegalovirus immediate early gene expression through proteolytic and nonproteolytic mechanisms.

    PubMed

    Winkler, Laura L; Kalejta, Robert F

    2014-10-01

    Proteasomes are large, multisubunit complexes that support normal cellular activities by executing the bulk of protein turnover. During infection, many viruses have been shown to promote viral replication by using proteasomes to degrade cellular factors that restrict viral replication. For example, the human cytomegalovirus (HCMV) pp71 protein induces the proteasomal degradation of Daxx, a cellular transcriptional repressor that can silence viral immediate early (IE) gene expression. We previously showed that this degradation requires both the proteasome catalytic 20S core particle (CP) and the 19S regulatory particle (RP). The 19S RP associates with the 20S CP to facilitate protein degradation but also plays a 20S CP-independent role promoting transcription. Here, we present a nonproteolytic role of the 19S RP in HCMV IE gene expression. We demonstrate that 19S RP subunits are recruited to the major immediate early promoter (MIEP) that directs IE transcription. Depletion of 19S RP subunits generated a defect in RNA polymerase II elongation through the MIE locus during HCMV infection. Our results reveal that HCMV commandeers proteasome components for both proteolytic and nonproteolytic roles to promote HCMV lytic infection. Importance: Proteasome inhibitors decrease or eliminate 20S CP activity and are garnering increasing interest as chemotherapeutics. However, an increasing body of evidence implicates 19S RP subunits in important proteolytic-independent roles during transcription. Thus, pharmacological inhibition of the 20S CP as a means to modulate proteasome function toward therapeutic effect is an incomplete capitalization on the potential of this approach. Here, we provide an additional example of nonproteolytic 19S RP function in promoting HCMV transcription. These data provide a novel system with which to study the roles of different proteasome components during transcription, a rationale for previously described shifts in 19S RP subunit localization during

  5. Human cytomegalovirus infection inhibits tumor necrosis factor alpha (TNF-alpha) signaling by targeting the 55-kilodalton TNF-alpha receptor.

    PubMed

    Baillie, J; Sahlender, D A; Sinclair, J H

    2003-06-01

    Infection with human cytomegalovirus (HCMV) results in complex interactions between viral and cellular factors which perturb many cellular functions. HCMV is known to target the cell cycle, cellular transcription, and immunoregulation, and it is believed that this optimizes the cellular environment for viral DNA replication during productive infection or during carriage in the latently infected host. Here, we show that HCMV infection also prevents external signaling to the cell by disrupting the function of TNFRI, the 55-kDa receptor for tumor necrosis factor alpha (TNF-alpha), one of the receptors for a potent cytokine involved in eliciting a wide spectrum of cellular responses, including antiviral responses. HCMV infection of fully permissive differentiated monocytic cell lines and U373 cells resulted in a reduction in cell surface expression of TNFRI. The reduction appeared to be due to relocalization of TNFRI from the cell surface and was reflected in the elimination of TNF-alpha-induced Jun kinase activity. Analysis of specific phases of infection suggested that viral early gene products were responsible for this relocalization. However, a mutant HCMV in which all viral gene products known to be involved in down-regulation of major histocompatibility complex (MHC) class I were deleted still resulted in relocalization of TNFRI. Consequently, TNFRI relocalization by HCMV appears to be mediated by a novel viral early function not involved in down-regulation of cell surface MHC class I expression. We suggest that upon infection, HCMV isolates the cell from host-mediated signals, forcing the cell to respond only to virus-specific signals which optimize the cell for virus production and effect proviral responses from bystander cells.

  6. Generation of potent neutralizing human monoclonal antibodies against cytomegalovirus infection from immune B cells

    PubMed Central

    Funaro, Ada; Gribaudo, Giorgio; Luganini, Anna; Ortolan, Erika; Lo Buono, Nicola; Vicenzi, Elisa; Cassetta, Luca; Landolfo, Santo; Buick, Richard; Falciola, Luca; Murphy, Marianne; Garotta, Gianni; Malavasi, Fabio

    2008-01-01

    Background Human monoclonal antibodies (mAbs) generated as a result of the immune response are likely to be the most effective therapeutic antibodies, particularly in the case of infectious diseases against which the immune response is protective. Human cytomegalovirus (HCMV) is an ubiquitous opportunistic virus that is the most serious pathogenic agent in transplant patients. The available therapeutic armamentarium (e.g. HCMV hyperimmune globulins or antivirals) is associated with severe side effects and the emergence of drug-resistant strains; therefore, neutralizing human mAb may be a decisive alternative in the prevention of primary and re-activated HCMV infections in these patients. Results The purpose of this study was to generate neutralizing mAb against HCMV from the immunological repertoire of immune donors. To this aim, we designed an efficient technology relying on two discrete and sequential steps: first, human B-lymphocytes are stimulated with TLR9-agonists and IL-2; second, after both additives are removed, the cells are infected with EBV. Using this strategy we obtained 29 clones secreting IgG neutralizing the HCMV infectivity; four among these were further characterized. All of the mAbs neutralize the infection in different combinations of HCMV strains and target cells, with a potency ~20 fold higher than that of the HCMV hyperimmune globulins, currently used in transplant recipients. Recombinant human monoclonal IgG1 suitable as a prophylactic or therapeutic tool in clinical applications has been generated. Conclusion The technology described has proven to be more reproducible, efficient and rapid than previously reported techniques, and can be adopted at low overall costs by any cell biology laboratory for the development of fully human mAbs for immunotherapeutic uses. PMID:19014469

  7. Reconstitution of Human Cytomegalovirus-Specific CD4+ T Cells is Critical for Control of Virus Reactivation in Hematopoietic Stem Cell Transplant Recipients but Does Not Prevent Organ Infection.

    PubMed

    Gabanti, Elisa; Lilleri, Daniele; Ripamonti, Francesco; Bruno, Francesca; Zelini, Paola; Furione, Milena; Colombo, Anna A; Alessandrino, Emilio P; Gerna, Giuseppe

    2015-12-01

    The relative contribution of human cytomegalovirus (HMCV)-specific CD4(+) and CD8(+) T cells to the control of HCMV infection in hematopoietic stem cell transplant (HSCT) recipients is still controversial. HCMV reactivation and HCMV-specific CD4(+) and CD8(+) T cell reconstitution were monitored for 1 year in 63 HCMV-seropositive patients receiving HSCT. HCMV reactivation was detected in all but 2 patients. In 20 of 63 (31.7%) patients (group 1) HCMV infection resolved spontaneously, whereas 32 of 63 (50.8%) patients (group 2) controlled the infection after a single short-course of pre-emptive therapy and the remaining 9 (14.3%) patients (group 3) suffered from relapsing episodes of HCMV infection, requiring multiple courses of antiviral therapy. The kinetics and magnitude of HCMV-specific CD8(+) T cell reconstitution were comparable among the 3 groups, but HCMV-specific CD4(+) T cells were lower in number in patients requiring antiviral treatment. HCMV-seronegative donors, as well as unrelated donors (receiving antithymocyte globulin) and acute graft-versus-host disease (GVHD) were associated with both delayed HCMV-specific CD4(+) T cell reconstitution and severity of infection. Conversely, these risk factors had no impact on HCMV-specific CD8(+) T cells. Eight patients with previous GVHD suffered from HCMV gastrointestinal disease, although in the presence of HCMV-specific CD4(+) and CD8(+) systemic immunity and undetectable HCMV DNA in blood. Reconstitution of systemic HCMV-specific CD4(+) T cell immunity is required for control of HCMV reactivation in adult HSCT recipients, but it may not be sufficient to prevent late-onset organ localization in patients with GVHD. HCMV-specific CD8(+) T cells contribute to control of HCMV infection, but only after HCMV-specific CD4(+) T cell reconstitution.

  8. Vaccine-Derived Neutralizing Antibodies to the Human Cytomegalovirus gH/gL Pentamer Potently Block Primary Cytotrophoblast Infection

    PubMed Central

    Chiuppesi, Flavia; Wussow, Felix; Johnson, Erica; Bian, Chao; Zhuo, Meng; Rajakumar, Augustine; Barry, Peter A.; Britt, William J.; Chakraborty, Rana

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) elicits neutralizing antibodies (NAb) of various potencies and cell type specificities to prevent HCMV entry into fibroblasts (FB) and epithelial/endothelial cells (EpC/EnC). NAb targeting the major essential envelope glycoprotein complexes gB and gH/gL inhibit both FB and EpC/EnC entry. In contrast to FB infection, HCMV entry into EpC/EnC is additionally blocked by extremely potent NAb to conformational epitopes of the gH/gL/UL128/130/131A pentamer complex (PC). We recently developed a vaccine concept based on coexpression of all five PC subunits by a single modified vaccinia virus Ankara (MVA) vector, termed MVA-PC. Vaccination of mice and rhesus macaques with MVA-PC resulted in a high titer and sustained NAb that blocked EpC/EnC infection and lower-titer NAb that inhibited FB entry. However, antibody function responsible for the neutralizing activity induced by the MVA-PC vaccine is uncharacterized. Here, we demonstrate that MVA-PC elicits NAb with cell type-specific neutralization potency and antigen recognition pattern similar to human NAb targeting conformational and linear epitopes of the UL128/130/131A subunits or gH. In addition, we show that the vaccine-derived PC-specific NAb are significantly more potent than the anti-gH NAb to prevent HCMV spread in EpC and infection of human placental cytotrophoblasts, cell types thought to be of critical importance for HCMV transmission to the fetus. These findings further validate MVA-PC as a clinical vaccine candidate to elicit NAb that resembles those induced during HCMV infection and provide valuable insights into the potency of PC-specific NAb to interfere with HCMV cell-associated spread and infection of key placental cells. IMPORTANCE As a consequence of the leading role of human cytomegalovirus (HCMV) in causing permanent birth defects, developing a vaccine against HCMV has been assigned a major public health priority. We have recently introduced a vaccine strategy based

  9. In vitro selection of novel RNA ligands that bind human cytomegalovirus and block viral infection.

    PubMed Central

    Wang, J; Jiang, H; Liu, F

    2000-01-01

    Ribonuclease-resistant RNA molecules that bind to infectious human cytomegalovirus (HCMV) were isolated in vitro from a pool of randomized sequences after 16 cycles of selection and amplification. The two ligands (L13 and L19) characterized exhibited high HCMV-binding affinity in vitro and effectively inhibited viral infection in tissue culture. Their antiviral activity was also specific as they only reacted with two different strains of HCMV but not with the related herpes simplex virus 1 and human cells. These two ligands appeared to function as antivirals by blocking viral entry. Ultraviolet (UV) crosslinking studies suggested that L13 and L19 bind to HCMV essential glycoproteins B and H, respectively. Thus, RNA ligands that bind to different surface antigens of HCMV can be simultaneously isolated by the selection procedure. Our study demonstrates the feasibility of using these RNA ligands as a research tool to identify viral proteins required for infectivity and as an antiviral agent to block viral infection. PMID:10786848

  10. Use of diploid human fibroblasts as a model system to culture, grow, and study human cytomegalovirus infection.

    PubMed

    Fortunato, Elizabeth A

    2014-01-01

    Primary human diploid fibroblasts are used routinely to study host/pathogen interactions of human cytomegalovirus (HCMV). Fibroblasts' ease of culture and tremendous permissiveness for infection allow the study of all facets of infection, an abbreviated list of which includes ligand/receptor interactions, activation of cell signaling responses, and dysregulation of the cell cycle and DNA repair processes. Another advantage to fibroblasts' permissiveness for HCMV is the capability to grow high titer stocks of virus in them. This chapter will discuss the production of viral stocks of HCMV in primary human fibroblasts, commencing with culturing and infection of cells and continuing through harvest, titration (determining the infectious capacity of a particular virus preparation), and storage of viral stocks for use in downstream experiments.

  11. Human Cytomegalovirus pUL29/28 and pUL38 Repression of p53-Regulated p21CIP1 and Caspase 1 Promoters during Infection

    PubMed Central

    Savaryn, John P.; Reitsma, Justin M.; Bigley, Tarin M.; Halligan, Brian D.; Qian, Zhikang; Yu, Dong

    2013-01-01

    During infection by human cytomegalovirus (HCMV), the tumor suppressor protein p53, which promotes efficient viral gene expression, is stabilized. However, the expression of numerous p53-responsive cellular genes is not upregulated. The molecular mechanism used to manipulate the transcriptional activity of p53 during infection remains unclear. The HCMV proteins IE1, IE2, pUL44, and pUL84 likely contribute to the regulation of p53. In this study, we used a discovery-based approach to identify the protein targets of the HCMV protein pUL29/28 during infection. Previous studies have demonstrated that pUL29/28 regulates viral gene expression by interacting with the chromatin remodeling complex NuRD. Here, we observed that pUL29/28 also associates with p53, an additional deacetylase complex, and several HCMV proteins, including pUL38. We confirmed the interaction between p53 and pUL29/28 in both the presence and absence of infection. HCMV pUL29/28 with pUL38 altered the activity of the 53-regulatable p21CIP1 promoter. During infection, pUL29/28 and pUL38 contributed to the inhibition of p21CIP1 as well as caspase 1 expression. The expression of several other p53-regulating genes was not altered. Infection using a UL29-deficient virus resulted in increased p53 binding and histone H3 acetylation at the responsive promoters. Furthermore, expression of pUL29/28 and its interacting partner pUL38 contributed to an increase in the steady-state protein levels of p53. This study identified two additional HCMV proteins, pUL29/28 and pUL38, which participate in the complex regulation of p53 transcriptional activity during infection. PMID:23236067

  12. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  13. 3D Analysis of HCMV Induced-Nuclear Membrane Structures by FIB/SEM Tomography: Insight into an Unprecedented Membrane Morphology.

    PubMed

    Villinger, Clarissa; Neusser, Gregor; Kranz, Christine; Walther, Paul; Mertens, Thomas

    2015-11-01

    We show that focused ion beam/scanning electron microscopy (FIB/SEM) tomography is an excellent method to analyze the three-dimensional structure of a fibroblast nucleus infected with human cytomegalovirus (HCMV). We found that the previously described infoldings of the inner nuclear membrane, which are unique among its kind, form an extremely complex network of membrane structures not predictable by previous two-dimensional studies. In all cases they contained further invaginations (2nd and 3rd order infoldings). Quantification revealed 5498HCMV capsids within two nuclear segments, allowing an estimate of 15,000 to 30,000 capsids in the entire nucleus five days post infection. Only 0.8% proved to be enveloped capsids which were exclusively detected in 1st order infoldings (perinuclear space). Distribution of the capsids between 1st, 2nd and 3rd order infoldings is in complete agreement with the envelopment/de-envelopment model for egress of HCMV capsids from the nucleus and we confirm that capsid budding does occur at the large infoldings. Based on our results we propose the pushing membrane model: HCMV infection induces local disruption of the nuclear lamina and synthesis of new membrane material which is pushed into the nucleoplasm, forming complex membrane infoldings in a highly abundant manner, which then may be also used by nucleocapsids for budding. PMID:26556360

  14. 3D Analysis of HCMV Induced-Nuclear Membrane Structures by FIB/SEM Tomography: Insight into an Unprecedented Membrane Morphology

    PubMed Central

    Villinger, Clarissa; Neusser, Gregor; Kranz, Christine; Walther, Paul; Mertens, Thomas

    2015-01-01

    We show that focused ion beam/scanning electron microscopy (FIB/SEM) tomography is an excellent method to analyze the three-dimensional structure of a fibroblast nucleus infected with human cytomegalovirus (HCMV). We found that the previously described infoldings of the inner nuclear membrane, which are unique among its kind, form an extremely complex network of membrane structures not predictable by previous two-dimensional studies. In all cases they contained further invaginations (2nd and 3rd order infoldings). Quantification revealed 5498 HCMV capsids within two nuclear segments, allowing an estimate of 15,000 to 30,000 capsids in the entire nucleus five days post infection. Only 0.8% proved to be enveloped capsids which were exclusively detected in 1st order infoldings (perinuclear space). Distribution of the capsids between 1st, 2nd and 3rd order infoldings is in complete agreement with the envelopment/de-envelopment model for egress of HCMV capsids from the nucleus and we confirm that capsid budding does occur at the large infoldings. Based on our results we propose the pushing membrane model: HCMV infection induces local disruption of the nuclear lamina and synthesis of new membrane material which is pushed into the nucleoplasm, forming complex membrane infoldings in a highly abundant manner, which then may be also used by nucleocapsids for budding. PMID:26556360

  15. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection

    PubMed Central

    Goodier, Martin R.; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M.; Darboe, Alansana; Moldoveanu, Ana L.; White, Matthew J.; Behrens, Ron

    2016-01-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2–dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV−) individuals than in HCMV-seropositive (HCMV+) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV+ and HCMV− subjects. In addition to these IL-2–dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57− NK cells and was most evident in HCMV+ subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  16. Thrombin stimulates IL-6 and IL-8 expression in cytomegalovirus-infected human retinal pigment epithelial cells.

    PubMed

    Scholz, Martin; Vogel, Jens-Uwe; Höver, Gerold; Kotchetkov, Ruslan; Cinatl, Jaroslav; Doerr, Hans Wilhelm; Cinatl, Jindrich

    2004-02-01

    Recently, we reported that thrombin specifically stimulates protease-activated receptor-1 (PAR-1) signaling in RPE entailing inhibition of Sp1 dependent HCMV replication. We now studied whether thrombin modulates the expression of the proinflammatory cytokine/chemokines IL-6 and IL-8 in mock- and cytomegalovirus-infected human retinal pigment epithelial cells (RPE). Our data show that thrombin/PAR-1 stimulates IL-6 and IL-8 gene transcription and protein secretion in both mock- and HCMV-infected RPE. Thrombin/PAR-1-mediated signaling stimulated PKC and NF-kappaB-dependent IL-6 and IL-8 gene expression via phosphoinositide 3-kinase and further downstream via p42/44 and p38 MAPKs. Thus, thrombin/PAR-1-mediated IL-6/IL-8 gene expression is uncoupled from Sp1 inhibition and may support proinflammatory pathomechanisms probably involved in hemorrhage/HCMV retinitis progression.

  17. Structural and biochemical studies of HCMV gH/gL/gO and Pentamer reveal mutually exclusive cell entry complexes

    PubMed Central

    Ciferri, Claudio; Chandramouli, Sumana; Donnarumma, Danilo; Nikitin, Pavel A.; Cianfrocco, Michael A.; Gerrein, Rachel; Feire, Adam L.; Barnett, Susan W.; Lilja, Anders E.; Rappuoli, Rino; Norais, Nathalie; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and the leading viral cause of birth defects after congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are key targets of the human humoral response against HCMV and are required for HCMV entry into fibroblasts and endothelial/epithelial cells, respectively. We expressed and characterized soluble forms of gH/gL, gH/gL/gO, and Pentamer. Mass spectrometry and mutagenesis analysis revealed that gL-Cys144 forms disulfide bonds with gO-Cys351 in gH/gL/gO and with UL128-Cys162 in the Pentamer. Notably, Pentamer harboring the UL128-Cys162Ser/gL-Cys144Ser mutations had impaired syncytia formation and reduced interference of HCMV entry into epithelial cells. Electron microscopy analysis showed that HCMV gH/gL resembles HSV gH/gL and that gO and UL128/UL130/UL131A bind to the same site at the gH/gL N terminus. These data are consistent with gH/gL/gO and Pentamer forming mutually exclusive cell entry complexes and reveal the overall location of gH/gL-, gH/gL/gO-, and Pentamer-specific neutralizing antibody binding sites. Our results provide, to our knowledge, the first structural view of gH/gL/gO and Pentamer supporting the development of vaccines and antibody therapeutics against HCMV. PMID:25624487

  18. Absence of human cytomegalovirus infection in childhood brain tumors

    PubMed Central

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients’ neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  19. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  20. Antigenic Characterization of the HCMV gH/gL/gO and Pentamer Cell Entry Complexes Reveals Binding Sites for Potently Neutralizing Human Antibodies

    PubMed Central

    Ciferri, Claudio; Chandramouli, Sumana; Leitner, Alexander; Donnarumma, Danilo; Cianfrocco, Michael A.; Gerrein, Rachel; Friedrich, Kristian; Aggarwal, Yukti; Palladino, Giuseppe; Aebersold, Ruedi; Norais, Nathalie; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human Cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and in fetuses following congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are required for HCMV entry in fibroblasts and endothelial/epithelial cells, respectively, and are targeted by potently neutralizing antibodies in the infected host. Using purified soluble forms of gH/gL/gO and Pentamer as well as a panel of naturally elicited human monoclonal antibodies, we determined the location of key neutralizing epitopes on the gH/gL/gO and Pentamer surfaces. Mass Spectrometry (MS) coupled to Chemical Crosslinking or to Hydrogen Deuterium Exchange was used to define residues that are either in proximity or part of neutralizing epitopes on the glycoprotein complexes. We also determined the molecular architecture of the gH/gL/gO- and Pentamer-antibody complexes by Electron Microscopy (EM) and 3D reconstructions. The EM analysis revealed that the Pentamer specific neutralizing antibodies bind to two opposite surfaces of the complex, suggesting that they may neutralize infection by different mechanisms. Together, our data identify the location of neutralizing antibodies binding sites on the gH/gL/gO and Pentamer complexes and provide a framework for the development of antibodies and vaccines against HCMV. PMID:26485028

  1. Antigenic Characterization of the HCMV gH/gL/gO and Pentamer Cell Entry Complexes Reveals Binding Sites for Potently Neutralizing Human Antibodies.

    PubMed

    Ciferri, Claudio; Chandramouli, Sumana; Leitner, Alexander; Donnarumma, Danilo; Cianfrocco, Michael A; Gerrein, Rachel; Friedrich, Kristian; Aggarwal, Yukti; Palladino, Giuseppe; Aebersold, Ruedi; Norais, Nathalie; Settembre, Ethan C; Carfi, Andrea

    2015-10-01

    Human Cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and in fetuses following congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are required for HCMV entry in fibroblasts and endothelial/epithelial cells, respectively, and are targeted by potently neutralizing antibodies in the infected host. Using purified soluble forms of gH/gL/gO and Pentamer as well as a panel of naturally elicited human monoclonal antibodies, we determined the location of key neutralizing epitopes on the gH/gL/gO and Pentamer surfaces. Mass Spectrometry (MS) coupled to Chemical Crosslinking or to Hydrogen Deuterium Exchange was used to define residues that are either in proximity or part of neutralizing epitopes on the glycoprotein complexes. We also determined the molecular architecture of the gH/gL/gO- and Pentamer-antibody complexes by Electron Microscopy (EM) and 3D reconstructions. The EM analysis revealed that the Pentamer specific neutralizing antibodies bind to two opposite surfaces of the complex, suggesting that they may neutralize infection by different mechanisms. Together, our data identify the location of neutralizing antibodies binding sites on the gH/gL/gO and Pentamer complexes and provide a framework for the development of antibodies and vaccines against HCMV. PMID:26485028

  2. Human cytomegalovirus and Epstein-Barr virus infection in inflammatory bowel disease: Need for mucosal viral load measurement

    PubMed Central

    Ciccocioppo, Rachele; Racca, Francesca; Paolucci, Stefania; Campanini, Giulia; Pozzi, Lodovica; Betti, Elena; Riboni, Roberta; Vanoli, Alessandro; Baldanti, Fausto; Corazza, Gino Roberto

    2015-01-01

    AIM: To evaluate the best diagnostic technique and risk factors of the human Cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) infection in inflammatory bowel disease (IBD). METHODS: A cohort of 40 IBD patients (17 refractory) and 40 controls underwent peripheral blood and endoscopic colonic mucosal sample harvest. Viral infection was assessed by quantitative real-time polymerase chain reaction and immunohistochemistry, and correlations with clinical and endoscopic indexes of activity, and risk factors were investigated. RESULTS: All refractory patients carried detectable levels of HCMV and/or EBV mucosal load as compared to 13/23 (56.5%) non-refractory and 13/40 (32.5%) controls. The median DNA value was significantly higher in refractory (HCMV 286 and EBV 5.440 copies/105 cells) than in non-refractory (HCMV 0 and EBV 6 copies/105 cells; P < 0.05 and < 0.001) IBD patients and controls (HCMV and EBV 0 copies/105 cells; P < 0.001 for both). Refractory patients showed DNA peak values ≥ 103 copies/105 cells in diseased mucosa in comparison to non-diseased mucosa (P < 0.0121 for HCMV and < 0.0004 for EBV), while non-refractory patients and controls invariably displayed levels below this threshold, thus allowing us to differentiate viral colitis from mucosal infection. Moreover, the mucosal load positively correlated with the values found in the peripheral blood, whilst no correlation with the number of positive cells at immunohistochemistry was found. Steroid use was identified as a significant risk factor for both HCMV (P = 0.018) and EBV (P = 0.002) colitis. Finally, a course of specific antiviral therapy with ganciclovir was successful in all refractory patients with HCMV colitis, whilst refractory patients with EBV colitis did not show any improvement despite steroid tapering and discontinuation of the other medications. CONCLUSION: Viral colitis appeared to contribute to mucosal lesions in refractory IBD, and its correct diagnosis and management require

  3. Physical activity, immunity and infection.

    PubMed

    Romeo, J; Wärnberg, J; Pozo, T; Marcos, A

    2010-08-01

    During the last few decades, scientific evidence has confirmed a wide range of health benefits related to regular physical activity. How physical activity affects the immune function and infection risk is, however, still under debate. Commonly, intensive exercise suppresses the activity and levels of several immune cells, while other immune functions may be stimulated by moderate physical activity. With this knowledge, the understanding of the relationship between different levels of physical activity on the immune function has been raised as a potential tool to protect health not only in athletes but also in the general population; the mechanisms that translate a physically active lifestyle into good health continue to be investigated. Reviewing the literature, although several outcomes (i.e. the mechanisms by which different levels and duration of physical activity programmes affect numerous cell types and responses) remain unclear, given that the additional benefits encompass healthy habits including exercise, the use of physical activity programmes may result in improved health of elderly populations. Moderate physical activity or moderate-regulated training may enhance the immune function mainly in less fit subjects or sedentary population and the pre-event fitness status also seems to be an important individual factor regarding this relationship. Although adequate nutrition and regular physical activity habits may synergistically improve health, clinical trials in athletes using nutritional supplements to counteract the immune suppression have been inconclusive so far.Further research is necessary to find out to what extent physical activity training can exert an effect on the immune function.

  4. Human cytomegalovirus and Epstein–Barr virus inhibit oral bacteria-induced macrophage activation and phagocytosis

    PubMed Central

    Lin, Y.-L.; Li, M.

    2016-01-01

    Introduction Periodontal disease is an inflammatory condition caused by periodontal microorganisms. Viruses such as human cytomegalovirus (HCMV) and Epstein–Barr virus (EBV) are associated with certain types of periodontal disease, but their roles in promoting the disease are unclear. Because both viruses infect human macrophages, cells which play key roles in the clearance of pathogenic bacteria, it is likely that the viruses alter the functional capacity of macrophages by inhibiting their defense mechanisms against invading pathogens. Methods Macrophages preinfected with HCMV or EBV were evaluated following stimulation by selected oral bacteria. Bacteria-induced macrophage activation was assayed by measuring the levels of tumor necrosis factor-α (TNF-α) produced in the media, and phagocytic activity was analysed by a phagocytosis assay with fluorescein isothiocyanate-labeled bacteria. The virus-infected macrophages were also subjected to semi-quantitative polymerase chain reaction to measure the expression of toll-like receptor 9, which is involved in the activation of phagocytosis-related pathways. Results Both HCMV and EBV significantly diminished the TNF-α production typically induced by oral bacteria, inhibited the phagocytic activity of macrophages, and downregulated the expression of toll-like receptor 9. Conclusion Infection by HCMV or EBV inhibits the functional ability of macrophages to respond to bacterial challenge, thereby suggesting their pathogenic role in the development of periodontal disease. PMID:19416455

  5. Human cytomegalovirus IE72 protein interacts with the transcriptional repressor hDaxx to regulate LUNA gene expression during lytic infection.

    PubMed

    Reeves, Matthew; Woodhall, David; Compton, Teresa; Sinclair, John

    2010-07-01

    A putative latency-associated transcript (LUNA) complementary to the human cytomegalovirus (HCMV) UL81-82 region previously identified in seropositive donors' monocytes is also expressed during lytic infection. Thus, the LUNA promoter is active during both lytic and latent infection. Consequently, the mechanisms regulating this promoter may provide further insight into factors that determine whether the outcome of HCMV infection is latent or lytic. By transfection, the LUNA promoter exhibited low but reproducible activity. Substantial activation by virus infection suggested that a viral factor was important for LUNA expression during lytic infection. IE72, a known transactivator of viral promoters, activated the LUNA promoter in cotransfection assays. Furthermore, coinfection with wild-type HCMV but not an IE72 deletion virus (CR208) also activated the LUNA promoter. Finally, diminished LUNA gene expression in CR208 virus-infected cells supported a role for IE72 in LUNA gene expression. The initial regulation of herpesvirus immediate-early gene expression is associated with proteins found at cellular nuclear domain 10 (ND10) bodies, such as PML, hDaxx, and ATRX. hDaxx transfection repressed LUNA promoter activity. Furthermore, we observed binding of hDaxx to the LUNA promoter, which was abrogated by IE72 gene expression via direct interaction. Finally, we show that small interfering RNA (siRNA) knockdown of the hDaxx interaction partner ATRX rescued LUNA gene expression in CR208-infected cells. Overall, these data show that hDaxx/ATRX-mediated repression of LUNA during lytic infection absolutely requires IE72 gene expression. It also suggests that the targeting of cellular factors by IE72 is important throughout the different phases of HCMV gene expression during productive infection.

  6. Autoreactivity of primary human immunoglobulins ancestral to hypermutated human antibodies that neutralize HCMV.

    PubMed

    McLean, Gary R; Cho, Chin-wen; Schrader, John W

    2006-05-01

    The human antibody response to the AD-2S1 epitope of glycoprotein B (gB) of human cytomegalovirus (HCMV) is dominated by a family of closely related somatically mutated antibodies. These antibodies neutralize viral infectivity and the genes encoding them are derived from two commonly used germ-line variable (V) region genes, IGHV3-30 and IGKV3-11. Recombination of these V genes with the appropriate junctional diversity generates genes that encode primary immunoglobulins that bind to AD-2S1. To further understand the initial primary immunoglobulin response to AD-2S1 we synthesized the germ-line-based ancestor of one such family of antibodies and showed that it bound gB at the AD-2S1 epitope. Here we show that the germ-line ancestor of a second family of antibodies likewise binds to gB. We further show that one of the ancestral primary immunoglobulins, but not the other, also recognized autoantigens. In contrast, the hypermutated derivatives did not demonstrate autoreactivity and minor structural changes in the primary immunoglobulin were sufficient to generate or abolish autoreactivity or to change specificity. Thus, our demonstration that the ancestor of a highly mutated, non-autoreactive antiviral IgG antibody binds nuclear and cell-surface autoantigens indicates for the first time that self-reactivity is not necessarily a barrier to development into a follicular B lymphocyte that undergoes antigen-initiated affinity maturation.

  7. Cytomegalovirus alpha-chemokine genotypes are associated with clinical manifestations in children with congenital or postnatal infections.

    PubMed

    Paradowska, Edyta; Jabłońska, Agnieszka; Płóciennikowska, Agnieszka; Studzińska, Mirosława; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Dzierżanowska-Fangrat, Katarzyna; Kasztelewicz, Beata; Woźniakowska-Gęsicka, Teresa; Leśnikowski, Zbigniew J

    2014-08-01

    Human cytomegalovirus (HCMV) is the leading cause of congenital infections. The aim of our study was to determine the prevalence of genotypes based on the highly polymorphic UL146 and UL147 HCMV genes and the relationship between the genotype and symptoms or viral load. We analyzed samples from 121 infants with symptomatic HCMV infection, including 32 congenitally infected newborns. The G7 and G5 genotypes were predominant in postnatal infection, whereas the G1 genotype was prevalent in congenital infection. Central nervous system (CNS) damage and hepatomegaly were detected more frequently among children infected with the G1 genotype than in those infected by other genotypes. An association between the viral genotype and viruria level was found. There was a strong correlation between HCMV genotypes determined through the UL146 and UL147 sequences (ĸ=0.794). In conclusion, we found that certain vCXCL genotypes are associated with clinical sequelae following HCMV infection.

  8. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    SciTech Connect

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A. . E-mail: lfort@uidaho.edu

    2006-04-25

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection.

  9. Viperin Regulates Cellular Lipid Metabolism during Human Cytomegalovirus Infection

    PubMed Central

    Seo, Jun-Young; Cresswell, Peter

    2013-01-01

    Human cytomegalovirus (HCMV) has been shown to induce increased lipogenesis in infected cells, and this is believed to be required for proper virion envelopment. We show here that this increase is a consequence of the virus-induced redistribution of the host protein viperin to mitochondria and its capacity to interact with and block the function of the mitochondrial trifunctional protein (TFP), the enzyme that mediates fatty acid-β-oxidation. The resulting decrease in cellular ATP levels activates the enzyme AMP-activated protein kinase (AMPK), which induces expression of the glucose transporter GLUT4, resulting in increased glucose import and translocation to the nucleus of the glucose-regulated transcription factor ChREBP. This induces increased transcription of genes encoding lipogenic enzymes, increased lipid synthesis and lipid droplet accumulation, and generation of the viral envelope. Viperin-dependent lipogenesis is required for optimal production of infectious virus. We show that all of these metabolic outcomes can be replicated by direct targeting of viperin to mitochondria in the absence of HCMV infection, and that the motif responsible for Fe-S cluster binding by viperin is essential. The data indicate that viperin is the major effector underlying the ability of HCMV to regulate cellular lipid metabolism. PMID:23935494

  10. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells

    PubMed Central

    Krishna, B. A.; Lau, B.; Jackson, S. E.; Wills, M. R.; Sinclair, J. H.; Poole, E.

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  11. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells.

    PubMed

    Krishna, B A; Lau, B; Jackson, S E; Wills, M R; Sinclair, J H; Poole, E

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  12. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells.

    PubMed

    Krishna, B A; Lau, B; Jackson, S E; Wills, M R; Sinclair, J H; Poole, E

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens.

  13. Human cytomegalovirus gene expression in long-term infected glioma stem cells.

    PubMed

    Fiallos, Estefania; Judkins, Jonathon; Matlaf, Lisa; Prichard, Mark; Dittmer, Dirk; Cobbs, Charles; Soroceanu, Liliana

    2014-01-01

    The most common adult primary brain tumor, glioblastoma (GBM), is characterized by fifteen months median patient survival and has no clear etiology. We and others have identified the presence of human cytomegalovirus (HCMV) gene products endogenously expressed in GBM tissue and primary cells, with a subset of viral genes being consistently expressed in most samples. Among these viral genes, several have important oncomodulatory properties, regulating tumor stemness, proliferation, immune evasion, invasion and angiogenesis. These findings lead us to hypothesize that a specific HCMV gene signature may be associated with GBM pathogenesis. To investigate this hypothesis, we used glioma cell lines and primary glioma stem-like cells (GSC) infected with clinical and laboratory HCMV strains and measured relative viral gene expression levels along several time points up to 15 weeks post-infection. While HCMV gene expression was detected in several infected glioma lines through week 5 post-infection, only HCMV-infected GSC expressed viral gene products 15 weeks post-infection. Efficiency of infection across time was higher in GSC compared to cell lines. Importantly, HCMV-infected GSC outlived their uninfected counterparts, and this extended survival was paralleled by increased tumorsphere frequency and upregulation of stemness regulators, such as SOX2, p-STAT3, and BMX (a novel HCMV target identified in this study). Interleukin 6 (IL-6) treatment significantly upregulated HCMV gene expression in long-term infected glioma cultures, suggesting that pro-inflammatory signaling in the tumor milieu may further augment HCMV gene expression and subsequent tumor progression driven by viral-induced cellular signaling. Together, our data support a critical role for long-term, low-level HCMV infection in promoting survival, stemness, and proliferation of GSC that could significantly contribute to GBM pathogenesis. PMID:25549333

  14. Role of the human cytomegalovirus major immediate-early promoter's 19-base-pair-repeat cyclic AMP-response element in acutely infected cells.

    PubMed

    Keller, M J; Wheeler, D G; Cooper, E; Meier, J L

    2003-06-01

    Prior studies have suggested a role of the five copies of the 19-bp-repeat cyclic AMP (cAMP)-response element (CRE) in major immediate-early (MIE) promoter activation, the rate-limiting step in human cytomegalovirus (HCMV) replication. We used two different HCMV genome modification strategies to test this hypothesis in acutely infected cells. We report the following: (i) the CREs do not govern basal levels of MIE promoter activity at a high or low multiplicity of infection (MOI) in human foreskin fibroblast (HFF)- or NTera2-derived neuronal cells; (ii) serum and virion components markedly increase MIE promoter-dependent transcription at a low multiplicity of infection (MOI), but this increase is not mediated by the CREs; (iii) forskolin stimulation of the cAMP signaling pathway induces a two- to threefold increase in MIE RNA levels in a CRE-specific manner at a low MOI in both HFF- and NTera2-derived neuronal cells; and (iv) the CREs do not regulate basal levels of HCMV DNA replication at a high or low MOI in HFF. Their presence does impart a forskolin-induced increase in viral DNA replication at a low MOI but only when basal levels of MIE promoter activity are experimentally diminished. In conclusion, the 19-bp-repeat CREs add to the robust MIE promoter activity that occurs in the acutely infected stimulated cells, although the CREs' greater role may be in other settings.

  15. Effect of baicalein on the expression of VIP in extravillous cytotrophoblasts infected with human cytomegalovirus in vitro.

    PubMed

    Qiao, Yuan; Fang, Jian-guo; Xiao, Juan; Liu, Tao; Liu, Jing; Zhang, Yan-li; Chen, Su-hua

    2013-06-01

    This paper aimed to study the ability of baicalein to block human cytomegalovirus (HCMV) infection in extravillous cytotrophoblasts (EVT) and its effect on the vasoactive intestinal peptide (VIP) expression in HCMV-infected EVT in vitro. A human trophoblast cell line (HPT-8) was chosen in this study. HCMV with 100 TCID50 was added into culture medium to infect HPT-8 cells, and then HCMV pp65 antigen was assayed by immunofluorescence staining. The infection status was determined by virus titration. Real-time quantitative polymerase chain reaction (qRT-PCR) was used to detect virus DNA load in the infected cells. The expression of VIP mRNA and protein in the infected cells was measured by qRT-PCR, immunocytochemistry and Western blotting. Concentration of VIP secreted in supernatants was determined by ELISA. Red-stained HCMV pp65 antigens were found in infected HPT-8 cells 48 h after infection. HCMV replicated in large quantity in infected HPT-8 cells 4 days after infection, reaching a peak at day 6 post-infection. After treatment with baicalein, virus DNA load in infected HPT-8 cells was decreased (P<0.05), and the levels of VIP mRNA and protein, and the concentration were raised to the normal (P>0.05). Our study suggested that baicalein exerts a positive effect on the VIP expression in HCMV-infected EVT at maternal-fetal interface.

  16. Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate.

    PubMed

    Compton, T; Nowlin, D M; Cooper, N R

    1993-04-01

    In this report, we demonstrate that the initial event in human cytomegalovirus (HCMV) infection is attachment to extracellular heparan sulfate. Further, this interaction is important for initiation of infection in fibroblast cells. Using microbinding assays to specifically monitor virus attachment as well as plaque titration assays to measure infectivity, we found that heparin competition as well as enzymatic digestion of cells with heparinase blocked virus attachment, initiation of immediate-early gene expression and infectivity. Other major glycosaminoglycans were found not to be involved in HCMV attachment and infectivity. In addition, HCMV was unable to attach to mutant derivatives of Chinese hamster ovary cells deficient in synthesis of heparan sulfate proteoglycans. Basic fibroblast growth factor, which requires initial interaction with extracellular heparin prior to binding to its high affinity receptor, also inhibited HCMV attachment to cells. Time-course experiments revealed that the initial HCMV binding was sensitive to heparin competition (10 micrograms/ml) or 0.75 M salt washes. The initial heparin-dissociable binding converted rapidly to high affinity (heparin resistant) HCMV attachment. These data suggest that sequential receptor interactions may mediate HCMV adsorption to cells. Heparin affinity chromatography revealed that multiple HCMV envelope glycoproteins, including gB, are capable of binding to heparin.

  17. Bone-marrow-derived mesenchymal stem cells as a target for cytomegalovirus infection: Implications for hematopoiesis, self-renewal and differentiation potential

    SciTech Connect

    Smirnov, Sergey V.; Harbacheuski, Ryhor; Lewis-Antes, Anita; Zhu Hua; Rameshwar, Pranela; Kotenko, Sergei V. . E-mail: kotenkse@umdnj.edu

    2007-03-30

    Mesenchymal stem cells (MSCs) in bone marrow (BM) regulate the differentiation and proliferation of adjacent hematopoietic precursor cells and contribute to the regeneration of mesenchymal tissues, including bone, cartilage, fat and connective tissue. BM is an important site for the pathogenesis of human cytomegalovirus (HCMV) where the virus establishes latency in hematopoietic progenitors and can transmit after reactivation to neighboring cells. Here we demonstrate that BM-MSCs are permissive to productive HCMV infection, and that HCMV alters the function of MSCs: (i) by changing the repertoire of cell surface molecules in BM-MSCs, HCMV modifies the pattern of interaction between BM-MSCs and hematopoietic cells; (ii) HCMV infection of BM-MSCs undergoing adipogenic or osteogenic differentiation impaired the process of differentiation. Our results suggest that by altering BM-MSC biology, HCMV may contribute to the development of various diseases.

  18. EBV, HCMV, HHV6, and HHV7 Screening in Bone Marrow Samples from Children with Acute Lymphoblastic Leukemia

    PubMed Central

    Morales-Sánchez, A.; Pompa-Mera, E. N.; Fajardo-Gutiérrez, A.; Alvarez-Rodríguez, F. J.; Bekker-Méndez, V. C.; Flores-Chapa, J. de Diego; Flores-Lujano, J.; Jiménez-Hernández, E.; Peñaloza-González, J. G.; Rodríguez-Zepeda, M. C.; Torres-Nava, J. R.; Velázquez-Aviña, M. M.; Amador-Sánchez, R.; Alvarado-Ibarra, M.; Reyes-Zepeda, N.; Espinosa-Elizondo, R. M.; Pérez-Saldivar, M. L.; Núñez-Enríquez, J. C.; Mejía-Aranguré, J. M.; Fuentes-Pananá, E. M.

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer in childhood worldwide and Mexico has reported one of the highest incidence rates. An infectious etiology has been suggested and supported by epidemiological evidences; however, the identity of the involved agent(s) is not known. We considered that early transmitted lymphotropic herpes viruses were good candidates, since transforming mechanisms have been described for them and some are already associated with human cancers. In this study we interrogated the direct role of EBV, HCMV, HHV6, and HHV7 human herpes viruses in childhood ALL. Viral genomes were screened in 70 bone marrow samples from ALL patients through standard and a more sensitive nested PCR. Positive samples were detected only by nested PCR indicating a low level of infection. Our result argues that viral genomes were not present in all leukemic cells, and, hence, infection most likely was not part of the initial genetic lesions leading to ALL. The high statistical power of the study suggested that these agents are not involved in the genesis of ALL in Mexican children. Additional analysis showed that detected infections or coinfections were not associated with prognosis. PMID:25309913

  19. EBV, HCMV, HHV6, and HHV7 screening in bone marrow samples from children with acute lymphoblastic leukemia.

    PubMed

    Morales-Sánchez, A; Pompa-Mera, E N; Fajardo-Gutiérrez, A; Alvarez-Rodríguez, F J; Bekker-Méndez, V C; Flores-Chapa, J de Diego; Flores-Lujano, J; Jiménez-Hernández, E; Peñaloza-González, J G; Rodríguez-Zepeda, M C; Torres-Nava, J R; Velázquez-Aviña, M M; Amador-Sánchez, R; Alvarado-Ibarra, M; Reyes-Zepeda, N; Espinosa-Elizondo, R M; Pérez-Saldivar, M L; Núñez-Enríquez, J C; Mejía-Aranguré, J M; Fuentes-Pananá, E M

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer in childhood worldwide and Mexico has reported one of the highest incidence rates. An infectious etiology has been suggested and supported by epidemiological evidences; however, the identity of the involved agent(s) is not known. We considered that early transmitted lymphotropic herpes viruses were good candidates, since transforming mechanisms have been described for them and some are already associated with human cancers. In this study we interrogated the direct role of EBV, HCMV, HHV6, and HHV7 human herpes viruses in childhood ALL. Viral genomes were screened in 70 bone marrow samples from ALL patients through standard and a more sensitive nested PCR. Positive samples were detected only by nested PCR indicating a low level of infection. Our result argues that viral genomes were not present in all leukemic cells, and, hence, infection most likely was not part of the initial genetic lesions leading to ALL. The high statistical power of the study suggested that these agents are not involved in the genesis of ALL in Mexican children. Additional analysis showed that detected infections or coinfections were not associated with prognosis. PMID:25309913

  20. Structure of the HCMV UL16-MICB complex elucidates select binding of a viral immunoevasin to diverse NKG2D ligands.

    PubMed

    Müller, Steffen; Zocher, Georg; Steinle, Alexander; Stehle, Thilo

    2010-01-01

    The activating immunoreceptor NKG2D promotes elimination of infected or malignant cells by cytotoxic lymphocytes through engagement of stress-induced MHC class I-related ligands. The human cytomegalovirus (HCMV)-encoded immunoevasin UL16 subverts NKG2D-mediated immune responses by retaining a select group of diverse NKG2D ligands inside the cell. We report here the crystal structure of UL16 in complex with the NKG2D ligand MICB at 1.8 A resolution, revealing the molecular basis for the promiscuous, but highly selective, binding of UL16 to unrelated NKG2D ligands. The immunoglobulin-like UL16 protein utilizes a three-stranded beta-sheet to engage the alpha-helical surface of the MHC class I-like MICB platform domain. Intriguingly, residues at the center of this beta-sheet mimic a central binding motif employed by the structurally unrelated C-type lectin-like NKG2D to facilitate engagement of diverse NKG2D ligands. Using surface plasmon resonance, we find that UL16 binds MICB, ULBP1, and ULBP2 with similar affinities that lie in the nanomolar range (12-66 nM). The ability of UL16 to bind its ligands depends critically on the presence of a glutamine (MICB) or closely related glutamate (ULBP1 and ULBP2) at position 169. An arginine residue at this position however, as found for example in MICA or ULBP3, would cause steric clashes with UL16 residues. The inability of UL16 to bind MICA and ULBP3 can therefore be attributed to single substitutions at key NKG2D ligand locations. This indicates that selective pressure exerted by viral immunoevasins such as UL16 contributed to the diversification of NKG2D ligands.

  1. Structure of the HCMV UL16-MICB complex elucidates select binding of a viral immunoevasin to diverse NKG2D ligands.

    PubMed

    Müller, Steffen; Zocher, Georg; Steinle, Alexander; Stehle, Thilo

    2010-01-01

    The activating immunoreceptor NKG2D promotes elimination of infected or malignant cells by cytotoxic lymphocytes through engagement of stress-induced MHC class I-related ligands. The human cytomegalovirus (HCMV)-encoded immunoevasin UL16 subverts NKG2D-mediated immune responses by retaining a select group of diverse NKG2D ligands inside the cell. We report here the crystal structure of UL16 in complex with the NKG2D ligand MICB at 1.8 A resolution, revealing the molecular basis for the promiscuous, but highly selective, binding of UL16 to unrelated NKG2D ligands. The immunoglobulin-like UL16 protein utilizes a three-stranded beta-sheet to engage the alpha-helical surface of the MHC class I-like MICB platform domain. Intriguingly, residues at the center of this beta-sheet mimic a central binding motif employed by the structurally unrelated C-type lectin-like NKG2D to facilitate engagement of diverse NKG2D ligands. Using surface plasmon resonance, we find that UL16 binds MICB, ULBP1, and ULBP2 with similar affinities that lie in the nanomolar range (12-66 nM). The ability of UL16 to bind its ligands depends critically on the presence of a glutamine (MICB) or closely related glutamate (ULBP1 and ULBP2) at position 169. An arginine residue at this position however, as found for example in MICA or ULBP3, would cause steric clashes with UL16 residues. The inability of UL16 to bind MICA and ULBP3 can therefore be attributed to single substitutions at key NKG2D ligand locations. This indicates that selective pressure exerted by viral immunoevasins such as UL16 contributed to the diversification of NKG2D ligands. PMID:20090832

  2. Study of Soluble HLA-G in Congenital Human Cytomegalovirus Infection

    PubMed Central

    Gabrielli, Liliana; Bortolotti, Daria; Gentili, Valentina; Piccirilli, Giulia; Chiereghin, Angela; Pavia, Claudia; Bolzani, Silvia; Guerra, Brunella; Simonazzi, Giuliana; Cervi, Francesca; Capretti, Maria Grazia; Luca, Dario Di; Landini, Maria Paola; Lazzarotto, Tiziana

    2016-01-01

    Human leukocyte antigen-G (HLA-G) is a nonclassical HLA class I antigen that is expressed during pregnancy contributing to maternal-fetal tolerance. HLA-G can be expressed as membrane-bound and soluble forms. HLA-G expression increases strongly during viral infections such as congenital human cytomegalovirus (HCMV) infections, with functional consequences in immunoregulation. In this work we investigated the expression of soluble (s)HLA-G and beta-2 microglobulin (component of HLA) molecules in correlation with the risk of transmission and severity of congenital HCMV infection. We analyzed 182 blood samples from 130 pregnant women and 52 nonpregnant women and 56 amniotic fluid samples from women experiencing primary HCMV infection. The median levels of sHLA-G in maternal serum of women with primary HCMV infection were higher in comparison with nonprimary and uninfected pregnant women (p < 0.001). AF from HCMV symptomatic fetuses presented higher sHLA-G levels in comparison with infected asymptomatic fetuses (p < 0.001), presence of HLA-G free-heavy chain, and a concentration gradient from amniotic fluid to maternal blood. No significant statistical difference of beta-2 microglobulin median levels was observed between all different groups. Our results suggest the determination of sHLA-G molecules in both maternal blood and amniotic fluid as a promising biomarker of diagnosis of maternal HCMV primary infection and fetal HCMV disease. PMID:27699182

  3. Study of Soluble HLA-G in Congenital Human Cytomegalovirus Infection

    PubMed Central

    Gabrielli, Liliana; Bortolotti, Daria; Gentili, Valentina; Piccirilli, Giulia; Chiereghin, Angela; Pavia, Claudia; Bolzani, Silvia; Guerra, Brunella; Simonazzi, Giuliana; Cervi, Francesca; Capretti, Maria Grazia; Luca, Dario Di; Landini, Maria Paola; Lazzarotto, Tiziana

    2016-01-01

    Human leukocyte antigen-G (HLA-G) is a nonclassical HLA class I antigen that is expressed during pregnancy contributing to maternal-fetal tolerance. HLA-G can be expressed as membrane-bound and soluble forms. HLA-G expression increases strongly during viral infections such as congenital human cytomegalovirus (HCMV) infections, with functional consequences in immunoregulation. In this work we investigated the expression of soluble (s)HLA-G and beta-2 microglobulin (component of HLA) molecules in correlation with the risk of transmission and severity of congenital HCMV infection. We analyzed 182 blood samples from 130 pregnant women and 52 nonpregnant women and 56 amniotic fluid samples from women experiencing primary HCMV infection. The median levels of sHLA-G in maternal serum of women with primary HCMV infection were higher in comparison with nonprimary and uninfected pregnant women (p < 0.001). AF from HCMV symptomatic fetuses presented higher sHLA-G levels in comparison with infected asymptomatic fetuses (p < 0.001), presence of HLA-G free-heavy chain, and a concentration gradient from amniotic fluid to maternal blood. No significant statistical difference of beta-2 microglobulin median levels was observed between all different groups. Our results suggest the determination of sHLA-G molecules in both maternal blood and amniotic fluid as a promising biomarker of diagnosis of maternal HCMV primary infection and fetal HCMV disease.

  4. The life cycle and pathogenesis of human cytomegalovirus infection: lessons from proteomics

    PubMed Central

    Beltran, Pierre M. Jean; Cristea, Ileana M.

    2015-01-01

    Viruses have co-evolved with their hosts, acquiring strategies to subvert host cellular pathways for effective viral replication and spread. Human cytomegalovirus (HCMV), a widely-spread β-herpesvirus, is a major cause of birth defects and opportunistic infections in HIV-1/AIDS patients. HCMV displays an intricate system-wide modulation of the human cell proteome. An impressive array of virus–host protein interactions occurs throughout the infection. To investigate the virus life cycle, proteomics has recently become a significant component of virology studies. Here, we review the mass spectrometry-based proteomics approaches used in HCMV studies, as well as their contribution to understanding the HCMV life cycle and the virus-induced changes to host cells. The importance of the biological insights gained from these studies clearly demonstrate the impact that proteomics has had and can continue to have on understanding HCMV biology and identifying new therapeutic targets. PMID:25327590

  5. The increased sensitivity of human cytomegalovirus (HCMV) PCR quantitation in whole blood affects reproductive rate (Ro) measurement.

    PubMed

    Gurtler, Volker; Mayall, Barrie C; Wang, Jenny; Ghaly-Derias, Shahbano

    2014-02-01

    In order to determine the effect of the increase in sensitivity of HCMV detection in whole blood compared to plasma on reproductive rate (Ro) measurement, an optimized human cytomegalovirus (HCMV) quantitative PCR assay was developed. The results presented in this study are summarized by the following three methodological improvements: (i) at values below the limit of quantitation (LOQ) of 60copies/ml, determination of HCMV load was more sensitive with whole blood than plasma, (ii) for the determination of viral load, whole blood was more sensitive than plasma below 1000copies/ml but little difference was observed above 1000copies/ml and (iii) the measurement of "Reproductive Rate" can be affected by imprecise measurement of HCMV viral load in either plasma or whole blood compartments depending on whether samples were taken from patients on antiviral treatment or from patients where HCMV load was rising. Taken together this study provides methodological improvements suggesting that below HCMV viral load levels of 1000copies/ml (1640IU/ml) both plasma and whole blood should be tested.

  6. Human cytomegalovirus transcriptome activity differs during replication in human fibroblast, epithelial and astrocyte cell lines

    PubMed Central

    Towler, James C.; Ebrahimi, Bahram; Lane, Brian; Davison, Andrew J.

    2012-01-01

    Broad cell tropism contributes to the pathogenesis of human cytomegalovirus (HCMV), but the extent to which cell type influences HCMV gene expression is unclear. A bespoke HCMV DNA microarray was used to monitor the transcriptome activity of the low passage Merlin strain of HCMV at 12, 24, 48 and 72 h post-infection, during a single round of replication in human fetal foreskin fibroblast cells (HFFF-2s), human retinal pigmented epithelial cells (RPE-1s) and human astrocytoma cells (U373MGs). In order to correlate transcriptome activity with concurrent biological responses, viral cytopathic effect, growth kinetics and genomic loads were examined in the three cell types. The temporal expression pattern of viral genes was broadly similar in HFFF-2s and RPE-1s, but dramatically different in U373MGs. Of the 165 known HCMV protein-coding genes, 41 and 48 were differentially regulated in RPE-1s and U373MGs, respectively, compared with HFFF-2s, and 22 of these were differentially regulated in both RPE-1s and U373MGs. In RPE-1s, all differentially regulated genes were downregulated, but, in U373MGs, some were down- and others upregulated. Differentially regulated genes were identified among the immediate-early, early, early late and true-late viral gene classes. Grouping of downregulated genes according to function at landmark stages of the replication cycle led to the identification of potential bottleneck stages (genome replication, virion assembly, and virion maturation and release) that may account for cell type-dependent viral growth kinetics. The possibility that cell type-specific differences in expressed cellular factors are responsible for modulation of viral gene expression is discussed. PMID:22258857

  7. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner.

    PubMed

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins.

  8. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner

    PubMed Central

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins. PMID:27375569

  9. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner.

    PubMed

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins. PMID:27375569

  10. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.

    PubMed

    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus

    2016-08-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  11. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.

    PubMed

    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus

    2016-08-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection.

  12. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus

    PubMed Central

    Sturgill, Elizabeth R.; Malouli, Daniel; Hansen, Scott G.; Burwitz, Benjamin J.; Schneider, Christine L.; Womack, Jennie L.; Verweij, Marieke C.; Ventura, Abigail B.; Bhusari, Amruta; Jeffries, Krystal M.; Legasse, Alfred W.; Axthelm, Michael K.; Hudson, Amy W.; Sacha, Jonah B.; Picker, Louis J.; Früh, Klaus

    2016-01-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  13. Controversies in the natural history of congenital human cytomegalovirus infection: the paradox of infection and disease in offspring of women with immunity prior to pregnancy.

    PubMed

    Britt, William

    2015-06-01

    Human cytomegalovirus (HCMV) is the most common virus infection in the developing fetus. A fraction of infants infected in utero develop significant life-threatening and organ-threatening disease with over 90% of infected infants exhibiting no clinical evidence of infection in the newborn period. However, about 10% of all infected infants will develop long-term sequelae. Early studies stressed the importance of primary maternal HCMV infection during pregnancy as a critical determinant of intrauterine transmission and outcome. This concept serves as the foundation for the development of prophylactic vaccines and biologics such as HCMV immune globulins. More recently, studies in maternal populations with high HCMV seroprevalence have challenged the concept of protective maternal immunity. Findings from multiple studies suggest that preexisting maternal HCMV immunity provides at best, partial protection from disease in the infected offspring and similarly may have limited impact on intrauterine transmission. This brief review will provide some considerations about the apparent paradox of maternal HCMV immunity and congenital infection.

  14. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.

    1981-04-01

    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  15. Human Papillomavirus Infections in Nonsexually Active Perinatally HIV Infected Children

    PubMed Central

    Puga, Ana; Farhat, Sepideh; Ma, Yifei

    2014-01-01

    Abstract Although human papillomavirus (HPV) infections are common in HIV-infected adults, little is known about children. Our objective was to examine the prevalence of and risks for HPV of the oral mucosal and external genital areas in nonsexually active (NSA) perinatally (P) HIV+ children and compare with HIV-exposed but uninfected (HEU) children. A convenience sample attending a pediatric clinic were enrolled. Samples for HPV were obtained from the oral and anogenital areas and tested for one of 37 HPV types. The mean age of the 48 PHIV+ children was 14.3±3.9 years vs. 6.2±4.8 for the 52 HEU (p<0.001). Of the 23 PHIV+ girls, 30.4% had anogenital and 17% had oral HPV, and of the 27 HEU girls, 2 (7.4%) anogenital and 0 had oral HPV. Of the boys, 4/23 (17.4%) and 1/25 (4%) PHIV+ had anogenital and oral HPV, respectively, and 3/24 (12.5%) and 1/25 (4%) HEU had anogenital and oral HPV, respectively. Rates of HPV did not differ by age among the PHIV+, whereas older HEU were more likely to have HPV than younger HEU (p=0.07). This large age gap precluded statistical comparison by HIV status. The presence of HPV in NSA PHIV+ children may have implications regarding HPV vaccination efficacy. PMID:24460009

  16. Deletion of the Human Cytomegalovirus US17 Gene Increases the Ratio of Genomes per Infectious Unit and Alters Regulation of Immune and Endoplasmic Reticulum Stress Response Genes at Early and Late Times after Infection

    PubMed Central

    Gurczynski, Stephen J.; Das, Subhendu

    2014-01-01

    Human cytomegalovirus (HCMV) employs numerous strategies to combat, subvert, or co-opt host immunity. One evolutionary strategy for this involves capture of a host gene and then its successive duplication and divergence, forming a family of genes, many of which have immunomodulatory activities. The HCMV US12 family consists of 10 tandemly arranged sequence-related genes in the unique short (US) region of the HCMV genome (US12 to US21). Each gene encodes a protein possessing seven predicted transmembrane domains, patches of sequence similarity with cellular G-protein-coupled receptors, and the Bax inhibitor 1 family of antiapoptotic proteins. We show that one member, US17, plays an important role during virion maturation. Microarray analysis of cells infected with a recombinant HCMV isolate with a US17 deletion (the ΔUS17 mutant virus) revealed blunted host innate and interferon responses at early times after infection (12 h postinfection [hpi]), a pattern opposite that previously seen in the absence of the immunomodulatory tegument protein pp65 (pUL83). Although the ΔUS17 mutant virus produced numbers of infectious particles in fibroblasts equal to the numbers produced by the parental virus, it produced >3-fold more genome-containing noninfectious viral particles and delivered increased amounts of pp65 to newly infected cells. These results suggest that US17 has evolved to control virion composition, to elicit an appropriately balanced host immune response. At later time points (96 hpi), ΔUS17 mutant-infected cells displayed aberrant expression of several host endoplasmic reticulum stress response genes and chaperones, some of which are important for the final stages of virion assembly and egress. Our results suggest that US17 modulates host pathways to enable production of virions that elicit an appropriately balanced host immune response. PMID:24335296

  17. Human cytomegalovirus microRNA miR-US25-1-5p inhibits viral replication by targeting multiple cellular genes during infection.

    PubMed

    Jiang, Shujuan; Qi, Ying; He, Rong; Huang, Yujing; Liu, Zhongyang; Ma, Yanping; Guo, Xin; Shao, Yaozhong; Sun, Zhengrong; Ruan, Qiang

    2015-10-01

    MicroRNAs (miRNAs) play important roles in regulating various cellular processes in plants, animals, and viruses. This mechanism is also utilized by human cytomegalovirus (HCMV) in the process of infection and pathogenesis. The HCMV-encoded miRNA, hcmv-miR-US25-1-5p, was highly expressed during lytic and latent infections, and was found to inhibit viral replication. Identification of functional target genes of this microRNA is important in that it will enable a better understanding of the function of hcmv-miR-US25-1-5p during HCMV infection. In the present study, 35 putative cellular transcript targets of hcmv-miR-US25-1-5p were identified. Down-regulation of the targets YWHAE, UBB, NPM1, and HSP90AA1 by hcmv-miR-US25-1-5p was validated by luciferase reporter assay and Western blot analysis. In addition, we showed that hcmv-miR-US25-1-5p could inhibit viral replication by interacting with these targets, the existence of which may impact virus replication directly or indirectly.

  18. HCMV gB shares structural and functional properties with gB proteins from other herpesviruses

    SciTech Connect

    Sharma, Sapna; Wisner, Todd W.; Johnson, David C.; Heldwein, Ekaterina E.

    2013-01-20

    Glycoprotein B (gB) facilitates HCMV entry into cells by binding receptors and mediating membrane fusion. The crystal structures of gB ectodomains from HSV-1 and EBV are available, but little is known about the HCMV gB structure. Using multiangle light scattering and electron microscopy, we show here that HCMV gB ectodomain is a trimer with the overall shape similar to HSV-1 and EBV gB ectodomains. HCMV gB ectodomain forms rosettes similar to rosettes formed by EBV gB and the postfusion forms of other viral fusogens. Substitution of several bulky hydrophobic residues within the putative fusion loops with more hydrophilic residues reduced rosette formation and abolished cell fusion. We propose that like gB proteins from HSV-1 and EBV, HCMV gB has two internal hydrophobic fusion loops that likely interact with target membranes. Our work establishes structural and functional similarities between gB proteins from three subfamilies of herpesviruses.

  19. A Role for 3-O-Sulfated Heparan Sulfate in Promoting Human Cytomegalovirus Infection in Human Iris Cells

    PubMed Central

    Baldwin, John; Maus, Erika; Zanotti, Brian; Volin, Michael V.; Tandon, Ritesh; Shukla, Deepak

    2015-01-01

    Human cytomegalovirus (HCMV) has emerged as a clinically opportunistic pathogen that targets multiple types of ocular cells and tissues, including the iris region of the uveal tract during anterior uveitis. In this report, we used primary cultures of human iris stroma (HIS) cells derived from human eye donors to investigate HCMV entry. The following lines of evidence suggested the role of 3-O-sulfated heparan sulfate (3-OS HS) during HCMV-mediated entry and cell-to-cell fusion in HIS cells. First, 3-O-sulfotransferase-3 (3-OST-3) expression in HIS cells promoted HCMV internalization, while pretreatment of HIS cells with heparinase enzyme or with anti-3-OS HS (G2) peptide significantly reduced the HCMV-mediated formation of plaques/foci. Second, coculture of the HCMV-infected HIS cells with CHO-K1 cells expressing 3-OS HS significantly enhanced cell fusion. Finally, a similar trend of enhanced fusion was observed with cells expressing HCMV glycoproteins (gB, gO, and gH-gL) cocultured with 3-OS HS cells. Taken together, these results highlight the role of 3-OS HS during HCMV plaque formation and cell-to-cell fusion and identify a novel target for future therapeutic interventions. PMID:25717110

  20. Trypsin activation pathway of rotavirus infectivity.

    PubMed Central

    Arias, C F; Romero, P; Alvarez, V; López, S

    1996-01-01

    The infectivity of rotaviruses is increased by and most probably is dependent on trypsin treatment of the virus. This proteolytic treatment specifically cleaves VP4, the protein that forms the spikes on the surface of the virions, to polypeptides VP5 and VP8. This cleavage has been reported to occur in rotavirus SA114fM at two conserved, closely spaced arginine residues located at VP4 amino acids 241 and 247. In this work, we have characterized the VP4 cleavage products of rotavirus SA114S generated by in vitro treatment of the virus with increasing concentrations of trypsin and with proteases AspN and alpha-chymotrypsin. The VP8 and VP5 polypeptides were analyzed by gel electrophoresis and by Western blotting (immunoblotting) with antibodies raised to synthetic peptides that mimic the terminal regions of VP4 generated by the trypsin cleavage. It was shown that in addition to arginine residues 241 and 247, VP4 is cleaved at arginine residue 231. These three sites were found to have different susceptibilities to trypsin, Arg-241 > Arg-231 > Arg-247, with the enhancement of infectivity correlating with cleavage at Arg-247 rather than at Arg-231 or Arg-241. Proteases AspN and alpha-chymotrypsin cleaved VP4 at Asp-242 and Tyr-246, respectively, with no significant enhancement of infectivity, although this enhancement could be achieved by further treatment of the virus with trypsin. The VP4 end products of trypsin treatment were a homogeneous VP8 polypeptide comprising VP4 amino acids 1 to 231 and a heterogeneous VP5, which is formed by two polypeptide species (present at a ratio of approximately 1:5) as a result of cleavage at either Arg-241 or Arg-247. A pathway for the trypsin activation of rotavirus infectivity is proposed. PMID:8709201

  1. Viral affects on metabolism: changes in glucose and glutamine utilization during human cytomegalovirus infection

    PubMed Central

    Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.

    2011-01-01

    Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293

  2. Differential cellular localization of Epstein-Barr virus and human cytomegalovirus in the colonic mucosa of patients with active or quiescent inflammatory bowel disease.

    PubMed

    Ciccocioppo, Rachele; Racca, Francesca; Scudeller, Luigia; Piralla, Antonio; Formagnana, Pietro; Pozzi, Lodovica; Betti, Elena; Vanoli, Alessandro; Riboni, Roberta; Kruzliak, Peter; Baldanti, Fausto; Corazza, Gino Roberto

    2016-02-01

    The role of human cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) in the exacerbation of inflammatory bowel disease (IBD) is still uncertain. We prospectively investigated the presence of EBV and HCMV infection in both epithelial and immune cells of colonic mucosa of IBD patients, both refractory and responders to standard therapies, in comparison with patients suffering from irritable bowel syndrome who were considered as controls, by using quantitative real-time polymerase chain reaction, immunohistochemistry and in situ hybridization, in an attempt to assess viral localization, DNA load, life cycle phase and possible correlation with disease activity indexes. We obtained clear evidence of the presence of high DNA loads of both viruses in either enterocytes or immune cells of refractory IBD patients, whereas we observed low levels in the responder group and an absence of detectable copies in all cell populations of controls. Remarkably, the values of EBV and HCMV DNA in inflamed mucosa were invariably higher than in non-inflamed areas in both IBD groups, and the EBV DNA loads in the cell populations of diseased mucosa of refractory IBD patients positively correlated with the severity of mucosal damage and clinical indexes of activity. Moreover, EBV infection resulted the most prevalent either alone or in combination with HCMV, while immunohistochemistry and in situ hybridization did not allow us to distinguish between the different phases of viral life cycle. Finally, as regards treatment, these novel findings could pave the way for the use of new antiviral molecules in the treatment of this condition. PMID:26659090

  3. TLR9 -1486T/C and 2848C/T SNPs Are Associated with Human Cytomegalovirus Infection in Infants

    PubMed Central

    Paradowska, Edyta; Jabłońska, Agnieszka; Studzińska, Mirosława; Skowrońska, Katarzyna; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Woźniakowska-Gęsicka, Teresa; Nowakowska, Dorota; Gaj, Zuzanna; Wilczyński, Jan; Leśnikowski, Zbigniew J.

    2016-01-01

    Toll-like receptor 9 (TLR9) recognizes non-methylated viral CpG-containing DNA and serves as a pattern recognition receptor that signals the presence of human cytomegalovirus (HCMV). Here, we present the genotype distribution of single-nucleotide polymorphisms (SNPs) of the TLR9 gene in infants and the relationship between TLR9 polymorphisms and HCMV infection. Four polymorphisms (-1237T/C, rs5743836; -1486T/C, rs187084; 1174G/A, rs352139; and 2848C/T, rs352140) in the TLR9 gene were genotyped in 72 infants with symptomatic HCMV infection and 70 healthy individuals. SNP genotyping was performed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Digested fragments were separated and identified by capillary electrophoresis. The HCMV DNA copy number was measured by a quantitative real-time PCR assay. We found an increased frequency of heterozygous genotypes TLR9 -1486T/C and 2848C/T in infants with HCMV infection compared with uninfected cases. Heterozygous variants of these two SNPs increased the risk of HCMV disease in children (P = 0.044 and P = 0.029, respectively). In infants with a mutation present in at least one allele of -1486T/C and 2848C/T SNPs, a trend towards increased risk of cytomegaly was confirmed after Bonferroni’s correction for multiple testing (Pc = 0.063). The rs352139 GG genotype showed a significantly reduced relative risk for HCMV infection (Pc = 0.006). In contrast, the -1237T/C SNP was not related to viral infection. We found no evidence for linkage disequilibrium with the four examined TLR9 SNPs. The findings suggest that the TLR9 -1486T/C and 2848C/T polymorphisms could be a genetic risk factor for the development of HCMV disease. PMID:27105145

  4. MAIT cells are activated during human viral infections.

    PubMed

    van Wilgenburg, Bonnie; Scherwitzl, Iris; Hutchinson, Edward C; Leng, Tianqi; Kurioka, Ayako; Kulicke, Corinna; de Lara, Catherine; Cole, Suzanne; Vasanawathana, Sirijitt; Limpitikul, Wannee; Malasit, Prida; Young, Duncan; Denney, Laura; Moore, Michael D; Fabris, Paolo; Giordani, Maria Teresa; Oo, Ye Htun; Laidlaw, Stephen M; Dustin, Lynn B; Ho, Ling-Pei; Thompson, Fiona M; Ramamurthy, Narayan; Mongkolsapaya, Juthathip; Willberg, Christian B; Screaton, Gavin R; Klenerman, Paul

    2016-01-01

    Mucosal-associated invariant T (MAIT) cells are abundant in humans and recognize bacterial ligands. Here, we demonstrate that MAIT cells are also activated during human viral infections in vivo. MAIT cells activation was observed during infection with dengue virus, hepatitis C virus and influenza virus. This activation-driving cytokine release and Granzyme B upregulation-is TCR-independent but dependent on IL-18 in synergy with IL-12, IL-15 and/or interferon-α/β. IL-18 levels and MAIT cell activation correlate with disease severity in acute dengue infection. Furthermore, HCV treatment with interferon-α leads to specific MAIT cell activation in vivo in parallel with an enhanced therapeutic response. Moreover, TCR-independent activation of MAIT cells leads to a reduction of HCV replication in vitro mediated by IFN-γ. Together these data demonstrate MAIT cells are activated following viral infections, and suggest a potential role in both host defence and immunopathology. PMID:27337592

  5. Dendritic cells in cytomegalovirus infection: viral evasion and host countermeasures.

    PubMed

    Rölle, Alexander; Olweus, Johanna

    2009-05-01

    Human cytomegalovirus (HCMV) is a beta-herpesvirus that infects the majority of the population during early childhood and thereafter establishes life-long latency. Primary infection as well as spontaneous reactivation usually remains asymptomatic in healthy hosts but can, in the context of systemic immunosuppression, result in substantial morbidity and mortality. HCMV counteracts the host immune response by interfering with the recognition of infected cells. A growing body of literature has also suggested that the virus evades the immune system by paralyzing the initiators of antiviral immune responses--the dendritic cells (DCs). In the current review, we discuss the effects of CMV (HCMV and murine CMV) on various DC subsets and the ensuing innate and adaptive immune responses. The impact of HCMV on DCs has mainly been investigated using monocyte-derived DCs, which are rendered functionally impaired by infection. In mouse models, DCs are targets of viral evasion as well, but the complex cross-talk between DCs and natural killer cells has, however, demonstrated an instrumental role for DCs in the control and clearance of viral infection. Fewer studies address the role of peripheral blood DC subsets, plasmacytoid DCs and CD11c+ myeloid DCs in the response against HCMV. These DCs, rather than being paralyzed by HCMV, are largely resistant to infection, mount a vigorous first-line defense and induce T-cell responses to the virus. This possibly provides a partial explanation for an intriguing conundrum: the highly efficient control of viral infection and reactivation in immunocompetent hosts in spite of multi-layered viral evasion mechanisms.

  6. MAIT cells are activated during human viral infections

    PubMed Central

    van Wilgenburg, Bonnie; Scherwitzl, Iris; Hutchinson, Edward C.; Leng, Tianqi; Kurioka, Ayako; Kulicke, Corinna; de Lara, Catherine; Cole, Suzanne; Vasanawathana, Sirijitt; Limpitikul, Wannee; Malasit, Prida; Young, Duncan; Denney, Laura; Barnes, Eleanor; Ball, Jonathan; Burgess, Gary; Cooke, Graham; Dillon, John; Gore, Charles; Foster, Graham; Guha, Neil; Halford, Rachel; Herath, Cham; Holmes, Chris; Howe, Anita; Hudson, Emma; Irving, William; Khakoo, Salim; Koletzki, Diana; Martin, Natasha; Mbisa, Tamyo; McKeating, Jane; McLauchlan, John; Miners, Alec; Murray, Andrea; Shaw, Peter; Simmonds, Peter; Spencer, Chris; Targett-Adams, Paul; Thomson, Emma; Vickerman, Peter; Zitzmann, Nicole; Moore, Michael D.; Fabris, Paolo; Giordani, Maria Teresa; Oo, Ye Htun; Laidlaw, Stephen M.; Dustin, Lynn B.; Ho, Ling-Pei; Thompson, Fiona M.; Ramamurthy, Narayan; Mongkolsapaya, Juthathip; Willberg, Christian B.; Screaton, Gavin R.; Klenerman, Paul

    2016-01-01

    Mucosal-associated invariant T (MAIT) cells are abundant in humans and recognize bacterial ligands. Here, we demonstrate that MAIT cells are also activated during human viral infections in vivo. MAIT cells activation was observed during infection with dengue virus, hepatitis C virus and influenza virus. This activation—driving cytokine release and Granzyme B upregulation—is TCR-independent but dependent on IL-18 in synergy with IL-12, IL-15 and/or interferon-α/β. IL-18 levels and MAIT cell activation correlate with disease severity in acute dengue infection. Furthermore, HCV treatment with interferon-α leads to specific MAIT cell activation in vivo in parallel with an enhanced therapeutic response. Moreover, TCR-independent activation of MAIT cells leads to a reduction of HCV replication in vitro mediated by IFN-γ. Together these data demonstrate MAIT cells are activated following viral infections, and suggest a potential role in both host defence and immunopathology. PMID:27337592

  7. Palmitoylation Strengthens Cholesterol-dependent Multimerization and Fusion Activity of Human Cytomegalovirus Glycoprotein B (gB).

    PubMed

    Patrone, Marco; Coroadinha, Ana Sofia; Teixeira, Ana P; Alves, Paula M

    2016-02-26

    Herpesviruses are a large order of animal enveloped viruses displaying a virion fusion mechanism of unusual complexity. Their multipartite machinery has a conserved core made of the gH/gL ancillary complexes and the homo-trimeric fusion protein glycoprotein B (gB). Despite its essential role in starting the viral infection, gB interaction with membrane lipids is still poorly understood. Here, evidence is provided demonstrating that human cytomegalovirus (HCMV) gB depends on the S-palmitoylation of its endodomain for an efficient interaction with cholesterol-rich membrane patches. We found that, unique among herpesviral gB proteins, the HCMV fusion factor has a Cys residue in the C-terminal region that is palmitoylated and mediates methyl-β-cyclodextrin-sensitive self-association of purified gB. A cholesterol-dependent virus-like particle trap assay, based on co-expression of the HIV Gag protein, confirmed that this post-translational modification is functional in the context of cellular membranes. Mutation of the palmitoylated Cys residue to Ala or inhibition of protein palmitoylation decreased HCMV gB export via Gag particles. Moreover, purified gBC777A showed an increased kinetic sensitivity in a cholesterol depletion test, demonstrating that palmitoyl-gB limits outward cholesterol diffusion. Finally, gB palmitoylation was required for full fusogenic activity in human epithelial cells. Altogether, these results uncover the palmitoylation of HCMV gB and its role in gB multimerization and activity.

  8. Activation of Complement by Cells Infected with Respiratory Syncytial Virus

    PubMed Central

    Smith, Thomas F.; Mcintosh, Kenneth; Fishaut, Mark; Henson, Peter M.

    1981-01-01

    The ability of respiratory syncytial virus (RSV)-infected HEp-2 cells in culture to activate complement was investigated. After incubation of cells with various complement sources and buffer, binding of C3b to surfaces of infected cells was demonstrated by immunofluorescence with a double-staining technique. Nonsyncytial and syncytial (i.e., fused, multinucleated) cells were separately enumerated. Also, lysis of RSV-infected cells was assessed by lactic dehydrogenase release. In this system only RSV-infected cells stained for C3b, and they did so only after incubation with functionally active complement. Blocking of classical pathway activation with ethylenediaminetetraacetic acid diminished the number of infected nonsyncytial cells positively stained for C3b, but had no effect on staining of syncytial cells. Blocking of alternative pathway activation with either zymosan incubation or heat treatment decreased the number of both syncytial and nonsyncytial cells stained for C3b. Decreasing immunoglobulin concentration of the serum used as the complement source also decreased numbers of both cell types stained for C3b. Eliminating specific anti-RSV antibody diminished numbers of both cell types stained for C3b, but staining was not eliminated. Lastly, incubation with functionally active complement markedly increased lactic dehydrogenase release from infected cells. This study demonstrated that RSV-infected nonsyncytial and syncytial cells are able to activate complement by both classical and alternative pathways. Activation of complement by syncytial cells appears to be less dependent on the classical pathway than is activation by nonsyncytial cells, and activation by syncytial cells may require immunoglobulin but not specific antibody. These experiments suggest the possibility of complement activation during respiratory tract infection by RSV. Implications of this are discussed. Images PMID:7263071

  9. A Method for Quantifying Mechanical Properties of Tissue following Viral Infection

    PubMed Central

    Lam, Vy; Bigley, Tarin; Terhune, Scott S.; Wakatsuki, Tetsuro

    2012-01-01

    Viral infection and replication involves the reorganization of the actin network within the host cell. Actin plays a central role in the mechanical properties of cells. We have demonstrated a method to quantify changes in mechanical properties of fabricated model three-dimensional (3D) connective tissue following viral infection. Using this method, we have characterized the impact of infection by the human herpesvirus, cytomegalovirus (HCMV). HCMV is a member of the herpesvirus family and infects a variety of cell types including fibroblasts. In the body, fibroblasts are necessary for maintaining connective tissue and function by creating mechanical force. Using this 3D connective tissue model, we observed that infection disrupted the cell’s ability to generate force and reduced the cumulative contractile force of the tissue. The addition of HCMV viral particles in the absence of both viral gene expression and DNA replication was sufficient to disrupt tissue function. We observed that alterations of the mechanical properties are, in part, due to a disruption of the underlying complex actin microfilament network established by the embedded fibroblasts. Finally, we were able to prevent HCMV-mediated disruption of tissue function by the addition of human immune globulin against HCMV. This study demonstrates a method to quantify the impact of viral infection on mechanical properties which are not evident using conventional cell culture systems. PMID:22870300

  10. Antagonistic Determinants Controlling Replicative and Latent States of Human Cytomegalovirus Infection

    PubMed Central

    Umashankar, Mahadevaiah; Rak, Michael; Bughio, Farah; Zagallo, Patricia; Caviness, Katie

    2014-01-01

    ABSTRACT The mechanisms by which viruses persist and particularly those by which viruses actively contribute to their own latency have been elusive. Here we report the existence of opposing functions encoded by genes within a polycistronic locus of the human cytomegalovirus (HCMV) genome that regulate cell type-dependent viral fates: replication and latency. The locus, referred to as the UL133-UL138 (UL133/8) locus, encodes four proteins, pUL133, pUL135, pUL136, and pUL138. As part of the ULb′ region of the genome, the UL133/8 locus is lost upon serial passage of clinical strains of HCMV in cultured fibroblasts and is therefore considered dispensable for replication in this context. Strikingly, we could not reconstitute infection in permissive fibroblasts from bacterial artificial chromosome clones of the HCMV genome where UL135 alone was disrupted. The loss of UL135 resulted in complex phenotypes and could ultimately be overcome by infection at high multiplicities. The requirement for UL135 but not the entire locus led us to hypothesize that another gene in this locus suppressed virus replication in the absence of UL135. The defect associated with the loss of UL135 was largely rescued by the additional disruption of the UL138 latency determinant, indicating a requirement for UL135 for virus replication when UL138 is expressed. In the CD34+ hematopoietic progenitor model of latency, viruses lacking only UL135 were defective for viral genome amplification and reactivation. Taken together, these data indicate that UL135 and UL138 comprise a molecular switch whereby UL135 is required to overcome UL138-mediated suppression of virus replication to balance states of latency and reactivation. IMPORTANCE Mechanisms by which viruses persist in their host remain one of the most poorly understood phenomena in virology. Herpesviruses, including HCMV, persist in an incurable, latent state that has profound implications for immunocompromised individuals, including transplant

  11. Increased Viral Dissemination in the Brain and Lethality in MCMV-Infected, Dicer-Deficient Neonates

    PubMed Central

    Ostermann, Eleonore; Macquin, Cécile; Krezel, Wojciech; Bahram, Seiamak; Georgel, Philippe

    2015-01-01

    Among Herpesviruses, Human Cytomegalovirus (HCMV or HHV-5) represents a major threat during congenital or neonatal infections, which may lead to encephalitis with serious neurological consequences. However, as opposed to other less prevalent pathogens, the mechanisms and genetic susceptibility factors for CMV encephalitis are poorly understood. This lack of information considerably reduces the prognostic and/or therapeutic possibilities. To easily monitor the effects of genetic defects on brain dissemination following CMV infection we used a recently developed in vivo mouse model based on the neonatal inoculation of a MCMV genetically engineered to express Luciferase. Here, we further validate this protocol for live imaging, and demonstrate increased lethality associated with viral infection and encephalitis in mutant mice lacking Dicer activity. Our data indicate that miRNAs are important players in the control of MCMV pathogenesis and suggest that miRNA-based endothelial functions and integrity are crucial for CMV encephalitis. PMID:25955106

  12. Increased Viral Dissemination in the Brain and Lethality in MCMV-Infected, Dicer-Deficient Neonates.

    PubMed

    Ostermann, Eleonore; Macquin, Cécile; Krezel, Wojciech; Bahram, Seiamak; Georgel, Philippe

    2015-05-01

    Among Herpesviruses, Human Cytomegalovirus (HCMV or HHV-5) represents a major threat during congenital or neonatal infections, which may lead to encephalitis with serious neurological consequences. However, as opposed to other less prevalent pathogens, the mechanisms and genetic susceptibility factors for CMV encephalitis are poorly understood. This lack of information considerably reduces the prognostic and/or therapeutic possibilities. To easily monitor the effects of genetic defects on brain dissemination following CMV infection we used a recently developed in vivo mouse model based on the neonatal inoculation of a MCMV genetically engineered to express Luciferase. Here, we further validate this protocol for live imaging, and demonstrate increased lethality associated with viral infection and encephalitis in mutant mice lacking Dicer activity. Our data indicate that miRNAs are important players in the control of MCMV pathogenesis and suggest that miRNA-based endothelial functions and integrity are crucial for CMV encephalitis. PMID:25955106

  13. Is human cytomegalovirus infection associated with essential hypertension? A meta-analysis of 11,878 participants.

    PubMed

    Wang, Zuoguang; Peng, Xiaoyun; Li, Mei; Jin, Fei; Zhang, Bei; Wang, Hao; Wei, Yongxiang

    2016-05-01

    Human cytomegalovirus (HCMV) has been reported to be highly expressed in essential hypertension (EH), and it has been proposed that HCMV infection may contribute to EH development. However, different studies showed opposite results. The present meta-analysis was performed to investigate the association between HCMV infection and the risk of EH. All relevant literature from 1980 to 2015 was extracted from six electronic databases. Odds ratios (OR) and 95% confidence intervals (CI) were used to assess the strength of the association of HCMV infection and risk of EH. Sensitivity analysis and examination for bias were conducted to evaluate cumulative evidence of the association. The random-effect model using the Mantel-Haenszel method was used to give the individual effect-size estimates. Of the 11,878 participants included in this study, there were 3,864 EH patients and 8,014 control subjects. Meta-analysis of nine studies performed in a random-effect model found that EH patients had a higher risk of HCMV infection than normal control subjects (OR = 1.47, 95%CI: 1.13-1.90, P = 0.004; heterogeneity: I(2)  = 66%, P = 0.002). Sensitivity analysis and bias examination showed the overall quality and consistency of the studies to be acceptable. For subgroup analysis, studies of Chinese populations were selected for further analysis. There was a significant association between HCMV infection and EH among Chinese patients (OR = 2.18, 95%CI:1.43-3.31, P = 0.0003) but not among other ethnic groups (OR = 1.11, 95%CI:0.95-1.31, P = 0.19). These findings provide quantitative support for the association between HCMV infection and high risk of EH in individuals of Chinese ethnicity.

  14. EGFR regulates macrophage activation and function in bacterial infection.

    PubMed

    Hardbower, Dana M; Singh, Kshipra; Asim, Mohammad; Verriere, Thomas G; Olivares-Villagómez, Danyvid; Barry, Daniel P; Allaman, Margaret M; Washington, M Kay; Peek, Richard M; Piazuelo, M Blanca; Wilson, Keith T

    2016-09-01

    EGFR signaling regulates macrophage function, but its role in bacterial infection has not been investigated. Here, we assessed the role of macrophage EGFR signaling during infection with Helicobacter pylori, a bacterial pathogen that causes persistent inflammation and gastric cancer. EGFR was phosphorylated in murine and human macrophages during H. pylori infection. In human gastric tissues, elevated levels of phosphorylated EGFR were observed throughout the histologic cascade from gastritis to carcinoma. Deleting Egfr in myeloid cells attenuated gastritis and increased H. pylori burden in infected mice. EGFR deficiency also led to a global defect in macrophage activation that was associated with decreased cytokine, chemokine, and NO production. We observed similar alterations in macrophage activation and disease phenotype in the Citrobacter rodentium model of murine infectious colitis. Mechanistically, EGFR signaling activated NF-κB and MAPK1/3 pathways to induce cytokine production and macrophage activation. Although deletion of Egfr had no effect on DC function, EGFR-deficient macrophages displayed impaired Th1 and Th17 adaptive immune responses to H. pylori, which contributed to decreased chronic inflammation in infected mice. Together, these results indicate that EGFR signaling is central to macrophage function in response to enteric bacterial pathogens and is a potential therapeutic target for infection-induced inflammation and associated carcinogenesis.

  15. EGFR regulates macrophage activation and function in bacterial infection.

    PubMed

    Hardbower, Dana M; Singh, Kshipra; Asim, Mohammad; Verriere, Thomas G; Olivares-Villagómez, Danyvid; Barry, Daniel P; Allaman, Margaret M; Washington, M Kay; Peek, Richard M; Piazuelo, M Blanca; Wilson, Keith T

    2016-09-01

    EGFR signaling regulates macrophage function, but its role in bacterial infection has not been investigated. Here, we assessed the role of macrophage EGFR signaling during infection with Helicobacter pylori, a bacterial pathogen that causes persistent inflammation and gastric cancer. EGFR was phosphorylated in murine and human macrophages during H. pylori infection. In human gastric tissues, elevated levels of phosphorylated EGFR were observed throughout the histologic cascade from gastritis to carcinoma. Deleting Egfr in myeloid cells attenuated gastritis and increased H. pylori burden in infected mice. EGFR deficiency also led to a global defect in macrophage activation that was associated with decreased cytokine, chemokine, and NO production. We observed similar alterations in macrophage activation and disease phenotype in the Citrobacter rodentium model of murine infectious colitis. Mechanistically, EGFR signaling activated NF-κB and MAPK1/3 pathways to induce cytokine production and macrophage activation. Although deletion of Egfr had no effect on DC function, EGFR-deficient macrophages displayed impaired Th1 and Th17 adaptive immune responses to H. pylori, which contributed to decreased chronic inflammation in infected mice. Together, these results indicate that EGFR signaling is central to macrophage function in response to enteric bacterial pathogens and is a potential therapeutic target for infection-induced inflammation and associated carcinogenesis. PMID:27482886

  16. Schistosoma mansoni, nematode infections, and progression to active tuberculosis among HIV-1-infected Ugandans.

    PubMed

    Brown, Michael; Miiro, George; Nkurunziza, Peter; Watera, Christine; Quigley, Maria A; Dunne, David W; Whitworth, James A G; Elliott, Alison M

    2006-05-01

    Rates of tuberculosis (TB) in Africa are highest among people infected with HIV. Searching for additional risk factors in a cohort of HIV-infected Ugandan adults, we previously found that a type 2 cytokine bias and eosinophilia were associated with progression to active TB. A possible role for helminth infection was assessed in this study. We analyzed TB incidence in 462 members of this cohort who were screened for filarial infections, gastrointestinal nematodes, and schistosomiasis. Progression to TB was not associated with gastrointestinal nematodes (rate ratio [RR], 1.18; confidence intervals [CIs], 0.66-2.10) or Mansonella perstans (RR, 0.42; CI, 0.13-1.34). A weak association between Schistosoma mansoni infection and TB was found (RR, 1.42; CI, 0.86-2.34); after adjusting for potential explanatory variables and using more stringent diagnostic criteria, the association was strengthened (RR, 2.31; 1.00-5.33). This analysis suggests an effect of S. mansoni infection on progression to active TB among HIV-1-infected Ugandans. PMID:16687687

  17. Members of the HCMV US12 family of predicted heptaspanning membrane proteins have unique intracellular distributions, including association with the cytoplasmic virion assembly complex

    SciTech Connect

    Das, Subhendu; Pellett, Philip E. . E-mail: pelletp@ccf.org

    2007-05-10

    The human cytomegalovirus (HCMV) US12 gene family is a group of 10 predicted seven-transmembrane domain proteins that have some features in common with G-protein-coupled receptors. Little is known of their patterns of expression, localization, or functional interactions. Here, we studied the intracellular localization of three US12 family members, US14, US17, and US18, with respect to various intracellular markers and the cytoplasmic virion assembly compartment (AC). The three proteins have distinct patterns of expression, which include associations with the AC. US14 is often distributed in a uniform granular manner throughout the cytoplasm, concentrating in the AC in some cells. US17 is expressed in a segmented manner, with its N-terminal domain localizing to the periphery of what we show here to be the AC and the C-terminal domain localizing to nuclei and the cytoplasm [Das, S., Skomorovska-Prokvolit, Y., Wang, F. Z., Pellett, P.E., 2006. Infection-dependent nuclear localization of US17, a member of the US12 family of human cytomegalovirus-encoded seven-transmembrane proteins. J. Virol. 80, 1191-1203]. Here, we show that the C-terminal domain is present at the center of the AC, in close association with markers of early endosomes; the N-terminal staining corresponds to an area stained by markers for the Golgi and trans-Golgi. US18 is distributed throughout the cytoplasm, concentrating in the AC at later stages of infection; it is localized more to the periphery of the AC than are US14 and US17C, in association with markers of the trans-Golgi. Although not detected in virions, their structures and localization in various zones within the AC suggest possible roles for these proteins in the process of virion maturation and egress.

  18. Active hepatic capsulitis caused by Paragonimus westermani infection.

    PubMed

    Sasaki, Michiro; Kamiyama, Takuro; Yano, Takeshi; Nakamura-Uchiyama, Fukumi; Nawa, Yukifumi

    2002-08-01

    Paragonimiasis is an important re-emerging parasitosis in Japan. Although the lungs and pleural cavity are the principal sites affected with the parasite, ectopic infection can occur in unexpected sites such as skin and brain. This case report describes a patient with active hepatic capsulitis due to Paragonimus westermani infection. The patient was successfully treated with praziquantel at the dose of 75 mg/kg/day for 3 days.

  19. Immune parameters differentiating active from latent tuberculosis infection in humans.

    PubMed

    Lee, Ji Yeon; Jung, Young Won; Jeong, Ina; Joh, Joon-Sung; Sim, Soo Yeon; Choi, Boram; Jee, Hyeon-Gun; Lim, Dong-Gyun

    2015-12-01

    Tuberculosis remains a highly prevalent infectious disease worldwide. Identification of the immune parameters that differentiate active disease from latent infection will facilitate the development of efficient control measures as well as new diagnostic modalities for tuberculosis. Here, we investigated the cytokine production profiles of monocytes and CD4(+) T lymphocytes upon encountering mycobacterial antigens. In addition, cytokines and lipid mediators with immune-modulating activities were examined in plasma samples ex vivo. Comparison of these parameters in active tuberculosis patients and healthy subjects with latent infection revealed that, active tuberculosis was associated with diminished Th1-type cytokine secretion from CD4(+) T cells and less augmented inflammatory cytokine secretion from monocytes induced by IFN-γ than that in latent tuberculosis infection. In addition, a higher plasma concentration of lipoxin A4 and lower ratio of prostaglandin E2 to lipoxin A4 were observed in active cases than in latent infections. These findings have implications for preparing new therapeutic strategies and for differential diagnosis of the two types of tuberculosis infection.

  20. LL-37 immunomodulatory activity during Mycobacterium tuberculosis infection in macrophages.

    PubMed

    Torres-Juarez, Flor; Cardenas-Vargas, Albertina; Montoya-Rosales, Alejandra; González-Curiel, Irma; Garcia-Hernandez, Mariana H; Enciso-Moreno, Jose A; Hancock, Robert E W; Rivas-Santiago, Bruno

    2015-12-01

    Tuberculosis is one of the most important infectious diseases worldwide. The susceptibility to this disease depends to a great extent on the innate immune response against mycobacteria. Host defense peptides (HDP) are one of the first barriers to counteract infection. Cathelicidin (LL-37) is an HDP that has many immunomodulatory effects besides its weak antimicrobial activity. Despite advances in the study of the innate immune response in tuberculosis, the immunological role of LL-37 during M. tuberculosis infection has not been clarified. Monocyte-derived macrophages were infected with M. tuberculosis strain H37Rv and then treated with 1, 5, or 15 μg/ml of exogenous LL-37 for 4, 8, and 24 h. Exogenous LL-37 decreased tumor necrosis factor alpha (TNF-α) and interleukin-17 (IL-17) while inducing anti-inflammatory IL-10 and transforming growth factor β (TGF-β) production. Interestingly, the decreased production of anti-inflammatory cytokines did not reduce antimycobacterial activity. These results are consistent with the concept that LL-37 can modulate the expression of cytokines during mycobacterial infection and this activity was independent of the P2X7 receptor. Thus, LL-37 modulates the response of macrophages during infection, controlling the expression of proinflammatory and anti-inflammatory cytokines.

  1. LL-37 Immunomodulatory Activity during Mycobacterium tuberculosis Infection in Macrophages

    PubMed Central

    Torres-Juarez, Flor; Cardenas-Vargas, Albertina; Montoya-Rosales, Alejandra; González-Curiel, Irma; Garcia-Hernandez, Mariana H.; Enciso-Moreno, Jose A.; Hancock, Robert E. W.

    2015-01-01

    Tuberculosis is one of the most important infectious diseases worldwide. The susceptibility to this disease depends to a great extent on the innate immune response against mycobacteria. Host defense peptides (HDP) are one of the first barriers to counteract infection. Cathelicidin (LL-37) is an HDP that has many immunomodulatory effects besides its weak antimicrobial activity. Despite advances in the study of the innate immune response in tuberculosis, the immunological role of LL-37 during M. tuberculosis infection has not been clarified. Monocyte-derived macrophages were infected with M. tuberculosis strain H37Rv and then treated with 1, 5, or 15 μg/ml of exogenous LL-37 for 4, 8, and 24 h. Exogenous LL-37 decreased tumor necrosis factor alpha (TNF-α) and interleukin-17 (IL-17) while inducing anti-inflammatory IL-10 and transforming growth factor β (TGF-β) production. Interestingly, the decreased production of anti-inflammatory cytokines did not reduce antimycobacterial activity. These results are consistent with the concept that LL-37 can modulate the expression of cytokines during mycobacterial infection and this activity was independent of the P2X7 receptor. Thus, LL-37 modulates the response of macrophages during infection, controlling the expression of proinflammatory and anti-inflammatory cytokines. PMID:26351280

  2. Human Cytomegalovirus US28 Is Important for Latent Infection of Hematopoietic Progenitor Cells

    PubMed Central

    Humby, Monica S.

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) resides latently in hematopoietic progenitor cells (HPCs). During latency, only a subset of HCMV genes is transcribed, including one of the four virus-encoded G protein-coupled receptors (GPCRs), US28. Although US28 is a multifunctional lytic protein, its function during latency has remained undefined. We generated a panel of US28 recombinant viruses in the bacterial artificial chromosome (BAC)-derived clinical HCMV strain TB40/E-mCherry. We deleted the entire US28 open reading frame (ORF), deleted all four of the viral GPCR ORFs, or deleted three of the HCMV GPCRs but not the US28 wild-type protein. Using these recombinant viruses, we assessed the requirement for US28 during latency in the Kasumi-3 in vitro latency model system and in primary ex vivo-cultured CD34+ HPCs. Our data suggest that US28 is required for latency as infection with viruses lacking the US28 ORF alone or in combination with the remaining HCMV-encoded GPCR results in transcription from the major immediate early promoter, the production of extracellular virions, and the production of infectious virus capable of infecting naive fibroblasts. The other HCMV GPCRs are not required for this phenotype as a virus expressing only US28 but not the remaining virus-encoded GPCRs is phenotypically similar to that of wild-type latent infection. Finally, we found that US28 copurifies with mature virions and is expressed in HPCs upon virus entry although its expression at the time of infection does not complement the US28 deletion latency phenotype. This work suggests that US28 protein functions to promote a latent state within hematopoietic progenitor cells. IMPORTANCE Human cytomegalovirus (HCMV) is a widespread pathogen that, once acquired, remains with its host for life. HCMV remains latent, or quiescent, in cells of the hematopoietic compartment and upon immune challenge can reactivate to cause disease. HCMV-encoded US28 is one of several genes expressed during

  3. Toxoplasma gondii Actively Inhibits Neuronal Function in Chronically Infected Mice

    PubMed Central

    Haroon, Fahad; Händel, Ulrike; Angenstein, Frank; Goldschmidt, Jürgen; Kreutzmann, Peter; Lison, Holger; Fischer, Klaus-Dieter; Scheich, Henning; Wetzel, Wolfram; Schlüter, Dirk; Budinger, Eike

    2012-01-01

    Upon infection with the obligate intracellular parasite Toxoplasma gondii, fast replicating tachyzoites infect a broad spectrum of host cells including neurons. Under the pressure of the immune response, tachyzoites convert into slow-replicating bradyzoites, which persist as cysts in neurons. Currently, it is unclear whether T. gondii alters the functional activity of neurons, which may contribute to altered behaviour of T. gondii–infected mice and men. In the present study we demonstrate that upon oral infection with T. gondii cysts, chronically infected BALB/c mice lost over time their natural fear against cat urine which was paralleled by the persistence of the parasite in brain regions affecting behaviour and odor perception. Detailed immunohistochemistry showed that in infected neurons not only parasitic cysts but also the host cell cytoplasm and some axons stained positive for Toxoplasma antigen suggesting that parasitic proteins might directly interfere with neuronal function. In fact, in vitro live cell calcium (Ca2+) imaging studies revealed that tachyzoites actively manipulated Ca2+ signalling upon glutamate stimulation leading either to hyper- or hypo-responsive neurons. Experiments with the endoplasmatic reticulum Ca2+ uptake inhibitor thapsigargin indicate that tachyzoites deplete Ca2+ stores in the endoplasmatic reticulum. Furthermore in vivo studies revealed that the activity-dependent uptake of the potassium analogue thallium was reduced in cyst harbouring neurons indicating their functional impairment. The percentage of non-functional neurons increased over time In conclusion, both bradyzoites and tachyzoites functionally silence infected neurons, which may significantly contribute to the altered behaviour of the host. PMID:22530040

  4. Cytomegalovirus infection does not impact on survival or time to first treatment in patients with chronic lymphocytic leukemia

    PubMed Central

    Damery, Sarah; Hudson, Christopher; Maurer, Matthew J.; Cerhan, James R.; Pachnio, Annette; Begum, Jusnara; Slager, Susan L.; Fegan, Christopher; Man, Stephen; Pepper, Christopher; Shanafelt, Tait D.; Pratt, Guy; Moss, Paul A. H.

    2016-01-01

    Human cytomegalovirus (HCMV) is a widely prevalent herpes virus which establishes a state of chronic infection. The establishment of CMV‐specific immunity controls viral reactivation and leads to the accumulation of very large numbers of virus‐specific T cells which come to dominate the immune repertoire. There is concern that this may reduce the immune response to heterologous infections and HCMV infection has been associated with reduced survival in elderly people. Patients with chronic lymphocytic leukemia (B‐CLL) suffer from a state of immune suppression but have a paradoxical increase in the magnitude of the CMV‐specific T cell and humoral immune response. As such, there is now considerable interest in how CMV infection impacts on the clinical outcome of patients with B‐CLL. Utilizing a large prospective cohort of patients with B‐CLL (n = 347) we evaluated the relationship between HCMV seropositivity and patient outcome. HCMV seropositive patients had significantly worse overall survival than HCMV negative patients in univariate analysis (HR = 2.28, 95% CI: 1.34–3.88; P = 0.002). However, CMV seropositive patients were 4 years older than seronegative donors and this survival difference was lost in multivariate modeling adjusted for age and other validated prognostic markers (P = 0.34). No significant difference was found in multivariate modeling between HCMV positive and negative patients in relation to the time to first treatment (HR = 1.12, 95% CI: 0.68–1.84; P = 0.65). These findings in a second independent cohort of 236 B‐CLL patients were validated. In conclusion no evidence that HCMV impacts on the clinical outcome of patients with B‐CLL was found. Am. J. Hematol. 91:776–781, 2016. © 2016 Wiley Periodicals, Inc. PMID:27124884

  5. Impact of Persistent Cytomegalovirus Infection on Dynamic Changes in Human Immune System Profile

    PubMed Central

    Vescovini, Rosanna; Telera, Anna Rita; Pedrazzoni, Mario; Abbate, Barbara; Rossetti, Pietro; Verzicco, Ignazio; Arcangeletti, Maria Cristina; Medici, Maria Cristina; Calderaro, Adriana; Volpi, Riccardo; Sansoni, Paolo; Fagnoni, Francesco Fausto

    2016-01-01

    Human cytomegalovirus (HCMV) imprints the immune system after primary infection, however its effect during chronic infection still needs to be deciphered. In this study we report the variation of blood cell count along with anti-HCMV IgG and T cell responses to pp-65 and IE-1 antigens, that occurred after an interval of five years in a cohort of 25 seropositive healthy adults. We found increased anti-viral IgG antibody responses and intracellular interferon-gamma secreting CD8+ T cell responses to pp-65: a result consistent with memory inflation. With the only exception of shortage in naive CD8+ T cells most memory T cell subsets as well as total CD8+ T cells, T cells, lymphocytes, monocytes and leukocytes had increased. By contrast, none of the cell types tested were found to have increased in 14 subjects stably seronegative. Rather, in addition to a shortage in naive CD8+ T cells, also memory T cell subsets and most other cell types decreased, either in a statistically significant or non-significant manner. The trend of T cell pool representation with regard to CD4/CD8 ratio was in the opposing directions depending on HCMV serology. Globally, this study demonstrates different dynamic changes of most blood cell types depending on presence or absence of HCMV infection. Therefore, HCMV plays a continual role in modulating homeostasis of blood T cells and a broader expanding effect on other cell populations of lymphoid and myeloid origin. PMID:26990192

  6. Disseminated rhodococcus equi infection in HIV infection despite highly active antiretroviral therapy

    PubMed Central

    2011-01-01

    Background Rhodococcus equi (R.equi) is an acid fast, GRAM + coccobacillus, which is widespread in the soil and causes pulmonary and extrapulmonary infections in immunocompromised people. In the context of HIV infection, R.equi infection (rhodococcosis) is regarded as an opportunistic disease, and its outcome is influenced by highly active antiretroviral therapy (HAART). Case presentation We report two cases of HIV-related rhodococcosis that disseminated despite suppressive HAART and anti-rhodococcal treatment; in both cases there was no immunological recovery, with CD4+ cells count below 200/μL. In the first case, pulmonary rhodococcosis presented 6 months after initiation of HAART, and was followed by an extracerebral intracranial and a cerebral rhodococcal abscess 1 and 8 months, respectively, after onset of pulmonary infection. The second case was characterized by a protracted course with spread of infection to various organs, including subcutaneous tissue, skin, colon and other intra-abdominal tissues, and central nervous system; the spread started 4 years after clinical resolution of a first pulmonary manifestation and progressed over a period of 2 years. Conclusions Our report highlights the importance of an effective immune recovery, despite fully suppressive HAART, along with anti-rhodococcal therapy, in order to clear rhodococcal infection. PMID:22168333

  7. LAG3 Expression in Active Mycobacterium tuberculosis Infections

    PubMed Central

    Phillips, Bonnie L.; Mehra, Smriti; Ahsan, Muhammad H.; Selman, Moises; Khader, Shabaana A.; Kaushal, Deepak

    2016-01-01

    Mycobacterium tuberculosis (MTB) is a highly successful pathogen because of its ability to persist in human lungs for long periods of time. MTB modulates several aspects of the host immune response. Lymphocyte-activation gene 3 (LAG3) is a protein with a high affinity for the CD4 receptor and is expressed mainly by regulatory T cells with immunomodulatory functions. To understand the function of LAG3 during MTB infection, a nonhuman primate model of tuberculosis, which recapitulates key aspects of natural human infection in rhesus macaques (Macaca mulatta), was used. We show that the expression of LAG3 is highly induced in the lungs and particularly in the granulomatous lesions of macaques experimentally infected with MTB. Furthermore, we show that LAG3 expression is not induced in the lungs and lung granulomas of animals exhibiting latent tuberculosis infection. However, simian immunodeficiency virus–induced reactivation of latent tuberculosis infection results in an increased expression of LAG3 in the lungs. This response is not observed in nonhuman primates infected with non-MTB bacterial pathogens, nor with simian immunodeficiency virus alone. Our data show that LAG3 was expressed primarily on CD4+ T cells, presumably by regulatory T cells but also by natural killer cells. The expression of LAG3 coincides with high bacterial burdens and changes in the host type 1 helper T-cell response. PMID:25549835

  8. LAG3 expression in active Mycobacterium tuberculosis infections.

    PubMed

    Phillips, Bonnie L; Mehra, Smriti; Ahsan, Muhammad H; Selman, Moises; Khader, Shabaana A; Kaushal, Deepak

    2015-03-01

    Mycobacterium tuberculosis (MTB) is a highly successful pathogen because of its ability to persist in human lungs for long periods of time. MTB modulates several aspects of the host immune response. Lymphocyte-activation gene 3 (LAG3) is a protein with a high affinity for the CD4 receptor and is expressed mainly by regulatory T cells with immunomodulatory functions. To understand the function of LAG3 during MTB infection, a nonhuman primate model of tuberculosis, which recapitulates key aspects of natural human infection in rhesus macaques (Macaca mulatta), was used. We show that the expression of LAG3 is highly induced in the lungs and particularly in the granulomatous lesions of macaques experimentally infected with MTB. Furthermore, we show that LAG3 expression is not induced in the lungs and lung granulomas of animals exhibiting latent tuberculosis infection. However, simian immunodeficiency virus-induced reactivation of latent tuberculosis infection results in an increased expression of LAG3 in the lungs. This response is not observed in nonhuman primates infected with non-MTB bacterial pathogens, nor with simian immunodeficiency virus alone. Our data show that LAG3 was expressed primarily on CD4(+) T cells, presumably by regulatory T cells but also by natural killer cells. The expression of LAG3 coincides with high bacterial burdens and changes in the host type 1 helper T-cell response.

  9. Reducing implant-related infections: active release strategies.

    PubMed

    Hetrick, Evan M; Schoenfisch, Mark H

    2006-09-01

    Despite sterilization and aseptic procedures, bacterial infection remains a major impediment to the utility of medical implants including catheters, artificial prosthetics, and subcutaneous sensors. Indwelling devices are responsible for over half of all nosocomial infections, with an estimate of 1 million cases per year (2004) in the United States alone. Device-associated infections are the result of bacterial adhesion and subsequent biofilm formation at the implantation site. Although useful for relieving associated systemic infections, conventional antibiotic therapies remain ineffective against biofilms. Unfortunately, the lack of a suitable treatment often leaves extraction of the contaminated device as the only viable option for eliminating the biofilm. Much research has focused on developing polymers that resist bacterial adhesion for use as medical device coatings. This tutorial review focuses on coatings that release antimicrobial agents (i.e., active release strategies) for reducing the incidence of implant-associated infection. Following a brief introduction to bacteria, biofilms, and infection, the development and study of coatings that slowly release antimicrobial agents such as antibiotics, silver ions, antibodies, and nitric oxide are covered. The success and limitations of these strategies are highlighted.

  10. Activity of a phenolic dibenzylsulfide against New World arenavirus infections

    PubMed Central

    Gowen, Brian B; Jung, Kie-Hoon; Sefing, Eric J; Wong, Min-Hui; Westover, Jonna B; Smee, Donald F

    2013-01-01

    Background Junín virus (JUNV) and several other Clade B New World arenaviruses cause human disease ranging from mild febrile illness to severe viral hemorrhagic fever (HF). These viruses pose a significant threat to national security and safe and effective therapies are limited outside of Argentina, where immune plasma is the standard of care for treating JUNV infection in cases of Argentine HF. Methods An in vitro screen of the Chemtura library identified several compounds with activity against Tacaribe virus (TCRV), a Clade B arenavirus closely related to JUNV. Of these compounds, D746, a phenolic dibenzylsulfide, was further pursued for additional in vitro studies and evaluated in the AG129 mouse TCRV infection model. Results D746 was found to act during an early to intermediate stage of the TCRV replication cycle and micromolar range activity was confirmed by virus yield reduction assays with both TCRV and JUNV. Although intraperitoneal twice daily treatment regimens were found to be highly effective when started 2 hours prior to TCRV challenge in AG129 mice, post-exposure treatment initiated 3 days after infection was not efficacious. Interestingly, despite the pre-exposure treatment success, D746 did not reduce serum or tissue virus titers during the acute infection. Moreover, D746 elicited ascites fluid accumulation in mice during, as well as independent of, infection. Conclusions Our findings suggest that D746 may be altering the host response to TCRV infection in AG129 mice in a way that limits pathogenesis and thereby protects mice from otherwise lethal infection in the absence of measurable reductions in viral burden. PMID:23337126

  11. Immune evasion proteins gpUS2 and gpUS11 of human cytomegalovirus incompletely protect infected cells from CD8 T cell recognition.

    PubMed

    Besold, K; Wills, M; Plachter, B

    2009-08-15

    Human cytomegalovirus (HCMV) encodes four glycoproteins, termed gpUS2, gpUS3, gpUS6 and gpUS11 that interfere with MHC class I biosynthesis and antigen presentation. Despite gpUS2-11 expression, however, HCMV infection is efficiently controlled by cytolytic CD8 T lymphocytes (CTL). To address the role of gpUS2 and gpUS11 in antigen presentation during viral infection, HCMV mutants were generated that expressed either gpUS2 or gpUS11 alone without coexpression of the three other proteins. Fibroblasts infected with these viruses showed reduced HLA-A2 and HLA-B7 surface expression. Surprisingly, however, CTL directed against the tegument protein pp65 and the regulatory IE1 protein still recognized and lysed mutant virus infected fibroblasts. Yet, suppression of IE1 derived peptide presentation by gpUS2 or gpUS11 was far more pronounced. The results show that gpUS2 and gpUS11 alone only incompletely protect HCMV infected fibroblasts from CTL recognition and underline the importance of studying infected cells to elucidate HCMV immune evasion.

  12. Activated mouse eosinophils protect against lethal respiratory virus infection

    PubMed Central

    Percopo, Caroline M.; Dyer, Kimberly D.; Ochkur, Sergei I.; Luo, Janice L.; Fischer, Elizabeth R.; Lee, James J.; Lee, Nancy A.; Domachowske, Joseph B.

    2014-01-01

    Eosinophils are recruited to the airways as a prominent feature of the asthmatic inflammatory response where they are broadly perceived as promoting pathophysiology. Respiratory virus infections exacerbate established asthma; however, the role of eosinophils and the nature of their interactions with respiratory viruses remain uncertain. To explore these questions, we established acute infection with the rodent pneumovirus, pneumonia virus of mice (PVM), in 3 distinct mouse models of Th2 cytokine–driven asthmatic inflammation. We found that eosinophils recruited to the airways of otherwise naïve mice in response to Aspergillus fumigatus, but not ovalbumin sensitization and challenge, are activated by and degranulate specifically in response to PVM infection. Furthermore, we demonstrate that activated eosinophils from both Aspergillus antigen and cytokine-driven asthma models are profoundly antiviral and promote survival in response to an otherwise lethal PVM infection. Thus, although activated eosinophils within a Th2-polarized inflammatory response may have pathophysiologic features, they are also efficient and effective mediators of antiviral host defense. PMID:24297871

  13. Marine Peptides and Their Anti-Infective Activities

    PubMed Central

    Kang, Hee Kyoung; Seo, Chang Ho; Park, Yoonkyung

    2015-01-01

    Marine bioresources are a valuable source of bioactive compounds with industrial and nutraceutical potential. Numerous clinical trials evaluating novel chemotherapeutic agents derived from marine sources have revealed novel mechanisms of action. Recently, marine-derived bioactive peptides have attracted attention owing to their numerous beneficial effects. Moreover, several studies have reported that marine peptides exhibit various anti-infective activities, such as antimicrobial, antifungal, antimalarial, antiprotozoal, anti-tuberculosis, and antiviral activities. In the last several decades, studies of marine plants, animals, and microbes have revealed tremendous number of structurally diverse and bioactive secondary metabolites. However, the treatments available for many infectious diseases caused by bacteria, fungi, and viruses are limited. Thus, the identification of novel antimicrobial peptides should be continued, and all possible strategies should be explored. In this review, we will present the structures and anti-infective activity of peptides isolated from marine sources (sponges, algae, bacteria, fungi and fish) from 2006 to the present. PMID:25603351

  14. Effects of atrazine on cercarial longevity, activity, and infectivity.

    PubMed

    Koprivnikar, Janet; Forbes, Mark R; Baker, Robert L

    2006-04-01

    Susceptibility of free-living infective stages of parasites to contaminants is relatively understudied compared with independent effects on measures of host health or immunity, but may be important in affecting prevalence and intensity of parasite infections. We investigated whether atrazine, an herbicide commonly used in North America, affected the cercariae of 4 different species of digenetic trematodes, and found that effects of atrazine concentration on mortality and activity of cercariae varied among species. Mortality of Echinostoma trivolvis increased in a 200 microg/L atrazine solution, and a species of Alaria showed both decreased activity and increased mortality. We also examined whether the ability of E. trivolvis to infect the second intermediate host, larval amphibians, was compromised by atrazine exposure. Longevity and prevalence of E. trivolvis cercariae was affected at 200 microg/L atrazine, whereas intensity of infection in Rana clamitans tadpoles was reduced at both 20 microg/L and 200 microg/L atrazine. Our results indicate that the viability of cercariae of some species is compromised by exposure to atrazine, emphasizing the importance of considering the influence of contaminants on free-living stages of parasites in addressing how environmental degradation may relate to host parasitism.

  15. Gelsolin activity controls efficient early HIV-1 infection

    PubMed Central

    2013-01-01

    Background HIV-1 entry into target lymphocytes requires the activity of actin adaptors that stabilize and reorganize cortical F-actin, like moesin and filamin-A. These alterations are necessary for the redistribution of CD4-CXCR4/CCR5 to one pole of the cell, a process that increases the probability of HIV-1 Envelope (Env)-CD4/co-receptor interactions and that generates the tension at the plasma membrane necessary to potentiate fusion pore formation, thereby favouring early HIV-1 infection. However, it remains unclear whether the dynamic processing of F-actin and the amount of cortical actin available during the initial virus-cell contact are required to such events. Results Here we show that gelsolin restructures cortical F-actin during HIV-1 Env-gp120-mediated signalling, without affecting cell-surface expression of receptors or viral co-receptor signalling. Remarkably, efficient HIV-1 Env-mediated membrane fusion and infection of permissive lymphocytes were impaired when gelsolin was either overexpressed or silenced, which led to a loss or gain of cortical actin, respectively. Indeed, HIV-1 Env-gp120-induced F-actin reorganization and viral receptor capping were impaired under these experimental conditions. Moreover, gelsolin knockdown promoted HIV-1 Env-gp120-mediated aberrant pseudopodia formation. These perturbed-actin events are responsible for the inhibition of early HIV-1 infection. Conclusions For the first time we provide evidence that through its severing of cortical actin, and by controlling the amount of actin available for reorganization during HIV-1 Env-mediated viral fusion, entry and infection, gelsolin can constitute a barrier that restricts HIV-1 infection of CD4+ lymphocytes in a pre-fusion step. These findings provide important insights into the complex molecular and actin-associated dynamics events that underlie early viral infection. Thus, we propose that gelsolin is a new factor that can limit HIV-1 infection acting at a pre-fusion step

  16. Macrophage Activation by Ursolic and Oleanolic Acids during Mycobacterial Infection.

    PubMed

    López-García, Sonia; Castañeda-Sanchez, Jorge Ismael; Jiménez-Arellanes, Adelina; Domínguez-López, Lilia; Castro-Mussot, Maria Eugenia; Hernández-Sanchéz, Javier; Luna-Herrera, Julieta

    2015-08-06

    Oleanolic (OA) and ursolic acids (UA) are triterpenes that are abundant in vegetables, fruits and medicinal plants. They have been described as active moieties in medicinal plants used for the treatment of tuberculosis. In this study, we analyzed the effects of these triterpenes on macrophages infected in vitro with Mycobacterium tuberculosis (MTB). We evaluated production of nitric oxide (NO), reactive oxygen species (ROS), and cytokines (TNF-α and TGF-β) as well as expression of cell membrane receptors (TGR5 and CD36) in MTB-infected macrophages following treatment with OA and UA. Triterpenes caused reduced MTB growth in macrophages, stimulated production of NO and ROS in the early phase, stimulated TNF-α, suppressed TGF-β and caused over-expression of CD36 and TGR5 receptors. Thus, our data suggest immunomodulatory properties of OA and UA on MTB infected macrophages. In conclusion, antimycobacterial effects induced by these triterpenes may be attributable to the conversion of macrophages from stage M2 (alternatively activated) to M1 (classically activated).

  17. Localised mitogenic activity in horses following infection with Streptococcus equi.

    PubMed

    McLean, R; Rash, N L; Robinson, C; Waller, A S; Paillot, R

    2015-06-01

    Streptococcus equi subspecies equi (S. equi) is the causative agent of strangles, a highly contagious upper respiratory disease of equids. Streptococcus equi produces superantigens (sAgs), which are thought to contribute to strangles pathogenicity through non-specific T-cell activation and pro-inflammatory response. Streptococcus equi infection induces abscesses in the lymph nodes of the head and neck. In some individuals, some abscess material remains into the guttural pouch and inspissates over time to form chondroids which can harbour live S. equi. The aim of this study was to determine the sites of sAg production during infection and therefore improve our understanding of their role. Abscess material, chondroids and serum collected from Equidae with signs of strangles were tested in mitogenic assays. Mitogenic sAg activity was only detected in abscess material and chondroids. Our data support the localised in vivo activity of sAg during both acute and carrier phases of S. equi infection.

  18. Macrophage Activation by Ursolic and Oleanolic Acids during Mycobacterial Infection.

    PubMed

    López-García, Sonia; Castañeda-Sanchez, Jorge Ismael; Jiménez-Arellanes, Adelina; Domínguez-López, Lilia; Castro-Mussot, Maria Eugenia; Hernández-Sanchéz, Javier; Luna-Herrera, Julieta

    2015-01-01

    Oleanolic (OA) and ursolic acids (UA) are triterpenes that are abundant in vegetables, fruits and medicinal plants. They have been described as active moieties in medicinal plants used for the treatment of tuberculosis. In this study, we analyzed the effects of these triterpenes on macrophages infected in vitro with Mycobacterium tuberculosis (MTB). We evaluated production of nitric oxide (NO), reactive oxygen species (ROS), and cytokines (TNF-α and TGF-β) as well as expression of cell membrane receptors (TGR5 and CD36) in MTB-infected macrophages following treatment with OA and UA. Triterpenes caused reduced MTB growth in macrophages, stimulated production of NO and ROS in the early phase, stimulated TNF-α, suppressed TGF-β and caused over-expression of CD36 and TGR5 receptors. Thus, our data suggest immunomodulatory properties of OA and UA on MTB infected macrophages. In conclusion, antimycobacterial effects induced by these triterpenes may be attributable to the conversion of macrophages from stage M2 (alternatively activated) to M1 (classically activated). PMID:26287131

  19. Maintenance of Large Numbers of Virus Genomes in Human Cytomegalovirus-Infected T98G Glioblastoma Cells

    PubMed Central

    Duan, Ying-Liang; Ye, Han-Qing; Zavala, Anamaria G.; Yang, Cui-Qing; Miao, Ling-Feng; Fu, Bi-Shi; Seo, Keun Seok; Davrinche, Christian

    2014-01-01

    ABSTRACT After infection, human cytomegalovirus (HCMV) persists for life. Primary infections and reactivation of latent virus can both result in congenital infection, a leading cause of central nervous system birth defects. We previously reported long-term HCMV infection in the T98G glioblastoma cell line (1). HCMV infection has been further characterized in T98Gs, emphasizing the presence of HCMV DNA over an extended time frame. T98Gs were infected with either HCMV Towne or AD169-IE2-enhanced green fluorescent protein (eGFP) strains. Towne infections yielded mixed IE1 antigen-positive and -negative (Ag+/Ag−) populations. AD169-IE2-eGFP infections also yielded mixed populations, which were sorted to obtain an IE2− (Ag−) population. Viral gene expression over the course of infection was determined by immunofluorescent analysis (IFA) and reverse transcription-PCR (RT-PCR). The presence of HCMV genomes was determined by PCR, nested PCR (n-PCR), and fluorescence in situ hybridization (FISH). Compared to the HCMV latency model, THP-1, Towne-infected T98Gs expressed IE1 and latency-associated transcripts for longer periods, contained many more HCMV genomes during early passages, and carried genomes for a greatly extended period of passaging. Large numbers of HCMV genomes were also found in purified Ag− AD169-infected cells for the first several passages. Interestingly, latency transcripts were observed from very early times in the Towne-infected cells, even when IE1 was expressed at low levels. Although AD169-infected Ag− cells expressed no detectable levels of either IE1 or latency transcripts, they also maintained large numbers of genomes within the cell nuclei for several passages. These results identify HCMV-infected T98Gs as an attractive new model in the study of the long-term maintenance of virus genomes in the context of neural cell types. IMPORTANCE Our previous work showed that T98G glioblastoma cells were semipermissive to HCMV infection; virus

  20. 2-Octynoic Acid Inhibits Hepatitis C Virus Infection through Activation of AMP-Activated Protein Kinase

    PubMed Central

    Yang, Darong; Xue, Binbin; Wang, Xiaohong; Yu, Xiaoyan; Liu, Nianli; Gao, Yimin; Liu, Chen; Zhu, Haizhen

    2013-01-01

    Many chronic hepatitis C virus (HCV)-infected patients with current therapy do not clear the virus. It is necessary to find novel treatments. The effect of 2-octynoic acid (2-OA) on HCV infection in human hepatocytes was examined. The mechanism of 2-OA antiviral activity was explored. Our data showed that 2-OA abrogated lipid accumulation in HCV replicon cells and virus-infected hepatocytes. It suppressed HCV RNA replication and infectious virus production with no cytotoxicity to the host cells. 2-OA did not affect hepatitis B virus replication in HepG2.2.15 cells derived from HepG2 cells transfected with full genome of HBV. Further study demonstrated that 2-OA activated AMP-activated protein kinase (AMPK) and inhibited acetyl-CoA carboxylase in viral-infected cells. Compound C, a specific inhibitor of AMPK, inhibited AMPK activity and reversed the reduction of intracellular lipid accumulation and the antiviral effect of 2-OA. Knockdown of AMPK expression by RNA interference abolished the activation of AMPK by 2-OA and blocked 2-OA antiviral activity. Interestingly, 2-OA induced interferon-stimulated genes (ISGs) and inhibited microRNA-122 (miR-122) expression in virus-infected hepatocytes. MiR-122 overexpression reversed the antiviral effect of 2-OA. Furthermore, knockdown of AMPK expression reversed both the induction of ISGs and suppression of miR-122 by 2-OA, implying that activated AMPK induces the intracellular innate response through the induction of ISGs and inhibiting miR-122 expression. 2-OA inhibits HCV infection through regulation of innate immune response by activated AMPK. These findings reveal a novel mechanism by which active AMPK inhibits HCV infection. 2-OA and its derivatives hold promise for novel drug development for chronic hepatitis C. PMID:23741428

  1. Human Ebola virus infection results in substantial immune activation.

    PubMed

    McElroy, Anita K; Akondy, Rama S; Davis, Carl W; Ellebedy, Ali H; Mehta, Aneesh K; Kraft, Colleen S; Lyon, G Marshall; Ribner, Bruce S; Varkey, Jay; Sidney, John; Sette, Alessandro; Campbell, Shelley; Ströher, Ute; Damon, Inger; Nichol, Stuart T; Spiropoulou, Christina F; Ahmed, Rafi

    2015-04-14

    Four Ebola patients received care at Emory University Hospital, presenting a unique opportunity to examine the cellular immune responses during acute Ebola virus infection. We found striking activation of both B and T cells in all four patients. Plasmablast frequencies were 10-50% of B cells, compared with less than 1% in healthy individuals. Many of these proliferating plasmablasts were IgG-positive, and this finding coincided with the presence of Ebola virus-specific IgG in the serum. Activated CD4 T cells ranged from 5 to 30%, compared with 1-2% in healthy controls. The most pronounced responses were seen in CD8 T cells, with over 50% of the CD8 T cells expressing markers of activation and proliferation. Taken together, these results suggest that all four patients developed robust immune responses during the acute phase of Ebola virus infection, a finding that would not have been predicted based on our current assumptions about the highly immunosuppressive nature of Ebola virus. Also, quite surprisingly, we found sustained immune activation after the virus was cleared from the plasma, observed most strikingly in the persistence of activated CD8 T cells, even 1 mo after the patients' discharge from the hospital. These results suggest continued antigen stimulation after resolution of the disease. From these convalescent time points, we identified CD4 and CD8 T-cell responses to several Ebola virus proteins, most notably the viral nucleoprotein. Knowledge of the viral proteins targeted by T cells during natural infection should be useful in designing vaccines against Ebola virus. PMID:25775592

  2. Human Ebola virus infection results in substantial immune activation.

    PubMed

    McElroy, Anita K; Akondy, Rama S; Davis, Carl W; Ellebedy, Ali H; Mehta, Aneesh K; Kraft, Colleen S; Lyon, G Marshall; Ribner, Bruce S; Varkey, Jay; Sidney, John; Sette, Alessandro; Campbell, Shelley; Ströher, Ute; Damon, Inger; Nichol, Stuart T; Spiropoulou, Christina F; Ahmed, Rafi

    2015-04-14

    Four Ebola patients received care at Emory University Hospital, presenting a unique opportunity to examine the cellular immune responses during acute Ebola virus infection. We found striking activation of both B and T cells in all four patients. Plasmablast frequencies were 10-50% of B cells, compared with less than 1% in healthy individuals. Many of these proliferating plasmablasts were IgG-positive, and this finding coincided with the presence of Ebola virus-specific IgG in the serum. Activated CD4 T cells ranged from 5 to 30%, compared with 1-2% in healthy controls. The most pronounced responses were seen in CD8 T cells, with over 50% of the CD8 T cells expressing markers of activation and proliferation. Taken together, these results suggest that all four patients developed robust immune responses during the acute phase of Ebola virus infection, a finding that would not have been predicted based on our current assumptions about the highly immunosuppressive nature of Ebola virus. Also, quite surprisingly, we found sustained immune activation after the virus was cleared from the plasma, observed most strikingly in the persistence of activated CD8 T cells, even 1 mo after the patients' discharge from the hospital. These results suggest continued antigen stimulation after resolution of the disease. From these convalescent time points, we identified CD4 and CD8 T-cell responses to several Ebola virus proteins, most notably the viral nucleoprotein. Knowledge of the viral proteins targeted by T cells during natural infection should be useful in designing vaccines against Ebola virus.

  3. Antiviral activity of lanatoside C against dengue virus infection.

    PubMed

    Cheung, Yan Yi; Chen, Karen Caiyun; Chen, Huixin; Seng, Eng Khuan; Chu, Justin Jang Hann

    2014-11-01

    Dengue infection poses a serious threat globally due to its recent rapid spread and rise in incidence. Currently, there is no approved vaccine or effective antiviral drug for dengue virus infection. In response to the urgent need for the development of an effective antiviral for dengue virus, the US Drug Collection library was screened in this study to identify compounds with anti-dengue activities. Lanatoside C, an FDA approved cardiac glycoside was identified as a candidate anti-dengue compound. Our data revealed that lanatoside C has an IC50 of 0.19μM for dengue virus infection in HuH-7 cells. Dose-dependent reduction in dengue viral RNA and viral proteins synthesis were also observed upon treatment with increasing concentrations of lanatoside C. Time of addition study indicated that lanatoside C inhibits the early processes of the dengue virus replication cycle. Furthermore, lanatoside C can effectively inhibit all four serotypes of dengue virus, flavivirus Kunjin, alphavirus Chikungunya and Sindbis virus as well as the human enterovirus 71. These findings suggest that lanatoside C possesses broad spectrum antiviral activity against several groups of positive-sense RNA viruses.

  4. Epstein-Barr virus infection induces bone resorption in apical periodontitis via increased production of reactive oxygen species.

    PubMed

    Jakovljevic, Aleksandar; Andric, Miroslav; Miletic, Maja; Beljic-Ivanovic, Katarina; Knezevic, Aleksandra; Mojsilovic, Slavko; Milasin, Jelena

    2016-09-01

    Chronic inflammatory processes in periapical tissues caused by etiological agents of endodontic origin lead to apical periodontitis. Apart from bacteria, two herpesviruses, Epstein-Barr virus (EBV) and Human cytomegalovirus (HCMV) are recognized as putative pathogens in apical periodontitis. Although previous reports suggest the involvement of EBV in the pathogenesis of apical periodontitis, its exact role in periapical bone resorption has not yet been fully elucidated. We hypothesize that EBV infection in apical periodontitis is capable of inducing periapical bone resorption via stimulation of reactive oxygen species (ROS) overproduction. Increased levels of ROS induce expression of receptor activator of nuclear factor kappa B (NF-κB) ligand (RANKL). RANKL binding to receptor activator of nuclear factor κB (RANK) present on the surface of preosteoclasts induces their maturation and activation which consequently leads to bone resorption. The potential benefit of antiviral and antioxidant-based therapies in periapical bone resorption treatment remains to be assessed. PMID:27515196

  5. A permanently growing human endothelial cell line supports productive infection with human cytomegalovirus under conditional cell growth arrest.

    PubMed

    Lieber, Diana; Hochdorfer, Daniel; Stoehr, Dagmar; Schubert, Axel; Lotfi, Ramin; May, Tobias; Wirth, Dagmar; Sinzger, Christian

    2015-09-01

    Infection of vascular endothelial cells (ECs) is assumed to contribute to dissemination of human cytomegalovirus (HCMV). Investigation of virus-host interactions in ECs such as human umbilical vein endothelial cells (HUVECs) is limited due to the low maximal passage numbers of these primary cells. We tested a conditionally immortalized EC line (HEC-LTT) and a permanent cell line (EA.hy926) for their susceptibility to HCMV infection. Both cell lines resembled HUVECs in that they allowed for entry and immediate early protein expression of highly endotheliotropic HCMV strains but not of poorly endotheliotropic strains, rendering them suitable for analysis of the viral entry mechanism in ECs. The late phase of viral replication and release, however, was supported by growth-controlled HEC-LTT cells but not by EA.hy926 cells. HEC-LTT cells support both the early and late phase of viral replication and release infectious progeny virus at titers comparable to primary HUVECs; thus, the HEC-LTT cell line is a cell culture model representing the full viral replicative cycle of HCMV in ECs. The implementation of permanent HEC-LTT and EA.hy926 cell lines in HCMV research will facilitate long-term approaches that are not feasible in primary HUVECs.

  6. Massive Activation of Archaeal Defense Genes during Viral Infection

    PubMed Central

    Voet, Marleen; Sismeiro, Odile; Dillies, Marie-Agnes; Jagla, Bernd; Coppée, Jean-Yves; Sezonov, Guennadi; Forterre, Patrick; van der Oost, John; Lavigne, Rob

    2013-01-01

    Archaeal viruses display unusually high genetic and morphological diversity. Studies of these viruses proved to be instrumental for the expansion of knowledge on viral diversity and evolution. The Sulfolobus islandicus rod-shaped virus 2 (SIRV2) is a model to study virus-host interactions in Archaea. It is a lytic virus that exploits a unique egress mechanism based on the formation of remarkable pyramidal structures on the host cell envelope. Using whole-transcriptome sequencing, we present here a global map defining host and viral gene expression during the infection cycle of SIRV2 in its hyperthermophilic host S. islandicus LAL14/1. This information was used, in combination with a yeast two-hybrid analysis of SIRV2 protein interactions, to advance current understanding of viral gene functions. As a consequence of SIRV2 infection, transcription of more than one-third of S. islandicus genes was differentially regulated. While expression of genes involved in cell division decreased, those genes playing a role in antiviral defense were activated on a large scale. Expression of genes belonging to toxin-antitoxin and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas systems was specifically pronounced. The observed different degree of activation of various CRISPR-Cas systems highlights the specialized functions they perform. The information on individual gene expression and activation of antiviral defense systems is expected to aid future studies aimed at detailed understanding of the functions and interplay of these systems in vivo. PMID:23698312

  7. Intrapleural tissue plasminogen activator and deoxyribonuclease therapy for pleural infection.

    PubMed

    Piccolo, Francesco; Popowicz, Natalia; Wong, Donny; Lee, Yun Chor Gary

    2015-06-01

    Pleural infection remains a global health burden associated with significant morbidity. Drainage of the infected pleural fluid is important but can often be hindered by septations and loculations. Intrapleural fibrinolytic therapy alone, to break pleural adhesions, has shown no convincing advantages over placebo in improving clinical outcome. Deoxyribonucleoprotein from degradation of leukocytes contributes significantly to high viscosity of infected pleural fluid. Recombinant deoxyribonuclease (DNase) is effective in reducing pleural fluid viscosity in pre-clinical studies. The combination of tissue plasminogen activator (tPA) and DNase was effective in animal model experiments of empyema. The benefits were established in a randomized clinical trial: those (n=48) treated with tPA/DNase had significantly improved radiological outcomes and reduced need of surgery and duration of hospital stay. A longitudinal observational series of 107 patients further confirmed the effectiveness and safety of tPA/DNase therapy, including its use as 'rescue therapy' when patients failed to respond to antibiotics and chest tube drainage. Overall, a short course of intrapleural tPA (10 mg) and DNase (5 mg) therapy provides a cure in over 90% of patients without requiring surgery. The treatment stimulates pleural fluid formation, enhances radiographic clearance and resolution of systemic inflammation. Serious complications are uncommon; pleural bleeding requiring transfusion occurred in ~2% of cases. Pain can occur, especially with the first dose. Treatment is contraindicated in those with significant bleeding diathesis or a bronchopleural fistula. Future research is required to optimize dosing regimens and in refining patient selection. PMID:26150913

  8. Mitral valve repair for active culture positive infective endocarditis

    PubMed Central

    Doukas, G; Oc, M; Alexiou, C; Sosnowski, A W; Samani, N J; Spyt, T J

    2006-01-01

    Objective To describe the clinical and echocardiographic outcome after mitral valve (MV) repair for active culture positive infective MV endocarditis. Patients and methods Between 1996 and 2004, 36 patients (mean (SD) age 53 (18) years) with positive blood culture up to three weeks before surgery (or positive culture of material removed at operation) and intraoperative evidence of endocarditis underwent MV repair. Staphylococci and streptococci were the most common pathogens. All patients had moderate or severe mitral regurgitation (MR). Mean New York Heart Association (NYHA) class was 2.3 (1.0). Follow up was complete (mean 38 (19) months). Results Operative mortality was 2.8% (one patient). At follow up, endocarditis has not recurred. One patient developed severe recurrent MR and underwent valve replacement and one patient had moderate MR. There were two late deaths, both non‐cardiac. Kaplan‐Meier five year freedom from recurrent moderate to severe MR, freedom from repeat operation, and survival were 94 (4)%, 97 (3)%, and 93 (5)%, respectively. At the most recent review the mean NYHA class was 1.17 (0.3) (p < 0.0001). At the latest echocardiographic evaluation, left atrial diameters, left ventricular end diastolic diameter, and MV diameter were significantly reduced (p < 0.05) compared with preoperative values. Conclusions MV repair for active culture positive endocarditis is associated with low operative mortality and provides satisfactory freedom from recurrent infection, freedom from repeat operation, and survival. Hence, every effort should be made to repair infected MVs and valves should be replaced only when repair is not possible. PMID:15951395

  9. Laboratory and clinical aspects of human herpesvirus 6 infections.

    PubMed

    Agut, Henri; Bonnafous, Pascale; Gautheret-Dejean, Agnès

    2015-04-01

    Human herpesvirus 6 (HHV-6) is a widespread betaherpesvirus which is genetically related to human cytomegalovirus (HCMV) and now encompasses two different species: HHV-6A and HHV-6B. HHV-6 exhibits a wide cell tropism in vivo and, like other herpesviruses, induces a lifelong latent infection in humans. As a noticeable difference with respect to other human herpesviruses, genomic HHV-6 DNA is covalently integrated into the subtelomeric region of cell chromosomes (ciHHV-6) in about 1% of the general population. Although it is infrequent, this may be a confounding factor for the diagnosis of active viral infection. The diagnosis of HHV-6 infection is performed by both serologic and direct methods. The most prominent technique is the quantification of viral DNA in blood, other body fluids, and organs by means of real-time PCR. Many active HHV-6 infections, corresponding to primary infections, reactivations, or exogenous reinfections, are asymptomatic. However, the virus may be the cause of serious diseases, particularly in immunocompromised individuals. As emblematic examples of HHV-6 pathogenicity, exanthema subitum, a benign disease of infancy, is associated with primary infection, whereas further virus reactivations can induce severe encephalitis cases, particularly in hematopoietic stem cell transplant recipients. Generally speaking, the formal demonstration of the causative role of HHV-6 in many acute and chronic human diseases is difficult due to the ubiquitous nature of the virus, chronicity of infection, existence of two distinct species, and limitations of current investigational tools. The antiviral compounds ganciclovir, foscarnet, and cidofovir are effective against active HHV-6 infections, but the indications for treatment, as well as the conditions of drug administration, are not formally approved to date. There are still numerous pending questions about HHV-6 which should stimulate future research works on the pathophysiology, diagnosis, and therapy of

  10. Laboratory and Clinical Aspects of Human Herpesvirus 6 Infections

    PubMed Central

    Bonnafous, Pascale; Gautheret-Dejean, Agnès

    2015-01-01

    SUMMARY Human herpesvirus 6 (HHV-6) is a widespread betaherpesvirus which is genetically related to human cytomegalovirus (HCMV) and now encompasses two different species: HHV-6A and HHV-6B. HHV-6 exhibits a wide cell tropism in vivo and, like other herpesviruses, induces a lifelong latent infection in humans. As a noticeable difference with respect to other human herpesviruses, genomic HHV-6 DNA is covalently integrated into the subtelomeric region of cell chromosomes (ciHHV-6) in about 1% of the general population. Although it is infrequent, this may be a confounding factor for the diagnosis of active viral infection. The diagnosis of HHV-6 infection is performed by both serologic and direct methods. The most prominent technique is the quantification of viral DNA in blood, other body fluids, and organs by means of real-time PCR. Many active HHV-6 infections, corresponding to primary infections, reactivations, or exogenous reinfections, are asymptomatic. However, the virus may be the cause of serious diseases, particularly in immunocompromised individuals. As emblematic examples of HHV-6 pathogenicity, exanthema subitum, a benign disease of infancy, is associated with primary infection, whereas further virus reactivations can induce severe encephalitis cases, particularly in hematopoietic stem cell transplant recipients. Generally speaking, the formal demonstration of the causative role of HHV-6 in many acute and chronic human diseases is difficult due to the ubiquitous nature of the virus, chronicity of infection, existence of two distinct species, and limitations of current investigational tools. The antiviral compounds ganciclovir, foscarnet, and cidofovir are effective against active HHV-6 infections, but the indications for treatment, as well as the conditions of drug administration, are not formally approved to date. There are still numerous pending questions about HHV-6 which should stimulate future research works on the pathophysiology, diagnosis, and

  11. Antimicrobial activity of Lactobacillus against microbial flora of cervicovaginal infections

    PubMed Central

    Dasari, Subramanyam; Shouri, Raju Naidu Devanaboyaina; Wudayagiri, Rajendra; Valluru, Lokanatha

    2014-01-01

    Objective To assess the probiotic nature of Lactobacillus in preventing cervical pathogens by studying the effectiveness of antimicrobial activity against vaginal pathogens. Methods Lactobacilli were isolated from healthy vaginal swabs on selective media and different pathogenic bacteria were isolated by using different selective media. The Lactobacillus strains were tested for the production of hydrogen peroxide and antimicrobial compounds along with probiotic properties. Results Of the 10 isolated Lactobacillus strains, strain 1, 3 and 6 are high hydrogen peroxide producers and the rest were low producers. Results of pH and amines tests indicated that pH increased with fishy odour in the vaginal fluids of cervicovaginal infection patients when compared with vaginal fluids of healthy persons. The isolates were found to be facultative anaerobic, Gram-positive, non-spore-forming, non-capsule forming and catalase-negative bacilli. The results of antimicrobial activity of compounds indicated that 280 and 140 µg/mL was the minimum concentration to inhibit the growth of both pathogens and test organisms respectively. Conclusions The results demonstrated that Lactobacillus producing antimicrobial compounds inhibits the growth of cervical pathogens, revealing that the hypothesis of preventing vaginal infection by administering probiotic organisms has a great appeal to patients, which colonize the vagina to help, restore and maintain healthy vagina.

  12. Discordant humoral and cellular immune responses to Cytomegalovirus (CMV) in glioblastoma patients whose tumors are positive for CMV

    PubMed Central

    Rahbar, Afsar; Peredo, Inti; Solberg, Nina Wolmer; Taher, Chato; Dzabic, Mensur; Xu, Xinling; Skarman, Petra; Fornara, Olesja; Tammik, Charlotte; Yaiw, Koon; Wilhelmi, Vanessa; Assinger, Alice; Stragliotto, Giuseppe; Söderberg-Naucler, Cecilia

    2015-01-01

    Background. Glioblastoma (GBM) is the most common malignant brain tumor in adults and is nearly always fatal. Emerging evidence suggests that human Cytomegalovirus (HCMV) is present in 90–100% of GBMs and that add-on antiviral treatment for HCMV show promise to improve survival. Methods. In a randomized, placebo-controlled trial of valganciclovir in 42 GBM patients, blood samples were collected for analyses of HCMV DNA, RNA, reactivity against HCMV peptides, IgG, and IgM at baseline and at 3, 12, and 24 weeks of treatment. Results. All 42 tumors were positive for HCMV protein. All patients examined had at least one blood sample positive for HCMV DNA, 63% were HCMV RNA positive, and 21% were IgM positive. However, 29% of GBM patients were IgG negative for HCMV. Five of these samples were positive in an enzyme-linked immunosorbent assay (ELISA) that used antigens derived from a clinical isolate. Blood T cells from 11 of 13 (85%) HCMV IgG-negative GBM patients reacted against HCMV peptides. Valganciclovir did not affect IgG titers, DNA, or RNA levels of the HCMV immediate early (HCMV IE) gene in blood. Conclusion. In GBM patients, HCMV activity is higher than in healthy controls and serology is a poor test to define previous or active HCMV infection in these patients. PMID:25949880

  13. Structural changes in human cytomegalovirus cytoplasmic assembly sites in the absence of UL97 kinase activity

    SciTech Connect

    Azzeh, Maysa; Honigman, Alik; Taraboulos, Albert; Rouvinski, Alexander; Wolf, Dana G. . E-mail: wolfd@md.huji.ac.il

    2006-10-10

    Studies of human cytomegalovirus (HCMV) UL97 kinase deletion mutant ({delta}UL97) indicated a multi-step role for this kinase in early and late phases of the viral life cycle, namely, in DNA replication, capsid maturation and nuclear egress. Here, we addressed its possible involvement in cytoplasmic steps of HCMV assembly. Using the {delta}UL97 and the UL97 kinase inhibitor NGIC-I, we demonstrate that the absence of UL97 kinase activity results in a modified subcellular distribution of the viral structural protein assembly sites, from compact structures impacting upon the nucleus to diffuse perinuclear structures punctuated by large vacuoles. Infection by either wild type or {delta}UL97 viruses induced a profound reorganization of wheat germ agglutinin (WGA)-positive Golgi-related structures. Importantly, the viral-induced Golgi remodeling along with the reorganization of the nuclear architecture was substantially altered in the absence of UL97 kinase activity. These findings suggest that UL97 kinase activity might contribute to organization of the viral cytoplasmic assembly sites.

  14. Signal peptide cleavage of a type I membrane protein, HCMV US11, is dependent on its membrane anchor

    PubMed Central

    Rehm, Armin; Stern, Patrick; Ploegh, Hidde L.; Tortorella, Domenico

    2001-01-01

    The human cytomegalovirus (HCMV) US11 polypeptide is a type I membrane glycoprotein that targets major histocompatibility complex (MHC) class I molecules for destruction in a proteasome-dependent manner. Although the US11 signal sequence appears to be a classical N-terminal signal peptide in terms of its sequence and cleavage site, a fraction of newly synthesized US11 molecules retain the signal peptide after the N-linked glycan has been attached and translation of the US11 polypeptide has been completed. Delayed cleavage of the US11 signal peptide is determined by the first four residues, the so-called n-region of the signal peptide. Its replacement with the four N-terminal residues of the H-2Kb signal sequence eliminates delayed cleavage. Surprisingly, a second region that affects the rate and extent of signal peptide cleavage is the transmembrane region close to the C-terminus of US11. Deletion of the transmembrane region of US11 (US11-180) significantly delays processing, a delay overcome by replacement with the H-2Kb signal sequence. Thus, elements at a considerable distance from the signal sequence affect its cleavage. PMID:11285222

  15. Activation of a Pollenin Promoter upon Nematode Infection

    PubMed Central

    Karimi, M.; de Oliveira Manes, C.-L.; Van Montagu, M.; Gheysen, G.

    2002-01-01

    Three glycine-rich protein genes of Arabidopsis thaliana (Atgrp-6, Atgrp-7, and Atgrp-8) that correspond to putative genes coding for pollenins (AtolnB;2, AtolnB;3, and AtolnB;4, respectively) are expressed predominantly in the anthers and, more specifically, in the tapetum layer. Tapetal cells are responsible for nutrition of developing pollen grains and show some functional similarities to nematode feeding sites (NFS) induced in plant roots by sedentary parasitic nematodes. The aim of this study was to analyze promoter activity of the Atgrp genes in NFS. Transformed Arabidopsis plants containing a promoter-ß-glucuronidase (gus) fusion of the Atgrp-7 gene were inoculated with the root-knot nematode Meloidogyne incognita and the cyst nematode Heterodera schachtii. GUS assays were performed at different time points after infection. Histochemical analysis revealed an up-regulation of Atgrp-7-gus expression 3 days after inoculation in the feeding sites of both nematodes. Maximal Atgrp-7-gus staining levels in NFS were observed 1 week after nematode infection. PMID:19265912

  16. Infection.

    PubMed

    Miclau, Theodore; Schmidt, Andrew H; Wenke, Joseph C; Webb, Lawrence X; Harro, Janette M; Prabhakara, Ranjani; Shirtliff, Mark E

    2010-09-01

    Musculoskeletal infection is a clinical problem with significant direct healthcare costs. The prevalence of infection after closed, elective surgery is frequently estimated to be less than 2%, but in severe injuries, posttraumatic infection rates have been reported as 10% or greater. Although clinical infections are found outside the realm of medical devices, it is clear that the enormous increase of infections associated with the use of implants presents a major challenge worldwide. This review summarizes recent advances in the understanding, diagnosis, and treatment of musculoskeletal infections.

  17. Infection of lymphocytes by a virus that aborts cytotoxic T lymphocyte activity and establishes persistent infection

    PubMed Central

    1991-01-01

    For viruses to establish persistent infections in their hosts, they must possess some mechanism for evading clearance by the immune system. When inoculated into adult immunocompetent mice, wild-type lymphocytic choriomeningitis virus (LCMV ARM) induces a CD8(+)-mediated cytotoxic T lymphocyte (CTL) response that clears the infection within 7-14 d (CTL+ [P-]). By contrast, variant viruses isolated from lymphoid tissues of persistently infected mice fail to induce a CTL response and are thus able to establish a persistent infection in adult mice (CTL- [P+]). This report compares the interaction of CTL+ (P-) and CTL- (P+) viruses with cells of the immune system. Both types of virus initially bind to 2-4% of CD4+ and CD8+ T lymphocytes and replicate within cells of both subsets. The replication of CTL- (P+) and CTL+ (P-) viruses in lymphocytes in vivo is similar for the first 5 d after initiating infection. Thereafter, in mice infected with CTL- (P+) variants, lymphocytes retain viral genetic information, and infectious virus can be recovered throughout the animals' lives. In contrast, when adult mice are infected with wild-type CTL+ (P-) LCMV ARM, virus is not recovered from lymphocytes for greater than 7 d after infection. A CD8(+)-mediated anti-LCMV CTL response is induced in such mice. Clearance of infected lymphocytes is produced by these LCMV-specific CTLs, as shown by their ability to lyse lymphocytes expressing LCMV determinants in vitro and the fact that depletion of CD8+ lymphocytes before infection with CTL+ (P-) viruses results in levels of infected lymphocytes similar to those found in undepleted CTL- (P+)-infected mice. Hence, CTL-mediated lysis of T lymphocytes carrying infectious virus is a critical factor determining whether virus persists or the infection is terminated. PMID:1905339

  18. How the heterogeneous infection rate effect on the epidemic spreading in activity-driven network

    NASA Astrophysics Data System (ADS)

    Han, Dun; Li, Dandan; Chen, Chao; Sun, Mei

    2016-01-01

    In this paper, we research the impact of the heterogeneous infection rate on the epidemic spread in the activity-driven networks. By using the mean field approximation, the epidemic threshold is theoretically obtained. Several immunization strategies that could curb the epidemic spread are presented. Based on the theoretical analysis and simulation results, we obtain that the epidemic would be prevented effectively if the infection rate strongly correlates with the individual activity. However, if infection rate has a little correlation with the individual activity, most of the individuals may be infected. In addition, the epidemic can be suppressed soon if the individuals with high activity are immunized preferentially.

  19. Human cytomegalovirus infection leads to elevated levels of transplant arteriosclerosis in a humanized mouse aortic xenograft model.

    PubMed

    Abele-Ohl, S; Leis, M; Wollin, M; Mahmoudian, S; Hoffmann, J; Müller, R; Heim, C; Spriewald, B M; Weyand, M; Stamminger, T; Ensminger, S M

    2012-07-01

    Recent findings emphasized an important role of human cytomegalovirus (HCMV) infection in the development of transplant arteriosclerosis. Therefore, the aim of this study was to develop a human peripheral blood lymphocyte (hu-PBL)/Rag-2(-/-) γc(-/-) mouse-xenograft-model to investigate both immunological as well as viral effector mechanisms in the progression of transplant arteriosclerosis. For this, sidebranches from the internal mammary artery were recovered during coronary artery bypass graft surgery, tissue-typed and infected with HCMV. Then, size-matched sidebranches were implanted into the infrarenal aorta of Rag-2(-/-) γc(-/-) mice. The animals were reconstituted with human peripheral blood mononuclear cells (PBMCs) 7 days after transplantation. HCMV-infection was confirmed by Taqman-PCR and immunofluorescence analyses. Arterial grafts were analyzed by histology on day 40 after transplantation. PBMC-reconstituted Rag-2(-/-) γc(-/-) animals showed splenic chimerism levels ranging from 1-16% human cells. After reconstitution, Rag-2(-/-) γc(-/-) mice developed human leukocyte infiltrates in their grafts and vascular lesions that were significantly elevated after infection. Cellular infiltration revealed significantly increased ICAM-1 and PDGF-R-β expression after HCMV-infection of the graft. Arterial grafts from unreconstituted Rag-2(-/-) γc(-/-) recipients showed no vascular lesions. These data demonstrate a causative relationship between HCMV-infection as an isolated risk factor and the development of transplant-arteriosclerosis in a humanized mouse arterial-transplant-model possibly by elevated ICAM-1 and PDGF-R-β expression.

  20. Aryl-alkyl-lysines: Membrane-Active Small Molecules Active against Murine Model of Burn Infection.

    PubMed

    Ghosh, Chandradhish; Manjunath, Goutham B; Konai, Mohini M; Uppu, Divakara S S M; Paramanandham, Krishnamoorthy; Shome, Bibek R; Ravikumar, Raju; Haldar, Jayanta

    2016-02-12

    Infections caused by drug-resistant Gram-negative pathogens continue to be significant contributors to human morbidity. The recent advent of New Delhi metallo-β-lactamase-1 (blaNDM-1) producing pathogens, against which few drugs remain active, has aggravated the problem even further. This paper shows that aryl-alkyl-lysines, membrane-active small molecules, are effective in treating infections caused by Gram-negative pathogens. One of the compounds of the study was effective in killing planktonic cells as well as dispersing biofilms of Gram-negative pathogens. The compound was extremely effective in disrupting preformed biofilms and did not select resistant bacteria in multiple passages. The compound retained activity in different physiological conditions and did not induce any toxic effect in female Balb/c mice until concentrations of 17.5 mg/kg. In a murine model of Acinetobacter baumannii burn infection, the compound was able to bring the bacterial burden down significantly upon topical application for 7 days. PMID:27624962

  1. Infections of neonatal and adult mice with murine CMV HaNa1 strain upon oronasal inoculation: New insights in the pathogenesis of natural primary CMV infections.

    PubMed

    Xiang, Jun; Zhang, Shunchuan; Nauwynck, Hans

    2016-01-01

    In healthy individuals, naturally acquired infections of human cytomegalovirus (HCMV) are generally asymptomatic. Animal models mimicking the natural primary HCMV infections in infants and adults are scarce. Here, neonatal and adult BALB/c mice were inoculated oronasally with a Belgian isolate HaNa1 of murine cytomegalovirus (MCMV). None of the mice showed clinical symptoms. In neonatal mice, a typical systemic infection occurred. In adult mice, viral replication was restricted to the nasal mucosa and submandibular glands. Infectious virus was not detected in trachea, oral mucosa, pharynx, esophagus, small intestines of both neonatal and adult mice at all time points. Nose was demonstrated to be the entry site. Double immunofluorescence staining showed that in nose infected cells were olfactory neurons and sustentacular cells in olfactory epithelium and were macrophages and dendritic cells in nasopharynx-associated lymphoid tissues (NALT). Neonatal and adult mice developed similar antibody response pattern, though former magnitude was lower. In summary, we have established intranasal (without anesthesia) infections of neonatal and adult mice with murine CMV HaNa1 strain, which mimic the range and extent of virus replication during natural primary HCMV infections in healthy infants and adults. These findings might bring new insights in the pathogenesis of natural primary CMV infections. PMID:26474525

  2. Novel real-time monitoring system for human cytomegalovirus-infected cells in vitro that uses a green fluorescent protein-PML-expressing cell line.

    PubMed

    Ueno, T; Eizuru, Y; Katano, H; Kurata, T; Sata, T; Irie, S; Ogawa-Goto, K

    2006-08-01

    Promyelocytic leukemia (PML) bodies are discrete nuclear foci that are intimately associated with many DNA viruses. In human cytomegalovirus (HCMV) infection, the IE1 (for "immediate-early 1") protein has a marked effect on PML bodies via de-SUMOylation of PML protein. Here, we report a novel real-time monitoring system for HCMV-infected cells using a newly established cell line (SE/15) that stably expresses green fluorescent protein (GFP)-PML protein. In SE/15 cells, HCMV infection causes specific and efficient dispersion of GFP-PML bodies in an IE1-dependent manner, allowing the infected cells to be monitored by fluorescence microscopy without immunostaining. Since a specific change in the detergent solubility of GFP-PML occurs upon infection, the infected cells can be quantified by GFP fluorescence measurement after extraction. With this assay, the inhibitory effects of heparin and neutralizing antibodies were determined in small-scale cultures, indicating its usefulness for screening inhibitory reagents for laboratory virus strains. Furthermore, we established a sensitive imaging assay by counting the number of nuclei containing dispersed GFP-PML, which is applicable for titration of slow-growing clinical isolates. In all strains tested, the virus titers estimated by the GFP-PML imaging assay were well correlated with the plaque-forming cell numbers determined in human embryonic lung cells. Coculture of SE/15 cells and HCMV-infected fibroblasts permitted a rapid and reliable method for estimating the 50% inhibitory concentration values of drugs for clinical isolates in susceptibility testing. Taken together, these results demonstrate the development of a rapid, sensitive, quantitative, and specific detection system for HCMV-infected cells involving a simple procedure that can be used for titration of low-titer clinical isolates.

  3. Hepatitis C Virus Infection Is Associated With an Increased Risk of Active Tuberculosis Disease

    PubMed Central

    Wu, Ping-Hsun; Lin, Yi-Ting; Hsieh, Kun-Pin; Chuang, Hung-Yi; Sheu, Chau-Chyun

    2015-01-01

    Abstract Tuberculosis (TB) and hepatitis C virus (HCV) infection contribute to major disease mortality and morbidity worldwide. However, the causal link between HCV infection and TB risk remains unclear. We conducted a population-based cohort study to elucidate the association between HCV infection and TB disease by analyzing Taiwan National Health Insurance Database. We enrolled 5454 persons with HCV infection and 54,274 age- and sex-matched non-HCV-infected persons between January 1998 and December 2007. Time-dependent Cox proportional hazards regression analysis was used to measure the association between HCV infection and active TB disease. Incidence rate of active TB disease was higher among HCV infection than in control (134.1 vs 89.1 per 100,000 person-years; incidence rate ratio 1.51; P = 0.014). HCV infection was significantly associated with active TB disease in multivariate Cox regression (adjusted hazard ratio [HR] 3.20; 95% confidence interval [CI], 1.85–5.53; P < 0.001) and competing death risk event analysis (adjusted HR 2.11; 95% CI, 1.39–3.20; P < 0.001). Multivariate stratified analysis further revealed that HCV infection was a risk of active TB disease in most strata. This nationwide cohort study suggests that HCV infection is associated with a higher risk of developing active TB disease. PMID:26287416

  4. Human cytomegalovirus function inhibits replication of herpes simplex virus

    SciTech Connect

    Cockley, K.D.; Shiraki, K.; Rapp, F.

    1988-01-01

    Human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of herpes simplex virus type 1 (HSV-1). A delay in HSV replication of 15 h as well as a consistent, almost 3 log inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 h after superinfection were observed compared with controls infected with HSV alone. Treatment of HCMV-infected HEL cells with cycloheximide (100 ..mu..g/ml) for 3 or 24 h was demonstrated effective in blocking HCMV protein synthesis, as shown by immunoprecipitation with HCMV antibody-positive polyvalent serum. Cycloheximide treatment of HCMV-infected HEL cells and removal of the cycloheximide block before superinfection inhibited HSV-1 replication more efficiently than non-drug-treated superinfected controls. HCMV DNA-negative temperature-sensitive mutants restricted HSV as efficiently as wild-type HCMV suggesting that immediate-early and/or early events which occur before viral DNA synthesis are sufficient for inhibition of HSV. Inhibition of HSV-1 in HCMV-infected HEL cells was unaffected by elevated temperature (40.5/sup 0/C). However, prior UV irradiation of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HSV-2 replication was similarly inhibited in HCMV-infected HEL cells. Superinfection of HCMV-infected HEL cells with HSV-1 labeled with (/sup 3/H)thymidine provided evidence that the labeled virus could penetrate to the nucleus of cells after superinfection. Evidence for penetration of superinfecting HSV into HCMV-infected cells was also provided by blot hybridization of HSV DNA synthesized in cells infected with HSV alone versus superinfected cell cultures at 0 and 48 h after superinfection.

  5. Glycolytic control of vacuolar-type ATPase activity: A mechanism to regulate influenza viral infection

    SciTech Connect

    Kohio, Hinissan P.; Adamson, Amy L.

    2013-09-15

    As new influenza virus strains emerge, finding new mechanisms to control infection is imperative. In this study, we found that we could control influenza infection of mammalian cells by altering the level of glucose given to cells. Higher glucose concentrations induced a dose-specific increase in influenza infection. Linking influenza virus infection with glycolysis, we found that viral replication was significantly reduced after cells were treated with glycolytic inhibitors. Addition of extracellular ATP after glycolytic inhibition restored influenza infection. We also determined that higher levels of glucose promoted the assembly of the vacuolar-type ATPase within cells, and increased vacuolar-type ATPase proton-transport activity. The increase of viral infection via high glucose levels could be reversed by inhibition of the proton pump, linking glucose metabolism, vacuolar-type ATPase activity, and influenza viral infection. Taken together, we propose that altering glucose metabolism may be a potential new approach to inhibit influenza viral infection. - Highlights: • Increased glucose levels increase Influenza A viral infection of MDCK cells. • Inhibition of the glycolytic enzyme hexokinase inhibited Influenza A viral infection. • Inhibition of hexokinase induced disassembly the V-ATPase. • Disassembly of the V-ATPase and Influenza A infection was bypassed with ATP. • The state of V-ATPase assembly correlated with Influenza A infection of cells.

  6. High Human Cytomegalovirus IgG Level is Associated with Increased Incidence of Diabetic Atherosclerosis in Type 2 Diabetes Mellitus Patients

    PubMed Central

    Zhang, Jun; Liu, Yuan-yuan; Sun, Hui-ling; Li, Shan; Xiong, Hai-rong; Yang, Zhan-qiu; Xiang, Guang-da; Jiang, Xiao-jing

    2015-01-01

    Background At present, whether human cytomegalovirus (HCMV) infection is associated with type 2 diabetes mellitus (T2DM) is debatable. The effect of active HCMV infection on glucose regulation has been poorly studied. Although HCMV infection is correlated with atherosclerosis in cardiovascular disease, the role of HCMV infection in the development of diabetic atherosclerosis in T2DM is unclear and is usually neglected by endocrinologists. The aim of this study was to assess the effects of HCMV infection on glucose regulation and the development of diabetic atherosclerosis in T2DM patients. Material/Methods A total of 222 hospitalized T2DM patients were enrolled. Nested polymerase chain reactions were used to detect HCMV DNA extracted from peripheral blood leukocytes. Quantitative real-time PCR was used to determine viral load. HCMV IgG antibody concentrations were analyzed by chemiluminescence immunoassay. Results HCMV active infection, viral load, and HCMV IgG titers were not correlated with glucose regulation. Binary logistic regression demonstrated that the highest quartile of HCMV IgG concentration (>500 U/ml) was correlated with the incidence of diabetic atherosclerosis (OR: 8.0, 95%CI: 2.3–27.2), and that titer >127U/ml of HCMV IgG is an independent predictor for the development of diabetic atherosclerosis in T2DM patients (OR: 4.6, 95%CI: 1.9–11.3) after adjustment for all potential confounding factors. Conclusions Active HCMV infection is unlikely to influence glucose regulation in T2DM. However, HCMV IgG titers are associated with the incidence of diabetic atherosclerosis, and titer >127U/ml of HCMV IgG might be an independent risk factor for the development of diabetic atherosclerosis in T2DM patients. PMID:26717490

  7. Macrophage Activation Redirects Yersinia-Infected Host Cell Death from Apoptosis to Caspase-1-Dependent Pyroptosis

    PubMed Central

    Bergsbaken, Tessa; Cookson, Brad T

    2007-01-01

    Infection of macrophages by Yersinia species results in YopJ-dependent apoptosis, and naïve macrophages are highly susceptible to this form of cell death. Previous studies have demonstrated that macrophages activated with lipopolysaccharide (LPS) prior to infection are resistant to YopJ-dependent cell death; we found this simultaneously renders macrophages susceptible to killing by YopJ− Yersinia pseudotuberculosis (Yptb). YopJ− Yptb-induced macrophage death was dependent on caspase-1 activation, resulting in rapid permeability to small molecules, followed by membrane breakdown and DNA damage, and accompanied by cleavage and release of proinflammatory interleukin-18. Induction of caspase-1-dependent death, or pyroptosis, required the bacterial type III translocon but none of its known translocated proteins. Wild-type Yptb infection also triggered pyroptosis: YopJ-dependent activation of proapoptotic caspase-3 was significantly delayed in activated macrophages and resulted in caspase-1-dependent pyroptosis. The transition to susceptibility was not limited to LPS activation; it was also seen in macrophages activated with other Toll-like receptor (TLR) ligands and intact nonviable bacteria. Yptb infection triggered macrophage activation and activation of caspase-1 in vivo. Y. pestis infection of activated macrophages also stimulated caspase-1 activation. These results indicate that host signaling triggered by TLR and other activating ligands during the course of Yersinia infection redirects both the mechanism of host cell death and the downstream consequences of death by shifting from noninflammatory apoptosis to inflammatory pyroptosis. PMID:17983266

  8. Neutrophil cell death, activation and bacterial infection in cystic fibrosis

    PubMed Central

    Watt, A; Courtney, J; Moore, J; Ennis, M; Elborn, J

    2005-01-01

    Background: Cystic fibrosis (CF) is characterised by chronic endobronchial bacterial infection and neutrophil mediated inflammation. Neutrophil apoptosis is essential for the resolution of inflammation. This study assessed the relationship between levels of neutrophil apoptosis and sputum microbiology in matched clinically stable patients with CF. Methods: Sputum was induced from 34 patients (nine with no Gram negative infection, 10 colonised with Pseudomonas aeruginosa, 10 with Burkholderia cenocepacia, and five with other infections). Apoptotic neutrophils measured by flow cytometric Annexin V/propidium iodide staining and morphology were similar in all groups. Results: Patients infected with P aeruginosa or B cenocepacia had a significantly lower percentage of viable neutrophils in the sputum than those with no Gram negative infection (Kruskal-Wallis p = 0.01, median (interquartile range (IQR)) 14.2% (9.4–21.6), 15.8% (12.3–19.5), and 48.4% (23.0–66.4); p = 0.003 and p = 0.002, respectively). They also had significantly higher levels of secondary necrotic granulocytes in sputum than patients with no Gram negative infection (Kruskal-Wallis p<0.0001, median (IQR) 55.5% (48.4–64.5), 50.4% (44.6–61.9), and 24.8% (14.4–30.5); p<0.0001 and p<0.0001, respectively). Neutrophils (x106/g sputum) in P aeruginosa infected patients (Kruskal-Wallis p = 0.05, median (IQR) 6.3 (3.5–12.7)) and B cenocepacia infected patients (5.7 (1.5–14.5)) were significantly higher than in the group with no Gram negative infection (0.5 (0.5–4.3), p = 0.03 and 0.04, respectively). Conclusion: These results suggest that cell death and clearance may be altered in patients with CF colonised with P aeruginosa and B cenocepacia compared with those with no Gram negative infection. PMID:16061707

  9. Decreased Flight Activity in Culex pipiens (Diptera: Culicidae) Naturally Infected With Culex flavivirus.

    PubMed

    Newman, Christina M; Anderson, Tavis K; Goldberg, Tony L

    2016-01-01

    Insect-specific flaviviruses (ISFVs) commonly infect vectors of mosquito-borne arboviruses. To investigate whether infection with an ISFV might affect mosquito flight behavior, we quantified flight behavior in Culex pipiens L. naturally infected with Culex flavivirus (CxFV). We observed a significant reduction in the scotophase (dark hours) flight activity of CxFV-positive mosquitoes relative to CxFV-negative mosquitoes, but only a marginal reduction in photophase (light hours) flight activity, and no change in the circadian pattern of flight activity. These results suggest that CxFV infection alters the flight activity of naturally infected Cx. pipiens most dramatically when these vectors are likely to be host seeking and may therefore affect the transmission of medically important arboviruses.

  10. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions

    PubMed Central

    Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  11. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions.

    PubMed

    Tirosh, Osnat; Cohen, Yifat; Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus.

  12. Determination of Urinary Neopterin/Creatinine Ratio to Distinguish Active Tuberculosis from Latent Mycobacterium tuberculosis Infection

    PubMed Central

    Eisenhut, Michael; Hargreaves, Dougal S.; Scott, Anne; Housley, David; Walters, Andrew; Mulla, Rohinton

    2016-01-01

    Background. Biomarkers to distinguish latent from active Mycobacterium (M.) tuberculosis infection in clinical practice are lacking. The urinary neopterin/creatinine ratio can quantify the systemic interferon-gamma effect in patients with M. tuberculosis infection. Methods. In a prospective observational study, urinary neopterin levels were measured by enzyme linked immunosorbent assay in patients with active tuberculosis, in people with latent M. tuberculosis infection, and in healthy controls and the urinary neopterin/creatinine ratio was calculated. Results. We included a total of 44 patients with M. tuberculosis infection and nine controls. 12 patients had active tuberculosis (8 of them culture-confirmed). The median age was 15 years (range 4.5 to 49). Median urinary neopterin/creatinine ratio in patients with active tuberculosis was 374.1 micromol/mol (129.0 to 1072.3), in patients with latent M. tuberculosis infection it was 142.1 (28.0 to 384.1), and in controls it was 146.0 (40.3 to 200.0), with significantly higher levels in patients with active tuberculosis (p < 0.01). The receiver operating characteristics curve had an area under the curve of 0.84 (95% CI 0.70 to 0.97) (p < 0.01). Conclusions. Urinary neopterin/creatinine ratios are significantly higher in patients with active tuberculosis compared to patients with latent infection and may be a significant predictor of active tuberculosis in patients with M. tuberculosis infection. PMID:27433370

  13. Effects of immunomodulators on functional activity of innate immunity cells infected with Streptococcus pneumoniae.

    PubMed

    Plekhova, N G; Kondrashova, N M; Somova, L M; Drobot, E I; Lyapun, I N

    2015-02-01

    Low activity of bactericidal enzymes was found in innate immunity cells infected with S. pneumonia. The death of these cells was fastened under these conditions. On the contrary, treatment with antibiotic maxifloxacin was followed by an increase in activity of bactericidal enzymes in phagocytes and induced their death via necrosis. Analysis of the therapeutic properties of immunomodulators tinrostim and licopid in combination with maxifloxacin showed that these combinations correct functional activity of cells infected with S. pneumonia. PMID:25708326

  14. Salamanders increase their feeding activity when infected with the pathogenic chytrid fungus Batrachochytrium dendrobatidis.

    PubMed

    Hess, Alexandra; McAllister, Caroline; DeMarchi, Joseph; Zidek, Makenzie; Murone, Julie; Venesky, Matthew D

    2015-10-27

    Immune function is a costly line of defense against parasitism. When infected with a parasite, hosts frequently lose mass due to these costs. However, some infected hosts (e.g. highly resistant individuals) can clear infections with seemingly little fitness losses, but few studies have tested how resistant hosts mitigate these costly immune defenses. We explored this topic using eastern red-backed salamanders Plethodon cinereus and the fungal pathogen Batrachochytrium dendrobatidis (Bd). Bd is generally lethal for amphibians, and stereotypical symptoms of infection include loss in mass and deficits in feeding. However, individuals of P. cinereus can clear their Bd infections with seemingly few fitness costs. We conducted an experiment in which we repeatedly observed the feeding activity of Bd-infected and non-infected salamanders. We found that Bd-infected salamanders generally increased their feeding activity compared to non-infected salamanders. The fact that we did not observe any differences in mass change between the treatments suggests that increased feeding might help Bd-infected salamanders minimize the costs of an effective immune response.

  15. Salamanders increase their feeding activity when infected with the pathogenic chytrid fungus Batrachochytrium dendrobatidis.

    PubMed

    Hess, Alexandra; McAllister, Caroline; DeMarchi, Joseph; Zidek, Makenzie; Murone, Julie; Venesky, Matthew D

    2015-10-27

    Immune function is a costly line of defense against parasitism. When infected with a parasite, hosts frequently lose mass due to these costs. However, some infected hosts (e.g. highly resistant individuals) can clear infections with seemingly little fitness losses, but few studies have tested how resistant hosts mitigate these costly immune defenses. We explored this topic using eastern red-backed salamanders Plethodon cinereus and the fungal pathogen Batrachochytrium dendrobatidis (Bd). Bd is generally lethal for amphibians, and stereotypical symptoms of infection include loss in mass and deficits in feeding. However, individuals of P. cinereus can clear their Bd infections with seemingly few fitness costs. We conducted an experiment in which we repeatedly observed the feeding activity of Bd-infected and non-infected salamanders. We found that Bd-infected salamanders generally increased their feeding activity compared to non-infected salamanders. The fact that we did not observe any differences in mass change between the treatments suggests that increased feeding might help Bd-infected salamanders minimize the costs of an effective immune response. PMID:26503775

  16. Infection of goats with goatpox virus triggers host antiviral defense through activation of innate immune signaling.

    PubMed

    Zeng, Xiancheng; Wang, Song; Chi, Xiaojuan; Chen, Shi-long; Huang, Shile; Lin, Qunqun; Xie, Baogui; Chen, Ji-Long

    2016-02-01

    Goatpox, caused by goatpox virus (GTPV), is one of the most serious infectious diseases associated with high morbidity and mortality in goats. However, little is known about involvement of host innate immunity during the GTPV infection. For this, goats were experimentally infected with GTPV. The results showed that GTPV infection significantly induced mRNA expression of type I interferon (IFN)-α and IFN-β in peripheral blood lymphocytes, spleen and lung. In addition, GTPV infection enhanced expression of several inflammatory cytokines, including interleukin (IL)-1β, IL-6, IL-18; and tumor necrosis factor-α (TNF-α). Strikingly, infection with GTPV activated signal transducers and activators of transcription 3 (STAT3), a critical cytokine signaling molecule. Interestingly, the virus infection induced expression of suppressor of cytokine signaling (SOCS)-1. Importantly, the infection resulted in an increased expression of some critical interferon-stimulated genes, such as interferon-induced transmembrane protein (IFITM) 1, IFITM3, interferon stimulated gene (ISG) 15 and ISG20. Furthermore, we found that infection with GTPV up-regulated expression of Toll-like receptor (TLR) 2 and TLR9. These results revealed that GTPV infection activated host innate immune signaling and thereby triggered antiviral innate immunity. The findings provide novel insights into complex mechanisms underlying GTPV-host interaction and pathogenesis of GTPV. PMID:26850535

  17. Tetherin/BST-2 promotes dendritic cell activation and function during acute retrovirus infection

    PubMed Central

    Li, Sam X.; Barrett, Bradley S.; Guo, Kejun; Kassiotis, George; Hasenkrug, Kim J.; Dittmer, Ulf; Gibbert, Kathrin; Santiago, Mario L.

    2016-01-01

    Tetherin/BST-2 is a host restriction factor that inhibits retrovirus release from infected cells in vitro by tethering nascent virions to the plasma membrane. However, contradictory data exists on whether Tetherin inhibits acute retrovirus infection in vivo. Previously, we reported that Tetherin-mediated inhibition of Friend retrovirus (FV) replication at 2 weeks post-infection correlated with stronger natural killer, CD4+ T and CD8+ T cell responses. Here, we further investigated the role of Tetherin in counteracting retrovirus replication in vivo. FV infection levels were similar between wild-type (WT) and Tetherin KO mice at 3 to 7 days post-infection despite removal of a potent restriction factor, Apobec3/Rfv3. However, during this phase of acute infection, Tetherin enhanced myeloid dendritic cell (DC) function. DCs from infected, but not uninfected, WT mice expressed significantly higher MHC class II and the co-stimulatory molecule CD80 compared to Tetherin KO DCs. Tetherin-associated DC activation during acute FV infection correlated with stronger NK cell responses. Furthermore, Tetherin+ DCs from FV-infected mice more strongly stimulated FV-specific CD4+ T cells ex vivo compared to Tetherin KO DCs. The results link the antiretroviral and immunomodulatory activity of Tetherin in vivo to improved DC activation and MHC class II antigen presentation. PMID:26846717

  18. Infection.

    PubMed

    Saigal, Gaurav; Nagornaya, Natalya; Post, M Judith D

    2016-01-01

    Imaging is useful in the diagnosis and management of infections of the central nervous system. Typically, imaging findings at the outset of the disease are subtle and nonspecific, but they often evolve to more definite imaging patterns in a few days, with less rapidity than for stroke but faster than for neoplastic lesions. This timing is similar to that of noninfectious inflammatory brain disease, such as multiple sclerosis. Fortunately, imaging patterns help to distinguish the two kinds of processes. Other than for sarcoidosis, the meninges are seldom involved in noninfectious inflammation; in contrast, many infectious processes involve the meninges, which then enhance with contrast on computed tomography (CT) or magnetic resonance imaging (MRI). However, brain infection causes a vast array of imaging patterns. Although CT is useful when hemorrhage or calcification is suspected or bony detail needs to be determined, MRI is the imaging modality of choice in the investigation of intracranial infections. Imaging sequences such as diffusion-weighted imaging help in accurately depicting the location and characterizing pyogenic infections and are particularly useful in differentiating bacterial infections from other etiologies. Susceptibility-weighted imaging is extremely useful for the detection of hemorrhage. Although MR spectroscopy findings can frequently be nonspecific, certain conditions such as bacterial abscesses show a relatively specific spectral pattern and are useful in diagnosing and constituting immediate therapy. In this chapter we review first the imaging patterns associated with involvement of various brain structures, such as the epidural and subdural spaces, the meninges, the brain parenchyma, and the ventricles. Involvement of these regions is illustrated with bacterial infections. Next we illustrate the patterns associated with viral and prion diseases, followed by mycobacterial and fungal infections, to conclude with a review of imaging findings

  19. Activation of Hypoxia Inducible Factor 1 Is a General Phenomenon in Infections with Human Pathogens

    PubMed Central

    Werth, Nadine; Beerlage, Christiane; Rosenberger, Christian; Yazdi, Amir S.; Edelmann, Markus; Amr, Amro; Bernhardt, Wanja; von Eiff, Christof; Becker, Karsten; Schäfer, Andrea; Peschel, Andreas; Kempf, Volkhard A. J.

    2010-01-01

    Background Hypoxia inducible factor (HIF)-1 is the key transcriptional factor involved in the adaptation process of cells and organisms to hypoxia. Recent findings suggest that HIF-1 plays also a crucial role in inflammatory and infectious diseases. Methodology/Principal Findings Using patient skin biopsies, cell culture and murine infection models, HIF-1 activation was determined by immunohistochemistry, immunoblotting and reporter gene assays and was linked to cellular oxygen consumption. The course of a S. aureus peritonitis was determined upon pharmacological HIF-1 inhibition. Activation of HIF-1 was detectable (i) in all ex vivo in biopsies of patients suffering from skin infections, (ii) in vitro using cell culture infection models and (iii) in vivo using murine intravenous and peritoneal S. aureus infection models. HIF-1 activation by human pathogens was induced by oxygen-dependent mechanisms. Small colony variants (SCVs) of S. aureus known to cause chronic infections did not result in cellular hypoxia nor in HIF-1 activation. Pharmaceutical inhibition of HIF-1 activation resulted in increased survival rates of mice suffering from a S. aureus peritonitis. Conclusions/Significance Activation of HIF-1 is a general phenomenon in infections with human pathogenic bacteria, viruses, fungi and protozoa. HIF-1-regulated pathways might be an attractive target to modulate the course of life-threatening infections. PMID:20644645

  20. Group B Streptococcal Infection and Activation of Human Astrocytes

    PubMed Central

    Stoner, Terri D.; Weston, Thomas A.; Trejo, JoAnn; Doran, Kelly S.

    2015-01-01

    Background Streptococcus agalactiae (Group B Streptococcus, GBS) is the leading cause of life-threatening meningitis in human newborns in industrialized countries. Meningitis results from neonatal infection that occurs when GBS leaves the bloodstream (bacteremia), crosses the blood-brain barrier (BBB), and enters the central nervous system (CNS), where the bacteria contact the meninges. Although GBS is known to invade the BBB, subsequent interaction with astrocytes that physically associate with brain endothelium has not been well studied. Methodology/Principal Findings We hypothesize that human astrocytes play a unique role in GBS infection and contribute to the development of meningitis. To address this, we used a well- characterized human fetal astrocyte cell line, SVG-A, and examined GBS infection in vitro. We observed that all GBS strains of representative clinically dominant serotypes (Ia, Ib, III, and V) were able to adhere to and invade astrocytes. Cellular invasion was dependent on host actin cytoskeleton rearrangements, and was specific to GBS as Streptococcus gordonii failed to enter astrocytes. Analysis of isogenic mutant GBS strains deficient in various cell surface organelles showed that anchored LTA, serine-rich repeat protein (Srr1) and fibronectin binding (SfbA) proteins all contribute to host cell internalization. Wild-type GBS also displayed an ability to persist and survive within an intracellular compartment for at least 12 h following invasion. Moreover, GBS infection resulted in increased astrocyte transcription of interleukin (IL)-1β, IL-6 and VEGF. Conclusions/Significance This study has further characterized the interaction of GBS with human astrocytes, and has identified the importance of specific virulence factors in these interactions. Understanding the role of astrocytes during GBS infection will provide important information regarding BBB disruption and the development of neonatal meningitis. PMID:26030618

  1. Behçet's disease diagnosed after acute HIV infection: viral replication activating underlying autoimmunity?

    PubMed

    Roscoe, Clay; Kinney, Rebecca; Gilles, Ryan; Blue, Sky

    2015-05-01

    Behçet's disease is an autoimmune systemic vasculitis that can occur after exposure to infectious agents. Behçet's disease also has been associated with HIV infection, including de novo development of this condition during chronic HIV infection and resolution of Behçet's disease symptoms following initiation of antiretroviral therapy. We describe a patient who presented with systemic vasculitis with skin and mucous membrane ulcerations in the setting of acute HIV infection, who was eventually diagnosed with Behçet's disease, demonstrating a possible link between acute HIV infection, immune activation and development of autoimmunity.

  2. Activation of small ruminant aortic endothelial cells after in vitro infection by caprine arthritis encephalitis virus.

    PubMed

    Jan, C L; Greenland, T; Gounel, F; Balleydier, S; Mornex, J F

    2000-12-01

    Small ruminants infected by the lentiviruses caprine arthritis-encephalitis virus (CAEV), originally isolated from a goat, or maedi-visna virus, originally from sheep, typically develop an organising lymphoid infiltration of affected tissues. This could reflect modulation of the migration pattern of lymphocytes in infected animals. Possible active contribution by vascular endothelial cells was investigated using an in vitro model. Low-passage cultured ovine aortic endothelium proved susceptible to productive infection by CAEV without significant cytotoxicity. Infected endothelial cells maintained expression of endothelial markers, increased MHC class I antigen expression and initiated expression of the adhesion molecule VCAM -1 and, at a late stage, MHC class II antigens. Infected endothelial cells showed a two-fold increase in binding capacity for sheep peripheral blood leucocytes over uninfected controls. Such events could contribute to the tissue distribution of lymphoid cells and local immune responses in lentiviral infections of small ruminants. PMID:11124093

  3. Decline in HIV infectivity following the introduction of highly active antiretroviral therapy

    PubMed Central

    Porco, Travis C.; Martin, Jeffrey N.; Page-Shafer, Kimberly A.; Cheng, Amber; Charlebois, Edwin; Grant, Robert M.; Osmond, Dennis H.

    2008-01-01

    Objective Little is known about the degree to which widespread use of antiretroviral therapy in a community reduces uninfected individuals’ risk of acquiring HIV. We estimated the degree to which the probability of HIV infection from an infected partner (the infectivity) declined following the introduction of highly active antiretroviral therapy (HAART) in San Francisco. Design Homosexual men from the San Francisco Young Men’s Health Study, who were initially uninfected with HIV, were asked about sexual practices, and tested for HIV antibodies at each of four follow-up visits during a 6-year period spanning the advent of widespread use of HAART (1994 to 1999). Methods We estimated the infectivity of HIV (per-partnership probability of transmission from an infected partner) using a probabilistic risk model based on observed incident infections and self-reported sexual risk behavior, and tested the hypothesis that infectivity was the same before and after HAART was introduced. Results A total of 534 homosexual men were evaluated. Decreasing trends in HIV seroincidence were observed despite increases in reported number of unprotected receptive anal intercourse partners. Conservatively assuming a constant prevalence of HIV infection between 1994 and 1999, HIV infectivity decreased from 0.120 prior to widespread use of HAART, to 0.048 after the widespread use of HAART – a decline of 60% (P = 0.028). Conclusions Use of HAART by infected persons in a community appears to reduce their infectiousness and therefore may provide an important HIV prevention tool. PMID:15090833

  4. From Wasting to Obesity: The Contribution of Nutritional Status to Immune Activation in HIV Infection.

    PubMed

    Koethe, John R; Heimburger, Douglas C; PrayGod, George; Filteau, Suzanne

    2016-10-01

    The impact of human immunodeficiency virus (HIV) infection on innate and adaptive immune activation occurs in the context of host factors, which serve to augment or dampen the physiologic response to the virus. Independent of HIV infection, nutritional status, particularly body composition, affects innate immune activation through a variety of conditions, including reduced mucosal barrier defenses and microbiome dysbiosis in malnutrition and the proinflammatory contribution of adipocytes and stromal vascular cells in obesity. Similarly, T-cell activation, proliferation, and cytokine expression are reduced in the setting of malnutrition and increased in obesity, potentially due to adipokine regulatory mechanisms restraining energy-avid adaptive immunity in times of starvation and exerting a paradoxical effect in overnutrition. The response to HIV infection is situated within these complex interactions between host nutritional health and immunologic function, which contribute to the varied phenotypes of immune activation among HIV-infected patients across a spectrum from malnutrition to obesity.

  5. From Wasting to Obesity: The Contribution of Nutritional Status to Immune Activation in HIV Infection.

    PubMed

    Koethe, John R; Heimburger, Douglas C; PrayGod, George; Filteau, Suzanne

    2016-10-01

    The impact of human immunodeficiency virus (HIV) infection on innate and adaptive immune activation occurs in the context of host factors, which serve to augment or dampen the physiologic response to the virus. Independent of HIV infection, nutritional status, particularly body composition, affects innate immune activation through a variety of conditions, including reduced mucosal barrier defenses and microbiome dysbiosis in malnutrition and the proinflammatory contribution of adipocytes and stromal vascular cells in obesity. Similarly, T-cell activation, proliferation, and cytokine expression are reduced in the setting of malnutrition and increased in obesity, potentially due to adipokine regulatory mechanisms restraining energy-avid adaptive immunity in times of starvation and exerting a paradoxical effect in overnutrition. The response to HIV infection is situated within these complex interactions between host nutritional health and immunologic function, which contribute to the varied phenotypes of immune activation among HIV-infected patients across a spectrum from malnutrition to obesity. PMID:27625434

  6. Effects of malaria (Plasmodium relicturm) on activity budgets of experimentally-infected juvenile Apapane (Himatione sanquinea)

    USGS Publications Warehouse

    Yorinks, N.; Atkinson, C.T.

    2000-01-01

    We used behavioral, physiological, and parasitological measures to document effects of acute malarial infections on activity budgets of experimentally infected juvenile Apapane (Himatione sanguinea). Five of eight birds died within 20 to 32 days after exposure to a single infective mosquito bite. Infected Apapane devoted less time to locomotory activities involving flight, walking or hopping, and stationary activities such as singing, preening, feeding, and probing. The amount of time spent sitting was positively correlated with parasitemia and increased dramatically after infection and between treatment and control groups. Birds that succumbed to infection experienced a significant loss of body mass and subcutaneous fat, whereas surviving Apapane were better able to maintain body condition and fat levels. When rechallenged with the parasite five months after initial infection, surviving birds experienced no increase in parasitemia, indicating that they had become immune to reinfection. Regardless of the outcome, infected birds experienced acute illness that would have left them unable to forage or to escape from predators in the wild.

  7. The Relationship between Active Trachoma and Ocular Chlamydia trachomatis Infection before and after Mass Antibiotic Treatment

    PubMed Central

    Ramadhani, Athumani M.; Derrick, Tamsyn; Macleod, David; Holland, Martin J.; Burton, Matthew J.

    2016-01-01

    Background Trachoma is a blinding disease, initiated in early childhood by repeated conjunctival infection with the obligate intracellular bacterium Chlamydia trachomatis. The population prevalence of the clinical signs of active trachoma; ‘‘follicular conjunctivitis” (TF) and/or ‘‘intense papillary inflammation” (TI), guide programmatic decisions regarding the initiation and cessation of mass drug administration (MDA). However, the persistence of TF following resolution of infection at both the individual and population level raises concerns over the suitability of this clinical sign as a marker for C. trachomatis infection. Methodology/Principle Findings We systematically reviewed the literature for population-based studies and those including randomly selected individuals, which reported the prevalence of the clinical signs of active trachoma and ocular C. trachomatis infection by nucleic acid amplification test. We performed a meta-analysis to assess the relationship between active trachoma and C. trachomatis infection before and after MDA. TF and C. trachomatis infection were strongly correlated prior to MDA (r = 0.92, 95%CI 0.83 to 0.96, p<0.0001); the relationship was similar when the analysis was limited to children. A moderate correlation was found between TI and prevalence of infection. Following MDA, the relationship between TF and infection prevalence was weaker (r = 0.60, 95%CI 0.25 to 0.81, p = 0.003) and there was no correlation between TI and C. trachomatis infection. Conclusions/Significance Prior to MDA, TF is a good indicator of the community prevalence of C. trachomatis infection. Following MDA, the prevalence of TF tends to overestimate the underlying infection prevalence. In order to prevent unnecessary additional rounds of MDA and to accurately ascertain when elimination goals have been reached, a cost-effective test for C. trachomatis that can be administered in low-resource settings remains desirable. PMID:27783678

  8. Houttuynia cordata blocks HSV infection through inhibition of NF-κB activation.

    PubMed

    Chen, Xiaoqing; Wang, Zhongxia; Yang, Ziying; Wang, Jingjing; Xu, Yunxia; Tan, Ren-Xiang; Li, Erguang

    2011-11-01

    Houttuynia cordata Thunb. is a medicinal plant widely used in folk medicine in several Asian countries. It has been reported that a water extract of H. cordata exhibits activity against herpes simplex virus (HSV) and the virus of severe acute respiratory syndrome (SARS), although the mechanisms are not fully understood yet. Previous studies have demonstrated absolute requirement of NF-κB activation for efficient replication of HSV-1 and HSV-2 and inhibition of NF-κB activation has been shown to suppress HSV infection. Here we show that a hot water extract of H. cordata (HCWE) inhibits HSV-2 infection through inhibition of NF-κB activation. The IC(50) was estimated at 50 μg/ml of lyophilized HCWE powder. At 150 and 450 μg/ml, HCWE blocked infectious HSV-2 production by more than 3 and 4 logs, respectively. The inhibitory activity was concomitant with an inhibition of NF-κB activation by HSV-2 infection. Although activation of NF-κB and Erk MAPK has been implicated for HSV replication and growth, HCWE showed no effect on HSV-2-induced Erk activation. Furthermore, we show that treatment with quercetin, quercitrin or isoquercitrin, major water extractable flavonoids from H. cordata, significantly blocked HSV-2 infection. These results together demonstrated that H. cordata blocks HSV-2 infection through inhibition of NF-κB activation. PMID:21951655

  9. High frequency of Human Cytomegalovirus DNA in the Liver of Infants with Extrahepatic Neonatal Cholestasis

    PubMed Central

    De Tommaso, Adriana MA; Andrade, Paula D; Costa, Sandra CB; Escanhoela, Cecília AF; Hessel, Gabriel

    2005-01-01

    Background Biliary atresia (BA) is the most severe hepatic disorder in newborns and its etiopathogenesis remains unknown. Viral involvement has been proposed, including the human cytomegalovirus (HCMV). The aims of the study were to use the polymerase chain reaction (PCR) to screen the liver tissue of infants with extrahepatic cholestasis for HCMV and to correlate the results with serological antibodies against HCMV and histological findings. Methods A retrospective study in a tertiary care setting included 35 patients (31 BA, 1 BA associated with a choledochal cyst, 2 congenital stenosis of the distal common bile duct and 1 hepatic cyst). HCMV serology was determined by ELISA. Liver and porta hepatis were examined histologically. Liver samples from infants and a control group were screened for HCMV DNA. Results Twelve patients had HCMV negative serology, 9 were positive for IgG antibodies and 14 were positive for IgG and IgM. Nine liver and seven porta hepatis samples were positive for HCMV DNA but none of the control group were positive (general frequency of positivity was 34.3% – 12/35). There was no correlation between HCMV positivity by PCR and the histological findings. The accuracy of serology for detecting HCMV antibodies was low. Conclusion These results indicate an elevated frequency of HCMV in pediatric patients with extrahepatic neonatal cholestasis. They also show the low accuracy of serological tests for detecting active HCMV infection and the lack of correlation between HCMV positivity by PCR and the histopathological changes. PMID:16321152

  10. Anti-infection activity of nanostructured titanium percutaneous implants with a postoperative infection model

    NASA Astrophysics Data System (ADS)

    Tan, Jing; Li, Yiting; Liu, Zhiyuan; Qu, Shuxin; Lu, Xiong; Wang, Jianxin; Duan, Ke; Weng, Jie; Feng, Bo

    2015-07-01

    The titanium percutaneous implants were widely used in clinic; however, they have an increased risk of infection since they breach the skin barrier. Lack of complete skin integration with the implants can cause infection and implant removal. In this work, three titania nanotubes (TNT) with different diameters, 50 nm (TNT-50), 100 nm (TNT-100) and 150 nm (TNT-150) arrays were prepared on titanium surfaces by anodization, pure titanium (pTi) was used as control. Samples were characterized by scanning electron microscopy (SEM), atomic force microscopy (AFM), and contact angle analysis. The antibacterial efficiency of TNT was evaluated in vitro against Staphylococcus aureus under the visible light. The results indicated that TNT-100 had the highest antibacterial efficiency under the visible light. Subsequently, TNT implants and pTi implants were placed subcutaneously to the dorsum of New Zealand White rabbits, 108 CFU S. aureus was inoculated into the implant sites 4 h after surgery. The TNF-alpha and IL-1alpha were determined using enzyme linked immunoassay (ELISA). TNT implants revealed less inflammatory factor release than pTi implants with or without injected S. aureus liquid. According to the histological results, the TNT implants displayed excellent tissue integration. Whereas, pTi implants were surrounded with fibrotic capsule, and the skin tissue was almost separated from the implant surface. Therefore, the TNT significantly inhibited the infection risk and enhanced tissue integration of the percutaneous implants compared to pTi. The immersion test in the culture medium suggested that one of causes be probably more proteins adsorbed on TNT than on pTi.

  11. Association of Human Immunoglobulin G1 Heavy Chain Variants With Neutralization Capacity and Antibody-Dependent Cellular Cytotoxicity Against Human Cytomegalovirus.

    PubMed

    Vietzen, Hannes; Görzer, Irene; Puchhammer-Stöckl, Elisabeth

    2016-10-15

    Human cytomegalovirus (HCMV) infection is limited by HCMV-specific antibody functions. Here the association between the genetic marker (GM) 3/17 variants in the immunoglobulin G1 (IgG1) heavy chain constant region, virus neutralization, and natural killer (NK)-cell activation was investigated. In 100 HCMV-seropositive individuals, the GM3/17 polymorphism, serum 50% HCMV antibody neutralization titer (NT50), and in vitro HCMV-specific antibody NK-cell activation were assessed. The HCMV NT50 was higher in heterozygous GM3/17 persons than in GM3/3 persons (P = .0276). Furthermore, individuals expressing GM3/17 exhibited significantly higher NK-cell activation than persons carrying GM3/3 (P < .0001) or GM17/17 (P = .0095). Thus, persons expressing GM3/17 have potentially a selective advantage in HCMV defense.

  12. Hemolytic activity of plasma and urine from rabbits experimentally infected with Legionella pneumophila.

    PubMed

    Baine, W B; Rasheed, J K; Maca, H W; Kaufmann, A F

    1979-01-01

    Rabbits were infected with Legionella pneumophila by intravenous administration of allantoic fluid from eggs infected with this organism. Heated plasma from animals with severe illness caused by L. pneumophila lysed erythrocytes from guinea pigs in a radial hemolysis assay. Plasma from control rabbits did not lyse guinea pig erythrocytes in parallel assays. Urine from two of the infected animals also showed hemolytic activity. Attempts to induce illness in rabbits by intranasal administration of L. pneumohpila were less successful. Allantoic fluid from embrynated hen eggs developed hemolytic activity when maintained eithr in vitro at room temperature or in eggs whose embryos were killed by refrigeration. Hemolytic activity in filtrates of allantoic fluid from eggs infected with L. pneumophila, as previously reported, may not be due to the presence of bacterial hemolysins in the fluid. PMID:399383

  13. Bacterial skin infections, active component, U.S. Armed Forces, 2000-2012.

    PubMed

    2013-12-01

    From 2000 through 2012, health care records of the Military Health System documented 998,671 incident cases of bacterial skin infections among active component members of the U.S. Armed Forces. Most cases (97.3%) were identified from records of outpatient medical encounters rather than hospitalizations. Cellulitis accounted for half (50.9%) of all cases of bacterial skin infection but 96 percent of associated hospital bed days. Of all cases, 42.3 percent were "other" skin infections (i.e., folliculitis, impetigo, pyoderma, pyogenic granuloma, other and unspecified infections). The remainder were attributable to carbuncles/furuncles (6.6%) and erysipelas (0.1%). Rates of infection were higher among female service members except for "other" skin infections. In general, the highest rates were associated with youth, recruit trainee status, and junior enlisted rank; however, rates of erysipelas were highest among those 50 years and older. Annual incidence rates of all bacterial skin infections have increased greatly since 2000. During the entire period, such infections required more than 1.4 million health care encounters and 94,000 hospital bed-days (equivalent to 257 years of lost duty time). The prevention, early diagnosis, and treatment of bacterial skin infections, particularly in high risk settings, deserve continued emphasis. PMID:24428536

  14. The activation of p38MAPK and JNK pathways in bovine herpesvirus 1 infected MDBK cells.

    PubMed

    Zhu, Liqian; Yuan, Chen; Huang, Liyuan; Ding, Xiuyan; Wang, Jianye; Zhang, Dong; Zhu, Guoqiang

    2016-01-01

    We have shown previously that BHV-1 infection activates Erk1/2 signaling. Here, we show that BHV-1 provoked an early-stage transient and late-stage sustained activation of JNK, p38MAPK and c-Jun signaling in MDBK cells. C-Jun phosphorylation was dependent on JNK. These early events were partially due to the viral entry process. Unexpectedly, reactive oxygen species were not involved in the later activation phase. Interestingly, only activated JNK facilitated the viral multiplication identified through both chemical inhibitor and siRNA. Collectively, this study provides insight into our understanding of early stages of BHV-1 infection. PMID:27590675

  15. Activities of Various 4-Aminoquinolines Against Infections with Chloroquine-Resistant Strains of Plasmodium falciparum1

    PubMed Central

    Schmidt, L. H.; Vaughan, Dennis; Mueller, Donna; Crosby, Ruth; Hamilton, Rebecca

    1977-01-01

    The studies reported here stemmed from a personal report by Geiman on the capacity of the 4-aminoquinoline amodiaquin to inhibit in vitro maturation of ring stages of the chloroquine-resistant Monterey strain of Plasmodium falciparum. This observation, confirmed in owl monkeys infected with this strain, led to a comparison of the activities of chloroquine, amodiaquin, amopyroquin, and dichlorquinazine (12,278 RP) against infections with various chloroquine-susceptible and chloroquine-resistant strains. The results showed that: (i) these 4-aminoquinolines were essentially equally active against infections with chloroquine-susceptible strains and (ii) the activities of amodiaquin, amopyroquin, and dichlorquinazine were reduced significantly in the face of chloroquine resistance, but (iii) well-tolerated doses of these compounds would cure infections with strains that fully resisted treatment with maximally tolerated doses of chloroquine. Two other 4-aminoquinolines, SN-8137 and SN-9584, which also exhibited activity against chloroquine-resistant parasites in vitro, displayed curative activity in monkeys infected with a chloroquine-resistant strain. These observations show that there is cross-resistance among the 4-aminoquinolines, confirming earlier findings, but indicate that the dimensions of this phenomenon are sufficiently limited so that some derivatives are therapeutically effective against infections refractory to maximally tolerated doses of chloroquine. PMID:406829

  16. Adenosine deaminase activity in serum and lymphocytes of rats infected with Sporothrix schenckii.

    PubMed

    Castro, Verônica S P; Pimentel, Victor C; Da Silva, Aleksandro S; Thomé, Gustavo R; Wolkmer, Patrícia; Castro, Jorge L C; Costa, Márcio M; da Silva, Cássia B; Oliveira, Daniele C; Alves, Sydney H; Schetinger, Maria R C; Lopes, Sonia T A; Mazzanti, Cinthia M

    2012-07-01

    Sporotrichosis is a fungal infection of subcutaneous or chronic evolution, inflammatory lesions characterized by their pyogranulomatous aspect, caused by the dimorphic fungus Sporothrix schenckii. Adenosine deaminase (ADA) is a "key" enzyme in the purine metabolism, promoting the deamination of adenosine, an important anti-inflammatory molecule. The increase in ADA activity has been demonstrated in several inflammatory conditions; however, there are no data in the literature associated with this fungal infection. The objective of this study was to evaluate the activity of serum ADA (S-ADA) and lymphocytes (L-ADA) of rats infected with S. schenckii. We used seventy-eight rats divided into two groups. In the first experiment, rats were infected subcutaneously and in the second experiment, infected intraperitoneally. Blood samples for hematologic evaluation and activities of S-ADA and L-ADA were performed at days 15, 30, and 40 post-infection (PI) to assess disease progression. In the second experiment, it was observed an acute decrease in activity of S-ADA and L-ADA (P < 0.05), suggesting a compensatory mechanism in an attempt to protect the host from excessive tissue damage. With chronicity of disease the rats in the first and second experiment at 30 days PI showed an increased activity of L-ADA (P < 0.05), promoting an inflammatory response in an attempt to combat the spread of the agent. Thus, it is suggested that infection with S. schenckii alters the activities of S-ADA in experimentally infected rats, demonstrating the involvement of this enzyme in the pathogenesis of sporotrichosis.

  17. Coordinated expansion of both memory T cells and NK cells in response to CMV infection in humans.

    PubMed

    Bayard, Charles; Lepetitcorps, Hélène; Roux, Antoine; Larsen, Martin; Fastenackels, Solène; Salle, Virginie; Vieillard, Vincent; Marchant, Arnaud; Stern, Marc; Boddaert, Jacques; Bajolle, Fanny; Appay, Victor; Sauce, Delphine

    2016-05-01

    NK cells are key players in the fight against persistent viruses. Human cytomegalovirus (HCMV) infection is associated with the presence of a population of CD16(+) CD56(dim) NKG2C(+) NK cells in both acutely and latently infected individuals. Here, we studied the nature of these terminally differentiated NK cells in different human populations infected with HCMV: healthy donors stratified by age, thymectomized individuals, pregnant women suffering from primary CMV infection, and lung transplant patients. Both CD16(+) CD56(dim) NK- and CD8 T-cell phenotypes as well as functional capacities were determined and stratified according to age and/or CMV event. Similarly to T-cell responsiveness, we observe an accumulation over time of NKG2C(+) NK cells, which preferentially expressed CD57. This accumulation is particularly prominent in elderly and amplified further by CMV infection. Latent HCMV infection (without replication) is sufficient for NKG2C(+) CD57(+) NK cells to persist in healthy individuals but is not necessarily required in old age. Collectively, the present work supports the emerging concept that CMV shapes both innate and adaptive immunity in humans.

  18. Expression of bovine vitamin K-dependent carboxylase activity in baculovirus-infected insect cells.

    PubMed

    Roth, D A; Rehemtulla, A; Kaufman, R J; Walsh, C T; Furie, B; Furie, B C

    1993-09-15

    A vitamin K-dependent carboxylase has recently been purified from bovine liver microsomes and candidate cDNA clones have been isolated. Definitive identification of the carboxylase remains circumstantial since expression of candidate carboxylase cDNAs in mammalian cells is confounded by the presence of endogenous carboxylase activity. To overcome this problem, a recombinant strain of baculovirus (Autographa california nuclear polyhedrosis virus, AcMNPV) encoding a putative carboxylase (vbCbx/AcMNPV) was used to infect Sf9 insect cells, which we demonstrate have no endogenous carboxylase activity. Infection with vbCbx/AcMNPV conferred vitamin K-dependent carboxylase activity to Sf9 insect cells. Carboxylase activity was demonstrated to peak 2-3 days after infection with vbCbx/AcMNPV. Metabolic radiolabeling with L-[35S]methionine revealed that the 90-kDa recombinant protein is the major protein synthesized at the time of peak activity after infection. An anti-peptide antibody directed against residues 86-99 reacted with bovine liver carboxylase on Western blot analysis and immunoprecipitated recombinant carboxylase from infected Sf9 microsomal protein preparations. Since Sf9 insect cells lack endogenous vitamin K-dependent carboxylase activity, expression of carboxylase activity in Sf9 insect cells with recombinant baculovirus demonstrates that the protein encoded by this cDNA is a vitamin K-dependent gamma-glutamyl carboxylase. PMID:8378308

  19. Long term results of mechanical prostheses for treatment of active infective endocarditis

    PubMed Central

    Guerra, J; Tornos, M; Permanyer-Miralda, G; Almirante, B; Murtra, M; Soler-Soler, J

    2001-01-01

    OBJECTIVE—To analyse the long term results of mechanical prostheses for treating active infective endocarditis.
DESIGN—Prospective cohort study of a consecutive series of patients diagnosed with infective endocarditis and operated on in the active phase of the infection for insertion of a mechanical prosthesis.
SETTING—Tertiary referral centre in a metropolitan area.
RESULTS—Between 1975 and 1997, 637 cases of infective endocarditis were diagnosed in the centre. Of these, 436 were left sided (with overall mortality of 20.3%). Surgical treatment in the active phase of the infection was needed in 141 patients (72% native, 28% prosthetic infective endocarditis). Mechanical prostheses were used in 131 patients. Operative mortality was 30.5% (40 patients). Ninety one survivors were followed up prospectively for (mean (SD)) 5.4 (4.5) years. Thirteen patients developed prosthetic valve dysfunction. Nine patients suffered reinfection: four of these (4%) were early and five were late. The median time from surgery for late reinfection was 1.4 years. During follow up, 12 patients died. Excluding operative mortality, actuarial survival was 86.6% at five years and 83.7% at 10 years; actuarial survival free from death, reoperation, and reinfection was 73.1% at five years and 59.8% at 10 years.
CONCLUSIONS—In patients surviving acute infective endocarditis and receiving mechanical prostheses, the rate of early reinfection compares well with reported results of homografts. In addition, prosthesis dysfunction rate is low and long term survival is good. These data should prove useful for comparison with long term studies, when available, using other types of valve surgery in active infective endocarditis.


Keywords: infective endocarditis; surgery; mechanical prosthesis PMID:11410564

  20. Macrophage activation and human immunodeficiency virus infection: HIV replication directs macrophages towards a pro-inflammatory phenotype while previous activation modulates macrophage susceptibility to infection and viral production.

    PubMed

    Porcheray, Fabrice; Samah, Boubekeur; Léone, Cathie; Dereuddre-Bosquet, Nathalie; Gras, Gabriel

    2006-05-25

    Macrophages are pivotal for the regulation of immune and inflammatory responses, but whether their role in HIV infection is protective or deleterious remains unclear. In this study, we investigated the effect of pro- and anti-inflammatory stimuli on macrophage sensitivity to two different aspects of HIV infection: their susceptibility to infection stricto sensu, which we measured by endpoint titration method, and their ability to support virus spread, which we measured by using an RT activity assay in infection kinetics. We show a partially protective role for pro-inflammatory agents as well as for IL-4. We also illustrate that various different stimuli display differential effects on macrophage susceptibility to HIV and on virus replication that occurs thereafter. On the other hand, HIV replication strongly repressed CD206 and CD163 expression, thus clearly orientating macrophages towards a pro-inflammatory phenotype, but independently of TNF. Taken together, our results emphasize that HIV infection of macrophages sets up inflammation at the cell level but through unexpected mechanisms. This may limit target susceptibility and participate in virus clearance but may also result in tissue damage.

  1. Treatment of primary HIV-1 infection with cyclosporin A coupled with highly active antiretroviral therapy

    PubMed Central

    Rizzardi, G. Paolo; Harari, Alexandre; Capiluppi, Brunella; Tambussi, Giuseppe; Ellefsen, Kim; Ciuffreda, Donatella; Champagne, Patrick; Bart, Pierre-Alexandre; Chave, Jean-Philippe; Lazzarin, Adriano; Pantaleo, Giuseppe

    2002-01-01

    Primary HIV-1 infection causes extensive immune activation, during which CD4+ T cell activation supports massive HIV-1 production. We tested the safety and the immune-modulating effects of combining cyclosporin A (CsA) treatment with highly active antiretroviral therapy (HAART) during primary HIV-1 infection. Nine adults with primary HIV-1 infection were treated with CsA along with HAART. At week 8, all patients discontinued CsA but maintained HAART. Viral replication was suppressed to a comparable extent in the CsA + HAART cohort and in 29 control patients whose primary infection was treated with HAART alone. CsA restored normal CD4+ T cell levels, both in terms of percentage and absolute numbers. The increase in CD4+ T cells was apparent within a week and persisted throughout the study period. CsA was not detrimental to virus-specific CD8+ or CD4+ T cell responses. At week 48, the proportion of IFN-γ–secreting CD4+ and CD4+CCR7– T cells was significantly higher in the CsA + HAART cohort than in the HAART-alone cohort. In conclusion, rapid shutdown of T cell activation in the early phases of primary HIV-1 infection can have long-term beneficial effects and establish a more favorable immunologic set-point. Appropriate, immune-based therapeutic interventions may represent a valuable complement to HAART for treating HIV infection. PMID:11877476

  2. Activated natural killer cells accelerate liver damage in patients with chronic hepatitis B virus infection.

    PubMed

    Zheng, Q; Zhu, Y Y; Chen, J; Ye, Y B; Li, J Y; Liu, Y R; Hu, M L; Zheng, Y C; Jiang, J J

    2015-06-01

    Emerging evidence indicates that natural killer (NK) cells may contribute to liver injury in patients with hepatitis B virus (HBV) infection. Because HBV infection progresses through various disease phases, the cytolytic profiles of peripheral and intrahepatic NK cells in HBV-infected patients remain to be defined. In this study, we comprehensively characterized intrahepatic and peripheral NK cells in a cohort of HBV-infected individuals, and investigated their impact on liver pathogenesis during chronic HBV infection. The study population included 34 immune-clearance (IC) patients, 36 immune-tolerant (IT) carriers and 10 healthy subjects. We found that the activity of peripheral NK cells from IC patients was functionally elevated compared to IT carriers and controls, and NK cell activation was indicated by an increased expression of CD69, CD107a, interferon (IFN)-γ and tumour necrosis factor (TNF)-α. Further analysis showed that the increased activity of both peripheral and hepatic NK cells was correlated positively with liver injury, which was assessed by serum alanine aminotransferase levels (ALT) and the liver histological activity index (HAI). Interestingly, the frequency of peripheral NK cells was reduced in IC patients (especially those with higher HAI scores of 3-4), but there was a concomitant increase in hepatic NK cells. The functionally activated NK cells are enriched preferentially in the livers of IC patients and skew towards cytolytic activity that accelerates liver injury in chronic hepatitis B (CHB) patients.

  3. Inhibitory activity of S-adenosylhomocysteine hydrolase inhibitors against human cytomegalovirus replication.

    PubMed

    Snoeck, R; Andrei, G; Neyts, J; Schols, D; Cools, M; Balzarini, J; De Clercq, E

    1993-07-01

    Various acyclic and carbocyclic adenosine analogues, which are apparently targeted at the S-adenosylhomocysteine (AdoHcy) hydrolase have been reported to inhibit the replication of a number of pox-, rhabdo-, paramyxo-, arena-, and reoviruses. Here we show that this activity spectrum extends to human cytomegalovirus (HCMV). Of the compounds tested, neplanocin A, 3-deazaneplanocin A, 6'-C-methylneplanocin A and 5'-noraristeromycin were found to be the most potent inhibitors of HCMV replication in vitro. Their 50% inhibitory concentration ranged from 0.05 to 1.35 micrograms/ml. In general, the anti-HCMV activity of the adenosine analogues correlated well with their affinity (Ki) for AdoHcy hydrolase, suggesting that AdoHcy hydrolase may be considered as a target enzyme for anti-HCMV agents. For four compounds (3-deazaneplanocin A, 6'-C-methylneplanocin A (isomers I and II) and 3-deazaadenosine), anti-HCMV potency was greater than could be expected solely from their interaction with AdoHcy hydrolase, suggesting that these compounds may be functioning by an additional mechanism. PMID:8215298

  4. Nuclease Activity of Legionella pneumophila Cas2 Promotes Intracellular Infection of Amoebal Host Cells

    PubMed Central

    Gunderson, Felizza F.; Mallama, Celeste A.; Fairbairn, Stephanie G.

    2014-01-01

    Legionella pneumophila, the primary agent of Legionnaires' disease, flourishes in both natural and man-made environments by growing in a wide variety of aquatic amoebae. Recently, we determined that the Cas2 protein of L. pneumophila promotes intracellular infection of Acanthamoeba castellanii and Hartmannella vermiformis, the two amoebae most commonly linked to cases of disease. The Cas2 family of proteins is best known for its role in the bacterial and archeal clustered regularly interspaced short palindromic repeat (CRISPR)–CRISPR-associated protein (Cas) system that constitutes a form of adaptive immunity against phage and plasmid. However, the infection event mediated by L. pneumophila Cas2 appeared to be distinct from this function, because cas2 mutants exhibited infectivity defects in the absence of added phage or plasmid and since mutants lacking the CRISPR array or any one of the other cas genes were not impaired in infection ability. We now report that the Cas2 protein of L. pneumophila has both RNase and DNase activities, with the RNase activity being more pronounced. By characterizing a catalytically deficient version of Cas2, we determined that nuclease activity is critical for promoting infection of amoebae. Also, introduction of Cas2, but not its catalytic mutant form, into a strain of L. pneumophila that naturally lacks a CRISPR-Cas locus caused that strain to be 40- to 80-fold more infective for amoebae, unequivocally demonstrating that Cas2 facilitates the infection process independently of any other component encoded within the CRISPR-Cas locus. Finally, a cas2 mutant was impaired for infection of Willaertia magna but not Naegleria lovaniensis, suggesting that Cas2 promotes infection of most but not all amoebal hosts. PMID:25547789

  5. Chlamydial infection of monocytes stimulates IL-1beta secretion through activation of the NLRP3 inflammasome.

    PubMed

    Abdul-Sater, Ali A; Saïd-Sadier, Najwane; Padilla, Eduardo V; Ojcius, David M

    2010-08-01

    Chlamydia trachomatis infections represent the leading cause of bacterial sexually-transmitted disease in the United States and can cause serious tissue damage leading to infertility and ectopic pregnancies in women. Inflammation and hence the innate immune response to chlamydial infection contributes significantly to tissue damage, particularly by secreting proinflammatory cytokines such as interleukin (IL)-1beta from monocytes, macrophages and dendritic cells. Here we demonstrate that C. trachomatis or Chlamydia muridarum infection of a monocytic cell line leads to caspase-1 activation and IL-1beta secretion through a process requiring the NLRP3 inflammasome. Thus, secretion of IL-1beta decreased significantly when cells were depleted of NLRP3 or treated with the anti-inflammatory inhibitors parthenolide or Bay 11-7082, which inhibit inflammasomes and the transcription factor NF-kappaB. As for other infections causing NRLP3 inflammasome assembly, caspase-1 activation in monocytes is triggered by potassium efflux and reactive oxygen species production. However, anti-oxidants inhibited IL-1beta secretion only partially. Atypically for a bacterial infection, caspase-1 activation during chlamydial infection also involves partially the spleen tyrosine kinase (Syk), which is usually associated with a pathogen recognition receptor for fungal pathogens. Secretion of IL-1beta during infection by many bacteria requires both microbial products from the pathogen and an exogenous danger signal, but chlamydial infection provides both the pathogen-associated molecular patterns and danger signals necessary for IL-1beta synthesis and its secretion from human monocytes. Use of inhibitors that target the inflammasome in animals should therefore dampen inflammation during chlamydial infection.

  6. PPARγ-mediated increase in glucose availability sustains chronic Brucella abortus infection in alternatively activated macrophages

    PubMed Central

    Xavier, Mariana N.; Winter, Maria G.; Spees, Alanna M.; den Hartigh, Andreas B.; Nguyen, Kim; Roux, Christelle M.; Silva, Teane M. A.; Atluri, Vidya L.; Kerrinnes, Tobias; Keestra, A. Marijke; Monack, Denise M.; Luciw, Paul A.; Eigenheer, Richard A.; Bäumler, Andreas J.; Santos, Renato L.; Tsolis, Renée M.

    2013-01-01

    SUMMARY Eradication of persistent intracellular bacterial pathogens with antibiotic therapy is often slow or incomplete. However, strategies to augment antibiotics are hampered by our poor understanding of the nutritional environment that sustains chronic infection. Here we show that the intracellular pathogen Brucella abortus survives and replicates preferentially in alternatively activated macrophages (AAM), which are more abundant during chronic infection. A metabolic shift induced by peroxisome proliferator activated receptor γ (PPARγ), which increases intracellular glucose availability, is identified as a causal mechanism promoting enhanced bacterial survival in AAM. Glucose uptake was crucial for increased replication of B. abortus in AAM, and chronic infection, as inactivation of the bacterial glucose transporter gluP reduced both intracellular survival in AAM and persistence in mice. Thus, a shift in intracellular nutrient availability induced by PPARγ promotes chronic persistence of B. abortus within AAM and targeting this pathway may aid in eradicating chronic infection. PMID:23954155

  7. PPARγ-mediated increase in glucose availability sustains chronic Brucella abortus infection in alternatively activated macrophages.

    PubMed

    Xavier, Mariana N; Winter, Maria G; Spees, Alanna M; den Hartigh, Andreas B; Nguyen, Kim; Roux, Christelle M; Silva, Teane M A; Atluri, Vidya L; Kerrinnes, Tobias; Keestra, A Marijke; Monack, Denise M; Luciw, Paul A; Eigenheer, Richard A; Bäumler, Andreas J; Santos, Renato L; Tsolis, Renée M

    2013-08-14

    Eradication of persistent intracellular bacterial pathogens with antibiotic therapy is often slow or incomplete. However, strategies to augment antibiotics are hampered by our poor understanding of the nutritional environment that sustains chronic infection. Here we show that the intracellular pathogen Brucella abortus survives and replicates preferentially in alternatively activated macrophages (AAMs), which are more abundant during chronic infection. A metabolic shift induced by peroxisome proliferator-activated receptor γ (PPARγ), which increases intracellular glucose availability, is identified as a causal mechanism promoting enhanced bacterial survival in AAMs. Glucose uptake was crucial for increased replication of B. abortus in AAMs, and for chronic infection, as inactivation of the bacterial glucose transporter gluP reduced both intracellular survival in AAMs and persistence in mice. Thus, a shift in intracellular nutrient availability induced by PPARγ promotes chronic persistence of B. abortus within AAMs, and targeting this pathway may aid in eradicating chronic infection. PMID:23954155

  8. PD-1 blockade during chronic SIV infection reduces hyperimmune activation and microbial translocation in rhesus macaques.

    PubMed

    Dyavar Shetty, Ravi; Velu, Vijayakumar; Titanji, Kehmia; Bosinger, Steven E; Freeman, Gordon J; Silvestri, Guido; Amara, Rama Rao

    2012-05-01

    Hyperimmune activation is a strong predictor of disease progression during pathogenic immunodeficiency virus infections and is mediated in part by sustained type I IFN signaling in response to adventitious microbial infection. The immune inhibitory receptor programmed death-1 (PD-1) regulates functional exhaustion of virus-specific CD8(+) T cells during chronic infections, and in vivo PD-1 blockade has been shown to improve viral control of SIV. Here, we show that PD-1 blockade during chronic SIV infection markedly reduced the expression of transcripts associated with type I IFN signaling in the blood and colorectal tissue of rhesus macaques (RMs). The effect of PD-1 blockade on type I IFN signaling was durable and persisted even under conditions of high viremia. Reduced type I IFN signaling was associated with enhanced expression of some of the junction-associated genes in colorectal tissue and with a profound decrease in plasma LPS levels, suggesting a possible repair of gut-associated junctions and decreased microbial translocation into the blood. PD-1 blockade enhanced immunity to gut-resident pathogenic bacteria, control of gut-associated opportunistic infections, and survival of SIV-infected RMs. Our results suggest PD-1 blockade as a potential novel therapeutic approach to enhance combination antiretroviral therapy by suppressing hyperimmune activation in HIV-infected individuals. PMID:22523065

  9. Bacterial Manipulation of NK Cell Regulatory Activity Increases Susceptibility to Listeria monocytogenes Infection

    PubMed Central

    Guthrie, Brandon S.; Schmidt, Rebecca L.; Jamieson, Amanda; Merkel, Patricia; Knight, Vijaya; Cole, Caroline M.; Raulet, David H.; Lenz, Laurel L.

    2016-01-01

    Natural killer (NK) cells produce interferon (IFN)-γ and thus have been suggested to promote type I immunity during bacterial infections. Yet, Listeria monocytogenes (Lm) and some other pathogens encode proteins that cause increased NK cell activation. Here, we show that stimulation of NK cell activation increases susceptibility during Lm infection despite and independent from robust NK cell production of IFNγ. The increased susceptibility correlated with IL-10 production by responding NK cells. NK cells produced IL-10 as their IFNγ production waned and the Lm virulence protein p60 promoted induction of IL-10 production by mouse and human NK cells. NK cells consequently exerted regulatory effects to suppress accumulation and activation of inflammatory myeloid cells. Our results reveal new dimensions of the role played by NK cells during Lm infection and demonstrate the ability of this bacterial pathogen to exploit the induction of regulatory NK cell activity to increase host susceptibility. PMID:27295349

  10. Thrombin activation and liver inflammation in advanced hepatitis C virus infection

    PubMed Central

    González-Reimers, Emilio; Quintero-Platt, Geraldine; Martín-González, Candelaria; Pérez-Hernández, Onán; Romero-Acevedo, Lucía; Santolaria-Fernández, Francisco

    2016-01-01

    Hepatitis C virus (HCV) infection is associated with increased thrombotic risk. Several mechanisms are involved including direct endothelial damage by the HCV virus, with activation of tissue factor, altered fibrinolysis and increased platelet aggregation and activation. In advanced stages, chronic HCV infection may evolve to liver cirrhosis, a condition in which alterations in the portal microcirculation may also ultimately lead to thrombin activation, platelet aggregation, and clot formation. Therefore in advanced HCV liver disease there is an increased prevalence of thrombotic phenomena in portal vein radicles. Increased thrombin formation may activate hepatic stellate cells and promote liver fibrosis. In addition, ischemic changes derived from vascular occlusion by microthrombi favor the so called parenchymal extinction, a process that promotes collapse of hepatocytes and the formation of gross fibrous tracts. These reasons may explain why advanced HCV infection may evolve more rapidly to end-stage liver disease than other forms of cirrhosis. PMID:27182154

  11. Nasopharyngeal Infection of Mice with Streptococcus pyogenes and In Vivo Detection of Superantigen Activity.

    PubMed

    Zeppa, Joseph J; Wakabayashi, Adrienne T; Kasper, Katherine J; Xu, Stacey X; Haeryfar, S M Mansour; McCormick, John K

    2016-01-01

    Streptococcus pyogenes is a globally prominent human-specific pathogen that is responsible for an enormous burden of infectious disease. Despite intensive experimental efforts to understand the molecular correlates that contribute to invasive infections, there has been less focus on S. pyogenes carriage and local infection of the nasopharynx. This chapter describes an acute nasopharyngeal infection model in mice that is utilized in our laboratory to study the role of superantigen toxins in the biology of S. pyogenes. We also describe a method to detect superantigen-specific T cell activation in vivo.

  12. Autoimmunity, polyclonal B-cell activation and infection.

    PubMed

    Granholm, N A; Cavallo, T

    1992-02-01

    It is widely believed that autoimmunity is an integral part of the immune system, and that genetic, immunologic, hormonal, environmental and other factors contribute to the pathogenesis of autoimmune disease. Thus, autoimmune disease may represent an abnormal expression of immune functions instead of loss of tolerance to self, and it can be organ specific or systemic in its manifestations. We review the various factors that contribute to the development of autoimmune disease; we also review the mechanisms of polyclonal B-cell activation, with emphasis on the role of infectious agents. We consider systemic lupus erythematosus in humans and in experimental animals as prototypic autoimmune disease, and we summarize data to indicate that polyclonal B-cell activation is central to the pathogenesis of systemic autoimmune disease. The effect of polyclonal B-cell activation, brought about by injections of a B-cell activator-lipopolysaccharide from Gram-negative bacteria-is sufficient to cause autoimmune disease in an immunologically normal host. In fact, autoimmune disease can be arrested if excessive polyclonal B-cell activation is suppressed; alternatively, autoimmune disease can be exacerbated if polyclonal B-cell activation is enhanced. We explore the mechanism of tissue injury when autoimmune disease is induced or exacerbated, and we consider the pathogenic roles of autoantibodies, immune complexes, complement, the blood cell carrier system, and the mononuclear phagocyte system. Although polyclonal B-cell activation may be the mechanism whereby various factors can cause or exacerbate systemic autoimmune disease, polyclonal B-cell activation may cause autoimmune disease on its own.

  13. Activities of adenine nucleotide and nucleoside degradation enzymes in platelets of rats infected by Trypanosoma evansi.

    PubMed

    Oliveira, Camila B; Da Silva, Aleksandro S; Vargas, Lara B; Bitencourt, Paula E R; Souza, Viviane C G; Costa, Marcio M; Leal, Claudio A M; Moretto, Maria B; Leal, Daniela B R; Lopes, Sonia T A; Monteiro, Silvia G

    2011-05-31

    Nucleotide and nucleoside-degrading enzymes, such as nucleoside triphosphate diphosphohydrose (NTPDase), 5'-nucleotidase and adenosine deaminase (ADA) are present in the surface membranes of platelets, involved in clotting disturbances of Trypanosoma evansi-infected animals. Thus, this study was aimed at evaluating the activities of these enzymes in platelets of rats experimentally infected with T. evansi. Animals were divided into four groups, according to the level of parasitemia. Blood samples were collected on days 3 (group A: at the beginning of parasitemia), 5 (group B: high parasitemia) and 15 (group C: chronic infection), post-infection. Group D (control group) was composed of non-infected animals for platelet count, separation and enzymatic assays. Animals from groups A and B showed marked thrombocytopenia, but platelet count was not affected in chronically infected rats. NTPDase, 5'-nucleotidase and ADA activities decreased (p<0.05) in platelets from rats of groups A and B, when compared to the control group. In group C, only NTPDase and 5'-nucleoside activities decreased (p<0.001). The correlations between platelet count and nucleotide/nucleoside hydrolysis were positive and statistically significant (p<0.05) in groups A and B. Platelet aggregation was decreased in all infected groups, in comparison to the control group (p<0.05). It is concluded that the alterations observed in the activities of NTPDase, 5'-nucleotidase and ADA in platelets of T. evansi-infected animals might be related to thrombocytopenia, that by reducing the number of platelets, there was less release of ATP and ADP. Another possibility being suggested is that changes have occurred in the membrane of these cells, decreasing the expression of these enzymes in the cell membrane.

  14. Cure of Trypanosoma musculi infection by heat-labile activity in immune plasma.

    PubMed

    Wechsler, D S; Kongshavn, P A

    1984-06-01

    Passive transfer of plasma from a mouse cured of parasitemia to a Trypanosoma musculi-infected host rapidly eliminates parasitemia; this curative activity, presumably mediated by an immunoglobulin, is sensitive to heat treatment (56 degrees C, 30 min). In addition, pretreatment with immune plasma, even after heat treatment, prevents the development of a patent parasitemia in a naive host (protective activity).

  15. Antileishmanial activity of licochalcone A in mice infected with Leishmania major and in hamsters infected with Leishmania donovani.

    PubMed Central

    Chen, M; Christensen, S B; Theander, T G; Kharazmi, A

    1994-01-01

    This study was designed to examine the antileishmanial activity of the oxygenated chalcone licochalcone A in mice and hamsters infected with Leishmania parasites. Intraperitoneal administration of licochalcone A at doses of 2.5 and 5 mg/kg of body weight per day completely prevented lesion development in BALB/c mice infected with Leishmania major. Treatment of hamsters infected with L. donovani with intraperitoneal administration of licochalcone A at a dose of 20 mg/kg of body weight per day for 6 consecutive days resulted in a > 96% reduction of parasite load in the liver and the spleen compared with values for untreated control animals. The [3H]thymidine uptake by the parasites isolated from the treated hamsters was only about 1% of that observed in parasites isolated from the controls. Oral administration of licochalcone A at concentrations of 5 to 150 mg/kg of body weight per day for 6 consecutive days resulted in > 65 and 85% reductions of L. donovani parasite loads in the liver and the spleen, respectively, compared with those of untreated control hamsters. These data clearly demonstrate that licochalcone A is a promising lead for the development of a new drug against leishmaniases. PMID:8092835

  16. Effects of rutin and quercetin on monooxygenase activities in experimental influenza virus infection.

    PubMed

    Savov, Varban M; Galabov, Angel S; Tantcheva, Lyubka P; Mileva, Milka M; Pavlova, Elitsa L; Stoeva, Emilia S; Braykova, Ana A

    2006-08-01

    The aim of this work is to study the effect of the flavonoids rutin and quercetin on hepatic monooxygenase activities in experimental influenza virus infection (EIVI). EIVI causes oxidative stress in the whole organism. This is confirmed by the rapidly increased concentrations of thiobarbituric reactive substances in influenza-infected mice: lungs - 290%; blood plasma - more than 320%; liver - 230%; brain - 50%. Although known for their antioxidant activities, rutin and quercetin exhibit prooxidant effect in healthy and antioxidant activity in influenza-infected animals. The pretreatment with both flavonoids (20 mg/kg b.w.) restores oxidative damage mostly in the target organ of the infection as well as in the liver of all infected mice (lungs: rutin - 30%, quercetin - 40%, combination - 45%; liver: rutin - 12%; quercetin - 40%; combination - 50%). As far as EIVI causes oxidative stress, toxicosis and inhibition of the hepatic monooxygenase activity, it is important to study the effects of rutin and quercetin on these systems. Both flavonoids induce the level of cytochrome P-450 (rutin - 13%, quercetin - 30%, combination - 22%) but inactivate NADPH-cytochrome c reductase, aminopyrine N-demethylase and analgin N-demethylase on the 5th day of EIVI. Probably, these flavonoids affect different components of the monooxygenase system. These effects could be explained with oxidative hepatic intoxication on the 5th critical day of EIVI as well as higher dose treatment. More data are needed on the antioxidant/prooxidant effects of rutin and quercetin, probably due to specific metabolic and physiological activities, chemical structure, etc.

  17. IL-15 promotes activation and expansion of CD8+ T cells in HIV-1 infection

    PubMed Central

    Younes, Souheil-Antoine; Freeman, Michael L.; Mudd, Joseph C.; Shive, Carey L.; Reynaldi, Arnold; Estes, Jacob D.; Deleage, Claire; Lucero, Carissa; Anderson, Jodi; Schacker, Timothy W.; Davenport, Miles P.; McCune, Joseph M.; Hunt, Peter W.; Lee, Sulggi A.; Debernardo, Robert L.; Jacobson, Jeffrey M.; Canaday, David H.; Sekaly, Rafick-Pierre; Sieg, Scott F.; Lederman, Michael M.

    2016-01-01

    In HIV-1–infected patients, increased numbers of circulating CD8+ T cells are linked to increased risk of morbidity and mortality. Here, we identified a bystander mechanism that promotes CD8 T cell activation and expansion in untreated HIV-1–infected patients. Compared with healthy controls, untreated HIV-1–infected patients have an increased population of proliferating, granzyme B+, CD8+ T cells in circulation. Vβ expression and deep sequencing of CDR3 revealed that in untreated HIV-1 infection, cycling memory CD8 T cells possess a broad T cell repertoire that reflects the repertoire of the resting population. This suggests that cycling is driven by bystander activation, rather than specific antigen exposure. Treatment of peripheral blood mononuclear cells with IL-15 induced a cycling, granzyme B+ phenotype in CD8+ T cells. Moreover, elevated IL-15 expression in the lymph nodes of untreated HIV-1–infected patients correlated with circulating CD8+ T cell counts and was normalized in these patients following antiretroviral therapy. Together, these results suggest that IL-15 drives bystander activation of CD8+ T cells, which predicts disease progression in untreated HIV-1–infected patients and suggests that elevated IL-15 may also drive CD8+ T cell expansion that is linked to increased morbidity and mortality in treated patients. PMID:27322062

  18. Localization and activity of various lysosomal proteases in Leishmania amazonensis-infected macrophages.

    PubMed Central

    Prina, E; Antoine, J C; Wiederanders, B; Kirschke, H

    1990-01-01

    In mammalian hosts, Leishmania amastigotes are obligatory intracellular parasites of macrophages and multiply within parasitophorous vacuoles of phagolysosomal origin. To understand how they escape the harmful strategies developed by macrophages to kill ingested microorganisms, it is important to obtain information on the functional state of parasitophorous vacuole. For this purpose, we studied the intracellular distribution and activity of host lysosomal proteases in rat bone marrow-derived macrophages infected with Leishmania amazonensis amastigotes. Localization of cathepsins B, H, L, and D was investigated by using specific immunoglobulins. In uninfected macrophages, these enzymes were located in perinuclear granules (most of them were probably secondary lysosomes) which, after infection, disappeared progressively. In infected macrophages, cathepsins were detected mainly in the parasitophorous vacuoles, suggesting that the missing secondary lysosomes had fused with these organelles. Biochemical assays of various proteases (cathepsins B, H, and D and dipeptidyl peptidases I and II) showed that infection was accompanied by a progressive increase of all activities tested, except that of dipeptidyl peptidase II, which remained constant. No more than 1 to 10% of these activities could be attributed to amastigotes. These data indicate that (i) Leishmania infection is followed by an increased synthesis and/or a reduced catabolism of host lysosomal proteases, and (ii) amastigotes grow in a compartment rich in apparently fully active proteases. Unexpectedly, it was found that infected and uninfected macrophages degraded endocytosed proteins similarly. The lack of correlation in infected macrophages between increase of protease activities and catabolism of exogenous proteins could be linked to the huge increase in volume of the lysosomal compartment. Images PMID:2187806

  19. RAAS Activation Is Associated With Visceral Adiposity and Insulin Resistance Among HIV-infected Patients

    PubMed Central

    Srinivasa, Suman; Fitch, Kathleen V.; Wong, Kimberly; Torriani, Martin; Mayhew, Caitlin; Stanley, Takara; Lo, Janet; Adler, Gail K.

    2015-01-01

    Context: Little is known about renin-angiotensin-aldosterone system (RAAS) activation in relationship to visceral adipose tissue (VAT) accumulation in HIV-infected patients, a population at significant risk for insulin resistance and other metabolic disease. Design: Twenty HIV and 10 non-HIV-infected subjects consumed a standardized low sodium or liberal sodium diet to stimulate or suppress the RAAS, respectively. RAAS parameters were evaluated in response to each diet and a graded angiotensin II infusion. Further analyses were performed after groups were substratified by median VAT measured by magnetic resonance imaging. Results: Aldosterone concentrations during the low-sodium diet were higher in HIV than non-HIV-infected subjects [13.8 (9.7, 30.9) vs 9.2 (7.6, 13.6) ng/dL, P = .03] and increased across groups stratified by visceral adipose tissue (VAT) [8.5 (7.1, 12.8), 9.2 (8.1, 21.5), 11.4 (9.4, 13.8), and 27.2 (13.0, 36.9) ng/dL in non-HIV-infected without increased VAT, non-HIV-infected with increased VAT, HIV-infected without increased VAT, HIV-infected with increased VAT, respectively, overall trend P = .02]. Under this condition, plasma renin activity [3.50 (2.58, 4.65) vs 1.45 (0.58, 2.33) ng/mL · h, P = .002] was higher among the HIV-infected subjects with vs without increased VAT. Differences in the suppressibility of plasma renin activity by graded angiotensin infusion were seen stratifying by VAT among the HIV-infected group (P < .02 at each dose). In addition, aldosterone (P = .007) was an independent predictor of insulin resistance in multivariate modeling, controlling for VAT and adiponectin. Conclusion: These data suggest excess RAAS activation in relationship to visceral adiposity in HIV-infected patients that may independently contribute to insulin resistance. Mineralocorticoid blockade may have therapeutic potential to reduce metabolic complications in HIV-infected patients with increased visceral adiposity. PMID:26086328

  20. Molecular Mechanisms of Inflammasome Activation during Microbial Infections

    PubMed Central

    Broz, Petr; Monack, Denise M.

    2011-01-01

    Summary The innate immune system plays a crucial role in the rapid recognition and elimination of invading microbes. Detection of microbes relies on germ-line encoded pattern recognition receptors (PRRs) that recognize essential bacterial molecules, so-called pathogen-associated molecular patterns (PAMPs). A subset of PRRs, belonging to the NOD-like receptor (NLR) and the PYHIN protein families, detects viral and bacterial pathogens in the cytosol of host cells and induces the assembly of a multi-protein signaling platform called the inflammasome. The inflammasome serves as an activation platform for the mammalian cysteine protease caspase-1, a central mediator of innate immunity. Active caspase-1 promotes the maturation and release of interleukin-1β (IL-1β) and IL-18 as well as protein involved in cytoprotection and tissue repair. In addition, caspase-1 initiates a novel form of cell death called pyroptosis. Here we discuss latest advances and our insights on inflammasome stimulation by two model intracellular pathogens, Francisella tularensis and Salmonella typhimurium. Recent studies on these pathogens have significantly shaped our understanding of the molecular mechanisms of inflammasome activation and how microbes can evade or manipulate inflammasome activity. In addition, we review the role of the inflammasome adapter ASC in the caspase-1 autoproteolysis and new insights into the structure of the inflammasome complex. PMID:21884176

  1. Pythium infection activates conserved plant defense responses in mosses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The moss Physcomitrella patens (P. patens) is a useful model to study abiotic stress responses since it is highly tolerant to drought, salt and osmotic stress. However, little is known about the defense mechanisms activated in this moss after pathogen assault. Here the induction of defense responses...

  2. Exosomes Derived from HIV-1-infected Cells Contain Trans-activation Response Element RNA*

    PubMed Central

    Narayanan, Aarthi; Iordanskiy, Sergey; Das, Ravi; Van Duyne, Rachel; Santos, Steven; Jaworski, Elizabeth; Guendel, Irene; Sampey, Gavin; Dalby, Elizabeth; Iglesias-Ussel, Maria; Popratiloff, Anastas; Hakami, Ramin; Kehn-Hall, Kylene; Young, Mary; Subra, Caroline; Gilbert, Caroline; Bailey, Charles; Romerio, Fabio; Kashanchi, Fatah

    2013-01-01

    Exosomes are nano-sized vesicles produced by healthy and virus-infected cells. Exosomes derived from infected cells have been shown to contain viral microRNAs (miRNAs). HIV-1 encodes its own miRNAs that regulate viral and host gene expression. The most abundant HIV-1-derived miRNA, first reported by us and later by others using deep sequencing, is the trans-activation response element (TAR) miRNA. In this study, we demonstrate the presence of TAR RNA in exosomes from cell culture supernatants of HIV-1-infected cells and patient sera. TAR miRNA was not in Ago2 complexes outside the exosomes but enclosed within the exosomes. We detected the host miRNA machinery proteins Dicer and Drosha in exosomes from infected cells. We report that transport of TAR RNA from the nucleus into exosomes is a CRM1 (chromosome region maintenance 1)-dependent active process. Prior exposure of naive cells to exosomes from infected cells increased susceptibility of the recipient cells to HIV-1 infection. Exosomal TAR RNA down-regulated apoptosis by lowering Bim and Cdk9 proteins in recipient cells. We found 104–106 copies/ml TAR RNA in exosomes derived from infected culture supernatants and 103 copies/ml TAR RNA in the serum exosomes of highly active antiretroviral therapy-treated patients or long term nonprogressors. Taken together, our experiments demonstrated that HIV-1-infected cells produced exosomes that are uniquely characterized by their proteomic and RNA profiles that may contribute to disease pathology in AIDS. PMID:23661700

  3. Activation and Recruitment of Regulatory T Cells via Chemokine Receptor Activation in Trichinella spiralis-Infected Mice

    PubMed Central

    Ahn, Jeong-Bin; Kang, Shin Ae; Kim, Dong-Hee; Yu, Hak Sun

    2016-01-01

    As most infections by the helminth parasite elicit the recruitment of CD4+CD25+Foxp3+ T (Treg) cells, many scientists have suggested that these cells could be used for the treatment of immune-mediated inflammation and associated diseases. In order to investigate the distribution and alteration of activated Treg cells, we compared the expression levels of Treg cell activation markers in the ileum and gastrocnemius tissues 1, 2, and 4 weeks after infection. The number of Treg cells was monitored using GFP-coded Foxp3 transgenic mice. In mice at 1 week after Trichinella spiralis infection, the number of activated Treg cells was higher than in the control group. In mice at 2 weeks after infection, there was a significant increase in the number of cells expressing Foxp3 and CTLA-4 when compared to the control group and mice at 1 week after infection. At 4 weeks after infection, T. spiralis was easily identifiable in nurse cells in mouse muscles. In the intestine, the expression of Gzmb and Klrg1 decreased over time and that of Capg remained unchanged for the first and second week, then decreased in the 4th week. However, in the muscles, the expression of most chemokine genes was increased due to T. spiralis infection, in particular the expression levels of Gzmb, OX40, and CTLA-4 increased until week 4. In addition, increased gene expression of all chemokine receptors in muscle, CXCR3, CCR4, CCR5, CCR9, and CCR10, was observed up until the 4th week. In conclusion, various chemokine receptors showed increased expressions combined with recruitment of Treg cells in the muscle tissue. PMID:27180574

  4. Activation and Recruitment of Regulatory T Cells via Chemokine Receptor Activation in Trichinella spiralis-Infected Mice.

    PubMed

    Ahn, Jeong-Bin; Kang, Shin Ae; Kim, Dong-Hee; Yu, Hak Sun

    2016-04-01

    As most infections by the helminth parasite elicit the recruitment of CD4(+)CD25(+)Foxp3(+) T (Treg) cells, many scientists have suggested that these cells could be used for the treatment of immune-mediated inflammation and associated diseases. In order to investigate the distribution and alteration of activated Treg cells, we compared the expression levels of Treg cell activation markers in the ileum and gastrocnemius tissues 1, 2, and 4 weeks after infection. The number of Treg cells was monitored using GFP-coded Foxp3 transgenic mice. In mice at 1 week after Trichinella spiralis infection, the number of activated Treg cells was higher than in the control group. In mice at 2 weeks after infection, there was a significant increase in the number of cells expressing Foxp3 and CTLA-4 when compared to the control group and mice at 1 week after infection. At 4 weeks after infection, T. spiralis was easily identifiable in nurse cells in mouse muscles. In the intestine, the expression of Gzmb and Klrg1 decreased over time and that of Capg remained unchanged for the first and second week, then decreased in the 4th week. However, in the muscles, the expression of most chemokine genes was increased due to T. spiralis infection, in particular the expression levels of Gzmb, OX40, and CTLA-4 increased until week 4. In addition, increased gene expression of all chemokine receptors in muscle, CXCR3, CCR4, CCR5, CCR9, and CCR10, was observed up until the 4th week. In conclusion, various chemokine receptors showed increased expressions combined with recruitment of Treg cells in the muscle tissue. PMID:27180574

  5. The Role of Platelet-Activating Factor in Chronic Inflammation, Immune Activation, and Comorbidities Associated with HIV Infection

    PubMed Central

    Kelesidis, Theodoros; Papakonstantinou, Vasiliki; Detopoulou, Paraskevi; Fragopoulou, Elizabeth; Chini, Maria; Lazanas, Marios C.; Antonopoulou, Smaragdi

    2016-01-01

    With the advent of highly effective antiretroviral therapy, cardiovascular disease has become an important cause of morbidity and mortality among people with treated HIV-1, but the pathogenesis is unclear. Platelet-activating factor is a potent lipid mediator of inflammation that has immunomodulatory effects and a pivotal role in the pathogenesis of inflammatory disorders and cardiovascular disease. Limited scientific evidence suggests that the platelet-activating factor pathway may be a mechanistic link between HIV-1 infection, systemic inflammation, and immune activation that contribute to pathogenesis of chronic HIV-related comorbidities, including cardiovascular disease and HIV-associated neurocognitive disorders. In this review, we examine the mechanisms by which the cross-talk between HIV-1, immune dysregulation, inflammation, and perturbations in the platelet-activating factor pathway may directly affect HIV-1 immunopathogenesis. Understanding the role of platelet-activating factor in HIV-1 infection may pave the way for further studies to explore therapeutic interventions, such as diet, that can modify platelet-activating factor activity and use of platelet-activating factor inhibitors that might improve the prognosis of HIV-1 infected patients. PMID:26616844

  6. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells

    PubMed Central

    Ho, Catherine M. K.; Donovan-Banfield, I’ah Z.; Tan, Li; Zhang, Tinghu; Gray, Nathanael S.; Strang, Blair L.

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  7. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells.

    PubMed

    Ho, Catherine M K; Donovan-Banfield, I'ah Z; Tan, Li; Zhang, Tinghu; Gray, Nathanael S; Strang, Blair L

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  8. Active hepatitis C infection and HCV genotypes prevalent among the IDUs of Khyber Pakhtunkhwa.

    PubMed

    ur Rehman, Latif; Ullah, Ihasn; Ali, Ijaz; Khan, Imtiaz Ali; Iqbal, Aqib; Khan, Sanaullah; Khan, Sher Hayat; Zaman, Khaleeq Uz; ullah Khan, Najib; Swati, Zahoor Ahmed; Jahangiri, Anila Tariq

    2011-01-01

    Injection drug users (IDUs) are considered as a high risk group to develop hepatitis C due to needle sharing. In this study we have examined 200 injection drug users from various regions of the Khyber Pakhtunkhwa province for the prevalence of active HCV infection and HCV genotypes by Immunochromatographic assays, RT-PCR and Type-specific PCR. Our results indicated that 24% of the IDUs were actively infected with HCV while anti HCV was detected among 31.5% cases. Prevalent HCV genotypes were HCV 2a, 3a, 4 and 1a. Majority of the IDUs were married and had attained primary or middle school education. 95% of the IDUs had a previous history of needle sharing. Our study indicates that the rate of active HCV infection among the IDUs is higher with comparatively more prevalence of the rarely found HCV types in KPK. The predominant mode of HCV transmission turned out to be needle sharing among the IDUs. PMID:21711541

  9. Activated ClpP kills persisters and eradicates a chronic biofilm infection.

    PubMed

    Conlon, B P; Nakayasu, E S; Fleck, L E; LaFleur, M D; Isabella, V M; Coleman, K; Leonard, S N; Smith, R D; Adkins, J N; Lewis, K

    2013-11-21

    Chronic infections are difficult to treat with antibiotics but are caused primarily by drug-sensitive pathogens. Dormant persister cells that are tolerant to killing by antibiotics are responsible for this apparent paradox. Persisters are phenotypic variants of normal cells and pathways leading to dormancy are redundant, making it challenging to develop anti-persister compounds. Biofilms shield persisters from the immune system, suggesting that an antibiotic for treating a chronic infection should be able to eradicate the infection on its own. We reasoned that a compound capable of corrupting a target in dormant cells will kill persisters. The acyldepsipeptide antibiotic (ADEP4) has been shown to activate the ClpP protease, resulting in death of growing cells. Here we show that ADEP4-activated ClpP becomes a fairly nonspecific protease and kills persisters by degrading over 400 proteins, forcing cells to self-digest. Null mutants of clpP arise with high probability, but combining ADEP4 with rifampicin produced complete eradication of Staphylococcus aureus biofilms in vitro and in a mouse model of a chronic infection. Our findings indicate a general principle for killing dormant cells-activation and corruption of a target, rather than conventional inhibition. Eradication of a biofilm in an animal model by activating a protease suggests a realistic path towards developing therapies to treat chronic infections.

  10. Cell death, BAX activation, and HMGB1 release during infection with Chlamydia.

    PubMed

    Jungas, Thomas; Verbeke, Philippe; Darville, Toni; Ojcius, David M

    2004-11-01

    Infection by a number of Chlamydia species leads to resistance of the host cell to apoptosis, followed by induction of host-cell death. In a population of infected cells that displays protection against staurosporine-induced apoptosis among the adherent cells, we find that cells that had been recovered from the supernatant share characteristics of both apoptosis and necrosis, as assayed by the propidium iodide (PI)-annexin V double-labeling technique. Cell death was observed in both an epithelial cell line and primary fibroblasts, although the primary cells had a higher propensity to die through apoptosis than the immortalized cell line. Staurosporine-mediated activation of the pro-apoptotic BCL-2 family member, BAX, was inhibited in the epithelial cell line infected for 32 h with the lymphogranuloma venereum (LGV/L2) but not the murine pneumonitis (MoPn) strain of C. trachomatis, but inhibition of staurosporine-mediated BAX activation disappeared after 48 h of infection with the LGV/L2 strain. Conversely, infection with MoPn (C. muridarum) but not LGV/L2 led to BAX activation after 72 h, as previously reported for shorter (48 h) infection with the guinea pig inclusion conjunctivitis (GPIC) serovar of C. psittaci (C. caviae). These results suggest that the ability to inhibit staurosporine-mediated BAX activation or to activate BAX due to the infection itself may vary as a function of the chlamydial strain. Interestingly, both the epithelial cells and the fibroblasts also released high mobility group box 1 protein (HMGB1) during infection, although much less HMGB1 was released from fibroblasts, consistent with the higher level of apoptosis observed in the primary cells. HMGB1 is released preferentially by necrotic or permeabilized viable cells, but not apoptotic cells. In the extracellular space, HMGB1 promotes inflammation through interaction with specific cell-surface receptors. Higher levels of HMGB1 were also measured in the genital-tract secretions of mice

  11. Cytokine profile and natural killer cell activity in Listeria monocytogenes infected mice treated orally with Petiveria alliacea extract.

    PubMed

    Queiroz, M L; Quadros, M R; Santos, L M

    2000-08-01

    In this work, we investigated the effects of Petiveria alliacea extract on the production of Th1-type and Th2-type cytokines and on NK cells activity in normal and Listeria monocytogenes infected mice. Our results demonstrated that in normal/non-infected mice P. alliacea administration led to increased levels of Interleukin-2 (IL-2). The infection alone enhanced INF-gamma levels and NK cell activity at 48 and 72 hours of infection. The treatment with five consecutive doses of 1000 mg/kg/day of P. alliacea extract, given previously to infection, led to further increases in IL-2 levels, in relation to normal/non-infected/P. alliacea treated controls, and in INF-gamma levels at 72 h of infection, compared to infected mice. On the other hand, the production of IL-4 and IL-10 were not altered either by the infection or by the treatment with P. alliacea extract. NK cells activity increased at 48 h and 72 h following the inoculation of the bacteria. When mice were treated with P. alliacea previously to infection, NK activity was higher than that observed at 48 h, 72 h and 120 h of infection in the infected animal. Based on these findings we suggest that P. alliacea up-regulates anti-bacterial immune response by enhancing both Th1 function and the activity of NK cells.

  12. Small-molecule inhibitors of lethal factor protease activity protect against anthrax infection.

    PubMed

    Moayeri, Mahtab; Crown, Devorah; Jiao, Guan-Sheng; Kim, Seongjin; Johnson, Alan; Leysath, Clinton; Leppla, Stephen H

    2013-09-01

    Bacillus anthracis, the causative agent of anthrax, manifests its pathogenesis through the action of two secreted toxins. The bipartite lethal and edema toxins, a combination of lethal factor or edema factor with the protein protective antigen, are important virulence factors for this bacterium. We previously developed small-molecule inhibitors of lethal factor proteolytic activity (LFIs) and demonstrated their in vivo efficacy in a rat lethal toxin challenge model. In this work, we show that these LFIs protect against lethality caused by anthrax infection in mice when combined with subprotective doses of either antibiotics or neutralizing monoclonal antibodies that target edema factor. Significantly, these inhibitors provided protection against lethal infection when administered as a monotherapy. As little as two doses (10 mg/kg) administered at 2 h and 8 h after spore infection was sufficient to provide a significant survival benefit in infected mice. Administration of LFIs early in the infection was found to inhibit dissemination of vegetative bacteria to the organs in the first 32 h following infection. In addition, neutralizing antibodies against edema factor also inhibited bacterial dissemination with similar efficacy. Together, our findings confirm the important roles that both anthrax toxins play in establishing anthrax infection and demonstrate the potential for small-molecule therapeutics targeting these proteins.

  13. Highly active antiretroviral therapy potently suppresses HIV infection in humanized Rag2-/-gammac-/- mice.

    PubMed

    Sango, Kaori; Joseph, Aviva; Patel, Mahesh; Osiecki, Kristin; Dutta, Monica; Goldstein, Harris

    2010-07-01

    Humanized Rag2(-/-)gamma(c)(-/-) mice (Hu-DKO mice) become populated with functional human T cells, B cells, and dendritic cells following transplantation with human hematopoietic stem cells (HSC) and represent an improved model for studying HIV infection in vivo. In the current study we demonstrated that intrasplenic inoculation of hu-DKO mice with HIV-1 initiated a higher level of HIV infection than intravenous or intraperitoneal inoculation, associated with a reciprocal decrease in peripheral CD4(+) T cells and increase in peripheral CD8(+) T cells. HIV infection by intrasplenic injection increased serum levels of human IgG and IgM including human IgM and IgG specific for HIV-1 gp120. There was a significant inverse correlation between the level of HIV-1 infection and the extent of CD4(+) T cell depletion. Highly active antiretroviral therapy (HAART) initiated 1 week after HIV-1 inoculation markedly suppressed HIV-1 infection and prevented CD4(+) T cell depletion. Taken together, these findings demonstrate that intrasplenic injection of hu-DKO mice with HIV is a more efficient route of HIV infection than intravenous or intraperitoneal injection and generates increased infection associated with an increased anti-HIV humoral response. This animal model can serve as a valuable in vivo model to study the efficacy of anti-HIV therapies.

  14. PKR Activation Favors Infectious Pancreatic Necrosis Virus Replication in Infected Cells

    PubMed Central

    Gamil, Amr A.A.; Xu, Cheng; Mutoloki, Stephen; Evensen, Øystein

    2016-01-01

    The double-stranded RNA-activated protein kinase R (PKR) is a Type I interferon (IFN) stimulated gene that has important biological and immunological functions. In viral infections, in general, PKR inhibits or promotes viral replication, but PKR-IPNV interaction has not been previously studied. We investigated the involvement of PKR during infectious pancreatic necrosis virus (IPNV) infection using a custom-made rabbit antiserum and the PKR inhibitor C16. Reactivity of the antiserum to PKR in CHSE-214 cells was confirmed after IFNα treatment giving an increased protein level. IPNV infection alone did not give increased PKR levels by Western blot, while pre-treatment with PKR inhibitor before IPNV infection gave decreased eukaryotic initiation factor 2-alpha (eIF2α) phosphorylation. This suggests that PKR, despite not being upregulated, is involved in eIF2α phosphorylation during IPNV infection. PKR inhibitor pre-treatment resulted in decreased virus titers, extra- and intracellularly, concomitant with reduction of cells with compromised membranes in IPNV-permissive cell lines. These findings suggest that IPNV uses PKR activation to promote virus replication in infected cells. PMID:27338445

  15. Prevalence of cervical Chlamydia trachomatis infection in sexually active adolescents from Salvador, Brazil.

    PubMed

    Machado, Márcia Sacramento Cunha; Costa e Silva, Bruno Fernando Borges da; Gomes, Igor Logetto Caetité; Santana, Iuri Usêda; Grassi, Maria Fernanda Rios

    2012-01-01

    The incidence of sexually transmitted diseases among adolescents is increasing worldwide. Genital Chlamydia trachomatis infection is one of the most prevalent sexually transmitted diseases in young women, and undetected disease is highly associated with long-term complications in women. Our goal was to determine the prevalence of cervical Chlamydia trachomatis infection in a sexually active population of female adolescents from Salvador, Brazil, and to describe their socio-demographic, behavioral, and clinical characteristics. 100 sexually active adolescents (10-19 years) were included in this study, between 2008 and 2010. Endocervical samples were obtained during gynecological examination. Inhouse polymerase chain reaction of cervical specimens was used for Chlamydia trachomatis detection. The overall prevalence of cervical Chlamydia trachomatis infection was 31% (95% CI 22-40). There were no statistically significant differences in the age at first sexual intercourse, number of sexual partners, and frequency of condom use between Chlamydia infected and uninfected adolescents. The prevalence of cervical Chlamydia trachomatis infection among adolescents from Salvador was the highest in Brazil up to the present date. These results demonstrate an urgent need for continued and comprehensive prevention strategies along with proper screening for Chlamydia in high-risk populations in order to decrease the rates of infection.

  16. PKR Activation Favors Infectious Pancreatic Necrosis Virus Replication in Infected Cells.

    PubMed

    Gamil, Amr A A; Xu, Cheng; Mutoloki, Stephen; Evensen, Øystein

    2016-01-01

    The double-stranded RNA-activated protein kinase R (PKR) is a Type I interferon (IFN) stimulated gene that has important biological and immunological functions. In viral infections, in general, PKR inhibits or promotes viral replication, but PKR-IPNV interaction has not been previously studied. We investigated the involvement of PKR during infectious pancreatic necrosis virus (IPNV) infection using a custom-made rabbit antiserum and the PKR inhibitor C16. Reactivity of the antiserum to PKR in CHSE-214 cells was confirmed after IFNα treatment giving an increased protein level. IPNV infection alone did not give increased PKR levels by Western blot, while pre-treatment with PKR inhibitor before IPNV infection gave decreased eukaryotic initiation factor 2-alpha (eIF2α) phosphorylation. This suggests that PKR, despite not being upregulated, is involved in eIF2α phosphorylation during IPNV infection. PKR inhibitor pre-treatment resulted in decreased virus titers, extra- and intracellularly, concomitant with reduction of cells with compromised membranes in IPNV-permissive cell lines. These findings suggest that IPNV uses PKR activation to promote virus replication in infected cells. PMID:27338445

  17. Bacterial Infection of Fly Ovaries Reduces Egg Production and Induces Local Hemocyte Activation

    PubMed Central

    Brandt, Stephanie M.; Schneider, David S.

    2009-01-01

    Summary Morbidity, the state of being diseased, is an important aspect of pathogenesis that has gone relatively unstudied in fruit flies. Our interest is in characterizing how bacterial pathogenesis affects various physiologies of the fly. We chose to examine the fly ovary because we found bacterial infection had a striking effect on fly reproduction. We observed decreased egg laying after bacterial infection that correlated with increased bacterial virulence. We also found that bacteria colonized the ovary in a previously undescribed manner; bacteria were found in the posterior of the ovary, adjacent to the lateral oviduct. This local infection in the ovary resulted in melanization and activation of the cellular immune response at the site of infection. PMID:17400292

  18. Low cost antiviral activity of Plodia interpunctella haemolymph in vivo demonstrated by dose dependent infection.

    PubMed

    Saejeng, A; Siva-Jothy, M T; Boots, M

    2011-02-01

    Given the ubiquity of infectious disease it is important to understand the way in which hosts defend themselves and any costs that they may pay for this defence. Despite this, we know relatively little about insect immune responses to viruses when compared to their well-characterized responses to other pathogens. In particular it is unclear whether there is significant haemocoelic response to viral infection. Here we directly examine this question by examining whether there is a dose-dependency in infection risk when a DNA virus is injected directly into the haemocoel. Infection from direct injection into the haemocoel showed a clear dose dependency that is indicative of an active intrahaemocoelic immune response to DNA viruses in insects. In contrast to the natural oral infection route, we found no measurable sublethal effects in the survivors from direct injection. This suggests that the immune responses in the haemocoel are less costly than those that occur earlier.

  19. Mechanistic insights on immunosenescence and chronic immune activation in HIV-tuberculosis co-infection

    PubMed Central

    Shankar, Esaki M; Velu, Vijayakumar; Kamarulzaman, Adeeba; Larsson, Marie

    2015-01-01

    Immunosenescence is marked by accelerated degradation of host immune responses leading to the onset of opportunistic infections, where senescent T cells show remarkably higher ontogenic defects as compared to healthy T cells. The mechanistic association between T-cell immunosenescence and human immunodeficiency virus (HIV) disease progression, and functional T-cell responses in HIV-tuberculosis (HIV-TB) co-infection remains to be elaborately discussed. Here, we discussed the association of immunosenescence and chronic immune activation in HIV-TB co-infection and reviewed the role played by mediators of immune deterioration in HIV-TB co-infection necessitating the importance of designing therapeutic strategies against HIV disease progression and pathogenesis. PMID:25674514

  20. EV71-infected CD14(+) cells modulate the immune activity of T lymphocytes in rhesus monkeys.

    PubMed

    Wang, Jingjing; Pu, Jing; Huang, Hongtai; Zhang, Ying; Liu, Longding; Yang, Erxia; Zhou, Xiaofang; Ma, Na; Zhao, Hongling; Wang, Lichun; Xie, Zhenfeng; Tang, Donghong; Li, Qihan

    2013-07-01

    Preliminary studies of the major pathogen enterovirus 71 (EV71), a member of the Picornaviridae family, have suggested that EV71 may be a major cause of fatal hand, foot and mouth disease cases. Currently, the role of the pathological changes induced by EV71 infection in the immunopathogenic response remains unclear. Our study focused on the interaction between this virus and immunocytes and indicated that this virus has the ability to replicate in CD14(+) cells. Furthermore, these EV71-infected CD14(+) cells have the capacity to stimulate the proliferation of T cells and to enhance the release of certain functional cytokines. An adaptive immune response induced by the back-transfusion of EV71-infected CD14(+) cells was observed in donor neonatal rhesus monkeys. Based on these observations, the proposed hypothesis is that CD14(+) cells infected by the EV71 virus might modulate the anti-EV71 adaptive immune response by inducing simultaneous T-cell activation.

  1. Sexually transmitted infections, active component, U.S. Armed Forces, 2000-2012.

    PubMed

    2013-02-01

    This report summarizes incidence rates of the five most commonly diagnosed sexually transmitted infections (STIs) among active component service members of the U.S. Armed Forces during 2000 to 2012. Human papillomavirus (HPV) infections were the most common, followed in decreasing order of frequency by infections associated with chlamydia, herpes simplex virus, gonorrhea, and syphilis. Compared to their counterparts, women, younger service members, soldiers, and enlisted members had higher incidence rates of each STI. Rates tended to be lower among married personnel. Rates of chlamydia, HPV, and gonorrhea diagnoses were notably higher among women during 2006 to 2008 but rates of the latter two infections have since declined sharply. The relatively recent introduction of STI screening among young service women and the HPV vaccine are discussed.

  2. Contribution of Immune Activation to the Pathogenesis and Transmission of Human Immunodeficiency Virus Type 1 Infection

    PubMed Central

    Lawn, Stephen D.; Butera, Salvatore T.; Folks, Thomas M.

    2001-01-01

    The life cycle of human immunodeficiency virus type 1 (HIV-1) is intricately related to the activation state of the host cells supporting viral replication. Although cellular activation is essential to mount an effective host immune response to invading pathogens, paradoxically the marked systemic immune activation that accompanies HIV-1 infection in vivo may play an important role in sustaining phenomenal rates of HIV-1 replication in infected persons. Moreover, by inducing CD4+ cell loss by apoptosis, immune activation may further be central to the increased rate of CD4+ cell turnover and eventual development of CD4+ lymphocytopenia. In addition to HIV-1-induced immune activation, exogenous immune stimuli such as opportunistic infections may further impact the rate of HIV-1 replication systemically or at localized anatomical sites. Such stimuli may also lead to genotypic and phenotypic changes in the virus pool. Together, these various immunological effects on the biology of HIV-1 may potentially enhance disease progression in HIV-infected persons and may ultimately outweigh the beneficial aspects of antiviral immune responses. This may be particularly important for those living in developing countries, where there is little or no access to antiretroviral drugs and where frequent exposure to pathogenic organisms sustains a chronically heightened state of immune activation. Moreover, immune activation associated with sexually transmitted diseases, chorioamnionitis, and mastitis may have important local effects on HIV-1 replication that may increase the risk of sexual or mother-to-child transmission of HIV-1. The aim of this paper is to provide a broad review of the interrelationship between immune activation and the immunopathogenesis, transmission, progression, and treatment of HIV-1 infection in vivo. PMID:11585784

  3. Macrophage activation associated with chronic murine cytomegalovirus infection results in more severe experimental choroidal neovascularization.

    PubMed

    Cousins, Scott W; Espinosa-Heidmann, Diego G; Miller, Daniel M; Pereira-Simon, Simone; Hernandez, Eleut P; Chien, Hsin; Meier-Jewett, Courtney; Dix, Richard D

    2012-01-01

    The neovascular (wet) form of age-related macular degeneration (AMD) leads to vision loss due to choroidal neovascularization (CNV). Since macrophages are important in CNV development, and cytomegalovirus (CMV)-specific IgG serum titers in patients with wet AMD are elevated, we hypothesized that chronic CMV infection contributes to wet AMD, possibly by pro-angiogenic macrophage activation. This hypothesis was tested using an established mouse model of experimental CNV. At 6 days, 6 weeks, or 12 weeks after infection with murine CMV (MCMV), laser-induced CNV was performed, and CNV severity was determined 4 weeks later by analysis of choroidal flatmounts. Although all MCMV-infected mice exhibited more severe CNV when compared with control mice, the most severe CNV developed in mice with chronic infection, a time when MCMV-specific gene sequences could not be detected within choroidal tissues. Splenic macrophages collected from mice with chronic MCMV infection, however, expressed significantly greater levels of TNF-α, COX-2, MMP-9, and, most significantly, VEGF transcripts by quantitative RT-PCR assay when compared to splenic macrophages from control mice. Direct MCMV infection of monolayers of IC-21 mouse macrophages confirmed significant stimulation of VEGF mRNA and VEGF protein as determined by quantitative RT-PCR assay, ELISA, and immunostaining. Stimulation of VEGF production in vivo and in vitro was sensitive to the antiviral ganciclovir. These studies suggest that chronic CMV infection may serve as a heretofore unrecognized risk factor in the pathogenesis of wet AMD. One mechanism by which chronic CMV infection might promote increased CNV severity is via stimulation of macrophages to make pro-angiogenic factors (VEGF), an outcome that requires active virus replication. PMID:22570607

  4. Macrophage Activation Associated with Chronic Murine Cytomegalovirus Infection Results in More Severe Experimental Choroidal Neovascularization

    PubMed Central

    Cousins, Scott W.; Espinosa-Heidmann, Diego G.; Miller, Daniel M.; Pereira-Simon, Simone; Hernandez, Eleut P.; Chien, Hsin; Meier-Jewett, Courtney; Dix, Richard D.

    2012-01-01

    The neovascular (wet) form of age-related macular degeneration (AMD) leads to vision loss due to choroidal neovascularization (CNV). Since macrophages are important in CNV development, and cytomegalovirus (CMV)-specific IgG serum titers in patients with wet AMD are elevated, we hypothesized that chronic CMV infection contributes to wet AMD, possibly by pro-angiogenic macrophage activation. This hypothesis was tested using an established mouse model of experimental CNV. At 6 days, 6 weeks, or 12 weeks after infection with murine CMV (MCMV), laser-induced CNV was performed, and CNV severity was determined 4 weeks later by analysis of choroidal flatmounts. Although all MCMV-infected mice exhibited more severe CNV when compared with control mice, the most severe CNV developed in mice with chronic infection, a time when MCMV-specific gene sequences could not be detected within choroidal tissues. Splenic macrophages collected from mice with chronic MCMV infection, however, expressed significantly greater levels of TNF-α, COX-2, MMP-9, and, most significantly, VEGF transcripts by quantitative RT-PCR assay when compared to splenic macrophages from control mice. Direct MCMV infection of monolayers of IC-21 mouse macrophages confirmed significant stimulation of VEGF mRNA and VEGF protein as determined by quantitative RT-PCR assay, ELISA, and immunostaining. Stimulation of VEGF production in vivo and in vitro was sensitive to the antiviral ganciclovir. These studies suggest that chronic CMV infection may serve as a heretofore unrecognized risk factor in the pathogenesis of wet AMD. One mechanism by which chronic CMV infection might promote increased CNV severity is via stimulation of macrophages to make pro-angiogenic factors (VEGF), an outcome that requires active virus replication. PMID:22570607

  5. Salmonella infections associated with international travel: a Foodborne Diseases Active Surveillance Network (FoodNet) study.

    PubMed

    Johnson, Laura R; Gould, L Hannah; Dunn, John R; Berkelman, Ruth; Mahon, Barbara E

    2011-09-01

    Salmonella species cause an estimated 1.2 million infections per year in the United States, making it one of the most commonly reported enteric pathogens. In addition, Salmonella is an important cause of travel-associated diarrhea and enteric fever, a systemic illness commonly associated with Salmonella serotypes Typhi and Paratyphi A. We reviewed cases of Salmonella infection reported to the Centers for Disease Control and Prevention's (CDC) Foodborne Diseases Active Surveillance Network (FoodNet), a sentinel surveillance network, from 2004 to 2008. We compared travelers with Salmonella infection to nontravelers with Salmonella infection with respect to demographics, clinical characteristics, and serotypes. Among 23,712 case-patients with known travel status, 11% had traveled internationally in the 7 days before illness. Travelers with Salmonella infection tended to be older (median age, 30 years) than nontravelers (median age, 24 years; p<0.0001), but were similar with respect to gender. The most common destinations reported were Mexico (38% of travel-associated infections), India (9%), Jamaica (7%), the Dominican Republic (4%), China (3%), and the Bahamas (2%). The proportions of travelers with Salmonella infection hospitalized and with invasive disease were inversely related to the income level of the destination (p<0.0001). The most commonly reported serotypes, regardless of travel status, were Enteritidis (19% of cases), Typhimurium (14%), Newport (9%), and Javiana (5%). Among infections caused by these four serotypes, 22%, 6%, 5%, and 4%, respectively, were associated with travel. A high index of clinical suspicion for Salmonella infection is appropriate when evaluating recent travelers, especially those who visited Africa, Asia, or Latin America.

  6. Pattern of Transcription Factor Activation in Helicobacter pylori–Infected Mongolian Gerbils

    PubMed Central

    Kudo, Takahiko; Lu, Hong; Wu, Jeng–Yih; Ohno, Tomoyuki; Wu, Michael J.; Genta, Robert M.; Graham, David Y.; Yamaoka, Yoshio

    2011-01-01

    Background & Aims Helicobacter pylori interact with epithelial cells resulting in activation of cellular signaling pathways leading to an inflammatory response. The pattern and timing of transcription factor activation in H pylori-infected gastric mucosa remain unclear. We investigated the roles of transcription factors in the gastric mucosa of H pylori-infected gerbils over the course of the infection. Methods Six-week-old male Mongolian gerbils were inoculated orally with H pylori TN2GF4 or isogenic cagE mutants and examined at 1, 3, 9, and 18 months. We examined the expression of 54 transcription factors using DNA/protein arrays and electrophoretic mobility shift assays. Phosphorylation status of mitogen-activated protein kinases and I κB were evaluated by immunoblot and immunohistochemistry. Results Ten transcription factors were up-regulated by H pylori infection. Six of these factors, including activator protein-1 (AP-1) and cAMP responsive element binding protein (CREB), reached maximal levels at 3 months and were strongly correlated with cellular inflammation and ulceration. Phosphorylation of extracellular signal-regulated kinase correlated with activation of AP-1 and CREB. Levels of nuclear factor-κB and interferon-stimulated responsive element (ISRE) peaked at 18 months and correlated with the presence of severe atrophy and with phosphorylation of Jun-N-terminal kinase (JNK), p38, and IκB. Conclusions The gastric mucosal transcription factors induced by H pylori infection differed according to the phase and outcome of infection; AP-1 and CREB levels were early responders related to inflammation and ulceration, whereas NF-κB and ISRE were late responders related to atrophy. PMID:17383425

  7. Monitoring of the lactonase activity of paraoxonase-1 enzyme in HIV-1-infection.

    PubMed

    Dias, Clara; Marinho, Aline; Morello, Judit; Almeida, Gabriela; Caixas, Umbelina; Soto, Karina; Monteiro, Emilia; Pereira, Sofia

    2014-01-01

    Paraoxonase-1 (PON1) is a high-density lipoprotein (HDL)-associated enzyme known as a free radical scavenging system (1). PON-1 has three main activities, responsible for its antioxidant and anti-inflammatory potential: paraoxonase, arylesterase and lactonase (LACase), the latest to be discovered and pointed out to be its native activity (2). Among other physiological roles, the LACase might minimize the deleterious effects of hyperhomocysteinaemia in infection, by detoxifying the highly reactive metabolite homocysteine-thiolactone (HcyTL) (3),4. In the present work, we have developed and applied a method to quantify LACase activity and to explore the role of this enzyme in HIV-infection and virological response. The LACase activity was monitored in a cohort of HIV-1-infected patients, through the titration of 3-(o-hydroxyphenyl) propionic acid, formed upon the LACase-mediated hydrolysis of the substrate dihydrocoumarin. The study protocol was approved by the Ethics Committee of Centro Hospitalar de Lisboa Central and Hospital Prof. Doutor Fernando Fonseca. All patients gave their written informed consent and were adults with documented HIV-1-infection, regardless of combined antiretroviral therapy (cART) use. Naïve patients and patients who had received continuous antiretroviral treatment for more than one month were included. A total of 179 HIV-1-infected patients were included on this study (51% Men, 39% non-Caucasian, 45±13 years old). Patients with non-suppressed viraemia, either from the non-cART (n=89, 12±4 kU/L, p<0.01) or from the cART with detectable viral load (n=11, 10±5 kU/L, p<0.05) groups, had lower activity than the cART with suppressed viraemia (n=79, 15±7 kU/L) (Kruskal-Wallis test). Among naïve patients, higher viral load (> 31,500 cps/mL, Spearman r=-0.535, p=0.003) and lower CD4+ T-cells count (< 500 cell/mm(3), Pearson r=0.326, p=0.024) were associated with the LACase activity. The present study suggests that lower LACase activity is

  8. Pseudomonas aeruginosa wound infection involves activation of its iron acquisition system in response to fascial contact

    PubMed Central

    Kim, M.; Christley, S.; Khodarev, N. N.; Fleming, I.; Huang, Y.; Chang, E.; Zaborina, O.; Alverdy, J.

    2015-01-01

    Background Wound infections are traditionally thought to occur when microbial burden exceeds the innate clearance capacity of host immune system. Here we introduce the idea that the wound environment itself plays a significant contributory role to wound infection. Methods We developed a clinically relevant murine model of soft tissue infection to explore the role of activation of microbial virulence in response to tissue factors as a mechanism by which pathogenic bacteria cause wound infections. Mice underwent abdominal skin incision and light muscle injury with a crushing forceps versus skin incision alone followed by topical inoculation of P. aeruginosa. Mice were sacrificed on postoperative day 6 and abdominal tissues analyzed for clinical signs of wound infection. To determine if specific wound tissues components induce bacterial virulence, P. aeruginosa was exposed to skin, fascia, and muscle. Results Gross wound infection due to P. aeruginosa was observed to be significantly increased in injured tissues vs non-injured (80% vs 10%) tissues (n=20/group, p<0.0001). Exposure of P. aeruginosa to individual tissue components demonstrated that fascia significantly induced bacterial virulence as judged by the production of pyocyanin, a redox-active phenazine compound known to kill immune cells. Whole genome transcriptional profiling of P. aeruginosa exposed to fascia demonstrated activation of multiple genes responsible for the synthesis of the iron scavenging molecule pyochelin. Conclusion We conclude that wound elements, in particular fascia, may play a significant role in enhancing the virulence of P. aeruginosa and may contribute to the pathogenesis of clinical wound infection. PMID:25807409

  9. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  10. The capsid proteins of Aleutian mink disease virus activate caspases and are specifically cleaved during infection.

    PubMed

    Cheng, Fang; Chen, Aaron Yun; Best, Sonja M; Bloom, Marshall E; Pintel, David; Qiu, Jianming

    2010-03-01

    Aleutian mink disease virus (AMDV) is currently the only known member of the genus Amdovirus in the family Parvoviridae. It is the etiological agent of Aleutian disease of mink. We have previously shown that a small protein with a molecular mass of approximately 26 kDa was present during AMDV infection and following transfection of capsid expression constructs (J. Qiu, F. Cheng, L. R. Burger, and D. Pintel, J. Virol. 80:654-662, 2006). In this study, we report that the capsid proteins were specifically cleaved at aspartic acid residue 420 (D420) during virus infection, resulting in the previously observed cleavage product. Mutation of a single amino acid residue at D420 abolished the specific cleavage. Expression of the capsid proteins alone in Crandell feline kidney (CrFK) cells reproduced the cleavage of the capsid proteins in virus infection. More importantly, capsid protein expression alone induced active caspases, of which caspase-10 was the most active. Active caspases, in turn, cleaved capsid proteins in vivo. Our results also showed that active caspase-7 specifically cleaved capsid proteins at D420 in vitro. These results suggest that viral capsid proteins alone induce caspase activation, resulting in cleavage of capsid proteins. We also provide evidence that AMDV mutants resistant to caspase-mediated capsid cleavage increased virus production approximately 3- to 5-fold in CrFK cells compared to that produced from the parent virus AMDV-G at 37 degrees C but not at 31.8 degrees C. Collectively, our results indicate that caspase activity plays multiple roles in AMDV infection and that cleavage of the capsid proteins might have a role in regulating persistent infection of AMDV. PMID:20042496

  11. Lysis of typhus-group rickettsia-infected targets by lymphokine activated killers

    SciTech Connect

    Carl, M.; Dasch, G.A.

    1986-03-01

    The authors recently described a subset of OKT8, OKT3-positive lymphocytes from typhus-group rickettsia immune individuals which were capable of lysing autologous PHA-blasts or Epstein-Barr virus transformed B cells (LCL) infected with typhus-group rickettsiae. In order to determine if killing by these effectors was HLA-restricted, they stimulated peripheral blood mononuclear cells (PBMC) from typhus-group rickettsia immune individuals in vitro with typhus-group rickettsia-derived antigen for one week and then measured lysis of autologous LCL or HLA-mismatched LCL in a 4-6 hour Cr/sup 51/-release assay. There was significant lysis of both the autologous and the HLA-mismatched infected targets as compared to the corresponding uninfected targets. Since this suggested that the effectors were lymphokine activated killers (LAK) rather than cytotoxic T lymphocytes, they then tested this hypothesis by stimulating PBMC from both immune and non-immune individuals in vitro for one week with purified interleukin 2 and measuring lysis of infected, autologous LCL. PBMC thus treated, from both immune and non-immune individuals, were capable of significantly lysing autologous, infected LCL as compared to the non-infected control. They therefore conclude that targets infected with typhus-group rickettsiae are susceptible to lysis to LAK.

  12. Disparity of basal and therapeutically activated interferon signalling in constraining hepatitis E virus infection.

    PubMed

    Zhou, X; Xu, L; Wang, W; Watashi, K; Wang, Y; Sprengers, D; de Ruiter, P E; van der Laan, L J W; Metselaar, H J; Kamar, N; Peppelenbosch, M P; Pan, Q

    2016-04-01

    Hepatitis E virus (HEV) represents one of the foremost causes of acute hepatitis globally. Although there is no proven medication for hepatitis E, pegylated interferon-α (IFN-α) has been used as off-label drug for treating HEV. However, the efficacy and molecular mechanisms of how IFN signalling interacts with HEV remain undefined. As IFN-α has been approved for treating chronic hepatitis C (HCV) for decades and the role of interferon signalling has been well studied in HCV infection, this study aimed to comprehensively investigate virus-host interactions in HEV infection with focusing on the IFN signalling, in comparison with HCV infection. A comprehensive screen of human cytokines and chemokines revealed that IFN-α was the sole humoral factor inhibiting HEV replication. IFN-α treatment exerted a rapid and potent antiviral activity against HCV, whereas it had moderate and delayed anti-HEV effects in vitro and in patients. Surprisingly, blocking the basal IFN pathway by inhibiting JAK1 to phosphorylate STAT1 has resulted in drastic facilitation of HEV, but not HCV infection. Gene silencing of the key components of JAK-STAT cascade of the IFN signalling, including JAK1, STAT1 and interferon regulatory factor 9 (IRF9), stimulated HEV infection. In conclusion, compared to HCV, HEV is less sensitive to IFN treatment. In contrast, the basal IFN cascade could effectively restrict HEV infection. This bears significant implications in management of HEV patients and future therapeutic development. PMID:26620360

  13. Antimicrobial activity of curcumin against Helicobacter pylori isolates from India and during infections in mice.

    PubMed

    De, Ronita; Kundu, Parag; Swarnakar, Snehasikta; Ramamurthy, T; Chowdhury, Abhijit; Nair, G Balakrish; Mukhopadhyay, Asish K

    2009-04-01

    Treatment failure is a major cause of concern for the Helicobacter pylori-related gastroduodenal diseases like gastritis, peptic ulcer, and gastric cancer. Curcumin, diferuloylmethane from turmeric, has recently been shown to arrest H. pylori growth. The antibacterial activity of curcumin against 65 clinical isolates of H. pylori in vitro and during protection against H. pylori infection in vivo was examined. The MIC of curcumin ranges from 5 microg/ml to 50 microg/ml, showing its effectiveness in inhibiting H. pylori growth in vitro irrespective of the genetic makeup of the strains. The nucleotide sequences of the aroE genes, encoding shikimate dehydrogenase, against which curcumin seems to act as a noncompetitive inhibitor, from H. pylori strains presenting differential curcumin MICs showed that curcumin-mediated growth inhibition of Indian H. pylori strains may not be always dependent on the shikimate pathway. The antimicrobial effect of curcumin in H. pylori-infected C57BL/6 mice and its efficacy in reducing the gastric damage due to infection were examined histologically. Curcumin showed immense therapeutic potential against H. pylori infection as it was highly effective in eradication of H. pylori from infected mice as well as in restoration of H. pylori-induced gastric damage. This study provides novel insights into the therapeutic effect of curcumin against H. pylori infection, suggesting its potential as an alternative therapy, and opens the way for further studies on identification of novel antimicrobial targets of curcumin. PMID:19204190

  14. Infection by bacterial pathogens expressing type III secretion decreases luciferase activity: ramifications for reporter gene studies.

    PubMed

    Savkovic, S D; Koutsouris, A; Wu, G; Hecht, G

    2000-09-01

    Pathogenic microbes influence gene regulation in eukaryotic hosts. Reporter gene studies can define the roles of promoter regulatory sequences. The effect of pathogenic bacteria on reporter genes has not been examined. The aim of this study was to identify which reporter genes are reliable in studies concerning host gene regulation by bacterial pathogens expressing type III secretory systems. Human intestinal epithelial cells, T84, Caco-2 and HT-29, were transfected with plasmids containing luciferase (luc), chloramphenicol acetyltransferase (CAT) or beta-galactosidase (beta-gal) as reporter genes driven by the inducible interleukin-8 (IL-8) or constitutively active simian virus 40 (SV40) promoter. Cells were infected with enteropathogenic E. coli or Salmonella typhimurium, and the reporter activity was assessed. Luc activity significantly decreased following infection, regardless of the promoter. The activity of recombinant luc was nearly ablated by incubation with either EPEC or Salmonella in a cell-free system. Activity was partially preserved by protease inhibitors, and immunoblot analysis showed a decreased amount and molecular weight of recombinant luc, suggesting protein degradation. Neither beta-gal nor CAT activity was altered by infection. Disruption of type III secretion prevented the loss of luc activity. We conclude that CAT or beta-gal, but not luc, can be used as reliable reporter genes to assess the impact of pathogenic microbes, especially those expressing type III secretion on host cell gene regulation.

  15. Contamination of the Hospital Environment From Potential Clostridium difficile Excretors Without Active Infection.

    PubMed

    Biswas, Jason S; Patel, Amita; Otter, Jonathan A; van Kleef, Esther; Goldenberg, Simon D

    2015-08-01

    Clostridium difficile was recovered from 33 (34%) of 98 rooms of patients who were excretors compared with 36 (49%) of 73 rooms of patients with active infection. Not all laboratory algorithms can distinguish between these 2 groups, yet both may be a significant source for ongoing transmission.

  16. Ursolic Acid Activates Intracellular Killing Effect of Macrophages During Mycobacterium tuberculosis Infection.

    PubMed

    Podder, Biswajit; Jang, Woong Sik; Nam, Kung-Woo; Lee, Byung-Eui; Song, Ho-Yeon

    2015-05-01

    Tuberculosis is one of the most threatening infectious diseases to public health all over the world, for which Mycobacterium tuberculosis (MTB) is the etiological agent of pathogenesis. Ursolic acid (UA) has immunomodulatory function and exhibits antimycobacterial activity. However, the intracellular killing effect of UA has yet to be elucidated. The aim of this study was to evaluate the intracellular killing effect of UA during mycobacterial infection. The intracellular killing activity of UA was evaluated in the macrophage cell line THP-1 by the MGIT 960 system as well as by CFU count. The production of reactive oxygen species (ROS) and the level of nitric oxide (NO) were measured using DCF-DA and Griess reagent, respectively. Phagocytosis was observed by a fluorescence-based staining method, and the colony forming units were enumerated on 7H11 agar medium following infection. In addition, MRP8 mRNA expression was measured by qRT-PCR. UA significantly decreased the number of intracellular Mycobacterium through generation of ROS and NO. In addition, it profoundly activated the phagocytosis process of THP-1 cells during MTB-infection. Furthermore, our data demonstrated that UA activated the phagocytosis process in human monocyte cells through MRP8 induction. These data suggest that UA firmly contributes to the intracellular killing effect of macrophages during mycobacterial infection.

  17. Polyomavirus JCV excretion and genotype analysis in HIV-infected patients receiving highly active antiretroviral therapy

    NASA Technical Reports Server (NTRS)

    Lednicky, John A.; Vilchez, Regis A.; Keitel, Wendy A.; Visnegarwala, Fehmida; White, Zoe S.; Kozinetz, Claudia A.; Lewis, Dorothy E.; Butel, Janet S.

    2003-01-01

    OBJECTIVE: To assess the frequency of shedding of polyomavirus JC virus (JCV) genotypes in urine of HIV-infected patients receiving highly active antiretroviral therapy (HAART). METHODS: Single samples of urine and blood were collected prospectively from 70 adult HIV-infected patients and 68 uninfected volunteers. Inclusion criteria for HIV-infected patients included an HIV RNA viral load < 1000 copies, CD4 cell count of 200-700 x 106 cells/l, and stable HAART regimen. PCR assays and sequence analysis were carried out using JCV-specific primers against different regions of the virus genome. RESULTS: JCV excretion in urine was more common in HIV-positive patients but not significantly different from that of the HIV-negative group [22/70 (31%) versus 13/68 (19%); P = 0.09]. HIV-positive patients lost the age-related pattern of JCV shedding (P = 0.13) displayed by uninfected subjects (P = 0.01). Among HIV-infected patients significant differences in JCV shedding were related to CD4 cell counts (P = 0.03). Sequence analysis of the JCV regulatory region from both HIV-infected patients and uninfected volunteers revealed all to be JCV archetypal strains. JCV genotypes 1 (36%) and 4 (36%) were the most common among HIV-infected patients, whereas type 2 (77%) was the most frequently detected among HIV-uninfected volunteers. CONCLUSION: These results suggest that JCV shedding is enhanced by modest depressions in immune function during HIV infection. JCV shedding occurred in younger HIV-positive persons than in the healthy controls. As the common types of JCV excreted varied among ethnic groups, JCV genotypes associated with progressive multifocal leukoencephalopathy may reflect demographics of those infected patient populations.

  18. Altered metabolism of gut microbiota contributes to chronic immune activation in HIV-infected individuals.

    PubMed

    Vázquez-Castellanos, J F; Serrano-Villar, S; Latorre, A; Artacho, A; Ferrús, M L; Madrid, N; Vallejo, A; Sainz, T; Martínez-Botas, J; Ferrando-Martínez, S; Vera, M; Dronda, F; Leal, M; Del Romero, J; Moreno, S; Estrada, V; Gosalbes, M J; Moya, A

    2015-07-01

    Altered interplay between gut mucosa and microbiota during treated HIV infection may possibly contribute to increased bacterial translocation and chronic immune activation, both of which are predictors of morbidity and mortality. Although a dysbiotic gut microbiota has recently been reported in HIV+ individuals, the metagenome gene pool associated with HIV infection remains unknown. The aim of this study is to characterize the functional gene content of gut microbiota in HIV+ patients and to define the metabolic pathways of this bacterial community, which is potentially associated with immune dysfunction. We determined systemic markers of innate and adaptive immunity in a cohort of HIV-infected individuals on successful antiretroviral therapy without comorbidities and in healthy non-HIV-infected subjects. Metagenome sequencing revealed an altered functional profile, with enrichment of the genes involved in various pathogenic processes, lipopolysaccharide biosynthesis, bacterial translocation, and other inflammatory pathways. In contrast, we observed depletion of genes involved in amino acid metabolism and energy processes. Bayesian networks showed significant interactions between the bacterial community, their altered metabolic pathways, and systemic markers of immune dysfunction. This study reveals altered metabolic activity of microbiota and provides novel insight into the potential host-microbiota interactions driving the sustained inflammatory state in successfully treated HIV-infected patients. PMID:25407519

  19. Altered metabolism of gut microbiota contributes to chronic immune activation in HIV-infected individuals.

    PubMed

    Vázquez-Castellanos, J F; Serrano-Villar, S; Latorre, A; Artacho, A; Ferrús, M L; Madrid, N; Vallejo, A; Sainz, T; Martínez-Botas, J; Ferrando-Martínez, S; Vera, M; Dronda, F; Leal, M; Del Romero, J; Moreno, S; Estrada, V; Gosalbes, M J; Moya, A

    2015-07-01

    Altered interplay between gut mucosa and microbiota during treated HIV infection may possibly contribute to increased bacterial translocation and chronic immune activation, both of which are predictors of morbidity and mortality. Although a dysbiotic gut microbiota has recently been reported in HIV+ individuals, the metagenome gene pool associated with HIV infection remains unknown. The aim of this study is to characterize the functional gene content of gut microbiota in HIV+ patients and to define the metabolic pathways of this bacterial community, which is potentially associated with immune dysfunction. We determined systemic markers of innate and adaptive immunity in a cohort of HIV-infected individuals on successful antiretroviral therapy without comorbidities and in healthy non-HIV-infected subjects. Metagenome sequencing revealed an altered functional profile, with enrichment of the genes involved in various pathogenic processes, lipopolysaccharide biosynthesis, bacterial translocation, and other inflammatory pathways. In contrast, we observed depletion of genes involved in amino acid metabolism and energy processes. Bayesian networks showed significant interactions between the bacterial community, their altered metabolic pathways, and systemic markers of immune dysfunction. This study reveals altered metabolic activity of microbiota and provides novel insight into the potential host-microbiota interactions driving the sustained inflammatory state in successfully treated HIV-infected patients.

  20. The effect of highly active antiretroviral therapy on liver function in human immunodeficiency virus-infected pediatric patients with or without hepatitis virus co-infection

    PubMed Central

    Wu, Lijuan; Jin, Changzhong; Bai, Shi; Davies, Henry; Rao, Heping; Liang, Yong; Wu, Nanping

    2015-01-01

    Background: Co-infection of hepatitis virus is common in human immunodeficiency virus (HIV) infected adults in China. But little is known about hepatitis virus co-infection in pediatric HIV-infected subjects. The study aimed to investigate the impact of hepatitis B virus (HBV) and/or hepatitis C virus (HCV) co-infection and highly active antiretroviral therapy (HAART) on liver function of pediatric HIV-infected subjects. Materials and Methods: A cohort study including 101 pediatric HIV-infected subjects with HBV/HCV co-infection and 44 pediatric comparators with HIV mono-infection was carried out in Henan Province of China from September 2011 to September 2012. All patients received HAART for 1-year. HBV and HCV infection was determined by antibody tests. HIV RNA load, CD4+ T-cell counts and liver function were determined before and after HAART. The Student's t-test or a one-way ANOVA was used for normally distributed values and A Mann-Whitney U-test was performed for values without normal distribution using SPSS statistical package 18.0 (SPSS Inc.). Results: After HAART for 1-year, the median levels of viral load were decreased to lower limit of detection in 90.34% pediatric HIV-infected subjects with/without HBV/HCV co-infection (P < 0.001), and CD4+ T-cell counts increased significantly (P < 0.001). Compared with the pre-HAART, mean level of alanine aminotransferase (ALT) in each group had a significant increase after HAART (P < 0.01). The mean levels of ALT and aspartate aminotransferase (AST) in nevirapine (NVP) based HAART group increased significantly after HAART (P < 0.01). Mean change values of ALT and AST were significantly higher in the NVP based regimen group than in the efavirenz (EFV) based regimen group (P < 0.01). For HIV/HBV/HCV co-infected patients, mean change values of ALT and AST in NVP-based HAART group was significantly higher than that in EFV-based HAART group (P < 0.01). Conclusion: Highly active antiretroviral therapy can damage liver

  1. NTPDase and 5'-nucleotidase activities in synaptosomes of rabbits experimentally infected with BoHV-5.

    PubMed

    da Silva, Cássia B; Paim, Francine C; Wolkmer, Patricia; Abdalla, Fátima H; Carvalho, Fabiano B; Palma, Heloísa H; Mello, Camila B E; Flores, Eduardo F; Andrade, Cinthia M; Lopes, Sonia T A

    2015-10-01

    Bovine herpesvirus type 5 (BoHV-5) is the causative agent of herpetic meningoencephalitis in cattle. The purinergic system is described as a modulator of the immune response and neuroinflammation. These functions are related to the extracellular nucleotides concentration. NTPDase and 5'-nucleotidase are enzymes responsible for controlling the extracellular concentration of adenosine triphosphate (ATP), adenosine diphosphate (ADP), adenosine monophosphate (AMP), and adenosine (ADO). The aim of this study is to determinate the ectonucleotidase activity in cortical synaptosomes and synaptosomes from the hippocampus of rabbits experimentally infected with BoHV-5. Rabbits were divided into four groups, two control groups (non-inoculated animals), and two infected groups (inoculated with BoHV-5). The infected groups received 0.5 ml of BoHV-5 suspension with 10(7.5)TCID50 of viral strain SV-507/99, per paranasal sinuses, and the control groups received 0.5 ml of minimum essential media per paranasal sinuses. Animals were submitted to euthanasia on days 7 and 12 post-inoculation (p.i.); cerebral cortex and hippocampus were collected for the synaptosomes isolation and posterior determination of the ectonucleotidase activities. The results showed a decrease (P < 0.05) in ectonucleotidase activity in synaptosomes from the cerebral cortex of infected rabbits, whereas an increased (P < 0.05) ectonucleotidase activity was observed in synaptosomes from the hippocampus. These differences may be related with the heterogeneous distribution of ectonucleotidases in the different brain regions and also with the viral infectivity. Therefore, it is possible to speculate that BoHV-5 replication results in changes in ectonucleotidase activity in the brain, which may contribute to the neurological signs commonly observed in this disease.

  2. Accumulation and activation of natural killer cells in local intraperitoneal HIV-1/MuLV infection results in early control of virus infected cells.

    PubMed

    Johansson, Susanne E; Brauner, Hanna; Hinkula, Jorma; Wahren, Britta; Berg, Louise; Johansson, Maria H

    2011-01-01

    Natural killer (NK) cells are important effectors in resistance to viral infections. The role of NK cells in the acute response to human immunodeficiency virus 1 (HIV-1) infected cells was investigated in a mouse model based on a HIV-1/murine leukemia virus (MuLV) pseudovirus. Splenocytes infected with HIV-1/MuLV were injected intraperitoneally and local immunologic responses and persistence of infected cells were investigated. In vivo depletion with an anti-NK1.1 antibody showed that NK cells are important in resistance to virus infected cells. Moreover, NK cell frequency in the peritoneal cavity increased in response to infected cells and these NK cells had a more mature phenotype, as determined by CD27 and Mac-1 expression. Interestingly, after injection of HIV-1/MuLV infected cells, but not MuLV infected cells, peritoneal NK cells had an increased cytotoxic activity. In conclusion, NK cells play a role in the early control of HIV-1/MuLV infected cells in vivo.

  3. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus

    PubMed Central

    McGregor, Alistair

    2016-01-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107–179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220

  4. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus.

    PubMed

    Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair

    2016-07-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model.

  5. Activity of 5-chloro-pyrazinamide in mice infected with Mycobacterium tuberculosis or Mycobacterium bovis

    PubMed Central

    Ahmad, Zahoor; Tyagi, Sandeep; Minkowski, Austin; Almeida, Deepak; Nuermberger, Eric L.; Peck, Kaitlin M.; Welch, John T.; Baughn, Anthony D.; Jacobs, Williams R.; Grosset, Jacques H.

    2012-01-01

    Background & objectives: Pyrazinamide is an essential component of first line anti-tuberculosis regimen as well as most of the second line regimens. This drug has a unique sterilizing activity against Mycobacterium tuberculosis. Its unique role in tuberculosis treatment has lead to the search and development of its structural analogues. One such analogue is 5-chloro-pyrazinamide (5-Cl-PZA) that has been tested under in vitro conditions against M. tuberculosis. The present study was designed with an aim to assess the activity of 5-Cl-PZA, alone and in combination with first-line drugs, against murine tuberculosis. Methods: The minimum inhibitory concentration (MIC) of 5-Cl-PZA in Middlebrook 7H9 broth (neutral pH) and the inhibitory titre of serum from mice that received a 300 mg/kg oral dose of 5-Cl-PZA 30 min before cardiac puncture were determined. To test the tolerability of orally administered 5-Cl-PZA, uninfected mice received doses up to 300 mg/kg for 2 wk. Four weeks after low-dose aerosol infection either with M. tuberculosis or M. bovis, mice were treated 5 days/wk with 5-Cl-PZA, at doses ranging from 37.5 to 150 mg/kg, either alone or in combination with isoniazid and rifampicin. Antimicrobial activity was assessed by colony-forming unit counts in lungs after 4 and 8 wk of treatment. Results: The MIC of 5-Cl-PZA against M. tuberculosis was between 12.5 and 25 μg/ml and the serum inhibitory titre was 1:4. Under the same experimental conditions, the MIC of pyrazinamide was >100 μg/ml and mouse serum had no inhibitory activity after a 300 mg/kg dose; 5-Cl-PZA was well tolerated in uninfected and infected mice up to 300 and 150 mg/kg, respectively. While PZA alone and in combination exhibited its usual antimicrobial activity in mice infected with M. tuberculosis and no activity in mice infected with M. bovis, 5-Cl-PZA exhibited antimicrobial activity neither in mice infected with M. tuberculosis nor in mice infected with M. bovis. Interpretation

  6. Mycobacterium avium serovars 2 and 8 infections elicit unique activation of the host macrophage immune responses.

    PubMed

    Cebula, B R; Rocco, J M; Maslow, J N; Irani, V R

    2012-12-01

    Mycobacterium avium is an opportunistic pathogen whose pathogenesis is attributed to its serovar-specific glycopeptidolipid (ssGPL), which varies among its 31 serovars. To determine if the presence and type of ssGPLs contribute to M. avium pathogenesis, we infected murine macrophages (mφs) with two M. avium wild type (wt) serovars (2 and 8) and their serovar-null strains. We examined the influence of ssGPL (presence and type) on cytokine production in non-activated (-IFN-γ) and activated (+IFN-γ) mφs, and the bacterial intra-mφ survival over a 6-day infection process. Serovar-2 infections activated TNF-α production that increased over the 6 day period and was capable of controlling the intra-mφ serovar-2 null strain. In contrast, the serovar-8 infection stimulated a strong pro-inflammatory response, but was incapable of removing the invading pathogen, maybe through IL-10 production. It was clear that the intracellular growth of serovar-null in contrast to the wt M. avium strains was easily controlled. Based on our findings and the undisputed fact that M. avium ssGPL is key to its pathogenesis, we conclude that it is not appropriate to dissect the pathogenesis of one M. avium serovar and apply those findings to other serovars. PMID:22991047

  7. Highly heterogeneous, activated and short-lived regulatory T cells during chronic filarial infection

    PubMed Central

    Metenou, Simon; Coulibaly, Yaya I.; Sturdevant, Daniel; Dolo, Housseini; Diallo, Abdallah A.; Soumaoro, Lamine; Coulibaly, Michel E.; Kanakabandi, Kishore; Porcella, Stephen F.; Klion, Amy D.; Nutman, Thomas B.

    2016-01-01

    The mechanisms underlying the increase in the numbers of regulatory T (Treg) cells in chronic infection settings remain unclear. Here we have delineated the phenotype and transcriptional profiles of Treg cells from 18 filarial-infected (Fil+) and 19 filarial-uninfected (Fil-) subjects. We found that the frequencies of Foxp3+ Treg cells expressing CTLA-4, GITR, LAG-3 and IL-10 were significantly higher in Fil+ subjects compared with that in Fil- subjects. Foxp3-expressing Treg-cell populations in Fil+ subjects were also more heterogeneous and had higher expression of IL-10, CCL-4, IL-29, CTLA-4 and TGF-β than Fil- subjects, each of these cytokines having been implicated in immune suppression. Moreover, Foxp3-expressing Treg cells from Fil+ subjects had markedly upregulated expression of activation-induced apoptotic genes with concomitant downregulation of those involved in cell survival. To determine whether the expression of apoptotic genes was due to Treg-cell activation, we found that the expression of CTLA-4, CDk8, RAD50, TNFRSF1A, FOXO3 and RHOA were significantly upregulated in stimulated cells compared with unstimulated cells. Taken together, our results suggest that in patent filarial infection, the expanded Treg-cell populations are heterogeneous, short-lived, activated and express higher levels of molecules known to modulate immune responsiveness, suggesting that filarial infection is associated with high Treg-cell turnover. PMID:24737144

  8. Evaluation of the Microbicidal Activity and Cytokines/Chemokines Profile Released by Neutrophils from HTLV-1-Infected Individuals

    PubMed Central

    Bezerra, Caroline A.; Cardoso, Thiago M.; Giudice, Angela; Porto, Aurélia F.; Santos, Silvane B.; Carvalho, Edgar M.; Bacellar, Olívia

    2011-01-01

    Human T cell lymphotropic virus type-1 (HTLV-1) induces activation and spontaneous proliferation of T cells with production of type-1 pro-inflammatory cytokines. It modifies the immune response to other antigens and increases susceptibility to infectious diseases. However, little is known about innate immunity in HTLV-1 infection. HTLV-1-infected individuals have higher spontaneous neutrophil activation than HTLV-1-seronegative individuals, as shown by the nitroblue tetrazolium (NBT) assay. This study was conducted to evaluate neutrophil function in HTLV-1-infected individuals. Participants in the study included 18 HTLV-1-infected individuals and 14 HTLV-1-seronegative controls. We evaluated the ability of neutrophils (PMNs) to control a parasite infection, to produce peroxynitrite, cytokines and chemokines and to express activation markers in cultures when stimulated with LPS or infected with Leishmania. When compared with the control group, there was no difference in the percentage of PMNs infected with Leishmania or in the number of amastigotes/100 PMNs in HTLV-1-infected individuals. The microbicidal activity of the PMNs and the levels of CXCL8 and CCL4 released by these cells did not show a difference between HTLV-1-infected individuals and the control group. In both the HTLV-1 group and the control group, infection with Leishmania or stimulation of PMNs led to cellular activation. These observations suggest that neutrophils from HTLV-1-infected individuals have preserved their ability to become activated and to produce chemokines and peroxynitrite after stimulation and that the susceptibility to infection by intracellular Leishmania amazonensis in HTLV-1-infected individuals does not depend on impairment of neutrophil function. PMID:21595736

  9. Immunomodulating and antiviral activities of Uncaria tomentosa on human monocytes infected with Dengue Virus-2.

    PubMed

    Reis, Sonia Regina I N; Valente, Ligia M M; Sampaio, André L; Siani, Antonio C; Gandini, Mariana; Azeredo, Elzinandes L; D'Avila, Luiz A; Mazzei, José L; Henriques, Maria das Graças M; Kubelka, Claire F

    2008-03-01

    Uncaria tomentosa (Willd.) DC., a large woody vine native to the Amazon and Central American rainforests has been used medicinally by indigenous peoples since ancient times and has scientifically proven immunomodulating, anti-inflammatory, cytotoxic and antioxidant activities. Several inflammatory mediators that are implicated in vascular permeability and shock are produced after Dengue Virus (DENV) infection by monocytes, the primary targets for virus replication. Here we assessed the immunoregulatory and antiviral activities from U. tomentosa-derived samples, which were tested in an in vitro DENV infection model. DENV-2 infected human monocytes were incubated with U. tomentosa hydro-alcoholic extract or either its pentacyclic oxindole alkaloid-enriched or non-alkaloid fractions. The antiviral activity was determined by viral antigen (DENV-Ag) detection in monocytes by flow cytometry. Our results demonstrated an in vitro inhibitory activity by both extract and alkaloidal fraction, reducing DENV-Ag+ cell rates in treated monocytes. A multiple microbead immunoassay was applied for cytokine determination (TNF-alpha, IFN-alpha, IL-6 and IL-10) in infected monocyte culture supernatants. The alkaloidal fraction induced a strong immunomodulation: TNF-alpha and IFN-alpha levels were significantly decreased and there was a tendency towards IL-10 modulation. We conclude that the alkaloidal fraction was the most effective in reducing monocyte infection rates and cytokine levels. The antiviral and immunomodulating in vitro effects from U. tomentosa pentacyclic oxindole alkaloids displayed novel properties regarding therapeutic procedures in Dengue Fever and might be further investigated as a promising candidate for clinical application.

  10. Dengue Virus Infection of Mast Cells Triggers Endothelial Cell Activation

    PubMed Central

    Brown, Michael G.; Hermann, Laura L.; Issekutz, Andrew C.; Marshall, Jean S.; Rowter, Derek; Al-Afif, Ayham; Anderson, Robert

    2011-01-01

    Vascular perturbation is a hallmark of severe forms of dengue disease. We show here that antibody-enhanced dengue virus infection of primary human cord blood-derived mast cells (CBMCs) and the human mast cell-like line HMC-1 results in the release of factor(s) which activate human endothelial cells, as evidenced by increased expression of the adhesion molecules ICAM-1 and VCAM-1. Endothelial cell activation was prevented by pretreatment of mast cell-derived supernatants with a tumor necrosis factor (TNF)-specific blocking antibody, thus identifying TNF as the endothelial cell-activating factor. Our findings suggest that mast cells may represent an important source of TNF, promoting vascular endothelial perturbation following antibody-enhanced dengue virus infection. PMID:21068256

  11. Activation of pulmonary and lymph node dendritic cells during chronic Pseudomonas aeruginosa lung infection in mice.

    PubMed

    Damlund, Dina Silke Malling; Christophersen, Lars; Jensen, Peter Østrup; Alhede, Morten; Høiby, Niels; Moser, Claus

    2016-06-01

    The majority of cystic fibrosis (CF) patients acquire chronic Pseudomonas aeruginosa lung infection, resulting in increased mortality and morbidity. The chronic P. aeruginosa lung infection is characterized by bacteria growing in biofilm surrounded by polymorphonuclear neutrophils (PMNs). However, the infection is not eradicated and the inflammatory response leads to gradual degradation of the lung tissue. In CF patients, a Th2-dominated adaptive immune response with a pronounced antibody response is correlated with poorer outcome. Dendritic cells (DCs) are crucial in bridging the innate immune system with the adaptive immune response. Once activated, the DCs deliver a set of signals to uncommitted T cells that induce development, such as expansion of regulatory T cells and polarization of Th1, Th2 or Th17 subsets. In this study, we characterized DCs in lungs and regional lymph nodes in BALB/c mice infected using intratracheal installation of P. aeruginosa embedded in seaweed alginate in the lungs. A significantly elevated concentration of DCs was detected earlier in the lungs than in the regional lymph nodes. To evaluate whether the chronic P. aeruginosa lung infection leads to activation of DCs, costimulatory molecules CD80 and CD86 were analyzed. During infection, the DCs showed significant elevation of CD80 and CD86 expression in both the lungs and the regional lymph nodes. Interestingly, the percentage of CD86-positive cells was significantly higher than the percentage of CD80-positive cells in the lymph nodes. In addition, cytokine production from Lipopolysaccharides (LPS)-stimulated DCs was analyzed demonstrating elevated production of IL-6, IL-10 and IL-12. However, production of IL-12 was suppressed earlier than IL-6 and IL-10. These results support that DCs are involved in skewing of the Th1/Th2 balance in CF and may be a possible treatment target. PMID:27009697

  12. Hybrid spreading mechanisms and T cell activation shape the dynamics of HIV-1 infection.

    PubMed

    Zhang, Changwang; Zhou, Shi; Groppelli, Elisabetta; Pellegrino, Pierre; Williams, Ian; Borrow, Persephone; Chain, Benjamin M; Jolly, Clare

    2015-04-01

    HIV-1 can disseminate between susceptible cells by two mechanisms: cell-free infection following fluid-phase diffusion of virions and by highly-efficient direct cell-to-cell transmission at immune cell contacts. The contribution of this hybrid spreading mechanism, which is also a characteristic of some important computer worm outbreaks, to HIV-1 progression in vivo remains unknown. Here we present a new mathematical model that explicitly incorporates the ability of HIV-1 to use hybrid spreading mechanisms and evaluate the consequences for HIV-1 pathogenenesis. The model captures the major phases of the HIV-1 infection course of a cohort of treatment naive patients and also accurately predicts the results of the Short Pulse Anti-Retroviral Therapy at Seroconversion (SPARTAC) trial. Using this model we find that hybrid spreading is critical to seed and establish infection, and that cell-to-cell spread and increased CD4+ T cell activation are important for HIV-1 progression. Notably, the model predicts that cell-to-cell spread becomes increasingly effective as infection progresses and thus may present a considerable treatment barrier. Deriving predictions of various treatments' influence on HIV-1 progression highlights the importance of earlier intervention and suggests that treatments effectively targeting cell-to-cell HIV-1 spread can delay progression to AIDS. This study suggests that hybrid spreading is a fundamental feature of HIV infection, and provides the mathematical framework incorporating this feature with which to evaluate future therapeutic strategies. PMID:25837979

  13. Activation-induced apoptosis in peripheral blood mononuclear cells during hepatosplenic Schistosoma mansoni infections.

    PubMed

    Ghoneim, H M; Demian, S R; Heshmat, M G; Ismail, N S; El-Sayed, Laila H

    2008-01-01

    It is well established that programmed cell death (apoptosis) is an important regulator of host responses during infection with a variety of intra- and extra-cellular pathogens. The present work aimed at assessment of in vitro spontaneous and phytohemagglutinin (PHA)-induced apoptosis in mononuclear cells isolated from patients with hepatosplenic form of S. mansoni infections. Cell death data were correlated to the degree of lymphoproliferative responses to PHA as well as to the serum anti-schistosomal antibody titers. A markedly significant increase in PHA-induced apoptosis in lymphocytes isolated from S. mansoni-infected patients was seen when compared to the corresponding healthy controls. However, a slight difference was recorded between the two studied groups regarding the spontaneous apoptosis. This was accompanied with a significant impairment of in vitro PHA-induced lymphoproliferation of T cells from S. mansoni patients. Data of the present study supports the hypothesis that activation-induced cell death (AICD) is a potentially contributing factor in T helper (Th) cell regulation during chronic stages of schistosomiasis, which represents a critically determinant factor in the host-parasite interaction and might influence the destiny of parasitic infections either towards establishment of chronic infection or towards host death.

  14. Activation-induced apoptosis in peripheral blood mononuclear cells during hepatosplenic Schistosoma mansoni infections.

    PubMed

    Ghoneim, H M; Demian, S R; Heshmat, M G; Ismail, N S; El-Sayed, Laila H

    2008-01-01

    It is well established that programmed cell death (apoptosis) is an important regulator of host responses during infection with a variety of intra- and extra-cellular pathogens. The present work aimed at assessment of in vitro spontaneous and phytohemagglutinin (PHA)-induced apoptosis in mononuclear cells isolated from patients with hepatosplenic form of S. mansoni infections. Cell death data were correlated to the degree of lymphoproliferative responses to PHA as well as to the serum anti-schistosomal antibody titers. A markedly significant increase in PHA-induced apoptosis in lymphocytes isolated from S. mansoni-infected patients was seen when compared to the corresponding healthy controls. However, a slight difference was recorded between the two studied groups regarding the spontaneous apoptosis. This was accompanied with a significant impairment of in vitro PHA-induced lymphoproliferation of T cells from S. mansoni patients. Data of the present study supports the hypothesis that activation-induced cell death (AICD) is a potentially contributing factor in T helper (Th) cell regulation during chronic stages of schistosomiasis, which represents a critically determinant factor in the host-parasite interaction and might influence the destiny of parasitic infections either towards establishment of chronic infection or towards host death. PMID:20306689

  15. Infection of Ustilaginoidea virens intercepts rice seed formation but activates grain‐filling‐related genes

    PubMed Central

    Fan, Jing; Guo, Xiao‐Yi; Li, Liang; Huang, Fu; Sun, Wen‐Xian; Li, Yan; Huang, Yan‐Yan; Xu, Yong‐Ju; Shi, Jun; Lei, Yang; Zheng, Ai‐Ping

    2015-01-01

    Abstract Rice false smut has become an increasingly serious disease in rice (Oryza sativa L.) production worldwide. The typical feature of this disease is that the fungal pathogen Ustilaginoidea virens (Uv) specifically infects rice flower and forms false smut ball, the ustiloxin‐containing ball‐like fungal colony, of which the size is usually several times larger than that of a mature rice seed. However, the underlying mechanisms of Uv‐rice interaction are poorly understood. Here, we applied time‐course microscopic and transcriptional approaches to investigate rice responses to Uv infection. The results demonstrated that the flower‐opening process and expression of associated transcription factors, including ARF6 and ARF8, were inhibited in Uv‐infected spikelets. The ovaries in infected spikelets were interrupted in fertilization and thus were unable to set seeds. However, a number of grain‐filling‐related genes, including seed storage protein genes, starch anabolism genes and endosperm‐specific transcription factors (RISBZ1 and RPBF), were highly transcribed as if the ovaries were fertilized. In addition, critical defense‐related genes like NPR1 and PR1 were downregulated by Uv infection. Our data imply that Uv may hijack host nutrient reservoir by activation of the grain‐filling network because of growth and formation of false smut balls. PMID:25319482

  16. Therapeutic and prophylactic activity of itraconazole against human rhinovirus infection in a murine model

    PubMed Central

    Shim, Aeri; Song, Jae-Hyoung; Kwon, Bo-Eun; Lee, Jeong-Jun; Ahn, Jae-Hee; Kim, Yeon-Jeong; Rhee, Ki-Jong; Chang, Sun-Young; Cha, Younggil; Lee, Yong-Soo; Kweon, Mi-Na; Park, Kwi Sung; Kim, Dong-Eun; Cho, Sungchan; Cho, Hyun-Jong; Ko, Hyun-Jeong

    2016-01-01

    Human rhinovirus (HRV) is the most common viral infectious agent in humans and is the predominant cause of the common cold. There is a need for appropriate vaccines or therapeutic agents to treat HRV infection. In this study, we investigated whether itraconazole (ICZ) can protect cells from HRV-induced cytotoxicity. Replication of HRV1B was reduced by ICZ treatment in the lungs of HRV1B- as compared to vehicle-treated mice. The numbers of immune cells, including granulocytes and monocytes, were reduced in bronchoalveolar lavage fluid (BALF) by ICZ administration after HRV1B infection, corresponding to decreased pro-inflammatory cytokine and chemokine levels in BALF. A histological analysis of lung tissue showed that ICZ suppressed inflammation caused by HRV1B infection. Interestingly, pretreatment of mice with ICZ in the form of a nasal spray had potent prophylactic antiviral activity. Cholesterol accumulation in the plasma membrane was observed upon HRV infection; ICZ blocked cholesterol trafficking to the plasma membrane, as well as resulted in its accumulation in subcellular compartments near the nucleus. These findings suggest that ICZ is a potential antiviral agent for the treatment of HRV infection, which can be adopted preventatively as well as therapeutically. PMID:26976677

  17. The anti-infective activity of punicalagin against Salmonella enterica subsp. enterica serovar typhimurium in mice.

    PubMed

    Li, Guanghui; Feng, Yuqing; Xu, Yunfeng; Wu, Qian; Han, Qi'an; Liang, Xiujun; Yang, Baowei; Wang, Xin; Xia, Xiaodong

    2015-07-01

    Punicalagin, a major bioactive component of pomegranate peel, has been proven to have antioxidant, antiviral, anti-apoptosis, and hepatoprotective properties. The aim of this study was to investigate the anti-infective activity of punicalagin in a mouse model. C57BL/6 mice were initially challenged with Salmonella enterica subsp. enterica serovar typhimurium (S. typhimurium) and then treated with punicalagin. Food and water consumption and body weight were recorded daily. On day 8 post infection, the mice were sacrificed to examine pathogen counts in tissues, hematological parameters, cytokine levels, and histological changes. Compared to mice only infected with S. typhimurium, punicalagin-treated mice had more food consumption and less weight loss. A higher survival rate and lower counts of viable S. typhimurium in feces, liver, spleen, and kidney were found in the punicalagin-treated mice. The enzyme linked immunosorbent assay showed that the levels of IL-6, IL-10, and IFN-γ in serum and the spleen and TNF-α in serum, the spleen and the liver were reduced by punicalagin. Moreover, more neutrophils and higher neutrophil-to-mononuclear cell ratios in the punicalagin-treated mice were observed. Histological examination showed that punicalagin protected cells in the liver and spleen from hemorrhagic necrosis. It is concluded that punicalagin has a beneficial effect against S. typhimurium infection in mice. The anti-infective properties, together with other nutritionally beneficial effects, make punicalagin a promising supplement in human food or animal feeds to prevent disease associated with S. typhimurium.

  18. Activated ClpP kills persisters and eradicates a chronic biofilm infection.

    SciTech Connect

    Conlon, Brian P.; Nakayasu, Ernesto S.; Fleck, Laura E.; LaFleur, Michael D.; Isabella, Vincent M.; Coleman, K.; Leonard, Steve N.; Smith, Richard D.; Adkins, Joshua N.; Lewis, Kim

    2013-11-21

    The current antibiotic crisis stems from two distinct phenomena-drug resistance, and drug tolerance. Resistance mechanisms such as drug efflux or modification prevent antibiotics from binding to their targets 1, allowing pathogens to grow. Antibiotic tolerance is the property of persister cells, phenotypic variants of regular bacteria 2. Antibiotics kill by corrupting targets, but these are inactive in dormant persisters, leading to tolerance. Persisters were first identified by Joseph Bigger in 1944, when he discovered a surviving sub-population of Staphylococcus following treatment with penicillin3. Persisters are largely responsible for recalcitrance of chronic diseases such as tuberculosis, and various infections associated with biofilms - endocarditis, osteomyelitis, infections of catheters and indwelling devices, and deep-seated infections of soft tissues 4. There are a number of redundant pathways involved in persister formation5,6 precluding development of drugs inhibiting their formation. The acyldepsipeptide antibiotic (ADEP 4) has been shown to activate the ClpP protease resulting in death of growing cells 7. Here we show that ADEP4 activated ClpP becomes a fairly non-specific protease and kills persister cells by degradation of over 400 intracellular targets. clpP mutants are resistant to ADEP4 7, but we find that they display increased susceptibility to killing by a range of conventional antibiotics. Combining ADEP4 with rifampicin leads to eradication of persisters, stationary and biofilm populations of Staphylococcus aureus in vitro and in a deep-seated murine infection. Target corruption/activation provides an approach to killing persisters and eradicating chronic infections.

  19. Mechanisms by Which Interleukin-12 Corrects Defective NK Cell Anticryptococcal Activity in HIV-Infected Patients

    PubMed Central

    Kyei, Stephen K.; Ogbomo, Henry; Li, ShuShun; Timm-McCann, Martina; Xiang, Richard F.; Huston, Shaunna M.; Ganguly, Anutosh; Colarusso, Pina; Gill, M. John

    2016-01-01

    ABSTRACT Cryptococcus neoformans is a pathogenic yeast and a leading cause of life-threatening meningitis in AIDS patients. Natural killer (NK) cells are important immune effector cells that directly recognize and kill C. neoformans via a perforin-dependent cytotoxic mechanism. We previously showed that NK cells from HIV-infected patients have aberrant anticryptococcal killing and that interleukin-12 (IL-12) restores the activity at least partially through restoration of NKp30. However, the mechanisms causing this defect or how IL-12 restores the function was unknown. By examining the sequential steps in NK cell killing of Cryptococcus, we found that NK cells from HIV-infected patients had defective binding of NK cells to C. neoformans. Moreover, those NK cells that bound to C. neoformans failed to polarize perforin-containing granules to the microbial synapse compared to healthy controls, suggesting that binding was insufficient to restore a defect in perforin polarization. We also identified lower expression of intracellular perforin and defective perforin release from NK cells of HIV-infected patients in response to C. neoformans. Importantly, treatment of NK cells from HIV-infected patients with IL-12 reversed the multiple defects in binding, granule polarization, perforin content, and perforin release and restored anticryptococcal activity. Thus, there are multiple defects in the cytolytic machinery of NK cells from HIV-infected patients, which cumulatively result in defective NK cell anticryptococcal activity, and each of these defects can be reversed with IL-12. PMID:27555306

  20. Aortic endothelium in HIV-1 infection: chronic injury, activation, and increased leukocyte adherence.

    PubMed Central

    Zietz, C.; Hotz, B.; Stürzl, M.; Rauch, E.; Penning, R.; Löhrs, U.

    1996-01-01

    Clinical and serological studies provide evidence for a pathogenetically relevant vasculopathy in acquired immune deficiency syndrome (AIDS); however, the morphological status of the endothelium under conditions of human immunodeficiency virus (HIV)-1 infection is only sparsely documented. In this study we adapted an en face preparation technique of endothelium for use in immunohistochemistry and investigated the aortic endothelium of pre-AIDS and AIDS patients (n = 32) in comparison with an HIV-negative group (n = 17). The control group showed a regular pattern of evenly distributed aortic endothelial cells, whereas the endothelial cell pattern in the HIV-1-infected patients was clearly disturbed. Simultaneously, the degree of leukocyte adherence on the aortic endothelium increased significantly. These changes were accompanied by an up-regulation of the vascular cell adhesion molecule-1 (VCAM-1) and E-selectin (ELAM-1). The endothelium turnover increased, and one-half of the HIV-1-infected patients exhibited HLA-DR (major histocompatibility complex class II) antigen in the aortic endothelium. Our results provide evidence for a profound and repeated injury with regeneration and activation of the endothelium in HIV-1 infection. Injury as well as activation of the endothelium impairs its normal regulatory properties. This could have consequences for the maintenance of the blood-brain barrier; it might influence the immunologically important interaction of the endothelium with T cells; and it might trigger Kaposi's sarcoma. Images Figure 1 Figure 2 Figure 3 PMID:8952525

  1. Transient CD4/CD8 ratio inversion and aberrant immune activation during dengue virus infection.

    PubMed

    Liu, Ching-Chuan; Huang, Kao-Jean; Lin, Yee-Shin; Yeh, Trai-Ming; Liu, Hsiao-Sheng; Lei, Huan-Yao

    2002-10-01

    The immune status after dengue virus infection was studied in dengue patients from an outbreak of serotype 3 dengue virus infection in the southern part of Taiwan during November and December 1998. Consecutive blood samples from 29 dengue patients, of whom 21 had dengue fever and 8 had dengue hemorrhagic fever/dengue shock syndrome, were collected, and the immunophenotypes of the peripheral blood mononuclear cells were determined by flow cytometry. The early activation marker CD69 appeared on lymphocytes and monocytes at day 4 after the onset of fever, and declined afterward. However, a transient reverse in the CD4/CD8 ratio occurred at days 6-10 after the onset of fever. The CD4/CD8 ratio inversion was manifested in 10 of 29 dengue patients and was encountered more frequently in dengue hemorrhagic fever/dengue shock syndrome than in dengue fever patients. Analysis of the clinical blood cell count of these 10 cases showed that increase of immature neutrophils developed at fever days 5-6, CD4(dim) or CD8(dim) monocytosis at days 6-7, and atypical lymphocytosis at days 8-10 after the onset of fever. Serum IL-6 was found at either day 7 or day 9-11. The PHA-stimulated T-cell response was depressed as well. These changes in immune parameters indicate aberrant immune activation during dengue virus infection and might be involved in the pathogenesis of dengue virus infection.

  2. In Vitro Activity of Quaternary Ammonium Surfactants against Streptococcal, Chlamydial, and Gonococcal Infective Agents.

    PubMed

    Inácio, Ângela S; Nunes, Alexandra; Milho, Catarina; Mota, Luís Jaime; Borrego, Maria J; Gomes, João P; Vaz, Winchil L C; Vieira, Otília V

    2016-06-01

    Quaternary ammonium compounds (QAC) are widely used, cheap, and chemically stable disinfectants and topical antiseptics with wide-spectrum antimicrobial activities. Within this group of compounds, we recently showed that there are significant differences between the pharmacodynamics of n-alkyl quaternary ammonium surfactants (QAS) with a short (C12) alkyl chain when in vitro toxicities toward bacterial and mammalian epithelial cells are compared. These differences result in an attractive therapeutic window that justifies studying short-chain QAS as prophylactics for sexually transmitted infections (STI) and perinatal vertically transmitted urogenital infections (UGI). We have evaluated the antimicrobial activities of short-chain (C12) n-alkyl QAS against several STI and UGI pathogens as well as against commensal Lactobacillus species. Inhibition of infection of HeLa cells by Neisseria gonorrhoeae and Chlamydia trachomatis was studied at concentrations that were not toxic to the HeLa cells. We show that the pathogenic bacteria are much more susceptible to QAS toxic effects than the commensal vaginal flora and that QAS significantly attenuate the infectivity of N. gonorrhoeae and C. trachomatis without affecting the viability of epithelial cells of the vaginal mucosa. N-Dodecylpyridinium bromide (C12PB) was found to be the most effective QAS. Our results strongly suggest that short-chain (C12) n-alkyl pyridinium bromides and structurally similar compounds are promising microbicide candidates for topical application in the prophylaxis of STI and perinatal vertical transmission of UGI. PMID:26976875

  3. Viral infection. II. Hemin induces overexpression of p67 as it partially prevents appearance of an active p67-deglycosylase in baculovirus-infected insect cells.

    PubMed

    Saha, D; Wu, S; Bose, A; Chatterjee, N; Chakraborty, A; Chatterjee, M; Gupta, N K

    1997-06-15

    The roles of p67-deglycosylase (p67-DG) in the regulation of protein synthesis in baculovirus-infected insect cells were studied. Like vaccinia viral infection, baculovirus infection of insect cells also induced the appearance of a p67-DG. However, p67-DG activity could not be detected because these cells do not contain a detectable level of p67. The baculovirus expression vector system (BEVS), however, promotes significant expression of cloned p67-cDNA. The expression of p67 was significantly enhanced by the addition of hemin to the growth medium. Maximum enhancement was observed at 5 microM hemin. Data suggest that hemin prevents the activation of latent p67-DG inside the cell and does not have any effect on p67 gene transcription. To gain a better understanding of the mechanism of p67-DG activation and hemin stimulation of p67 synthesis, we have now purified p67-DG from baculovirus-infected insect cells. We prepared antibodies against this protein. These antibodies reacted with a 105-kDa protein in cell extracts from the uninfected insect cells (Sf9), KRC-7, and L929 (animal cells). In addition, these antibodies reacted with an additional 60-kDa protein in the cell extracts of baculovirus-infected Sf9 cells and vaccinia virus-infected KRC-7 and L929 cells. Data are also presented to show that the antibodies against p67-DG reacted more efficiently (40%) with the 60-kDa protein in both hemin-deficient reticulocyte lysate and hemin-deficient baculovirus-infected cells. We suggest that hemin prevents the conversion of an inactive p67-DG into an active form possibly by covalent modification such as protein phosphorylation or protein glycosylation. The active form is more efficiently recognized by the p67-DG antibodies since these antibodies were prepared against the active form of p67-DG. PMID:9186500

  4. Infection of vascular endothelial cells with herpes simplex virus enhances tissue factor activity and reduces thrombomodulin expression.

    PubMed Central

    Key, N S; Vercellotti, G M; Winkelmann, J C; Moldow, C F; Goodman, J L; Esmon, N L; Esmon, C T; Jacob, H S

    1990-01-01

    Latent infection of vascular cells with herpes-viruses may play a pathogenic role in the development of human atherosclerosis. In a previous study, we found that cultured human umbilical vein endothelial cells (HUVECs) infected with herpes simplex virus 1 (HSV-1) became procoagulant, exemplified both by their enhanced assembly of the prothrombinase complex and by their inability to reduce adhesion of platelets. We now report two further procoagulant consequences of endothelial HSV infection: loss of surface thrombomodulin (TM) activity and induction of synthesis of tissue factor. Within 4 hr of infection of HUVECs, TM activity measured by thrombin-dependent protein C activation declined 21 +/- 3% (P less than 0.05) and by 18 hr, 48 +/- 5% (P less than 0.001). Similar significant TM decrements accompanied infection of bovine aortic endothelial cells. Identical TM loss was induced with HSV-2 infection but not with adenovirus infection. Decreased surface expression of TM antigen (measured by the specific binding of a polyclonal antibody to bovine TM) closely paralleled the loss of TM activity. As examined by Northern blotting, these losses apparently reflected rapid onset (within 4 hr of HSV infection) loss of mRNA for TM. In contrast, HSV infection induced a viral-dose-dependent increase in synthesis of tissue factor protein, adding to the procoagulant state. The results indicate that loss of endothelial protein-synthetic capacity is not a universal effect of HSV infection. We suggest that the procoagulant state induced by reduction in TM activity and amplified tissue factor activity accompanying HSV infection of endothelium could contribute to deposition of thrombi on atherosclerotic plaques and to the "coagulant-necrosis" state that characterizes HSV-infected mucocutaneous lesions. Images PMID:2169619

  5. Membrane-bound complement regulatory activity is decreased on vaccinia virus-infected cells.

    PubMed Central

    Baranyi, L; Okada, N; Baranji, K; Takizawa, H; Okada, H

    1994-01-01

    Decay accelerating factor (DAF), membrane cofactor protein (MCP), complement receptor 1 and mouse Crry are cell surface-bound complement regulatory proteins capable of inhibiting C3 convertase activity on cell membranes, and therefore provide a substantial protection from attack by homologous complement activated either by the classical or by the alternative pathway. Decrease in complement regulatory activity might lead to spontaneous complement deposition and subsequent cell injury. MoAb 5I2 can inhibit the complement regulatory activity of molecules on rat cells, resulting in deposition of homologous complement. The antigen recognized by 5I2 MoAb in rats is homologous to mouse Crry. Fifteen to 20 h after infection with vaccinia virus, in vitro cultured KDH-8 rat hepatoma cells show a strong decrease in expression of Crry-like antigen, and proved to be sensitive to complement deposition when 1:5 diluted normal rat serum was added to the culture medium as a source of complement. Addition of complement to the cultured KDH-8 cells infected with a very low dose of vaccinia virus (1 plaque-forming unit (PFU)/1000 cells) substantially reduced spreading of virus infection in the cell culture, while inactivation of complement by heat or zymosan treatment abrogated the protective effect. PMID:7923872

  6. Non-invasive Imaging of Staphylococcus aureus Infections with a Nuclease-Activated Probe

    PubMed Central

    Hernandez, Frank J.; Huang, Lingyan; Olson, Michael E.; Powers, Kristy M.; Hernandez, Luiza I.; Meyerholz, David K.; Thedens, Daniel R.; Behlke, Mark A.; Horswill, Alexander R.; McNamara, James O.

    2013-01-01

    Technologies that enable the rapid detection and localization of bacterial infections in living animals could address an unmet need for infectious disease diagnostics. We describe a molecular imaging approach for the specific, non-invasive detection of S. aureus based on the activity of its secreted nuclease, micrococcal nuclease (MN). Several short, synthetic oligonucleotides, rendered resistant to mammalian serum nucleases by various chemical modifications, flanked with a fluorophore and quencher, were activated upon degradation by recombinant MN and in S. aureus culture supernatants. A probe consisting of a pair of deoxythymidines flanked by several 2′-O-methyl-modified nucleotides was activated in culture supernatants of S. aureus but not in culture supernatants of several other pathogenic bacteria. Systemic administration of this probe to mice bearing bioluminescent S. aureus muscle infections resulted in probe activation at the infection sites in an MN-dependent manner. This novel bacterial imaging approach has potential clinical applicability for S. aureus and several other medically significant pathogens. PMID:24487433

  7. Inhibition of ecto-ATPase activities impairs HIV-1 infection of macrophages.

    PubMed

    Schachter, Julieta; Delgado, Kelly Valcárcel; Barreto-de-Souza, Victor; Bou-Habib, Dumith Chequer; Persechini, Pedro Muanis; Meyer-Fernandes, José Roberto

    2015-05-01

    Nucleotides and nucleosides are secreted into extracellular media at different concentrations as a consequence of different physiologic and pathological conditions. Ecto-nucleotidases, enzymes present on the surface of most cells, hydrolyze these extracellular nucleotides and reduce the concentration of them, thus affecting the activation of different nucleotide and nucleoside receptors. Also, ecto-nucleotidases are present in a number of microorganisms and play important roles in host-pathogen interactions. Here, we characterized the ecto-ATPase activities present on the surface of HIV-1 particle and human macrophages as well. We found that the kinetic properties of HIV-1 and macrophage ecto-ATPases are similar, suggesting that the enzyme is the same. This ecto-ATPase activity was increased in macrophages infected in vitro with HIV-1. Using three different non-related ecto-ATPase inhibitors-POM-1, ARL67156 and BG0-we showed that the inhibition of these macrophage and viral ecto-ATPase activities impairs HIV-1 infection. In addition, we also found that elevated extracellular concentrations of ATP inhibit HIV-1 production by infected macrophages.

  8. Metabolic Features of Protochlamydia amoebophila Elementary Bodies – A Link between Activity and Infectivity in Chlamydiae

    PubMed Central

    Watzka, Margarete; Wultsch, Anna; Tziotis, Dimitrios; Montanaro, Jacqueline; Richter, Andreas; Schmitt-Kopplin, Philippe; Horn, Matthias

    2013-01-01

    The Chlamydiae are a highly successful group of obligate intracellular bacteria, whose members are remarkably diverse, ranging from major pathogens of humans and animals to symbionts of ubiquitous protozoa. While their infective developmental stage, the elementary body (EB), has long been accepted to be completely metabolically inert, it has recently been shown to sustain some activities, including uptake of amino acids and protein biosynthesis. In the current study, we performed an in-depth characterization of the metabolic capabilities of EBs of the amoeba symbiont Protochlamydia amoebophila. A combined metabolomics approach, including fluorescence microscopy-based assays, isotope-ratio mass spectrometry (IRMS), ion cyclotron resonance Fourier transform mass spectrometry (ICR/FT-MS), and ultra-performance liquid chromatography mass spectrometry (UPLC-MS) was conducted, with a particular focus on the central carbon metabolism. In addition, the effect of nutrient deprivation on chlamydial infectivity was analyzed. Our investigations revealed that host-free P. amoebophila EBs maintain respiratory activity and metabolize D-glucose, including substrate uptake as well as host-free synthesis of labeled metabolites and release of labeled CO2 from 13C-labeled D-glucose. The pentose phosphate pathway was identified as major route of D-glucose catabolism and host-independent activity of the tricarboxylic acid (TCA) cycle was observed. Our data strongly suggest anabolic reactions in P. amoebophila EBs and demonstrate that under the applied conditions D-glucose availability is essential to sustain metabolic activity. Replacement of this substrate by L-glucose, a non-metabolizable sugar, led to a rapid decline in the number of infectious particles. Likewise, infectivity of Chlamydia trachomatis, a major human pathogen, also declined more rapidly in the absence of nutrients. Collectively, these findings demonstrate that D-glucose is utilized by P. amoebophila EBs and provide

  9. Metabolic features of Protochlamydia amoebophila elementary bodies--a link between activity and infectivity in Chlamydiae.

    PubMed

    Sixt, Barbara S; Siegl, Alexander; Müller, Constanze; Watzka, Margarete; Wultsch, Anna; Tziotis, Dimitrios; Montanaro, Jacqueline; Richter, Andreas; Schmitt-Kopplin, Philippe; Horn, Matthias

    2013-01-01

    The Chlamydiae are a highly successful group of obligate intracellular bacteria, whose members are remarkably diverse, ranging from major pathogens of humans and animals to symbionts of ubiquitous protozoa. While their infective developmental stage, the elementary body (EB), has long been accepted to be completely metabolically inert, it has recently been shown to sustain some activities, including uptake of amino acids and protein biosynthesis. In the current study, we performed an in-depth characterization of the metabolic capabilities of EBs of the amoeba symbiont Protochlamydia amoebophila. A combined metabolomics approach, including fluorescence microscopy-based assays, isotope-ratio mass spectrometry (IRMS), ion cyclotron resonance Fourier transform mass spectrometry (ICR/FT-MS), and ultra-performance liquid chromatography mass spectrometry (UPLC-MS) was conducted, with a particular focus on the central carbon metabolism. In addition, the effect of nutrient deprivation on chlamydial infectivity was analyzed. Our investigations revealed that host-free P. amoebophila EBs maintain respiratory activity and metabolize D-glucose, including substrate uptake as well as host-free synthesis of labeled metabolites and release of labeled CO2 from (13)C-labeled D-glucose. The pentose phosphate pathway was identified as major route of D-glucose catabolism and host-independent activity of the tricarboxylic acid (TCA) cycle was observed. Our data strongly suggest anabolic reactions in P. amoebophila EBs and demonstrate that under the applied conditions D-glucose availability is essential to sustain metabolic activity. Replacement of this substrate by L-glucose, a non-metabolizable sugar, led to a rapid decline in the number of infectious particles. Likewise, infectivity of Chlamydia trachomatis, a major human pathogen, also declined more rapidly in the absence of nutrients. Collectively, these findings demonstrate that D-glucose is utilized by P. amoebophila EBs and provide

  10. Ice-Active Substances from the Infective Juveniles of the Freeze Tolerant Entomopathogenic Nematode, Steinernema feltiae.

    PubMed

    Ali, Farman; Wharton, David A

    2016-01-01

    Steinernema feltiae is a moderately freezing tolerant nematode, that can withstand intracellular ice formation. We investigated recrystallization inhibition, thermal hysteresis and ice nucleation activities in the infective juveniles of S. feltiae. Both the splat cooling assay and optical recrystallometry indicate the presence of ice active substances that inhibit recrystallization in the nematode extract. The substance is relatively heat stable and largely retains the recrystallization inhibition activity after heating. No thermal hysteresis activity was detected but the extract had a typical hexagonal crystal shape when grown from a single seed crystal and weak ice nucleation activity. An ice active substance is present in a low concentration, which may be involved in the freezing survival of this species by inhibiting ice recrystallization. PMID:27227961

  11. Ice-Active Substances from the Infective Juveniles of the Freeze Tolerant Entomopathogenic Nematode, Steinernema feltiae

    PubMed Central

    Ali, Farman; Wharton, David A.

    2016-01-01

    Steinernema feltiae is a moderately freezing tolerant nematode, that can withstand intracellular ice formation. We investigated recrystallization inhibition, thermal hysteresis and ice nucleation activities in the infective juveniles of S. feltiae. Both the splat cooling assay and optical recrystallometry indicate the presence of ice active substances that inhibit recrystallization in the nematode extract. The substance is relatively heat stable and largely retains the recrystallization inhibition activity after heating. No thermal hysteresis activity was detected but the extract had a typical hexagonal crystal shape when grown from a single seed crystal and weak ice nucleation activity. An ice active substance is present in a low concentration, which may be involved in the freezing survival of this species by inhibiting ice recrystallization. PMID:27227961

  12. Induction of alternatively activated macrophages enhances pathogenesis during severe acute respiratory syndrome coronavirus infection.

    PubMed

    Page, Carly; Goicochea, Lindsay; Matthews, Krystal; Zhang, Yong; Klover, Peter; Holtzman, Michael J; Hennighausen, Lothar; Frieman, Matthew

    2012-12-01

    Infection with severe acute respiratory syndrome coronavirus (SARS-CoV) causes acute lung injury (ALI) that often leads to severe lung disease. A mouse model of acute SARS-CoV infection has been helpful in understanding the host response to infection; however, there are still unanswered questions concerning SARS-CoV pathogenesis. We have shown that STAT1 plays an important role in the severity of SARS-CoV pathogenesis and that it is independent of the role of STAT1 in interferon signaling. Mice lacking STAT1 have greater weight loss, severe lung pathology with pre-pulmonary-fibrosis-like lesions, and an altered immune response following infection with SARS-CoV. We hypothesized that STAT1 plays a role in the polarization of the immune response, specifically in macrophages, resulting in a worsened outcome. To test this, we created bone marrow chimeras and cell-type-specific knockouts of STAT1 to identify which cell type(s) is critical to protection from severe lung disease after SARS-CoV infection. Bone marrow chimera experiments demonstrated that hematopoietic cells are responsible for the pathogenesis in STAT1(-/-) mice, and because of an induction of alternatively activated (AA) macrophages after infection, we hypothesized that the AA macrophages were critical for disease severity. Mice with STAT1 in either monocytes and macrophages (LysM/STAT1) or ciliated lung epithelial cells (FoxJ1/STAT1) deleted were created. Following infection, LysM/STAT1 mice display severe lung pathology, while FoxJ1/STAT1 mice display normal lung pathology. We hypothesized that AA macrophages were responsible for this STAT1-dependent pathology and therefore created STAT1/STAT6(-/-) double-knockout mice. STAT6 is essential for the development of AA macrophages. Infection of the double-knockout mice displayed a lack of lung disease and prefibrotic lesions, suggesting that AA macrophage production may be the cause of STAT1-dependent lung disease. We propose that the control of AA

  13. Active syphilis in HIV infection: a multicentre retrospective survey. The German AIDS Study Group (GASG).

    PubMed Central

    Schöfer, H; Imhof, M; Thoma-Greber, E; Brockmeyer, N H; Hartmann, M; Gerken, G; Pees, H W; Rasokat, H; Hartmann, H; Sadri, I; Emminger, C; Stellbrink, H J; Baumgarten, R; Plettenberg, A

    1996-01-01

    OBJECTIVE: To study syphilis in HIV infection focusing on immunocompromised patients with an atypical or aggressive clinical course of syphilis, inappropriate serological reactions or an unreliable response to therapy. STUDY DESIGN: A multicentre retrospective chart review using a standardised questionnaire for all patients with active syphilis. SETTINGS: Thirteen dermatological and medical centres throughout Germany, all members of the German AIDS Study Group (GASG). PATIENTS: Clinical data of 11,368 HIV infected patients have been analysed for cases of active syphilis requiring treatment. Asymptotic patients with reactive serological parameters indicating latent syphilis without a need for treatment were excluded. RESULTS: Active syphilis was reported in 151 of 11,368 HIV infected patients (1.33%, range per centre 0.3%-5.1%). Most of the 151 syphilis patients were male (93%) and belonged to the homosexual or bisexual exposure category for HIV infection (79%); another 6% were iv drug users. Among the 151 syphilis patients primary syphilis was diagnosed in 17.2%, maculopapular secondary syphilis in 29.1%, ulcerating secondary syphilis in 7.3%, neurosyphilis in 16.6% and latent seropositive syphilis without clinical symptoms but serological abnormalities indicating active syphilis in 25.2%. A history of prior treatments for syphilis was reported in 50%. At the time of syphilis diagnosis 26.5% of the patients were in CDC stage II, 33.8% in stage III and 24.5% in stage IV of HIV disease (CDC classification 1987). CD4 cell count was lowest in those with ulcerating secondary syphilis (mean 307, SD 140/microliters) and neurosyphilis (351, SD 235/ microliters). The highest CD4 count was found in patients with early primary and early secondary syphilis (444, SD 163/microliters and 470, SD 355/microliters). Inappropriate serological response to syphilis infection was found in 81 of 151 patients (54%). Remarkable findings were false negative VDRL titres (11 patients with non

  14. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6.

    PubMed

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R; Murphy, Eain; Sinclair, John

    2016-08-05

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection.

  15. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6

    PubMed Central

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R.; Murphy, Eain; Sinclair, John

    2016-01-01

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  16. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6.

    PubMed

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R; Murphy, Eain; Sinclair, John

    2016-01-01

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  17. Low Prevalence of Ocular Chlamydia trachomatis Infection and Active Trachoma in the Western Division of Fiji

    PubMed Central

    Mudaliar, Umesh; Natutusau, Kinisimere; Pavluck, Alexandre L.; Willis, Rebecca; Alexander, Neal; Mabey, David C. W.; Cikamatana, Luisa; Kama, Mike; Rafai, Eric; Roberts, Chrissy H.; Solomon, Anthony W.

    2016-01-01

    Background Trachoma is the leading infectious cause of blindness and is caused by ocular infection with the bacterium Chlamydia trachomatis (Ct). While the majority of the global disease burden is found in sub-Saharan Africa, the Western Pacific Region has been identified as trachoma endemic. Population surveys carried out throughout Fiji have shown an abundance of both clinically active trachoma and trachomatous trichiasis in all divisions. This finding is at odds with the clinical experience of local healthcare workers who do not consider trachoma to be highly prevalent. We aimed to determine whether conjunctival infection with Ct could be detected in one administrative division of Fiji. Methods A population-based survey of 2306 individuals was conducted using the Global Trachoma Mapping Project methodology. Population prevalence of active trachoma in children and trichiasis in adults was estimated using the World Health Organization simplified grading system. Conjunctival swabs were collected from 1009 children aged 1–9 years. DNA from swabs was tested for the presence of the Ct plasmid and human endogenous control. Results The prevalence of active trachoma in 1–9 year olds was 3.4%. The age-adjusted prevalence was 2.8% (95% CI: 1.4–4.3%). The unadjusted prevalence of ocular Ct infection in 1–9 year-olds was 1.9% (19/1009), and the age-adjusted infection prevalence was 2.3% (95% CI: 0.4–2.5%). The median DNA load was 41 Ct plasmid copies per swab (min 20, first quartile 32, mean 6665, third quartile 161, max 86354). There was no association between current infection and follicular trachoma. No cases of trachomatous trichiasis were identified. Discussion The Western Division of Fiji has a low prevalence of clinical trachoma. Ocular Ct infections were observed, but they were predominantly low load infections and were not correlated with clinical signs. Our study data suggest that trachoma does not meet the WHO definition of a public health problem in

  18. [In vitro activity of ampicillin-ceftriaxone against Enterococcus faecalis isolates recovered from invasive infections].

    PubMed

    Burguer Moreira, Noelia; Nastro, Marcela; Vay, Carlos; Famiglietti, Ángela; Rodríguez, Carlos Hernán

    2016-01-01

    In vitro activity of the combination of ampicillin- ceftriaxone against 30 Enterococcus faecalis isolates recovered from invasive infections in patients admitted to Hospital de Clínicas José de San Martin in the city of Buenos Aires was assessed. Ampicillin- ceftriaxone synergies were determined by microdilution in Müeller-Hinton (MH) broth with and without subinhibitory concentrations of ceftriaxone. Synergy was detected in 22/30 isolates. A decrease in both minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) was observed in 14/30 isolates, whereas in 6/30 isolates the decrease was observed in the MIC value and only in the MBC value in the 2 remaining isolates. The bactericidal activity of the combination showed to be higher at low concentrations of ampicillin (< 1 μg/ml). We detected in vitro synergy using the ampicillin-ceftriaxone combination and thus, its efficacy was confirmed in the treatment of severe infections by E. faecalis.

  19. Activity of daptomycin against staphylococci collected from bloodstream infections in Spanish medical centers.

    PubMed

    Picazo, Juan J; Betriu, Carmen; Culebras, Esther; Rodríguez-Avial, Iciar; Gómez, María; López, Fátima

    2009-08-01

    We used the broth microdilution method to determine the MICs of daptomycin and 13 comparator agents against 319 methicillin-susceptible Staphylococcus aureus isolates, 201 methicillin-resistant S. aureus (MRSA) isolates, and 183 coagulase-negative staphylococci (CoNS). Isolates were consecutively collected from bloodstream infections in 39 Spanish medical centers during a 3-month period (March through May 2008). Among MRSA, 1 isolate with intermediate susceptibility to vancomycin and 6 isolates resistant to linezolid were found. Nonsusceptibility to teicoplanin was detected in 3.9% of CoNS. Daptomycin was highly active against the staphylococcal blood isolates tested-all were inhibited at the daptomycin susceptibility breakpoint of < or = 1 microg/mL. Daptomycin retained its activity against the isolates that were resistant to teicoplanin or linezolid, or that had reduced susceptibility to vancomycin. These data suggest that daptomycin could be useful for the treatment of bloodstream infections caused by staphylococci. PMID:19631100

  20. Stress responses in flavivirus-infected cells: activation of unfolded protein response and autophagy.

    PubMed

    Blázquez, Ana-Belén; Escribano-Romero, Estela; Merino-Ramos, Teresa; Saiz, Juan-Carlos; Martín-Acebes, Miguel A

    2014-01-01

    The Flavivirus is a genus of RNA viruses that includes multiple long known human, animal, and zoonotic pathogens such as Dengue virus, yellow fever virus, West Nile virus, or Japanese encephalitis virus, as well as other less known viruses that represent potential threats for human and animal health such as Usutu or Zika viruses. Flavivirus replication is based on endoplasmic reticulum-derived structures. Membrane remodeling and accumulation of viral factors induce endoplasmic reticulum stress that results in activation of a cellular signaling response termed unfolded protein response (UPR), which can be modulated by the viruses for their own benefit. Concomitant with the activation of the UPR, an upregulation of the autophagic pathway in cells infected with different flaviviruses has also been described. This review addresses the current knowledge of the relationship between endoplasmic reticulum stress, UPR, and autophagy in flavivirus-infected cells and the growing evidences for an involvement of these cellular pathways in the replication and pathogenesis of these viruses.

  1. Reducing infection in chronic leg ulcers with an activated carbon cloth dressing.

    PubMed

    Murphy, Nina

    2016-06-23

    Zorflex is a new type of antimicrobial dressing composed of 100% activated carbon cloth. It attracts and binds bacteria to its surface, enabling them to be safely removed at dressing change. It has no reported toxic effects and can be used on either a short-or long-term basis. This article describes 4 case studies in which patients with recalcitrant chronic venous leg ulcers that were prone to recurrent infection were treated with the activated carbon cloth dressing. All of the wounds had failed to respond to antimicrobial dressings containing silver, iodine or polyhexamethylene biguanide (PHMB), and were heavily exuding and painful. In all cases, the signs of infection reduced significantly within 4 weeks, resulting in good patient outcomes. PMID:27345081

  2. Haemostatic activation in HIV infected patients treated with different antiretroviral regimens.

    PubMed

    Pan, Angelo; Testa, Sophie; Quiros Roldan, Eugenia; Tinelli, Carmine; Bodini, Umberto; Cadeo, Barbara; Carnevale, Giuseppe; Martinelli, Ida; Maserati, Renato; Morstabilini, Pietro; Seminari, Elena; Signorini, Liana; Carosi, Giampiero

    2008-01-01

    HIV infected patients treated with highly active antiretroviral therapy (HAART) may be at increased risk of cardiovascular events, particularly if based upon the use of protease inhibitors (PI). We investigated the haemostatic markers of cardiovascular risk in 115 HIV infected subjects, divided into four groups : 1) patients naïve to antiretroviral therapy (Naïve; n=34 patients), or subjects that had been on a stable combination therapy for > or =12 months with either: 2) double reverse transcriptase nucleoside analogue inhibitors therapy (2NRTI; n=26), 3) 2NRTI backbone plus a non-nucleoside analogue reverse transcriptase inhibitor (NNRTI; n=27), and 4) on a PI based regimen (PI; n=28). Forty-four healthy subjects were included as controls. Naïve as well as 2NRTI and NNRTI differed from controls for higher F1+2 (P<.0001) and FVII (P<.007) levels. When comparing PI patients with controls we observed significantly higher levels of Fbg (P=.035), FVII (P<.0001), TM (P<.0089), vWF (P=.009), and F1+2 (P<.0001). The only difference observed among the 4 groups of HIV infected patients was a significantly lower level of F1+2 in PI as compared with NNRTI patients (P=.05) At least one abnormal result was observed in > or = 90.6% of HIV infects groups, vs 43.2% of controls (P<.0001 in all cases). In conclusion, a) HIV infection per se may alter the haemostatic markers of cardiovascular risk, b) minor differences were observed among the different classes of HIV infected patients, namely between NNRTI and PI treated patients.

  3. Buparvaquone is active against Neospora caninum in vitro and in experimentally infected mice.

    PubMed

    Müller, Joachim; Aguado-Martinez, Adriana; Manser, Vera; Balmer, Vreni; Winzer, Pablo; Ritler, Dominic; Hostettler, Isabel; Arranz-Solís, David; Ortega-Mora, Luis; Hemphill, Andrew

    2015-04-01

    The naphthoquinone buparvaquone is currently the only drug used against theileriosis. Here, the effects of buparvaquone were investigated in vitro and in an experimental mouse model for Neospora caninum infection. In 4-day proliferation assays, buparvaquone efficiently inhibited N. caninum tachyzoite replication (IC50 = 4.9 nM; IC100 = 100 nM). However, in the long term tachyzoites adapted and resumed proliferation in the presence of 100 nM buparvaquone after 20 days of cultivation. Parasiticidal activity was noted after 9 days of culture in 0.5 µM or 6 days in 1 µM buparvaquone. TEM of N. caninum infected fibroblasts treated with 1 µM buparvaquone showed that the drug acted rather slowly, and ultrastructural changes were evident only after 3-5 days of treatment, including severe alterations in the parasite cytoplasm, changes in the composition of the parasitophorous vacuole matrix and a diminished integrity of the vacuole membrane. Treatment of N. caninum infected mice with buparvaquone (100 mg/kg) either by intraperitoneal injection or gavage prevented neosporosis symptoms in 4 out of 6 mice in the intraperitoneally treated group, and in 6 out of 7 mice in the group receiving oral treatment. In the corresponding controls, all 6 mice injected intraperitoneally with corn oil alone died of acute neosporosis, and 4 out of 6 mice died in the orally treated control group. Assessment of infection intensities in the treatment groups showed that, compared to the drug treated groups, the controls showed a significantly higher parasite load in the lungs while cerebral parasite load was higher in the buparvaquone-treated groups. Thus, although buparvaquone did not eliminate the parasites infecting the CNS, the drug represents an interesting lead with the potential to eliminate, or at least diminish, fetal infection during pregnancy. PMID:25941626

  4. In Vivo Activity of Ceftobiprole in Murine Skin Infections Due to Staphylococcus aureus and Pseudomonas aeruginosa▿

    PubMed Central

    Fernandez, Jeffrey; Hilliard, Jamese J.; Abbanat, Darren; Zhang, Wenyan; Melton, John L.; Santoro, Colleen M.; Flamm, Robert K.; Bush, Karen

    2010-01-01

    Ceftobiprole, a broad-spectrum cephalosporin with activity against methicillin-resistant Staphylococcus aureus (MRSA) (P. Hebeisen et al., Antimicrob. Agents Chemother. 45:825-836, 2001), was evaluated in a subcutaneous skin infection model with Staphylococcus aureus Smith OC 4172 (methicillin-susceptible S. aureus [MSSA]), S. aureus OC 8525 (MRSA), Pseudomonas aeruginosa OC 4351 (having an inducible AmpC β-lactamase), and P. aeruginosa OC 4354 (overproducing AmpC β-lactamase). In the MSSA and MRSA infection models, ceftobiprole, administered as the prodrug ceftobiprole medocaril, was more effective in reducing CFU/g skin (P < 0.001) than were cefazolin, vancomycin, or linezolid based on the dose-response profiles. Skin lesion volumes in MSSA-infected animals treated with ceftobiprole were 19 to 29% lower than those for cefazolin-, vancomycin-, or linezolid-treated animals (P < 0.001). In MRSA infections, lesion size in ceftobiprole-treated mice was 34% less than that with cefazolin or linezolid treatment (P < 0.001). Against P. aeruginosa, ceftobiprole at similar doses was as effective as meropenem-cilastatin in reductions of CFU/g skin, despite 8- and 32-fold-lower MICs for meropenem; both treatments were more effective than was cefepime (P < 0.001) against the inducible and overproducing AmpC β-lactamase strains of P. aeruginosa. Ceftobiprole was similar to meropenem-cilastatin and 47 to 54% more effective than cefepime (P < 0.01) in reducing the size of the lesion caused by either strain of P. aeruginosa in this study. These studies indicate that ceftobiprole is effective in reducing both bacterial load and lesion volume associated with infections due to MSSA, MRSA, and P. aeruginosa in this murine model of skin and soft tissue infection. PMID:19884364

  5. Buparvaquone is active against Neospora caninum in vitro and in experimentally infected mice

    PubMed Central

    Müller, Joachim; Aguado-Martinez, Adriana; Manser, Vera; Balmer, Vreni; Winzer, Pablo; Ritler, Dominic; Hostettler, Isabel; Arranz-Solís, David; Ortega-Mora, Luis; Hemphill, Andrew

    2015-01-01

    The naphthoquinone buparvaquone is currently the only drug used against theileriosis. Here, the effects of buparvaquone were investigated in vitro and in an experimental mouse model for Neospora caninum infection. In 4-day proliferation assays, buparvaquone efficiently inhibited N. caninum tachyzoite replication (IC50 = 4.9 nM; IC100 = 100 nM). However, in the long term tachyzoites adapted and resumed proliferation in the presence of 100 nM buparvaquone after 20 days of cultivation. Parasiticidal activity was noted after 9 days of culture in 0.5 µM or 6 days in 1 µM buparvaquone. TEM of N. caninum infected fibroblasts treated with 1 µM buparvaquone showed that the drug acted rather slowly, and ultrastructural changes were evident only after 3–5 days of treatment, including severe alterations in the parasite cytoplasm, changes in the composition of the parasitophorous vacuole matrix and a diminished integrity of the vacuole membrane. Treatment of N. caninum infected mice with buparvaquone (100 mg/kg) either by intraperitoneal injection or gavage prevented neosporosis symptoms in 4 out of 6 mice in the intraperitoneally treated group, and in 6 out of 7 mice in the group receiving oral treatment. In the corresponding controls, all 6 mice injected intraperitoneally with corn oil alone died of acute neosporosis, and 4 out of 6 mice died in the orally treated control group. Assessment of infection intensities in the treatment groups showed that, compared to the drug treated groups, the controls showed a significantly higher parasite load in the lungs while cerebral parasite load was higher in the buparvaquone-treated groups. Thus, although buparvaquone did not eliminate the parasites infecting the CNS, the drug represents an interesting lead with the potential to eliminate, or at least diminish, fetal infection during pregnancy. PMID:25941626

  6. Activated human valvular interstitial cells sustain interleukin-17 production to recruit neutrophils in infective endocarditis.

    PubMed

    Yeh, Chiou-Yueh; Shun, Chia-Tung; Kuo, Yu-Min; Jung, Chiau-Jing; Hsieh, Song-Chou; Chiu, Yen-Ling; Chen, Jeng-Wei; Hsu, Ron-Bin; Yang, Chia-Ju; Chia, Jean-San

    2015-06-01

    The mechanisms that underlie valvular inflammation in streptococcus-induced infective endocarditis (IE) remain unclear. We previously demonstrated that streptococcal glucosyltransferases (GTFs) can activate human heart valvular interstitial cells (VIC) to secrete interleukin-6 (IL-6), a cytokine involved in T helper 17 (Th17) cell differentiation. Here, we tested the hypothesis that activated VIC can enhance neutrophil infiltration through sustained IL-17 production, leading to valvular damage. To monitor cytokine and chemokine production, leukocyte recruitment, and the induction or expansion of CD4(+) CD45RA(-) CD25(-) CCR6(+) Th17 cells, primary human VIC were cultured in vitro and activated by GTFs. Serum cytokine levels were measured using an enzyme-linked immunosorbent assay (ELISA), and neutrophils and Th17 cells were detected by immunohistochemistry in infected valves from patients with IE. The expression of IL-21, IL-23, IL-17, and retinoic acid receptor-related orphan receptor C (Rorc) was upregulated in GTF-activated VIC, which may enhance the proliferation of memory Th17 cells in an IL-6-dependent manner. Many chemokines, including chemokine (C-X-C motif) ligand 1 (CXCL1), were upregulated in GTF-activated VIC, which might recruit neutrophils and CD4(+) T cells. Moreover, CXCL1 production in VIC was induced in a dose-dependent manner by IL-17 to enhance neutrophil chemotaxis. CXCL1-expressing VIC and infiltrating neutrophils could be detected in infected valves, and serum concentrations of IL-17, IL-21, and IL-23 were increased in patients with IE compared to healthy donors. Furthermore, elevated serum IL-21 levels have been significantly associated with severe valvular damage, including rupture of chordae tendineae, in IE patients. Our findings suggest that VIC are activated by bacterial modulins to recruit neutrophils and that such activities might be further enhanced by the production of Th17-associated cytokines. Together, these factors can amplify

  7. Activation of RNase L is dependent on OAS3 expression during infection with diverse human viruses

    PubMed Central

    Li, Yize; Banerjee, Shuvojit; Wang, Yuyan; Goldstein, Stephen A.; Dong, Beihua; Gaughan, Christina; Silverman, Robert H.; Weiss, Susan R.

    2016-01-01

    The 2′,5′-oligoadenylate (2-5A) synthetase (OAS)–RNase L system is an IFN-induced antiviral pathway. RNase L activity depends on 2-5A, synthesized by OAS. Although all three enzymatically active OAS proteins in humans—OAS1, OAS2, and OAS3—synthesize 2-5A upon binding dsRNA, it is unclear which are responsible for RNase L activation during viral infection. We used clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR-associated protein-9 nuclease (Cas9) technology to engineer human A549-derived cell lines in which each of the OAS genes or RNase L is knocked out. Upon transfection with poly(rI):poly(rC), a synthetic surrogate for viral dsRNA, or infection with each of four viruses from different groups (West Nile virus, Sindbis virus, influenza virus, or vaccinia virus), OAS1-KO and OAS2-KO cells synthesized amounts of 2-5A similar to those synthesized in parental wild-type cells, causing RNase L activation as assessed by rRNA degradation. In contrast, OAS3-KO cells synthesized minimal 2-5A, and rRNA remained intact, similar to infected RNase L-KO cells. All four viruses replicated to higher titers in OAS3-KO or RNase L-KO A549 cells than in parental, OAS1-KO, or OAS2-KO cells, demonstrating the antiviral effects of OAS3. OAS3 displayed a higher affinity for dsRNA in intact cells than either OAS1 or OAS2, consistent with its dominant role in RNase L activation. Finally, the requirement for OAS3 as the major OAS isoform responsible for RNase L activation was not restricted to A549 cells, because OAS3-KO cells derived from two other human cell lines also were deficient in RNase L activation. PMID:26858407

  8. Guanylate binding proteins enable rapid activation of canonical and noncanonical inflammasomes in Chlamydia-infected macrophages.

    PubMed

    Finethy, Ryan; Jorgensen, Ine; Haldar, Arun K; de Zoete, Marcel R; Strowig, Till; Flavell, Richard A; Yamamoto, Masahiro; Nagarajan, Uma M; Miao, Edward A; Coers, Jörn

    2015-12-01

    Interferon (IFN)-inducible guanylate binding proteins (GBPs) mediate cell-autonomous host resistance to bacterial pathogens and promote inflammasome activation. The prevailing model postulates that these two GBP-controlled activities are directly linked through GBP-dependent vacuolar lysis. It was proposed that the rupture of pathogen-containing vacuoles (PVs) by GBPs destroyed the microbial refuge and simultaneously contaminated the host cell cytosol with microbial activators of inflammasomes. Here, we demonstrate that GBP-mediated host resistance and GBP-mediated inflammatory responses can be uncoupled. We show that PVs formed by the rodent pathogen Chlamydia muridarum, so-called inclusions, remain free of GBPs and that C. muridarum is impervious to GBP-mediated restrictions on bacterial growth. Although GBPs neither bind to C. muridarum inclusions nor restrict C. muridarum growth, we find that GBPs promote inflammasome activation in C. muridarum-infected macrophages. We demonstrate that C. muridarum infections induce GBP-dependent pyroptosis through both caspase-11-dependent noncanonical and caspase-1-dependent canonical inflammasomes. Among canonical inflammasomes, we find that C. muridarum and the human pathogen Chlamydia trachomatis activate not only NLRP3 but also AIM2. Our data show that GBPs support fast-kinetics processing and secretion of interleukin-1β (IL-1β) and IL-18 by the NLRP3 inflammasome but are dispensable for the secretion of the same cytokines at later times postinfection. Because IFN-γ fails to induce IL-1β transcription, GBP-dependent fast-kinetics inflammasome activation can drive the preferential processing of constitutively expressed IL-18 in IFN-γ-primed macrophages in the absence of prior Toll-like receptor stimulation. Together, our results reveal that GBPs control the kinetics of inflammasome activation and thereby shape macrophage responses to Chlamydia infections.

  9. Activation of RNase L is dependent on OAS3 expression during infection with diverse human viruses.

    PubMed

    Li, Yize; Banerjee, Shuvojit; Wang, Yuyan; Goldstein, Stephen A; Dong, Beihua; Gaughan, Christina; Silverman, Robert H; Weiss, Susan R

    2016-02-23

    The 2',5'-oligoadenylate (2-5A) synthetase (OAS)-RNase L system is an IFN-induced antiviral pathway. RNase L activity depends on 2-5A, synthesized by OAS. Although all three enzymatically active OAS proteins in humans--OAS1, OAS2, and OAS3--synthesize 2-5A upon binding dsRNA, it is unclear which are responsible for RNase L activation during viral infection. We used clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein-9 nuclease (Cas9) technology to engineer human A549-derived cell lines in which each of the OAS genes or RNase L is knocked out. Upon transfection with poly(rI):poly(rC), a synthetic surrogate for viral dsRNA, or infection with each of four viruses from different groups (West Nile virus, Sindbis virus, influenza virus, or vaccinia virus), OAS1-KO and OAS2-KO cells synthesized amounts of 2-5A similar to those synthesized in parental wild-type cells, causing RNase L activation as assessed by rRNA degradation. In contrast, OAS3-KO cells synthesized minimal 2-5A, and rRNA remained intact, similar to infected RNase L-KO cells. All four viruses replicated to higher titers in OAS3-KO or RNase L-KO A549 cells than in parental, OAS1-KO, or OAS2-KO cells, demonstrating the antiviral effects of OAS3. OAS3 displayed a higher affinity for dsRNA in intact cells than either OAS1 or OAS2, consistent with its dominant role in RNase L activation. Finally, the requirement for OAS3 as the major OAS isoform responsible for RNase L activation was not restricted to A549 cells, because OAS3-KO cells derived from two other human cell lines also were deficient in RNase L activation. PMID:26858407

  10. Guanylate Binding Proteins Enable Rapid Activation of Canonical and Noncanonical Inflammasomes in Chlamydia-Infected Macrophages

    PubMed Central

    Finethy, Ryan; Jorgensen, Ine; Haldar, Arun K.; de Zoete, Marcel R.; Strowig, Till; Flavell, Richard A.; Yamamoto, Masahiro; Nagarajan, Uma M.; Miao, Edward A.

    2015-01-01

    Interferon (IFN)-inducible guanylate binding proteins (GBPs) mediate cell-autonomous host resistance to bacterial pathogens and promote inflammasome activation. The prevailing model postulates that these two GBP-controlled activities are directly linked through GBP-dependent vacuolar lysis. It was proposed that the rupture of pathogen-containing vacuoles (PVs) by GBPs destroyed the microbial refuge and simultaneously contaminated the host cell cytosol with microbial activators of inflammasomes. Here, we demonstrate that GBP-mediated host resistance and GBP-mediated inflammatory responses can be uncoupled. We show that PVs formed by the rodent pathogen Chlamydia muridarum, so-called inclusions, remain free of GBPs and that C. muridarum is impervious to GBP-mediated restrictions on bacterial growth. Although GBPs neither bind to C. muridarum inclusions nor restrict C. muridarum growth, we find that GBPs promote inflammasome activation in C. muridarum-infected macrophages. We demonstrate that C. muridarum infections induce GBP-dependent pyroptosis through both caspase-11-dependent noncanonical and caspase-1-dependent canonical inflammasomes. Among canonical inflammasomes, we find that C. muridarum and the human pathogen Chlamydia trachomatis activate not only NLRP3 but also AIM2. Our data show that GBPs support fast-kinetics processing and secretion of interleukin-1β (IL-1β) and IL-18 by the NLRP3 inflammasome but are dispensable for the secretion of the same cytokines at later times postinfection. Because IFN-γ fails to induce IL-1β transcription, GBP-dependent fast-kinetics inflammasome activation can drive the preferential processing of constitutively expressed IL-18 in IFN-γ-primed macrophages in the absence of prior Toll-like receptor stimulation. Together, our results reveal that GBPs control the kinetics of inflammasome activation and thereby shape macrophage responses to Chlamydia infections. PMID:26416908

  11. Dengue Virus Infection-Enhancing Activity in Serum Samples with Neutralizing Activity as Determined by Using FcγR-Expressing Cells

    PubMed Central

    Moi, Meng Ling; Lim, Chang-Kweng; Chua, Kaw Bing; Takasaki, Tomohiko; Kurane, Ichiro

    2012-01-01

    Background Progress in dengue vaccine development has been hampered by limited understanding of protective immunity against dengue virus infection. Conventional neutralizing antibody titration assays that use FcγR-negative cells do not consider possible infection-enhancement activity. We reasoned that as FcγR-expressing cells are the major target cells of dengue virus, neutralizing antibody titration assays using FcγR-expressing cells that determine the sum of neutralizing and infection-enhancing activity, may better reflect the biological properties of antibodies in vivo. Methods and Findings We evaluated serum samples from 80 residents of a dengue endemic country, Malaysia, for neutralizing activity, and infection-enhancing activity at 1∶10 serum dilution by using FcγR-negative BHK cells and FcγR-expressing BHK cells. The serum samples consisted of a panel of patients with acute DENV infection (31%, 25/80) and a panel of donors without acute DENV infection (69%, 55/80). A high proportion of the tested serum samples (75%, 60/80) demonstrated DENV neutralizing activity (PRNT50≥10) and infection-enhancing activity. Eleven of 18 serum samples from patients with acute secondary DENV infection demonstrated neutralizing activity to the infecting serotype determined by using FcγR-negative BHK cells (PRNT50≥10), but not when determined by using FcγR-expressing cells. Conclusion Human serum samples with low neutralizing activity determined by using FcγR-negative cells showed DENV infection-enhancing activity using FcγR-expressing cells, whereas those with high neutralizing activity determined by using FcγR-negative cells demonstrate low or no infection-enhancing activity using FcγR-expressing cells. The results suggest an inverse relationship between neutralizing antibody titer and infection-enhancing activity, and that neutralizing activity determined by using FcγR-expressing cells, and not the activity determined by using FcγR-negative cells, may

  12. Virus infection elevates transcriptional activity of miR164a promoter in plants

    PubMed Central

    2009-01-01

    Background Micro RNAs (miRs) constitute a large group of endogenous small RNAs that have crucial roles in many important plant functions. Virus infection and transgenic expression of viral proteins alter accumulation and activity of miRs and so far, most of the published evidence involves post-transcriptional regulations. Results Using transgenic plants expressing a reporter gene under the promoter region of a characterized miR (P-miR164a), we monitored the reporter gene expression in different tissues and during Arabidopsis development. Strong expression was detected in both vascular tissues and hydathodes. P-miR164a activity was developmentally regulated in plants with a maximum expression at stages 1.12 to 5.1 (according to Boyes, 2001) along the transition from vegetative to reproductive growth. Upon quantification of P-miR164a-derived GUS activity after Tobacco mosaic virus Cg or Oilseed rape mosaic virus (ORMV) infection and after hormone treatments, we demonstrated that ORMV and gibberellic acid elevated P-miR164a activity. Accordingly, total mature miR164, precursor of miR164a and CUC1 mRNA (a miR164 target) levels increased after virus infection and interestingly the most severe virus (ORMV) produced the strongest promoter induction. Conclusion This work shows for the first time that the alteration of miR pathways produced by viral infections possesses a transcriptional component. In addition, the degree of miR alteration correlates with virus severity since a more severe virus produces a stronger P-miR164a induction. PMID:20042107

  13. Ibuprofen potentiates the in vivo antifungal activity of fluconazole against Candida albicans murine infection.

    PubMed

    Costa-de-Oliveira, Sofia; Miranda, Isabel M; Silva-Dias, Ana; Silva, Ana P; Rodrigues, Acácio G; Pina-Vaz, Cidália

    2015-07-01

    Candida albicans is the most prevalent cause of fungemia worldwide. Its ability to develop resistance in patients receiving azole antifungal therapy is well documented. In a murine model of systemic infection, we show that ibuprofen potentiates fluconazole antifungal activity against a fluconazole-resistant strain, drastically reducing the fungal burden and morbidity. The therapeutic combination of fluconazole with ibuprofen may constitute a new approach for the management of antifungal therapeutics to reverse the resistance conferred by efflux pump overexpression.

  14. Ibuprofen Potentiates the In Vivo Antifungal Activity of Fluconazole against Candida albicans Murine Infection

    PubMed Central

    Miranda, Isabel M.; Silva-Dias, Ana; Silva, Ana P.; Rodrigues, Acácio G.; Pina-Vaz, Cidália

    2015-01-01

    Candida albicans is the most prevalent cause of fungemia worldwide. Its ability to develop resistance in patients receiving azole antifungal therapy is well documented. In a murine model of systemic infection, we show that ibuprofen potentiates fluconazole antifungal activity against a fluconazole-resistant strain, drastically reducing the fungal burden and morbidity. The therapeutic combination of fluconazole with ibuprofen may constitute a new approach for the management of antifungal therapeutics to reverse the resistance conferred by efflux pump overexpression. PMID:25845879

  15. Innate immune response during Yersinia infection: critical modulation of cell death mechanisms through phagocyte activation

    PubMed Central

    Bergsbaken, Tessa; Cookson, Brad T.

    2009-01-01

    Yersinia pestis, the etiological agent of plague, is one of the most deadly pathogens on our planet. This organism shares important attributes with its ancestral progenitor, Yersinia pseudotuberculosis, including a 70-kb virulence plasmid, lymphotropism during growth in the mammalian host, and killing of host macrophages. Infections with both organisms are biphasic, where bacterial replication occurs initially with little inflammation, followed by phagocyte influx, inflammatory cytokine production, and tissue necrosis. During infection, plasmid-encoded attributes facilitate bacterial-induced macrophage death, which results from two distinct processes and corresponds to the inflammatory crescendo observed in vivo: Naïve cells die by apoptosis (noninflammatory), and later in infection, activated macrophages die by pyroptosis (inflammatory). The significance of this redirected cell death for the host is underscored by the importance of phagocyte activation for immunity to Yersinia and the protective role of pyroptosis during host responses to anthrax lethal toxin and infections with Francisella, Legionella, Pseudomonas, and Salmonella. The similarities of Y. pestis and Y. pseudotuberculosis, including conserved, plasmid-encoded functions inducing at least two distinct mechanisms of cell death, indicate that comparative studies are revealing about their critical pathogenic mechanism(s) and host innate immune responses during infection. Validation of this idea and evidence of similar interactions with the host immune system are provided by Y. pseudotuberculosis-priming, cross-protective immunity against Y. pestis. Despite these insights, additional studies indicate much remains to be understood concerning effective host responses against Yersinia, including chromosomally encoded attributes that also contribute to bacterial evasion and modulation of innate and adaptive immune responses. PMID:19734471

  16. mTORC1-Activated Monocytes Increase Tregs and Inhibit the Immune Response to Bacterial Infections

    PubMed Central

    Tu, Huaijun; Guo, Wei; Wang, Shixuan; Xue, Ting; Yang, Fei; Zhang, Xiaoyan; Yang, Yazhi; Wan, Qian; Shi, Zhexin; Zhan, Xulong

    2016-01-01

    The TSC1/2 heterodimer, a key upstream regulator of the mTOR, can inhibit the activation of mTOR, which plays a critical role in immune responses after bacterial infections. Monocytes are an innate immune cell type that have been shown to be involved in bacteremia. However, how the mTOR pathway is involved in the regulation of monocytes is largely unknown. In our study, TSC1 KO mice and WT mice were infected with E. coli. When compared to WT mice, we found higher mortality, greater numbers of bacteria, decreased expression of coactivators in monocytes, increased numbers of Tregs, and decreased numbers of effector T cells in TSC1 KO mice. Monocytes obtained from TSC1 KO mice produced more ROS, IL-6, IL-10, and TGF-β and less IL-1, IFN-γ, and TNF-α. Taken together, our results suggest that the inhibited immune functioning in TSC1 KO mice is influenced by mTORC1 activation in monocytes. The reduced expression of coactivators resulted in inhibited effector T cell proliferation. mTORC1-activated monocytes are harmful during bacterial infections. Therefore, inhibiting mTORC1 signaling through rapamycin administration could rescue the harmful aspects of an overactive immune response, and this knowledge provides a new direction for clinical therapy. PMID:27746591

  17. Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway

    SciTech Connect

    Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen

    2015-01-09

    Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection.

  18. Active co-infection with HBV and/or HCV in South African HIV positive patients due for cancer therapy.

    PubMed

    Musyoki, Andrew M; Msibi, Thembeni L; Motswaledi, Mojakgomo H; Selabe, Selokela G; Monokoane, Tshweu S; Mphahlele, M Jeffrey

    2015-02-01

    Human immunodeficiency virus (HIV), Hepatitis B virus (HBV) and Hepatitis C virus (HCV) share routes of transmission. There is limited data on the incidence of active co-infection with HBV and/or HCV in cancer patients infected with HIV in Africa. This was a prospective study based on 34 patients with varied cancer diagnosis, infected with HIV and awaiting cancer therapy in South Africa. HIV viral load, CD4+ cell counts, Alanine-aminotransferase and aspartate aminotransferase levels were tested. Exposure to HBV and HCV was assessed serologically using commercial kits. Active HBV and/or HCV co-infection was detected using viral specific nested PCR assays. HCV 5'-UTR PCR products were sequenced to confirm active HCV infection. Active viral infection was detected in 64.7% of patients for HBV, 38.2% for HCV, and 29.4% for both HBV and HCV. Occult HBV infection was observed in 63.6% of the patients, while seronegative HCV infection was found in 30.8% of patients. In addition, CD4+ cell count < 350 cells/µl was not a risk factor for increased active HBV, HCV or both HBV and HCV co-infections. A total of 72.7%, 18.2% and 9.1% of the HCV sequences were assigned genotype 5, 1 and 4 respectively.The study revealed for the first time a high active HBV and/or HCV co-infection rate in cancer patients infected with HIV. The findings call for HBV and HCV testing in such patients, and where feasible, appropriate antiviral treatment be indicated, as chemotherapy or radiotherapy has been associated with reactivation of viral hepatitis and termination of cancer therapy. PMID:25156907

  19. Chitosan based substrates for wound infection detection based on increased lysozyme activity.

    PubMed

    Tegl, Gregor; Rollett, Alexandra; Dopplinger, Jasmin; Gamerith, Clemens; Guebitz, Georg M

    2016-10-20

    There is a strong need of point-of-care diagnostics for early detection of wound infection. In this study, substrates based on functionalized chitosan were developed for visual detection of elevated lysozyme activity, an infection biomarker in wound fluids. For efficient hydrolysis by lysozyme, N-acetyl chitosan with a final degree of acetylation of around 50% was synthesized. N-acetylated chitosan and a chitosan-starch composite were labeled with structurally different dyes resulting in lysozyme-responsive biomaterials. Incubation with lysozyme in buffer and artificial wound fluid lead to a release of colored hydrolysis products already after 2h incubation. Tests in human wound fluid from infected wounds indicated a clear visual color change after 2.5h compared to control samples. A higher degree of swelling of the chitosan/starch containing substrate led to faster hydrolysis by lysozyme. This study demonstrates the potential of the lysozyme-responsive materials for diagnosis of wound infection and provides different diagnostic substrates for potential incorporation in point-of-care devices. PMID:27474566

  20. Autophagy Activated by Bluetongue Virus Infection Plays a Positive Role in Its Replication.

    PubMed

    Lv, Shuang; Xu, Qingyuan; Sun, Encheng; Yang, Tao; Li, Junping; Feng, Yufei; Zhang, Qin; Wang, Haixiu; Zhang, Jikai; Wu, Donglai

    2015-08-01

    Bluetongue virus (BTV) is an important pathogen of wild and domestic ruminants. Despite extensive study in recent decades, the interplay between BTV and host cells is not clearly understood. Autophagy as a cellular adaptive response plays a part in many viral infections. In our study, we found that BTV1 infection triggers the complete autophagic process in host cells, as demonstrated by the appearance of obvious double-membrane autophagosome-like vesicles, GFP-LC3 dots accumulation, the conversion of LC3-I to LC3-II and increased levels of autophagic flux in BSR cells (baby hamster kidney cell clones) and primary lamb lingual epithelial cells upon BTV1 infection. Moreover, the results of a UV-inactivated BTV1 infection assay suggested that the induction of autophagy was dependent on BTV1 replication. Therefore, we investigated the role of autophagy in BTV1 replication. The inhibition of autophagy by pharmacological inhibitors (3-MA, CQ) and RNA interference (siBeclin1) significantly decreased viral protein synthesis and virus yields. In contrast, treating BSR cells with rapamycin, an inducer of autophagy, promoted viral protein expression and the production of infectious BTV1. These findings lead us to conclude that autophagy is activated by BTV1 and contributes to its replication, and provide novel insights into BTV-host interactions.

  1. Roles of phagocytosis activating protein (PAP) in Aeromonas hydrophila infected Cyprinus carpio.

    PubMed

    Wonglapsuwan, Monwadee; Kongmee, Pataraporn; Suanyuk, Naraid; Chotigeat, Wilaiwan

    2016-06-01

    Cyprinus carpio (koi) is one of the most popular ornamental fish. A major problem for C. carpio farming is bacterial infections especially by Aeromonas hydrophila. Previously studies had shown that the Phagocytosis Activating Protein (PAP) gene was involved in the innate immune response of animals. Therefore, we attempted to identify a role for the PAP gene in the immunology of C. carpio. The expression of the PAP was found in C. carpio whole blood and increased when the fish were stimulated by inactivated A. hydrophila. In addition, PAP-phMGFP DNA was injected as an immunostimulant. The survival rate and the phagocytic index were significantly increased in the A. hydrophila infected fish that received the PAP-phMGFP DNA immunostimulant. A chitosan-PAP-phMGFP nanoparticle was then developed and feeded into fish which infected with A. hydrophila. These fish had a significantly lower mortality rate than the control. Therefore, this research confirmed a key role for PAP in protection fish from bacterial infection and the chitosan-PAP-phMGFP nanoparticle could be a good prototype for fish immunostimulant in the future. PMID:26748248

  2. Increased cytotoxicity and streptolysin O activity in group G streptococcal strains causing invasive tissue infections

    PubMed Central

    Siemens, Nikolai; Kittang, Bård R.; Chakrakodi, Bhavya; Oppegaard, Oddvar; Johansson, Linda; Bruun, Trond; Mylvaganam, Haima; Arnell, Per; Hyldegaard, Ole; Nekludov, Michael; Karlsson, Ylva; Svensson, Mattias; Skrede, Steiner; Norrby-Teglund, Anna

    2015-01-01

    Streptococcus dysgalactiae subsp. equisimilis (SDSE) has emerged as an important cause of severe skin and soft tissue infections, but little is known of the pathogenic mechanisms underlying tissue pathology. Patient samples and a collection of invasive and non-invasive group G SDSE strains (n = 69) were analyzed with respect to virulence factor expression and cytotoxic or inflammatory effects on human cells and 3D skin tissue models. SDSE strains efficiently infected the 3D-skin model and severe tissue pathology, inflammatory responses and altered production of host structural framework proteins associated with epithelial barrier integrity were evident already at 8 hours post-infection. Invasive strains were significantly more cytotoxic towards keratinocytes and expressed higher Streptokinase and Streptolysin O (SLO) activities, as compared to non-invasive strains. The opposite was true for Streptolysin S (SLS). Fractionation and proteomic analysis of the cytotoxic fractions implicated SLO as a factor likely contributing to the keratinocyte cytotoxicity and tissue pathology. Analyses of patient tissue biopsies revealed massive bacterial load, high expression of slo, as well as immune cell infiltration and pro-inflammatory markers. Our findings suggest the contribution of SLO to epithelial cytotoxicity and tissue pathology in SDSE tissue infections. PMID:26601609

  3. [Antibacterial activity of essential oils on microorganisms isolated from urinary tract infection].

    PubMed

    Pereira, Rogério Santos; Sumita, Tânia Cristina; Furlan, Marcos Roberto; Jorge, Antonio Olavo Cardoso; Ueno, Mariko

    2004-04-01

    The antibacterial activity of essential oils extracted from medicinal plants (Ocimum gratissimum, L., Cybopogum citratus (DC) Stapf., and Salvia officinalis, L.) was assessed on bacterial strains derived from 100 urine samples. Samples were taken from subjects diagnosed with urinary tract infection living in the community. Microorganisms were plated on Müller Hinton agar. Plant extracts were applied using a Steers replicator and petri dishes were incubated at 37 degrees C for 24 hours. Salvia officinalis, L. showed enhanced inhibitory activity compared to the other two herbs, with 100% efficiency against Klebsiella and Enterobacter species, 96% against Escherichia coli, 83% against Proteus mirabilis, and 75% against Morganella morganii. PMID:15122392

  4. Antibacterial activity of Pinus elliottii against anaerobic bacteria present in primary endodontic infections.

    PubMed

    Caetano da Silva, Sandro Donizete; Mendes de Souza, Maria Gorete; Oliveira Cardoso, Miguel Jorge; da Silva Moraes, Thais; Ambrósio, Sérgio Ricardo; Sola Veneziani, Rodrigo Cássio; Martins, Carlos Henrique G

    2014-12-01

    Endodontic infections have a polymicrobial nature, but anaerobic bacteria prevail among the infectious microbes. Considering that it is easy to eliminate planktonic bacteria, biofilm-forming bacteria still challenge clinicians during the fight against endodontic diseases. The chemical constituents of the oleoresin of Pinus elliottii, a plant belonging to the family Pinaceae, stand out in the search for biologically active compounds based on natural products with potential application in the treatment of endodontic infections. Indeed, plant oleoresins are an abundant natural source of diterpenes that display significant and well-defined biological activities as well as potential antimicrobial action. In this context, this study aimed to (1) evaluate the in vitro antibacterial activity of the oleoresin, fractions, and subfractions of P. elliottii as well as the action of dehydroabietic acid against 11 anaerobic bacteria that cause endodontic infection in both their planktonic and biofilm forms and (2) assess the in vitro antibiofilm activity of dehydroabietic acid against the same group of bacteria. The broth microdilution technique helped to determine the minimum inhibitory concentration (MIC) of the oleoresin and fractions. This same technique aided determination of the MIC values of nine subfractions of Fraction 1, the most active fraction. The MIC, minimum bactericidal concentration, and antibiofilm activity of dehydroabietic acid against the tested anaerobic bacteria were also examined. The oleoresin and fractions, especially fraction PE1, afforded promising MIC values, which ranged from 0.4 to 50 μg/mL. Concerning the nine evaluated subfractions, PE1.3 and PE1.4 furnished the most noteworthy MIC values, between 6.2 and 100 μg/mL. Dehydroabietic acid displayed antibacterial activity, with MIC values lying from 6.2 to 50 μg/mL, as well as bactericidal effect for all the investigated bacteria, except for Prevotella nigrescens. Assessment of the antibiofilm

  5. Antibacterial activity of Pinus elliottii against anaerobic bacteria present in primary endodontic infections.

    PubMed

    Caetano da Silva, Sandro Donizete; Mendes de Souza, Maria Gorete; Oliveira Cardoso, Miguel Jorge; da Silva Moraes, Thais; Ambrósio, Sérgio Ricardo; Sola Veneziani, Rodrigo Cássio; Martins, Carlos Henrique G

    2014-12-01

    Endodontic infections have a polymicrobial nature, but anaerobic bacteria prevail among the infectious microbes. Considering that it is easy to eliminate planktonic bacteria, biofilm-forming bacteria still challenge clinicians during the fight against endodontic diseases. The chemical constituents of the oleoresin of Pinus elliottii, a plant belonging to the family Pinaceae, stand out in the search for biologically active compounds based on natural products with potential application in the treatment of endodontic infections. Indeed, plant oleoresins are an abundant natural source of diterpenes that display significant and well-defined biological activities as well as potential antimicrobial action. In this context, this study aimed to (1) evaluate the in vitro antibacterial activity of the oleoresin, fractions, and subfractions of P. elliottii as well as the action of dehydroabietic acid against 11 anaerobic bacteria that cause endodontic infection in both their planktonic and biofilm forms and (2) assess the in vitro antibiofilm activity of dehydroabietic acid against the same group of bacteria. The broth microdilution technique helped to determine the minimum inhibitory concentration (MIC) of the oleoresin and fractions. This same technique aided determination of the MIC values of nine subfractions of Fraction 1, the most active fraction. The MIC, minimum bactericidal concentration, and antibiofilm activity of dehydroabietic acid against the tested anaerobic bacteria were also examined. The oleoresin and fractions, especially fraction PE1, afforded promising MIC values, which ranged from 0.4 to 50 μg/mL. Concerning the nine evaluated subfractions, PE1.3 and PE1.4 furnished the most noteworthy MIC values, between 6.2 and 100 μg/mL. Dehydroabietic acid displayed antibacterial activity, with MIC values lying from 6.2 to 50 μg/mL, as well as bactericidal effect for all the investigated bacteria, except for Prevotella nigrescens. Assessment of the antibiofilm

  6. Immune Activation Response in Chronic HIV-Infected Patients: Influence of Hepatitis C Virus Coinfection

    PubMed Central

    Márquez, Mercedes; Romero-Cores, Paula; Montes-Oca, Monserrat; Martín-Aspas, Andrés; Soto-Cárdenas, María-José; Guerrero, Francisca; Fernández-Gutiérrez, Clotilde; Girón-González, José-Antonio

    2015-01-01

    Objectives We have analyzed the parameters (bacterial translocation, immune activation and regulation, presence of HCV coinfection) which could be implicated in an inappropriate immune response from individuals with chronic HIV infection. The influence of them on the evolution of CD4+ T cell count has been investigated. Patients and methods Seventy HIV-infected patients [monoinfected by HIV (n = 20), HCV-coinfected (with (n = 25) and without (n = 25) liver cirrhosis)] and 25 healthy controls were included. Median duration of HIV infection was 20 years. HIV- and HCV-related parameters, as well as markers relative to bacterial translocation, monocyte and lymphocyte activation and regulation were considered as independent variables. Dependent variables were the increase of CD4+ T cell count during the follow-up (12 months). Results Increased values of bacterial translocation, measured by lipopolysaccharide-binding protein, monocyte and lymphocyte activation markers and T regulatory lymphocytes were detected in HIV-monoinfected and HIV/HCV coinfected patients. Serum sCD14 and IL-6 were increased in HIV/HCV-coinfected patients with liver cirrhosis in comparison with those with chronic hepatitis or HIV-monoinfected individuals. Time with undetectable HIV load was not related with these parameters. The presence of cirrhosis was negatively associated with a CD4+ T cell count increase. Conclusion In patients with a chronic HIV infection, a persistent increase of lipopolysaccharide-binding protein and monocyte and lymphocyte modifications are present. HCV-related cirrhosis is associated with more elevated serum concentrations of monocyte-derived markers. Cirrhosis influences the continued immune reconstitution of these patients. PMID:25775475

  7. Platelets from thrombocytopenic ponies acutely infected with equine infectious anemia virus are activated in vivo and hypofunctional.

    PubMed

    Russell, K E; Perkins, P C; Hoffman, M R; Miller, R T; Walker, K M; Fuller, F J; Sellon, D C

    1999-06-20

    Thrombocytopenia is a consistent finding and one of the earliest hematological abnormalities in horses acutely infected with equine infectious anemia virus (EIAV), a lentivirus closely related to human immunodeficiency virus. Multifactorial mechanisms, including immune-mediated platelet destruction and impaired platelet production, are implicated in the pathogenesis of EIAV-associated thrombocytopenia. This study was undertaken to investigate whether regenerative thrombopoiesis and platelet destruction occurred in ponies acutely infected with EIAV. Circulating large, immature platelets were increased in ponies acutely infected with EIAV late in the infection when platelet count was at a nadir. Morphometric analysis of bone marrow from acutely infected ponies revealed significant increased in megakaryocyte area and megakaryocyte nuclear area. A trend toward increased numbers of megakaryocytes was also observed. Platelets from acutely infected ponies had increased surface-bound fibrinogen and ultrastructural changes consistent with in vivo platelet activation. Platelets also had hypofunctional aggregation responses to three agonists in vitro. We conclude that thrombocytopenia in ponies acutely infected with EIAV is regenerative and suggest that bone marrow platelet production is not severely compromised in these ponies. Our findings reveal that in vivo platelet activation occurs in ponies acutely infected with EIAV, and as a result platelets are hypofunctional in vitro. Activation of platelets in vivo may cause platelet degranulation or formation of platelet aggregates, which would result in removal of these damages platelets from circulation. This may represent a form of nonimmune-mediated platelet destruction in ponies acutely infected with EIAV.

  8. Candidacidal Activity of Selected Ceragenins and Human Cathelicidin LL-37 in Experimental Settings Mimicking Infection Sites.

    PubMed

    Durnaś, Bonita; Wnorowska, Urszula; Pogoda, Katarzyna; Deptuła, Piotr; Wątek, Marzena; Piktel, Ewelina; Głuszek, Stanisław; Gu, Xiaobo; Savage, Paul B; Niemirowicz, Katarzyna; Bucki, Robert

    2016-01-01

    Fungal infections, especially those caused by antibiotic resistant pathogens, have become a serious public health problem due to the growing number of immunocompromised patients, including those subjected to anticancer treatment or suffering from HIV infection. In this study we assessed fungicidal activity of the ceragenins CSA-13, CSA-131 and CSA-192 against four fluconazole-resistant Candida strains. We found that ceragenins activity against planktonic Candida cells was higher than activity of human LL-37 peptide and synthetic cationic peptide omiganan. Compared to LL-37 peptide, ceragenins in the presence of DNase I demonstrated an increased ability to kill DNA-induced Candida biofilm. Microscopy studies show that treatment with LL-37 or ceragenins causes Candida cells to undergo extensive surface changes indicating surface membrane damage. This conclusion was substantiated by observation of rapid incorporation of FITC-labeled CSA-13, CSA-131 or LL-37 peptide into the more lipophilic environment of the Candida membrane. In addition to activity against Candida spp., ceragenins CSA-131 and CSA-192 display strong fungicidal activity against sixteen clinical isolates including Cryptococcus neoformans and Aspergillus fumigatus. These results indicate the potential of ceragenins for future development as new fungicidal agents. PMID:27315208

  9. Bystander Activation of CD8+ T Lymphocytes during Experimental Mycobacterial Infection

    PubMed Central

    Gilbertson, Brad; Germano, Susie; Steele, Pauline; Turner, Steven; de St. Groth, Barbara Fazekas; Cheers, Christina

    2004-01-01

    Infection of C57BL/6 mice with Mycobacterium avium leads to the activation of both CD4+ and CD8+ gamma interferon (IFN-γ)-producing T cells, although the CD8+ cells play no role in protection against infection. Using transfer of different lines of transgenic T cells with T-cell receptors (TCRs) which recognize irrelevant antigens, we show here that transferred CD8+ T cells from two of the three lines were activated to the same degree as the host cells, suggesting that the majority of the IFN-γ-producing CD8+ T cells of the host represented bystander activation. The third line, specific for the male HY antigen, showed no activation. Activation required the participation of the CD28 coreceptor on T cells and was unaffected by the removal of CD44hi (memory phenotype) T cells. The transferred CD8+ T cells proliferated in vivo, although this was not essential for IFN-γ production. Taken together, these data are highly reminiscent of homeostatic proliferation of TCR transgenic T cells upon transfer to lymphopenic hosts, and suggest low-affinity stimulation through the TCR, possibly by self peptides. The findings are discussed in relation to homeostatic proliferation and their significance in the possible induction of autoimmune disease. PMID:15557609

  10. Bystander activation of CD8+ T lymphocytes during experimental mycobacterial infection.

    PubMed

    Gilbertson, Brad; Germano, Susie; Steele, Pauline; Turner, Steven; Fazekas de St Groth, Barbara; Cheers, Christina

    2004-12-01

    Infection of C57BL/6 mice with Mycobacterium avium leads to the activation of both CD4+ and CD8+ gamma interferon (IFN-gamma)-producing T cells, although the CD8+ cells play no role in protection against infection. Using transfer of different lines of transgenic T cells with T-cell receptors (TCRs) which recognize irrelevant antigens, we show here that transferred CD8+ T cells from two of the three lines were activated to the same degree as the host cells, suggesting that the majority of the IFN-gamma-producing CD8+ T cells of the host represented bystander activation. The third line, specific for the male HY antigen, showed no activation. Activation required the participation of the CD28 coreceptor on T cells and was unaffected by the removal of CD44(hi) (memory phenotype) T cells. The transferred CD8+ T cells proliferated in vivo, although this was not essential for IFN-gamma production. Taken together, these data are highly reminiscent of homeostatic proliferation of TCR transgenic T cells upon transfer to lymphopenic hosts, and suggest low-affinity stimulation through the TCR, possibly by self peptides. The findings are discussed in relation to homeostatic proliferation and their significance in the possible induction of autoimmune disease.

  11. Candidacidal Activity of Selected Ceragenins and Human Cathelicidin LL-37 in Experimental Settings Mimicking Infection Sites

    PubMed Central

    Durnaś, Bonita; Wnorowska, Urszula; Pogoda, Katarzyna; Deptuła, Piotr; Wątek, Marzena; Piktel, Ewelina; Głuszek, Stanisław; Gu, Xiaobo; Savage, Paul B.; Niemirowicz, Katarzyna; Bucki, Robert

    2016-01-01

    Fungal infections, especially those caused by antibiotic resistant pathogens, have become a serious public health problem due to the growing number of immunocompromised patients, including those subjected to anticancer treatment or suffering from HIV infection. In this study we assessed fungicidal activity of the ceragenins CSA-13, CSA-131 and CSA-192 against four fluconazole–resistant Candida strains. We found that ceragenins activity against planktonic Candida cells was higher than activity of human LL-37 peptide and synthetic cationic peptide omiganan. Compared to LL-37 peptide, ceragenins in the presence of DNase I demonstrated an increased ability to kill DNA-induced Candida biofilm. Microscopy studies show that treatment with LL-37 or ceragenins causes Candida cells to undergo extensive surface changes indicating surface membrane damage. This conclusion was substantiated by observation of rapid incorporation of FITC-labeled CSA-13, CSA-131 or LL-37 peptide into the more lipophilic environment of the Candida membrane. In addition to activity against Candida spp., ceragenins CSA-131 and CSA-192 display strong fungicidal activity against sixteen clinical isolates including Cryptococcus neoformans and Aspergillus fumigatus. These results indicate the potential of ceragenins for future development as new fungicidal agents. PMID:27315208

  12. Dual mode antibacterial activity of ion substituted calcium phosphate nanocarriers for bone infections.

    PubMed

    Sampath Kumar, T S; Madhumathi, K; Rubaiya, Y; Doble, Mukesh

    2015-01-01

    Nanotechnology has tremendous potential for the management of infectious diseases caused by multi-drug resistant bacteria, through the development of newer antibacterial materials and efficient modes of antibiotic delivery. Calcium phosphate (CaP) bioceramics are commonly used as bone substitutes due to their similarity to bone mineral and are widely researched upon for the treatment of bone infections associated with bone loss. CaPs can be used as local antibiotic delivery agents for bone infections and can be substituted with antibacterial ions in their crystal structure to have a wide spectrum, sustained antibacterial activity even against drug resistant bacteria. In the present work, a dual mode antibiotic delivery system with antibacterial ion substituted calcium deficient hydroxyapatite (CDHA) nanoparticles has been developed. Antibacterial ions such as zinc, silver, and strontium have been incorporated into CDHA at concentrations of 6, 0.25-0.75, and 2.5-7.5 at. %, respectively. The samples were found to be phase pure, acicular nanoparticles of length 40-50 nm and width 5-6 nm approximately. The loading and release profile of doxycycline, a commonly used antibiotic, was studied from the nanocarriers. The drug release was studied for 5 days and the release profile was influenced by the ion concentrations. The release of antibacterial ions was studied over a period of 21 days. The ion substituted CDHA samples were tested for antibacterial efficacy on Staphylococcus aureus and Escherichia coli by MIC/MBC studies and time-kill assay. AgCDHA and ZnCDHA showed high antibacterial activity against both bacteria, while SrCDHA was weakly active against S. aureus. Present study shows that the antibiotic release can provide the initial high antibacterial activity, and the sustained ion release can provide a long-term antibacterial activity. Such dual mode antibiotic and antibacterial ion release offers an efficient and potent way to treat an incumbent drug

  13. Effect of a plant polyphenol-rich extract on the lung protease activities of influenza-virus-infected mice.

    PubMed

    Serkedjieva, Julia; Toshkova, Reneta; Antonova-Nikolova, Stefka; Stefanova, Tsvetanka; Teodosieva, Ani; Ivanova, Iskra

    2007-01-01

    Influenza infection was induced in white mice by intranasal inoculation of the virus A/Aichi/2/68 (H3N2). The lung protease and the protease-inhibitory activities were followed for 9 days after infection. The intranasal application of a polyphenol-rich extract (PC) isolated from Geranium sanguineum L. induced a continuous rise in the anti-protease activity but did not cause substantial changes in the lung protease activity of healthy mice. Influenza virus infection triggered a slight reduction in protease activity in the lungs at 5 and 48 h post infection (p.i.) and a marked increase at 24 h and 6 day p.i.. Protease inhibition in the lungs was reduced at 24 and 48 h p.i. and an increase was observed at 5 h and 6 and 9 days p.i.. PC treatment brought both activities to normal levels. The restoration of the examined parameters was consistent with a prolongation of mean survival time and reduction of mortality rate, infectious virus titre and lung consolidation. PC reinstated superoxide production by alveolar macrophages and increased their number in virus-infected mice. The favourable effect on the protease and the protease-inhibitory activities in the lungs of influenza-virus-infected mice apparently contributes to the overall protective effect of PC in the murine experimental influenza A/Aichi infection. The antiviral effect of the individual constituents was evaluated. PMID:17542152

  14. Human cytomegalovirus pUL97 kinase induces global changes in the infected cell phosphoproteome

    PubMed Central

    Oberstein, Adam; Perlman, David H.; Shenk, Thomas; Terry, Laura J.

    2015-01-01

    Replication of human cytomegalovirus is regulated in part by cellular kinases and the single viral Ser/Thr kinase, pUL97. The virus-coded kinase augments the replication of human cytomegalovirus (HCMV) by enabling nuclear egress and altering cell cycle progression. These roles are accomplished through direct phosphorylation of nuclear lamins and the retinoblastoma protein, respectively. In an effort to identify additional pUL97 substrates, we analyzed the phosphoproteome of SILAC-labeled human fibroblasts during infection with either wild-type HCMV or a pUL97 kinase-dead mutant virus. Phosphopeptides were enriched over a titanium dioxide matrix and analyzed by high resolution mass spectrometry. We identified 157 unambiguous phosphosites from 106 cellular and 17 viral proteins whose phosphorylation required UL97. Analysis of peptides containing these sites allowed the identification of several candidate pUL97 phosphorylation motifs, including a completely novel phosphorylation motif, LxSP. Substrates harboring the LxSP motif were enriched in nucleocytoplasmic transport functions, including a number of components of the nuclear pore complex. These results extend the known functions of pUL97 and suggest that modulation of nuclear pore function may be important during HCMV replication. PMID:25867546

  15. Safety and Efficacy of Activated Transfected Killer Cells for Neutropenic Fungal Infections

    PubMed Central

    Lin, Lin; Ibrahim, Ashraf S.; Baquir, Beverlie; Fu, Yue; Applebaum, David; Schwartz, Julie; Wang, Amy; Avanesian, Valentina; Spellberg, Brad

    2010-01-01

    Background Invasive fungal infections cause considerable morbidity and mortality in neutropenic patients. White blood cell transfusions are a promising treatment for such infections, but technical barriers have prevented their widespread use. Methods To recapitulate white blood cell transfusions, we are developing a cell-based immunotherapy using a phagocytic cell line, HL-60. We sought to stably transfect HL-60 cells with a suicide trap (herpes simplex virus thymidine kinase), to enable purging of the cells when desired, and a bioluminescence marker, to track the cells in vivo in mice. Results Transfection was stable despite 20 months of continuous culture or storage in liquid nitrogen. Activation of these transfected cells with retinoic acid and dimethyl sulfamethoxazole enhanced their microbicidal effects. Activated transfected killer (ATAK) cells were completely eliminated after exposure to ganciclovir, confirming function of the suicide trap. ATAK cells improved the survival of neutropenic mice with lethal disseminated candidiasis and inhalational aspergillosis. Bioluminescence and histopathologic analysis confirmed that the cells were purged from surviving mice after ganciclovir treatment. Comprehensive necropsy, histopathology, and metabolomic analysis revealed no toxicity of the cells. Conclusions These results lay the groundwork for continued translational development of this promising, novel technology for the treatment of refractory infections in neutropenic hosts. PMID:20397927

  16. A familial syndrome of susceptibility to chronic active Epstein-Barr virus infection.

    PubMed Central

    Joncas, J. H.; Ghibu, F.; Blagdon, M.; Montplaisir, S.; Stefanescu, I.; Menezes, J.

    1984-01-01

    In two members of a family (daughter and father) active Epstein-Barr virus (EBV) infections persisted over periods of 4 and 3 years respectively (possibly 10 years in the father). Both had persistent splenomegaly and occasional bouts of unexplained fever but lived otherwise normal lives. The other members of the family (mother and son) were healthy. The titres of antibody to the EBV viral capsid antigen (VCA) and early antigen (EA) were extremely high in the daughter's blood, whereas the titres of antibody to the Epstein-Barr nuclear antigen were low in the daughter's blood and undetectable in the father's. Target cells of the EBV infection that were obtained from the daughter's blood were established in culture with great difficulty and showed increased expression of VCA and EA. Other immunologic investigations in the two patients revealed that the ratio of helper to suppressor T lymphocytes was inverted, natural killer-cell activity was abnormally low, lymphocyte responses to certain mitogens were depressed and there was a serum factor blocking mitogen-induced transformation. The possibility that the patients' unusual susceptibility to EBV infection represented an inherited syndrome (perhaps X-linked) is discussed. PMID:6318944

  17. Dengue virus infection-enhancing antibody activities against Indonesian strains in inhabitants of central Thailand.

    PubMed

    Yamanaka, Atsushi; Oddgun, Duangjai; Chantawat, Nantarat; Okabayashi, Tamaki; Ramasoota, Pongrama; Churrotin, Siti; Kotaki, Tomohiro; Kameoka, Masanori; Soegijanto, Soegeng; Konishi, Eiji

    2016-04-01

    Dengue virus (DENV) infection-enhancing antibodies are a hypothetic factor to increase the dengue disease severity. In this study, we investigated the enhancing antibodies against Indonesian strains of DENV-1-4 in 50 healthy inhabitants of central Thailand (Bangkok and Uthai Thani). Indonesia and Thailand have seen the highest dengue incidence in Southeast Asia. The infection history of each subject was estimated by comparing his/her neutralizing antibody titers against prototype DENV-1-4 strains. To resolve the difficulty in obtaining foreign live viruses for use as assay antigens, we used a recombinant system to prepare single-round infectious dengue viral particles based on viral sequence information. Irrespective of the previously infecting serotype(s), most serum samples showed significantly higher enhancement titers against Indonesian DENV-2 strains than against Thai DENV-2 strains, whereas the opposite effect was observed for the DENV-3 strains. Equivalent enhancing activities were observed against both DENV-1 and DENV-4. These results suggest that the genotype has an impact on enhancing antibody activities against DENV-2 and DENV-3, because the predominant circulating genotypes of each serotype differ between Indonesia and Thailand.

  18. Activation of the AMPK-ULK1 pathway plays an important role in autophagy during prion infection

    PubMed Central

    Fan, Xue-Yu; Tian, Chan; Wang, Hui; Xu, Yin; Ren, Ke; Zhang, Bao-Yun; Gao, Chen; Shi, Qi; Meng, Ge; Zhang, Lu-Bin; Zhao, Yang-Jing; Shao, Qi-Xiang; Dong, Xiao-Ping

    2015-01-01

    AMPK is a serine/threonine protein kinase that acts as a positive regulator of autophagy, by phosphorylating ULK1 at specific sites. A previous study demonstrated activation of the macroautophagic system in scrapie-infected experimental rodents and in certain human prion diseases, in which the essential negative regulator mTOR is severely inhibited. In this study, AMPK and ULK1 in the brains of hamsters infected with scrapie strain 263 K and in the scrapie-infected cell line SMB-S15 were analysed. The results showed an up-regulated trend of AMPK and AMPK-Thr172, ULK1 and ULK1-Ser555. Increases in brain AMPK and ULK1 occurred at an early stage of agent 263 K infection. The level of phosphorylated ULK1-Ser757 decreased during mid-infection and was only negligibly present at the terminal stage, a pattern that suggested a close relationship of the phosphorylated protein with altered endogenous mTOR. In addition, the level of LKB1 associated with AMPK activation was selectively increased at the early and middle stages of infection. Knockdown of endogenous ULK1 in SMB-S15 cells inhibited LC3 lipidation. These results showed that, in addition to the abolishment of the mTOR regulatory pathway, activation of the AMPK-ULK1 pathway during prion infection contributes to autophagy activation in prion-infected brain tissues. PMID:26423766

  19. Heligmosomoides polygyrus bakeri infection activates colonic FoxP3+ T cells enhancing their capacity to prevent colitis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Helminthic infections protect mice from colitis in murine models of inflammatory bowel disease and also may protect people. Helminths like Heligmosomoides bakeri (Hpb) can induce Tregs. Experiments explored if Hpb infection could protect mice from colitis through activation of colonic Treg and exam...

  20. Human cytomegalovirus-induced NKG2C(hi) CD57(hi) natural killer cells are effectors dependent on humoral antiviral immunity.

    PubMed

    Wu, Zeguang; Sinzger, Christian; Frascaroli, Giada; Reichel, Johanna; Bayer, Carina; Wang, Li; Schirmbeck, Reinhold; Mertens, Thomas

    2013-07-01

    Recent studies indicate that expansion of NKG2C-positive natural killer (NK) cells is associated with human cytomegalovirus (HCMV); however, their activity in response to HCMV-infected cells remains unclear. We show that NKG2C(hi) CD57(hi) NK cells gated on CD3(neg) CD56(dim) cells can be phenotypically identified as HCMV-induced NK cells that can be activated by HCMV-infected cells. Using HCMV-infected autologous macrophages as targets, we were able to show that these NKG2C(hi) CD57(hi) NK cells are highly responsive to HCMV-infected macrophages only in the presence of HCMV-specific antibodies, whereas they are functionally poor effectors of natural cytotoxicity. We further demonstrate that NKG2C(hi) CD57(hi) NK cells are intrinsically responsive to signaling through CD16 cross-linking. Our findings show that the activity of pathogen-induced innate immune cells can be enhanced by adaptive humoral immunity. Understanding the activity of NKG2C(hi) CD57(hi) NK cells against HCMV-infected cells will be of relevance for the further development of adoptive immunotherapy.

  1. Nuclear factor of activated T-cells (NFAT) plays a role in SV40 infection

    SciTech Connect

    Manley, Kate; O'Hara, Bethany A.; Atwood, Walter J.

    2008-03-01

    Recent evidence highlighted a role for the transcription factor, nuclear factor of activated T-cells (NFAT), in the transcription of the human polyomavirus JCV. Here we show that NFAT is also important in the transcriptional control of the related polyomavirus, Simian Virus 40 (SV40). Inhibition of NFAT activity reduced SV40 infection of Vero, 293A, and HeLa cells, and this block occurred at the stage of viral transcription. Both NFAT3 and NFAT4 bound to the SV40 promoter through {kappa}B sites located within the 72 bp repeated enhancer region. In Vero cells, NFAT was involved in late transcription, but in HeLa and 293A cells both early and late viral transcription required NFAT activity. SV40 large T-Ag was found to increase NFAT activity and provided a positive feedback loop to transactivate the SV40 promoter.

  2. LGP2 Downregulates Interferon Production during Infection with Seasonal Human Influenza A Viruses That Activate Interferon Regulatory Factor 3

    PubMed Central

    Malur, Meghana; Gale, Michael

    2012-01-01

    LGP2, a member of the RIG-I-like receptor family, lacks the amino-terminal caspase activation recruitment domains (CARDs) required for initiating the activation of interferon regulatory factor 3 (IRF3) and interferon (IFN) transcription. The role of LGP2 in virus infection is controversial, and the only LGP2 experiments previously carried out with mammalian influenza A viruses employed an attenuated, mouse-adapted H1N1 A/PR/8/34 (PR8) virus that does not encode the NS1 protein. Here we determine whether LGP2 has a role during infection with wild-type, nonattenuated influenza A viruses that have circulated in the human population, specifically two types of seasonal influenza A viruses: (i) H3N2 and H1N1 viruses that activate IRF3 and IFN transcription and (ii) recent H1N1 viruses that block these two activations. In human cells infected with an H3N2 virus that activates IRF3, overexpression of LGP2 or its repressor domain decreased STAT1 activation and IFN-β transcription approximately 10-fold. Overexpression of LGP2 also caused a 10-fold decrease of STAT1 activation during infection with other seasonal influenza A viruses that activate IRF3. Using LGP2+/+ and LGP2−/− mouse cells, we show that endogenous LGP2 decreased IFN production during H3N2 virus infection 3- to 4-fold. In contrast, in both mouse and human cells infected with H1N1 viruses that do not activate IRF3, LGP2 had no detectable role. These results demonstrate that LGP2 downregulates IFN production during infection by seasonal influenza A viruses that activate IRF3 and IFN transcription. It is intriguing that LGP2, a host protein induced during influenza A virus infection, downregulates the host antiviral IFN response. PMID:22837208

  3. LGP2 downregulates interferon production during infection with seasonal human influenza A viruses that activate interferon regulatory factor 3.

    PubMed

    Malur, Meghana; Gale, Michael; Krug, Robert M

    2012-10-01

    LGP2, a member of the RIG-I-like receptor family, lacks the amino-terminal caspase activation recruitment domains (CARDs) required for initiating the activation of interferon regulatory factor 3 (IRF3) and interferon (IFN) transcription. The role of LGP2 in virus infection is controversial, and the only LGP2 experiments previously carried out with mammalian influenza A viruses employed an attenuated, mouse-adapted H1N1 A/PR/8/34 (PR8) virus that does not encode the NS1 protein. Here we determine whether LGP2 has a role during infection with wild-type, nonattenuated influenza A viruses that have circulated in the human population, specifically two types of seasonal influenza A viruses: (i) H3N2 and H1N1 viruses that activate IRF3 and IFN transcription and (ii) recent H1N1 viruses that block these two activations. In human cells infected with an H3N2 virus that activates IRF3, overexpression of LGP2 or its repressor domain decreased STAT1 activation and IFN-β transcription approximately 10-fold. Overexpression of LGP2 also caused a 10-fold decrease of STAT1 activation during infection with other seasonal influenza A viruses that activate IRF3. Using LGP2(+/+) and LGP2(-/-) mouse cells, we show that endogenous LGP2 decreased IFN production during H3N2 virus infection 3- to 4-fold. In contrast, in both mouse and human cells infected with H1N1 viruses that do not activate IRF3, LGP2 had no detectable role. These results demonstrate that LGP2 downregulates IFN production during infection by seasonal influenza A viruses that activate IRF3 and IFN transcription. It is intriguing that LGP2, a host protein induced during influenza A virus infection, downregulates the host antiviral IFN response.

  4. Inhibitory effect of nicotinamide on enzymatic activity of selected fungal strains causing skin infection.

    PubMed

    Ciebiada-Adamiec, Anna; Małafiej, Eugeniusz; Ciebiada, Ireneusz

    2010-05-01

    Pathogenicity of fungi is connected with their ability to easily penetrate the host tissues, survive in the infected host organism and use the elements of the host tissues as nutrients. Hence, the co-occurrence of pathogenic properties with the high enzymatic activity, which is manifested through the production of various enzymes including extracellular enzymes, was observed. It can be expected that it is possible to decrease fungal pathogenicity by lowering their enzymatic activity. The aim of the study was to determine the effect of nicotinamide on enzymatic activity of the fungi, which are most frequently isolated in cases of skin infection. Enzymatic activity was analysed using 15 Candida albicans, 15 Trichophyton rubrum and 15 Trichophyton mentagrophytes strains. The strains used for the study were collected from the current diagnostic material. API ZYM tests were used in diagnostic analysis. MICs of nicotinamide were determined by the macrodilution method in liquid medium. In the case of Candida strains, the presence of nicotinamide in the broth had a significant effect on the decrease of enzymatic activity (P < 0.05) of esterase (C4), esterase lipase (C-8), valin-arylamidase, acid phosphatase and alpha-glycosydase. A considerably stronger effect of nicotinamide was observed in the case of dermatophytes (P < 0.005). Its action led to a decrease in the activity of all the enzymes under study except alpha-glucosidase produced by T. rubrum strains. Thus, nicotinamide exhibited biological activity towards C. albicans, T. rubrum and Trichophyton mentagrophytes, which resulted in a decrease in the activity of enzymes produced by the fungi.

  5. Muscles provide protection during microbial infection by activating innate immune response pathways in Drosophila and zebrafish

    PubMed Central

    Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha

    2016-01-01

    ABSTRACT Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. PMID:27101844

  6. Protein synthesis shut-off induced by influenza virus infection is independent of PKR activity.

    PubMed

    Zürcher, T; Marión, R M; Ortín, J

    2000-09-01

    The role of PKR activity in influenza virus-induced cell shut-off was studied by infection of PKR(+) or PKR(-) cell cultures and metabolic labeling in vivo. No differences in the synthesis of viral proteins or the decay of cellular protein synthesis were observed. To investigate the relevance of the inhibition of cellular pre-mRNA polyadenylation and nucleocytoplasmic transport in virus-induced shut-off, we carried out similar experiments with mutant viruses lacking C-terminal sequences of NS1 protein. No differences in the shut-off induced by mutant versus wild-type viruses were observed, indicating that these nuclear events are not relevant for shut-off. The analysis of cytoplasmic mRNA stability indicated that the accumulation of viral mRNA during the infection correlated with the progressive decay of cellular mRNA, in both the wild type and an NS1 deletion mutant.

  7. Sustained activation of Akt elicits mitochondrial dysfunction to block Plasmodium falciparum infection in the mosquito host.

    PubMed

    Luckhart, Shirley; Giulivi, Cecilia; Drexler, Anna L; Antonova-Koch, Yevgeniya; Sakaguchi, Danielle; Napoli, Eleonora; Wong, Sarah; Price, Mark S; Eigenheer, Richard; Phinney, Brett S; Pakpour, Nazzy; Pietri, Jose E; Cheung, Kong; Georgis, Martha; Riehle, Michael

    2013-02-01

    The overexpression of activated, myristoylated Akt in the midgut of female transgenic Anopheles stephensi results in resistance to infection with the human malaria parasite Plasmodium falciparum but also decreased lifespan. In the present study, the understanding of mitochondria-dependent midgut homeostasis has been expanded to explain this apparent paradox in an insect of major medical importance. Given that Akt signaling is essential for cell growth and survival, we hypothesized that sustained Akt activation in the mosquito midgut would alter the balance of critical pathways that control mitochondrial dynamics to enhance parasite killing at some cost to survivorship. Toxic reactive oxygen and nitrogen species (RNOS) rise to high levels in the midgut after blood feeding, due to a combination of high NO production and a decline in FOXO-dependent antioxidants. Despite an apparent increase in mitochondrial biogenesis in young females (3 d), energy deficiencies were apparent as decreased oxidative phosphorylation and increased [AMP]/[ATP] ratios. In addition, mitochondrial mass was lower and accompanied by the presence of stalled autophagosomes in the posterior midgut, a critical site for blood digestion and stem cell-mediated epithelial maintenance and repair, and by functional degradation of the epithelial barrier. By 18 d, the age at which An. stephensi would transmit P. falciparum to human hosts, mitochondrial dysfunction coupled to Akt-mediated repression of autophagy/mitophagy was more evident and midgut epithelial structure was markedly compromised. Inhibition of RNOS by co-feeding of the nitric-oxide synthase inhibitor L-NAME at infection abrogated Akt-dependent killing of P. falciparum that begins within 18 h of infection in 3-5 d old mosquitoes. Hence, Akt-induced changes in mitochondrial dynamics perturb midgut homeostasis to enhance parasite resistance and decrease mosquito infective lifespan. Further, quality control of mitochondrial function in the

  8. Sustained Activation of Akt Elicits Mitochondrial Dysfunction to Block Plasmodium falciparum Infection in the Mosquito Host

    PubMed Central

    Drexler, Anna L.; Antonova-Koch, Yevgeniya; Sakaguchi, Danielle; Napoli, Eleonora; Wong, Sarah; Price, Mark S.; Eigenheer, Richard; Phinney, Brett S.; Pakpour, Nazzy; Pietri, Jose E.; Cheung, Kong; Georgis, Martha; Riehle, Michael

    2013-01-01

    The overexpression of activated, myristoylated Akt in the midgut of female transgenic Anopheles stephensi results in resistance to infection with the human malaria parasite Plasmodium falciparum but also decreased lifespan. In the present study, the understanding of mitochondria-dependent midgut homeostasis has been expanded to explain this apparent paradox in an insect of major medical importance. Given that Akt signaling is essential for cell growth and survival, we hypothesized that sustained Akt activation in the mosquito midgut would alter the balance of critical pathways that control mitochondrial dynamics to enhance parasite killing at some cost to survivorship. Toxic reactive oxygen and nitrogen species (RNOS) rise to high levels in the midgut after blood feeding, due to a combination of high NO production and a decline in FOXO-dependent antioxidants. Despite an apparent increase in mitochondrial biogenesis in young females (3 d), energy deficiencies were apparent as decreased oxidative phosphorylation and increased [AMP]/[ATP] ratios. In addition, mitochondrial mass was lower and accompanied by the presence of stalled autophagosomes in the posterior midgut, a critical site for blood digestion and stem cell-mediated epithelial maintenance and repair, and by functional degradation of the epithelial barrier. By 18 d, the age at which An. stephensi would transmit P. falciparum to human hosts, mitochondrial dysfunction coupled to Akt-mediated repression of autophagy/mitophagy was more evident and midgut epithelial structure was markedly compromised. Inhibition of RNOS by co-feeding of the nitric-oxide synthase inhibitor L-NAME at infection abrogated Akt-dependent killing of P. falciparum that begins within 18 h of infection in 3–5 d old mosquitoes. Hence, Akt-induced changes in mitochondrial dynamics perturb midgut homeostasis to enhance parasite resistance and decrease mosquito infective lifespan. Further, quality control of mitochondrial function in the

  9. BAY 41-2272 activates host defence against local and disseminated Candida albicans infections

    PubMed Central

    Soeiro-Pereira, Paulo Vítor; Falcai, Angela; Kubo, Christina Arslanian; Antunes, Edson; Condino-Neto, Antonio

    2015-01-01

    In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation. PMID:25742266

  10. A novel prophage lysin Ply5218 with extended lytic activity and stability against Streptococcus suis infection.

    PubMed

    Zhang, Hang; Zhang, Chuanpeng; Wang, Hengan; Yan, Ya Xian; Sun, Jianhe

    2016-09-01

    Streptococcus suis (S. suis) is an emerging zoonotic agent that exhibits high level resistance to classic antibiotics and a heavy burden in the swine industry. Therefore alternative antibacterial agents need to be developed. A novel endolysin derived from the S. suis temperate phage phi5218, termed Ply5218, was identified. The minimum inhibitory concentration (MIC) of Ply5218 was 2.5 μg ml(-1) against S. suis strain HA9801, an activity many times greater than the lysins reported previously (MIC of LY7917 and Ply30 against HA9801 were 80 and 64 μg ml(-1), respectively). Ply5218 at 10 μg ml(-1) in vitro exerted broad antibacterial activities against S. suis strains with OD600 ratios decreased from 1 to <0.2 within 1 h. Moreover, Ply5218 showed favorable thermal stability. It was stable at 50°C >30 min, 4°C >30 days, -80°C >7 months, and >60% of the enzyme activity remained after 5 min pre-incubation at 70°C. In vivo, a 0.2 mg dose of Ply5218 protected 90% (9/10) of mice after infection with S. suis HA9801. Finally, Ply5218 maintained high antibacterial activity in some bio-matrices, such as culture media and milk. The data indicate that Ply5218 has all the characteristics to be an effective therapeutic agent against multiple S. suis infections. PMID:27481700

  11. Evaluation of Interleukin17and Interleukin 23 expression in patients with active and latent tuberculosis infection

    PubMed Central

    Heidarnezhad, Fatemeh; Asnaashari, Amir; Rezaee, Seyed Abdolrahim; Ghezelsofla, Roghayeh; Ghazvini, Kiarash; Valizadeh, Narges; Basiri, Reza; Ziaeemehr, Aghigh; Sobhani, Somayeh; Rafatpanah, Houshang

    2016-01-01

    Objective(s): Tuberculosis is one of the most important infectious diseases with high mortality rates worldwide, especially in developing countries. Interleukin17 (IL-17) is an important acquired immunity cytokine, which is mainly produced by CD4+TH17 cells. It can recruit neutrophils and macrophages to the infected site in the lungs. IL-23 is one of the most important inducers of IL-17. In the present study, the expressions of IL-23 and IL-17 were examined in the pathogenesis of tuberculosis. Materials and Methods: Peripheral blood mononuclear cells (PBMCs) were isolated from subjects with latent tuberculosis infection (LTB) and newly diagnosed active tuberculosis patients (ATB). PBMCs were activated with purified protein derivative (PPD) for 72 hr. Activated cells were harvested, RNA was extracted, and cDNA was synthesized. IL-17 and IL-23 mRNA expressions were evaluated by real-time PCR. The frequency of Th17 cells was examined by flowcytometry. Results: The expressions of IL-17 and IL-23 mRNA were lower in patients than subjects with LTB (P<0.05). The frequency of IL-17 producing CD4+ T cells in patients with active TB was lower than LTB subjects (P<0.05). Conclusion: The results of the present study might suggest that IL-17 and IL-23 play critical roles in the immune response against TB. PMID:27746865

  12. Antiadhesive and antibiofilm activity of hyaluronic acid against bacteria responsible for respiratory tract infections.

    PubMed

    Drago, Lorenzo; Cappelletti, Laura; De Vecchi, Elena; Pignataro, Lorenzo; Torretta, Sara; Mattina, Roberto

    2014-10-01

    To address the problem of limited efficacy of existing antibiotics in the treatment of bacterial biofilm, it is necessary to find alternative remedies. One candidate could be hyaluronic acid; this study therefore aimed to evaluate the in vitro antiadhesive and antibiofilm activity of hyaluronic acid toward bacterial species commonly isolated from respiratory infections. Interference exerted on bacterial adhesion was evaluated by using Hep-2 cells, while the antibiofilm activity was assessed by means of spectrophotometry after incubation of biofilm with hyaluronic acid and staining with crystal violet. Our data suggest that hyaluronic acid is able to interfere with bacterial adhesion to a cellular substrate in a concentration-dependent manner, being notably active when assessed as pure substance. Moreover, we found that Staphylococcus aureus biofilm was more sensitive to the action of hyaluronic acid than biofilm produced by Haemophilus influenzae and Moraxella catarrhalis. In conclusion, hyaluronic acid is characterized by notable antiadhesive properties, while it shows a moderate activity against bacterial biofilm. As bacterial adhesion to oral cells is the first step for colonization, these results further sustain the role of hyaluronic acid in prevention of respiratory infections. PMID:24698341

  13. In vitro evaluation of the antiviral activity of methylglyoxal against influenza B virus infection.

    PubMed

    Charyasriwong, Siriwan; Haruyama, Takahiro; Kobayashi, Nobuyuki

    2016-01-01

    Influenza A and B virus infections are serious public health concerns globally. However, the concerns regarding influenza B infection have been underestimated. The currently used anti-influenza drugs have not provided equal efficacy for both influenza A and B viruses. Susceptibility to neuraminidase (NA) inhibitors has been observed to be lower for influenza B viruses than for influenza A viruses. Moreover, the emergence of resistance to anti-influenza drugs underscores the need to develop new drugs. Recently, we reported that methylglyoxal (MGO) suppressed influenza A virus replication in a strain-independent manner. Therefore, we hypothesize that MGO exhibits anti-influenza activity against B strains. This study aimed to evaluate the anti-influenza viral activity of MGO against influenza B strains by using Madin-Darby canine kidney (MDCK) cells. Several types of influenza B viruses were used to determine the activity of MGO. The susceptibilities of influenza A and B viruses to NA inhibitors were compared. MGO inhibited influenza B virus replication, with 50% inhibitory concentrations ranging from 23-140 μM, which indicated greater sensitivity of influenza B viruses than influenza A viruses. Our results show that MGO has potent inhibitory activity against influenza B viruses, including NA inhibitor-resistant strains. PMID:27558282

  14. Liver stiffness is associated with monocyte activation in HIV-infected Ugandans without viral hepatitis.

    PubMed

    Redd, Andrew D; Wendel, Sarah K; Grabowski, Mary K; Ocama, Ponsiano; Kiggundu, Valerian; Bbosa, Francis; Boaz, Iga; Balagopal, Ashwin; Reynolds, Steven J; Gray, Ronald H; Serwadda, David; Kirk, Gregory D; Quinn, Thomas C; Stabinski, Lara

    2013-07-01

    A high prevalence of liver stiffness, as determined by elevated transient elastography liver stiffness measurement, was previously found in a cohort of HIV-infected Ugandans in the absence of chronic viral hepatitis. Given the role of immune activation and microbial translocation in models of liver disease, a shared immune mechanism was hypothesized in the same cohort without other overt causes of liver disease. This study examined whether HIV-related liver stiffness was associated with markers of immune activation or microbial translocation (MT). A retrospective case-control study of subjects with evidence of liver stiffness as defined by a transient elastography stiffness measurement ≥9.3 kPa (cases=133) and normal controls (n=133) from Rakai, Uganda was performed. Cases were matched to controls by age, gender, HIV, hepatitis B virus (HBV), and highly active antiretroviral therapy (HAART) status. Lipopolysaccharide (LPS), endotoxin IgM antibody, soluble CD14 (sCD14), C-reactive protein (CRP), and D-dimer levels were measured. Conditional logistic regression was used to estimate adjusted matched odds ratios (adjMOR) and 95% confidence intervals. Higher sCD14 levels were associated with a 19% increased odds of liver stiffness (adjMOR=1.19, p=0.002). In HIV-infected individuals, higher sCD14 levels were associated with a 54% increased odds of having liver stiffness (adjMOR=1.54, p<0.001); however, the opposite was observed in HIV-negative individuals (adjMOR=0.57, p=0.001). No other biomarker was significantly associated with liver stiffness, and only one subject was found to have detectable LPS. Liver stiffness in HIV-infected Ugandans is associated with increased sCD14 indicative of monocyte activation in the absence of viral hepatitis or microbial translocation, and suggests that HIV may be directly involved in liver disease.

  15. Liver Stiffness Is Associated With Monocyte Activation in HIV-Infected Ugandans Without Viral Hepatitis

    PubMed Central

    Wendel, Sarah K.; Grabowski, Mary K.; Ocama, Ponsiano; Kiggundu, Valerian; Bbosa, Francis; Boaz, Iga; Balagopal, Ashwin; Reynolds, Steven J.; Gray, Ronald H.; Serwadda, David; Kirk, Gregory D.; Quinn, Thomas C.; Stabinski, Lara

    2013-01-01

    Abstract A high prevalence of liver stiffness, as determined by elevated transient elastography liver stiffness measurement, was previously found in a cohort of HIV-infected Ugandans in the absence of chronic viral hepatitis. Given the role of immune activation and microbial translocation in models of liver disease, a shared immune mechanism was hypothesized in the same cohort without other overt causes of liver disease. This study examined whether HIV-related liver stiffness was associated with markers of immune activation or microbial translocation (MT). A retrospective case-control study of subjects with evidence of liver stiffness as defined by a transient elastography stiffness measurement ≥9.3 kPa (cases=133) and normal controls (n=133) from Rakai, Uganda was performed. Cases were matched to controls by age, gender, HIV, hepatitis B virus (HBV), and highly active antiretroviral therapy (HAART) status. Lipopolysaccharide (LPS), endotoxin IgM antibody, soluble CD14 (sCD14), C-reactive protein (CRP), and D-dimer levels were measured. Conditional logistic regression was used to estimate adjusted matched odds ratios (adjMOR) and 95% confidence intervals. Higher sCD14 levels were associated with a 19% increased odds of liver stiffness (adjMOR=1.19, p=0.002). In HIV-infected individuals, higher sCD14 levels were associated with a 54% increased odds of having liver stiffness (adjMOR=1.54, p<0.001); however, the opposite was observed in HIV-negative individuals (adjMOR=0.57, p=0.001). No other biomarker was significantly associated with liver stiffness, and only one subject was found to have detectable LPS. Liver stiffness in HIV-infected Ugandans is associated with increased sCD14 indicative of monocyte activation in the absence of viral hepatitis or microbial translocation, and suggests that HIV may be directly involved in liver disease. PMID:23548102

  16. Differential relocation and stability of PML-body components during productive human cytomegalovirus infection: detailed characterization by live-cell imaging.

    PubMed

    Dimitropoulou, Panagiota; Caswell, Richard; McSharry, Brian P; Greaves, Richard F; Spandidos, Demetrios A; Wilkinson, Gavin W G; Sourvinos, George

    2010-10-01

    In controlling the switch from latency to lytic infection, the immediate early (IE) genes lie at the core of herpesvirus pathogenesis. To image the 72kDa human cytomegalovirus (HCMV) major IE protein (IE1-72K), a recombinant virus encoding IE1 fused with EGFP was constructed. Using this construct, the IE1-EGFP fusion was detected at ND10 (PML-bodies) within 2h post infection (p.i.) and the complete disruption of ND10 imaged through to 6h p.i. HCMV genomes and IE2-86K protein could be detected adjacent to the slowly degrading IE1-72K/ND10 foci. IE1-72K associates with metaphase chromatin, recruiting both PML and STAT2. hDaxx, STAT1 and IE2-86K did not re-locate to metaphase chromatin; the fate of hDaxx is particularly important as this protein contributes to an intrinsic barrier to HCMV infection. While IE1-72K participates in a complex with chromatin, PML, STAT2 and Sp100, IE1-72K releases hDaxx from ND10 yet does not appear to remain associated with it.

  17. Accumulation of activated CD4+ lymphocytes in the lung of individuals infected with HIV accompanied by increased virus production in patients with secondary infections.

    PubMed Central

    Franchini, M; Walker, C; Henrard, D R; Suter-Gut, D; Braun, P; Villiger, B; Suter, M

    1995-01-01

    The lung is continuously exposed to infectious and non-infectious agents causing cell activation. Activated cells in the lung such as antigen-presenting cells which harbour HIV may favour this organ as a site for virus production. To test this hypothesis, cells from blood and bronchoalveolar lavage (BAL) of HIV-infected patients and healthy controls were obtained and the activation of the cells were analysed by measuring the expression of IL-2 receptor, HLA-DR and VLA-1. The HIV-infected individuals were subdivided into 'lung symptomatic' or 'lung asymptomatic' patients, depending on the presence or absence of secondary lung diseases besides HIV. All HIV-infected individuals demonstrated a decreased number of CD4+ lymphocytes in blood; however, normal numbers of these cells were found in BAL. The activation state of CD4+ and CD8+ T lymphocytes in blood and BAL was higher in lymphocytes from HIV-infected patients compared with controls. The activation state was highest in the lung symptomatic group. Lung symptomatic patients and lung asymptomatic patients with extrapulmonary infections had increased levels of free virus in plasma. Four out of four individuals without or with only low amounts of cell-free HIV in plasma belonged to the symptom-free subgroup. These results suggest that microorganisms other than HIV may promote viral replication via antigen-driven accumulation and activation of CD4+ cells in the lung or other organs, and thus may be responsible for the loss of helper T cells and the progression of the disease. PMID:7586671

  18. Virion encapsidated HIV-1 Vpr induces NFAT to prime non-activated T cells for productive infection.

    PubMed

    Höhne, Kristin; Businger, Ramona; van Nuffel, Anouk; Bolduan, Sebastian; Koppensteiner, Herwig; Baeyens, Ann; Vermeire, Jolien; Malatinkova, Eva; Verhasselt, Bruno; Schindler, Michael

    2016-07-01

    The majority of T cells encountered by HIV-1 are non-activated and do not readily allow productive infection. HIV-1 Vpr is highly abundant in progeny virions, and induces signalling and HIV-1 LTR transcription. We hence hypothesized that Vpr might be a determinant of non-activated T-cell infection. Virion-delivered Vpr activated nuclear factor of activated T cells (NFAT) through Ca(2+) influx and interference with the NFAT export kinase GSK3β. This leads to NFAT translocation and accumulation within the nucleus and was required for productive infection of unstimulated primary CD4(+) T cells. A mutagenesis approach revealed correlation of Vpr-mediated NFAT activation with its ability to enhance LTR transcription and mediate cell cycle arrest. Upon NFAT inhibition, Vpr did not augment resting T-cell infection, and showed reduced G2/M arrest and LTR transactivation. Altogether, Vpr renders unstimulated T cells more permissive for productive HIV-1 infection and stimulates activation of productively infected as well as virus-exposed T cells. Therefore, it could be involved in the establishment and reactivation of HIV-1 from viral reservoirs and might have an impact on the levels of immune activation, which are determinants of HIV-1 pathogenesis.

  19. Virion encapsidated HIV-1 Vpr induces NFAT to prime non-activated T cells for productive infection

    PubMed Central

    Höhne, Kristin; Businger, Ramona; van Nuffel, Anouk; Bolduan, Sebastian; Koppensteiner, Herwig; Baeyens, Ann; Vermeire, Jolien; Malatinkova, Eva; Verhasselt, Bruno; Schindler, Michael

    2016-01-01

    The majority of T cells encountered by HIV-1 are non-activated and do not readily allow productive infection. HIV-1 Vpr is highly abundant in progeny virions, and induces signalling and HIV-1 LTR transcription. We hence hypothesized that Vpr might be a determinant of non-activated T-cell infection. Virion-delivered Vpr activated nuclear factor of activated T cells (NFAT) through Ca2+ influx and interference with the NFAT export kinase GSK3β. This leads to NFAT translocation and accumulation within the nucleus and was required for productive infection of unstimulated primary CD4+ T cells. A mutagenesis approach revealed correlation of Vpr-mediated NFAT activation with its ability to enhance LTR transcription and mediate cell cycle arrest. Upon NFAT inhibition, Vpr did not augment resting T-cell infection, and showed reduced G2/M arrest and LTR transactivation. Altogether, Vpr renders unstimulated T cells more permissive for productive HIV-1 infection and stimulates activation of productively infected as well as virus-exposed T cells. Therefore, it could be involved in the establishment and reactivation of HIV-1 from viral reservoirs and might have an impact on the levels of immune activation, which are determinants of HIV-1 pathogenesis. PMID:27383627

  20. Controlled infection with a therapeutic virus defines the activation kinetics of human natural killer cells in vivo

    PubMed Central

    El-Sherbiny, Y M; Holmes, T D; Wetherill, L F; Black, E V I; Wilson, E B; Phillips, S L; Scott, G B; Adair, R A; Dave, R; Scott, K J; Morgan, R S M; Coffey, M; Toogood, G J; Melcher, A A; Cook, G P

    2015-01-01

    Human natural killer (NK) cells play an important role in anti-viral immunity. However, studying their activation kinetics during infection is highly problematic. A clinical trial of a therapeutic virus provided an opportunity to study human NK cell activation in vivo in a controlled manner. Ten colorectal cancer patients with liver metastases received between one and five doses of oncolytic reovirus prior to surgical resection of their tumour. NK cell surface expression of the interferon-inducible molecules CD69 and tetherin peaked 24–48 h post-infection, coincident with a peak of interferon-induced gene expression. The interferon response and NK cell activation were transient, declining by 96 h post-infection. Furthermore, neither NK cell activation nor the interferon response were sustained in patients undergoing multiple rounds of virus treatment. These results show that reovirus modulates human NK cell activity in vivo and suggest that this may contribute to any therapeutic effect of this oncolytic virus. Detection of a single, transient peak of activation, despite multiple treatment rounds, has implications for the design of reovirus-based therapy. Furthermore, our results suggest the existence of a post-infection refractory period when the interferon response and NK cell activation are blunted. This refractory period has been observed previously in animal models and may underlie the enhanced susceptibility to secondary infections that is seen following viral infection. PMID:25469725

  1. Virion encapsidated HIV-1 Vpr induces NFAT to prime non-activated T cells for productive infection.

    PubMed

    Höhne, Kristin; Businger, Ramona; van Nuffel, Anouk; Bolduan, Sebastian; Koppensteiner, Herwig; Baeyens, Ann; Vermeire, Jolien; Malatinkova, Eva; Verhasselt, Bruno; Schindler, Michael

    2016-07-01

    The majority of T cells encountered by HIV-1 are non-activated and do not readily allow productive infection. HIV-1 Vpr is highly abundant in progeny virions, and induces signalling and HIV-1 LTR transcription. We hence hypothesized that Vpr might be a determinant of non-activated T-cell infection. Virion-delivered Vpr activated nuclear factor of activated T cells (NFAT) through Ca(2+) influx and interference with the NFAT export kinase GSK3β. This leads to NFAT translocation and accumulation within the nucleus and was required for productive infection of unstimulated primary CD4(+) T cells. A mutagenesis approach revealed correlation of Vpr-mediated NFAT activation with its ability to enhance LTR transcription and mediate cell cycle arrest. Upon NFAT inhibition, Vpr did not augment resting T-cell infection, and showed reduced G2/M arrest and LTR transactivation. Altogether, Vpr renders unstimulated T cells more permissive for productive HIV-1 infection and stimulates activation of productively infected as well as virus-exposed T cells. Therefore, it could be involved in the establishment and reactivation of HIV-1 from viral reservoirs and might have an impact on the levels of immune activation, which are determinants of HIV-1 pathogenesis. PMID:27383627

  2. Comparative analysis of signature genes in PRRSV-infected porcine monocyte-derived dendritic cells at differential activation statuses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Activation statuses of monocytic cells including monocytes, macrophages and dendritic cells (DCs) are critically important for antiviral immunity. In particular, some devastating viruses, including porcine reproductive and respiratory syndrome virus (PRRSV), are capable of directly infecting these c...

  3. Activity profiling of vacuolar processing enzymes reveals a role for VPE during oomycete infection.

    PubMed

    Misas-Villamil, Johana C; Toenges, Gerrit; Kolodziejek, Izabella; Sadaghiani, Amir M; Kaschani, Farnusch; Colby, Thomas; Bogyo, Matthew; van der Hoorn, Renier A L

    2013-02-01

    Vacuolar processing enzymes (VPEs) are important cysteine proteases that are implicated in the maturation of seed storage proteins, and programmed cell death during plant-microbe interactions and development. Here, we introduce a specific, cell-permeable, activity-based probe for VPEs. This probe is highly specific for all four Arabidopsis VPEs, and labeling is activity-dependent, as illustrated by sensitivity for inhibitors, pH and reducing agents. We show that the probe can be used for in vivo imaging and displays multiple active isoforms of VPEs in various tissues and in both monocot and dicot plant species. Thus, VPE activity profiling is a robust, simple and powerful tool for plant research for a wide range of applications. Using VPE activity profiling, we discovered that VPE activity is increased during infection with the oomycete pathogen Hyaloperonospora arabidopsidis (Hpa). The enhanced VPE activity is host-derived and EDS1-independent. Sporulation of Hpa is reduced on vpe mutant plants, demonstrating a role for VPE during compatible interactions that is presumably independent of programmed cell death. Our data indicate that, as an obligate biotroph, Hpa takes advantage of increased VPE activity in the host, e.g. to mediate protein turnover and nutrient release.

  4. Distinct activation of primary human BDCA1(+) dendritic cells upon interaction with stressed or infected β cells.

    PubMed

    Schulte, B M; Kers-Rebel, E D; Bottino, R; Piganelli, J D; Galama, J M D; Engelse, M A; de Koning, E J P; Adema, G J

    2016-06-01

    Derailment of immune responses can lead to autoimmune type 1 diabetes, and this can be accelerated or even induced by local stress caused by inflammation or infection. Dendritic cells (DCs) shape both innate and adaptive immune responses. Here, we report on the responses of naturally occurring human myeloid BDCA1(+) DCs towards differentially stressed pancreatic β cells. Our data show that BDCA1(+) DCs in human pancreas-draining lymph node (pdLN) suspensions and blood-derived BDCA1(+) DCs both effectively engulf β cells, thus mimicking physiological conditions. Upon uptake of enterovirus-infected, but not mock-infected cells, BDCA1(+) DCs induced interferon (IFN)-α/β responses, co-stimulatory molecules and proinflammatory cytokines and chemokines. Notably, induction of stress in β cells by ultraviolet irradiation, culture in serum-free medium or cytokine-induced stress did not provoke strong DC activation, despite efficient phagocytosis. DC activation correlated with the amount of virus used to infect β cells and required RNA within virally infected cells. DCs encountering enterovirus-infected β cells, but not those incubated with mock-infected or stressed β cells, suppressed T helper type 2 (Th2) cytokines and variably induced IFN-γ in allogeneic mixed lymphocyte reaction (MLR). Thus, stressed β cells have little effect on human BDCA1(+) DC activation and function, while enterovirus-infected β cells impact these cells significantly, which could help to explain their role in development of autoimmune diabetes in individuals at risk.

  5. Enhanced allergic responsiveness after early childhood infection with respiratory viruses: Are long-lived alternatively activated macrophages the missing link?

    PubMed

    Keegan, Achsah D; Shirey, Kari Ann; Bagdure, Dayanand; Blanco, Jorge; Viscardi, Rose M; Vogel, Stefanie N

    2016-07-01

    Early childhood infection with respiratory viruses, including human rhinovirus, respiratory syncytial virus (RSV) and influenza, is associated with an increased risk of allergic asthma and severe exacerbation of ongoing disease. Despite the long recognition of this relationship, the mechanism linking viral infection and later susceptibility to allergic lung inflammation is still poorly understood. We discuss the literature and provide new evidence demonstrating that these viruses induce the alternative activation of macrophages. Alternatively activated macrophages (AAM) induced by RSV or influenza infection persisted in the lungs of mice up to 90 days after initial viral infection. Several studies suggest that AAM contribute to allergic inflammatory responses, although their mechanism of action is unclear. In this commentary, we propose that virus-induced AAM provide a link between viral infection and enhanced responses to inhaled allergens. PMID:27178560

  6. Suppression of NYVAC Infection in HeLa Cells Requires RNase L but Is Independent of Protein Kinase R Activity.

    PubMed

    Fernández-Escobar, Mercedes; Nájera, José Luis; Baldanta, Sara; Rodriguez, Dolores; Way, Michael; Esteban, Mariano; Guerra, Susana

    2015-12-09

    Protein kinase R (PKR) and RNase L are host cell components that function to contain viral spread after infections. In this study, we analyzed the role of both proteins in the abortive infection of human HeLa cells with the poxvirus strain NYVAC, for which an inhibition of viral A27L and B5R gene expression is described. Specifically, the translation of these viral genes is independent of PKR activation, but their expression is dependent on the RNase L activity.

  7. In vitro antimicrobial activity of orbifloxacin against Staphylococcus intermedius isolates from canine skin and ear infections.

    PubMed

    Ganière, Jean-Pierre; Médaille, Christine; Etoré, Florence

    2004-08-01

    The objective of the study was to evaluate the in vitro activity of orbifloxacin against Staphylococcus intermedius strains isolated in France from canine skin and ear infections. The minimum inhibitory concentrations (MICs) of orbifloxacin against 240 field S. intermedius isolates (69 skin and 171 ear isolates) ranged from 0.016 to 8 mg l(-1), with MIC50 and MIC90 equal to 0.5 and 1 mg l(-1), respectively. Only one strain, a pyoderma isolate was resistant (MIC=8 mg l(-1)). Orbifloxacin was tested at different concentrations for killing rate against five isolates obtained from pyoderma cases and against a reference strain (Staphylococcus aureus ATCC 29213). Orbifloxacin expressed a concentration-dependent bactericidal activity against the S. aureus reference strain, but a time-dependent bactericidal activity against S. intermedius. Orbifloxacin induced bactericidal effect against the S. intermedius strains tested with concentrations equal to or two times MIC.

  8. Role of Biological Characteristics of Staphylococcus epidermidis in Intraerythrocytic Invasion and in Modulation of Erythrocyte Catalase and Superoxide Dismutase Activities in Experimental Generalized Infection.

    PubMed

    Shchuplova, E A; Stadnikov, A A; Fadeev, S B

    2015-05-01

    Studies on mouse model of generalized Staphylococcus epidermidis infection have demonstrated that erythrocytes more often contained microorganisms with pronounced antihemoglobin activity and less frequently with hemolytic activity. Infection with S. epidermidis strains characterized by pronounced hemolytic or antihemoglobin activities was associated with inhibition of erythrocyte catalase and superoxide dismutase activities in all cases, except infection with strains with high antihemoglobin activity, when superoxide dismutase activity increased.

  9. Role of Biological Characteristics of Staphylococcus epidermidis in Intraerythrocytic Invasion and in Modulation of Erythrocyte Catalase and Superoxide Dismutase Activities in Experimental Generalized Infection.

    PubMed

    Shchuplova, E A; Stadnikov, A A; Fadeev, S B

    2015-05-01

    Studies on mouse model of generalized Staphylococcus epidermidis infection have demonstrated that erythrocytes more often contained microorganisms with pronounced antihemoglobin activity and less frequently with hemolytic activity. Infection with S. epidermidis strains characterized by pronounced hemolytic or antihemoglobin activities was associated with inhibition of erythrocyte catalase and superoxide dismutase activities in all cases, except infection with strains with high antihemoglobin activity, when superoxide dismutase activity increased. PMID:26033594

  10. Human cytomegalovirus renders cells non-permissive for replication of herpes simplex viruses

    SciTech Connect

    Cockley, K.D.

    1988-01-01

    The herpes simplex virus (HSV) genome during production infection in vitro may be subject to negative regulation which results in modification of the cascade of expression of herpes virus macromolecular synthesis leading to establishment of HSV latency. In the present study, human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of HSV type-1 (HSV-1). A delay in HSV replication of 15 hr as well as a consistent, almost 1000-fold inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 hr after superinfection were observed compared with controls infected with HSV alone. HSV type-2 (HSV-2) replication was similarly inhibited in HCMV-infected HEL cells. Prior ultraviolet-irradiation (UV) of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HCMV deoxyribonucleic acid (DNA) negative temperature-sensitive (ts) mutants inhibited HSV replications as efficiently as wild-type (wt) HCMV at the non-permissive temperature. Evidence for penetration and replication of superinfecting HSV into HCMV-infected cells was provided by blot hybridization of HSV DNA synthesized in HSV-superinfected cell cultures and by cesium chloride density gradient analysis of ({sup 3}H)-labeled HSV-1-superinfected cells.

  11. Involvement of fish signal transducer and activator of transcription 3 (STAT3) in nodavirus infection induced cell death.

    PubMed

    Huang, Youhua; Huang, Xiaohong; Yang, Ying; Wang, Wei; Yu, Yepin; Qin, Qiwei

    2015-03-01

    The Janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway is an important signaling pathway activated by interferons in response to virus infection. Fish STAT3 has been demonstrated to be involved in Singapore grouper iridovirus (SGIV) infection and virus induced paraptosis, but its effects on the replication of other fish viruses still remained uncertain. Here, the roles of grouper STAT3 (Ec-STAT3) in red spotted grouper nervous necrosis virus (RGNNV) infection were investigated. The present data showed that the distribution of phosphorylated Ec-STAT3 was altered in RGNNV infected fish cells, and the promoter activity of STAT3 was significantly increased during virus infection, suggesting that STAT3 activation was involved in RGNNV infection. Using STAT3 specific inhibitor, we found that inhibition of Ec-STAT3 in vitro did not affect the transcription and protein synthesis of RGNNV coat protein (CP), however, the severity of RGNNV induced vacuolation and autophagy was significantly increased. Meanwhile, at the late stage of virus infection, RGNNV induced necrotic cell death was significantly decreased after inhibition of Ec-STAT3. Further studies indicated that Ec-STAT3 inhibition significantly increased the transcript level of autophagy related genes, including UNC-51-like kinase 2 (ULK2) and microtubule-associated protein 1 light chain 3-II (LC3-II) induced by RGNNV infection. Moreover, the expression of several pro-inflammatory factors, including TNFα, IL-1β and IL-8 were mediated by Ec-STAT3 during RGNNV infection. Together, our results not only firstly revealed that STAT3 exerted novel roles in response to fish virus infection, but also provided new insights into understanding the roles of STAT3 in different forms of programmed cell death. PMID:25555814

  12. CD4+ T cells with an activated and exhausted phenotype distinguish immunodeficiency during aviremic HIV-2 infection

    PubMed Central

    Buggert, Marcus; Frederiksen, Juliet; Lund, Ole; Betts, Michael R.; Biague, Antonio; Nielsen, Morten; Tauriainen, Johanna; Norrgren, Hans; Medstrand, Patrik; Karlsson, Annika C.; Jansson, Marianne

    2016-01-01

    Objective: HIV type 2 (HIV-2) represents an attenuated form of HIV, in which many infected individuals remain ‘aviremic’ without antiretroviral therapy. However, aviremic HIV-2 disease progression exists, and in the current study, we therefore aimed to examine if specific pathological characteristics of CD4+ T cells are linked to such outcome. Design: HIV-seronegative (n = 25), HIV type 1 (HIV-1) (n = 33), HIV-2 (n = 39, of whom 26 were aviremic), and HIV-1/2 dually (HIV-D) (n = 13)-infected study participants were enrolled from an occupational cohort in Guinea-Bissau. Methods: CD4+ T-cell differentiation, activation, exhaustion, senescence, and transcription factors were assessed by polychromatic flow cytometry. Multidimensional clustering bioinformatic tools were used to identify CD4+ T-cell subpopulations linked to infection type and disease stage. Results: HIV-2-infected individuals had early and late-differentiated CD4+ T-cell clusters with lower activation (CD38+HLA-DR+) and exhaustion programmed death-1 (PD-1) than HIV-1 and HIV-D-infected individuals. We also noted that aviremic HIV-2-infected individuals possessed fewer individuals. CD4+ T cells with pathological signs compared to other HIV-infected groups. Still, compared to HIV-seronegative individuals, aviremic HIV-2-infected individuals had T-bet+ CD4+ T cells that showed elevated immune activation/exhaustion, and particularly the frequencies of PD-1+ cells were associated with a suboptimal percentage of CD4+ T cells. Conclusion: Increased frequencies of CD4+ T cells with an activated/exhausted phenotype correlate with exacerbated immunodeficiency in aviremic HIV-2-infected individuals. Thus, these findings encourage studies on the introduction of antiretroviral therapy also to individuals with aviremic HIV-2 infection. PMID:27525551

  13. Involvement of fish signal transducer and activator of transcription 3 (STAT3) in nodavirus infection induced cell death.

    PubMed

    Huang, Youhua; Huang, Xiaohong; Yang, Ying; Wang, Wei; Yu, Yepin; Qin, Qiwei

    2015-03-01

    The Janus kinase (JAK)-signal transducer and activator of transcription (STAT) signaling pathway is an important signaling pathway activated by interferons in response to virus infection. Fish STAT3 has been demonstrated to be involved in Singapore grouper iridovirus (SGIV) infection and virus induced paraptosis, but its effects on the replication of other fish viruses still remained uncertain. Here, the roles of grouper STAT3 (Ec-STAT3) in red spotted grouper nervous necrosis virus (RGNNV) infection were investigated. The present data showed that the distribution of phosphorylated Ec-STAT3 was altered in RGNNV infected fish cells, and the promoter activity of STAT3 was significantly increased during virus infection, suggesting that STAT3 activation was involved in RGNNV infection. Using STAT3 specific inhibitor, we found that inhibition of Ec-STAT3 in vitro did not affect the transcription and protein synthesis of RGNNV coat protein (CP), however, the severity of RGNNV induced vacuolation and autophagy was significantly increased. Meanwhile, at the late stage of virus infection, RGNNV induced necrotic cell death was significantly decreased after inhibition of Ec-STAT3. Further studies indicated that Ec-STAT3 inhibition significantly increased the transcript level of autophagy related genes, including UNC-51-like kinase 2 (ULK2) and microtubule-associated protein 1 light chain 3-II (LC3-II) induced by RGNNV infection. Moreover, the expression of several pro-inflammatory factors, including TNFα, IL-1β and IL-8 were mediated by Ec-STAT3 during RGNNV infection. Together, our results not only firstly revealed that STAT3 exerted novel roles in response to fish virus infection, but also provided new insights into understanding the roles of STAT3 in different forms of programmed cell death.

  14. Mast cell activation by conidia of Sporothrix schenckii: role in the severity of infection.

    PubMed

    Romo-Lozano, Y; Hernández-Hernández, F; Salinas, E

    2012-07-01

    Mast cells are abundant in the skin and other peripheral tissues, where they are one of the first immune cells to make contact with invading pathogens. As a result of pathogen recognition, mast cells can be activated and release different preformed and de novo-synthesized mediators. Sporothrix schenckii is the fungus that causes sporotrichosis, a worldwide-distributed subcutaneous mycosis considered as an important emerging health problem. It remains unknown whether or not mast cells are activated by S. schenckii. Here, we investigated the in vitro response of mast cells to conidia of S. schenckii and their in vivo involvement in sporotrichosis. Mast cells became activated after interaction with conidia, releasing early response cytokines as TNF-α and IL-6. Although histamine release was not significantly stimulated by S. schenckii, we determined that conidia potentiate histamine secretion induced by compound 48/80. Furthermore, functional depletion of peritoneal mast cells before S. schenckii infection significantly reduced the severity of cutaneous lesions of the sporotrichosis. These data demonstrate that mast cells are important contributors in the host response to S. schenckii infection, suggesting a role of these cells in the progress of clinical manifestations in sporotrichosis. PMID:22486186

  15. Mast cell activation by conidia of Sporothrix schenckii: role in the severity of infection.

    PubMed

    Romo-Lozano, Y; Hernández-Hernández, F; Salinas, E

    2012-07-01

    Mast cells are abundant in the skin and other peripheral tissues, where they are one of the first immune cells to make contact with invading pathogens. As a result of pathogen recognition, mast cells can be activated and release different preformed and de novo-synthesized mediators. Sporothrix schenckii is the fungus that causes sporotrichosis, a worldwide-distributed subcutaneous mycosis considered as an important emerging health problem. It remains unknown whether or not mast cells are activated by S. schenckii. Here, we investigated the in vitro response of mast cells to conidia of S. schenckii and their in vivo involvement in sporotrichosis. Mast cells became activated after interaction with conidia, releasing early response cytokines as TNF-α and IL-6. Although histamine release was not significantly stimulated by S. schenckii, we determined that conidia potentiate histamine secretion induced by compound 48/80. Furthermore, functional depletion of peritoneal mast cells before S. schenckii infection significantly reduced the severity of cutaneous lesions of the sporotrichosis. These data demonstrate that mast cells are important contributors in the host response to S. schenckii infection, suggesting a role of these cells in the progress of clinical manifestations in sporotrichosis.

  16. Gene Expression and Antiviral Activity of Interleukin-35 in Response to Influenza A Virus Infection.

    PubMed

    Wang, Li; Zhu, Shengli; Xu, Gang; Feng, Jian; Han, Tao; Zhao, Fanpeng; She, Ying-Long; Liu, Shi; Ye, Linbai; Zhu, Ying

    2016-08-01

    Interleukin-35 (IL-35) is a newly described member of the IL-12 family. It has been reported to inhibit inflammation and autoimmune inflammatory disease and can increase apoptotic sensitivity. Little is known about the role of IL-35 during viral infection. Herein, high levels of IL-35 were found in peripheral blood mononuclear cells and throat swabs from patients with seasonal influenza A virus (IAV) relative to healthy individuals. IAV infection of human lung epithelial and primary cells increased levels of IL-35 mRNA and protein. Further studies demonstrated that IAV-induced IL-35 transcription is regulated by NF-κB. IL-35 expression was significantly suppressed by selective inhibitors of cyclooxygenase-2 (COX-2) and inducible nitric-oxide synthase, indicating their involvement in IL-35 expression. Interestingly, IL-35 production may have suppressed IAV RNA replication and viral protein synthesis via induction of type I and III interferons (IFN), leading to activation of downstream IFN effectors, including double-stranded RNA-dependent protein kinase, 2',5'-oligoadenylate synthetase, and myxovirus resistance protein. IL-35 exhibited extensive antiviral activity against the hepatitis B virus, enterovirus 71, and vesicular stomatitis virus. Our results demonstrate that IL-35 is a novel IAV-inducible cytokine, and its production elicits antiviral activity. PMID:27307042

  17. Active vaccination to prevent de novo hepatitis B virus infection in liver transplantation.

    PubMed

    Lin, Chih-Che; Yong, Chee-Chien; Chen, Chao-Long

    2015-10-21

    The shortage of organ donors mandates the use of liver allograft from anti-HBc(+) donors, especially in areas highly endemic for hepatitis B virus (HBV) infection. The incidence of de novo hepatitis B infection (DNH) is over 30%-70% among recipients of hepatitis B core antibody (HBcAb) (+) grafts without any prophylaxis after liver transplantation (LT). Systematic reviews showed that prophylactic therapy [lamivudine and/or hepatitits B immunoglobulin (HBIG)] dramatically reduces the probability of DNH. However, there are limited studies regarding the effects of active immunization to prevent DNH, and the role of active vaccination is not well-defined. This review focuses on the feasibility and efficacy of pre- and post-LT HBV vaccination to prevent DNH in HBsAg(-) recipient using HBcAb(+) grafts. The presence of HBsAb in combination with lamivudine or HBIG results in lower incidence of DNH and may reduce the requirement of HBIG. There was a trend towards decreasing incidence of DNH with higher titers of HBsAb. High titers of HBsAb (> 1000 IU/L) achieved after repeated vaccination could eliminate the necessity for additional antiviral prophylaxis in pediatric recipients. In summary, active vaccination with adequate HBsAb titer is a feasible, cost-effective strategy to prevent DNH in recipients of HBcAb(+) grafts. HBV vaccination is advised for candidates on waiting list and for recipients after withdrawal of steroids and onset of low dose immunosuppression after transplantation.

  18. Surgical Outcome in Hemodialysis Patients with Active-Phase Infective Endocarditis

    PubMed Central

    Aoki, Atsushi; Maruta, Kazuto; Masuda, Tomoaki

    2016-01-01

    Purpose: The aim of this study was to elucidate the characteristics of chronic hemodialysis (HD) patients requiring surgery during the active phase of infective endocarditis (IE). Methods: From December 2004 to July 2015, 58 patients underwent surgery in our institute for active IE. Seven patients had been on HD for 1–15 years. Their preoperative profiles and surgical outcomes were compared to those of the other 51 patients (non-HD group). Results: The predominant causative microorganisms in the HD group were Staphylococcus spp, particularly methicillin-resistant Staphylococcus aureus (MRSA), whereas Streptococcus spp were predominant in the non-HD group. Prosthetic dysfunction (stuck valve after mechanical and structural valve dysfunction following bioprosthetic valve replacement), complete atrioventricular (AV) block, and annular abscess formation were more frequent in the HD group. In-hospital mortality was higher in the HD group (29% vs. 6%, p = 0.044). Actuarial survival in the HD and non-HD groups was 43% vs. 87% at 5 years and 43% vs. 76% at 10 years (p = 0.007). Conclusions: Early and long term outcomes in patients with chronic HD were poor. Compared to other patients, chronic HD patients undergoing valve surgery during active IE had higher incidences of MRSA infection, annular abscess formation, postoperative valve dysfunction, and postoperative complete AV block. PMID:26948436

  19. Urinary tract infections, active component, U.S. Armed Forces, 2000-2013.

    PubMed

    2014-02-01

    Urinary tract infections (UTIs) are common among young adults, especially women. During the 14-year surveillance period, 30.4 percent of females and 3.5 percent of males who served in the active component had a least one UTI diagnosed during a medical encounter. The incidence rate of first-time UTIs was 70.4 per 1,000 person-years (p-yrs) among females and 7.2 per 1,000 p-yrs among males. Among those who received a diagnosis of UTI, 41.3 percent of females and 13.0 percent of males had recurrences. Rates of UTIs were highest among the youngest age group among females and the youngest and oldest age groups among males. Service members in armor/motor transport occupations in both genders had the greatest incidence rates of UTI compared to other occupations while pilots and air crew had the lowest incidence rates. The rates of UTIs overall were 130.9 per 1,000 p-yrs among females and 8.5 per 1,000 p-yrs among males. The occurrence of a first-ever urinary tract infection may be an opportunity for a healthcare provider to educate the patient about the risk factors for UTI, strategies to prevent recurrent infection, and the appropriate response to the new onset of typical symptoms of UTI.

  20. Activation of TRPML1 clears intraneuronal Aβ in preclinical models of HIV infection.

    PubMed

    Bae, Mihyun; Patel, Neha; Xu, Haoxing; Lee, Mingwaoh; Tominaga-Yamanaka, Kumiko; Nath, Avindra; Geiger, Jonathan; Gorospe, Myriam; Mattson, Mark P; Haughey, Norman J

    2014-08-20

    Antiretroviral therapy extends the lifespan of human immunodeficiency virus (HIV)-infected patients, but many survivors develop premature impairments in cognition. These residual cognitive impairments may involve aberrant deposition of amyloid β-peptides (Aβ). By unknown mechanisms, Aβ accumulates in the lysosomal and autophagic compartments of neurons in the HIV-infected brain. Here we identify the molecular events evoked by the HIV coat protein gp120 that facilitate the intraneuronal accumulation of Aβ. We created a triple transgenic gp120/APP/PS1 mouse that recapitulates intraneuronal deposition of Aβ in a manner reminiscent of the HIV-infected brain. In cultured neurons, we found that the HIV coat protein gp120 increased the transcriptional expression of BACE1 through repression of PPARγ, and increased APP expression by promoting interaction of the translation-activating RBP heterogeneous nuclear ribonucleoprotein C with APP mRNA. APP and BACE1 were colocalized into stabilized membrane microdomains, where the β-cleavage of APP and Aβ formation were enhanced. Aβ-peptides became localized to lysosomes that were engorged with sphingomyelin and calcium. Stimulating calcium efflux from lysosomes with a TRPM1 agonist promoted calcium efflux, luminal acidification, and cleared both sphingomyelin and Aβ from lysosomes. These findings suggest that therapeutics targeted to reduce lysosomal pH in neurodegenerative conditions may protect neurons by facilitating the clearance of accumulated sphingolipids and Aβ-peptides. PMID:25143627

  1. Activation of TRPML1 Clears Intraneuronal Aβ in Preclinical Models of HIV Infection

    PubMed Central

    Bae, Mihyun; Patel, Neha; Xu, Haoxing; Lee, Mingwaoh; Tominaga-Yamanaka, Kumiko; Nath, Avindra; Geiger, Jonathan; Gorospe, Myriam; Mattson, Mark P.

    2014-01-01

    Antiretroviral therapy extends the lifespan of human immunodeficiency virus (HIV)-infected patients, but many survivors develop premature impairments in cognition. These residual cognitive impairments may involve aberrant deposition of amyloid β-peptides (Aβ). By unknown mechanisms, Aβ accumulates in the lysosomal and autophagic compartments of neurons in the HIV-infected brain. Here we identify the molecular events evoked by the HIV coat protein gp120 that facilitate the intraneuronal accumulation of Aβ. We created a triple transgenic gp120/APP/PS1 mouse that recapitulates intraneuronal deposition of Aβ in a manner reminiscent of the HIV-infected brain. In cultured neurons, we found that the HIV coat protein gp120 increased the transcriptional expression of BACE1 through repression of PPARγ, and increased APP expression by promoting interaction of the translation-activating RBP heterogeneous nuclear ribonucleoprotein C with APP mRNA. APP and BACE1 were colocalized into stabilized membrane microdomains, where the β-cleavage of APP and Aβ formation were enhanced. Aβ-peptides became localized to lysosomes that were engorged with sphingomyelin and calcium. Stimulating calcium efflux from lysosomes with a TRPM1 agonist promoted calcium efflux, luminal acidification, and cleared both sphingomyelin and Aβ from lysosomes. These findings suggest that therapeutics targeted to reduce lysosomal pH in neurodegenerative conditions may protect neurons by facilitating the clearance of accumulated sphingolipids and Aβ-peptides. PMID:25143627

  2. Anticestodal activity of Houttuynia cordata leaf extract against Hymenolepis diminuta in experimentally infected rats.

    PubMed

    Yadav, Arun K; Temjenmongla

    2011-10-01

    The leaves of Houttuynia cordata Thunb. (Saururaceae) are considered to have anthelmintic properties in the traditional medicine of Naga tribes in Northeast India and, therefore, are used by the natives to treat the intestinal worm infections. In the present study, the anticestodal activity of H. cordata leaf extract was investigated against Hymenolepis diminuta, a zoonotic cestode, in experimentally infected albino rats. For the assessment of anticestodal efficacy, the eggs per gram (EPG) of faeces counts and worm loads of animals were monitored following treatment with 200, 400 and 800 mg/kg p.o. doses of leaf extract to different groups of rats harbouring larval, immature and mature H. diminuta infections. The efficacy of the extract was found to be dose-dependent (P < 0.05). Further, the extract showed its maximum efficacy against the mature Hymenolepis worms. In this case, the 800 mg/kg dose of extract significantly reduced (P < 0.001) the EPG counts of animals by 57.09% and worm load by 75.00%, at post-treatment. In comparison, the reference drug praziquantel at 5 mg/kg showed a reduction in the EPG counts and worm load of experimental animals by 80.37 and 87.50%, respectively. These findings indicate that leaves of H. cordata possess significant anticestodal property and provide a rationale for their use in traditional medicine as an anthelmintic. PMID:23024502

  3. New paradigms for understanding and step changes in treating active and chronic, persistent apicomplexan infections

    PubMed Central

    McPhillie, Martin; Zhou, Ying; El Bissati, Kamal; Dubey, Jitender; Lorenzi, Hernan; Capper, Michael; Lukens, Amanda K; Hickman, Mark; Muench, Stephen; Verma, Shiv Kumar; Weber, Christopher R.; Wheeler, Kelsey; Gordon, James; Sanders, Justin; Moulton, Hong; Wang, Kai; Kim, Taek-Kyun; He, Yuqing; Santos, Tatiana; Woods, Stuart; Lee, Patty; Donkin, David; Kim, Eric; Fraczek, Laura; Lykins, Joseph; Esaa, Farida; Alibana-Clouser, Fatima; Dovgin, Sarah; Weiss, Louis; Brasseur, Gael; Wirth, Dyann; Kent, Michael; Hood, Leroy; Meunieur, Brigitte; Roberts, Craig W.; Hasnain, S. Samar; Antonyuk, Svetlana V.; Fishwick, Colin; McLeod, Rima

    2016-01-01

    Toxoplasma gondii, the most common parasitic infection of human brain and eye, persists across lifetimes, can progressively damage sight, and is currently incurable. New, curative medicines are needed urgently. Herein, we develop novel models to facilitate drug development: EGS strain T. gondii forms cysts in vitro that induce oocysts in cats, the gold standard criterion for cysts. These cysts highly express cytochrome b. Using these models, we envisioned, and then created, novel 4-(1H)-quinolone scaffolds that target the cytochrome bc1 complex Qi site, of which, a substituted 5,6,7,8-tetrahydroquinolin-4-one inhibits active infection (IC50, 30 nM) and cysts (IC50, 4 μM) in vitro, and in vivo (25 mg/kg), and drug resistant Plasmodium falciparum (IC50, <30 nM), with clinically relevant synergy. Mutant yeast and co-crystallographic studies demonstrate binding to the bc1 complex Qi site. Our results have direct impact on improving outcomes for those with toxoplasmosis, malaria, and ~2 billion persons chronically infected with encysted bradyzoites. PMID:27412848

  4. New paradigms for understanding and step changes in treating active and chronic, persistent apicomplexan infections.

    PubMed

    McPhillie, Martin; Zhou, Ying; El Bissati, Kamal; Dubey, Jitender; Lorenzi, Hernan; Capper, Michael; Lukens, Amanda K; Hickman, Mark; Muench, Stephen; Verma, Shiv Kumar; Weber, Christopher R; Wheeler, Kelsey; Gordon, James; Sanders, Justin; Moulton, Hong; Wang, Kai; Kim, Taek-Kyun; He, Yuqing; Santos, Tatiana; Woods, Stuart; Lee, Patty; Donkin, David; Kim, Eric; Fraczek, Laura; Lykins, Joseph; Esaa, Farida; Alibana-Clouser, Fatima; Dovgin, Sarah; Weiss, Louis; Brasseur, Gael; Wirth, Dyann; Kent, Michael; Hood, Leroy; Meunieur, Brigitte; Roberts, Craig W; Hasnain, S Samar; Antonyuk, Svetlana V; Fishwick, Colin; McLeod, Rima

    2016-01-01

    Toxoplasma gondii, the most common parasitic infection of human brain and eye, persists across lifetimes, can progressively damage sight, and is currently incurable. New, curative medicines are needed urgently. Herein, we develop novel models to facilitate drug development: EGS strain T. gondii forms cysts in vitro that induce oocysts in cats, the gold standard criterion for cysts. These cysts highly express cytochrome b. Using these models, we envisioned, and then created, novel 4-(1H)-quinolone scaffolds that target the cytochrome bc1 complex Qi site, of which, a substituted 5,6,7,8-tetrahydroquinolin-4-one inhibits active infection (IC50, 30 nM) and cysts (IC50, 4 μM) in vitro, and in vivo (25 mg/kg), and drug resistant Plasmodium falciparum (IC50, <30 nM), with clinically relevant synergy. Mutant yeast and co-crystallographic studies demonstrate binding to the bc1 complex Qi site. Our results have direct impact on improving outcomes for those with toxoplasmosis, malaria, and ~2 billion persons chronically infected with encysted bradyzoites.

  5. New paradigms for understanding and step changes in treating active and chronic, persistent apicomplexan infections.

    PubMed

    McPhillie, Martin; Zhou, Ying; El Bissati, Kamal; Dubey, Jitender; Lorenzi, Hernan; Capper, Michael; Lukens, Amanda K; Hickman, Mark; Muench, Stephen; Verma, Shiv Kumar; Weber, Christopher R; Wheeler, Kelsey; Gordon, James; Sanders, Justin; Moulton, Hong; Wang, Kai; Kim, Taek-Kyun; He, Yuqing; Santos, Tatiana; Woods, Stuart; Lee, Patty; Donkin, David; Kim, Eric; Fraczek, Laura; Lykins, Joseph; Esaa, Farida; Alibana-Clouser, Fatima; Dovgin, Sarah; Weiss, Louis; Brasseur, Gael; Wirth, Dyann; Kent, Michael; Hood, Leroy; Meunieur, Brigitte; Roberts, Craig W; Hasnain, S Samar; Antonyuk, Svetlana V; Fishwick, Colin; McLeod, Rima

    2016-01-01

    Toxoplasma gondii, the most common parasitic infection of human brain and eye, persists across lifetimes, can progressively damage sight, and is currently incurable. New, curative medicines are needed urgently. Herein, we develop novel models to facilitate drug development: EGS strain T. gondii forms cysts in vitro that induce oocysts in cats, the gold standard criterion for cysts. These cysts highly express cytochrome b. Using these models, we envisioned, and then created, novel 4-(1H)-quinolone scaffolds that target the cytochrome bc1 complex Qi site, of which, a substituted 5,6,7,8-tetrahydroquinolin-4-one inhibits active infection (IC50, 30 nM) and cysts (IC50, 4 μM) in vitro, and in vivo (25 mg/kg), and drug resistant Plasmodium falciparum (IC50, <30 nM), with clinically relevant synergy. Mutant yeast and co-crystallographic studies demonstrate binding to the bc1 complex Qi site. Our results have direct impact on improving outcomes for those with toxoplasmosis, malaria, and ~2 billion persons chronically infected with encysted bradyzoites. PMID:27412848

  6. Immunotherapy of HIV-infected patients with Gc protein-derived macrophage activating factor (GcMAF).

    PubMed

    Yamamoto, Nobuto; Ushijima, Naofumi; Koga, Yoshihiko

    2009-01-01

    Serum Gc protein (known as vitamin D3-binding protein) is the precursor for the principal macrophage activating factor (MAF). The MAF precursor activity of serum Gc protein of HIV-infected patients was lost or reduced because Gc protein is deglycosylated by alpha-N-acetylgalactosaminidase (Nagalase) secreted from HIV-infected cells. Therefore, macrophages of HIV-infected patients having deglycosylated Gc protein cannot be activated, leading to immunosuppression. Since Nagalase is the intrinsic component of the envelope protein gp120, serum Nagalase activity is the sum of enzyme activities carried by both HIV virions and envelope proteins. These Nagalase carriers were already complexed with anti-HIV immunoglobulin G (IgG) but retained Nagalase activity that is required for infectivity. Stepwise treatment of purified Gc protein with immobilized beta-galactosidase and sialidase generated the most potent macrophage activating factor (termed GcMAF), which produces no side effects in humans. Macrophages activated by administration of 100 ng GcMAF develop a large amount of Fc-receptors as well as an enormous variation of receptors that recognize IgG-bound and unbound HIV virions. Since latently HIV-infected cells are unstable and constantly release HIV virions, the activated macrophages rapidly intercept the released HIV virions to prevent reinfection resulting in exhaustion of infected cells. After less than 18 weekly administrations of 100 ng GcMAF for nonanemic patients, they exhibited low serum Nagalase activities equivalent to healthy controls, indicating eradication of HIV-infection, which was also confirmed by no infectious center formation by provirus inducing agent-treated patient PBMCs. No recurrence occurred and their healthy CD + cell counts were maintained for 7 years. PMID:19031451

  7. The ATF6 branch of unfolded protein response and apoptosis are activated to promote African swine fever virus infection.

    PubMed

    Galindo, I; Hernáez, B; Muñoz-Moreno, R; Cuesta-Geijo, M A; Dalmau-Mena, I; Alonso, C

    2012-07-05

    African swine fever virus (ASFV) infection induces apoptosis in the infected cell; however, the consequences of this activation on virus replication have not been defined. In order to identify the role of apoptosis in ASFV infection, we analyzed caspase induction during the infection and the impact of caspase inhibition on viral production. Caspases 3, 9 and 12 were activated from 16 h post-infection, but not caspase 8. Indeed, caspase 3 activation during the early stages of the infection appeared to be crucial for efficient virus exit. In addition, the inhibition of membrane blebbing reduced the release of virus particles from the cell. ASFV uses the endoplasmic reticulum (ER) as a site of replication and this process can trigger ER stress and the unfolded protein response (UPR) of the host cell. In addition to caspase 12 activation, indicators of ER stress include the upregulation of the chaperones calnexin and calreticulin upon virus infection. Moreover, ASFV induces transcription factor 6 signaling pathway of the UPR, but not the protein kinase-like ER kinase or the inositol-requiring enzyme 1 pathways. Thus, the capacity of ASFV to regulate the UPR may prevent early apoptosis and ensure viral replication.

  8. The ATF6 branch of unfolded protein response and apoptosis are activated to promote African swine fever virus infection

    PubMed Central

    Galindo, I; Hernáez, B; Muñoz-Moreno, R; Cuesta-Geijo, M A; Dalmau-Mena, I; Alonso, C

    2012-01-01

    African swine fever virus (ASFV) infection induces apoptosis in the infected cell; however, the consequences of this activation on virus replication have not been defined. In order to identify the role of apoptosis in ASFV infection, we analyzed caspase induction during the infection and the impact of caspase inhibition on viral production. Caspases 3, 9 and 12 were activated from 16 h post-infection, but not caspase 8. Indeed, caspase 3 activation during the early stages of the infection appeared to be crucial for efficient virus exit. In addition, the inhibition of membrane blebbing reduced the release of virus particles from the cell. ASFV uses the endoplasmic reticulum (ER) as a site of replication and this process can trigger ER stress and the unfolded protein response (UPR) of the host cell. In addition to caspase 12 activation, indicators of ER stress include the upregulation of the chaperones calnexin and calreticulin upon virus infection. Moreover, ASFV induces transcription factor 6 signaling pathway of the UPR, but not the protein kinase-like ER kinase or the inositol-requiring enzyme 1 pathways. Thus, the capacity of ASFV to regulate the UPR may prevent early apoptosis and ensure viral replication. PMID:22764100

  9. An altered intestinal mucosal microbiome in HIV-1 infection is associated with mucosal and systemic immune activation and endotoxemia

    PubMed Central

    Dillon, SM; Lee, EJ; Kotter, CV; Austin, GL; Dong, Z; Hecht, DK; Gianella, S; Siewe, B; Smith, DM; Landay, AL; Robertson, CE; Frank, DN; Wilson, CC

    2014-01-01

    HIV-1 infection disrupts the intestinal immune system, leading to microbial translocation and systemic immune activation. We investigated the impact of HIV-1 infection on the intestinal microbiome and its association with mucosal T cell and dendritic cell (DC) frequency and activation, as well as with levels of systemic T cell activation, inflammation and microbial translocation. Bacterial 16S ribosomal DNA sequencing was performed on colon biopsies and fecal samples from subjects with chronic, untreated HIV-1 infection and uninfected control subjects. Colon biopsies of HIV-1 infected subjects had increased abundances of Proteobacteria and decreased abundances of Firmicutes compared to uninfected donors. Furthermore at the genus level, a significant increase in Prevotella and decrease in Bacteroides was observed in HIV-1 infected subjects, indicating a disruption in the Bacteroidetes bacterial community structure. This HIV-1-associated increase in Prevotella abundance was associated with increased numbers of activated colonic T cells and myeloid DCs. Principal coordinates analysis demonstrated an HIV-1-related change in the microbiome that was associated with increased mucosal cellular immune activation, microbial translocation and blood T cell activation. These observations suggest that an important relationship exists between altered mucosal bacterial communities and intestinal inflammation during chronic HIV-1 infection. PMID:24399150

  10. Intracellular activity of tedizolid phosphate and ACH-702 versus Mycobacterium tuberculosis infected macrophages

    PubMed Central

    2014-01-01

    Background Due to the emergency of multidrug-resistant strains of Mycobacterium tuberculosis, is necessary the evaluation of new compounds. Findings Tedizolid, a novel oxazolidinone, and ACH-702, a new isothiazoloquinolone, were tested against M. tuberculosis infected THP-1 macrophages. These two compounds significantly decreased the number of intracellular mycobacteria at 0.25X, 1X, 4X and 16X the MIC value. The drugs were tested either in nanoparticules or in free solution. Conclusion Tedizolid and ACH-702 have a good intracellular killing activity comparable to that of rifampin or moxifloxacin. PMID:24708819

  11. Antiviral activity of a carrageenan from Gigartina skottsbergii against intraperitoneal murine herpes simplex virus infection.

    PubMed

    Pujol, C A; Scolaro, L A; Ciancia, M; Matulewicz, M C; Cerezo, A S; Damonte, E B

    2006-02-01

    The partially cyclized mu/nu-carrageenan 1C3, isolated from the red seaweed Gigartina skottsbergii, was previously shown to be a potent inhibitor of the in vitro replication of Herpes simplex virus types 1 (HSV-1) and 2 (HSV-2). Here the protective effect of 1C3 in a murine model of intraperitoneal ( i. p.) HSV-1 infection was evaluated. OF1 mice were i. p. infected with 5 x 10 (5) PFU of HSV-1 KOS strain, and the effects of different treatments with 1C3 were studied. When 30 mg/kg of body weight of 1C3 was administered by the i. p. route immediately after HSV-1 infection, 87.5 % survival of the animals was achieved (p < 0.005), associated with a delay in the mean day of death in 1C3-treated non-surviving mice. Animal survival was not improved when multiple doses of 1C3 were also given in the period 1 - 48 h post-infection, and no protection was afforded when treatment was started after 24 h of infection. When virus and compound were injected by different routes, i. p. and intravenous ( i. v.), respectively, a still significant protection was achieved (40 % survival, p < 0.05). No toxicity of 1C3 for the animals was recorded. The pharmacokinetic properties were analyzed after injection of 1C3 into the tail vein by monitoring of [ (3)H]-1C3 in plasma and organs and by a bioassay of the anti-HSV-1 activity remaining in serum after non-radioactive 1C3 inoculation. A very rapid disappearance of the compound from the blood was observed since only 5.9 - 0.9 % of the radioactivity of the initially administered [ (3)H]-1C3 appeared in the plasma between 5-300 minutes after administration. A transient peak of radioactivity was detected in the kidney 15 minutes after inoculation. The bioassay confirms the presence of the compound circulating in a biologically active form up to 1 hour after injection. PMID:16491446

  12. Interleukin-27 exhibited anti-inflammatory activity during Plasmodium berghei infection in mice.

    PubMed

    Fazalul Rahiman, S S; Basir, R; Talib, H; Tie, T H; Chuah, Y K; Jabbarzare, M; Chong, W C; Mohd Yusoff, M A; Nordin, N; Yam, M F; Abdullah, W O; Abdul Majid, R

    2013-12-01

    Interleukin-27 (IL-27) has a pleiotropic role either as a pro-inflammatory or anti-inflammatory cytokine in inflammatory related diseases. The role and involvement of IL-27 during malaria was investigated and the effects of modulating its release on the production of major inflammatory cytokines and the histopathological consequences in major affected organs during the infection were evaluated. Results showed that IL-27 concentration was significantly elevated throughout the infection but no positive correlation with the parasitaemia development observed. Augmentation of IL-27 significantly elevated the release of anti-inflammatory cytokine, IL-10 whereas antagonising and neutralising IL-27 produced the opposite. A significant elevation of pro-inflammatory cytokines (IFN-γ and IL-6) was also observed, both during augmentation and inhibition of IL-27. Thus, it is suggested that IL-27 exerts an anti-inflammatory activity in the Th1 type response by signalling the production of IL-10 during malaria. Histopathological examination showed sequestration of PRBC in the microvasculature of major organs in malarial mice. Other significant histopathological changes include hyperplasia and hypertrophy of the Kupffer cells in the liver, hyaline membrane formation in lung tissue, enlargement of the white and red pulp followed by the disappearance of germinal centre of the spleen, and tubular vacuolation of the kidney tissues. In conclusion, it is suggested that IL-27 may possibly acts as an anti-inflammatory cytokine during the infection. Modulation of its release produced a positive impact on inflammatory cytokine production during the infection, suggesting its potential in malaria immunotherapy, in which the host may benefit from its inhibition.

  13. Tim-3 induces Th2-biased immunity and alternative macrophage activation during Schistosoma japonicum infection.

    PubMed

    Hou, Nan; Piao, Xianyu; Liu, Shuai; Wu, Chuang; Chen, Qijun

    2015-08-01

    T cell immunoglobulin- and mucin-domain-containing molecule 3 (Tim-3) has been regarded as an important regulatory factor in both adaptive and innate immunity. Recently, Tim-3 was reported to be involved in Th2-biased immune responses in mice infected with Schistosoma japonicum, but the exact mechanism behind the involvement of Tim-3 remains unknown. The present study aims to understand the role of Tim-3 in the immune response against S. japonicum infection. Tim-3 expression was determined by flow cytometry, and increased Tim-3 expression was observed on CD4(+) and CD8(+) T cells, NK1.1(+) cells, and CD11b(+) cells from the livers of S. japonicum-infected mice. However, the increased level of Tim-3 was lower in the spleen than in the liver, and no increase in Tim-3 expression was observed on splenic CD8(+) T cells or CD11b(+) cells. The schistosome-induced upregulation of Tim-3 on natural killer (NK) cells was accompanied by reduced NK cell numbers in vitro and in vivo. Tim-3 antibody blockade led to upregulation of inducible nitric oxide synthase and interleukin-12 (IL-12) mRNA in CD11b(+) cells cocultured with soluble egg antigen and downregulation of Arg1 and IL-10, which are markers of M2 macrophages. In summary, we observed schistosome-induced expression of Tim-3 on critical immune cell populations, which may be involved in the Th2-biased immune response and alternative activation of macrophages during infection.

  14. Multiple phosphorylation sites at the C-terminus regulate nuclear import of HCMV DNA polymerase processivity factor ppUL44

    SciTech Connect

    Alvisi, Gualtiero; Marin, Oriano; Pari, Gregory; Mancini, Manuela; Avanzi, Simone; Loregian, Arianna; Jans, David A.; Ripalti, Alessandro

    2011-09-01

    The processivity factor of human cytomegalovirus DNA polymerase, phosphoprotein ppUL44, is essential for viral replication. During viral infection ppUL44 is phosphorylated by the viral kinase pUL97, but neither the target residues on ppUL44 nor the effect of phosphorylation on ppUL44's activity are known. We report here that ppUL44 is phosphorylated when transiently expressed in mammalian cells and coimmunoprecipitates with cellular kinases. Of three potential phosphorylation sites (S413, S415, S418) located upstream of ppUL44's nuclear localization signal (NLS) and one (T427) within the NLS itself, protein kinase CK2 (CK2) specifically phosphorylates S413, to trigger a cascade of phosphorylation of S418 and S415 by CK1 and CK2, respectively. Negative charge at the CK2/CK1 target serine residues facilitates optimal nuclear accumulation of ppUL44, whereas negative charge on T427, a potential cyclin-dependent 1 phosphorylation site, strongly decreases nuclear accumulation. Thus, nuclear transport of ppUL44 is finely tuned during viral infection through complex phosphorylation events.

  15. Active and Secretory IgA-Coated Bacterial Fractions Elucidate Dysbiosis in Clostridium difficile Infection.

    PubMed

    Džunková, Mária; Moya, Andrés; Vázquez-Castellanos, Jorge F; Artacho, Alejandro; Chen, Xinhua; Kelly, Ciaran; D'Auria, Giuseppe

    2016-01-01

    The onset of Clostridium difficile infection (CDI) has been associated with treatment with wide-spectrum antibiotics. Antibiotic treatment alters the activity of gut commensals and may result in modified patterns of immune responses to pathogens. To study these mechanisms during CDI, we separated bacteria with high cellular RNA content (the active bacteria) and their inactive counterparts by fluorescence-activated cell sorting (FACS) of the fecal bacterial suspension. The gut dysbiosis due to the antibiotic treatment may result in modification of immune recognition of intestinal bacteria. The immune recognition patterns were assessed by FACS of bacterial fractions either coated or not with intestinal secretory immunoglobulin A (SIgA). We described the taxonomic distributions of these four bacterial fractions (active versus inactive and SIgA coated versus non-SIgA coated) by massive 16S rRNA gene amplicon sequencing and quantified the proportion of C. difficile toxin genes in the samples. The overall gut microbiome composition was more robustly influenced by antibiotics than by the C. difficile toxins. Bayesian networks revealed that the C. difficile cluster was preferentially SIgA coated during CDI. In contrast, in the CDI-negative group Fusobacterium was the characteristic genus of the SIgA-opsonized fraction. Lactobacillales and Clostridium cluster IV were mostly inactive in CDI-positive patients. In conclusion, although the proportion of C. difficile in the gut is very low, it is able to initiate infection during the gut dysbiosis caused by environmental stress (antibiotic treatment) as a consequence of decreased activity of the protective bacteria. IMPORTANCE C. difficile is a major enteric pathogen with worldwide distribution. Its expansion is associated with broad-spectrum antibiotics which disturb the normal gut microbiome. In this study, the DNA sequencing of highly active bacteria and bacteria opsonized by intestinal secretory immunoglobulin A (SIg

  16. Active and Secretory IgA-Coated Bacterial Fractions Elucidate Dysbiosis in Clostridium difficile Infection

    PubMed Central

    Moya, Andrés; Vázquez-Castellanos, Jorge F.; Artacho, Alejandro; Chen, Xinhua; Kelly, Ciaran

    2016-01-01

    ABSTRACT The onset of Clostridium difficile infection (CDI) has been associated with treatment with wide-spectrum antibiotics. Antibiotic treatment alters the activity of gut commensals and may result in modified patterns of immune responses to pathogens. To study these mechanisms during CDI, we separated bacteria with high cellular RNA content (the active bacteria) and their inactive counterparts by fluorescence-activated cell sorting (FACS) of the fecal bacterial suspension. The gut dysbiosis due to the antibiotic treatment may result in modification of immune recognition of intestinal bacteria. The immune recognition patterns were assessed by FACS of bacterial fractions either coated or not with intestinal secretory immunoglobulin A (SIgA). We described the taxonomic distributions of these four bacterial fractions (active versus inactive and SIgA coated versus non-SIgA coated) by massive 16S rRNA gene amplicon sequencing and quantified the proportion of C. difficile toxin genes in the samples. The overall gut microbiome composition was more robustly influenced by antibiotics than by the C. difficile toxins. Bayesian networks revealed that the C. difficile cluster was preferentially SIgA coated during CDI. In contrast, in the CDI-negative group Fusobacterium was the characteristic genus of the SIgA-opsonized fraction. Lactobacillales and Clostridium cluster IV were mostly inactive in CDI-positive patients. In conclusion, although the proportion of C. difficile in the gut is very low, it is able to initiate infection during the gut dysbiosis caused by environmental stress (antibiotic treatment) as a consequence of decreased activity of the protective bacteria. IMPORTANCE C. difficile is a major enteric pathogen with worldwide distribution. Its expansion is associated with broad-spectrum antibiotics which disturb the normal gut microbiome. In this study, the DNA sequencing of highly active bacteria and bacteria opsonized by intestinal secretory immunoglobulin

  17. Activation of innate immune-response genes in little brown bats (Myotis lucifugus) infected with the fungus Pseudogymnoascus destructans.

    PubMed

    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M; Bollinger, Trent K; Willis, Craig K R; Voyles, Jamie; Misra, Vikram

    2014-01-01

    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes.

  18. Activation of Innate Immune-Response Genes in Little Brown Bats (Myotis lucifugus) Infected with the Fungus Pseudogymnoascus destructans

    PubMed Central

    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M.; Bollinger, Trent K.; Willis, Craig K. R.; Voyles, Jamie; Misra, Vikram

    2014-01-01

    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes. PMID:25391018

  19. Activation of innate immune-response genes in little brown bats (Myotis lucifugus) infected with the fungus Pseudogymnoascus destructans.

    PubMed

    Rapin, Noreen; Johns, Kirk; Martin, Lauren; Warnecke, Lisa; Turner, James M; Bollinger, Trent K; Willis, Craig K R; Voyles, Jamie; Misra, Vikram

    2014-01-01

    Recently bats have been associated with the emergence of diseases, both as reservoirs for several new viral diseases in humans and other animals and, in the northern Americas, as hosts for a devastating fungal disease that threatens to drive several bat species to regional extinction. However, despite these catastrophic events little Information is available on bat defences or how they interact with their pathogens. Even less is known about the response of bats to infection during torpor or long-term hibernation. Using tissue samples collected at the termination of an experiment to explore the pathogenesis of White Nose Syndrome in Little Brown Bats, we determined if hibernating bats infected with the fungus Pseudogymnoascus destructans could respond to infection by activating genes responsible for innate immune and stress responses. Lesions due to fungal infection and, in some cases, secondary bacterial infections, were restricted to the skin. However, we were unable to obtain sufficient amounts of RNA from these sites. We therefore examined lungs for response at an epithelial surface not linked to the primary site of infection. We found that bats responded to infection with a significant increase in lungs of transcripts for Cathelicidin (an anti-microbial peptide) as well as the immune modulators tumor necrosis factor alpha and interleukins 10 and 23. In conclusion, hibernating bats can respond to experimental P. destructans infection by activating expression of innate immune response genes. PMID:25391018

  20. Effects of artificial infection of Litopenaeus vannamei by Micrococcus lysodeikticus and WSSV on the activity of immunity related enzymes.

    PubMed

    Sun, Cheng-Bo; Wang, Gang; Chan, Siuming F

    2015-10-01

    In this study, the activities of 5 immunity related enzymes namely acid phosphatase (ACP), alkaline phosphatase (AKP), phenoloxidase (PO), peroxidase (POD) and lysozyme phosphatase (LZM)) of Litopenaeus vannamei after they have been injected with different concentrations of Micrococcus lysodeikticus and the white spot syndrome virus (WSSV) were examined. The cumulative mortality at 0, 24, 48, 72, 96 h was obtained. Copy numbers of WSSV in L. vannamei after a single infection, secondary infection and concurrent infection were measured. Hemolymph samples of M. lysodeikticus and WSSV injected shrimp were collected at 0, 6, 12 24, 48, 72, 78, 84, 96 and 120 h. The results were: (i) The cumulative mortality of L. vannamei increased as the shrimp were infected with higher concentration of the bacteria; (ii) The most sensitive changes of ACP, AKP and LZM were in the 6.2 × 10(5), 6.2 × 10(6), 6.2 × 10(7) cfu/mL M. lysodeikticus group; (iii) ACP but LZM were more sensitive to M. lysodeikticus than WSSV, and AKP, PO and POD is more sensitive to WSSV; (iv) The copies of WSSV in the co-injected group were higher than WSSV-single infection and WSSV-bacteria-secondary infection group at 48 h. The amount of WSSV in L. vannamei of concurrent infection and WSSV-bacteria-secondary infection groups were higher than that of the WSSV-single infection group.

  1. Neisseria gonorrhoeae enhances HIV-1 infection of primary resting CD4+ T cells through TLR2 activation.

    PubMed

    Ding, Jian; Rapista, Aprille; Teleshova, Natalia; Mosoyan, Goar; Jarvis, Gary A; Klotman, Mary E; Chang, Theresa L

    2010-03-15

    Sexually transmitted infections increase the likelihood of HIV-1 transmission. We investigated the effect of Neisseria gonorrheae (gonococcus [GC]) exposure on HIV replication in primary resting CD4(+) T cells, a major HIV target cell during the early stage of sexual transmission of HIV. GC and TLR2 agonists, such as peptidylglycan (PGN), Pam(3)CSK(4), and Pam(3)C-Lip, a GC-derived synthetic lipopeptide, but not TLR4 agonists including LPS or GC lipooligosaccharide enhanced HIV-1 infection of primary resting CD4(+) T cells after viral entry. Pretreatment of CD4(+) cells with PGN also promoted HIV infection. Anti-TLR2 Abs abolished the HIV enhancing effect of GC and Pam(3)C-Lip, indicating that GC-mediated enhancement of HIV infection of resting CD4(+) T cells was through TLR2. IL-2 was required for TLR2-mediated HIV enhancement. PGN and GC induced cell surface expression of T cell activation markers and HIV coreceptors, CCR5 and CXCR4. The maximal postentry HIV enhancing effect was achieved when PGN was added immediately after viral exposure. Kinetic studies and analysis of HIV DNA products indicated that GC exposure and TLR2 activation enhanced HIV infection at the step of nuclear import. We conclude that GC enhanced HIV infection of primary resting CD4(+) T cells through TLR2 activation, which both increased the susceptibility of primary CD4(+) T cells to HIV infection as well as enhanced HIV-infected CD4(+) T cells at the early stage of HIV life cycle after entry. This study provides a molecular mechanism by which nonulcerative sexually transmitted infections mediate enhancement of HIV infection and has implication for HIV prevention and therapeutics. PMID:20147631

  2. Relation between iron metabolism and antioxidants enzymes and δ-ALA-D activity in rats experimentally infected by Fasciola hepatica.

    PubMed

    Bottari, Nathieli B; Mendes, Ricardo E; Baldissera, Matheus D; Bochi, Guilherme V; Moresco, Rafael N; Leal, Marta L R; Morsch, Vera M; Schetinger, Maria R C; Christ, Ricardo; Gheller, Larissa; Marques, Éder J; Da Silva, Aleksandro S

    2016-06-01

    The aim of this study was to evaluate the iron metabolism in serum, as well as antioxidant enzymes, in addition to the Delta-Aminolevulinic Acid Dehydratase (δ-ALA-D) activity in the liver of rats experimentally infected by Fasciola hepatica. Thirty male adult rats (Wistar) specific pathogen free were divided into four groups: two uninfected group (CTRL 1 and CTRL 2) with five animals each and two infected groups (INF 1 and INF 2) with 10 animals each. Infection was performed orally with 20 metacercariae at day 1. On day 15 (CTRL 1 and INF 1 groups) and 87 PI (CTRL 2 and INF 2 groups) blood and bone marrow were collected and the animals were subsequently euthanized for liver sampling. Blood was allocated in tubes without anticoagulant for serum acquisition to measure iron, transferrin and unsaturated iron binding capacity (UIBC). δ-ALA-D, superoxide dismutase (SOD), and catalase (CAT) activities were measured in the liver. A decrease in iron, transferrin and UIBC levels was observed in all infected animals compared to control groups (P < 0.05). Furthermore, iron accumulation was observed in bone marrow of infected mice. Infected animals showed an increase in δ-ALA-D activity at 87 post-infection (PI) (INF 2) as well as in SOD activity at days 15 (INF 1) and 87 PI (INF 2). On the other hand, CAT activity was reduced in rats infected by F. hepatica during acute and chronic phase of fasciolosis (INF 1 and INF 2 groups), when moderate (acute) and severe necrosis in the liver histopathology were observed. These results may suggest that oxidative damage to tissues along with antioxidant mechanisms might have taken part in fasciolosis pathogenesis and are also involved in iron deficiency associated to changes in δ-ALA-D activity during chronic phase of disease.

  3. In Vivo Antimalarial Activity of Annona muricata Leaf Extract in Mice Infected with Plasmodium berghei.

    PubMed

    Somsak, Voravuth; Polwiang, Natsuda; Chachiyo, Sukanya

    2016-01-01

    Malaria is one of the most important infectious diseases in the world. The choice for the treatment is highly limited due to drug resistance. Hence, finding the new compounds to treat malaria is urgently needed. The present study was attempted to evaluate the antimalarial activity of the Annona muricata aqueous leaf extract in Plasmodium berghei infected mice. Aqueous leaf extract of A. muricata was prepared and tested for acute toxicity in mice. For efficacy test in vivo, standard 4-day suppressive test was carried out. ICR mice were inoculated with 10(7) parasitized erythrocytes of P. berghei ANKA by intraperitoneal injection. The extracts (100, 500, and 1000 mg/kg) were then given orally by gavage once a day for 4 consecutive days. Parasitemia, percentage of inhibition, and packed cell volume were subsequently calculated. Chloroquine (10 mg/kg) was given to infected mice as positive control while untreated control was given only distilled water. It was found that A. muricata aqueous leaf extract at doses of 100, 500, and 1000 mg/kg resulted in dose dependent parasitemia inhibition of 38.03%, 75.25%, and 85.61%, respectively. Survival time was prolonged in infected mice treated with the extract. Moreover, no mortality to mice was observed with this extract up to a dose of 4000 mg/kg. In conclusion, the A. muricata aqueous leaf extract exerted significant antimalarial activity with no toxicity and prolonged survival time. Therefore, this extract might contain potential lead molecule for the development of a new drug for malaria treatment.

  4. In Vivo Antimalarial Activity of Annona muricata Leaf Extract in Mice Infected with Plasmodium berghei

    PubMed Central

    Somsak, Voravuth; Polwiang, Natsuda; Chachiyo, Sukanya

    2016-01-01

    Malaria is one of the most important infectious diseases in the world. The choice for the treatment is highly limited due to drug resistance. Hence, finding the new compounds to treat malaria is urgently needed. The present study was attempted to evaluate the antimalarial activity of the Annona muricata aqueous leaf extract in Plasmodium berghei infected mice. Aqueous leaf extract of A. muricata was prepared and tested for acute toxicity in mice. For efficacy test in vivo, standard 4-day suppressive test was carried out. ICR mice were inoculated with 107 parasitized erythrocytes of P. berghei ANKA by intraperitoneal injection. The extracts (100, 500, and 1000 mg/kg) were then given orally by gavage once a day for 4 consecutive days. Parasitemia, percentage of inhibition, and packed cell volume were subsequently calculated. Chloroquine (10 mg/kg) was given to infected mice as positive control while untreated control was given only distilled water. It was found that A. muricata aqueous leaf extract at doses of 100, 500, and 1000 mg/kg resulted in dose dependent parasitemia inhibition of 38.03%, 75.25%, and 85.61%, respectively. Survival time was prolonged in infected mice treated with the extract. Moreover, no mortality to mice was observed with this extract up to a dose of 4000 mg/kg. In conclusion, the A. muricata aqueous leaf extract exerted significant antimalarial activity with no toxicity and prolonged survival time. Therefore, this extract might contain potential lead molecule for the development of a new drug for malaria treatment. PMID:27092277

  5. Antigen-dependent and -independent contributions to primary memory CD8 T cell activation and protection following infection.

    PubMed

    Martin, Matthew D; Badovinac, Vladimir P

    2015-12-10

    Memory CD8 T-cell activation, including expression of IFN-γ and granzymeB, can be induced by antigen (Ag)-dependent signals through the T-cell-receptor, or by pathogen-derived inflammatory cytokines in an Ag-independent manner. Recent studies have come to conflicting results regarding the contributions of Ag and/or inflammation to memory CD8 T-cell activation. Additionally, research has indicated that inflammation-driven CD8 T-cell responses during un-related infections (bystander activation) have the potential to provide protection, but whether protection occurs in immuno-competent hosts is unclear. To investigate these questions, we examined activation of virus-specific memory CD8 T-cells following infection with L. monocytogenes either expressing or not cognate Ag. We show that Ag and inflammation act synergistically in vitro to induce memory activation. In vivo, we found that when memory CD8 T-cells significantly contribute to clearance of infection, early activation and continued responses by these cells are enhanced by cognate Ag recognition. Mechanistically, we show that bystander responses by memory are dependent upon the dose of infection and the amount of inflammation elicited following infection and are able to provide protection in IFN-γ deficient mice, but not in immuno-competent hosts. The data elucidate the requirements for memory CD8 T-cell activation and the protective role of bystander responses.

  6. Antigen-dependent and –independent contributions to primary memory CD8 T cell activation and protection following infection

    PubMed Central

    Martin, Matthew D.; Badovinac, Vladimir P.

    2015-01-01

    Memory CD8 T-cell activation, including expression of IFN-γ and granzymeB, can be induced by antigen (Ag)-dependent signals through the T-cell-receptor, or by pathogen-derived inflammatory cytokines in an Ag-independent manner. Recent studies have come to conflicting results regarding the contributions of Ag and/or inflammation to memory CD8 T-cell activation. Additionally, research has indicated that inflammation-driven CD8 T-cell responses during un-related infections (bystander activation) have the potential to provide protection, but whether protection occurs in immuno-competent hosts is unclear. To investigate these questions, we examined activation of virus-specific memory CD8 T-cells following infection with L. monocytogenes either expressing or not cognate Ag. We show that Ag and inflammation act synergistically in vitro to induce memory activation. In vivo, we found that when memory CD8 T-cells significantly contribute to clearance of infection, early activation and continued responses by these cells are enhanced by cognate Ag recognition. Mechanistically, we show that bystander responses by memory are dependent upon the dose of infection and the amount of inflammation elicited following infection and are able to provide protection in IFN-γ deficient mice, but not in immuno-competent hosts. The data elucidate the requirements for memory CD8 T-cell activation and the protective role of bystander responses. PMID:26658291

  7. Inhibition of caspase-8 activity reduces IFN-gamma expression by T cells from Leishmania major infection.

    PubMed

    Pereira, Wânia F; Guillermo, Landi V C; Ribeiro-Gomes, Flávia L; Lopes, Marcela F

    2008-03-01

    Following infection with Leishmania major, T cell activation and apoptosis can be detected in draining lymph nodes of C57BL/6-infected mice. We investigated the mechanisms involved in apoptosis and cytokine expression following T cell activation. After two weeks of infection, apoptotic T cells were not detected in draining lymph nodes but activation with anti-CD3 induced apoptosis in both CD4 and CD8 T cells. Treatment with anti-Fas Ligand, caspase-8 or caspase- 9 inhibitors did not block activation-induced T-cell death. We also investigated whether the blockade of caspase-8 activity would affect the expression of type-1 or type-2 cytokines. At early stages of infection, both CD4 and CD8 T cells expressed IFN-gamma upon activation. Treatment with the caspase-8 inhibitor zIETD-fmk (benzyl-oxycarbonyl-Ile- Glu(OMe)-Thr-Asp(OMe)-fluoromethyl ketone) reduced the proportion of CD8 T cells and IFN-gamma expression in both CD4 and CD8 T cells. We conclude that a non apoptotic role of caspase-8 activity may be required for T cell-mediated type-1 responses during L. major infection.

  8. Signal Transducers and Activators of Transcription (STAT) Family Members in Helminth Infections

    PubMed Central

    Becerra-Díaz, Mireya; Valderrama-Carvajal, Héctor; Terrazas, Luis I.

    2011-01-01

    Helminth parasites are a diverse group of multicellular organisms. Despite their heterogeneity, helminths share many common characteristics, such as the modulation of the immune system of their hosts towards a permissive state that favors their development. They induce strong Th2-like responses with high levels of IL-4, IL-5 and IL-13 cytokines, and decreased production of proinflammatory cytokines such as IFN-γ. IL-4, IFN-γ and other cytokines bind with their specific cytokine receptors to trigger an immediate signaling pathway in which different tyrosine kinases (e.g. Janus kinases) are involved. Furthermore, a seven-member family of transcription factors named Signal Transducers and Activators of Transcription (STAT) that initiate the transcriptional activation of different genes are also involved and regulate downstream the JAK/STAT signaling pathway. However, how helminths avoid and modulate immune responses remains unclear; moreover, information concerning STAT-mediated immune regulation during helminth infections is scarce. Here, we review the research on mice deficient in STAT molecules, highlighting the importance of the JAK/STAT signaling pathway in regulating susceptibility and/or resistance in these infections. PMID:22110388

  9. Stress responses in flavivirus-infected cells: activation of unfolded protein response and autophagy

    PubMed Central

    Blázquez, Ana-Belén; Escribano-Romero, Estela; Merino-Ramos, Teresa; Saiz, Juan-Carlos; Martín-Acebes, Miguel A.

    2014-01-01

    The Flavivirus is a genus of RNA viruses that includes multiple long known human, animal, and zoonotic pathogens such as Dengue virus, yellow fever virus, West Nile virus, or Japanese encephalitis virus, as well as other less known viruses that represent potential threats for human and animal health such as Usutu or Zika viruses. Flavivirus replication is based on endoplasmic reticulum-derived structures. Membrane remodeling and accumulation of viral factors induce endoplasmic reticulum stress that results in activation of a cellular signaling response termed unfolded protein response (UPR), which can be modulated by the viruses for their own benefit. Concomitant with the activation of the UPR, an upregulation of the autophagic pathway in cells infected with different flaviviruses has also been described. This review addresses the current knowledge of the relationship between endoplasmic reticulum stress, UPR, and autophagy in flavivirus-infected cells and the growing evidences for an involvement of these cellular pathways in the replication and pathogenesis of these viruses. PMID:24917859

  10. Activation of peripheral blood mononuclear cells by dengue virus infection depotentiates balapiravir.

    PubMed

    Chen, Yen-Liang; Abdul Ghafar, Nahdiyah; Karuna, Ratna; Fu, Yilong; Lim, Siew Pheng; Schul, Wouter; Gu, Feng; Herve, Maxime; Yokohama, Fumiaki; Wang, Gang; Cerny, Daniela; Fink, Katja; Blasco, Francesca; Shi, Pei-Yong

    2014-02-01

    In a recent clinical trial, balapiravir, a prodrug of a cytidine analog (R1479), failed to achieve efficacy (reducing viremia after treatment) in dengue patients, although the plasma trough concentration of R1479 remained above the 50% effective concentration (EC(50)). Here, we report experimental evidence to explain the discrepancy between the in vitro and in vivo results and its implication for drug development. R1479 lost its potency by 125-fold when balapiravir was used to treat primary human peripheral blood mononuclear cells (PBMCs; one of the major cells targeted for viral replication) that were preinfected with dengue virus. The elevated EC(50) was greater than the plasma trough concentration of R1479 observed in dengue patients treated with balapiravir and could possibly explain the efficacy failure. Mechanistically, dengue virus infection triggered PBMCs to generate cytokines, which decreased their efficiency of conversion of R1479 to its triphosphate form (the active antiviral ingredient), resulting in decreased antiviral potency. In contrast to the cytidine-based compound R1479, the potency of an adenosine-based inhibitor of dengue virus (NITD008) was much less affected. Taken together, our results demonstrate that viral infection in patients before treatment could significantly affect the conversion of the prodrug to its active form; such an effect should be calculated when estimating the dose efficacious for humans.

  11. Dual Mode Antibacterial Activity of Ion Substituted Calcium Phosphate Nanocarriers for Bone Infections

    PubMed Central

    Sampath Kumar, T. S.; Madhumathi, K.; Rubaiya, Y.; Doble, Mukesh

    2015-01-01

    Nanotechnology has tremendous potential for the management of infectious diseases caused by multi-drug resistant bacteria, through the development of newer antibacterial materials and efficient modes of antibiotic delivery. Calcium phosphate (CaP) bioceramics are commonly used as bone substitutes due to their similarity to bone mineral and are widely researched upon for the treatment of bone infections associated with bone loss. CaPs can be used as local antibiotic delivery agents for bone infections and can be substituted with antibacterial ions in their crystal structure to have a wide spectrum, sustained antibacterial activity even against drug resistant bacteria. In the present work, a dual mode antibiotic delivery system with antibacterial ion substituted calcium deficient hydroxyapatite (CDHA) nanoparticles has been developed. Antibacterial ions such as zinc, silver, and strontium have been incorporated into CDHA at concentrations of 6, 0.25–0.75, and 2.5–7.5 at. %, respectively. The samples were found to be phase pure, acicular nanoparticles of length 40–50 nm and width 5–6 nm approximately. The loading and release profile of doxycycline, a commonly used antibiotic, was studied from the nanocarriers. The drug release was studied for 5 days and the release profile was influenced by the ion concentrations. The release of antibacterial ions was studied over a period of 21 days. The ion substituted CDHA samples were tested for antibacterial efficacy on Staphylococcus aureus and Escherichia coli by MIC/MBC studies and time-kill assay. AgCDHA and ZnCDHA showed high antibacterial activity against both bacteria, while SrCDHA was weakly active against S. aureus. Present study shows that the antibiotic release can provide the initial high antibacterial activity, and the sustained ion release can provide a long-term antibacterial activity. Such dual mode antibiotic and antibacterial ion release offers an efficient and potent way to treat an incumbent

  12. Platelet activation attracts a subpopulation of effector monocytes to sites of Leishmania major infection.

    PubMed

    Goncalves, Ricardo; Zhang, Xia; Cohen, Heather; Debrabant, Alain; Mosser, David M

    2011-06-01

    Leishmania species trigger a brisk inflammatory response and efficiently induce cell-mediated immunity. We examined the mechanisms whereby leukocytes were recruited into lesions after Leishmania major infection of mice. We found that a subpopulation of effector monocytes expressing the granulocyte marker GR1 (Ly6C) is rapidly recruited into lesions, and these monocytes efficiently kill L. major parasites. The recruitment of this subpopulation of monocytes depends on the chemokine receptor CCR2 and the activation of platelets. Activated platelets secrete platelet-derived growth factor, which induces the rapid release of CCL2 from leukocytes and mesenchymal cells. This work points to a new role for platelets in host defense involving the selective recruitment of a subpopulation of effector monocytes from the blood to efficiently kill this intracellular parasite.

  13. Antimicrobial activity of Arctium lappa constituents against microorganisms commonly found in endodontic infections.

    PubMed

    Pereira, Juliana Vianna; Bergamo, Débora Cristina Baldoqui; Pereira, José Odair; França, Suzelei de Castro; Pietro, Rosemeire Cristina Linhares Rodrigues; Silva-Sousa, Yara T Corrêa

    2005-01-01

    This study evaluated in vitro the antimicrobial activity of rough extracts from leaves of Arctium lappa and their phases. The following microorganisms, commonly found in the oral cavity, specifically in endodontic infections, were used: Enterococcus faecalis, Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis and Candida albicans. The agar-diffusion method allowed detection of the hexanic phase as an inhibitor of microbial growth. Bioautographic assays identified antimicrobial substances in the extract. The results showed the existence, in the rough hexanic phase and in its fractions, of constituents that have retention factors (Rf) in three distinct zones, thereby suggesting the presence of active constituents with chemical structures of different polarities that exhibited specificity against the target microorganisms. It may be concluded that the Arctium lappa constituents exhibited a great microbial inhibition potential against the tested endodontic pathogens.

  14. Measuring hospital-wide activity volume for patient safety and infection control: a multi-centre study in Japan

    PubMed Central

    Hayashida, Kenshi; Imanaka, Yuichi; Fukuda, Haruhisa

    2007-01-01

    Background In Japan, as in many other countries, several quality and safety assurance measures have been implemented since the 1990's. This has occurred in spite of cost containment efforts. Although government and hospital decision-makers demand comprehensive analysis of these activities at the hospital-wide level, there have been few studies that actually quantify them. Therefore, the aims of this study were to measure hospital-wide activities for patient safety and infection control through a systematic framework, and to identify the incremental volume of these activities implemented over the last five years. Methods Using the conceptual framework of incremental activity corresponding to incremental cost, we defined the scope of patient safety and infection control activities. We then drafted a questionnaire to analyze these realms. After implementing the questionnaire, we conducted several in-person interviews with managers and other staff in charge of patient safety and infection control in seven acute care teaching hospitals in Japan. Results At most hospitals, nurses and clerical employees acted as the main figures in patient safety practices. The annual amount of activity ranged from 14,557 to 72,996 person-hours (per 100 beds: 6,240; per 100 staff: 3,323) across participant hospitals. Pharmacists performed more incremental activities than their proportional share. With respect to infection control activities, the annual volume ranged from 3,015 to 12,196 person-hours (per 100 beds: 1,141; per 100 staff: 613). For infection control, medical doctors and nurses tended to perform somewhat more of the duties relative to their share. Conclusion We developed a systematic framework to quantify hospital-wide activities for patient safety and infection control. We also assessed the incremental volume of these activities in Japanese hospitals under the reimbursement containment policy. Government and hospital decision makers can benefit from this type of analytic

  15. Bovine viral diarrhea virus 2 infection activates the unfolded protein response in MDBK cells, leading to apoptosis.

    PubMed

    Maeda, Kouji; Fujihara, Masatoshi; Harasawa, Ryô

    2009-06-01

    Bovine viral diarrhea virus 2 (BVDV-2) strains are divided into cytopathic and non-cytopathic biotypes based on the ablity to induce cytopathic effects in cultured cells. The mechanism of cytopathogenicity of BVDV-2 is not well understood. We examined cytopathogenesis in MDBK cells resulting from BVDV-2 infections by microscopic examinations and microarray analysis. We found that BVDV-2 activates endoplasmic reticulum (ER) stress signaling pathways that contribute to apoptosis of infected cells. We also monitored the expression of ER stress marker gene by RT-PCR during BVDV-2 infection and demonstrated that infection of MDBK cells with a cytopathic strain of BVDV-2 induces glucose-regulated protein 78 expression. Infection with BVDV-2 also induces DNA-damage-inducible transcript 3 expression and downregulates the lectin-galactoside-binding soluble 1 level. These results show that cytopathic strains of BVDV-2 induce an ER stress response resulting in apoptosis.

  16. Early surgery for hospital-acquired and community-acquired active infective endocarditis.

    PubMed

    Shibata, Toshihiko; Sasaki, Yasuyuki; Hirai, Hidekazu; Fukui, Toshihiro; Hosono, Mitsuharu; Suehiro, Shigefumi

    2007-06-01

    Active infective endocarditis (IE) is classified into two groups; hospital acquired IE (HIE) and IE other than HIE, which was defined as community-acquired IE (CIE). Eighty-two patients underwent surgical treatment for active IE. Seventy-one cases were CIE group and eleven were HIE. There were six patients with native valve endocarditis and five cases of prosthetic valve endocarditis in the HIE group. We compared the surgical outcome of both types of active IE retrospectively. The preoperative status of the patients in the HIE group was more critical than that in the CIE group. Streptococcus spp. were the major micro-organisms in the CIE group (39%), while 82% of the HIE cases were caused by Staphylococcus spp. All Staphylococcus organisms in the HIE group were methicillin resistant. There were 10 hospital deaths, three in the CIE group and seven in the HIE group. Operative mortality in the HIE group was significantly higher than in the CIE group (63.6% vs. 4.2%, P<0.001). The outcome of early operation was satisfactory for active CIE, but poor for HIE. These types of active IE should be considered separately.

  17. Gene-expression reversal of lncRNAs and associated mRNAs expression in active vs latent HIV infection

    PubMed Central

    Nair, Madhavan; Sagar, Vidya; Pilakka-Kanthikeel, Sudheesh

    2016-01-01

    Interplay between lncRNAs and mRNAs is rapidly emerging as a key epigenetic mechanism in controlling various cell functions. HIV can actively infect and/or can persist latently for years by manipulating host epigenetics; however, its molecular essence remains undiscovered in entirety. Here for the first time, we delineate the influence of HIV on global lncRNAs expression in monocytic cells lines. Our analysis revealed the expression modulation of nearly 1060 such lncRNAs which are associated with differentially expressed mRNAs in active and latent infection. This suggests a greater role of lncRNAs in regulating transcriptional and post-transcriptional gene expression during HIV infection. The differentially expressed mRNAs were involved in several different biological pathways where immunological networks were most enriched. Importantly, we discovered that HIV induces expression reversal of more than 150 lncRNAs between its active and latent infection. Also, hundreds of unique lncRNAs were identified in both infection conditions. The pathology specific “gene-expression reversal” and “on-and-off” switching of lncRNAs and associated mRNAs may lead to establish the relationship between active and HIV infection. PMID:27756902

  18. Exhaustion of Activated CD8 T Cells Predicts Disease Progression in Primary HIV-1 Infection

    PubMed Central

    Hickling, Stephen; Hurst, Jacob; Meyerowitz, Jodi; Willberg, Christian B.; Robinson, Nicola; Brown, Helen; Kinloch, Sabine; Babiker, Abdel; Nwokolo, Nneka; Fox, Julie; Fidler, Sarah; Phillips, Rodney; Frater, John

    2016-01-01

    The rate at which HIV-1 infected individuals progress to AIDS is highly variable and impacted by T cell immunity. CD8 T cell inhibitory molecules are up-regulated in HIV-1 infection and associate with immune dysfunction. We evaluated participants (n = 122) recruited to the SPARTAC randomised clinical trial to determine whether CD8 T cell exhaustion markers PD-1, Lag-3 and Tim-3 were associated with immune activation and disease progression. Expression of PD-1, Tim-3, Lag-3 and CD38 on CD8 T cells from the closest pre-therapy time-point to seroconversion was measured by flow cytometry, and correlated with surrogate markers of HIV-1 disease (HIV-1 plasma viral load (pVL) and CD4 T cell count) and the trial endpoint (time to CD4 count <350 cells/μl or initiation of antiretroviral therapy). To explore the functional significance of these markers, co-expression of Eomes, T-bet and CD39 was assessed. Expression of PD-1 on CD8 and CD38 CD8 T cells correlated with pVL and CD4 count at baseline, and predicted time to the trial endpoint. Lag-3 expression was associated with pVL but not CD4 count. For all exhaustion markers, expression of CD38 on CD8 T cells increased the strength of associations. In Cox models, progression to the trial endpoint was most marked for PD-1/CD38 co-expressing cells, with evidence for a stronger effect within 12 weeks from confirmed diagnosis of PHI. The effect of PD-1 and Lag-3 expression on CD8 T cells retained statistical significance in Cox proportional hazards models including antiretroviral therapy and CD4 count, but not pVL as co-variants. Expression of ‘exhaustion’ or ‘immune checkpoint’ markers in early HIV-1 infection is associated with clinical progression and is impacted by immune activation and the duration of infection. New markers to identify exhausted T cells and novel interventions to reverse exhaustion may inform the development of novel immunotherapeutic approaches. PMID:27415828

  19. Exhaustion of Activated CD8 T Cells Predicts Disease Progression in Primary HIV-1 Infection.

    PubMed

    Hoffmann, Matthias; Pantazis, Nikos; Martin, Genevieve E; Hickling, Stephen; Hurst, Jacob; Meyerowitz, Jodi; Willberg, Christian B; Robinson, Nicola; Brown, Helen; Fisher, Martin; Kinloch, Sabine; Babiker, Abdel; Weber, Jonathan; Nwokolo, Nneka; Fox, Julie; Fidler, Sarah; Phillips, Rodney; Frater, John

    2016-07-01

    The rate at which HIV-1 infected individuals progress to AIDS is highly variable and impacted by T cell immunity. CD8 T cell inhibitory molecules are up-regulated in HIV-1 infection and associate with immune dysfunction. We evaluated participants (n = 122) recruited to the SPARTAC randomised clinical trial to determine whether CD8 T cell exhaustion markers PD-1, Lag-3 and Tim-3 were associated with immune activation and disease progression. Expression of PD-1, Tim-3, Lag-3 and CD38 on CD8 T cells from the closest pre-therapy time-point to seroconversion was measured by flow cytometry, and correlated with surrogate markers of HIV-1 disease (HIV-1 plasma viral load (pVL) and CD4 T cell count) and the trial endpoint (time to CD4 count <350 cells/μl or initiation of antiretroviral therapy). To explore the functional significance of these markers, co-expression of Eomes, T-bet and CD39 was assessed. Expression of PD-1 on CD8 and CD38 CD8 T cells correlated with pVL and CD4 count at baseline, and predicted time to the trial endpoint. Lag-3 expression was associated with pVL but not CD4 count. For all exhaustion markers, expression of CD38 on CD8 T cells increased the strength of associations. In Cox models, progression to the trial endpoint was most marked for PD-1/CD38 co-expressing cells, with evidence for a stronger effect within 12 weeks from confirmed diagnosis of PHI. The effect of PD-1 and Lag-3 expression on CD8 T cells retained statistical significance in Cox proportional hazards models including antiretroviral therapy and CD4 count, but not pVL as co-variants. Expression of 'exhaustion' or 'immune checkpoint' markers in early HIV-1 infection is associated with clinical progression and is impacted by immune activation and the duration of infection. New markers to identify exhausted T cells and novel interventions to reverse exhaustion may inform the development of novel immunotherapeutic approaches. PMID:27415828

  20. Early Activation of Teleost B Cells in Response to Rhabdovirus Infection

    PubMed Central

    Abós, Beatriz; Castro, Rosario; González Granja, Aitor; Havixbeck, Jeffrey J.; Barreda, Daniel R.

    2014-01-01

    ABSTRACT To date, the response of teleost B cells to specific pathogens has been only scarcely addressed. In this work, we have demonstrated that viral hemorrhagic septicemia virus (VHSV), a fish rhabdovirus, has the capacity to infect rainbow trout spleen IgM-positive (IgM+) cells, although the infection is not productive. Consequently, we have studied the effects of VHSV on IgM+ cell functionality, comparing these effects to those elicited by a Toll-like receptor 3 (TLR3) ligand, poly(I·C). We found that poly(I·C) and VHSV significantly upregulated TLR3 and type I interferon (IFN) transcription in spleen and blood IgM+ cells. Further effects included the upregulated transcription of the CK5B chemokine. The significant inhibition of some of these effects in the presence of bafilomycin A1 (BAF), an inhibitor of endosomal acidification, suggests the involvement of an intracellular TLR in these responses. In the case of VHSV, these transcriptional effects were dependent on viral entry into B cells and the initiation of viral transcription. VHSV also provoked the activation of NF-κB and the upregulation of major histocompatibility complex class II (MHC-II) cell surface expression on IgM+ cells, which, along with the increased transcription of the costimulatory molecules CD80/86 and CD83, pointed to VHSV-induced IgM+ cell activation toward an antigen-presenting profile. Finally, despite the moderate effects of VHSV on IgM+ cell proliferation, a consistent effect on IgM+ cell survival was detected. IMPORTANCE Innate immune responses to pathogens established through their recognition by pattern recognition receptors (PRRs) have been traditionally ascribed to innate cells. However, recent evidence in mammals has revealed that innate pathogen recognition by B lymphocytes is a crucial factor in shaping the type of immune response that is mounted. In teleosts, these immediate effects of viral encounter on B lymphocytes have not been addressed to date. In our study, we

  1. Double-stranded RNA-activated protein kinase regulates early innate immune responses during respiratory syncytial virus infection.

    PubMed

    Minor, Radiah A Corn; Limmon, Gino V; Miller-DeGraff, Laura; Dixon, Darlene; Andrews, Danica M K; Kaufman, Randal J; Imani, Farhad

    2010-04-01

    Respiratory syncytial virus (RSV) is the most common cause of childhood viral bronchiolitis and lung injury. Inflammatory responses significantly contribute to lung pathologies during RSV infections and bronchiolitis but the exact mechanisms have not been completely defined. The double-stranded RNA-activated protein kinase (PKR) functions to inhibit viral replication and participates in several signaling pathways associated with innate inflammatory immune responses. Using a functionally defective PKR (PKR(-/-)) mouse model, we investigated the role of this kinase in early events of RSV-induced inflammation. Our data showed that bronchoalveolar lavage (BAL) fluid from infected PKR(-/-) mice had significantly lower levels of several innate inflammatory cytokines and chemokines. Histological examinations revealed that there was less lung injury in infected PKR(-/-) mice as compared to the wild type. A genome-wide analysis showed that several early antiviral and immune regulatory genes were affected by PKR activation. These data suggest that PKR is a signaling molecule for immune responses during RSV infections.

  2. Incident and recurrent Chlamydia trachomatis and Neisseria gonorrhoeae infections, active component, U.S. Armed Forces, 2010-2014.

    PubMed

    Owings, Alfred J; Clark, Leslie L; Rohrbeck, Patricia

    2016-02-01

    Chlamydia trachomatis and Neisseria gonorrhoeae infections impose a significant clinical and public health burden on the Military Health System. Repeat infections contribute significantly to that burden. This report summarizes rates and relative risks of true incident (i.e., initial or "first time ever") and recurrent (i.e., repeat) chlamydia and gonorrhea infections among active component members between 1 January 2010 and 31 December 2014. During the surveillance period, a total of 66,396 initial chlamydia and 9,138 initial gonorrhea cases were diagnosed. Annual crude rates of initial chlamydia infections increased by 23%. Crude rates of initial gonorrhea infections remained stable overall, but female rates decreased by 28.3% over the period. Among the incident cohorts, 11,699 cases of repeat chlamydia, and 1,138 cases of repeat gonorrhea were diagnosed over the period, accounting for 15.0% and 11.1% of overall cohort chlamydia and gonorrhea infections, respectively. The Army branch, those aged 17-19 years, females, non-Hispanic black service members, junior enlisted ranks, and single/never-married service members had the highest crude rates of initial chlamydia and gonorrhea infection, and (single/never-married service members excepted) highest adjusted relative risk of repeat chlamydia infection. PMID:26930148

  3. Evaluating sludge minimization caused by predation and viral infection based on the extended activated sludge model No. 2d.

    PubMed

    Hao, Xiaodi; Wang, Qilin; Cao, Yali; van Loosdrecht, Mark C M

    2011-10-15

    The Activated Sludge Model No. 2d (ASM2d) was extended to incorporate the processes of both predation and viral infection. The extended model was used to evaluate the contributions of predation and viral infection to sludge minimization in a sequencing batch reactor (SBR) system enriching polyphosphate-accumulating organisms (PAOs). Three individual decay processes formulated according to the general model rules were used in the extended model. The model was firstly calibrated and validated by different experimental results. It was used to evaluate the potential extent of predation and viral infection on sludge minimization. Simulations indicate that predation contributes roughly two times more to sludge minimization than viral infection in the SBR system enriching PAOs. The sensitivity analyses of the selected key parameters reveal that there are thresholds on both predation and viral infection rates, if they are too large a minimal sludge retention time is obtained and the effluent quality is deteriorating. Due to the thresholds, the contributions of predation and viral infection to sludge minimization are limited to a maximal extent of about 21% and 9%, respectively. However, it should be noted that the parameters concerning predation and viral infection were not calibrated separately by independent experiment in our study due to the lack of an effective method, especially for the parameters regarding viral infection. Therefore, it is essential to better evaluate these parameters in the future.

  4. Enhanced resistance against Listeria monocytogenes at an early phase of primary infection in pregnant mice: activation of macrophages during pregnancy.

    PubMed Central

    Watanabe, Y; Mitsuyama, M; Sano, M; Nakano, H; Nomoto, K

    1986-01-01

    We investigated the pregnancy-induced changes in macrophage activity which are important in the expression of host defense against infections. Several macrophage functions were examined by using Listeria monocytogenes. In pregnant mice, prolonged survival and enhanced in vivo elimination of bacteria were observed in the early phase of primary infection. Functions of peritoneal macrophages, including in vitro phagocytosis intracellular killing, glucose consumption, generation of superoxide anion, and intracellular beta-glucuronidase activity were shown to be enhanced in pregnant mice. These findings indicate that pregnancy enhances macrophage functions qualitatively. Possible mechanisms for this enhancement and the significance of macrophage activation for pregnant hosts are discussed. PMID:3011673

  5. Assessment of the diagnostic efficacy of enolase as an indication of active infection of Schistosoma japonicum.

    PubMed

    Gao, Hong; Xiao, Di; Song, Lijun; Zhang, Wei; Shen, Shuang; Yin, Xuren; Wang, Jie; Ke, Xuedan; Yu, Chuanxin; Zhang, Jianzhong

    2016-01-01

    Schistosomiasis is a common zoonoses affecting humans. The atypical clinical symptoms, low morbidity, and low degree of infection impede diagnosis and assessment of epidemics. Detecting circulating antigens from adult worms in patients' body fluids should be diagnostically superior to examining eggs in feces. Herein, the excretory-secretory proteins of adult worms were analyzed by using 2-D protein electrophoresis and mass spectrometry. The Schistosoma japonicum enolase (Sj enolase) was identified as the most abundant excretory-secretory antigen. Purified recombinant Sj enolase was prepared, and specific monoclonal and polyclonal antibodies were raised against it. A sandwich enzyme-linked immunoassay (sandwich ELISA) was established that used the monoclonal antibody as a capture antibody and the polyclonal antibody as a detection antibody. The linear detection range was 0.7-1000 ng/ml (minimum 700 pg/ml). Sj enolase could be detected in the sera of infected rabbits and disappeared rapidly postpraziquantel treatment. The sensitivity and specificity of this sandwich ELISA to detect field serum samples of schistosomiasis were 84.61 and 95.83 %, respectively. The cross-reaction rates for clonorchiasis and paragonimiasis were 3.33 and 5 %, respectively. This ELISA assay was used to test 45 matching sera of schistosomiasis patients before treatment and at 3, 6, 9, and 12 months posttreatment. Among the sera, 88.89 % were positive before treatment. At 3, 6, 9, and 12 months postpraziquantel treatment, 93.33, 97.78, 100, and 100 % tested negative, respectively. Therefore, Sj enolase can be used to indicate active Schistosoma infection, and detecting serum Sj enolase is important for diagnosis and evaluating treatment effect. PMID:26420425

  6. BK virus infection activates the TNFα/TNF receptor system in Polyomavirus-associated nephropathy.

    PubMed

    Ribeiro, Andrea; Merkle, Monika; Motamedi, Nasim; Nitschko, Hans; Köppel, Simone; Wörnle, Markus

    2016-01-01

    Polyomavirus-associated nephropathy due to BK virus infection (BKVAN) is recognized as an important cause of significant kidney transplant dysfunction often leading to renal graft loss. The activation of innate immune defense mechanisms during BKVAN is still poorly understood and an altered regulation of inflammatory mediators by resident kidney cells upon viral infection can be expected to contribute to the onset and progression of disease. TNFα interacting with its receptors, TNF receptor 1 (TNFR1) and TNF receptor 2 (TNFR2), is largely accepted to be involved in viral responses, exhibiting both proinflammatory and immunosuppressive effects. Our aim was to examine the expressions of TNFα and TNFR1 and 2 in human collecting duct epithelial cells (HCDC) after infection with BKV as well as to study the effect of TNFα and poly(I:C), a synthetic analog of viral RNA, on the expressions of TNF receptors and proinflammatory cytokines and chemokines in HCDC. Quantitative RT-PCR analyses showed a downregulation of TNFα and an upregulation of both TNFR1 and 2 upon exposure of HCDC to the BK virus. TNFα stimulation induced the expressions of IL-6, IL-8, RANTES, and TNFR2. Poly(I:C) upregulated the expressions of both TNFR1 and TNFR2, a response that could be effectively blocked by siRNA to TLR3 and RIG-I, two double-stranded (ds) RNA receptors of the innate immune system. Poly(I:C)-dependent expression of TNFR2 but not TNFR1 was enhanced by TNFα. Taken together, our results suggest an involvement of TNF/TNFR system in virus-associated nephropathy.

  7. Highly Active Antiretroviral Therapy and Adverse Birth Outcomes Among HIV-Infected Women in Botswana

    PubMed Central

    Chen, Jennifer Y.; Ribaudo, Heather J.; Souda, Sajini; Parekh, Natasha; Ogwu, Anthony; Lockman, Shahin; Powis, Kathleen; Dryden-Peterson, Scott; Creek, Tracy; Jimbo, William; Madidimalo, Tebogo; Makhema, Joseph; Essex, Max; Shapiro, Roger L

    2012-01-01

    Background. It is unknown whether adverse birth outcomes are associated with maternal highly active antiretroviral therapy (HAART) in pregnancy, particularly in resource-limited settings. Methods. We abstracted obstetrical records at 6 sites in Botswana for 24 months. Outcomes included stillbirths (SBs), preterm delivery (PTD), small for gestational age (SGA), and neonatal death (NND). Among human immunodeficiency virus (HIV)–infected women, comparisons were limited to HAART exposure status at conception, and those with similar opportunities for outcomes. Comparisons were adjusted for CD4+ lymphocyte cell count. Results. Of 33 148 women, 32 113 (97%) were tested for HIV, of whom 9504 (30%) were HIV infected. Maternal HIV was significantly associated with SB, PTD, SGA, and NND. Compared with all other HIV-infected women, those continuing HAART from before pregnancy had higher odds of PTD (adjusted odds ratio [AOR], 1.2; 95% confidence interval [CI], 1.1, 1.4), SGA (AOR, 1.8; 95% CI, 1.6, 2.1) and SB (AOR, 1.5; 95% CI, 1.2, 1.8). Among women initiating antiretroviral therapy in pregnancy, HAART use (vs zidovudine) was associated with higher odds of PTD (AOR, 1.4; 95% CI, 1.2, 1.8), SGA (AOR, 1.5; 95% CI, 1.2, 1.9), and SB (AOR, 2.5; 95% CI, 1.6, 3.9). Low CD4+ was independently associated with SB and SGA, and maternal hypertension during pregnancy with PTD, SGA, and SB. Conclusions. HAART receipt during pregnancy was associated with increased PTD, SGA, and SB. PMID:23066160

  8. Endothelial cell permeability during hantavirus infection involves factor XII-dependent increased activation of the kallikrein-kinin system.

    PubMed

    Taylor, Shannon L; Wahl-Jensen, Victoria; Copeland,