Science.gov

Sample records for active metal oxo

  1. Late transition metal. mu. -oxo and. mu. -imido complexes

    SciTech Connect

    Sharp, P.R.

    1990-01-01

    The synthesis and reactions of late-transition-metal oxo and imido complexes was explored. The deprotonation of platinum(II) hydroxo complexes yielded new oxo complexes. Attempted deprotonation of Cp*Rh(III) hydroxo complexes did not give oxo complexes but complex mixtures probably resulting from reduction of the Rh(III) center. The reaction of Na/Hg with (Cp*RhCl{sub 2}){sub 2} gave the very reactive Rh(II) dimer, (Cp*RhCl){sub 2}. Rhodium(I) imido complexes with the bis(dimethylphosphino)methane ligand were prepared and found to be similar to the previously prepared bis(diphenylphosphino)methane complexes. Attempts to prepare bis(diphenylphosphino)methylamine, bis(diphenylphosphino)phenylamine, PMe{sub e} and NO{sup +} analogues were not successful. Attempts to prepare Cp*Rh(III) imido complexes resulted in amido complexes and reduction. Rhodium (III) tris(3.5-dimethylpyrazoyl)borate analogues are reduction resistant but have not yet yielded imido complexes. The first imido complexes of Au were prepared by treating a Au oxo complex with amines or isocyanates. Dimeric Cp*Rh dioxygen and nitrosobenzene complexes were prepared by insertion into the Rh-Rh bond of (Cp*RhCl){sub 2}. The dioxygen complex activates a C-H bond of the Cp* ligand on treatment with PMe{sub 3}. Imido and oxo complexes nitrene and oxygen atom transfer product in reactions with CO. A novel electrophilic ring addition was observed with sterically protected aryl imido complexes. 15 refs.

  2. A Mononuclear Non-Heme Manganese(IV)-Oxo Complex Binding Redox-Inactive Metal Ions

    SciTech Connect

    Chen, Junying; Lee, Yong-Min; Davis, Katherine M.; Wu, Xiujuan; Seo, Mi Sook; Cho, Kyung-Bin; Yoon, Heejung; Park, Young Jun; Fukuzumi, Shunichi; Pushkar, Yulia N.; Nam, Wonwoo

    2013-05-29

    Redox-inactive metal ions play pivotal roles in regulating the reactivities of high-valent metal–oxo species in a variety of enzymatic and chemical reactions. A mononuclear non-heme Mn(IV)–oxo complex bearing a pentadentate N5 ligand has been synthesized and used in the synthesis of a Mn(IV)–oxo complex binding scandium ions. The Mn(IV)–oxo complexes were characterized with various spectroscopic methods. The reactivities of the Mn(IV)–oxo complex are markedly influenced by binding of Sc3+ ions in oxidation reactions, such as a ~2200-fold increase in the rate of oxidation of thioanisole (i.e., oxygen atom transfer) but a ~180-fold decrease in the rate of C–H bond activation of 1,4-cyclohexadiene (i.e., hydrogen atom transfer). The present results provide the first example of a non-heme Mn(IV)–oxo complex binding redox-inactive metal ions that shows a contrasting effect of the redox-inactive metal ions on the reactivities of metal–oxo species in the oxygen atom transfer and hydrogen atom transfer reactions.

  3. C-H Oxidation by Platinum Group Metal Oxo or Peroxo Species

    SciTech Connect

    Zhou, Meng; Crabtree, Robert H

    2011-01-01

    While C–H oxidation by ruthenium oxo compounds has been broadly applied in organic synthesis, examples of C–H oxidation by metal oxo complexes from the rest of the platinum group are still rare. We survey the preparation and reactivity of these late-transition metal oxo and peroxo complexes in this tutorial review.

  4. Laser Flash Photolysis Generation of High-Valent Transition Metal-Oxo Species: Insights from Kinetic Studies in Real Time

    PubMed Central

    Zhang, Rui; Newcomb, Martin

    2010-01-01

    Conspectus High-valent transition metal-oxo species are active oxidizing species in many metal-catalyzed oxidation reactions in both Nature and the laboratory. In homogeneous catalytic oxidations, a transition metal catalyst is oxidized to a metal-oxo species by a sacrificial oxidant, and the activated transition metal-oxo intermediate oxidizes substrates. Mechanistic studies of these oxidizing species can provide insights for understanding commercially important catalytic oxidations and the oxidants in cytochrome P450 enzymes. In many cases, however, the transition metal oxidants are so reactive that they do not accumulate to detectable levels in mixing experiments, which have millisecond mixing times, and successful generation and direct spectroscopic characterization of these highly reactive transients remain a considerable challenge. Our strategy for understanding homogeneous catalysis intermediates employs photochemical generation of the transients with spectroscopic detection on time-scales as short as nanoseconds and direct kinetic studies of their reactions with substrates by laser flash photolysis (LFP) methods. This Account describes studies of high-valent manganese- and iron-oxo intermediates. Irradiation of porphyrin-manganese(III) nitrates and chlorates or corrole-manganese(IV) chlorates resulted in homolytic cleavage of the O-X bonds in the ligands, whereas irradiation of porphyrin-manganese(III) perchlorates resulted in heterolytic cleavage of O-Cl bonds to give porphyrin-manganese(V)-oxo cations. Similar reactions of corrole- and porphyrin-iron(IV) complexes gave highly reactive transients that were tentatively identified as macrocyclic ligand-iron(V)-oxo species. Kinetic studies demonstrated high reactivity of the manganese(V)-oxo species, and even higher reactivities of the putative iron(V)-oxo transients. For example, second-order rate constants for oxidations of cis-cyclooctene at room temperature were 6 × 103 M−1 s−1 for a corrole-iron(V)-oxo

  5. Metal-Ligand Misfits: Facile Access to Rhenium-Oxo Corroles by Oxidative Metalation.

    PubMed

    Einrem, Rune F; Gagnon, Kevin J; Alemayehu, Abraham B; Ghosh, Abhik

    2016-01-11

    With the exception of a single accidental synthesis, rhenium corroles are unknown, but of great interest as catalysts and potential radiopharmaceuticals. Oxidative metalation of meso-triarylcorroles with [Re2 (CO)10 ] in refluxing decalin has provided a facile and relatively high-yielding route to rhenium(V)-oxo corroles. The complexes synthesized could all be fully characterized by single-crystal X-ray structure analyses. PMID:26639951

  6. Oxidation Reactions with Bioinspired Mononuclear Non-Heme Metal-Oxo Complexes.

    PubMed

    Engelmann, Xenia; Monte-Pérez, Inés; Ray, Kallol

    2016-06-27

    The selective functionalization of strong C-H bonds and the oxidation of water by cheap and nontoxic metals are some of the key targets of chemical research today. It has been proposed that high-valent iron-, manganese-, and copper-oxo cores are involved as reactive intermediates in important oxidation reactions performed by biological systems, thus making them attractive targets for biomimetic synthetic studies. The generation and characterization of metal-oxo model complexes of iron, manganese, and copper together with detailed reactivity studies can help in understanding how the steric and electronic properties of the metal centers modulate the reactivity of the metalloenzymes. This Review provides a focused overview of the advances in the chemistry of biomimetic high-valent metal-oxo complexes from the last 5-10 years that can be related to our understanding of biological systems. PMID:27311082

  7. Transition-Metal Oxos as the Lewis Basic Component of Frustrated Lewis Pairs.

    PubMed

    Lambic, Nikola S; Sommer, Roger D; Ison, Elon A

    2016-04-13

    The reaction of oxorhenium complexes that incorporate diamidopyridine (DAP) ligands with B(C6F5)3 results in the formation of classical Lewis acid-base adducts. The adducts effectively catalyze the hydrogenation of a variety of unactivated olefins at 100 °C. Control reactions with these complexes or B(C6F5)3 alone did not yield any hydrogenated products under these conditions. Mechanistic studies suggest a frustrated Lewis pair is generated between the oxorhenium DAP complexes and B(C6F5)3, which is effective at olefin hydrogenation. Thus, we demonstrate for the first time that the incorporation of a transition-metal oxo in a frustrated Lewis pair can have a synergistic effect and results in enhanced catalytic activity. PMID:27002927

  8. A Manganese(V)-Oxo Complex: Synthesis by Dioxygen Activation and Enhancement of Its Oxidizing Power by Binding Scandium Ion.

    PubMed

    Hong, Seungwoo; Lee, Yong-Min; Sankaralingam, Muniyandi; Vardhaman, Anil Kumar; Park, Young Jun; Cho, Kyung-Bin; Ogura, Takashi; Sarangi, Ritimukta; Fukuzumi, Shunichi; Nam, Wonwoo

    2016-07-13

    A mononuclear non-heme manganese(V)-oxo complex, [Mn(V)(O)(TAML)](-) (1), was synthesized by activating dioxygen in the presence of olefins with weak allylic C-H bonds and characterized structurally and spectroscopically. In mechanistic studies, the formation rate of 1 was found to depend on the allylic C-H bond dissociation energies (BDEs) of olefins, and a kinetic isotope effect (KIE) value of 16 was obtained in the reactions of cyclohexene and cyclohexene-d10. These results suggest that a hydrogen atom abstraction from the allylic C-H bonds of olefins by a putative Mn(IV)-superoxo species, which is formed by binding O2 by a high-spin (S = 2) [Mn(III)(TAML)](-) complex, is the rate-determining step. A Mn(V)-oxo complex binding Sc(3+) ion, [Mn(V)(O)(TAML)](-)-(Sc(3+)) (2), was also synthesized in the reaction of 1 with Sc(3+) ion and then characterized using various spectroscopic techniques. The binding site of the Sc(3+) ion was proposed to be the TAML ligand, not the Mn-O moiety, probably due to the low basicity of the oxo group compared to the basicity of the amide carbonyl group in the TAML ligand. Reactivity studies of the Mn(V)-oxo intermediates, 1 and 2, in oxygen atom transfer and electron-transfer reactions revealed that the binding of Sc(3+) ion at the TAML ligand of Mn(V)-oxo enhanced its oxidizing power with a positively shifted one-electron reduction potential (ΔEred = 0.70 V). This study reports the first example of tuning the second coordination sphere of high-valent metal-oxo species by binding a redox-inactive metal ion at the supporting ligand site, thereby modulating their electron-transfer properties as well as their reactivities in oxidation reactions. PMID:27310336

  9. Heterometallic Triiron-Oxo/Hydroxo Clusters: Effect of Redox-Inactive Metals

    PubMed Central

    Herbert, David E.; Lionetti, Davide; Rittle, Jonathan; Agapie, Theodor

    2014-01-01

    A series of tetranuclear oxo/hydroxo clusters comprised of three Fe centers and a redox-inactive metal (M) of various charge is reported. Crystallographic studies show an unprecedented Fe3M(μ4-O)(μ2-OH) core that remains intact upon changing M or the oxidation state of iron. Electrochemical studies reveal that the reduction potentials (E1/2) span a window of 500 mV and depend upon the Lewis acidity of M. Using the pKa of the redox-inactive metal aqua complex as a measure of Lewis acidity, these compounds display a linear dependence between E1/2 and acidity with a slope of ca. 70 mV per pKa unit. The current study of [Fe3MO(OH)] and previous ones of [Mn3MOn] (n = 2, 4) moieties support the generality of the above relationship between the reduction potentials of heterometallic oxido clusters and the Lewis acidity of incorporated cations, as applied to clusters of different redox-active metals. PMID:24304416

  10. Metal-catalyzed oxidation of 2-alkenals generates genotoxic 4-oxo-2-alkenals during lipid peroxidation.

    PubMed

    Nuka, Erika; Tomono, Susumu; Ishisaka, Akari; Kato, Yoji; Miyoshi, Noriyuki; Kawai, Yoshichika

    2016-10-01

    Lipid peroxidation products react with cellular molecules, such as DNA bases, to form covalent adducts, which are associated with aging and disease processes. Since lipid peroxidation is a complex process and occurs in multiple stages, there might be yet unknown reaction pathways. Here, we analyzed comprehensively 2'-deoxyguanosine (dG) adducts with oxidized arachidonic acid using liquid chromatography-tandem mass spectrometry and found the formation of 7-(2-oxo-hexyl)-etheno-dG as one of the major unidentified adducts. The formation of this adduct was reproduced in the reaction of dG with 2-octenal and predominantly with 4-oxo-2-octenal (OOE). We also found that other 2-alkenals (with five or more carbons) generate corresponding 4-oxo-2-alkenal-type adducts. Importantly, it was found that transition metals enhanced the oxidation of C4-position of 2-octenal, leading to the formation of OOE-dG adduct. These findings demonstrated a new pathway for the formation of 4-oxo-2-alkenals during lipid peroxidation and might provide a mechanism for metal-catalyzed genotoxicity. PMID:27281652

  11. Heterometallic triiron-oxo/hydroxo clusters: effect of redox-inactive metals.

    PubMed

    Herbert, David E; Lionetti, Davide; Rittle, Jonathan; Agapie, Theodor

    2013-12-26

    A series of tetranuclear oxo/hydroxo clusters comprised of three Fe centers and a redox-inactive metal (M) of various charge is reported. Crystallographic studies show an unprecedented Fe3M(μ4-O)(μ2-OH) core that remains intact upon changing M or the oxidation state of iron. Electrochemical studies reveal that the reduction potentials (E1/2) span a window of 500 mV and depend upon the Lewis acidity of M. Using the pKa of the M-aqua complex as a measure of Lewis acidity, these compounds display a linear dependence between E1/2 and acidity, with a slope of ∼70 mV per pKa unit. The current study of [Fe3MO(OH)] and previous ones of [Mn3MOn] (n = 2,4) moieties support the generality of the above relationship between the reduction potentials of heterometallic oxido clusters and the Lewis acidity of incorporated cations, as applied to clusters of different redox-active metals. PMID:24304416

  12. Facile synthesis and quantitative structure-activity relationship study of antitumor active 2-(4-oxo-thiazolidin-2-ylidene)-3-oxo-propionitriles.

    PubMed

    Hanna, Mona Maurice; George, Riham François

    2012-01-01

    2-(5-Arylidene-4-oxo-3-phenyl-thiazolidin-2-ylidene)-3-oxo-propionitriles 4a-j were prepared via condensation of aromatic aldehydes with 4-thiazolidinones 3a,b. The latter was obtained via electrophilic attack of phenylisothiocyanate on 3-oxo-propionitriles 1a,b followed by reaction with chloroacetyl chloride under basic condition. Additionally, 2-(5-heteroalicyclic methylene) analogues 5a-h were prepared via Mannich reaction of the appropriate secondary amines and formaldehyde with 4-thiazolidinones 3a,b. Many of the synthesized compounds exhibited promising antitumor properties against colon HCT116 and breast T47D cell lines. 3D-Pharmacophore modeling and quantitative structure-activity relationship (QSAR) analysis were combined to explain the observed antitumor properties. PMID:22976330

  13. Structural requirements for activation of the 5-oxo-6E,8Z, 11Z,14Z-eicosatetraenoic acid (5-oxo-ETE) receptor: identification of a mead acid metabolite with potent agonist activity.

    PubMed

    Patel, Pranav; Cossette, Chantal; Anumolu, Jaganmohan R; Gravel, Sylvie; Lesimple, Alain; Mamer, Orval A; Rokach, Joshua; Powell, William S

    2008-05-01

    The 5-lipoxygenase product 5-oxo-6E,8Z,11Z,14Z-eicosatetraenoic acid (5-oxo-ETE) is a potent chemoattractant for neutrophils and eosinophils, and its actions are mediated by the oxoeicosanoid (OXE) receptor, a member of the G protein-coupled receptor family. To define the requirements for activation of the OXE receptor, we have synthesized a series of 5-oxo-6E,8Z-dienoic acids with chain lengths between 12 and 20 carbons, as well as a series of 20-carbon 5-oxo fatty acids, either fully saturated or containing between one and five double bonds. The effects of these compounds on neutrophils (calcium mobilization, CD11b expression, and cell migration) and eosinophils (actin polymerization) were compared with those of 5-oxo-ETE. The C12 and C14 analogs were without appreciable activity, whereas the C16 5-oxo-dienoic acid was a weak partial agonist. In contrast, the corresponding C18 analog (5-oxo-18:2) was nearly as potent as 5-oxo-ETE. Among the C20 analogs, the fully saturated compound had virtually no activity, whereas 5-oxo-6E-eicosenoic acid had only weak agonist activity. In contrast, 5-oxo-6E,8Z,11Z-eicosatrienoic acid (5-oxo-20:3) and its 8-trans isomer were approximately equipotent with 5-oxo-ETE in activating granulocytes. Because of the potent effects of 5-oxo-20:3, we investigated its formation from Mead acid (5Z,8Z,11Z-eicosatrienoic acid), which accumulates in dietary essential fatty acid deficiency, by neutrophils. The main Mead acid metabolite identified was 5-hydroxy-6,8,11-eicosatrienoic acid, followed by 5-oxo-20:3 and two 6-trans isomers of leukotriene B(3). We conclude that optimal activation of the OXE receptor is achieved with 5-oxo-ETE, 5-oxo-18:2, and 5-oxo-20:3, and that the latter compound could potentially be formed under conditions of essential fatty acid deficiency. PMID:18292294

  14. Molecular metal-Oxo catalysts for generating hydrogen from water

    SciTech Connect

    Long, Jeffrey R; Chang, Christopher J; Karunadasa, Hemamala I

    2015-02-24

    A composition of matter suitable for the generation of hydrogen from water is described, the positively charged cation of the composition having the general formula [(PY5W.sub.2)MO].sup.2+, wherein PY5W.sub.2 is (NC.sub.5XYZ)(NC.sub.5H.sub.4).sub.4C.sub.2W.sub.2, M is a transition metal, and W, X, Y, and Z can be H, R, a halide, CF.sub.3, or SiR.sub.3, where R can be an alkyl or aryl group. The two accompanying counter anions, in one embodiment, can be selected from the following Cl.sup.-, I.sup.-, PF.sub.6.sup.-, and CF.sub.3SO.sub.3.sup.-. In embodiments of the invention, water, such as tap water containing electrolyte or straight sea water can be subject to an electric potential of between 1.0 V and 1.4 V relative to the standard hydrogen electrode, which at pH 7 corresponds to an overpotential of 0.6 to 1.0 V, with the result being, among other things, the generation of hydrogen with an optimal turnover frequency of ca. 1.5 million mol H.sub.2/mol catalyst per h.

  15. Metal-oxo containing polymer nanobeads as potential contrast agents for magnetic resonance imaging

    NASA Astrophysics Data System (ADS)

    Pablico, Michele Huelar

    Magnetic resonance imaging (MRI) has greatly revolutionized the way diseases are detected and treated, as it is a non-invasive imaging modality solely based on the interaction of radiowaves and hydrogen nuclei in the presence of an external magnetic field. It is widely used today for the diagnosis of diseases as it offers an efficient method of mapping structure and function of soft tissues in the body. Most MRI examinations utilize paramagnetic materials known as contrast agents, which enhance the MR signal by decreasing the longitudinal (T1) and transverse (T2) relaxation times of the surrounding water protons in biological systems. This results into increased signal intensity differences thereby allowing better interpretation and analysis of pathological tissues. Contrast agents function by lowering the T1 or lowering the T2, resulting into bright and dark contrasts, respectively. The most common MRI contrast agents that are in clinical use today are gadolinium chelates and superparamagnetic iron oxide nanoparticles, both of which have their own advantages in terms of contrast enhancement properties. In the past few years, however, there has been interest in utilizing metal-containing clusters for MRI contrast enhancement as these materials bridge the gap between the constrained structure and magnetic properties of the gadolinium chelates with the superparamagnetic behavior of the iron oxide nanoparticles. Recently, metallic clusters containing Mn and Fe metal centers have received increased attention mainly because of their potential for high spin states and benign nature. In the quest to further develop novel imaging agents, this research has focused on investigating the use of metal-oxo clusters as potential contrast agents for MRI. The primary goal of this project is to identify clusters that meet the following criteria: high paramagnetic susceptibility, water-soluble, stable, cheap, contain environmentally benign metals, and easily derivatized. This work is

  16. 13-Oxo-9(Z),11(E),15(Z)-octadecatrienoic acid activates peroxisome proliferator-activated receptor γ in adipocytes.

    PubMed

    Takahashi, Haruya; Hara, Hideyuki; Goto, Tsuyoshi; Kamakari, Kosuke; Wataru, Nomura; Mohri, Shinsuke; Takahashi, Nobuyuki; Suzuki, Hideyuki; Shibata, Daisuke; Kawada, Teruo

    2015-01-01

    Peroxisome proliferator-activated receptor (PPAR)γ is expressed in adipose tissue and plays a key role in the regulation of adipogenesis. PPARγ activators are known to have potent antihyperglycemic activity and are used to treat insulin resistance associated with diabetes. Therefore, many natural and synthetic agonists of PPARγ are used in the treatment of glucose disorders. In the present study, we found that 13-oxo-9(Z),11(E),15(Z)-octadecatrienoic acid (13-oxo-OTA), a linolenic acid derivative, is present in the extract of tomato (Solanum lycopersicum), Mandarin orange (Citrus reticulata), and bitter gourd (Momordica charantia). We also found that 13-oxo-OTA activated PPARγ and induced the mRNA expression of PPARγ target genes in adipocytes, thereby promoting differentiation. Furthermore, 13-oxo-OTA induced secretion of adiponectin and stimulated glucose uptake in adipocytes. To our knowledge, this is the first study to report that 13-oxo-OTA induces adipogenesis through PPARγ activation and to present 13-oxo-OTA as a valuable food-derived compound that may be applied in the management of glucose metabolism disorders. PMID:25425149

  17. To rebound or dissociate? This is the mechanistic question in C-H hydroxylation by heme and nonheme metal-oxo complexes.

    PubMed

    Cho, Kyung-Bin; Hirao, Hajime; Shaik, Sason; Nam, Wonwoo

    2016-03-01

    Enzymatic reactions that involve C-H bond activation of alkanes by high-valent iron-oxo species can be explained by the rebound mechanism (RM). Hydroxylation reactions of alkane substrates effected by the reactive compound I (Cpd I) species of cytochrome P450 enzymes are good examples. There was initially little doubt that the rebound paradigm could be carried over in the same form to the arena of synthetic nonheme high-valent iron-oxo or other metal-oxo complexes. However, the active reaction centres of these synthetic systems are not well-caged, in contrast to the active sites of enzymes; therefore, the relative importance of the radical dissociation pathway can become prominent. Indeed, accumulating experimental and theoretical evidence shows that introduction of the non-rebound mechanism (non-RM) is necessary to rationalise the different reactivity patterns observed for synthetic nonheme complexes. In this tutorial review, we discuss several specific examples involving the non-RM while making frequent comparisons to the RM, mainly from the perspective of computational chemistry. We also provide a technical guide to DFT calculations of RM and non-RM and to the interpretations of computational outcomes. PMID:26690848

  18. 9-Oxo-10(E),12(Z),15(Z)-Octadecatrienoic Acid Activates Peroxisome Proliferator-Activated Receptor α in Hepatocytes.

    PubMed

    Takahashi, Haruya; Kamakari, Kosuke; Goto, Tsuyoshi; Hara, Hideyuki; Mohri, Shinsuke; Suzuki, Hideyuki; Shibata, Daisuke; Nakata, Rieko; Inoue, Hiroyasu; Takahashi, Nobuyuki; Kawada, Teruo

    2015-11-01

    The peroxisome proliferator-activated receptor (PPAR)α is mainly expressed in the liver and plays an important role in the regulation of lipid metabolism. It has been reported that PPARα activation enhances fatty acid oxidation and reduces fat storage. Therefore, PPARα agonists are used to treat dyslipidemia. In the present study, we found that 9-oxo-10(E),12(Z),15(Z)-octadecatrienoic acid (9-oxo-OTA), which is a α-linolenic acid (ALA) derivative, is present in tomato (Solanum lycopersicum) extract. We showed that 9-oxo-OTA activated PPARα and induced the mRNA expression of PPARα target genes in murine primary hepatocytes. These effects promoted fatty acid uptake and the secretion of β-hydroxybutyrate, which is one of the endogenous ketone bodies. We also demonstrated that these effects of 9-oxo-OTA were not observed in PPARα-knockout (KO) primary hepatocytes. To our knowledge, this is the first study to report that 9-oxo-OTA promotes fatty acid metabolism via PPARα activation and discuss its potential as a valuable food-derived compound for use in the management of dyslipidemia. PMID:26387026

  19. Activation of gas-phase uranyl: from an oxo to a nitrido complex.

    PubMed

    Gong, Yu; Vallet, Valérie; Michelini, Maria del Carmen; Rios, Daniel; Gibson, John K

    2014-01-01

    The uranyl moiety, UO2(2+), is ubiquitous in the chemistry of uranium, the most prevalent actinide. Replacing the strong uranium-oxygen bonds in uranyl with other ligands is very challenging, having met with only limited success. We report here uranyl oxo bond activation in the gas phase to form a terminal nitrido complex, a previously elusive transformation. Collision induced dissociation of gas-phase UO2(NCO)Cl2(-) in an ion trap produced the nitrido oxo complex, NUOCl2(-), and CO2. NUOCl2(-) was computed by DFT to have Cs symmetry and a singlet ground state. The computed bond length and order indicate a triple U-N bond. Endothermic activation of UO2(NCO)Cl2(-) to produce NUOCl2(-) and neutral CO2 was computed to be thermodynamically more favorable than NCO ligand loss. Complete reaction pathways for the CO2 elimination process were computed at the DFT level. PMID:24354492

  20. Probing the selective antitumor activity of 22-oxo-26-selenocyanocholestane derivatives.

    PubMed

    Fernández-Herrera, María A; Sandoval-Ramírez, Jesús; Sánchez-Sánchez, Luis; López-Muñoz, Hugo; Escobar-Sánchez, María L

    2014-03-01

    Diverse steroidal compounds have shown antiproliferative activity on certain tumor cell lines; however, their complete role on cancer cells has not been extensively established since the research is quite recent. Hence, deeper study in this field is required. Due to the importance of selenium in animal and human health; herein, we report the synthesis, characterization, and biological evaluation of two novel 22-oxo-26-selenocyanocholestanic steroids on cervicouterine cancer cells and non-tumor cells. The title compounds were straightforward prepared from diosgenin and hecogenin in excellent overall yields. We determined their effect on cell proliferation on HeLa, CaSki, and ViBo cell cultures. Their cytotoxic effect on tumor cells, as well as on peripheral blood lymphocytes was also evaluated. The increase in the expression of active caspase-3 along with the fragmentation of DNA confirm that the new 22-oxo-26-selenocyanocholestane frameworks potentiate apoptosis in tumor cells. The antiproliferative activity on tumor cells affects to some extent the proliferative potential of peripheral blood lymphocytes, so an immunosuppressive effect has also been established. The novel 22-oxo-26-selenocyanocholestane compounds show selective antitumor activity and therefore are promising lead candidates for further in vivo evaluation. PMID:24487193

  1. The active site of TthPolX is adapted to prevent 8-oxo-dGTP misincorporation

    PubMed Central

    Garrido, Patricia; Mejia, Edison; Garcia-Diaz, Miguel; Blanco, Luis; Picher, Angel J.

    2014-01-01

    Full genome sequencing of bacterial genomes has revealed the presence of numerous genes encoding family X DNA polymerases. These enzymes play a variety of biological roles and, accordingly, display often striking functional differences. Here we report that the PolX from the heat-stable organism Thermus thermophilus (TthPolX) inserts the four dNTPs with strong asymmetry. We demonstrate that this behaviour is related to the presence of a single divergent residue in the active site of TthPolX. Mutation of this residue (Ser266) to asparagine, the residue present in most PolXs, had a strong effect on TthPolX polymerase activity, increasing and equilibrating the insertion efficiencies of the 4 dNTPs. Moreover, we show that this behaviour correlates with the ability of TthPolX to insert 8-oxo-dGMP. Although the wild-type enzyme inefficiently incorporates 8-oxo-dGMP, the substitution of Ser266 to asparagine resulted in a dramatic increase in 8-oxo-dGMP incorporation opposite dA. These results suggest that the presence of a serine at position 266 in TthPolX allows the enzyme to minimize the formation of dA:8-oxo-dGMP at the expense of decreasing the insertion rate of pyrimidines. We discuss the structural basis for these effects and the implications of this behaviour for the GO system (BER of 8-oxo-dG lesions). PMID:24084083

  2. Switching on the Metathesis Activity of Re Oxo Alkylidene Surface Sites through a Tailor-Made Silica-Alumina Support.

    PubMed

    Valla, Maxence; Stadler, David; Mougel, Victor; Copéret, Christophe

    2016-01-18

    Re oxo alkylidene surface species are putative active sites in classical heterogeneous Re-based alkene-metathesis catalysts. However, the lack of evidence for such species questions their existence and/or relevance as reaction intermediates. Using Re(O)(=CH-CH=CPh2)(OtBuF6)3(THF), the corresponding well-defined Re oxo alkylidene surface species can be generated on both silica and silica-alumina supports. While inactive on the silica support, it displays very good activity, even for functionalized olefins, on the silica-alumina support. PMID:26756446

  3. Biodegradation of oxo-alcohol ethoxylates in the continuous flow activated sludge simulation test.

    PubMed

    Szymanski, Andrzej; Wyrwas, Bogdan; Bubien, Ewa; Kurosz, Tatiana; Hreczuch, Wieslaw; Zembrzuski, Wlodzimierz; Lukaszewski, Zenon

    2002-07-01

    Biodegradation of two alpha-methyl branched oxo-alcohol ethoxylates (OAE) of different polydispersity: LIAL 125/14 BRD (LIALB) (broad M.W. distribution) and LIAL 125/14 NRD (LIALN) (narrow M.W. distribution), both having an average of 14 oxyethylene subunits (EO) and a C(12-15) alkyl moiety were tested under the continuous flow activated sludge conditions of the classical Husmann plant. Primary biodegradation and concentration of metabolites: free oxo-alcohol fraction (FOA) and poly(ethylene glycols) (PEG), were measured. PEG were divided into two fractions: short-chained PEG (PEGshch) (1-4 EO) and long-chained PEG (PEGlch) (>4 EO). The indirect tensammetric technique combined with an adequate separation was used for analysis. Central fission was found to be a highly dominating pathway, as is the case with fatty alcohol ethoxylates. OAE are highly primarily biodegraded (above 95%). High concentrations of FOA and PEG are formed. Once formed the PEGlch are further fragmented into the PEGshch. Free alcohol fraction compounds are biodegraded sooner when alkyl moiety is shorter. OAE polydispersity has an influence on the kinetics of biodegradation; PEG formed from LIALN are biodegraded slower and to a lower degree than those from LIALB. PMID:12188138

  4. A Highly Reactive Mononuclear Non-Heme Manganese(IV)-Oxo Complex That Can Activate the Strong C-H Bonds of Alkanes

    SciTech Connect

    Wu, Xiujuan; Seo, Mi Sook; Davis, Katherine M; Lee, Yong-Min; Chen, Junying; Cho, Kyung-Bin; Pushkar, Yulia N; Nam, Wonwoo

    2012-03-15

    A mononuclear non-heme manganese(IV)-oxo complex has been synthesized and characterized using various spectroscopic methods. The Mn(IV)-oxo complex shows high reactivity in oxidation reactions, such as C-H bond activation, oxidations of olefins, alcohols, sulfides, and aromatic compounds, and N-dealkylation. In C-H bond activation, the Mn(IV)-oxo complex can activate C-H bonds as strong as those in cyclohexane. It is proposed that C-H bond activation by the non-heme Mn(IV)-oxo complex does not occur via an oxygen-rebound mechanism. The electrophilic character of the non-heme Mn(IV)-oxo complex is demonstrated by a large negative ρ value of ~4.4 in the oxidation of para-substituted thioanisoles.

  5. Synthesis and biological activity of furostanic analogues of brassinosteroids bearing the 5alpha-hydroxy-6-oxo moiety.

    PubMed

    Romero-Avila, Margarita; de Dios-Bravo, Guadalupe; Mendez-Stivalet, Jóse M; Rodríguez-Sotres, Rogelio; Iglesias-Arteaga, Martin A

    2007-12-01

    Two furostanic analogues of brassinosteroids bearing the 5alpha-hydroxy-6-oxo moiety were synthesized and their biological activity studied using the bean second internode elongation test. One of the compounds produced significant stimulation at doses of 2.5 and 5ng/plant. PMID:17905389

  6. Thermodynamic properties and cloud droplet activation of a series of oxo-acids

    NASA Astrophysics Data System (ADS)

    Frosch, Mia; Platt, Stephen; Zardini, Alessandro; Bilde, Merete

    2010-05-01

    Submicron sized aerosol particles in the Earth's atmosphere influence visibility, human health, and global climate (IPCC, 2007). The organic mass fraction of the atmospheric aerosol has been estimated at 20-90% of the total aerosol mass mass (Kanakidou et al., 2005). Many of the organic species found in the particle phase in the atmosphere are produced via the oxidation of biogenic hydrocarbon emissions such as terpenes and sesquiterpenes (Hallquist et al. 2009). We have investigated the thermodynamic properties of four aliphatic oxo-dicarboyxlic acids identified or thought to be present in atmospheric particulate matter: oxosuccinic acid, 2-oxoglutaric acid, 3-oxoglutaric acid, and 4-oxopimelic acid. The compounds were characterized in terms of their cloud condensation nuclei (CCN) activity, vapor pressure, density, and tendency to decarboxylate in aqueous solution. We deployed a variety of experimental techniques and instruments: a CCN counter, a Tandem Differential Mobililty Analyzer (TDMA) coupled with a laminar flow tube (Bilde, 2003), and liquid chromatography/mass spectrometry (LC/MS). Generally, the presence of the oxo functional group causes the vapor pressure of the compounds to diminish by an order of magnitude with respect to the parent dicarboxylic acid, and it tends to increase the CCN activity. Dicarboxylic acids with an oxo-group in the β-position were found to decarboxylate in aqueous solution. IPCC: Climate Change (2007): The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press, Cambridge, UK. Kanakidou, M., Seinfeld, J. H., Pandis, S. N., Barnes, I., Dentener, F. J., Facchini, M. C., Van Dingenen, R., Ervens, B., Nenes, A., Nielsen, C. J., Swietlicki, E., Putaud, J. P., Balkanski, Y., Fuzzi, S., Horth, J., Moortgat, G. K., Winterhalter, R., Myhre, C. E. L., Tsigaridis, K., Vignati, E., Stephanou, E. G., and Wilson, J (2005). Atmos

  7. Oxidations of Organic and Inorganic Substrates by Superoxo-, hydroperoxo-, and oxo-compounds of the transition metals.

    SciTech Connect

    Michael John Vasbinder

    2006-12-12

    Hammett correlation. It was found that the values of the Hammett reaction constant PN were -1.0(1) for 4-nitro-2-methylpyridine-N-oxide and -2.6(4) for 4-methylpyridine-N-oxide as substrates. The negative value confirms pyridine is acting as a nucleophile. Nucleophiles other than pyridine derivatives were also tested. In the end, it was found that the most effective nucleophiles were the pyridine-N-oxides themselves, meaning that a second equivalent of substrate serves as the most efficient promoter of this oxygen-atom transfer reaction. This relative nucleophilicity of pyridines and pyridine-N-oxides is similar to what is observed in other OAT reactions generating high-valent metal-oxo species.

  8. Antimitotic effect of the retinoid 4-oxo-fenretinide through inhibition of tubulin polymerization: a novel mechanism of retinoid growth-inhibitory activity.

    PubMed

    Appierto, Valentina; Tiberio, Paola; Cavadini, Elena; Casalini, Patrizia; Cappelletti, Graziella; Formelli, Franca

    2009-12-01

    The retinoid 4-oxo-N-(4-hydroxyphenyl)retinamide (4-oxo-4-HPR), a metabolite of fenretinide (4-HPR) present in plasma of 4-HPR-treated patients, is very effective in inducing growth inhibition and apoptosis in several cancer cell lines. 4-Oxo-4-HPR and 4-HPR have different mechanisms of action because 4-oxo-4-HPR, unlike 4-HPR, causes marked cell accumulation in G2-M phase. Here, we investigated the molecular events involving 4-oxo-4-HPR-induced cell cycle perturbation in ovarian (A2780 and IGROV-1) and breast (T47D, estrogen receptor+ and BT-20, estrogen receptor-) cancer cells. 4-Oxo-4-HPR induced a delay of mitosis (with mitotic index increasing 5- to 6-fold in all cell lines) without progression beyond the anaphase, as shown by cyclin B1 expression. 4-Oxo-4-HPR induced multipolar spindle formation and phosphorylation of BUBR1, resulting in activation of the spindle checkpoint. Multipolar spindles were not due to impairment of pole-focusing process, loss of centrosome integrity, or modulation of the expression levels of molecules associated with spindle aberrations (Kif 1C, Kif 2A, Eg5, Tara, tankyrase-1, centractin, and TOGp). We show here that 4-oxo-4-HPR targets microtubules because, in treated cells, it interfered with the reassembly of cold-depolymerized spindle microtubules and decreased the polymerized tubulin fraction. In cell-free assays, 4-oxo-4-HPR inhibited tubulin polymerization (50% inhibition of microtubule assembly at 5.9 micromol/L), suggesting a direct molecular interaction with tubulin. In conclusion, by showing that 4-oxo-4-HPR causes mitotic arrest through antimicrotubule activities, we delineate a new molecular mechanism for a retinoid. PMID:19996280

  9. New oxo-bridged peroxotungsten complexes containing biogenic co-ligand as potent inhibitors of alkaline phosphatase activity.

    PubMed

    Hazarika, Pankaj; Kalita, Diganta; Sarmah, Swapnalee; Islam, Nashreen S

    2006-03-01

    Novel dinuclear peroxo complexes of tungsten with coordinated cystine of the type A(2)[W(2)O(3)(O(2))(4)(cystine)].4H(2)O, A = Na (1) or K (2) have been synthesized from the reaction of A(2)WO(4,)cysteine and 30% H(2)O(2)at pH 2.5. The synthesized compounds were characterized by elemental analysis, spectral and physico-chemical methods. The two W(VI) centres with side-on bound peroxo groups of the dinuclear complex species are bridged by an oxo group and a cystine ligand, formed from the oxidation of cysteine. Cystine occurring as zwitterion binds the metal centers of the complex ion through O(carboxylate) atoms leading to hepta co-ordination around each W(VI). The compounds exhibit high stability toward decomposition in solution of acidic as well as physiological pH and serve as weak substrates to catalase, undergoing degradation in presence of the enzyme at a rate much slower relative to H(2)O(2). The compounds efficiently oxidized GSH to GSSG, a reaction in which only two of the peroxide groups of the complex species were found to participate. The compounds induce strong inhibitory effect on alkaline phosphatase activity with a potency higher than that of the free cystine, tungstate, or peroxotungstate. PMID:16477386

  10. Physiological characterization of the ARO10-dependent, broad-substrate-specificity 2-oxo acid decarboxylase activity of Saccharomyces cerevisiae.

    PubMed

    Vuralhan, Zeynep; Luttik, Marijke A H; Tai, Siew Leng; Boer, Viktor M; Morais, Marcos A; Schipper, Dick; Almering, Marinka J H; Kötter, Peter; Dickinson, J Richard; Daran, Jean-Marc; Pronk, Jack T

    2005-06-01

    Aerobic, glucose-limited chemostat cultures of Saccharomyces cerevisiae CEN.PK113-7D were grown with different nitrogen sources. Cultures grown with phenylalanine, leucine, or methionine as a nitrogen source contained high levels of the corresponding fusel alcohols and organic acids, indicating activity of the Ehrlich pathway. Also, fusel alcohols derived from the other two amino acids were detected in the supernatant, suggesting the involvement of a common enzyme activity. Transcript level analysis revealed that among the five thiamine-pyrophospate-dependent decarboxylases (PDC1, PDC5, PDC6, ARO10, and THI3), only ARO10 was transcriptionally up-regulated when phenylalanine, leucine, or methionine was used as a nitrogen source compared to growth on ammonia, proline, and asparagine. Moreover, 2-oxo acid decarboxylase activity measured in cell extract from CEN.PK113-7D grown with phenylalanine, methionine, or leucine displayed similar broad-substrate 2-oxo acid decarboxylase activity. Constitutive expression of ARO10 in ethanol-limited chemostat cultures in a strain lacking the five thiamine-pyrophosphate-dependent decarboxylases, grown with ammonia as a nitrogen source, led to a measurable decarboxylase activity with phenylalanine-, leucine-, and methionine-derived 2-oxo acids. Moreover, even with ammonia as the nitrogen source, these cultures produced significant amounts of the corresponding fusel alcohols. Nonetheless, the constitutive expression of ARO10 in an isogenic wild-type strain grown in a glucose-limited chemostat with ammonia did not lead to any 2-oxo acid decarboxylase activity. Furthermore, even when ARO10 was constitutively expressed, growth with phenylalanine as the nitrogen source led to increased decarboxylase activities in cell extracts. The results reported here indicate the involvement of posttranscriptional regulation and/or a second protein in the ARO10-dependent, broad-substrate-specificity decarboxylase activity. PMID:15933030

  11. A Metal-Organic Framework Containing Unusual Eight-Connected Zr–-Oxo Secondary Building Units and Orthogonal Carboxylic Acids for Ultra-sensitive Metal Detection

    SciTech Connect

    Carboni, Michaël; Lin, Zekai; Abney, Carter W.; Zhang, Teng; Lin, Wenbin

    2015-08-21

    Two metal-organic frameworks (MOFs) with Zr-oxo secondary building units (SBUs) were prepared by using p,p'-terphenyldicarboxylate (TPDC) bridging ligands pre-functionalized with orthogonal succinic acid (MOF-1) and maleic acid groups (MOF-2). Single-crystal X-ray structure analysis of MOF-1 provides the first direct evidence for eight-connected SBUs in UiO-type MOFs. In contrast, MOF-2 contains twelve-connected SBUs as seen in the traditional UiO MOF topology. These structural assignments were confirmed by extended X-ray absorption fine structure (EXAFS) analysis. The highly porous MOF-1 is an excellent fluorescence sensor for metal ions with the detection limit of <0.5 ppb for Mn2+ and three to four orders of magnitude greater sensitivity for metal ions than previously reported luminescent MOFs.

  12. Control of oxo-group functionalization and reduction of the uranyl ion.

    PubMed

    Arnold, Polly L; Pécharman, Anne-Frédérique; Lord, Rianne M; Jones, Guy M; Hollis, Emmalina; Nichol, Gary S; Maron, Laurent; Fang, Jian; Davin, Thomas; Love, Jason B

    2015-04-01

    Uranyl complexes of a large, compartmental N8-macrocycle adopt a rigid, "Pacman" geometry that stabilizes the U(V) oxidation state and promotes chemistry at a single uranyl oxo-group. We present here new and straightforward routes to singly reduced and oxo-silylated uranyl Pacman complexes and propose mechanisms that account for the product formation, and the byproduct distributions that are formed using alternative reagents. Uranyl(VI) Pacman complexes in which one oxo-group is functionalized by a single metal cation are activated toward single-electron reduction. As such, the addition of a second equivalent of a Lewis acidic metal complex such as MgN″2 (N″ = N(SiMe3)2) forms a uranyl(V) complex in which both oxo-groups are Mg functionalized as a result of Mg-N bond homolysis. In contrast, reactions with the less Lewis acidic complex [Zn(N″)Cl] favor the formation of weaker U-O-Zn dative interactions, leading to reductive silylation of the uranyl oxo-group in preference to metalation. Spectroscopic, crystallographic, and computational analysis of these reactions and of oxo-metalated products isolated by other routes have allowed us to propose mechanisms that account for pathways to metalation or silylation of the exo-oxo-group. PMID:25799215

  13. Understanding the origin of metal-sulfur vibrations in an oxo-molybdenum dithiolene complex: relevance to sulfite oxidase.

    PubMed

    Inscore, Frank E; Knottenbelt, Sushilla Z; Rubie, Nick D; Joshi, Hemant K; Kirk, Martin L; Enemark, John H

    2006-02-01

    X-ray crystallography and resonance Raman (rR) spectroscopy have been used to further characterize (Tp*)MoO(qdt) (Tp* is hydrotris(3,5-dimethyl-1-pyrazolyl)borate and qdt is 2,3-quinoxalinedithiolene), which represents an important benchmark oxomolybdenum mono-dithiolene model system relevant to various pyranopterin Mo enzyme active sites, including sulfite oxidase. The compound (Tp*)MoO(qdt) crystallizes in the triclinic space group, P1, where a = 9.8424 (7) A, b = 11.2323 (8) A, c = 11.9408 (8) A, alpha = 92.7560 (10) degrees, beta = 98.9530 (10) degrees, and gamma = 104.1680 (10) degrees. The (Tp*)MoO(qdt) molecule exhibits the distorted six-coordinate geometry characteristic of related oxo-Mo(V) systems possessing a single coordinated dithiolene ligand. The first coordination sphere bond lengths and angles in (Tp*)MoO(qdt) are very similar to the corresponding structural parameters for (Tp*)MoO(bdt) (bdt is 1,2-benzenedithiolene). The relatively small inner-sphere structural variations observed between (Tp*)MoO(qdt) and (Tp*)MoO(bdt) strongly suggest that geometric effects are not a major contributor to the significant electronic structural differences reported for these two oxo-Mo(V) dithiolenes. Therefore, the large differences observed in the reduction potential and first ionization energy between the two molecules appear to derive primarily from differences in the effective nuclear charges of their respective sulfur donors. However, a subtle perturbation to Mo-S bonding is implied by the nonplanarity of the dithiolene chelate ring, which is defined by the fold angle. This angular distortion (theta = 29.5 degrees in (Tp*)MoO(qdt); 21.3 degrees in (Tp*)MoO(bdt)) observed between the MoS2 and S-C=C-S planes may contribute to the electronic structure of these oxo-Mo dithiolene systems by controlling the extent of S p-Mo d orbital overlap. In enzymes, the fold angle may be dynamically modulated by the pyranopterin, thereby functioning as a transducer of

  14. Anti-inflammatory, analgesic and antioxidant activities of 3,4-oxo-isopropylidene-shikimic acid.

    PubMed

    Sun, Jin-Yao; You, Cui-Yu; Dong, Kai; You, Hai-Sheng; Xing, Jian-Feng

    2016-10-01

    Context 3,4-Oxo-isopropylidene-shikimic acid (ISA) is an analog of shikimic acid (SA). SA is extracted from the dry fruit of Illicium verum Hook. f. (Magnoliaceae), which has been used for treating stomachaches, skin inflammation and rheumatic pain. Objective To investigate the anti-inflammatory, analgesic and antioxidant activities of ISA. Materials and methods Analgesic and anti-inflammatory activities of ISA were evaluated using writhing, hot plate, xylene-induced ear oedema, carrageenan-induced paw oedema and cotton pellets-induced granuloma test, meanwhile the prostaglandin E2 (PGE2) and malondialdehyde (MDA) levels were assessed in the oedema paw tissue. ISA (60, 120 and 240 mg/kg in mice model and 50, 120 and 200 mg/kg in rat model) was administered orally, 30 min before induction of inflammation/pain. Additionally, ISA was administered for 12 d in rats from the day of cotton pellet implantation. The active oxygen species scavenging potencies of ISA (10(-3)-10(-5) M) were evaluated by the electron spin resonance spin-trapping technique. Results ISA caused a reduction of inflammation induced by xylene (18.1-31.4%), carrageenan (7.8-51.0%) and cotton pellets (11.4-24.0%). Furthermore, ISA decreased the production of PGE2 and MDA in the rat paw tissue by 1.0-15.6% and 6.3-27.6%, respectively. ISA also reduced pain induced by acetic acid (15.6-48.9%) and hot plate (10.5-28.5%). Finally, ISA exhibited moderate antioxidant activity by scavenging the superoxide radical and hydroxyl radical with IC50 values of 0.214 and 0.450 μg/mL, respectively. Discussion and conclusion Our findings confirmed the anti-inflammatory, analgesic and antioxidant activities of ISA. PMID:27609150

  15. Structural, spectral, thermal and biological studies on 2-oxo-N‧-((4-oxo-4H-chromen-3-yl)methylene)-2-(phenylamino)acetohydrazide (H2L) and its metal complexes

    NASA Astrophysics Data System (ADS)

    El-Gammal, Ola A.; El-Reash, Gaber Abu; Ahmed, Sara F.

    2012-01-01

    A new series of metal complexes formed by the reaction of 2-oxo-N'-((4-oxo-4H-chromen-3-yl)methylene)-2-(phenylamino)acetohydrazide(H 2L) and Cu(II), Co(II), Ni(II), Cd(II), Zn(II), Hg(II) and U(VI) O22+ ions. The isolated complexes have been characterized by elemental analyses, spectral (IR, UV-visible and 1H NMR) as well as magnetic and thermal measurements. The data revealed that the ligand acts as neutral ON or ONO as well as mononegative ONO. On the basis of magnetic and electronic spectral data an octahedral geometry for the Co(II), Cu(II) and U(VI)O 2 complexes, a tetrahedral structure for the Ni(II), Cd(II), Zn(II) and Hg(II) complexes have been proposed. The bond length, bond angle, HOMO, LUMO, dipole moment and charges on the atoms have been calculated to confirm the geometry of the ligand and the investigated complexes. Also, kinetic parameters were determined for each thermal degradation stage of some complexes using Coats-Redfern and Horowitz-Metzger methods. Moreover, the ligand and its complexes were screened against Bacillus thuringiensis ( Bt) as Gram positive bacteria and Pseudomonas aeuroginosa ( Pa) Gram negative bacteria using the inhibitory zone diameter.

  16. CiMutT, an asidian MutT homologue, has a 7, 8-dihydro-8-oxo-dGTP pyrophosphohydrolase activity responsible for sanitization of oxidized nucleotides in Ciona intestinalis.

    PubMed

    Yonekura, Shin-Ichiro; Sanada, U; Zhang-Akiyama, Qiu-Mei

    2010-01-01

    The oxidized nucleotide precursors 7, 8-dihydro-8-oxo-dGTP (8-oxo-dGTP) and 1, 2-dihydro-2-oxo-dATP (2-oxo-dATP) are readily incorporated into nascent DNA strands during replication, which would cause base substitution mutations. E. coli MutT and human homologue hMTH1 hydrolyze 8-oxo-dGTP, thereby preventing mutations. In this study, we searched for hMTH1 homologues in the ascidian Ciona intestinalis using the NCBI-BLAST database. Among several candidates, we focused on one open reading frame, designated as CiMutT, because of its high degree of identity (41.7%) and similarity (58.3%) to the overall amino acid sequence of hMTH1, including the Nudix box. CiMutT significantly suppressed the mutator activity of E. coli mutT mutant. Purified CiMutT had a pyrophosphohydrolase activity that hydrolyzed 8-oxo-dGTP to 8-oxo-dGMP and inorganic pyrophosphate. It had a pH optimum of 9.5 and Mg(++) requirement with optimal activity at 5 mM. The activity of CiMutT for 8-oxo-dGTP was comparable to that of hMTH1, while it was 100-fold lower for 2-oxo-dATP than that of hMTH1. These facts indicate that CiMutT is a functional homologue of E. coli MutT. In addition, the enzyme hydrolyzed all four of the unoxidized nucleoside triphosphates, with a preference for dATP. The specific activity for 8-oxo-dGTP was greater than that for unoxidized dATP and dGTP. These results suggest that CiMutT has the potential to prevent mutations by 8-oxo-dGTP in C. intestinalis. PMID:21178309

  17. Terminal Gold-Oxo Complexes

    SciTech Connect

    Cao, R.; Anderson, T.M.; Piccoli, P.M.B.; Schultz, A.J.; Koetzle, T.F.; Geletii, Y.V.; Slonkina, E.; Hedman, B.; Hodgson, K.O.; Hardcastle, K.I.; Fang, X.; Kirk, M.L.; Knottenbelt, S.; Kogerler, P.; Musaev, D.G.; Morokuma, K.; Takahashi, M.; Hill, C.L.; /Emory U. /Argonne /SLAC, SSRL /New Mexico U. /Iowa State U. /Toho U.

    2007-10-19

    In contradiction to current bonding paradigms, two terminal Au-oxo molecular complexes have been synthesized by reaction of AuCl{sub 3} with metal oxide-cluster ligands that model redox-active metal oxide surfaces. Use of K{sub 10}[{alpha}{sub 2}-P{sub 2}W{sub 17}O{sub 61}] x 20H{sub 2}O and K{sub 2}WO{sub 4} (forming the [A-PW{sub 9}O{sub 34}]{sup 9-} ligand in situ) produces K{sub 15}H{sub 2}[Au(O)(OH{sub 2})P{sub 2}W{sub 18}O{sub 68}] x 25H{sub 2}O (1); use of K{sub 10}[P{sub 2}W{sub 20}O{sub 70}(OH{sub 2}){sub 2}] x 22H{sub 2}O (3) produces K{sub 7}H{sub 2}[Au(O)(OH{sub 2})P{sub 2}W{sub 20}O{sub 70}(OH{sub 2}){sub 2}] x 27H{sub 2}O (2). Complex 1 crystallizes in orthorhombic Fddd, with a = 28.594(4) Angstroms, b = 31.866(4) Angstroms, c = 38.241(5) Angstroms, V = 34844(7) Angstroms{sup 3}, Z = 16 (final R = 0.0540), and complex 2 crystallizes in hexagonal P6(3)/mmc, with a = 16.1730(9) Angstroms, b = 16.1730(9) Angstroms, c = 19.7659(15) Angstroms, V = 4477.4(5) Angstroms{sup 3}, Z = 2 (final R = 0.0634). The polyanion unit in 1 is disorder-free. Very short ({approx}1.76 Angstroms) Au-oxo distances are established by both X-ray and 30 K neutron diffraction studies, and the latter confirms oxo and trans aqua (H2O) ligands on Au. Seven findings clarify that Au and not W is present in the Au-oxo position in 1 and 2. Five lines of evidence are consistent with the presence of d8 Au(III) centers that are stabilized by the flanking polytungstate ligands in both 1 and 2: redox titrations, electrochemical measurements, 17 K optical spectra, Au L2 edge X-ray absorption spectroscopy, and Au-oxo bond distances. Variable-temperature magnetic susceptibility data for crystalline 1 and 2 establish that both solids are diamagnetic, and {sup 31}P and {sup 17}O NMR spectroscopy confirm that both remain diamagnetic in solution. Both complexes have been further characterized by FT-IR, thermogravimetric analysis (TGA), differential scanning calorimetry (DSC), and other techniques.

  18. (6-methyl-2-methylsulfanyl-4-oxo-3,4-dihydro-3-pyrimidinyl)acetic acid and related compounds exhibiting anti-inflammatory activity.

    PubMed

    Jakubkiene, V; Burbuliene, M M; Udrenaite, E; Garaliene, V; Vainilavicius, P

    2002-09-01

    Base-promoted hydrolysis of methyl or ethyl esters 1a-c gave the (6-methyl-2-methylsulfanyl-4-oxo-3,4-dihydro-3-pyrimidinyl)- and (5-ethyl-6-methyl-2-methylsulfanyl-4-oxo-3,4-dihydro-3-pyrimidinyl)acetic acids 2a, b. Under the reaction of ester 1a or acid 2a with nucleophilic reagents a series of derivatives 3-7 of acid 2a were synthesized and evaluated for their anti-inflammatory activity. Most of them were found to be more active than acetylsalicylic acid, and compounds 2a, 6a, b, 7a, f were significantly more active than ibuprofen. The compounds exhibiting the best anti-inflammatory activity showed negative inotropic effect. PMID:12369447

  19. Biocatalytic Conversion of Avermectin to 4"-Oxo-Avermectin: Characterization of Biocatalytically Active Bacterial Strains and of Cytochrome P450 Monooxygenase Enzymes and Their Genes

    PubMed Central

    Jungmann, Volker; Molnár, István; Hammer, Philip E.; Hill, D. Steven; Zirkle, Ross; Buckel, Thomas G.; Buckel, Dagmar; Ligon, James M.; Pachlatko, J. Paul

    2005-01-01

    4"-Oxo-avermectin is a key intermediate in the manufacture of the agriculturally important insecticide emamectin benzoate from the natural product avermectin. Seventeen biocatalytically active Streptomyces strains with the ability to oxidize avermectin to 4"-oxo-avermectin in a regioselective manner have been discovered in a screen of 3,334 microorganisms. The enzymes responsible for this oxidation reaction in these biocatalytically active strains were found to be cytochrome P450 monooxygenases (CYPs) and were termed Ema1 to Ema17. The genes for Ema1 to Ema17 have been cloned, sequenced, and compared to reveal a new subfamily of CYPs. Ema1 to Ema16 have been overexpressed in Escherichia coli and purified as His-tagged recombinant proteins, and their basic enzyme kinetic parameters have been determined. PMID:16269732

  20. The Role of the Secondary Coordination Sphere in Metal-Mediated Dioxygen Activation

    PubMed Central

    Shook, Ryan L.

    2012-01-01

    Alfred Werner proposed nearly 100 years ago that the secondary coordination sphere has a role in determining physical properties of transition metal complexes. We now know that the secondary coordination sphere impacts nearly all aspects of transition metal chemistry, including the reactivity and selectivity in metal-mediated processes. These features are highlighted in the binding and activation of dioxygen by transition metal complexes. There are clear connections between the control of the secondary coordination sphere and the ability of metal complexes to 1) reversibly bind dioxygen or 2) bind and activate dioxygen to form highly reactive M–oxo complexes. In this forum article, several biological and synthetic examples are presented and discussed in terms of structure-function relationships. Particular emphasis is given to systems with defined non-covalent interactions, such as intramolecular hydrogen bonds involving dioxygen-derived ligands. To further illustrate these effects, the homolytic cleavage of C–H bonds by M–oxo complexes with basic oxo ligands is described. PMID:20380466

  1. An electrochemiluminescence biosensor for 8-oxo-7,8-dihydro-2'-deoxyguanosine quantification and DNA repair enzyme activity analysis using a novel bifunctional probe.

    PubMed

    Wu, Yiping; Yang, Xiqiang; Zhang, Bintian; Guo, Liang-Hong

    2015-07-15

    A new electrochemiluminescence (ECL) sensor was developed for 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) quantification and Escherichia coli formamidopyrimidine-DNA glycosylase (FPG) activity assay. The sensor employed a novel spermine conjugated ruthenium tris-(bipyridine) derivative (spermine-Ru) which binds specifically with 8-oxodGuo through a one-step reaction and also acts as an ECL signal reporter. In the sensor, an 8-oxodGuo-containing ds-DNA film was first immobilized on a gold electrode by self-assembly. The DNA film was then incubated with spermine-Ru under oxidative condition for 8-oxodGuo labeling. The ECL intensity was found to correlate with the amount of 8-oxodGuo on the surface and the detection limit was estimated to be about 1 lesion in 500 DNA bases. Addition of FPG resulted in some loss of the signal due to the excision of 8-oxodGuo by the enzyme. An inverse relationship between ECL intensity and FPG concentration was observed in a range from 0 to 4.0U/µL, demonstrating that this sensor could be used for FPG activity assay. A number of metal ions were screened by the sensor for their inhibition effect on FPG activity. Among them, Hg(2+) and methyl Hg(II) shown very potent inhibition, with IC50 values of 4.04µM and 4.34nM respectively. The result may suggest that interference on the DNA repair system could be another mechanism for the high toxicity of MeHg. PMID:25747509

  2. Effect of diet and starvation on the activity state of branched-chain 2-oxo-acid dehydrogenase complex in rat liver and heart.

    PubMed

    Solomon, M; Cook, K G; Yeaman, S J

    1987-12-10

    In rats fed a high-protein diet, the branched-chain 2-oxo-acid dehydrogenase complex in liver was essentially fully active and its activity state was unaffected by subsequent starvation for 48 h. Feeding with a low-protein diet led to a decrease in the activity state which was essentially reversed by 48 h of starvation. In heart, the enzyme was primarily inactive (activity state 18%) in rats fed a high-protein diet, with both low-protein diet and starvation leading to a further decrease in the activity state. PMID:3676350

  3. The Lupane-type Triterpene 30-Oxo-calenduladiol Is a CCR5 Antagonist with Anti-HIV-1 and Anti-chemotactic Activities*

    PubMed Central

    Barroso-González, Jonathan; El Jaber-Vazdekis, Nabil; García-Expósito, Laura; Machado, José-David; Zárate, Rafael; Ravelo, Ángel G.; Estévez-Braun, Ana; Valenzuela-Fernández, Agustín

    2009-01-01

    The existence of drug-resistant human immunodeficiency virus (HIV) viruses in patients receiving antiretroviral treatment urgently requires the characterization and development of new antiretroviral drugs designed to inhibit resistant viruses and to complement the existing antiretroviral strategies against AIDS. We assayed several natural or semi-synthetic lupane-type pentacyclic triterpenes in their ability to inhibit HIV-1 infection in permissive cells. We observed that the 30-oxo-calenduladiol triterpene, compound 1, specifically impaired R5-tropic HIV-1 envelope-mediated viral infection and cell fusion in permissive cells, without affecting X4-tropic virus. This lupane derivative competed for the binding of a specific anti-CCR5 monoclonal antibody or the natural CCL5 chemokine to the CCR5 viral coreceptor with high affinity. 30-Oxo-calenduladiol seems not to interact with the CD4 antigen, the main HIV receptor, or the CXCR4 viral coreceptor. Our results suggest that compound 1 is a specific CCR5 antagonist, because it binds to the CCR5 receptor without triggering cell signaling or receptor internalization, and inhibits RANTES (regulated on activation normal T cell expressed and secreted)-mediated CCR5 internalization, intracellular calcium mobilization, and cell chemotaxis. Furthermore, compound 1 appeared not to interact with β-chemokine receptors CCR1, CCR2b, CCR3, or CCR4. Thereby, the 30-oxo-calenduladiol-associated anti-HIV-1 activity against R5-tropic virus appears to rely on the selective occupancy of the CCR5 receptor to inhibit CCR5-mediated HIV-1 infection. Therefore, it is plausible that the chemical structure of 30-oxo-calenduladiol or other related dihydroxylated lupane-type triterpenes could represent a good model to develop more potent anti-HIV-1 molecules to inhibit viral infection by interfering with early fusion and entry steps in the HIV life cycle. PMID:19386595

  4. X-ray Crystal Structure of Arsenite-Inhibited Xanthine Oxidase:[mu]-Sulfido,[mu]-Oxo Double Bridge between Molybdenum and Arsenic in the Active Site

    SciTech Connect

    Cao, Hongnan; Hall, James; Hille, Russ

    2012-10-23

    Xanthine oxidoreductase is a molybdenum-containing enzyme that catalyzes the hydroxylation reaction of sp{sup 2}-hybridized carbon centers of a variety of substrates, including purines, aldehydes, and other heterocyclic compounds. The complex of arsenite-inhibited xanthine oxidase has been characterized previously by UV-vis, electron paramagnetic resonance, and X-ray absorption spectroscopy (XAS), and the catalytically essential sulfido ligand of the square-pyrimidal molybdenum center has been suggested to be involved in arsenite binding through either a {mu}-sulfido,{mu}-oxo double bridge or a single {mu}-sulfido bridge. However, this is contrary to the crystallographically observed single {mu}-oxo bridge between molybdenum and arsenic in the desulfo form of aldehyde oxidoreductase from Desulfovibrio gigas (an enzyme closely related to xanthine oxidase), whose molybdenum center has an oxo ligand replacing the catalytically essential sulfur, as seen in the functional form of xanthine oxidase. Here we use X-ray crystallography to characterize the molybdenum center of arsenite-inhibited xanthine oxidase and solve the structures of the oxidized and reduced inhibition complexes at 1.82 and 2.11 {angstrom} resolution, respectively. We observe {mu}-sulfido,{mu}-oxo double bridges between molybdenum and arsenic in the active sites of both complexes. Arsenic is four-coordinate with a distorted trigonal-pyramidal geometry in the oxidized complex and three-coordinate with a distorted trigonal-planar geometry in the reduced complex. The doubly bridged binding mode is in agreement with previous XAS data indicating that the catalytically essential sulfur is also essential for the high affinity of reduced xanthine oxidoreductase for arsenite.

  5. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  6. Dicobalt-μ-oxo polyoxometalate compound, [(α(2)-P2W17O61Co)2O](14-): a potent species for water oxidation, C-H bond activation, and oxygen transfer.

    PubMed

    Barats-Damatov, Delina; Shimon, Linda J W; Weiner, Lev; Schreiber, Roy E; Jiménez-Lozano, Pablo; Poblet, Josep M; de Graaf, Coen; Neumann, Ronny

    2014-02-01

    High-valent oxo compounds of transition metals are often implicated as active species in oxygenation of hydrocarbons through carbon-hydrogen bond activation or oxygen transfer and also in water oxidation. Recently, several examples of cobalt-catalyzed water oxidation have been reported, and cobalt(IV) species have been suggested as active intermediates. A reactive species, formally a dicobalt(IV)-μ-oxo polyoxometalate compound [(α2-P2W17O61Co)2O](14-), [(POMCo)2O], has now been isolated and characterized by the oxidation of a monomeric [α2-P2W17O61Co(II)(H2O)](8-), [POMCo(II)H2O], with ozone in water. The crystal structure shows a nearly linear Co-O-Co moiety with a Co-O bond length of ∼1.77 Å. In aqueous solution [(POMCo)2O] was identified by (31)P NMR, Raman, and UV-vis spectroscopy. Reactivity studies showed that [(POMCo)2O]2O] is an active compound for the oxidation of H2O to O2, direct oxygen transfer to water-soluble sulfoxides and phosphines, indirect epoxidation of alkenes via a Mn porphyrin, and the selective oxidation of alcohols by carbon-hydrogen bond activation. The latter appears to occur via a hydrogen atom transfer mechanism. Density functional and CASSCF calculations strongly indicate that the electronic structure of [(POMCo)2O]2O] is best defined as a compound having two cobalt(III) atoms with two oxidized oxygen atoms. PMID:24437566

  7. An artificial di-iron oxo-protein with phenol oxidase activity

    PubMed Central

    Faiella, Marina; Andreozzi, Concetta; de Rosales, Rafael Torres Martin; Pavone, Vincenzo; Maglio, Ornella; Nastri, Flavia; DeGrado, William F; Lombardi, Angela

    2013-01-01

    Here we report the de novo design and NMR structure of a four-helical bundle di-iron protein with phenol oxidase activity. The introduction of the cofactor-binding and phenol-binding sites required the incorporation of residues that were detrimental to the free energy of folding of the protein. Sufficient stability was, however, obtained by optimizing the sequence of a loop distant from the active site. PMID:19915535

  8. Mechanism of the oxo reaction. I The conversion of cobalt carbonyls during the oxo reaction. The promoting effect of organic bases

    SciTech Connect

    Borovikov, M.S.; Rybakov, V.A.

    1986-01-01

    The authors use the Breslow-Heck mechanism to examine the conversions of cobalt carbonyls during the oxo reaction. An interrelationship was found between hydrogen activation (catalysis of the hydrogenolysts of Co/sub 2/(CO)/sub 8/) and olefin activation (acceleration of the oxo reaction). A mechanism was proposed for the promoting effect of organic bases in the oxo reaction.

  9. Label-free colorimetric detection of mercury via Hg2+ ions-accelerated structural transformation of nanoscale metal-oxo clusters

    NASA Astrophysics Data System (ADS)

    Chen, Kun; She, Shan; Zhang, Jiangwei; Bayaguud, Aruuhan; Wei, Yongge

    2015-11-01

    Mercury and its compounds are known to be extremely toxic but widely distributed in environment. Although many works have been reported to efficiently detect mercury, development of simple and convenient sensors is still longed for quick analyzing mercury in water. In this work, a nanoscale metal-oxo cluster, (n-Bu4N)2[Mo5NaO13(OCH3)4(NO)], (MLPOM), organically-derivatized from monolacunary Lindqvist-type polyoxomolybdate, is found to specifically react with Hg2+ in methanol/water via structural transformation. The MLPOM methanol solution displays a color change from purple to brown within seconds after being mixed with an aqueous solution containing Hg2+. By comparing the structure of polyoxomolybdate before and after reaction, the color change is revealed to be the essentially structural transformation of MLPOM accelerated by Hg2+. Based on this discovery, MLPOM could be utilized as a colorimetric sensor to sense the existence of Hg2+, and a simple and label-free method is developed to selectively detect aqueous Hg2+. Furthermore, the colorimetric sensor has been applied to indicating mercury contamination in industrial sewage.

  10. Complexes of selected transition metal ions with 4-oxo-4-{[3-(trifluoromethyl)phenyl]amino}but-2-enoic acid: Synthesis, structure and magnetic properties

    NASA Astrophysics Data System (ADS)

    Ferenc, Wiesława; Sadowski, Paweł; Tarasiuk, Bogdan; Cristóvão, Beata; Drzewiecka-Antonik, Aleksandra; Osypiuk, Dariusz; Sarzyński, Jan

    2015-07-01

    The new complexes of 4-oxo-4-{[3-(trifluoromethyl)phenyl]amino}but-2-enoic acid, HL anion with Mn(II), Co(II), Ni(II), Cu(II) and Pr(III), Nd(III), Sm(III), Gd(III), Dy(III), Ho(III), Er(III), Y(III) were synthesized and some of their physico-chemical properties investigated. The complexes form hydrates with two or three molecules of water. The carboxylate groups act as a bidentate bridging or chelating ligand. The compounds of Pr(III), Nd(III), Sm(III), Gd(III), Dy(III), Ho(III), Er(III) and Y(III) are amorphous solids while those of Cu(II), Co(II), Ni(II) and Mn(II) crystalline ones that crystallize in monoclinic system. Complex of Cu(II) is the centrosymmetric dinuclear compound. Around both Cu(II) cations the tetragonal pyramide is formed. Being heated in air at 293-1173 K the complexes are decomposed in three steps. The oxides of appropriate metals are the final products of complex decomposition. All analysed compounds obey Curie-Weiss law. They show the paramagnetic properties with the ferromagnetic interactions between molecular centres.

  11. Label-free colorimetric detection of mercury via Hg2+ ions-accelerated structural transformation of nanoscale metal-oxo clusters

    PubMed Central

    Chen, Kun; She, Shan; Zhang, Jiangwei; Bayaguud, Aruuhan; Wei, Yongge

    2015-01-01

    Mercury and its compounds are known to be extremely toxic but widely distributed in environment. Although many works have been reported to efficiently detect mercury, development of simple and convenient sensors is still longed for quick analyzing mercury in water. In this work, a nanoscale metal-oxo cluster, (n-Bu4N)2[Mo5NaO13(OCH3)4(NO)], (MLPOM), organically-derivatized from monolacunary Lindqvist-type polyoxomolybdate, is found to specifically react with Hg2+ in methanol/water via structural transformation. The MLPOM methanol solution displays a color change from purple to brown within seconds after being mixed with an aqueous solution containing Hg2+. By comparing the structure of polyoxomolybdate before and after reaction, the color change is revealed to be the essentially structural transformation of MLPOM accelerated by Hg2+. Based on this discovery, MLPOM could be utilized as a colorimetric sensor to sense the existence of Hg2+, and a simple and label-free method is developed to selectively detect aqueous Hg2+. Furthermore, the colorimetric sensor has been applied to indicating mercury contamination in industrial sewage. PMID:26559602

  12. A combination of both arginine- and lysine-specific gingipain activity of Porphyromonas gingivalis is necessary for the generation of the micro-oxo bishaem-containing pigment from haemoglobin.

    PubMed Central

    Smalley, John W; Thomas, Michael F; Birss, Andrew J; Withnall, Robert; Silver, Jack

    2004-01-01

    The black pigment of Porphyromonas gingivalis is composed of the mu-oxo bishaem complex of Fe(III) protoporphyrin IX (mu-oxo oligomer, dimeric haem), namely [Fe(III)PPIX]2O. P. gingivalis W50 and Rgp (Arg-gingipain)- and Kgp (Lys-gingipain)-deficient mutants K1A, D7, E8 and W501 [Aduse-Opoku, Davies, Gallagher, Hashim, Evans, Rangarajan, Slaney and Curtis (2000) Microbiology 146, 1933-1940] were grown on horse blood/agar for 14 days and examined for the production of mu-oxo bishaem. Mu-oxo Bishaem was detected by UV-visible, Mössbauer and Raman spectroscopies in wild-type W50 and in the black-pigmented RgpA- and RgpB-deficient mutants (W501 and D7 respectively), whereas no haem species were detected in the straw-coloured colonies of Kgp-deficient strain K1A. The dark brown pigment of the double RgpA/RgpB knockout mutant (E8) was not composed of mu-oxo bishaem, but of a high-spin monomeric Fe(III) protoporphyrin IX species (possibly a haem-albumin complex). In vitro incubation of oxyhaemoglobin with cells of the W50 strain and the RgpA- and RgpB-deficient mutants (W501 and D7) resulted in the formation of mu-oxo bishaem via methaemoglobin as an intermediate. Although the Kgp-deficient strain K1A converted oxyhaemoglobin into methaemoglobin, this was not further degraded into mu-oxo bishaem. The double RgpA/RgpB knockout was also not capable of producing mu-oxo bishaem from oxyhaemoglobin, but instead generated a haemoglobin haemichrome. Inhibition of Arg-X protease activity of W50, W501, D7 and K1A with leupeptin, under conditions where Lys-X protease activity was unaffected, prevented the production of mu-oxo bishaem from oxyhaemoglobin, but resulted in the formation of a haemoglobin haemichrome. These results show that one or both of RgpA and RgpB gingipains, in addition to the lysine-specific gingipain, is necessary for the production of mu-oxo bishaem from haemoglobin by whole cells of P. gingivalis. PMID:14741050

  13. Metabolic characteristics of 13-cis-retinoic acid (isotretinoin) and anti-tumour activity of the 13-cis-retinoic acid metabolite 4-oxo-13-cis-retinoic acid in neuroblastoma

    PubMed Central

    Sonawane, Poonam; Cho, Hwang Eui; Tagde, Ashujit; Verlekar, Dattesh; Yu, Alice L; Reynolds, C Patrick; Kang, Min H

    2014-01-01

    Background and Purpose Isotretinoin (13-cis-retinoic acid; 13-cRA) is a differentiation inducer used to treat minimal residual disease after myeloablative therapy for high-risk neuroblastoma. However, more than 40% of children develop recurrent disease during or after 13-cRA treatment. The plasma concentrations of 13-cRA in earlier studies were considered subtherapeutic while 4-oxo-13-cis-RA (4-oxo-13-cRA), a metabolite of 13-cRA considered by some investigators as inactive, were greater than threefold higher than 13-cRA. We sought to define the metabolic pathways of 13-cRA and investigated the anti-tumour activity of its major metabolite, 4-oxo-13-cRA. Experimental Approach Effects of 13-cRA and 4-oxo-13-cRA on human neuroblastoma cell lines were assessed by DIMSCAN and flow cytometry for cell proliferation, MYCN down-regulation by reverse transcription PCR and immunoblotting, and neurite outgrowth by confocal microscopy. 13-cRA metabolism was determined using tandem MS in human liver microsomes and in patient samples. Key Results Six major metabolites of 13-cRA were identified in patient samples. Of these, 4-oxo-13-cRA was the most abundant, and 4-oxo-13-cRA glucuronide was also detected at a higher level in patients. CYP3A4 was shown to play a major role in catalysing 13-cRA to 4-oxo-13-cRA. In human neuroblastoma cell lines, 4-oxo-13-cRA and 13-cRA were equi-effective at inducing neurite outgrowth, inhibiting proliferation, decreasing MYCN mRNA and protein, and increasing the expression of retinoic acid receptor-β mRNA and protein levels. Conclusions and Implications We showed that 4-oxo-13-cRA is as active as 13-cRA against neuroblastoma cell lines. Plasma levels of both 13-cRA and 4-oxo-13-cRA should be evaluated in pharmacokinetic studies of isotretinoin in neuroblastoma. PMID:25039756

  14. Synthesis, structure, optical properties, antifungal and antibacterial activities of 2-(1-oxo-1H-2,3-dihydroisoindol-2-yl)-3-imidazolyl-L-lactamic acid

    NASA Astrophysics Data System (ADS)

    Jia, Ting; Zhang, Wei-Long; Chen, Yun; Cai, Shuang-Lian; Yi, Hai-Bo

    2013-10-01

    2-(1-oxo-1H-2,3-dihydroisoindol-2-yl)-3-imidazolyl-L-lactamic acid has been prepared conveniently by the condensation reaction of o-phthalaldehyde (OPA) with L-Histidine, and its single crystal structure has been characterized by X-ray crystallography method. The in vitro antifungal and antibacterial activities of the compound were investigated with the representative strains of Candida albicans, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. Its luminescent and nonlinear optical properties have also been investigated. Second-harmonic-generation (SHG) measurements indicate that compound 1 displays a weak SHG response of about 0.75 times that of KH2PO4.

  15. The Recently Identified Isoleucine Conjugate of cis-12-Oxo-Phytodienoic Acid Is Partially Active in cis-12-Oxo-Phytodienoic Acid-Specific Gene Expression of Arabidopsis thaliana.

    PubMed

    Arnold, Monika D; Gruber, Cornelia; Floková, Kristýna; Miersch, Otto; Strnad, Miroslav; Novák, Ondřej; Wasternack, Claus; Hause, Bettina

    2016-01-01

    Oxylipins of the jasmonate family are active as signals in plant responses to biotic and abiotic stresses as well as in development. Jasmonic acid (JA), its precursor cis-12-oxo-phytodienoic acid (OPDA) and the isoleucine conjugate of JA (JA-Ile) are the most prominent members. OPDA and JA-Ile have individual signalling properties in several processes and differ in their pattern of gene expression. JA-Ile, but not OPDA, is perceived by the SCFCOI1-JAZ co-receptor complex. There are, however, numerous processes and genes specifically induced by OPDA. The recently identified OPDA-Ile suggests that OPDA specific responses might be mediated upon formation of OPDA-Ile. Here, we tested OPDA-Ile-induced gene expression in wild type and JA-deficient, JA-insensitive and JA-Ile-deficient mutant background. Tests on putative conversion of OPDA-Ile during treatments revealed only negligible conversion. Expression of two OPDA-inducible genes, GRX480 and ZAT10, by OPDA-Ile could be detected in a JA-independent manner in Arabidopsis seedlings but less in flowering plants. The data suggest a bioactivity in planta of OPDA-Ile. PMID:27611078

  16. Synthesis and Structure–Activity Relationships of N-(2-Oxo-3-oxetanyl)amides as N-Acylethanolamine-hydrolyzing Acid Amidase Inhibitors

    PubMed Central

    Solorzano, Carlos; Antonietti, Francesca; Duranti, Andrea; Tontini, Andrea; Rivara, Silvia; Lodola, Alessio; Vacondio, Federica; Tarzia, Giorgio; Piomelli, Daniele; Mor, Marco

    2010-01-01

    The fatty acid ethanolamides (FAEs) are a family of bioactive lipid mediators that include the endogenous agonist of peroxisome proliferator-activated receptor-α, palmitoylethanolamide (PEA). FAEs are hydrolyzed intracellularly by either fatty acid amide hydrolase or N-acylethanolamine-hydrolyzing acid amidase (NAAA). Selective inhibition of NAAA by (S)-N-(2-oxo-3-oxetanyl)-3-phenylpropionamide [(S)-OOPP, 7a] prevents PEA degradation in mouse leukocytes and attenuates responses to proinflammatory stimuli. Starting from the structure of 7a a series of β-lactones was prepared and tested on recombinant rat NAAA to explore structure-activity relationships (SARs) for this class of inhibitors and improve their in vitro potency. Following the hypothesis that these compounds inhibit NAAA by acylation of the catalytic cysteine, we identified several requirements for recognition at the active site and obtained new potent inhibitors. In particular, (S)-N-(2-oxo-3-oxetanyl)biphenyl-4-carboxamide (7h) was more potent than 7a at inhibiting recombinant rat NAAA activity (7a, IC50 = 420 nM; 7h, IC50 = 115 nM) in vitro and at reducing carrageenan-induced leukocyte infiltration in vivo. PMID:20604568

  17. Synthesis, characterisation, reactivity and in vitro antiamoebic activity of hydrazone based oxovanadium(IV), oxovanadium(V) and mu-bis(oxo)bis{oxovanadium(V)} complexes.

    PubMed

    Maurya, Mannar R; Agarwal, Shalu; Abid, Mohammad; Azam, Amir; Bader, Cerstin; Ebel, Martin; Rehder, Dieter

    2006-02-21

    Binuclear, mu-bis(oxo)bis{oxovanadium(V)} complexes [(VOL)2(mu-O)2](2 and 7)(where HL are the hydrazones Hacpy-nah I or Hacpy-fah II; acpy = 2-acetylpyridine, nah = nicotinic acid hydrazide and fah = 2-furoic acid hydrazide) were prepared by the reaction of [VO(acac)2] and the ligands in methanol followed by aerial oxidation. The paramagnetic intermediate complexes [VO(acac)(acpy-nah)](1) and [VO(acac)(acpy-fah)](6) have also been isolated. Treatment of [VO(acac)(acpy-nah)] and [VO(acac)(acpy-fah)] with aqueous H2O2 yields the oxoperoxovanadium(V) complexes [VO(O2)(acpy-nah)](3) and [VO(O2)(acpy-fah)](8). In the presence of catechol (H2cat) or benzohydroxamic acid (H2bha), 1 and 6 give the mixed chelate complexes [VO(cat)L](HL =I: 4, HL =II: 9) or [VO(bha)L](HL =I: 5, HL =II: 10). Complexes 4, 5, 9 and 10 slowly convert to the corresponding oxo-mu-oxo species 2 and 7 in DMF solution. Ascorbic acid enhances this conversion under aerobic conditions, possibly through reduction of these complexes with concomitant removal of coordinated catecholate or benzohydroxamate. Acidification of 7 with HCl dissolved in methanol afforded a hydroxo(oxo) complex. The crystal and molecular structure of 2.1.5H2O has been determined, and the structure of 7 re-determined, by single crystal X-ray diffraction. Both of these binuclear complexes contain the uncommon asymmetrical {VO(mu-O)}2 diamond core. The in vitro tests of the antiamoebic activity of ligands I and II and their binuclear complexes 2 and 7 against the protozoan parasite Entamoeba histolytica show that the ligands have no amoebicidal activity while their vanadium complexes 2 and 7 display more effective amoebicidal activity than the most commonly used drug metronidazole (IC50 values are 1.68 and 0.45 microM, respectively vs 1.81 microM for metronidazole). Complexes 2 and 7 catalyse the oxidation of styrene and ethyl benzene effectively. Oxidation of styrene, using H2O2 as an oxidant, gives styrene epoxide, 2

  18. Synthesis and Antibacterial Activity of 3-(Substituted)-2-(4-oxo-2-phenylquinazolin-3(4H)-ylamino)quinazolin-4(3H)-one.

    PubMed

    Appani, Ramgopal; Bhukya, Baburao; Gangarapu, Kiran

    2016-01-01

    A series of novel 3-(substituted)-2-(substituted quinazolinylamino)quinazolin-4(3H)-ones were synthesized by the reaction of 3-(substituted)-2-hydrazino-quinazoline-4(3H)-ones with 2-phenyl-3,1-benzoxazin-4-one. The starting materials 3-(substituted)-2-hydrazino-quinazolin-4(3H)-ones were synthesized from various primary amines by a multistep synthesis. All the title compounds were tested for their antibacterial activity using ciprofloxacin as reference standard. Compounds 3-(4-fluorophenyl)-2-(4-oxo-2-phenylquinazolin-3(4H)-ylamino)quinazolin-4(3H)-one (9a) and 3-(4-chlorophenyl)-2-(4-oxo-2-phenylquinazolin-3(4H)-ylamino)quinazolin-4(3H)-one (9h) emerged as the most active compounds of the series. These compounds have shown most potent antibacterial activity against the tested organisms of Proteus vulgaris and Bacillus subtilis having zone of inhibition values of 1.1 cm and 1.4 cm for compound 9a 1.2 cm and 1.0 cm for compound 9h, respectively. PMID:27190676

  19. Synthesis and Antibacterial Activity of 3-(Substituted)-2-(4-oxo-2-phenylquinazolin-3(4H)-ylamino)quinazolin-4(3H)-one

    PubMed Central

    Appani, Ramgopal; Bhukya, Baburao; Gangarapu, Kiran

    2016-01-01

    A series of novel 3-(substituted)-2-(substituted quinazolinylamino)quinazolin-4(3H)-ones were synthesized by the reaction of 3-(substituted)-2-hydrazino-quinazoline-4(3H)-ones with 2-phenyl-3,1-benzoxazin-4-one. The starting materials 3-(substituted)-2-hydrazino-quinazolin-4(3H)-ones were synthesized from various primary amines by a multistep synthesis. All the title compounds were tested for their antibacterial activity using ciprofloxacin as reference standard. Compounds 3-(4-fluorophenyl)-2-(4-oxo-2-phenylquinazolin-3(4H)-ylamino)quinazolin-4(3H)-one (9a) and 3-(4-chlorophenyl)-2-(4-oxo-2-phenylquinazolin-3(4H)-ylamino)quinazolin-4(3H)-one (9h) emerged as the most active compounds of the series. These compounds have shown most potent antibacterial activity against the tested organisms of Proteus vulgaris and Bacillus subtilis having zone of inhibition values of 1.1 cm and 1.4 cm for compound 9a 1.2 cm and 1.0 cm for compound 9h, respectively. PMID:27190676

  20. The plant limonoid 7-oxo-deacetoxygedunin inhibits RANKL-induced osteoclastogenesis by suppressing activation of the NF-{kappa}B and MAPK pathways

    SciTech Connect

    Wisutsitthiwong, Chonnaree; Buranaruk, Chayanit; Pudhom, Khanitha; Palaga, Tanapat

    2011-11-18

    Highlights: Black-Right-Pointing-Pointer A gedunin type limonoid from seeds of mangroves, 7-oxo-7-deacetoxygedunin, exhibits strong anti-osteoclastogenic activity. Black-Right-Pointing-Pointer Treatment with this limonoid results in significant decrease in expression of NFATc1 and osteoclast-related genes. Black-Right-Pointing-Pointer The mode of action of this limonoid is by inhibiting activation of the NF-{kappa}B and MAPK pathways which are activated by RANKL. -- Abstract: Osteoclasts together with osteoblasts play pivotal roles in bone remodeling. Aberrations in osteoclast differentiation and activity contribute to osteopenic disease. Osteoclasts differentiate from monocyte/macrophage progenitors, a process that is initiated by the interaction between receptor activator of NF-{kappa}B (RANK) and its ligand, RANKL. In this study, we identified 7-oxo-7-deacetoxygedunin (7-OG), a gedunin type limonoid from seeds of the mangrove Xylocarpus moluccensis, as a potent inhibitor of osteoclastogenesis. Additionally, 7-OG showed strong anti-osteoclastogenic activity with low cytotoxicity against the monocyte/macrophage progenitor cell line, RAW264.7. The IC50 for anti-osteoclastogenic activity was 4.14 {mu}M. Treatment with 7-OG completely abolished the appearance of multinucleated giant cells with tartrate-resistant acid phosphatase activity in RAW264.7 cells stimulated with RANKL. When the expression of genes related to osteoclastogenesis was investigated, a complete downregulation of NFATc1 and cathepsin K and a delayed downregulation of irf8 were observed upon 7-OG treatment in the presence of RANKL. Furthermore, treatment with this limonoid suppressed RANKL-induced activation of p38, MAPK and Erk and nuclear localization of NF-{kappa}B p65. Taken together, we present evidence indicating a plant limonoid as a novel osteoclastogenic inhibitor that could be used for osteoporosis and related conditions.

  1. Active Metal-Insulator-Metal Plasmonic Devices

    NASA Astrophysics Data System (ADS)

    Diest, Kenneth Alexander

    As the field of photonics constantly strives for ever smaller devices, the diffraction limit of light emerges as a fundamental limitation in this pursuit. A growing number of applications for optical "systems on a chip" have inspired new ways of circumventing this issue. One such solution to this problem is active plasmonics. Active plasmonics is an emerging field that enables light compression into nano-structures based on plasmon resonances at a metal-dielectric interface and active modulation of these plasmons with an applied external field. One area of active plasmonics has focused on replacing the dielectric layer in these waveguides with an electro-optic material and designing the resulting structures in such a way that the transmitted light can be modulated. These structures can be utilized to design a wide range of devices including optical logic gates, modulators, and filters. This thesis focuses on replacing the dielectric layer within a metal-insulator-metal plasmonic waveguide with a range of electrically active materials. By applying an electric field between the metal layers, we take advantage of the electro-optic effect in lithium niobate, and modulating the carrier density distribution across the structure in n-type silicon and indium tin oxide. The first part of this thesis looks at fabricating metal-insulator-metal waveguides with ion-implantation induced layer transferred lithium niobate. The process is analyzed from a thermodynamic standpoint and the ion-implantation conditions required for layer transfer are determined. The possible failure mechanisms that can occur during this process are analyzed from a thin-film mechanics standpoint, and a metal-bonding method to improve successful layer transfer is proposed and analyzed. Finally, these devices are shown to naturally filter white light into individual colors based on the interference of the different optical modes within the dielectric layer. Full-field electromagnetic simulations show that

  2. Conventional and microwave assisted synthesis of some new N-[(4-oxo-2-substituted aryl -1, 3-thiazolidine)-acetamidyl]-5-nitroindazoles and its antimicrobial activity.

    PubMed

    Upadhyay, Apoorva; Srivastava, S K; Srivastava, S D

    2010-09-01

    Several new N-[(4-oxo-2-substituted aryl-1, 3-thiazolidine)-acetamidyl]-5-nitroindazoles (4a-l) were synthesized from N-(arylidene amino acetamidyl)-5-nitroindazoles (3a-l). The reactions were carried out by both conventional as well as microwave method. The structures of these compounds were confirmed by IR, (1)H NMR, (13)C NMR, FAB-mass spectra and also by microanalytical data. The newly synthesized compounds were evaluated for their antimicrobial activity against variety of bacterial and fungal strains. The compounds 4 g and 4 h showed the maximum antibacterial activity (MIC 11 and 10 microg/mL) against Escherichia coli and antifungal activity (MIC 9 and 8 microg/mL) against Fusarium oxysporum. PMID:20570024

  3. Enantiomerically pure 3-aryl- and 3-hetaryl-2-hydroxypropanoic acids by chemoenzymatic reduction of 2-oxo acids.

    PubMed

    Sivanathan, Sivatharushan; Körber, Florian; Tent, Jannis Aron; Werner, Svenja; Scherkenbeck, Jürgen

    2015-03-01

    Phenyllactic acids are found in numerous natural products as well as in active substances used in medicine or plant protection. Enantiomerically pure phenyllactic acids are available by transition-metal-catalyzed hydrogenations or chemoenzymatic reductions of the corresponding 3-aryl-2-oxopropanoic acids. We show here that d-lactate dehydrogenase from Staphylococcus epidermidis reduces a broad spectrum of 2-oxo acids, which are difficult substrates for transition-metal-catalyzed reactions, with excellent enantioselectivities in a simple experimental setup. PMID:25647633

  4. The activity of HYDROPEROXIDE LYASE 1 regulates accumulation of galactolipids containing 12-oxo-phytodienoic acid in Arabidopsis

    PubMed Central

    Nilsson, Anders K.; Fahlberg, Per; Johansson, Oskar N.; Hamberg, Mats; Andersson, Mats X.; Ellerström, Mats

    2016-01-01

    Arabidopsis produces galactolipids containing esters of 12-oxo-phytodienoic acid (OPDA) and dinor-12-oxo-phytodienoic acid (dnOPDA). These lipids are referred to as arabidopsides and accumulate in response to abiotic and biotic stress. We explored the natural genetic variation found in 14 different Arabidopsis accessions to identify genes involved in the formation of arabidopsides. The accession C24 was identified as a poor accumulator of arabidopsides whereas the commonly used accession Col-0 was found to accumulate comparably large amounts of arabidopsides in response to tissue damage. A quantitative trait loci analysis of an F2 population created from a cross between C24 and Col-0 located a region on chromosome four strongly linked to the capacity to form arabidopsides. Expression analysis of HYDROPEROXIDE LYASE 1 (HPL1) showed large differences in transcript abundance between accessions. Transformation of Col-0 plants with the C24 HPL1 allele under transcriptional regulation of the 35S promoter revealed a strong negative correlation between HPL1 expression and arabidopside accumulation after tissue damage, thereby strengthening the view that HPL1 competes with ALLENE OXIDE SYNTHASE (AOS) for lipid-bound hydroperoxide fatty acids. We further show that the last step in the synthesis of galactolipid-bound OPDA and dnOPDA from unstable allene oxides is exclusively enzyme-catalyzed and not the result of spontaneous cyclization. Thus, the results presented here together with previous studies suggest that all steps in arabidopside biosynthesis are enzyme-dependent and apparently all reactions can take place with substrates being esterified to galactolipids. PMID:27422994

  5. 10-oxo-12(Z)-octadecenoic acid, a linoleic acid metabolite produced by gut lactic acid bacteria, potently activates PPARγ and stimulates adipogenesis

    SciTech Connect

    Goto, Tsuyoshi; Kim, Young-Il; Furuzono, Tomoya; Takahashi, Nobuyuki; Yamakuni, Kanae; Yang, Ha-Eun; Li, Yongjia; Ohue, Ryuji; Nomura, Wataru; Sugawara, Tatsuya; Yu, Rina; Kitamura, Nahoko; and others

    2015-04-17

    Our previous study has shown that gut lactic acid bacteria generate various kinds of fatty acids from polyunsaturated fatty acids such as linoleic acid (LA). In this study, we investigated the effects of LA and LA-derived fatty acids on the activation of peroxisome proliferator-activated receptors (PPARs) which regulate whole-body energy metabolism. None of the fatty acids activated PPARδ, whereas almost all activated PPARα in luciferase assays. Two fatty acids potently activated PPARγ, a master regulator of adipocyte differentiation, with 10-oxo-12(Z)-octadecenoic acid (KetoA) having the most potency. In 3T3-L1 cells, KetoA induced adipocyte differentiation via the activation of PPARγ, and increased adiponectin production and insulin-stimulated glucose uptake. These findings suggest that fatty acids, including KetoA, generated in gut by lactic acid bacteria may be involved in the regulation of host energy metabolism. - Highlights: • Most LA-derived fatty acids from gut lactic acid bacteria potently activated PPARα. • Among tested fatty acids, KetoA and KetoC significantly activated PPARγ. • KetoA induced adipocyte differentiation via the activation of PPARγ. • KetoA enhanced adiponectin production and glucose uptake during adipogenesis.

  6. Kinetic Analysis of Human PrimPol DNA Polymerase Activity Reveals a Generally Error-Prone Enzyme Capable of Accurately Bypassing 7,8-Dihydro-8-oxo-2′-deoxyguanosine

    PubMed Central

    2015-01-01

    Recent studies have identified human PrimPol as a new RNA/DNA primase and translesion DNA synthesis polymerase (TLS pol) that contributes to nuclear and mitochondrial DNA replication. We investigated the mechanism of PrimPol polymerase activity on both undamaged and damaged DNA substrates. With Mg2+ as a cofactor, PrimPol binds primer-template DNA with low affinity Kd,DNA values (∼200–1200 nM). DNA binding is enhanced 34-fold by Mn2+ (Kd,DNA = 27 nM). The pol activity of PrimPol is increased 400–1000-fold by Mn2+ compared to Mg2+ based on steady-state kinetic parameters. PrimPol makes a mistake copying undamaged DNA once every ∼100–2500 insertions events, which is comparable to other TLS pols, and the fidelity of PrimPol is ∼1.7-fold more accurate when Mg2+ is the cofactor compared to Mn2+. PrimPol inserts dCMP opposite 8-oxo-dG with 2- (Mn2+) to 6-fold (Mg2+) greater efficiency than dAMP misinsertion. PrimPol-catalyzed dCMP insertion opposite 8-oxo-dG proceeds at ∼25% efficiency relative to unmodified template dG, and PrimPol readily extends from dC:8-oxo-dG base pairs (bps) with ∼2-fold greater efficiency than dA:8-oxo-dG bps. A tetrahydrofuran (THF) abasic-site mimic decreases PrimPol activity to ∼0.04%. In summary, PrimPol exhibits the fidelity typical of other TLS pols, is rather unusual in the degree of activation afforded by Mn2+, and accurately bypasses 8-oxo-dG, a DNA lesion of special relevance to mitochondrial DNA replication and transcription. PMID:25255211

  7. A Highly Reactive Seven-Coordinate Osmium(V) Oxo Complex: [Os(V)(O)(qpy)(pic)Cl](2+).

    PubMed

    Liu, Yingying; Ng, Siu-Mui; Lam, William W Y; Yiu, Shek-Man; Lau, Tai-Chu

    2016-01-01

    Seven-coordinate ruthenium oxo species have been proposed as active intermediates in catalytic water oxidation by a number of highly active ruthenium catalysts, however such species have yet to be isolated. Reported herein is the first example of a seven-coordinate group 8 metal-oxo species, [Os(V)(O)(qpy)(pic)Cl](2+) (qpy = 2,2':6',2'':6'',2'''-quaterpyridine, pic = 4-picoline). The X-ray crystal structure of this complex shows that it has a distorted pentagonal bipyramidal geometry with an Os=O distance of 1.7375 Å. This oxo species undergoes facile O-atom and H-atom-transfer reactions with various organic substrates. Notably it can abstract H atoms from alkylaromatics with C-H bond dissociation energy as high as 90 kcal mol(-1). This work suggests that highly active oxidants may be designed based on group 8 seven-coordinate metal oxo species. PMID:26554748

  8. A well-defined terminal vanadium(III) oxo complex.

    PubMed

    King, Amanda E; Nippe, Michael; Atanasov, Mihail; Chantarojsiri, Teera; Wray, Curtis A; Bill, Eckhard; Neese, Frank; Long, Jeffrey R; Chang, Christopher J

    2014-11-01

    The ubiquity of vanadium oxo complexes in the V+ and IV+ oxidation states has contributed to a comprehensive understanding of their electronic structure and reactivity. However, despite being predicted to be stable by ligand-field theory, the isolation and characterization of a well-defined terminal mononuclear vanadium(III) oxo complex has remained elusive. We present the synthesis and characterization of a unique terminal mononuclear vanadium(III) oxo species supported by the pentadentate polypyridyl ligand 2,6-bis[1,1-bis(2-pyridyl)ethyl]pyridine (PY5Me2). Exposure of [V(II)(NCCH3)(PY5Me2)](2+) (1) to either dioxygen or selected O-atom-transfer reagents yields [V(IV)(O)(PY5Me2)](2+) (2). The metal-centered one-electron reduction of this vanadium(IV) oxo complex furnishes a stable, diamagnetic [V(III)(O)(PY5Me2)](+) (3) species. The vanadium(III) oxo species is unreactive toward H- and O-atom transfer but readily reacts with protons to form a putative vanadium hydroxo complex. Computational results predict that further one-electron reduction of the vanadium(III) oxo species will result in ligand-based reduction, even though pyridine is generally considered to be a poor π-accepting ligand. These results have implications for future efforts toward low-valent vanadyl chemistry, particularly with regard to the isolation and study of formal vanadium(II) oxo species. PMID:25097094

  9. Antimycobacterial activity of new N(1)-[1-[1-aryl-3-[4-(1H-imidazol-1-yl)phenyl]-3-oxo]propyl]-pyridine-2-carboxamidrazone derivatives.

    PubMed

    Zampieri, Daniele; Mamolo, Maria Grazia; Vio, Luciano; Romano, Maurizio; Skoko, Nataša; Baralle, Marco; Pau, Valentina; De Logu, Alessandro

    2016-07-15

    N(1)-[1-[1-aryl-3-[4-(1H-imidazol-1-yl)phenyl]-3-oxo]propyl]-pyridine-2-carboxamidrazone derivatives were design, synthesized and tested for their in vitro antimycobacterial activity. The new compounds showed a moderate antimycobacterial activity against the tested strain of Mycobacterium tuberculosis H37Ra and a significant antimycobacterial activity against several mycobacteria other than tuberculosis strains. PMID:27241693

  10. Actively convected liquid metal divertor

    NASA Astrophysics Data System (ADS)

    Shimada, Michiya; Hirooka, Yoshi

    2014-12-01

    The use of actively convected liquid metals with j × B force is proposed to facilitate heat handling by the divertor, a challenging issue associated with magnetic fusion experiments such as ITER. This issue will be aggravated even more for DEMO and power reactors because the divertor heat load will be significantly higher and yet the use of copper would not be allowed as the heat sink material. Instead, reduced activation ferritic/martensitic steel alloys with heat conductivities substantially lower than that of copper, will be used as the structural materials. The present proposal is to fill the lower part of the vacuum vessel with liquid metals with relatively low melting points and low chemical activities including Ga and Sn. The divertor modules, equipped with electrodes and cooling tubes, are immersed in the liquid metal. The electrode, placed in the middle of the liquid metal, can be biased positively or negatively with respect to the module. The j × B force due to the current between the electrode and the module provides a rotating motion for the liquid metal around the electrodes. The rise in liquid temperature at the separatrix hit point can be maintained at acceptable levels from the operation point of view. As the rotation speed increases, the current in the liquid metal is expected to decrease due to the v × B electromotive force. This rotating motion in the poloidal plane will reduce the divertor heat load significantly. Another important benefit of the convected liquid metal divertor is the fast recovery from unmitigated disruptions. Also, the liquid metal divertor concept eliminates the erosion problem.

  11. The plant limonoid 7-oxo-deacetoxygedunin inhibits RANKL-induced osteoclastogenesis by suppressing activation of the NF-κB and MAPK pathways.

    PubMed

    Wisutsitthiwong, Chonnaree; Buranaruk, Chayanit; Pudhom, Khanitha; Palaga, Tanapat

    2011-11-18

    Osteoclasts together with osteoblasts play pivotal roles in bone remodeling. Aberrations in osteoclast differentiation and activity contribute to osteopenic disease. Osteoclasts differentiate from monocyte/macrophage progenitors, a process that is initiated by the interaction between receptor activator of NF-κB (RANK) and its ligand, RANKL. In this study, we identified 7-oxo-7-deacetoxygedunin (7-OG), a gedunin type limonoid from seeds of the mangrove Xylocarpus moluccensis, as a potent inhibitor of osteoclastogenesis. Additionally, 7-OG showed strong anti-osteoclastogenic activity with low cytotoxicity against the monocyte/macrophage progenitor cell line, RAW264.7. The IC50 for anti-osteoclastogenic activity was 4.14μM. Treatment with 7-OG completely abolished the appearance of multinucleated giant cells with tartrate-resistant acid phosphatase activity in RAW264.7 cells stimulated with RANKL. When the expression of genes related to osteoclastogenesis was investigated, a complete downregulation of NFATc1 and cathepsin K and a delayed downregulation of irf8 were observed upon 7-OG treatment in the presence of RANKL. Furthermore, treatment with this limonoid suppressed RANKL-induced activation of p38, MAPK and Erk and nuclear localization of NF-κB p65. Taken together, we present evidence indicating a plant limonoid as a novel osteoclastogenic inhibitor that could be used for osteoporosis and related conditions. PMID:22037580

  12. Bivalent transition metal complexes of coumarin-3-yl thiosemicarbazone derivatives: Spectroscopic, antibacterial activity and thermogravimetric studies

    NASA Astrophysics Data System (ADS)

    Refat, Moamen S.; El-Deen, Ibrahim M.; Anwer, Zeinab M.; El-Ghol, Samir

    2009-02-01

    Schiff base complexes of Cu(II), Co(II) and Ni(II) with two coumarin-3-yl thiosemicarbazone derivatives (1E)-1-(1-(2-oxo-2H-chromen-3-yl)ethylidene)thiosemicarbazide (OCET) and (1E)-1-(1-(6-bromo-2-oxo-2H-chromen-3-yl)ethylidene)thiosemicarbazide (BOCET) were synthesized by the reaction of Cu(II), Co(II) and Ni(II) chlorides with each mentioned ligand with molar ratio 1:2 metal-to-ligand. Both ligands and their metal complexes were characterized by different physicochemical methods, elemental analysis, molar conductivity, (UV-vis, Mass, Infrared, 1H NMR spectra) and also thermal analysis (TG and DTG) techniques. The discussion of the outcome data of the prepared complexes indicate that the coumarin-3-yl thiosemicarbazone derivatives ligands behave as a bidentate ligand through both thione sulphur and azomethine nitrogen with 1:2 (metal:ligand) stoichiometry for all complexes. The molar conductance measurements proved that the complexes are electrolytes. The kinetic thermodynamic parameters such as: E∗, Δ H∗, Δ S∗and Δ G∗are calculated from the DTG curves, all complexes are more ordered except Ni(II) complexes. The antibacterial activity of the coumarin-3-yl thiosemicarbazone derivatives and their metal complexes was evaluated against some kinds of Gram positive and Gram negative bacteria.

  13. Heterobimetallic cerium(iv) oxo clusters supported by a tripodal oxygen ligand.

    PubMed

    Wong, Kang-Long; So, Yat-Ming; Wang, Guo-Cang; Sung, Herman H-Y; Williams, Ian D; Leung, Wa-Hung

    2016-06-01

    Heterometallic Ce(IV)/M (M = Mo(VI), Re(VII), V(V)) oxo clusters supported by the Kläui tripodal oxygen ligand [(η(5)-C5H5)Co{P(O)(OEt)2}3](-) (LOEt(-)) have been synthesized and structurally characterized, and the catalytic activity of the Ce(IV)/V(V) oxo cluster in the oxidation of thioanisoles has been studied. Treatment of [Ce(LOEt)Cl3] (1) with [Ag2MoO4] afforded the reported Ce(IV)/Mo(VI) cluster [H4(CeLOEt)6Mo9O38] (2), whereas that with [AgReO4] yielded the Ce(IV)/Re(VII) cluster [{LOEtCe(ReO4)2(H2O)(μ-ReO4)}2] (3) that contains an 8-membered Ce2Re2O4 ring. Treatment of 1 with [Ag3VO4] afforded the Ce(IV)/V(V) cluster [H2(CeLOEt)4(V[double bond, length as m-dash]O)4(μ4-O)(μ3-O)12] (4) containing a {Ce4V4O13} oxo-metallic core. The solid-state structure of 4 consists of four {VO4}(3-) units bridged by four {LOEtCe(3+)} moieties and a μ4-oxo ligand. Each Ce atom in 4 is 9-coordinated, whereas the geometry around each V atom is pseudo square pyramidal with a terminal oxo at the apical position. Cluster 4 is an active catalyst for the oxidation of substituted thioanisoles with tert-butyl hydroperoxide. For example, the oxidation of thioanisole with tert-butyl hydroperoxide in the presence of 0.01 mol% of 4 gave a ca. 30 : 1 mixture of the sulfoxide and sulfone products in 96% yield. PMID:27142892

  14. Synthesis, antibacterial and antioxidant activities of new 1-alkyl-4-(1-alkyl-4-oxo-1,4-dihydroquinolin-2-yl)pyridinium bromides.

    PubMed

    Kahriman, Nuran; Yaylı, Büşra; Aktaş, Ayça; Iskefiyeli, Zeynep; Beriş, Fatih Şaban; Yaylı, Nurettin

    2013-11-01

    New 1-alkyl-4-(1-alkyl-4-oxo-1,4-dihydroquinolin-2-yl)pyridinium bromides (3a-k) were synthesized from 1,4'-diazaflavone [2-pyridin-4-ylquinolin-4(1H)-one] and evaluated for antibacterial and antioxidant activities. A rapid one-pot preparation of 1,4'-diazaflavone (2) was done from 2'-amino substituted chalcone (1) by intramolecular Michael addition using solvent-free microwave heating. New N,N'-dialkyl substituted (C₅-C₁₅) 1,4'-diazaflavonium bromides were synthesized from compound 2 with corresponding alkyl halides. Compounds 3a-k were active against six bacteria (MIC: 7.8-500.0 μg/mL). They also showed good antioxidant activities in DPPH scavenging (SC₅₀: 45-133 μg/mL) and ferric reducing/antioxidant power (14-141 μM TEAC) tests. The biological activities decreased as alkyl chain length increased. The reason behind the obvious negative effect of alkyl chain elongation is unclear and requires investigations about the intermolecular interactions of these pyridinium salts with bioassay components. PMID:24077525

  15. Studying Activity Series of Metals.

    ERIC Educational Resources Information Center

    Hoon, Tien-Ghun; And Others

    1995-01-01

    Presents teaching strategies that illustrate the linking together of numerous chemical concepts involving the activity of metals (quantitative analysis, corrosion, and electrolysis) through the use of deep-level processing strategies. Concludes that making explicit links in the process of teaching chemistry can lead effectively to meaningful…

  16. Synthesis, Characterization, Antimicrobial and Antioxidant Activities of The Homocyclotrimer Of 4-Oxo-4h-Thieno[3,4-C]Chromene-3-Diazonium Sulfate

    PubMed Central

    Sopbue Fondjo, Emmanuel; Sorel, Djeukoua Dimo Kamal; Jean-de-Dieu, Tamokou; Joseph, Tsemeugne; Sylvian, Kouamo; Doriane, Ngouanet; Rodolphe, Chouna Jean; Pepin, Nkeng-Efouet-Alango; Jules-Roger, Kuiate; Arnaud, Ngongang Ndjintchui; Lucas, Sondengam Beibam

    2016-01-01

    The in situ formed 4-oxo-4H-thieno[3,4-c]chromene-3-diazonium sulfate (5) in the coupling reactions involving the parent 2-aminothiophene (4) and various phenolic and arylamines’ couplers, readily undergoes homocyclotrimerization at low temperature to afford in fairly good yield the first ever reported eighteen member ring heteroaromatic holigomer 6. Compound 6 was fully characterized by its elemental analysis, IR, UV-Vis, 1H-NMR, 13C-NMR and HRMS spectral data. The HMBC and HSQC techniques were used to ascertain the structural assignments. A comparative study on the antimicrobial and antioxidant activities of compounds 3, 4 and 6 was carried out to assess the SAR due to the transformations (from 3 to 6 via 4) on the tested compounds. It was found that compounds 6 and 4 were respectively the most active compounds against bacteria (MIC = 32-64 μg/ml) and yeasts (MIC = 16–64 μg/ml). Compound 6 also showed high radical-scavenging activities and ferric reducing power when compared with vitamin C and BHT used as reference antioxidants. PMID:27583034

  17. (E)-4-aryl-4-oxo-2-butenoic acid amides, chalcone–aroylacrylic acid chimeras: Design, antiproliferative activity and inhibition of tubulin polymerization

    PubMed Central

    Vitorović-Todorović, Maja D.; Erić-Nikolić, Aleksandra; Kolundžija, Branka; Hamel, Ernest; Ristić, Slavica; Juranić, Ivan O.; Drakulić, Branko J.

    2013-01-01

    Antiproliferative activity of twenty-nine (E)-4-aryl-4-oxo-2-butenoic acid amides against three human tumor cell lines (HeLa, FemX, and K562) is reported. Compounds showed antiproliferative activity in one-digit micromolar to submicromolar concentrations. The most active derivatives toward all the cell lines tested bear alkyl substituents on the aroyl moiety of the molecules. Fourteen compounds showed tubulin assembly inhibition at concentrations <20 μM. The most potent inhibitor of tubulin assembly was unsubstituted compound 1, with IC50 = 2.9 μM. Compound 23 had an oral LD50 in vivo of 45 mg/kg in mice. Cell cycle analysis on K562 cells showed that compounds 1, 2 and 23 caused accumulation of cells in the G2/M phase, but inhibition of microtubule polymerization is not the principal mode of action of the compounds. Nevertheless, they may be useful leads for the design of a new class of antitubulin agents. PMID:23353745

  18. Synthesis, Characterization, Antimicrobial and Antioxidant Activities of The Homocyclotrimer Of 4-Oxo-4h-Thieno[3,4-C]Chromene-3-Diazonium Sulfate.

    PubMed

    Sopbue Fondjo, Emmanuel; Sorel, Djeukoua Dimo Kamal; Jean-de-Dieu, Tamokou; Joseph, Tsemeugne; Sylvian, Kouamo; Doriane, Ngouanet; Rodolphe, Chouna Jean; Pepin, Nkeng-Efouet-Alango; Jules-Roger, Kuiate; Arnaud, Ngongang Ndjintchui; Lucas, Sondengam Beibam

    2016-01-01

    The in situ formed 4-oxo-4H-thieno[3,4-c]chromene-3-diazonium sulfate (5) in the coupling reactions involving the parent 2-aminothiophene (4) and various phenolic and arylamines' couplers, readily undergoes homocyclotrimerization at low temperature to afford in fairly good yield the first ever reported eighteen member ring heteroaromatic holigomer 6. Compound 6 was fully characterized by its elemental analysis, IR, UV-Vis, (1)H-NMR, (13)C-NMR and HRMS spectral data. The HMBC and HSQC techniques were used to ascertain the structural assignments. A comparative study on the antimicrobial and antioxidant activities of compounds 3, 4 and 6 was carried out to assess the SAR due to the transformations (from 3 to 6 via 4) on the tested compounds. It was found that compounds 6 and 4 were respectively the most active compounds against bacteria (MIC = 32-64 μg/ml) and yeasts (MIC = 16-64 μg/ml). Compound 6 also showed high radical-scavenging activities and ferric reducing power when compared with vitamin C and BHT used as reference antioxidants. PMID:27583034

  19. Coronal Metallicities of Active Binaries

    NASA Astrophysics Data System (ADS)

    Kashyap, V.; Drake, J. J.; Pease, D. O.; Schmitt, J. H. M. M.

    1998-09-01

    We analyze EUV and X-ray data on a sample of X-ray active binary stars to determine coronal abundances. EUVE spectrometer data are used to obtain line fluxes, which are then used to determine Differential Emission Measures (DEMs). The continuum emission predicted for these DEMs (constrained at high temperatures by measurements in the X-ray regime where available) are then compared with EUVE/DS counts to derive coronal metallicities. These measurements indicate whether the coronae on these stars are metal deficient (the ``MAD Syndrome'') or subject to the FIP-effect (low First Ionization Potential elements have enhanced abundances relative to the photospheres).

  20. Charge density of the biologically active molecule (2-oxo-1,3-benzoxazol-3(2H)-yl)acetic acid.

    PubMed

    Wang, Ai; Ashurov, Jamshid; Ibragimov, Aziz; Wang, Ruimin; Mouhib, Halima; Mukhamedov, Nasir; Englert, Ulli

    2016-02-01

    (2-Oxo-1,3-benzoxazol-3(2H)-yl)acetic acid is a member of a biologically active class of compounds. Its molecular structure in the crystal has been determined by X-ray diffraction, and its gas phase structure was obtained by quantum chemical calculations at the B3LYP/6-311++G(d,p) level of theory. In order to understand the dynamics of the molecule, two presumably soft degrees of freedom associated with the relative orientation of the planar benzoxazolone system and its substituent at the N atom were varied systematically. Five conformers have been identified as local minima on the resulting two-dimensional potential energy surface within an energy window of 27 kJ mol(-1). The energetically most favourable minimum closely matches the conformation observed in the crystal. Based on high-resolution diffraction data collected at low temperature, the experimental electron density of the compound was determined. Comparison with the electron density established by theory for the isolated molecule allowed the effect of intermolecular interactions to be addressed, in particular a moderately strong O-H...O hydrogen bond with a donor...acceptor distance of 2.6177 (9) Å: the oxygen acceptor is clearly polarized in the extended solid. The hydrogen bond connects consecutive molecules to chains, and the pronounced charge separation leads to stacking between neighburs with antiparallel dipole moments perpendicular to the chain direction. PMID:26830806

  1. Novel 3,5-bis(arylidene)-4-oxo-1-piperidinyl dimers: structure-activity relationships and potent antileukemic and antilymphoma cytotoxicity.

    PubMed

    Santiago-Vazquez, Yahaira; Das, Swagatika; Das, Umashankar; Robles-Escajeda, Elisa; Ortega, Nora M; Lema, Carolina; Varela-Ramírez, Armando; Aguilera, Renato J; Balzarini, Jan; De Clercq, Erik; Dimmock, Stephen G; Gorecki, Dennis K J; Dimmock, Jonathan R

    2014-04-22

    Novel clusters of 3,5-bis(benzylidene)-4-oxo-1-piperidinyl dimers 3-5 were evaluated against human Molt4/C8 and CEM T-lymphocytes and human HeLa cervix adenocarcinoma cells as well as murine L1210 leukemia neoplasms. Several of these compounds demonstrated IC50 values in the submicromolar and low micromolar range and compounds possessing 4-fluoro, 4-chloro and 3,4,5-trimethoxy substituents in the series 3 and 4 were identified as potent molecules. A heat map revealed the very high cytotoxic potencies of representative compounds against a number of additional leukemic and lymphoma cell lines and displayed greater toxicity to these cells than nonmalignant MCF10A and Hs-27 neoplasms. These dienones are more refractory to breast and prostate cancers. The evaluation of representative compounds in series 3-5 against a panel of human cancer cell lines revealed them to be potent cytotoxins with average IC50 values ranging from 0.05 to 8.51 μM. In particular, the most potent compound 4g demonstrated over 382-fold and 590-fold greater average cytotoxic potencies in this screen than the reference drugs, melphalan and 5-fluorouracil, respectively. A mode of action investigation of two representative compounds 3f and 4f indicated that they induce apoptosis which is due, at least in part, to the activation of caspase-3 and depolarization of the mitochondrial membrane potential. PMID:24657568

  2. Site-Specific, Intramolecular Cross-Linking of Pin1 Active Site Residues by the Lipid Electrophile 4-Oxo-2-nonenal

    PubMed Central

    2016-01-01

    Products of oxidative damage to lipids include 4-hydroxy-2-nonenal (HNE) and 4-oxo-2-nonenal (ONE), both of which are cytotoxic electrophiles. ONE reacts more rapidly with nucleophilic amino acid side chains, resulting in covalent protein adducts, including residue–residue cross-links. Previously, we demonstrated that peptidylprolyl cis/trans isomerase A1 (Pin1) was highly susceptible to adduction by HNE and that the catalytic cysteine (Cys113) was the preferential site of modification. Here, we show that ONE also preferentially adducts Pin1 at the catalytic Cys but results in a profoundly different modification. Results from experiments using purified Pin1 incubated with ONE revealed the principal product to be a Cys-Lys pyrrole-containing cross-link between the side chains of Cys113 and Lys117. In vitro competition assays between HNE and ONE demonstrate that ONE reacts more rapidly than HNE with Cys113. Exposure of RKO cells to alkynyl-ONE (aONE) followed by copper-mediated click chemistry and streptavidin purification revealed that Pin1 is also modified by ONE in cells. Analysis of the Pin1 crystal structure reveals that Cys113 and Lys117 are oriented toward each other in the active site, facilitating formation of an ONE cross-link. PMID:25739016

  3. Spectral, magnetic, thermal, molecular modelling, ESR studies and antimicrobial activity of ( E )-3-(2-(2-hydroxybenzylidene) hydrazinyl)-3-oxo- n (thiazole-2-yl)propanamide complexes

    NASA Astrophysics Data System (ADS)

    Zaky, R. R.; Yousef, T. A.

    2011-09-01

    ( E)-3-(2-(2-hydroxybenzylidene)hydrazinyl)-3-oxo- n(thiazole-2-yl) propane-mide (H 2L) has been prepared and its structure confirmed by elemental analysis, IR and 1HNMR spectroscopy. It has been used to produce diverse complexes with Ni(II), Co(II) and Cu(II) ions. The complexes obtained have been investigated by thermal analysis, spectral studies (IR, UV-visible, ESR), and magnetic measurements. IR spectra suggest that the H 2L acts as a bidentate ligand coordinating via (C dbnd N) 1 and (OH) phenolic or deprotonated enolized carbonyl oxygen ( dbnd C sbnd O sbnd ) 1. The electronic spectra of the complexes and their magnetic moments provide information about geometries. The room temperature solid state ESR spectra of the Cu(II) complexes show d x2-y2 as a ground state, suggesting tetragonally distorted octahedral or square-planar geometries around Cu(II) centre. The molar conductance measurements proved that the complexes are non-electrolytes. The bond length, bond angle, HOMO, LUMO, dipole moment and charges on the atoms have been calculated to confirm the geometry of the ligand and the investigated complexes. Also, thermal properties and decomposition kinetics of all compounds are investigated. The interpretation, mathematical analysis and evaluation of kinetic parameters ( Ea, A, Δ H, Δ S and Δ G) of all thermal decomposition stages have been evaluated using Coats-Redfern and Horowitz-Metzger methods. Finally, the antimicrobial activity has been tested.

  4. Sparfloxacin-metal complexes as antifungal agents - Their synthesis, characterization and antimicrobial activities

    NASA Astrophysics Data System (ADS)

    Sultana, Najma; Arayne, M. Saeed; Gul, Somia; Shamim, Sana

    2010-06-01

    Metal complexes with the third-generation quinolone antibacterial agent sparfloxacin (SPFX) or 5-amino-1-cyclopropyl-7-(cis-3,5-dimethyl-1-piperazinyl)-6,8,di-fluoro-1-4-dihydro-4-oxo-3-quinocarboxylic acid have been synthesized and characterized with physicochemical and spectroscopic techniques such as TLC, IR, NMR and elemental analyses. In these complexes, sparfloxacin acts as bidentate deprotonated ligands bound to the metal through the pyridone oxygen and one carboxylate oxygen. The antimicrobial activity of these complexes has been evaluated against four Gram-positive and seven Gram-negative bacteria. Antifungal activity against five different fungi has been evaluated and compared with reference drug sparfloxacin. Fe 2+-SPFX and Cd 2+-SPFX complexes showed remarkable potency as compared to the parent drug.

  5. Photochemical generation and kinetic studies of a putative porphyrin-ruthenium(V)-oxo species

    PubMed Central

    Zhang, Rui; Vanover, Eric; Luo, Weilong; Newcomb, Martin

    2014-01-01

    Photo-disproportionation of a bis-porphyrin-diruthenium(IV) μ-oxo dimer gave a porphyrin-ruthenium(III) species and a putative poprhyrin-ruthenium(V)-oxo species that can be detected and studied in real time via laser flash photolysis methods. As determined by its spectral and kinetic behavior, the same oxo transient was also formed by photolysis of a porphyrin-ruthenium(III) N-oxide adduct. Second-order rate constants for reactions with several substrates at 22 °C were determined; representative values of rate constants were kox = 6.6 × 103 M−1 s−1 for diphenylmethanol, kox = 2.5 × 103 M−1 s−1 for styrene, and kox = 1.8 × 103 M−1 s−1 for cyclohexene. The putative porphyrin-ruthenium(V)-oxo transient reacted 5–6 orders of magnitude faster than the corresponding trans-dioxoruthenium(VI)-oxo porphyrins, and the rate constants obtained in this work were similar to those of corrole-iron(V)-oxo derivative. The high reactivity for the photochemically generated ruthenium-oxo species in comparison to other poprhyrin-metal-oxo intermediates suggests it is a true ruthenium(V)-oxo species. PMID:24770388

  6. Oxo-group-14-element bond formation in binuclear uranium(V) Pacman complexes.

    PubMed

    Jones, Guy M; Arnold, Polly L; Love, Jason B

    2013-07-29

    Simple and versatile routes to the functionalization of uranyl-derived U(V)-oxo groups are presented. The oxo-lithiated, binuclear uranium(V)-oxo complexes [{(py)3LiOUO}2(L)] and [{(py)3LiOUO}(OUOSiMe3)(L)] were prepared by the direct combination of the uranyl(VI) silylamide "ate" complex [Li(py)2][(OUO)(N")3] (N" = N(SiMe3)2) with the polypyrrolic macrocycle H4L or the mononuclear uranyl (VI) Pacman complex [UO2(py)(H2L)], respectively. These oxo-metalated complexes display distinct U-O single and multiple bonding patterns and an axial/equatorial arrangement of oxo ligands. Their ready availability allows the direct functionalization of the uranyl oxo group leading to the binuclear uranium(V) oxo-stannylated complexes [{(R3Sn)OUO}2(L)] (R = nBu, Ph), which represent rare examples of mixed uranium/tin complexes. Also, uranium-oxo-group exchange occurred in reactions with [TiCl(OiPr)3] to form U-O-C bonds [{(py)3LiOUO}(OUOiPr)(L)] and [(iPrOUO)2(L)]. Overall, these represent the first family of uranium(V) complexes that are oxo-functionalised by Group 14 elements. PMID:23794441

  7. Anti-CD40 Ab- or 8-oxo-dG-enhanced Treg cells reduce development of experimental autoimmune encephalomyelitis via down-regulating migration and activation of mast cells.

    PubMed

    Hong, Gwan Ui; Kim, Nam Goo; Jeoung, Dooil; Ro, Jai Youl

    2013-07-15

    This study investigated whether anti-CD40 Ab and 8-oxo-dG attenuate mast cell migration and EAE development. Anti-CD40 Ab and 8-oxo-dG reduced EAE scores, mast cell numbers, expression of adhesion molecules, OX40L and Act1, levels of TNF-α, LTs, expression of cytokines, and co-localization of Treg cells and mast cells, all of which are increased in EAE-brain tissues. Each treatment enhanced Treg cells, expression of OX40, and cytokines related to suppressive function of Treg cells in EAE brain tissues. Act-BMMCs with Treg cells reduced expression of OX40L and CCL2/CCR2, VCAM-1, PECAM-1, [Ca²⁺]i levels, release of mediators, various signaling molecules, Act1 related to IL-17a signals versus those in act-BMMCs without Treg cells. The data suggest that IL-10- and IL-35-producing Foxp3⁺-Treg cells, enhanced by anti-CD40 Ab or 8-oxo-dG, suppress migration of mast cells through down-regulating the expression of adhesion molecules, and suppress mast cell activation through cell-to-cell cross-talk via OX40/OX40L in EAE development. PMID:23622820

  8. INHIBITORY AND MECHANISTIC INVESTIGATIONS OF OXO-LIPIDS WITH HUMAN LIPOXYGENASE ISOZYMES

    PubMed Central

    Armstrong, Michelle M.; Diaz, Giovanni; Kenyon, Victor; Holman, Theodore R.

    2014-01-01

    Oxo-lipids, a large family of oxidized human lipoxygenase (hLOX) products, are of increasing interest to researchers due to their involvement in different inflammatory responses in the cell. Oxo-lipids are unique because they contain electrophilic sites that can potentially form covalent bonds through a Michael addition mechanism with nucleophilic residues in protein active sites and thus increase inhibitor potency. Due to the resemblance of oxo-lipids to LOX substrates, the inhibitor potency of 4 different oxo-lipids; 5-oxo-6,8,11,14-(E,Z,Z,Z)-eicosatetraenoic acid (5-oxo-ETE), 15-oxo-5,8,11,13-(Z,Z,Z,E)-eicosatetraenoic acid (15-oxo-ETE), 12-oxo-5,8,10,14-(Z,Z,E,Z)-eicosatetraenoic acid (12-oxo-ETE), and 13-oxo-9,11-(Z,E)-octadecadienoic acid (13-oxo-ODE) were determined against a library of LOX isozymes; leukocyte 5-lipoxygenase (h5-LOX), human reticulocyte 15-lipoxygenase-1 (h15-LOX-1), human platelet 12-lipoxygenase (h12-LOX), human epithelial 15-lipoxygenase-2 (h15-LOX-2), soybean 15-lipoxygenase-1 (s15-LOX-1), and rabbit reticulocyte 15-LOX (r15-LOX). 15-oxo-ETE exhibited the highest potency against h12-LOX, with an IC50 = 1 ± 0.1 μM and was highly selective. Steady state inhibition kinetic experiments determined 15-oxo-ETE to be a mixed inhibitor against h12-LOX, with a Kic value of 0.087 ± 0.008 μM and a Kiu value of 2.10 ± 0.8 μM. Time-dependent studies demonstrated irreversible inhibition with 12-oxo-ETE and h15-LOX-1, however, the concentration of 12-oxo-ETE required (Ki = 36.8 ± 13.2 μM) and the time frame (k2 = 0.0019 ± .00032 s−1) were not biologically relevant. These data are the first observations that oxo-lipids can inhibit LOX isozymes and may be another mechanism in which LOX products regulate LOX activity. PMID:24924423

  9. Synthesis and characterization of 3-methyl-5-oxo-N,1-diphenyl-4,5-dihydro-1-H-pyrazole-4-carbothioamide and its metal complexes

    NASA Astrophysics Data System (ADS)

    El-Shazly, R. M.

    2009-09-01

    The molecular parameters have been calculated to confirm the geometry of 3-methyl-5-oxo-N,1-diphenyl-4,5-dihydro-1-H-pyrazole-4-carbothioamide, HL. The compound is introduced as a new chelating agent for complexation with Cr(III), Fe(III), Co(II), Ni(II) and Cu(II) ions. The isolated chelates were characterized by partial elemental analyses, magnetic moments, spectra (IR, UV-vis, ESR; 1H NMR) and thermal studies. The protonation constant of HL (5.04) and the stepwise stability constants of its Co(II), Cu(II), Cr(III) and Fe(III) complexes were calculated. The ligand coordinates as a monobasic bidentate through hydroxo and thiol groups in all complexes except Cr(III) which acts as a monobasic monodentate through the enolized carbonyl oxygen. Cr(III) and Fe(III) complexes measured normal magnetic moments; Cu(II) and Co(II) measured subnormal while Ni(II) complex is diamagnetic. The data confirm a high spin and low spin octahedral structures for the Fe(III) and Co(II) complexes. The ESR spectrum of the Cu(II) complex support the binuclear structure. The molecular parameters have also been calculated for the Cu(II) and Fe(III) complexes. The thermal decomposition stages of the complexes confirm the MS to be the residual part. Also, the thermodynamic and kinetic parameters were calculated for some decomposition steps.

  10. Cationic Silica-Supported N-Heterocyclic Carbene Tungsten Oxo Alkylidene Sites: Highly Active and Stable Catalysts for Olefin Metathesis.

    PubMed

    Pucino, Margherita; Mougel, Victor; Schowner, Roman; Fedorov, Alexey; Buchmeiser, Michael R; Copéret, Christophe

    2016-03-18

    Designing supported alkene metathesis catalysts with high activity and stability is still a challenge, despite significant advances in the last years. Described herein is the combination of strong σ-donating N-heterocyclic carbene ligands with weak σ-donating surface silanolates and cationic tungsten sites leading to highly active and stable alkene metathesis catalysts. These well-defined silica-supported catalysts, [(≡SiO)W(=O)(=CHCMe2 Ph)(IMes)(OTf)] and [(≡SiO)W(=O)(=CHCMe2 Ph)(IMes)(+) ][B(Ar(F) )4 (-) ] [IMes=1,3-bis(2,4,6-trimethylphenyl)-imidazol-2-ylidene, B(Ar(F) )4 =B(3,5-(CF3 )2 C6 H3 )4 ] catalyze alkene metathesis, and the cationic species display unprecedented activity for a broad range of substrates, especially for terminal olefins with turnover numbers above 1.2 million for propene. PMID:26928967

  11. A sialic acid aldolase from Peptoclostridium difficile NAP08 with 4-hydroxy-2-oxo-pentanoate aldolase activity.

    PubMed

    Chen, Qijia; Han, Lei; Chen, Xi; Cui, Yunfeng; Feng, Jinhui; Wu, Qiaqing; Zhu, Dunming

    2016-10-01

    Sialic acid aldolases (E.C.4.1.3.3) catalyze the reversible aldol cleavage of N-acetyl-d-neuraminic acid (Neu5Ac) to from N-acetyl-d-mannosamine (ManNAc) and pyruvate. In this study, a sialic acid aldolase (PdNAL) from Peptoclostridium difficile NAP08 was expressed in Escherichia coli BL21 (DE3). This homotetrameric enzyme was purified with a specific activity of 18.34U/mg for the cleavage of Neu5Ac. The optimal pH and temperature for aldol addition reaction were 7.4 and 65°C, respectively. PdNAL was quite stable at neutral and alkaline pH (6.0-10.0) and maintained about 89% of the activity after incubation at pH 10.0 for 24h. After incubation at 70°C for 15min, almost no activity loss was observed. The high thermostability simplified the purification of this enzyme. Interestingly, substrate profiling showed that PdNAL not only accepted ManNAc but also short chain aliphatic aldehydes such as acetaldehyde, propionaldehyde and n-butyraldehyde as the substrates. This is the first example that a sialic acid aldolase is active toward aliphatic aldehyde acceptors with two or more carbons. The amino acid sequence analysis indicates that PdNAL belongs to the NAL subfamily rather than 4-hydroxy-2-oxopentanoate (HOPA) aldolase, but it is interesting that the enzyme possesses the activity of HOPA aldolase. PMID:27542750

  12. Biosynthesis and actions of 5-oxoeicosatetraenoic acid (5-oxo-ETE) on feline granulocytes.

    PubMed

    Cossette, Chantal; Gravel, Sylvie; Reddy, Chintam Nagendra; Gore, Vivek; Chourey, Shishir; Ye, Qiuji; Snyder, Nathaniel W; Mesaros, Clementina A; Blair, Ian A; Lavoie, Jean-Pierre; Reinero, Carol R; Rokach, Joshua; Powell, William S

    2015-08-01

    The 5-lipoxygenase product 5-oxo-6,8,11,14-eicosatetraenoic acid (5-oxo-ETE) is the most powerful human eosinophil chemoattractant among lipid mediators and could play a major pathophysiological role in eosinophilic diseases such as asthma. Its actions are mediated by the OXE receptor, orthologs of which are found in many species from humans to fish, but not rodents. The unavailability of rodent models to examine the pathophysiological roles of 5-oxo-ETE and the OXE receptor has substantially hampered progress in this area. As an alternative, we have explored the possibility that the cat could serve as an appropriate animal model to investigate the role of 5-oxo-ETE. We found that feline peripheral blood leukocytes synthesize 5-oxo-ETE and that physiologically relevant levels of 5-oxo-ETE are present in bronchoalveolar lavage fluid from cats with experimentally induced asthma. 5-Oxo-ETE (EC50, 0.7nM) is a much more potent activator of actin polymerization in feline eosinophils than various other eicosanoids, including leukotriene (LT) B4 and prostaglandin D2. 5-Oxo-ETE and LTB4 induce feline leukocyte migration to similar extents at low concentrations (1nM), but at higher concentrations the response to 5-oxo-ETE is much greater. Although high concentrations of selective human OXE receptor antagonists blocked 5-oxo-ETE-induced actin polymerization in feline granulocytes, their potencies were about 200 times lower than for human granulocytes. We conclude that feline leukocytes synthesize and respond to 5-oxo-ETE, which could potentially play an important role in feline asthma, a common condition in this species. The cat could serve as a useful animal model to investigate the pathophysiological role of 5-oxo-ETE. PMID:26032638

  13. Synthesis, spectroscopic characterization and thermal behavior of metal complexes formed with N'-(1-(4-hydroxyphenyl) ethylidene)-2-oxo-2-(phenylamino) acetohydrazide (H 3OPAH)

    NASA Astrophysics Data System (ADS)

    Ahmed, Sara F.; El-Gammal, Ola A.; El-Reash, Gaber Abu

    2011-12-01

    Complexes of Co(II), Ni(II), Cu(II), Mn(II), Cd(II), Zn(II), Hg(II) and U(IV)O 22+ with N'-(1-(4-hydroxyphenyl) ethylidene)-2-oxo-2-(phenylamino) acetohydrazide (H 3OPAH) are reported and have been characterized by various spectroscopic techniques like IR, UV-visible, 1H NMR and ESR as well as magnetic and thermal (TG and DTA) measurements. It is found that the ligand behaves as a neutral bidentate, monoanionic tridentate or tetradentate and dianionic tetradentate. An octahedral geometry for [Mn(H 3OPAH) 2Cl 2], [Co 2(H 2OPAH) 2Cl 2(H 2O) 4] and [(UO 2) 2(HOPAH)(OAc) 2(H 2O) 2] complexes, a square planar geometry for [Cu 2(H 2OPAH)Cl 3(H 2O)]H 2O complex, a tetrahedral structure for [Cd(H 3OPAH)Cl 2], [Zn(H 3OPAH)(OAc) 2] and [Hg(H 3OPAH)Cl 2]H 2O complexes. The binuclear [Ni 2(HOPAH)Cl 2(H 2O) 2]H 2O complex contains a mixed geometry of both tetrahedral and square planar structures. The protonation constants of ligand and stepwise stability constants of its complexes at 298, 308 and 318 K as well as the thermodynamic parameters are being calculated. The bond lengths, bond angles, HOMO, LUMO and dipole moments have been calculated to confirm the geometry of the ligand and the investigated complexes. Also, thermal properties and decomposition kinetics of all compounds are investigated. The interpretation, mathematical analysis and evaluation of kinetic parameters ( Ea, A, Δ H, Δ S and Δ G) of all thermal decomposition stages have been evaluated using Coats-Redfern and Horowitz-Metzger methods.

  14. Antimicrobial activity of the metals and metal oxide nanoparticles.

    PubMed

    Dizaj, Solmaz Maleki; Lotfipour, Farzaneh; Barzegar-Jalali, Mohammad; Zarrintan, Mohammad Hossein; Adibkia, Khosro

    2014-11-01

    The ever increasing resistance of pathogens towards antibiotics has caused serious health problems in the recent years. It has been shown that by combining modern technologies such as nanotechnology and material science with intrinsic antimicrobial activity of the metals, novel applications for these substances could be identified. According to the reports, metal and metal oxide nanoparticles represent a group of materials which were investigated in respect to their antimicrobial effects. In the present review, we focused on the recent research works concerning antimicrobial activity of metal and metal oxide nanoparticles together with their mechanism of action. Reviewed literature indicated that the particle size was the essential parameter which determined the antimicrobial effectiveness of the metal nanoparticles. Combination therapy with the metal nanoparticles might be one of the possible strategies to overcome the current bacterial resistance to the antibacterial agents. However, further studies should be performed to minimize the toxicity of metal and metal oxide nanoparticles to apply as proper alternatives for antibiotics and disinfectants especially in biomedical applications. PMID:25280707

  15. A novel hexanuclear titanium(iv)-oxo-iminodiacetate cluster with a Ti6O9 core: single-crystal structure and photocatalytic activities.

    PubMed

    Ni, Lubin; Liang, Dashuai; Cai, Yin; Diao, Guowang; Zhou, Zhaohui

    2016-05-01

    A new family of hexanuclear titanium(iv)-oxo-carboxylate cluster K7H[Ti6O9(ida)6]Cl2·13H2O {Ti6O9} has been synthesized via the H2O2-assisted reaction between TiCl4 and iminodiacetate ligands. This cluster was fully characterized by single-crystal X-ray diffraction and a wide range of analytical methods, including FT-IR, UV/vis spectroscopy as well as electrochemistry and thermogravimetric analysis. As a new type of carboxylate substituted Ti-oxo-cluster, the structural motif of the {Ti6O9} cluster consists of one symmetric {Ti6O6} hexagonal prism with two staggered triangular {Ti3O3} subunits linked by three μ2-O bridges. The {Ti6O9} polyanions are linked by K(+) cations to form a novel 3D architecture. The structural information and stability of the {Ti6O9} polyanion in aqueous solution were thoroughly investigated by solid-state/solution NMR, ESI-MS spectroscopy. Moreover, this Ti-oxo cluster exhibits remarkable potential as a visible-light homogeneous photocatalyst for degradation of rhodamine B (RhB). Finally, a proposed peroxotitanium(iv)-mediated photocatalytic pathway involved is illustrated by spectroscopic data. PMID:26857945

  16. Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

    PubMed Central

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

  17. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    PubMed

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

  18. Synthesis and characterization of heterometallic carbonyl clusters containing ruthenium and a highly coordinated oxo, acetamidato, or sulfido ligand

    SciTech Connect

    Voss, E.J.

    1992-01-01

    This thesis describes investigations of carbonyl clusters containing a highly coordinated oxo, acetamidato, or sulfido ligand supported on a low oxidation mixed-metal framework. These heterometallic complexes contain a triangle of ruthenium atoms and result from the reaction of an electron rich three-metal oxo or sulfido cluster with a lightly stabilized electrophilic cluster building reagent. Chapter One details the formation of the five-metal oxo cluster [Fe[sub 2]Ru[sub 3](CO)[sub 14]([mu][sub 4]-O)][sup 2[minus

  19. Synthesis, structures, electrochemical studies and antioxidant activity of 5-aryl-4-oxo-3,4,5,8-tetrahydropyrido[2,3-d]pyrimidine-7-carboxylic acids

    NASA Astrophysics Data System (ADS)

    Quiroga, Jairo; Romo, Pablo E.; Ortiz, Alejandro; Isaza, José Hipólito; Insuasty, Braulio; Abonia, Rodrigo; Nogueras, Manuel; Cobo, Justo

    2016-09-01

    The synthesis of 5-aryl-4-oxo-3,4,5,8-tetrahydropyrido[2,3-d]pyrimidine-7-carboxylic acids 3 from the reaction of 6-aminopyrimidines 1 with arylidene derivatives of pyruvic acid 2 under microwave and ultrasound irradiation is described. The orientation of cyclization process was determined by NMR measurements. The methodology provides advantages such as high yields and friendly to the environment without the use of solvents. The antioxidant properties, DPPH free radical scavenging, ORAC, and anodic potential oxidation of the new pyridopyrimidines were studied.

  20. A GGA+U approach to effective electronic correlations in thiolate-ligated iron-oxo (IV) porphyrin

    NASA Astrophysics Data System (ADS)

    Elenewski, Justin E.; Hackett, John C.

    2012-09-01

    High-valent oxo-metal complexes exhibit correlated electronic behavior on dense, low-lying electronic state manifolds, presenting challenging systems for electronic structure methods. Among these species, the iron-oxo (IV) porphyrin denoted Compound I occupies a privileged position, serving a broad spectrum of catalytic roles. The most reactive members of this family bear a thiolate axial ligand, exhibiting high activity toward molecular oxygen activation and substrate oxidation. The default approach to such systems has entailed the use of hybrid density functionals or multi-configurational/multireference methods to treat electronic correlation. An alternative approach is presented based on the GGA+U approximation to density functional theory, in which a generalized gradient approximation (GGA) functional is supplemented with a localization correction to treat on-site correlation as inspired by the Hubbard model. The electronic structure of thiolate-ligated iron-oxo (IV) porphyrin and corresponding Coulomb repulsion U are determined both empirically and self-consistently, yielding spin-distributions, state level splittings, and electronic densities of states consistent with prior hybrid functional calculations. Comparison of this detailed electronic structure with model Hamiltonian calculations suggests that the localized 3d iron moments induce correlation in the surrounding electron gas, strengthening local moment formation. This behavior is analogous to strongly correlated electronic systems such as Mott insulators, in which the GGA+U scheme serves as an effective single-particle representation for the full, correlated many-body problem.

  1. Transition metals activate TFEB in overexpressing cells

    PubMed Central

    Peña, Karina A.; Kiselyov, Kirill

    2015-01-01

    Transition metal toxicity is an important factor in the pathogenesis of numerous human disorders, including neurodegenerative diseases. Lysosomes have emerged as important factors in transition metal toxicity because they handle transition metals via endocytosis, autophagy, absorption from the cytoplasm and exocytosis. Transcription factor EB (TFEB) regulates lysosomal biogenesis and the expression of lysosomal proteins in response to lysosomal and/or metabolic stresses. Since transition metals cause lysosomal dysfunction, we proposed that TFEB may be activated to drive gene expression in response to transition metal exposure and that such activation may influence transition metal toxicity. We found that transition metals copper (Cu) and iron (Fe) activate recombinant TFEB and stimulate the expression of TFEB-dependent genes in TFEB-overexpressing cells. In cells that show robust lysosomal exocytosis, TFEB was cytoprotective at moderate levels of Cu exposure, decreasing oxidative stress as reported by the expression of heme oxygenase-1 (HMOX1) gene. However, at high levels of Cu exposure, particularly in cells with low levels of lysosomal exocytosis, activation of overexpressed TFEB was toxic, increasing oxidative stress and mitochondrial damage. Based on these data, we conclude that TFEB-driven gene network is a component of the cellular response to transition metals. These data suggest limitations and disadvantages of TFEB overexpression as a therapeutic approach. PMID:26251447

  2. Exoemissive noise activity of different metallic materials

    NASA Astrophysics Data System (ADS)

    Bichevin, V.; Käämbre, H.; Sammelselg, V.; Kelle, H.; Asari, E.; Saks, O.

    1996-11-01

    A method is proposed for testing the exoemission activity of different metals, used as materials in high sensitivity electrometry (attoammetry). The presented test results allow us to select materials with weaker exoelectron spurious currents.

  3. Active Site Metal Occupancy and Cyclic Di-GMP Phosphodiesterase Activity of Thermotoga maritima HD-GYP.

    PubMed

    Miner, Kyle D; Kurtz, Donald M

    2016-02-16

    HD-GYPs make up a subclass of the metal-dependent HD phosphohydrolase superfamily and catalyze conversion of cyclic di(3',5')-guanosine monophosphate (c-di-GMP) to 5'-phosphoguanylyl-(3'→5')-guanosine (pGpG) and GMP. Until now, the only reported crystal structure of an HD-GYP that also exhibits c-di-GMP phosphodiesterase activity contains a His/carboxylate ligated triiron active site. However, other structural and phylogenetic correlations indicate that some HD-GYPs contain dimetal active sites. Here we provide evidence that an HD-GYP c-di-GMP phosphodiesterase, TM0186, from Thermotoga maritima can accommodate both di- and trimetal active sites. We show that an as-isolated iron-containing TM0186 has an oxo/carboxylato-bridged diferric site, and that the reduced (diferrous) form is necessary and sufficient to catalyze conversion of c-di-GMP to pGpG, but that conversion of pGpG to GMP requires more than two metals per active site. Similar c-di-GMP phosphodiesterase activities were obtained with divalent iron or manganese. On the basis of activity correlations with several putative metal ligand residue variants and molecular dynamics simulations, we propose that TM0186 can accommodate both di- and trimetal active sites. Our results also suggest that a Glu residue conserved in a subset of HD-GYPs is required for formation of the trimetal site and can also serve as a labile ligand to the dimetal site. Given the anaerobic growth requirement of T. maritima, we suggest that this HD-GYP can function in vivo with either divalent iron or manganese occupying di- and trimetal sites. PMID:26786892

  4. Dichotomous Hydrogen Atom Transfer vs. Proton Coupled Electron Transfer During Activation of X-H Bonds (X = C, N, O) by Nonheme Iron-Oxo Complexes of Variable Basicity

    PubMed Central

    Usharani, Dandamudi; Lacy, David C.; Borovik, A. S.; Shaik, Sason

    2013-01-01

    We describe herein the hydrogen-atom transfer (HAT)/ proton-coupled electron-transfer (PCET) reactivity for FeIV-oxo and FeIII-oxo complexes (1–4) that activate C-H, N-H, and O-H bonds in 9,10 dihydroanthracene (S1), dimethylformamide (S2), 1,2 diphenylhydrazine (S3), p-methoxyphenol (S4), and 1,4-cyclohexadiene (S5). In 1–3, the iron is pentacoordinated by tris[N'-tert-butylureaylato)-N-ethylene]aminato ([H3buea]3−) or its derivatives. These complexes are basic, in the order 3 >> 1 > 2. Oxidant 4, [FeIVN4Py(O)]2+ (N4Py: N,N-bis(2-pyridylmethyl)-bis(2-pyridyl) methylamine), is the least basic oxidant. The DFT results match experimental trends and exhibit a mechanistic spectrum ranging from concerted HAT and PCET reactions to concerted-asynchronous proton transfer (PT) / electron transfer (ET) mechanisms, all the way to PT. The singly occupied orbital along the O---H---X (X= C, N, O) moiety in the TS shows clearly that in the PCET cases, the electron is transferred separately from the proton. The Bell-Evans-Polanyi principle does not account for the observed reactivity pattern, as evidenced by the scatter in the plot of calculated barrier vs. reactions driving forces. However, a plot of the deformation energy in the TS vs. the respective barrier provides a clear signature of the HAT/PCET dichotomy. Thus, in all C-H bond activations, the barrier derives from the deformation energy required to create the TS, whereas in N-H/O-H bond activations, the deformation energy is much larger than the corresponding barrier, indicating the presence of stabilizing interaction between the TS fragments. A valence bond model is used to link the observed results with the basicity/acidity of the reactants. PMID:24124906

  5. Impact of Conformational Heterogeneity of OxoG Lesions and Their Pairing Partners on Bypass Fidelity by Y Family Polymerases

    SciTech Connect

    Rechkoblit, Olga; Malinina, Lucy; Cheng, Yuan; Geacintov, Nicholas E.; Broyde, Suse; Patel, Dinshaw J.

    2009-07-21

    7,8-Dihydro-8-oxoguanine (oxoG), the predominant oxidative DNA damage lesion, is processed differently by high-fidelity and Y-family lesion bypass polymerases. Although high-fidelity polymerases extend predominantly from an A base opposite an oxoG, the Y-family polymerases Dpo4 and human Pol {eta} preferentially extend from the oxoG{center_dot}C base pair. We have determined crystal structures of extension Dpo4 ternary complexes with oxoG opposite C, A, G, or T and the next nascent base pair. We demonstrate that neither template backbone nor the architecture of the active site is perturbed by the oxoG(anti){center_dot}C and oxoG{center_dot}A pairs. However, the latter manifest conformational heterogeneity, adopting both oxoG(syn){center_dot}A(anti) and oxoG(anti){center_dot}A(syn) alignment. Hence, the observed reduced primer extension from the dynamically flexible 3'-terminal primer base A is explained. Because of homology between Dpo4 and Pol {eta}, such a dynamic screening mechanism might be utilized by Dpo4 and Pol {eta} to regulate error-free versus error-prone bypass of oxoG and other lesions.

  6. Preferential affinity of /sup 3/H-2-oxo-quazepam for type I benzodiazepine recognition sites in the human brain

    SciTech Connect

    Corda, M.G.; Giorgi, O.; Longoni, B.; Ongini, E.; Montaldo, S.; Biggio, G.

    1988-01-01

    The hypnotic drug quazepam and its active metabolite 2-oxo-quazepam (2-oxo-quaz) are two benzodiazepines (BZ) containing a trifluoroethyl moiety on the ring nitrogen at position 1, characterized by their preferential affinity for Type I BZ recognition sites. In the present study we characterized the binding of /sup 3/H-2-oxo-quaz in discrete areas of the human brain. Saturation analysis demonstrated specific and saturable binding of /sup 3/H-2-oxo-quaz to membrane preparations from human cerebellum. Hill plot analysis of displacement curves of /sup 3/H-flunitrazepam binding by 2-oxo-quaz yielded Hill coefficients of approximately 1 in the cerebellum and significantly less than 1 in the cerebral cortex, hippocampus, caudate nucleus, thalamus and pons. Self and cross displacement curves for /sup 3/H-FNT and /sup 3/H-2-oxo-quaz binding in these brain areas indicated that 2-oxo-quaz binds with different affinities to two populations of binding sites. High affinity binding sites were more abundant in the cerebellum, cerebral cortex, hippocampus and thalamus, whereas low affinity sites were predominant in the caudate nucleus and pons. Competition studies of /sup 3/H-2-oxo-quaz and /sup 3/H-FNT using unlabelled ligands indicated that compounds which preferentially bind to Type I sites are more potent at displacing /sup 3/H-2-oxo-quaz than /sup 3/H-FNT from cerebral cortex membrane preparations. 26 references, 2 figures, 3 tables.

  7. Metallic Magnetic Calorimeters for Absolute Activity Measurement

    NASA Astrophysics Data System (ADS)

    Loidl, M.; Leblanc, E.; Rodrigues, M.; Bouchard, J.; Censier, B.; Branger, T.; Lacour, D.

    2008-05-01

    We present a prototype of metallic magnetic calorimeters that we are developing for absolute activity measurements of low energy emitting radionuclides. We give a detailed description of the realization of the prototype, containing an 55Fe source inside the detector absorber. We present the analysis of first data taken with this detector and compare the result of activity measurement with liquid scintillation counting. We also propose some ways for reducing the uncertainty on the activity determination with this new technique.

  8. The use of a cis-dioxomolybdenum(VI) dinuclear complex with quadradentate 1,4-benzenediylbis(benzyldithiocarbamate)(2-) as model compound for the active site of oxo transfer molybdoenzymes: Reactivity, kinetics, and catalysis

    NASA Astrophysics Data System (ADS)

    Moradi-Shoeili, Zeinab; Boghaei, Davar M.

    2012-03-01

    Dinuclear cis-dioxomolybdenum(VI) complex [{MoO2(Bz2Benzenediyldtc)}2] coordinated by a quadradentate dithiocarbamate (Bz2Benzenediyldtc2- = 1,4-benzenediylbis(benzyldithiocarbamate)(2-)) has been prepared and characterized by elemental analysis, 13C NMR, IR and UV-vis spectroscopy. The kinetics of the oxygen atom transfer between [{MoO2(Bz2Benzenediyldtc)}2] and PPh3 was studied spectrophotometrically in CH2Cl2 medium at 520 nm and four different temperatures, 288, 293, 298 and 303 K, respectively. The reaction follows second order kinetics with the rate constant k = 0.163(2) M-1 S-1 and its increasingly strong absorption at 520 nm clearly indicate the formation of a μ-oxo molybdenum(V) species as a product. Despite the steric restrictions imposed by the ligand structure to prevent the formation of Mo(V) species, experimental evidence confirms its interference during the process. The product can then be formulated as [MoO2(Bz2Benzenediyldtc)2Mo2O3(Bz2Benzenediyldtc)2MoO2] which has one μ-oxomolybdenum(V) moiety. An Eyring plot allows the activation parameters ΔH‡ = 64.2(1) kJ mol-1 and ΔS‡ = -45.1(6) J K-1 mol-1 to be determined from the temperature dependence of the rate constant, suggesting an associative transition state for the oxo transfer reaction. Catalytic oxygen atom transfer reaction from DMSO to PPh3 was also followed by monitoring the chemical shift changes in 31P NMR spectroscopy. The substrate oxidation process follows a well-defined catalytic cycle capable of 100% conversion for the reaction of PPh3 and DMSO without intervention of Mo(V) formation during about 36 h.

  9. Scavenging 4-Oxo-2-nonenal.

    PubMed

    Amarnath, Venkataraman; Amarnath, Kalyani

    2015-10-19

    4-Oxo-2-nonenal (ONE), a product of cellular lipid oxidation, reacts nonspecifically with the lysine residues of proteins and is generated in increased amounts during degenerative diseases and cancer. We show that pyridoxamine, salicylamine, and related 2-aminomethylphenols react with ONE, to form pyrrolo[2,1-b][1,3]oxazines with the participation of both the amino and the phenolic groups. 2-Aminomethylphenols react with ONE as well as with the Michael adducts of ONE much more rapidly than lysine, suggesting their use for therapeutically scavenging ONE. PMID:26355561

  10. METALS DISTRIBUTIONS IN ACTIVATED SLUDGE SYSTEMS

    EPA Science Inventory

    This project developed models to predict the distribution of metals in activated sludge system process streams. The data used to develop the models were obtained through extended pilot studies from a previous project. The objectives of the study were to evaluate the effects of wa...

  11. Electrocatalytic oxidation of small organic molecules in acid medium: enhancement of activity of noble metal nanoparticles and their alloys by supporting or modifying them with metal oxides

    PubMed Central

    Kulesza, Pawel J.; Pieta, Izabela S.; Rutkowska, Iwona A.; Wadas, Anna; Marks, Diana; Klak, Karolina; Stobinski, Leszek; Cox, James A.

    2013-01-01

    Different approaches to enhancement of electrocatalytic activity of noble metal nanoparticles during oxidation of small organic molecules (namely potential fuels for low-temperature fuel cells such as methanol, ethanol and formic acid) are described. A physical approach to the increase of activity of catalytic nanoparticles (e.g. platinum or palladium) involves nanostructuring to obtain highly dispersed systems of high surface area. Recently, the feasibility of enhancing activity of noble metal systems through the formation of bimetallic (e.g. PtRu, PtSn, and PdAu) or even more complex (e.g. PtRuW, PtRuSn) alloys has been demonstrated. In addition to possible changes in the electronic properties of alloys, specific interactions between metals as well as chemical reactivity of the added components have been postulated. We address and emphasize here the possibility of utilization of noble metal and alloyed nanoparticles supported on robust but reactive high surface area metal oxides (e.g. WO3, MoO3, TiO2, ZrO2, V2O5, and CeO2) in oxidative electrocatalysis. This paper concerns the way in which certain inorganic oxides and oxo species can act effectively as supports for noble metal nanoparticles or their alloys during electrocatalytic oxidation of hydrogen and representative organic fuels. Among important issues are possible changes in the morphology and dispersion, as well as specific interactions leading to the improved chemisorptive and catalytic properties in addition to the feasibility of long time operation of the discussed systems. PMID:24443590

  12. Characterizations of Metal Binding in the Active Sites of Acireductone Dioxygenase Isoforms from Klebsiella ATCC 8724

    SciTech Connect

    Chai,S.; Ju, T.; Dang, M.; Goldsmith, R.; Maroney, M.; Pochapsky, T.

    2008-01-01

    The two acireductone dioxygenase (ARD) isozymes from the methionine salvage pathway of Klebsiella ATCC 8724 present an unusual case in which two enzymes with different structures and distinct activities toward their common substrates (1, 2-dihydroxy-3-oxo-5-(methylthio)pent-1-ene and dioxygen) are derived from the same polypeptide chain. Structural and functional differences between the two isozymes are determined by the type of M2+ metal ion bound in the active site. The Ni2+-bound NiARD catalyzes an off-pathway shunt from the methionine salvage pathway leading to the production of formate, methylthiopropionate, and carbon monoxide, while the Fe2+-bound FeARD' catalyzes the on-pathway formation of methionine precursor 2-keto-4-methylthiobutyrate and formate. Four potential protein-based metal ligands were identified by sequence homology and structural considerations. Based on the results of site-directed mutagenesis experiments, X-ray absorption spectroscopy (XAS), and isothermal calorimetry measurements, it is concluded that the same four residues, His96, His98, Glu102 and His140, provide the protein-based ligands for the metal in both the Ni- and Fe-containing forms of the enzyme, and subtle differences in the local backbone conformations trigger the observed structural and functional differences between the FeARD' and NiARD isozymes. Furthermore, both forms of the enzyme bind their respective metals with pseudo-octahedral geometry, and both may lose a histidine ligand upon binding of substrate under anaerobic conditions. However, mutations at two conserved nonligand acidic residues, Glu95 and Glu100, result in low metal contents for the mutant proteins as isolated, suggesting that some of the conserved charged residues may aid in transfer of metal from in vivo sources or prevent the loss of metal to stronger chelators. The Glu100 mutant reconstitutes readily but has low activity. Mutation of Asp101 results in an active enzyme that incorporates metal in vivo but

  13. Characterization of Metal Binding in the Active Sites of acireductone dioxygenase Isoforms from Klebsiella ATCC 8724

    SciTech Connect

    S Chai; T Ju; M Dang; R Goldsmith; M Maroney; T Pochapsky

    2011-12-31

    The two acireductone dioxygenase (ARD) isozymes from the methionine salvage pathway of Klebsiella ATCC 8724 present an unusual case in which two enzymes with different structures and distinct activities toward their common substrates (1,2-dihydroxy-3-oxo-5-(methylthio)pent-1-ene and dioxygen) are derived from the same polypeptide chain. Structural and functional differences between the two isozymes are determined by the type of M{sup 2+} metal ion bound in the active site. The Ni{sup 2+}-bound NiARD catalyzes an off-pathway shunt from the methionine salvage pathway leading to the production of formate, methylthiopropionate, and carbon monoxide, while the Fe{sup 2+}-bound FeARD catalyzes the on-pathway formation of methionine precursor 2-keto-4-methylthiobutyrate and formate. Four potential protein-based metal ligands were identified by sequence homology and structural considerations. Based on the results of site-directed mutagenesis experiments, X-ray absorption spectroscopy (XAS), and isothermal calorimetry measurements, it is concluded that the same four residues, His96, His98, Glu102 and His140, provide the protein-based ligands for the metal in both the Ni- and Fe-containing forms of the enzyme, and subtle differences in the local backbone conformations trigger the observed structural and functional differences between the FeARD and NiARD isozymes. Furthermore, both forms of the enzyme bind their respective metals with pseudo-octahedral geometry, and both may lose a histidine ligand upon binding of substrate under anaerobic conditions. However, mutations at two conserved nonligand acidic residues, Glu95 and Glu100, result in low metal contents for the mutant proteins as isolated, suggesting that some of the conserved charged residues may aid in transfer of metal from in vivo sources or prevent the loss of metal to stronger chelators. The Glu100 mutant reconstitutes readily but has low activity. Mutation of Asp101 results in an active enzyme that incorporates

  14. Antiretroviral activity of thiosemicarbazone metal complexes.

    PubMed

    Pelosi, Giorgio; Bisceglie, Franco; Bignami, Fabio; Ronzi, Paola; Schiavone, Pasqualina; Re, Maria Carla; Casoli, Claudio; Pilotti, Elisabetta

    2010-12-23

    Thiosemicarbazones display a wide antimicrobial activity by targeting bacteria, fungi, and viruses. Here, we report our studies on the antiviral activity of two thiosemicarbazone metal complexes, [bis(citronellalthiosemicarbazonato)nickel(II)] and [aqua(pyridoxalthiosemicarbazonato)copper(II)] chloride monohydrate, against the retroviruses HIV-1 and HTLV-1/-2. Both compounds exhibit antiviral properties against HIV but not against HTLVs . In particular, the copper complex shows the most potent anti-HIV activity by acting at the post-entry steps of the viral cycle. PMID:21121632

  15. Mechanism of Oxidation of Ethane to Ethanol at Iron(IV)-Oxo Sites in Magnesium-Diluted Fe2(dobdc).

    PubMed

    Verma, Pragya; Vogiatzis, Konstantinos D; Planas, Nora; Borycz, Joshua; Xiao, Dianne J; Long, Jeffrey R; Gagliardi, Laura; Truhlar, Donald G

    2015-05-01

    The catalytic properties of the metal-organic framework Fe2(dobdc), containing open Fe(II) sites, include hydroxylation of phenol by pure Fe2(dobdc) and hydroxylation of ethane by its magnesium-diluted analogue, Fe0.1Mg1.9(dobdc). In earlier work, the latter reaction was proposed to occur through a redox mechanism involving the generation of an iron(IV)-oxo species, which is an intermediate that is also observed or postulated (depending on the case) in some heme and nonheme enzymes and their model complexes. In the present work, we present a detailed mechanism by which the catalytic material, Fe0.1Mg1.9(dobdc), activates the strong C-H bonds of ethane. Kohn-Sham density functional and multireference wave function calculations have been performed to characterize the electronic structure of key species. We show that the catalytic nonheme-Fe hydroxylation of the strong C-H bond of ethane proceeds by a quintet single-state σ-attack pathway after the formation of highly reactive iron-oxo intermediate. The mechanistic pathway involves three key transition states, with the highest activation barrier for the transfer of oxygen from N2O to the Fe(II) center. The uncatalyzed reaction, where nitrous oxide directly oxidizes ethane to ethanol is found to have an activation barrier of 280 kJ/mol, in contrast to 82 kJ/mol for the slowest step in the iron(IV)-oxo catalytic mechanism. The energetics of the C-H bond activation steps of ethane and methane are also compared. Dehydrogenation and dissociation pathways that can compete with the formation of ethanol were shown to involve higher barriers than the hydroxylation pathway. PMID:25882096

  16. Crystal structure, Hirshfeld surfaces and DFT computation of NLO active (2E)-2-(ethoxycarbonyl)-3-[(1-methoxy-1-oxo-3-phenylpropan-2-yl)amino] prop-2-enoic acid

    NASA Astrophysics Data System (ADS)

    Venkatesan, Perumal; Thamotharan, Subbiah; Ilangovan, Andivelu; Liang, Hongze; Sundius, Tom

    2016-01-01

    Nonlinear optical (NLO) activity of the compound (2E)-2-(ethoxycarbonyl)-3-[(1-methoxy-1-oxo-3-phenylpropan-2-yl)amino] prop-2-enoic acid is investigated experimentally and theoretically using X-ray crystallography and quantum chemical calculations. The NLO activity is confirmed by both powder Second Harmonic Generation (SHG) experiment and first hyper polarizability calculation. The title compound displays 8 fold excess of SHG activity when compared with the standard compound KDP. The gas phase geometry optimization and vibrational frequencies calculations are performed using density functional theory (DFT) incorporated in B3LYP with 6-311G++(d,p) basis set. The title compound crystallizes in non-centrosymmetric space group P21. Moreover, the crystal structure is primarily stabilized through intramolecular N-H···O and O-H···O hydrogen bonds and intermolecular C-H···O and C-H···π interactions. These intermolecular interactions are analyzed and quantified using Hirshfeld surface analysis and PIXEL method. The detailed vibrational assignments are performed on the basis of the potential energy distributions (PED) of the vibrational modes.

  17. Crystal structure, Hirshfeld surfaces and DFT computation of NLO active (2E)-2-(ethoxycarbonyl)-3-[(1-methoxy-1-oxo-3-phenylpropan-2-yl)amino] prop-2-enoic acid.

    PubMed

    Venkatesan, Perumal; Thamotharan, Subbiah; Ilangovan, Andivelu; Liang, Hongze; Sundius, Tom

    2016-01-15

    Nonlinear optical (NLO) activity of the compound (2E)-2-(ethoxycarbonyl)-3-[(1-methoxy-1-oxo-3-phenylpropan-2-yl)amino] prop-2-enoic acid is investigated experimentally and theoretically using X-ray crystallography and quantum chemical calculations. The NLO activity is confirmed by both powder Second Harmonic Generation (SHG) experiment and first hyper polarizability calculation. The title compound displays 8 fold excess of SHG activity when compared with the standard compound KDP. The gas phase geometry optimization and vibrational frequencies calculations are performed using density functional theory (DFT) incorporated in B3LYP with 6-311G++(d,p) basis set. The title compound crystallizes in non-centrosymmetric space group P21. Moreover, the crystal structure is primarily stabilized through intramolecular N-H···O and O-H···O hydrogen bonds and intermolecular C-H···O and C-H···π interactions. These intermolecular interactions are analyzed and quantified using Hirshfeld surface analysis and PIXEL method. The detailed vibrational assignments are performed on the basis of the potential energy distributions (PED) of the vibrational modes. PMID:26452098

  18. Chemical and Spectroscopic Evidence for an Fev-Oxo Complex

    SciTech Connect

    de Oliveira,F.; Chanda, A.; Banerjee, D.; Shan, X.; Mondal, S.; Que, Jr., L.; Bominaar, E.; Munck, E.; Collins, T.

    2007-01-01

    Iron(V)-oxo species have been proposed as key reactive intermediates in the catalysis of oxygen-activating enzymes and synthetic catalysts. Here, we report the synthesis of [Fe(TAML)(O)]{sup -} in nearly quantitative yield, where TAML is a macrocyclic tetraamide ligand. Mass spectrometry, Moessbauer, electron paramagnetic resonance, and x-ray absorption spectroscopies, as well as reactivity studies and density functional theory calculations show that this long-lived (hours at -60 C) intermediate is a spin S = 1/2 iron(V)-oxo complex. Iron-TAML systems have proven to be efficient catalysts in the decomposition of numerous pollutants by hydrogen peroxide, and the species we characterized is a likely reactive intermediate in these reactions.

  19. The stability of copper oxo species in zeolite frameworks

    DOE PAGESBeta

    Vilella, Laia; Studt, Felix

    2016-03-07

    Cu-exchanged zeolites are promising heterogeneous catalysts, as they provide a confined environment to carry out highly selective reactions. Furthermore, the knowledge of how the zeolite framework and the location of Al atoms therein affect the adsorption of copper species is still not well understood. In this work, DFT was used to investigate the adsorption of potential Cu oxo active species suggested in the literature [Cu(η2-O2), Cu(µ-O)Cu, and Cu2O2] into zeolites with different pore sizes and shapes (AFI, CHA, TON, MOR, and MFI). The calculations revealed that both monomeric and dimeric Cu oxo species bind strongly to the O atoms ofmore » the lattice. For the monometallic species similar adsorption energies are obtained with the different zeolite frameworks, whereas an optimum Al–Al distance is required for the dimeric species.« less

  20. Metal ion effects on enolase activity

    SciTech Connect

    Lee, M.E.; Nowak, T.

    1986-05-01

    Most metal binding studies with yeast enolase suggest that two metals per monomer are required for catalytic activity. The functions of metal I and metal II have not been unequivocally defined. In a series of kinetic experiments where the concentration of MgII is kept constant at subsaturating levels (1mM), the addition of MnII or of ZnII gives a hyperbolic decrease in activity. The final velocity of these mixed metal systems is the same velocity obtained with either only MnII or ZnII respectively. The concentration of MnII (40 ..mu..M) or of Zn (2..mu..M) which gives half maximal effect in the presence of (1mM) MgII is approximately the same as the Km' value for MnII (9..mu..M) or ZnII (3..mu..M) respectively. Direct binding of MnII to enolase in the absence and presence of MgII shows that MnII and MgII compete for the same metal site on enolase. In the presence of 2-phosphoglycerate (2-PGA) and MgII, only a single site is occupied by MnII. Results suggest MnII at site I and MgII at site II. PRR and high resolution /sup 1/H and /sup 31/P NMR studies of enzyme-ligand complexes containing MnII and MgII and MnII are consistent with this model. /sub 31/P measurements allow a measure of the equilibrium constant (0.36) for enolase. Saturation transfer measurements yield net rate constants (k/sub f/ = 0.49s/sup -1/; k/sub r/ = 1.3s/sup -1/) for the overall reaction. These values are smaller than k/sub cat/ (38s/sup -1/) measured under analogous conditions. The cation at site I appears to determine catalytic activity.

  1. Oxo chemistry in supercritical carbon dioxide

    SciTech Connect

    Krause, T.R.; Rathke, J.W.; Klingler, R.J.

    1991-01-01

    We report an investigation of the cobalt carbonyl-catalyzed oxo process in supercritical CO{sub 2} using in situ high pressure NMR spectroscopy. The use of supercritical CO{sub 2} as the solvent medium eliminates gas-liquid mixing problems. The effect of supercritical CO{sub 2} on the oxo reaction was determined by comparing the linear to branched aldehyde yield and rate and other equilibrium processes involved in the catalytic cycle with measured values in conventional liquid solvents.

  2. Design and synthesis of novel 4-(4-oxo-2-arylthiazolidin-3-yl)benzenesulfonamides as selective inhibitors of carbonic anhydrase IX over I and II with potential anticancer activity.

    PubMed

    Suthar, Sharad Kumar; Bansal, Sumit; Lohan, Sandeep; Modak, Vikarm; Chaudhary, Anil; Tiwari, Amit

    2013-08-01

    The novel 4-(4-oxo-2-arylthiazolidin-3-yl)benzenesulfonamide derivatives were designed and synthesized for selective carbonic anhydrase IX (CA IX) inhibitory activity with anticancer potential. In the CA inhibition assay, 3f was found to be the most potent and selective inhibitor of CA IX with inhibitory constant (K(I)) value of 2.2 nM. Among the synthesized compounds, 3f showed IC₅₀ values of 5.03 μg/ml (cisplatin: 6.56 μg/ml), 5.81 μg/ml (cisplatin: 5.85 μg/ml), and 23.93 μg/ml (cisplatin: 2.75 μg/ml) against COLO-205, MDA-MB-231, and DU-145 cell lines, respectively. At IC₅₀, 3f caused cell shrinkage, nuclear condensation, and nuclear fragmentation events characteristic to apoptosis in the Hoechst 33258 and acridine orange-ethidium bromide staining studies of COLO-205 cells. In the Dalton's lymphoma ascites (DLA) solid tumor model 3f decreased tumor volume by 64.83% (cisplatin: 71.62%), while increase in mean body weight was found to be only 4.09% (cisplatin: 3.47%). PMID:23827177

  3. A Non-Diazo Approach to α-Oxo Gold Carbenes via Gold-Catalyzed Alkyne Oxidation

    PubMed Central

    2015-01-01

    For the past dozen years, homogeneous gold catalysis has evolved from a little known topic in organic synthesis to a fully blown research field of significant importance to synthetic practitioners, due to its novel reactivities and reaction modes. Cationic gold(I) complexes are powerful soft Lewis acids that can activate alkynes and allenes toward efficient attack by nucleophiles, leading to the generation of alkenyl gold intermediates. Some of the most versatile aspects of gold catalysis involve the generation of gold carbene intermediates, which occurs through the approach of an electrophile to the distal end of the alkenyl gold moiety, and their diverse transformations thereafter. On the other hand, α-oxo metal carbene/carbenoids are highly versatile intermediates in organic synthesis and can undergo various synthetically challenging yet highly valuable transformations such as C–H insertion, ylide formation, and cyclopropanation reactions. Metal-catalyzed dediazotizations of diazo carbonyl compounds are the principle and most reliable strategy to access them. Unfortunately, the substrates contain a highly energetic diazo moiety and are potentially explosive. Moreover, chemists need to use energetic reagents to prepare them, putting further constrains on operational safety. In this Account, we show that the unique access to the gold carbene species in homogeneous gold catalysis offers an opportunity to generate α-oxo gold carbenes if both nucleophile and electrophile are oxygen. Hence, this approach would enable readily available and safer alkynes to replace hazardous α-diazo carbonyl compounds as precursors in the realm of gold carbene chemistry. For the past several years, we have demonstrated that alkynes can indeed effectively serve as precursors to versatile α-oxo gold carbenes. In our initial study, we showed that a tethered sulfoxide can be a suitable oxidant, which in some cases leads to the formation of α-oxo gold carbene intermediates. The

  4. Molecular structures and conformations of 1-benzenesulphonyl-2-oxo-5-alkoxypyrrolidines with anti-amnesic activity. X-ray, 1H-NMR and quantum mechanical (PM3) studies

    NASA Astrophysics Data System (ADS)

    Amato, Maria E.; Bandoli, Giuliano; Dolmella, Alessandro; Grassi, Antonio; Pappalardo, Giuseppe C.; Toja, Emilio

    1991-04-01

    The crystal and molecular structures of the nootropic agents RU-47001 ((±) 1-(4-nitrobenzenesulphonyl)-2-oxo-5-ethoxypyrrolidine) and RU-47064 ((±) 1-(4-nitrobenzenesulphonyl)-2-oxo-5-isopropyloxypyrrolidine) have been determined by X-ray analysis and their solution conformation has been investigated using 1H NMR spectroscopy. The conformations of these molecules together with those of their analogues RU-35929 ((±) 1-benzenesulphonyl-2-oxo-5-ethoxypyrrolidine), RU-47010 ((±) 1-(3-pyridinylsulphonyl)-2-oxo-5-ethoxypyrrolidine) and RU-35965 ((±) 1-benzenesulphonyl-2-oxo-5-isopropyloxypyrrolidine) have been deduced from semi-quantitative PM3 type theoretical calculations. The main feature of all compounds consists of a common envelope conformation with C (4) at the flap of the pyrrolidinone ring in the solid, that in solution changes into the analogous, but opposite, possible puckered conformational isomer. The 5-alkoxy groups were found rather flexible in solution. Theoretical preferred conformations about NS and SC bonds were in acceptable agreement with those of the solid state. The calculated torsional energetics suggested that 1- 5 do not undergo conformational interconversion.

  5. Tailorable chiroptical activity of metallic nanospiral arrays

    NASA Astrophysics Data System (ADS)

    Deng, Junhong; Fu, Junxue; Ng, Jack; Huang, Zhifeng

    2016-02-01

    The engineering of the chiroptical activity of the emerging chiral metamaterial, metallic nanospirals, is in its infancy. We utilize glancing angle deposition (GLAD) to facilely sculpture the helical structure of silver nanospirals (AgNSs), so that the scope of chiroptical engineering factors is broadened to include the spiral growth of homochiral AgNSs, the combination of left- and right-handed helical chirality to create heterochiral AgNSs, and the coil-axis alignment of the heterochiral AgNSs. It leads to flexible control over the chiroptical activity of AgNS arrays with respect to the sign, resonance wavelength and amplitude of circular dichroism (CD) in the UV and visible regime. The UV chiroptical mode has a distinct response from the visible mode. Finite element simulation together with LC circuit theory illustrates that the UV irradiation is mainly adsorbed in the metal and the visible is preferentially scattered by the AgNSs, accounting for the wavelength-related chiroptical distinction. This work contributes to broadening the horizons in understanding and engineering chiroptical responses, primarily desired for developing a wide range of potential chiroplasmonic applications.The engineering of the chiroptical activity of the emerging chiral metamaterial, metallic nanospirals, is in its infancy. We utilize glancing angle deposition (GLAD) to facilely sculpture the helical structure of silver nanospirals (AgNSs), so that the scope of chiroptical engineering factors is broadened to include the spiral growth of homochiral AgNSs, the combination of left- and right-handed helical chirality to create heterochiral AgNSs, and the coil-axis alignment of the heterochiral AgNSs. It leads to flexible control over the chiroptical activity of AgNS arrays with respect to the sign, resonance wavelength and amplitude of circular dichroism (CD) in the UV and visible regime. The UV chiroptical mode has a distinct response from the visible mode. Finite element simulation

  6. Synthesis, characterization, and reactivity of a uranium(VI) carbene imido oxo complex.

    PubMed

    Lu, Erli; Cooper, Oliver J; McMaster, Jonathan; Tuna, Floriana; McInnes, Eric J L; Lewis, William; Blake, Alexander J; Liddle, Stephen T

    2014-06-23

    We report the uranium(VI) carbene imido oxo complex [U(BIPM(TMS))(NMes)(O)(DMAP)2] (5, BIPM(TMS) = C(PPh2 NSiMe3)2; Mes = 2,4,6-Me3C6H2; DMAP = 4-(dimethylamino)pyridine) which exhibits the unprecedented arrangement of three formal multiply bonded ligands to one metal center where the coordinated heteroatoms derive from different element groups. This complex was prepared by incorporation of carbene, imido, and then oxo groups at the uranium center by salt elimination, protonolysis, and two-electron oxidation, respectively. The oxo and imido groups adopt axial positions in a T-shaped motif with respect to the carbene, which is consistent with an inverse trans-influence. Complex 5 reacts with tert-butylisocyanate at the imido rather than carbene group to afford the uranyl(VI) carbene complex [U(BIPM(TMS))(O)2(DMAP)2] (6). PMID:24842784

  7. Substrate Specificity of Thiamine Pyrophosphate-Dependent 2-Oxo-Acid Decarboxylases in Saccharomyces cerevisiae

    PubMed Central

    Romagnoli, Gabriele; Luttik, Marijke A. H.; Kötter, Peter; Pronk, Jack T.

    2012-01-01

    Fusel alcohols are precursors and contributors to flavor and aroma compounds in fermented beverages, and some are under investigation as biofuels. The decarboxylation of 2-oxo acids is a key step in the Ehrlich pathway for fusel alcohol production. In Saccharomyces cerevisiae, five genes share sequence similarity with genes encoding thiamine pyrophosphate-dependent 2-oxo-acid decarboxylases (2ODCs). PDC1, PDC5, and PDC6 encode differentially regulated pyruvate decarboxylase isoenzymes; ARO10 encodes a 2-oxo-acid decarboxylase with broad substrate specificity, and THI3 has not yet been shown to encode an active decarboxylase. Despite the importance of fusel alcohol production in S. cerevisiae, the substrate specificities of these five 2ODCs have not been systematically compared. When the five 2ODCs were individually overexpressed in a pdc1Δ pdc5Δ pdc6Δ aro10Δ thi3Δ strain, only Pdc1, Pdc5, and Pdc6 catalyzed the decarboxylation of the linear-chain 2-oxo acids pyruvate, 2-oxo-butanoate, and 2-oxo-pentanoate in cell extracts. The presence of a Pdc isoenzyme was also required for the production of n-propanol and n-butanol in cultures grown on threonine and norvaline, respectively, as nitrogen sources. These results demonstrate the importance of pyruvate decarboxylases in the natural production of n-propanol and n-butanol by S. cerevisiae. No decarboxylation activity was found for Thi3 with any of the substrates tested. Only Aro10 and Pdc5 catalyzed the decarboxylation of the aromatic substrate phenylpyruvate, with Aro10 showing superior kinetic properties. Aro10, Pdc1, Pdc5, and Pdc6 exhibited activity with all branched-chain and sulfur-containing 2-oxo acids tested but with markedly different decarboxylation kinetics. The high affinity of Aro10 identified it as a key contributor to the production of branched-chain and sulfur-containing fusel alcohols. PMID:22904058

  8. Substrate specificity of thiamine pyrophosphate-dependent 2-oxo-acid decarboxylases in Saccharomyces cerevisiae.

    PubMed

    Romagnoli, Gabriele; Luttik, Marijke A H; Kötter, Peter; Pronk, Jack T; Daran, Jean-Marc

    2012-11-01

    Fusel alcohols are precursors and contributors to flavor and aroma compounds in fermented beverages, and some are under investigation as biofuels. The decarboxylation of 2-oxo acids is a key step in the Ehrlich pathway for fusel alcohol production. In Saccharomyces cerevisiae, five genes share sequence similarity with genes encoding thiamine pyrophosphate-dependent 2-oxo-acid decarboxylases (2ODCs). PDC1, PDC5, and PDC6 encode differentially regulated pyruvate decarboxylase isoenzymes; ARO10 encodes a 2-oxo-acid decarboxylase with broad substrate specificity, and THI3 has not yet been shown to encode an active decarboxylase. Despite the importance of fusel alcohol production in S. cerevisiae, the substrate specificities of these five 2ODCs have not been systematically compared. When the five 2ODCs were individually overexpressed in a pdc1Δ pdc5Δ pdc6Δ aro10Δ thi3Δ strain, only Pdc1, Pdc5, and Pdc6 catalyzed the decarboxylation of the linear-chain 2-oxo acids pyruvate, 2-oxo-butanoate, and 2-oxo-pentanoate in cell extracts. The presence of a Pdc isoenzyme was also required for the production of n-propanol and n-butanol in cultures grown on threonine and norvaline, respectively, as nitrogen sources. These results demonstrate the importance of pyruvate decarboxylases in the natural production of n-propanol and n-butanol by S. cerevisiae. No decarboxylation activity was found for Thi3 with any of the substrates tested. Only Aro10 and Pdc5 catalyzed the decarboxylation of the aromatic substrate phenylpyruvate, with Aro10 showing superior kinetic properties. Aro10, Pdc1, Pdc5, and Pdc6 exhibited activity with all branched-chain and sulfur-containing 2-oxo acids tested but with markedly different decarboxylation kinetics. The high affinity of Aro10 identified it as a key contributor to the production of branched-chain and sulfur-containing fusel alcohols. PMID:22904058

  9. Tailorable chiroptical activity of metallic nanospiral arrays.

    PubMed

    Deng, Junhong; Fu, Junxue; Ng, Jack; Huang, Zhifeng

    2016-02-18

    The engineering of the chiroptical activity of the emerging chiral metamaterial, metallic nanospirals, is in its infancy. We utilize glancing angle deposition (GLAD) to facilely sculpture the helical structure of silver nanospirals (AgNSs), so that the scope of chiroptical engineering factors is broadened to include the spiral growth of homochiral AgNSs, the combination of left- and right-handed helical chirality to create heterochiral AgNSs, and the coil-axis alignment of the heterochiral AgNSs. It leads to flexible control over the chiroptical activity of AgNS arrays with respect to the sign, resonance wavelength and amplitude of circular dichroism (CD) in the UV and visible regime. The UV chiroptical mode has a distinct response from the visible mode. Finite element simulation together with LC circuit theory illustrates that the UV irradiation is mainly adsorbed in the metal and the visible is preferentially scattered by the AgNSs, accounting for the wavelength-related chiroptical distinction. This work contributes to broadening the horizons in understanding and engineering chiroptical responses, primarily desired for developing a wide range of potential chiroplasmonic applications. PMID:26530309

  10. An N-bridged high-valent diiron-oxo species on a porphyrin platform that can oxidize methane

    NASA Astrophysics Data System (ADS)

    Kudrik, Evgeny V.; Afanasiev, Pavel; Alvarez, Leonardo X.; Dubourdeaux, Patrick; Clémancey, Martin; Latour, Jean-Marc; Blondin, Geneviève; Bouchu, Denis; Albrieux, Florian; Nefedov, Sergey E.; Sorokin, Alexander B.

    2012-12-01

    High-valent oxo-metal complexes are involved in key biochemical processes of selective oxidation and removal of xenobiotics. The catalytic properties of cytochrome P-450 and soluble methane monooxygenase enzymes are associated with oxo species on mononuclear iron haem and diiron non-haem platforms, respectively. Bio-inspired chemical systems that can reproduce the fascinating ability of these enzymes to oxidize the strongest C-H bonds are the focus of intense scrutiny. In this context, the development of highly oxidizing diiron macrocyclic catalysts requires a structural determination of the elusive active species and elucidation of the reaction mechanism. Here we report the preparation of an Fe(IV)(µ-nitrido)Fe(IV) = O tetraphenylporphyrin cation radical species at -90 °C, characterized by ultraviolet-visible, electron paramagnetic resonance and Mössbauer spectroscopies and by electrospray ionization mass spectrometry. This species exhibits a very high activity for oxygen-atom transfer towards alkanes, including methane. These findings provide a foundation on which to develop efficient and clean oxidation processes, in particular transformations of the strongest C-H bonds.

  11. Induction of 12-oxo-phytodienoic acid in wounded plants and elicited plant cell cultures.

    PubMed Central

    Parchmann, S; Gundlach, H; Mueller, M J

    1997-01-01

    Jasmonic acid (JA) is rapidly biosynthesized from alpha-linolenic acid in plants upon contact with pathogens or wounding, and triggers gene activation, leading to the synthesis of defensive secondary metabolites and proteins. Despite the recent finding that its precursor, 12-oxo-phytodienoic acid (PDA), is a more powerful inducer of gene activation, interest has focused so far almost exclusively on JA. A validated negative chemical ionization-gas chromatography-mass spectrometry method has been developed that allows the simultaneous quantification of endogenous 12-oxo-PDA and JA in plant tissues. In six out of eight plant species tested maximal levels of 12-oxo-PDA exceeded peak levels of JA by approximately 3- to 5-fold after elicitation with a yeast cell wall preparation or when plants were wounded. These experiments support the hypothesis that 12-oxo-PDA acts as the predominant jasmonate signal in most plants, whereas JA remains an active metabolite of its precursor. Furthermore, JA but not 12-oxo-PDA was shown to be secreted into the medium from cultured plant cells, suggesting that JA may also act as an intercellular signal. PMID:9390438

  12. Oxygen activation with transition metal complexes in aqueous solution

    SciTech Connect

    Bakac, Andreja

    2010-04-12

    Coordination to transition-metal complexes changes both the thermodynamics and kinetics of oxygen reduction. Some of the intermediates (superoxo, hydroperoxo, and oxo species) are close analogues of organic oxygen-centered radicals and peroxides (ROO{sm_bullet}, ROOH, and RO{sm_bullet}). Metal-based intermediates are typically less reactive, but more persistent, than organic radicals, which makes the two types of intermediates similarly effective in their reactions with various substrates. The self-exchange rate constant for hydrogen-atom transfer for the couples Cr{sub aq}OO{sup 2+}/Cr{sub aq}OOH{sup 2+} and L{sup 1}(H{sub 2}O)RhOO{sup 2+}/L{sup 1}(H{sub 2}O)RhOOH{sup 2+} was estimated to be 10{sup 1 {+-} 1} M{sup -1} s{sup -1}. The use of this value in the simplified Marcus equation for the Cr{sub aq}O{sup 2+}/Cr{sub aq}OOH{sup 2+} cross reaction provided an upper limit k{sub CrO,CrOH} {le} 10{sup (-2{+-}1)} M{sup -1} s{sup -1} for Cr{sub aq}O{sup 2+}/Cr{sub aq}OH{sup 2+} self-exchange. Even though superoxo complexes react very slowly in bimolecular self-reactions, extremely fast cross reactions with organic counterparts, i.e., acylperoxyl radicals, have been observed. Many of the intermediates generated by the interaction of O{sub 2} with reduced metal complexes can also be accessed by alternative routes, both thermal and photochemical.

  13. Strongly coupled binuclear uranium-oxo complexes from uranyl oxo rearrangement and reductive silylation

    NASA Astrophysics Data System (ADS)

    Arnold, Polly L.; Jones, Guy M.; Odoh, Samuel O.; Schreckenbach, Georg; Magnani, Nicola; Love, Jason B.

    2012-03-01

    The most common motif in uranium chemistry is the d0f0 uranyl ion [UO2]2+ in which the oxo groups are rigorously linear and inert. Alternative geometries, such as the cis-uranyl, have been identified theoretically and implicated in oxo-atom transfer reactions that are relevant to environmental speciation and nuclear waste remediation. Single electron reduction is now known to impart greater oxo-group reactivity, but with retention of the linear OUO motif, and reactions of the oxo groups to form new covalent bonds remain rare. Here, we describe the synthesis, structure, reactivity and magnetic properties of a binuclear uranium-oxo complex. Formed through a combination of reduction and oxo-silylation and migration from a trans to a cis position, the new butterfly-shaped Si-OUO2UO-Si molecule shows remarkably strong UV-UV coupling and chemical inertness, suggesting that this rearranged uranium oxo motif might exist for other actinide species in the environment, and have relevance to the aggregation of actinide oxide clusters.

  14. Strongly coupled binuclear uranium-oxo complexes from uranyl oxo rearrangement and reductive silylation.

    PubMed

    Arnold, Polly L; Jones, Guy M; Odoh, Samuel O; Schreckenbach, Georg; Magnani, Nicola; Love, Jason B

    2012-03-01

    The most common motif in uranium chemistry is the d(0)f(0) uranyl ion [UO(2)](2+) in which the oxo groups are rigorously linear and inert. Alternative geometries, such as the cis-uranyl, have been identified theoretically and implicated in oxo-atom transfer reactions that are relevant to environmental speciation and nuclear waste remediation. Single electron reduction is now known to impart greater oxo-group reactivity, but with retention of the linear OUO motif, and reactions of the oxo groups to form new covalent bonds remain rare. Here, we describe the synthesis, structure, reactivity and magnetic properties of a binuclear uranium-oxo complex. Formed through a combination of reduction and oxo-silylation and migration from a trans to a cis position, the new butterfly-shaped Si-OUO(2)UO-Si molecule shows remarkably strong U(V)-U(V) coupling and chemical inertness, suggesting that this rearranged uranium oxo motif might exist for other actinide species in the environment, and have relevance to the aggregation of actinide oxide clusters. PMID:22354437

  15. High-spin Mn-oxo complexes and their relevance to the oxygen-evolving complex within photosystem II.

    PubMed

    Gupta, Rupal; Taguchi, Taketo; Lassalle-Kaiser, Benedikt; Bominaar, Emile L; Yano, Junko; Hendrich, Michael P; Borovik, A S

    2015-04-28

    The structural and electronic properties of a series of manganese complexes with terminal oxido ligands are described. The complexes span three different oxidation states at the manganese center (III-V), have similar molecular structures, and contain intramolecular hydrogen-bonding networks surrounding the Mn-oxo unit. Structural studies using X-ray absorption methods indicated that each complex is mononuclear and that oxidation occurs at the manganese centers, which is also supported by electron paramagnetic resonance (EPR) studies. This gives a high-spin Mn(V)-oxo complex and not a Mn(IV)-oxy radical as the most oxidized species. In addition, the EPR findings demonstrated that the Fermi contact term could experimentally substantiate the oxidation states at the manganese centers and the covalency in the metal-ligand bonding. Oxygen-17-labeled samples were used to determine spin density within the Mn-oxo unit, with the greatest delocalization occurring within the Mn(V)-oxo species (0.45 spins on the oxido ligand). The experimental results coupled with density functional theory studies show a large amount of covalency within the Mn-oxo bonds. Finally, these results are examined within the context of possible mechanisms associated with photosynthetic water oxidation; specifically, the possible identity of the proposed high valent Mn-oxo species that is postulated to form during turnover is discussed. PMID:25852147

  16. Bis(mu-oxo)dimetal "diamond" cores in copper and iron complexes relevant to biocatalysis.

    PubMed

    Que, Lawrence; Tolman, William B

    2002-04-01

    Although quite a familiar feature in high-valent manganese chemistry, the M(2)(mu-O)(2) diamond core motif has only recently been found in synthetic complexes for M=Cu or Fe. Structural and spectroscopic characterization of these more reactive Cu(2)(mu-O)(2) and Fe(2)(mu-O)(2) compounds has been possible through use of appropriately designed supporting ligands, low-temperature handling methods, and techniques such as electrospray ionization mass spectrometry and X-ray crystallography with area detector instrumentation for rapid data collection. Despite differences in electronic structures that have been revealed through experimental and theoretical studies, Cu(2)(mu-O)(2) and Fe(2)(mu-O)(2) cores exhibit analogously covalent metal-oxo bonding, remarkably congruent Raman and extended X-ray absorption fine structure (EXAFS) signatures, and similar tendencies to abstract hydrogen atoms from substrates. Core isomerization is another common reaction attribute, although different pathways are traversed; for Fe, bridge-to-terminal oxo migration has been discovered, while for Cu, reversible formation of an O-O bond to yield a peroxo isomer has been identified. Our understanding of biocatalysis has been enhanced significantly through the isolation and comprehensive characterization of the Cu(2)(mu-O)(2) and Fe(2)(mu-O)(2) complexes. In particular, it has led to the development of new mechanistic notions about how non-heme multimetal enzymes, such as methane monooxygenases, fatty acid desaturase, and tyrosinase, may function in the activation of dioxygen to catalyze a diverse array of organic transformations. PMID:12491240

  17. Oxidation of ethane to ethanol by N2O in a metal-organic framework with coordinatively unsaturated iron(II) sites.

    PubMed

    Xiao, Dianne J; Bloch, Eric D; Mason, Jarad A; Queen, Wendy L; Hudson, Matthew R; Planas, Nora; Borycz, Joshua; Dzubak, Allison L; Verma, Pragya; Lee, Kyuho; Bonino, Francesca; Crocellà, Valentina; Yano, Junko; Bordiga, Silvia; Truhlar, Donald G; Gagliardi, Laura; Brown, Craig M; Long, Jeffrey R

    2014-07-01

    Enzymatic haem and non-haem high-valent iron-oxo species are known to activate strong C-H bonds, yet duplicating this reactivity in a synthetic system remains a formidable challenge. Although instability of the terminal iron-oxo moiety is perhaps the foremost obstacle, steric and electronic factors also limit the activity of previously reported mononuclear iron(IV)-oxo compounds. In particular, although nature's non-haem iron(IV)-oxo compounds possess high-spin S = 2 ground states, this electronic configuration has proved difficult to achieve in a molecular species. These challenges may be mitigated within metal-organic frameworks that feature site-isolated iron centres in a constrained, weak-field ligand environment. Here, we show that the metal-organic framework Fe2(dobdc) (dobdc(4-) = 2,5-dioxido-1,4-benzenedicarboxylate) and its magnesium-diluted analogue, Fe0.1Mg1.9(dobdc), are able to activate the C-H bonds of ethane and convert it into ethanol and acetaldehyde using nitrous oxide as the terminal oxidant. Electronic structure calculations indicate that the active oxidant is likely to be a high-spin S = 2 iron(IV)-oxo species. PMID:24950328

  18. Oxidation of ethane to ethanol by N2O in a metal-organic framework with coordinatively unsaturated iron(II) sites

    NASA Astrophysics Data System (ADS)

    Xiao, Dianne J.; Bloch, Eric D.; Mason, Jarad A.; Queen, Wendy L.; Hudson, Matthew R.; Planas, Nora; Borycz, Joshua; Dzubak, Allison L.; Verma, Pragya; Lee, Kyuho; Bonino, Francesca; Crocellà, Valentina; Yano, Junko; Bordiga, Silvia; Truhlar, Donald G.; Gagliardi, Laura; Brown, Craig M.; Long, Jeffrey R.

    2014-07-01

    Enzymatic haem and non-haem high-valent iron-oxo species are known to activate strong C-H bonds, yet duplicating this reactivity in a synthetic system remains a formidable challenge. Although instability of the terminal iron-oxo moiety is perhaps the foremost obstacle, steric and electronic factors also limit the activity of previously reported mononuclear iron(IV)-oxo compounds. In particular, although nature's non-haem iron(IV)-oxo compounds possess high-spin S = 2 ground states, this electronic configuration has proved difficult to achieve in a molecular species. These challenges may be mitigated within metal-organic frameworks that feature site-isolated iron centres in a constrained, weak-field ligand environment. Here, we show that the metal-organic framework Fe2(dobdc) (dobdc4- = 2,5-dioxido-1,4-benzenedicarboxylate) and its magnesium-diluted analogue, Fe0.1Mg1.9(dobdc), are able to activate the C-H bonds of ethane and convert it into ethanol and acetaldehyde using nitrous oxide as the terminal oxidant. Electronic structure calculations indicate that the active oxidant is likely to be a high-spin S = 2 iron(IV)-oxo species.

  19. Structure of Human DNL Polymerase k Inserting dATP Opposite an 8-OxoG DNA Lesion

    SciTech Connect

    Vasquez-Del Carpio, R.; Silverstein, T; Lone, S; Swan, M; Choudhury, J; Johnson, R; Pratkash, S; Aggarwal, A

    2009-01-01

    The structure we present here is the first for a eukaryotic translesion synthesis (TLS) DNA polymerase with an 8-oxoG:A base pair in the active site. The structure shows why Pol? is more efficient at inserting an A opposite the 8-oxoG lesion than a C. The structure also provides a basis for why Pol? is more efficient at inserting an A opposite the lesion than other Y-family DNA polymerases.

  20. On divorcing isomers, dissecting reactivity, and resolving mechanisms of propane Csbnd H and aryl Csbnd X (X = halogen) bond activations mediated by a ligated copper(III) oxo complex

    NASA Astrophysics Data System (ADS)

    Rijs, Nicole J.; Weiske, Thomas; Schlangen, Maria; Schwarz, Helmut

    2014-07-01

    The long suspected presence of two isomeric copper complexes (A and B), proportionally dependent on ESI cone voltage, was confirmed by their isolation, separation and characterization in a travelling wave ion mobility spectrometry-mass spectrometer (TWIMS-MS) with modifications to allow for ion/molecule reactions to be performed. Despite their small difference in cross-sectional area (∼1%) the isomers were well resolved, in part due to a strong interaction of isomer B with the N2 buffer gas. The reactivity of each TWIMS-separated isomer was probed: propane reacted with isomer A via Csbnd H bond activation and O-atom transfer, while no such reactions were observed for isomer B; the aryl halides PhX (X = F, Cl, Br, I) also reacted solely with A, via either concerted oxidation and halide transfer, or O-atom transfer. DFT calculations reveal that the aryl Csbnd X bond activation of PhX by isomer A involves several mechanistic pathways. Are the suspected structural isomers of the copper species resolvable via TWIMS-MS? If so, what type of reactivity does each isomer have toward hydrocarbons? Further, the ability to selectively activate aryl halides is highly sought-after in order to carry out selective functionalizations. The halogen exchange of X is a desirable reaction and can be mediated by copper catalysts [56-58]. As well known, the Csbnd F and Csbnd Cl bonds are more stable than the Csbnd Br and Csbnd I bonds, the latter being more reactive and thus used more often in organic transformations. An understanding of the underlying mechanisms is thus key to using these underutilized substrates in catalytic reactions.Thus we also address the question: Can any isomer-separated reactive copper oxo species also activate other strong bonds, such as the Csbnd X bonds in aryl halides (PhX)? In addition, we carry out careful electronic structure calculations in order to gain additional mechanistic insight into the mechanism(s) of halogen-atom and O-atom transfer reactions

  1. Synthesis, structure-activity, and structure-stability relationships of 2-substituted-N-(4-oxo-3-oxetanyl) N-acylethanolamine acid amidase (NAAA) inhibitors.

    PubMed

    Vitale, Romina; Ottonello, Giuliana; Petracca, Rita; Bertozzi, Sine Mandrup; Ponzano, Stefano; Armirotti, Andrea; Berteotti, Anna; Dionisi, Mauro; Cavalli, Andrea; Piomelli, Daniele; Bandiera, Tiziano; Bertozzi, Fabio

    2014-02-01

    N-Acylethanolamine acid amidase (NAAA) is a cysteine amidase that preferentially hydrolyzes saturated or monounsaturated fatty acid ethanolamides (FAEs), such as palmitoylethanolamide (PEA) and oleoylethanolamide (OEA), which are endogenous agonists of nuclear peroxisome proliferator-activated receptor-α (PPAR-α). Compounds that feature an α-amino-β-lactone ring have been identified as potent and selective NAAA inhibitors and have been shown to exert marked anti-inflammatory effects that are mediated through FAE-dependent activation of PPAR-α. We synthesized and tested a series of racemic, diastereomerically pure β-substituted α-amino-β-lactones, as either carbamate or amide derivatives, investigating the structure-activity and structure-stability relationships (SAR and SSR) following changes in β-substituent size, relative stereochemistry at the α- and β-positions, and α-amino functionality. Substituted carbamate derivatives emerged as more active and stable than amide analogues, with the cis configuration being generally preferred for stability. Increased steric bulk at the β-position negatively affected NAAA inhibitory potency, while improving both chemical and plasma stability. PMID:24403170

  2. Synthesis, structure and catechol-oxidase activity of copper(II) complexes of 17-hydroxy-16-(N-3-oxo-prop-1-enyl)amino steroids.

    PubMed

    Wegner, Rainer; Dubs, Manuela; Görls, Helmar; Robl, Christian; Schönecker, Bruno; Jäger, Ernst-G

    2002-09-01

    Copper is next to iron the most important element in the biological transport, storage and in redox reactions of dioxygen. A bioanalogous activation of dioxygen with copper complexes is used for catalytical epoxidation, allylic hydroxylation and oxidative coupling of aromatic substrates, for example. With stereochemical information in form of chiral ligands, enantioselective reactions may be possible. Another aspect of interest on copper catalyzed reactions with dioxygen is that the exact mechanism and biological function of some enzymes (especially catechol oxidase) is yet not fully clear. For studies mimicking the copper-containing catechol oxidase appropriate chiral steroid ligands with defined stereochemistry and conformation have been synthesized. The four diastereomeric 16,17-aminoalcohols of the 3-methoxy-estra-1,3,5(10)-triene series have been condensed with salicylic aldehyde and different beta-ketoenols to the chiral ligand types 1-5. These compounds with different steric and electronic properties and different arrangements of the neighboring hydroxy and nitrogen functions were reacted with copper(II) acetate to copper complexes. The structure of these complexes will be discussed. The bioanalogous oxidation of 3,5-di-tbutyl-catechol (dtbc) to the corresponding quinone was catalyzed by most of the complexes, indicating their ability to activate dioxygen. The trans configurations c and d showed an activity one magnitude higher than the cis configurations a and b. Comparing compounds with the same diastereomeric configuration, the main influence was that of the peripheral R(1-3) substituents at the beta-ketoenaminic group which are useful for the fine-tuning of the properties of the copper atoms like redox potential and Lewis acidity. PMID:12231119

  3. Metal Toxicity Affects Fungal and Bacterial Activities in Soil Differently

    PubMed Central

    Rajapaksha, R. M. C. P.; Tobor-Kapłon, M. A; Bååth, E.

    2004-01-01

    Although the toxic effect of heavy metals on soil microorganism activity is well known, little is known about the effects on different organism groups. The influence of heavy metal addition on total, bacterial, and fungal activities was therefore studied for up to 60 days in a laboratory experiment using forest soil contaminated with different concentrations of Zn or Cu. The effects of the metals differed between the different activity measurements. During the first week after metal addition, the total activity (respiration rate) decreased by 30% at the highest level of contamination and then remained stable during the 60 days of incubation. The bacterial activity (thymidine incorporation rate) decreased during the first days with the level of metal contamination, resulting in a 90% decrease at the highest level of contamination. Bacterial activity then slowly recovered to values similar to those of the control soil. The recovery was faster when soil pH, which had decreased due to metal addition, was restored to control values by liming. Fungal activity (acetate-in-ergosterol incorporation rate) initially increased with the level of metal contamination, being up to 3 and 7 times higher than that in the control samples during the first week at the highest levels of Zn and Cu addition, respectively. The positive effect of metal addition on fungal activity then decreased, but fungal activity was still higher in contaminated than in control soil after 35 days. This is the first direct evidence that fungal and bacterial activities in soil are differently affected by heavy metals. The different responses of bacteria and fungi to heavy metals were reflected in an increase in the relative fungal/bacterial ratio (estimated using phospholipid fatty acid analysis) with increased metal load. PMID:15128558

  4. Metal toxicity affects fungal and bacterial activities in soil differently.

    PubMed

    Rajapaksha, R M C P; Tobor-Kapłon, M A; Bååth, E

    2004-05-01

    Although the toxic effect of heavy metals on soil microorganism activity is well known, little is known about the effects on different organism groups. The influence of heavy metal addition on total, bacterial, and fungal activities was therefore studied for up to 60 days in a laboratory experiment using forest soil contaminated with different concentrations of Zn or Cu. The effects of the metals differed between the different activity measurements. During the first week after metal addition, the total activity (respiration rate) decreased by 30% at the highest level of contamination and then remained stable during the 60 days of incubation. The bacterial activity (thymidine incorporation rate) decreased during the first days with the level of metal contamination, resulting in a 90% decrease at the highest level of contamination. Bacterial activity then slowly recovered to values similar to those of the control soil. The recovery was faster when soil pH, which had decreased due to metal addition, was restored to control values by liming. Fungal activity (acetate-in-ergosterol incorporation rate) initially increased with the level of metal contamination, being up to 3 and 7 times higher than that in the control samples during the first week at the highest levels of Zn and Cu addition, respectively. The positive effect of metal addition on fungal activity then decreased, but fungal activity was still higher in contaminated than in control soil after 35 days. This is the first direct evidence that fungal and bacterial activities in soil are differently affected by heavy metals. The different responses of bacteria and fungi to heavy metals were reflected in an increase in the relative fungal/bacterial ratio (estimated using phospholipid fatty acid analysis) with increased metal load. PMID:15128558

  5. Characterization of 2,4-Diamino-6-oxo-1,6-dihydropyrimidin-5-yl Ureido Based Inhibitors of Trypanosoma brucei FolD and Testing for Antiparasitic Activity

    PubMed Central

    2015-01-01

    The bifunctional enzyme N5,N10-methylenetetrahydrofolate dehydrogenase/cyclo hydrolase (FolD) is essential for growth in Trypanosomatidae. We sought to develop inhibitors of Trypanosoma brucei FolD (TbFolD) as potential antiparasitic agents. Compound 2 was synthesized, and the molecular structure was unequivocally assigned through X-ray crystallography of the intermediate compound 3. Compound 2 showed an IC50 of 2.2 μM, against TbFolD and displayed antiparasitic activity against T. brucei (IC50 49 μM). Using compound 2, we were able to obtain the first X-ray structure of TbFolD in the presence of NADP+ and the inhibitor, which then guided the rational design of a new series of potent TbFolD inhibitors. PMID:26322631

  6. Characterization of the optically excited state of a bis (μ-oxo)-dicopper(III) species mimicking the hemocyanin and tyrosinase active sites

    NASA Astrophysics Data System (ADS)

    Binder, Stephan; Salomone-Stagni, Marco; Haase, Roxana; Schulz, Benjamin; Eich, Andreas; Henkel, Gerald; Rübhausen, Michael; Herres-Pawlis, Sonja; Meyer-Klaucke, Wolfram

    2009-11-01

    Optical excited molecules play an increasingly important role in research at light sources. Here we compare two approaches to structurally characterize such states, pumped-XAS and an innovative combination of EXAFS spectroscopy and resonant Raman scattering. The later combination allows to study efficiently charge-transfer complexes in their ground and excited state. The design of the experimental setups for pumped-XAS and resonant Raman scattering at different temperatures as well as results obtained are presented. We receive twofold information on the structural and electronic properties of both states elucidating the alterations upon induced charge transfer in the Cu2O2-core of a system mimicking the active site of tyrosinase and hemocyanin.

  7. Activity of Ingavirin (6-[2-(1H-Imidazol-4-yl)ethylamino]-5-oxo-hexanoic Acid) Against Human Respiratory Viruses in in Vivo Experiments

    PubMed Central

    Zarubaev, Vladimir V.; Garshinina, Angelica V.; Kalinina, Nelly A.; Shtro, Anna A.; Belyaevskaya, Svetlana V.; Slita, Alexander V.; Nebolsin, Vladimir E.; Kiselev, Oleg I.

    2011-01-01

    Respiratory viral infections constitute the most frequent reason for medical consultations in the World. They can be associated with a wide range of clinical manifestations ranging from self-limited upper respiratory tract infections to more devastating conditions such as pneumonia. In particular, in serious cases influenza A leads to pneumonia, which is particularly fatal in patients with cardiopulmonary diseases, obesity, young children and the elderly. In the present study, we show a protective effect of the low-molecular weight compound Ingavirin (6-[2-(1H-imidazol-4-yl)ethylamino]-5-oxohexanoic acid) against influenza A (H1N1) virus, human parainfluenza virus and human adenovirus infections in animals. Mortality, weight loss, infectious titer of the virus in tissues and tissue morphology were monitored in the experimental groups of animals. The protective action of Ingavirin was observed as a reduction of infectious titer of the virus in the lung tissue, prolongation of the life of the infected animals, normalization of weight dynamics throughout the course of the disease, lowering of mortality of treated animals compared to a placebo control and normalization of tissue structure. In case of influenza virus infection, the protective activity of Ingavirin was similar to that of the reference compound Tamiflu. Based on the results obtained, Ingavirin should be considered as an important part of anti-viral prophylaxis and therapy.

  8. Abortiporus biennis tolerance to insoluble metal oxides: oxalate secretion, oxalate oxidase activity, and mycelial morphology.

    PubMed

    Graz, Marcin; Jarosz-Wilkołazka, Anna; Pawlikowska-Pawlega, Bozena

    2009-06-01

    The ability of Abortiporus biennis to tolerate and solubilize toxic metal oxides (Cu(2)O, Al(2)O(3), ZnO, CuFe(2)O(4)Zn, CdO, and MnO(2)) incorporated into agar media was investigated and the growth rate, oxalic acid secretion, and mycelial morphology were monitored. Among the tested metal oxides, formation of clear zones underneath the mycelium growing on Cu(2)O- and ZnO-amended plates was observed. ZnO, CdO and Cu(2)O caused the highest rate of fungal growth inhibition. An increased level of oxalic acid concentration was detected as a response of A. biennis to the presence of Cu(2)O, MnO(2), ZnO and CuFe(2)O(4)Zn in growth medium. The oxalate oxidase (OXO) was found to be responsible for oxalic acid degradation in A. biennis cultivated in metal-amended media. An increased level of OXO was observed in media amended with Cu(2)O, ZnO and MnO(2). Confocal microscopy used in this study revealed changes in mycelial morphology which appeared as increased hyphal branching, increased septation and increased spore number. PMID:18985279

  9. Size-dependent catalytic activity of supported metal clusters

    NASA Astrophysics Data System (ADS)

    Xu, Z.; Xiao, F.-S.; Purnell, S. K.; Alexeev, O.; Kawi, S.; Deutsch, S. E.; Gates, B. C.

    1994-11-01

    BECAUSE catalysis by metals is a surface phenomenon, many technological catalysts contain small (typically nanometre-sized) supported metal particles with a large fraction of the atoms exposed1. Many reactions, such as hydrocarbon hydrogenations, are structure-insensitive, proceeding at approximately the same rate on metal particles of various sizes provided that they are larger than about 1 nm and show bulk-like metallic behaviour1. But it is not known whether the catalytic properties of metal particles become size-dependent as the particles become so small that they are no longer metallic in character. Here we investigate the catalytic behaviour of precisely defined clusters of just four and six iridium atoms on solid supports. We find that the Ir4 and Ir6 clusters differ in catalytic activity both from each other and from metallic Ir particles. This raises the possibility of tailoring the catalytic behaviour of metal clusters by controlling the cluster size.

  10. Pharmacological activity of metal binding agents that alter copper bioavailability

    PubMed Central

    Helsel, Marian E.

    2015-01-01

    Iron, copper and zinc are required nutrients for many organisms but also potent toxins if misappropriated. An overload of any of these metals can be cytotoxic and ultimately lead to organ failure, whereas deficiencies can result in anemia, weakened immune system function, and other medical conditions. Cellular metal imbalances have been implicated in neurodegenerative diseases, cancer and infection. It is therefore critical for living organisms to maintain careful control of both the total levels and subcellular distributions of these metals to maintain healthy function. This perspective explores several strategies envisioned to alter the bioavailability of metal ions by using synthetic metal-binding agents targeted for diseases where misappropriated metal ions are suspected of exacerbating cellular damage. Specifically, we discuss chemical properties that influence the pharmacological outcome of a subset of metal-binding agents known as ionophores, and review several examples that have shown multiple pharmacological activities in metal-related diseases, with a specific focus on copper. PMID:25797044

  11. Chemistry and catalytic activity of molybdenum(VI)-pyrazolylpyridine complexes in olefin epoxidation. Crystal structures of monomeric dioxo, dioxo-μ-oxo, and oxodiperoxo derivatives.

    PubMed

    Coelho, Ana C; Nolasco, Mariela; Balula, Salete S; Antunes, Margarida M; Pereira, Cláudia C L; Almeida Paz, Filipe A; Valente, Anabela A; Pillinger, Martyn; Ribeiro-Claro, Paulo; Klinowski, Jacek; Gonçalves, Isabel S

    2011-01-17

    The dioxomolybdenum(VI) complexes [MoO2Cl2(PzPy)] (1) and [MoO2(OSiPh3)2(PzPy)] (5) (PzPy = 2-[3(5)-pyrazolyl]pyridine) were synthesized and characterized by vibrational spectroscopy, with assignments being supported by DFT calculations. Complex 5 was additionally characterized by single crystal X-ray diffraction. Recrystallization of 1 under different conditions originated crystal structures containing either the mononuclear [MoO2Cl2(PzPy)] complex co-crystallized with 2-[3(5)-pyrazolyl]pyridinium chloride, binuclear [Mo2O4(μ2-O)Cl2(PzPy)2] complexes, or the oxodiperoxomolybdenum(VI) complex [MoO(O2)2Cl(PzPyH)], in which a 2-[3(5)-pyrazolyl]pyridinium cation weakly interacts with the Mo(VI) center via a pyrazolyl N-atom. The crystal packing in the different structures is mediated by a variety of supramolecular interactions: hydrogen bonding involving the pyridinium and/or pyrazolyl N-H groups, weak CH · · · O and CH · · · π contacts, and strong π-π stacking. Complexes 1 and 5 are moderately active catalysts for the epoxidation of cis-cyclooctene at 55 °C using tert-butylhydroperoxide as oxidant, giving 1,2-epoxycyclooctane as the only reaction product. Insoluble materials were recovered at the end of the first catalytic runs and characterized by IR spectroscopy, elemental analysis, scanning electron microscopy (SEM)-energy dispersive spectroscopy (EDS), and powder X-ray diffraction. For complex 5 the loss of the triphenylsiloxy ligands during the catalytic run resulted in the formation of a tetranuclear complex, [Mo4O8(μ2-O)4(PzPy)4]. The recovered solids could be used as efficient heterogeneous catalysts for the epoxidation of cyclooctene, showing no loss of catalytic performance between successive catalytic runs. PMID:21141938

  12. A ligand field chemistry of oxygen generation by the oxygen-evolving complex and synthetic active sites

    PubMed Central

    Betley, Theodore A; Surendranath, Yogesh; Childress, Montana V; Alliger, Glen E; Fu, Ross; Cummins, Christopher C; Nocera, Daniel G

    2007-01-01

    Oxygen–oxygen bond formation and O2 generation occur from the S4 state of the oxygen-evolving complex (OEC). Several mechanistic possibilities have been proposed for water oxidation, depending on the formal oxidation state of the Mn atoms. All fall under two general classifications: the AB mechanism in which nucleophilic oxygen (base, B) attacks electrophilic oxygen (acid, A) of the Mn4Ca cluster or the RC mechanism in which radical-like oxygen species couple within OEC. The critical intermediate in either mechanism involves a metal oxo, though the nature of this oxo for AB and RC mechanisms is disparate. In the case of the AB mechanism, assembly of an even-electron count, high-valent metal-oxo proximate to a hydroxide is needed whereas, in an RC mechanism, two odd-electron count, high-valent metal oxos are required. Thus the two mechanisms give rise to very different design criteria for functional models of the OEC active site. This discussion presents the electron counts and ligand geometries that support metal oxos for AB and RC O–O bond-forming reactions. The construction of architectures that bring two oxygen functionalities together under the purview of the AB and RC scenarios are described. PMID:17971328

  13. 4-Hydroxy-7-oxo-5-heptenoic Acid (HOHA) Lactone is a Biologically Active Precursor for the Generation of 2-(ω-Carboxyethyl)pyrrole (CEP) Derivatives of Proteins and Ethanolamine Phospholipids.

    PubMed

    Wang, Hua; Linetsky, Mikhail; Guo, Junhong; Choi, Jaewoo; Hong, Li; Chamberlain, Amanda S; Howell, Scott J; Howes, Andrew M; Salomon, Robert G

    2015-05-18

    2-(ω-Carboxyethyl)pyrrole (CEP) derivatives of proteins were previously shown to have significant pathological and physiological relevance to age-related macular degeneration, cancer and wound healing. Previously, we showed that CEPs are generated in the reaction of ε-amino groups of protein lysyl residues with 1-palmityl-2-(4-hydroxy-7-oxo-5-heptenoyl)-sn-glycero-3-phosphatidylcholine (HOHA-PC), a lipid oxidation product uniquely generated by oxidative truncation of docosahexanenate-containing phosphatidylcholine. More recently, we found that HOHA-PC rapidly releases HOHA-lactone and 2-lyso-PC (t1/2 = 30 min at 37 °C) by nonenzymatic transesterification/deacylation. Now we report that HOHA-lactone reacts with Ac-Gly-Lys-OMe or human serum albumin to form CEP derivatives in vitro. Incubation of human red blood cell ghosts with HOHA-lactone generates CEP derivatives of membrane proteins and ethanolamine phospholipids. Quantitative analysis of the products generated in the reaction HOHA-PC with Ac-Gly-Lys-OMe showed that HOHA-PC mainly forms CEP-dipeptide that is not esterified to 2-lysophosphatidycholine. Thus, the HOHA-lactone pathway predominates over the direct reaction of HOHA-PC to produce the CEP-PC-dipeptide derivative. Myleoperoxidase/H2O2/NO2(-) promoted in vitro oxidation of either 1-palmityl-2-docosahexaneoyl-sn-glycero-3-phosphatidylcholine (DHA-PC) or docosahexaenoic acid (DHA) generates HOHA-lactone in yields of 0.45% and 0.78%, respectively. Lipid oxidation in human red blood cell ghosts also releases HOHA-lactone. Oxidative injury of ARPE-19 human retinal pigmented epithelial cells by exposure to H2O2 generated CEP derivatives. Treatment of ARPE-19 cells with HOHA-lactone generated CEP-modified proteins. Low (submicromolar), but not high, concentrations of HOHA-lactone promote increased vascular endothelial growth factor (VEGF) secretion by ARPE-19 cells. Therefore, HOHA-lactone not only serves as an intermediate for the generation of CEPs but

  14. Nucleotide binding interactions modulate dNTP selectivity and facilitate 8-oxo-dGTP incorporation by DNA polymerase lambda

    PubMed Central

    Burak, Matthew J.; Guja, Kip E.; Garcia-Diaz, Miguel

    2015-01-01

    8-Oxo-7,8,-dihydro-2′-deoxyguanosine triphosphate (8-oxo-dGTP) is a major product of oxidative damage in the nucleotide pool. It is capable of mispairing with adenosine (dA), resulting in futile, mutagenic cycles of base excision repair. Therefore, it is critical that DNA polymerases discriminate against 8-oxo-dGTP at the insertion step. Because of its roles in oxidative DNA damage repair and non-homologous end joining, DNA polymerase lambda (Pol λ) may frequently encounter 8-oxo-dGTP. Here, we have studied the mechanisms of 8-oxo-dGMP incorporation and discrimination by Pol λ. We have solved high resolution crystal structures showing how Pol λ accommodates 8-oxo-dGTP in its active site. The structures indicate that when mispaired with dA, the oxidized nucleotide assumes the mutagenic syn-conformation, and is stabilized by multiple interactions. Steady-state kinetics reveal that two residues lining the dNTP binding pocket, Ala510 and Asn513, play differential roles in dNTP selectivity. Specifically, Ala510 and Asn513 facilitate incorporation of 8-oxo-dGMP opposite dA and dC, respectively. These residues also modulate the balance between purine and pyrimidine incorporation. Our results shed light on the mechanisms controlling 8-oxo-dGMP incorporation in Pol λ and on the importance of interactions with the incoming dNTP to determine selectivity in family X DNA polymerases. PMID:26220180

  15. 15-oxo-ETE-induced internal carotid artery constriction in hypoxic rats is mediated by potassium channels.

    PubMed

    Wang, D; Liu, Y; Lu, P; Zhu, D; Zhu, Y

    2016-07-18

    Our own study as well as others have previously reported that hypoxia activates 15-lipoxygenase (15-LO) in the brain, causing a series of chain reactions, which exacerbates ischemic stroke. 15-hydroxyeicosatetraenoic acid (15-HETE) and 15-oxo-eicosatetraenoic acid (15-oxo-ETE/15-KETE) are 15-LO-specific metabolites of arachidonic acid (AA). 15-HETE was found to be rapidly converted into 15-oxo-ETE by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) in some circumstances. We have demonstrated that 15-HETE promotes cerebral vasoconstriction during hypoxia. However, the effect of 15-oxo-ETE upon the contraction of cerebral vasculature remains unclear. To investigate this effect and to clarify the underlying mechanism, we performed immunohistochemistry and Western blot to test the expression of 15-PGDH in rat cerebral tissue, examined internal carotid artery (ICA) tension in isolated rat ICA rings. Western blot and reverse transcription polymerase chain reaction (RT-PCR) were used to analyze the expression of voltage-gated potassium (Kv) channels (Kv2.1, Kv1.5, and Kv1.1) in cultured cerebral arterial smooth muscle cells (CASMCs). The results showed that the levels of 15-PGDH expression were drastically elevated in the cerebral of rats with hypoxia, and 15-oxo-ETE enhanced ICA contraction in a dose-dependent manner. This effect was more significant in the hypoxic rats than in the normoxic rats. We also found that 15-oxo-ETE significantly attenuated the expression of Kv2.1 and Kv1.5, but not Kv1.1. In conclusion, these results suggest that 15-oxo-ETE leads to the contraction of the ICA, especially under hypoxic conditions and that specific Kv channels may play an important role in 15-oxo-ETE-induced ICA constriction. PMID:26447508

  16. Platinum(II) 1,5-COD oxo complexes

    SciTech Connect

    Shan, H.; James, A.; Sharp, P.R.

    1998-11-02

    Three new types of platinum(II) oxo complexes--[(1,5-COD)Pt({mu}{sup 3}-O)(AuL)]{sub 2}(BF{sub 4}){sub 2} [1, L = PPh{sub 3}, PPh{sub 2}Et, PPh{sub 2}-i-Pr, P(o-tol){sub 3}, P(p-tol){sub 3}, P(p-MeOC{sub 6}H{sub 4}){sub 3}, P(p-CF{sub 3}C{sub 6}H{sub 4}){sub 3}], [(1,5-COD)Pt{l_brace}{mu}{sup 3}-O(AuL){sub 2}{r_brace}{sub 2}](BF{sub 4}){sub 2} (2), and [(1,5-COD){sub 4}Pt{sub 4}({mu}{sup 3}-O){sub 2}Cl{sub 2}]X{sub 2} (3, X = BF{sub 4}; 3a, X = CF{sub 3}SO{sub 3})--are obtained from oxo/chloro exchange reactions between (1,5-COD)PtCl{sub 2} and [(LAu){sub 3}({mu}{sup 3}-O)]BF{sub 4}. Crystals of 1 (L = PPh{sub 3}) from CDCl{sub 3} are triclinic. Crystals of 3a from CH{sub 2}Cl{sub 2}/toluene are trigonal. The structure of the cationic portion of 1 shows a planar (COD)-Pt({mu}-O){sub 2}Pt(COD) unit with slightly out-of-plane LAu{sup +} groups linearly coordinated to the oxo ligands. The structure of the cationic portion of 3a is similar and shows a slightly folded (COD)Pt({mu}-O){sub 2}Pt(COD) unit with out-of-plane [(COD)PtCl]{sup +} groups coordinated to the oxo ligands. Solutions of 3 in untreated CH{sub 2}Cl{sub 2} or CD{sub 2}Cl{sup 2} deposit crystals of [(1,5-COD){sub 4}Pt{sub 4}({mu}{sup 3}-O){sub 2}({mu}{sup 2}-OH)](BF{sub 4}){sub 3} (4) which are monoclinic. The core structure of the cationic portion of 4 shows a tetranuclear platinum cation in which the metal atoms occupy the corners of a distorted tetrahedron and two {mu}{sup 3}-oxo ligands and one {mu}{sup 2}-hydroxo ligand bridge the four platinum atoms. Reaction of 1 (L = PPh{sub 3}) with PPh{sub 3} gives OPPh{sub 3} and [(Ph{sub 3}P){sub 3}PtAuPPh{sub 3}]BF{sub 4} (5) which is also obtained from (Ph{sub 3}P){sub 4}Pt and Ph{sub 3}-PAuBF{sub 4}. Crystals of 5 from THF are monoclinic. The structure of 5 consists of an L{sub 3}Pt-AuL cation where the Au atom is linear 2-coordinate and the Pt atom is distorted square-planar 4-coordinate.

  17. [Biological activity of selenorganic compounds at heavy metal salts intoxication].

    PubMed

    Rusetskaya, N Y; Borodulin, V B

    2015-01-01

    Possible mechanisms of the antitoxic action of organoselenium compounds in heavy metal poisoning have been considered. Heavy metal toxicity associated with intensification of free radical oxidation, suppression of the antioxidant system, damage to macromolecules, mitochondria and the genetic material can cause apoptotic cell death or the development of carcinogenesis. Organic selenium compounds are effective antioxidants during heavy metal poisoning; they exhibit higher bioavailability in mammals than inorganic ones and they are able to activate antioxidant defense, bind heavy metal ions and reactive oxygen species formed during metal-induced oxidative stress. One of promising organoselenium compounds is diacetophenonyl selenide (DAPS-25), which is characterized by antioxidant and antitoxic activity, under conditions including heavy metal intoxication. PMID:26350735

  18. Catalytic activity of noble metals for metal-assisted chemical etching of silicon

    NASA Astrophysics Data System (ADS)

    Yae, Shinji; Morii, Yuma; Fukumuro, Naoki; Matsuda, Hitoshi

    2012-06-01

    Metal-assisted chemical etching of silicon is an electroless method that can produce porous silicon by immersing metal-modified silicon in a hydrofluoric acid solution without electrical bias. We have been studying the metal-assisted hydrofluoric acid etching of silicon using dissolved oxygen as an oxidizing agent. Three major factors control the etching reaction and the porous silicon structure: photoillumination during etching, oxidizing agents, and metal particles. In this study, the influence of noble metal particles, silver, gold, platinum, and rhodium, on this etching is investigated under dark conditions: the absence of photogenerated charges in the silicon. The silicon dissolution is localized under the particles, and nanopores are formed whose diameters resemble the size of the metal nanoparticles. The etching rate of the silicon and the catalytic activity of the metals for the cathodic reduction of oxygen in the hydrofluoric acid solution increase in the order of silver, gold, platinum, and rhodium.

  19. Catalytic activity of noble metals for metal-assisted chemical etching of silicon

    PubMed Central

    2012-01-01

    Metal-assisted chemical etching of silicon is an electroless method that can produce porous silicon by immersing metal-modified silicon in a hydrofluoric acid solution without electrical bias. We have been studying the metal-assisted hydrofluoric acid etching of silicon using dissolved oxygen as an oxidizing agent. Three major factors control the etching reaction and the porous silicon structure: photoillumination during etching, oxidizing agents, and metal particles. In this study, the influence of noble metal particles, silver, gold, platinum, and rhodium, on this etching is investigated under dark conditions: the absence of photogenerated charges in the silicon. The silicon dissolution is localized under the particles, and nanopores are formed whose diameters resemble the size of the metal nanoparticles. The etching rate of the silicon and the catalytic activity of the metals for the cathodic reduction of oxygen in the hydrofluoric acid solution increase in the order of silver, gold, platinum, and rhodium. PMID:22738277

  20. Metal-carbon nanocomposites based on activated IR pyrolized polyacrylonitrile

    NASA Astrophysics Data System (ADS)

    Efimov, Mikhail N.; Zhilyaeva, Natalya A.; Vasilyev, Andrey A.; Muratov, Dmitriy G.; Zemtsov, Lev M.; Karpacheva, Galina P.

    2016-05-01

    In this paper we report about new approach to preparation of metal-carbon nanocomposites based on activated carbon. Polyacrylonitrile is suggested as a precursor for Co, Pd and Ru nanoparticles carbon support which is prepared under IR pyrolysis conditions of a precursor. The first part of the paper is devoted to study activated carbon structural characteristics dependence on activation conditions. In the second part the effect of type of metal introduced in precursor on metal-carbon nanocomposite structural characteristics is shown. Prepared AC and nanocomposite samples are characterized by BET, TEM, SEM and X-ray diffraction.

  1. The effect of the metal-on-metal hip controversy on Internet search activity.

    PubMed

    Phelan, Nigel; Kelly, John C; Moore, David P; Kenny, Patrick

    2014-10-01

    The recall of the articular surface replacement (ASR) hip prosthesis in 2010 represents one of the most controversial areas in orthopaedic surgery in recent years. The aim of this study was to compare the impact of the metal-on-metal hip controversy on Internet search activity in four different regions and determine whether the number of related news reports affected Internet search activity. The Google Trends, Keywords and News applications were used to record the number of news articles and Internet search activity for the terms "hip recall", "metal-on-metal hip" and "ASR hip" from October 2009 to October 2012 in the USA, the UK, Australia and Ireland. There was a large increase in search activity following the official recall in August 2010 in all countries. There was significantly greater search activity after the recall in Ireland compared with the UK for the search term "hip recall" (P = 0.004). For the term "metal-on-metal hip", the UK had significantly more search activity (P = 0.0009). There was a positive correlation between the number of news stories in UK and Ireland with Internet search activity but not in the USA or Australia. Differences between countries affected by the same recall highlight the complex effects of the media on public awareness. The data demonstrates a window of opportunity prior to the official recall for the development of an awareness campaign to provide patients with accurate information. PMID:24390041

  2. Synthesis, evaluation and structure-activity relationships of 5-alkyl-2,3-dihydroimidazo[1,2-c] quinazoline, 2,3-dihydroimidazo[1,2-c]quinazolin-5(6H)-thiones and their oxo-analogues as new potential bronchodilators.

    PubMed

    Bahekar, R H; Rao, A R

    2001-01-01

    With an aim to obtain potent bronchodilators, two series of 5-alkyl-2,3-dihydroimidazo[1,2-c]quinazolines (Va-1), 2,3-dihydroimidazo[1,2-c]quinazolin-5-(6H)-thiones (VIIIa-d) and their oxo-analogues (IXa-d) have been designed. The compounds Va-1 were synthesized by two alternative routes. The former (Method A) based on the dehydrocyclization of 4-(1-hydroxyethyl)-aminoquinazoline (IV) and the latter (Method B) involves the usage of 2-aminobenzonitrile (VI) which on reaction with ethylenediamine leads to the formation of the key intermediate 2-(2-aminophenyl)-4,5-dihydro-1H-imidazoles (VII). Finally the intermediate VII on condensation with different acidanhydrides yielded the title compound V. In general method-A resulted the compound V in quantitatively higher yields. 2,3-Dihydroimidazo[1,2-c]quinazolin-5 (6H)-thiones (VIII) were obtained by condensing VII with carbon disulfide and a further oxidation of VIII gave their corresponding oxo-analogues (IX). The title compounds V, VIII and IX were evaluated for their bronchodilator activity using in vitro and in vivo (standard animal models) methods. All the test compounds exhibited bronchodilatory activity. The structure activity relationship studies indicated good correlation between the nature of the substituent and bronchodilatory activity. In the 5-alkyl substituted compounds V, a longer alkyl chain showed higher bronchodilatory activity. Compounds VIII and IX were found to be less potent and replacement of sulphur with oxygen showed no significant effect on the biological activity. The presence of halogens altered the biological activity in both the series. Among the compounds tested, 9-lodo-5-(n-propyl)-2,3-dihydroimidazo[1,2-c]quinazoline (VI) was found to be the most potent (percentage protection = 87.1%; relative activity = 1.1 compared to the standard aminophylline). PMID:11367868

  3. Activation of the C-H bond by metal complexes

    NASA Astrophysics Data System (ADS)

    Shilov, Aleksandr E.; Shul'pin, Georgiy B.

    1990-09-01

    Reactions involving the cleavage of C-H bonds by metal complexes in saturated and aromatic hydrocarbons and also in other compounds are examined. Some of these processes occur with formation of a carbon-metal bond, whilst in others the interaction of the complexes with the hydrocarbon takes place without direct contact between the metal atom and the C-H bonds. Metal compounds are widely used as initiators of the liquid-phase oxidation of hydrocarbons at relatively low temperatures. There is a prospect of creating new technologies for the chemical processing of petroleum and gas hydrocarbons, whereby they can be converted into valuable products, for example, into alcohols, ketones, and carboxylic acids, on the basis of processes involving metal complexes. The study of the metal complex activation of the C-H bond also makes it possible to understand and model the metalloenzyme-catalysed hydrocarbon oxidation reactions in the living cell. The bibliography includes 340 references.

  4. Synthesis and aggregation behavior of meso-sulfinylporphyrins: evaluation of S-chirality effects on the self-organization to S-oxo-tethered cofacial porphyrin dimers.

    PubMed

    Matano, Yoshihiro; Shinokura, Tomonori; Matsumoto, Kazuaki; Imahori, Hiroshi; Nakano, Haruyuki

    2007-11-01

    The synthesis and aggregation behavior of meso-sulfinylporphyrins are described. The copper-catalyzed C-S cross-coupling reaction of a meso-iodoporphyrin with benzenethiol and n-octanethiol has proved to be an efficient method for the synthesis of meso-sulfanylporphyrins, which are oxygenated by m-chloroperbenzoic acid to produce the corresponding meso-sulfinylporphyrins. Optically active zinc meso-sulfinylporphyrins were successfully isolated by means of optical resolution of the racemates on a chiral HPLC column. Zinc sulfinylporphyrins readily undergo self-organization through S-oxo-zinc coordination to form cofacial porphyrin dimers in solution, in which the hetero- and homodimers are present as a diastereomeric mixture. The aggregation modes of the S-oxo-tethered porphyrin dimers were fully characterized by 1H NMR, IR, and UV/Vis spectroscopy as well as DFT calculations on their model compounds, thus revealing that the self-aggregation behavior depends on the combination of S chirality. The absolute configurations at the sulfur center can be determined by the exciton-coupled CD method. The observed self-association constant for the S-oxo-tethered dimerization of (S)-phenylsulfinylporphyrin in toluene is larger than that in dichloromethane, which reflects the difference in dipole moments between the homodimer and the monomer. In cyclic and differential pulse voltammetry, the first oxidation process of the cofacial dimers is split into two reversible steps, which indicates that the initially produced pi radical cations are delocalized efficiently between the two porphyrin rings. The present findings demonstrate the potential utility of meso-sulfinyl groups as promising ligands for investigating the effects of peripheral chirality on the structures and optical and electrochemical properties of metal-assisted porphyrin self-assemblies. PMID:17893892

  5. Elevated temperature creep properties for selected active metal braze alloys

    SciTech Connect

    Stephens, J.J.

    1997-02-01

    Active metal braze alloys reduce the number of processes required for the joining of metal to ceramic components by eliminating the need for metallization and/or Ni plating of the ceramic surfaces. Titanium (Ti), V, and Zr are examples of active element additions which have been used successfully in such braze alloys. Since the braze alloy is expected to accommodate thermal expansion mismatch strains between the metal and ceramic materials, a knowledge of its elevated temperature mechanical properties is important. In particular, the issue of whether or not the creep strength of an active metal braze alloy is increased or decreased relative to its non-activated counterpart is important when designing new brazing processes and alloy systems. This paper presents a survey of high temperature mechanical properties for two pairs of conventional braze alloys and their active metal counterparts: (a) the conventional 72Ag-28Cu (Cusil) alloy, and the active braze alloy 62.2Ag- 36.2Cu-1.6Ti (Cusil ABA), and (b) the 82Au-18Ni (Nioro) alloy and the active braze alloy Mu-15.5M-0.75Mo-1.75V (Nioro ABA). For the case of the Cusil/Cusil ABA pair, the active metal addition contributes to solid solution strengthening of the braze alloy, resulting in a higher creep strength as compared to the non-active alloy. In the case of the Nioro/Nioro ABA pair, the Mo and V additions cause the active braze alloy to have a two-phase microstructure, which results in a reduced creep strength than the conventional braze alloy. The Garofalo sinh equation has been used to quantitatively describe the stress and temperature dependence of the deformation behavior. It will be observed that the effective stress exponent in the Garofalo sinh equation is a function of the instantaneous value of the stress argument.

  6. Molecular designs for controlling the local environments around metal ions.

    PubMed

    Cook, Sarah A; Borovik, A S

    2015-08-18

    The functions of metal complexes are directly linked to the local environment in which they are housed; modifications to the local environment (or secondary coordination sphere) are known to produce changes in key properties of the metal centers that can affect reactivity. Noncovalent interactions are the most common and influential forces that regulate the properties of secondary coordination spheres, which leads to complexities in structure that are often difficult to achieve in synthetic systems. Using key architectural features from the active sites of metalloproteins as inspiration, we have developed molecular systems that enforce intramolecular hydrogen bonds (H-bonds) around a metal center via incorporation of H-bond donors and acceptors into rigid ligand scaffolds. We have utilized these molecular species to probe mechanistic aspects of biological dioxygen activation and water oxidation. This Account describes the stabilization and characterization of unusual M-oxo and heterobimetallic complexes. These types of species have been implicated in a range of oxidative processes in biology but are often difficult to study because of their inherent reactivity. Our H-bonding ligand systems allowed us to prepare an Fe(III)-oxo species directly from the activation of O2 that was subsequently oxidized to form a monomeric Fe(IV)-oxo species with an S = 2 spin state, similar to those species proposed as key intermediates in non-heme monooxygenases. We also demonstrated that a single Mn(III)-oxo center that was prepared from water could be converted to a high-spin Mn(V)-oxo species via stepwise oxidation, a process that mimics the oxidative charging of the oxygen-evolving complex (OEC) of photosystem II. Current mechanisms for photosynthetic O-O bond formation invoke a Mn(IV)-oxyl species rather than the isoelectronic Mn(V)-oxo system as the key oxidant based on computational studies. However, there is no experimental information to support the existence of a Mn

  7. Efficiency of metal activators of accelerated sulfur vulcanization

    SciTech Connect

    Duchacek, V.; Kuta, A.; Pribyl, P. )

    1993-01-20

    The effects of copper, mercury, nickel, zinc, cadmium, indium, magnesium, and calcium stearates on the course of N-cyclohexyl-2-benzthiazylsulphenamide-accelerated sulfur vulcanization of natural rubber have been investigated on the basis of curemeter measurements at 145 C. The differences in the efficiencies of these metal activators of accelerated sulfur vulcanization have been discussed from the points of view of the electron configurations of the metals and their affinities to sulfur. The authors attempted to determine why zinc oxide is generally accepted as the best metal vulcanization activator.

  8. Structural and Functional Elucidation of the Mechanism Promoting Error-prone Synthesis by Human DNA Polymerase [kappa] Opposite the 7,8-Dihydro-8-oxo-2'-deoxyguanosine Adduct

    SciTech Connect

    Irimia, Adriana; Eoff, Robert L.; Guengerich, F.Peter; Egli, Martin

    2009-09-25

    Human polymerase kappa (hPol {kappa}) is one of four eukaryotic Y-class DNA polymerases and may be an important element in the cellular response to polycyclic aromatic hydrocarbons such as benzo[a]pyrene, which can lead to reactive oxygenated metabolite-mediated oxidative stress. Here, we present a detailed analysis of the activity and specificity of hPol {kappa} bypass opposite the major oxidative adduct 7,8-dihydro-8-oxo-2{prime}-deoxyguanosine (8-oxoG). Unlike its archaeal homolog Dpo4, hPol {kappa} bypasses this lesion in an error-prone fashion by inserting mainly dATP. Analysis of transient-state kinetics shows diminished 'bursts' for dATP:8-oxoG and dCTP:8-oxoG incorporation, indicative of non-productive complex formation, but dATP:8-oxoG insertion events that do occur are 2-fold more efficient than dCTP:G insertion events. Crystal structures of ternary hPol {kappa} complexes with adducted template-primer DNA reveal non-productive (dGTP and dATP) alignments of incoming nucleotide and 8-oxoG. Structural limitations placed upon the hPol {kappa} by interactions between the N-clasp and finger domains combined with stabilization of the syn-oriented template 8-oxoG through the side chain of Met-135 both appear to contribute to error-prone bypass. Mutating Leu-508 in the little finger domain of hPol {kappa} to lysine modulates the insertion opposite 8-oxoG toward more accurate bypass, similar to previous findings with Dpo4. Our structural and activity data provide insight into important mechanistic aspects of error-prone bypass of 8-oxoG by hPol {kappa} compared with accurate and efficient bypass of the lesion by Dpo4 and polymerase {eta}.

  9. Functionalized Metallated Cavitands via Imidation and Late-Stage Elaboration

    PubMed Central

    Zhao, Yanchuan

    2015-01-01

    Efficient methods for the preparation of functionalized metallated cavitands are described. Functional groups can be either introduced by an imidation of metal-oxo complexes or by a late-stage elaboration of the imido ligands. By using diversified iminophosphorane (PPh3=NR) reagents, π-conjugated pyrene, redox active ferrocene and polymerizable norbornene moieties were successfully introduced. Furthermore, the iodo and alkynyl groups on the imido ligands are capable of undergoing efficient Sonogashira cross-coupling and copper-catalyzed azide alkyne cycloaddition reactions, thereby providing facile access to complex architectures containing metallated cavitands. PMID:26962300

  10. Active Insolubilized Antibiotics Based on Cellulose-Metal Chelates1

    PubMed Central

    Kennedy, J. F.; Barker, S. A.; Zamir, A.

    1974-01-01

    Cellulose was converted into a more reactive form by chelation with the transition metals titaniumIII, ironIII, tinIV, vanadiumIII, and zirconiumIV. The remaining unsubstituted ligands of the transition metal ions were found to be amenable to replacement by electron-donating groups of antibiotic molecules. Ampicillin, gentamicin, kanamycin, neomycin, paromomycin, polymyxin B, and streptomycin were used as antibacterial antibiotics, and amphotericin B and natamycin were used as antifungal antibiotics. Antibacterial activity of the products was tested against two gram-positive and two gram-negative bacteria, and antifungal activity was tested against four fungi. That the antibacterial antibiotics had complexed with the cellulose-metal chelates was demonstrated in that the product cellulose-metal-antibiotic chelates exhibited antibiotic activities whereas the metal chelates of cellulose themselves were inactive. Of 140 tests conducted, cellulose-metal-antibiotic chelates were active in 102 cases. Since the antibiotic derivatives were water insoluble and in fact retain some of the antibacterial activities of the parent compounds, the chelation method provides a facile way of rendering cellulose surfaces, etc., resistant to microbial attack over and above that degree of protection afforded by noncovalent adsorption of the antibiotic to cellulose itself. The underlying principles of the chelation reactions involved are discussed in detail. PMID:4451349

  11. Biologically active compounds of semi-metals.

    PubMed

    Rezanka, Tomás; Sigler, Karel

    2008-02-01

    Semi-metals (boron, silicon, arsenic and selenium) form organo-metal compounds, some of which are found in nature and affect the physiology of living organisms. They include, e.g., the boron-containing antibiotics aplasmomycin, borophycin, boromycin, and tartrolon or the silicon compounds present in "silicate" bacteria, relatives of the genus Bacillus, which release silicon from aluminosilicates through the secretion of organic acids. Arsenic is incorporated into arsenosugars and arsenobetaines by marine algae and invertebrates, and fungi and bacteria can produce volatile methylated arsenic compounds. Some prokaryotes can use arsenate as a terminal electron acceptor while others can utilize arsenite as an electron donor to generate energy. Selenium is incorporated into selenocysteine that is found in some proteins. Biomethylation of selenide produces methylselenide and dimethylselenide. Selenium analogues of amino acids, antitumor, antibacterial, antifungal, antiviral, anti-infective drugs are often used as analogues of important pharmacological sulfur compounds. Other metalloids, i.e. the rare and toxic tellurium and the radioactive short-lived astatine, have no biological significance. PMID:17991498

  12. Pyridonecarboxylic acids as antibacterial agents. IX. Synthesis and structure-activity relationship of 3-substituted 10-(1-aminocyclopropyl)-9-fluoro-7-oxo-2,3-dihydro-7H-pyrido[1,2,3-de]- 1,4-benzoxazine-6-carboxylic acids and their 1-thio and 1-aza analogues.

    PubMed

    Todo, Y; Takagi, H; Iino, F; Fukuoka, Y; Takahata, M; Okamoto, S; Saikawa, I; Narita, H

    1994-12-01

    A series of the title compounds listed in Chart 1 have been synthesized to study the effects of 3-alkyl substituents on the antibacterial potency and in vivo efficacy of 10-(1-aminocyclopropyl)-9-fluoro-7-oxo-2,3-dihydro-7H-pyrido[1,2,3 -de]-1,4-benzoxazine-6-carboxylic acid and its 1-thio and 1-aza variants. Compound (S)-1, which proved most active in vitro against five representative gram-positive and gram-negative organisms, was assayed in vivo using Staphylococcus aureus and Pseudomonas aeruginosa mouse infection models. It exhibited an excellent in vivo efficacy, being superior to ofloxacin and ciprofloxacin, and was then assayed for convulsion-inducing activity, mammalian cell cytotoxicity, and topoisomerase II inhibition. The biological results showed that (S)-1 displayed antibacterial and toxicological advantages over ofloxacin and ciprofloxacin. Compound (S)-1 and its methanesulfonate showed high serum concentrations after oral and intravenous administrations to mice. PMID:7697774

  13. Specific features of technetium mononuclear octahedral oxo complexes: A review

    SciTech Connect

    Sergienko, V. S. Churakov, A. V.

    2013-01-15

    The specific structural features of technetium mononuclear octahedral oxo complexes have been considered. The structures of d{sup 2}-Tc(V) mono- and dioxo complexes, d{sup 2}-Tc(V) pseudodioxo compounds (Tc(V) mono-oxo complexes with an additional multiply bonded RO{sup -} ligand), and d{sup 0}-Tc(VII) trioxo compounds are analyzed.

  14. Characterization of activation energy for flow in metallic glasses

    SciTech Connect

    Wang, J. Q.; Wang, W. H.; Liu, Y. H.; Bai, H. Y.

    2011-01-15

    The molar volume (V{sub m}) scaled flow activation energy ({Delta}E), namely as the activation energy density {rho}{sub E}={Delta}E/V{sub m}, is proposed to describe the flow of metallic glasses. Based on the energy landscape, both the shear and bulk moduli are critical parameters accounting for the {rho}{sub E} of both homogeneous and inhomogeneous flows in metallic glasses. The expression of {rho}{sub E} is determined experimentally to be a simple expression of {rho}{sub E}=(10/11)G+(1/11)K. The energy density perspective depicts a realistic picture for the flow in metallic glasses and is suggestive for understanding the glass transition and deformation in metallic glasses.

  15. Enzymes of 2-oxo acid degradation and biosynthesis in cell-free extracts of mixed rumen micro-organisms.

    PubMed Central

    Bush, R S; Sauer, F D

    1976-01-01

    The enzymes of 2-oxo acid decarboxylation and 2-oxo acid synthesis (EC 1.2.7.1 and EC 1.2.7.2) were isolated and partially purified from cell-free extracts of rumen micro-organisms. The lyase was active with pyruvate, 3-hydroxypyruvate and 2-oxobutyrate. The synthase was active with acetate, 2-oxoglutarate or succinate. Pyruvate synthase was separated from pyruvate lyase by Sephadex G-200 gel filtration. With Sephadex filtration, approximate mol.wts. of 310000 and 210000 were determined for pyruvate lyase and pyruvate synthase respectively. Images PLATE 1 PMID:962871

  16. Water oxidation surface mechanisms replicated by a totally inorganic tetraruthenium–oxo molecular complex

    PubMed Central

    Piccinin, Simone; Sartorel, Andrea; Aquilanti, Giuliana; Goldoni, Andrea; Bonchio, Marcella; Fabris, Stefano

    2013-01-01

    Solar-to-fuel energy conversion relies on the invention of efficient catalysts enabling water oxidation through low-energy pathways. Our aerobic life is based on this strategy, mastered by the natural Photosystem II enzyme, using a tetranuclear Mn–oxo complex as oxygen evolving center. Within artificial devices, water can be oxidized efficiently on tailored metal-oxide surfaces such as RuO2. The quest for catalyst optimization in vitro is plagued by the elusive description of the active sites on bulk oxides. Although molecular mimics of the natural catalyst have been proposed, they generally suffer from oxidative degradation under multiturnover regime. Here we investigate a nano-sized Ru4–polyoxometalate standing as an efficient artificial catalyst featuring a totally inorganic molecular structure with enhanced stability. Experimental and computational evidence reported herein indicates that this is a unique molecular species mimicking oxygenic RuO2 surfaces. Ru4–polyoxometalate bridges the gap between homogeneous and heterogeneous water oxidation catalysis, leading to a breakthrough system. Density functional theory calculations show that the catalytic efficiency stems from the optimal distribution of the free energy cost to form reaction intermediates, in analogy with metal-oxide catalysts, thus providing a unifying picture for the two realms of water oxidation catalysis. These correlations among the mechanism of reaction, thermodynamic efficiency, and local structure of the active sites provide the key guidelines for the rational design of superior molecular catalysts and composite materials designed with a bottom–up approach and atomic control. PMID:23479603

  17. Mononuclear Nonheme High-Spin (S=2) versus Intermediate-Spin (S=1) Iron(IV)-Oxo Complexes in Oxidation Reactions.

    PubMed

    Bae, Seong Hee; Seo, Mi Sook; Lee, Yong-Min; Cho, Kyung-Bin; Kim, Won-Suk; Nam, Wonwoo

    2016-07-01

    Mononuclear nonheme high-spin (S=2) iron(IV)-oxo species have been identified as the key intermediates responsible for the C-H bond activation of organic substrates in nonheme iron enzymatic reactions. Herein we report that the C-H bond activation of hydrocarbons by a synthetic mononuclear nonheme high-spin (S=2) iron(IV)-oxo complex occurs through an oxygen non-rebound mechanism, as previously demonstrated in the C-H bond activation by nonheme intermediate (S=1) iron(IV)-oxo complexes. We also report that C-H bond activation is preferred over C=C epoxidation in the oxidation of cyclohexene by the nonheme high-spin (HS) and intermediate-spin (IS) iron(IV)-oxo complexes, whereas the C=C double bond epoxidation becomes a preferred pathway in the oxidation of deuterated cyclohexene by the nonheme HS and IS iron(IV)-oxo complexes. In the epoxidation of styrene derivatives, the HS and IS iron(IV) oxo complexes are found to have similar electrophilic characters. PMID:27273456

  18. Antischistosomal Activity of Oxindolimine-Metal Complexes

    PubMed Central

    Dario, Bruno S.; Couto, Ricardo A. A.; Pinto, Pedro L. S.; da Costa Ferreira, Ana M.

    2015-01-01

    In recent years, a class of oxindole-copper and -zinc complex derivatives have been reported as compounds with efficient proapoptotic activity toward different tumor cells (e.g., neuroblastomas, melanomas, monocytes). Here we assessed the efficacy of synthesized oxindole-copper(II), -zinc(II), and -vanadyl (VO2+) complexes against adult Schistosoma mansoni worms. The copper(II) complexes (50% inhibitory concentrations of 30 to 45 μM) demonstrated greater antischistosomal properties than the analogous zinc and vanadyl complexes regarding lethality, reduction of motor activity, and oviposition. PMID:26239976

  19. Antischistosomal Activity of Oxindolimine-Metal Complexes.

    PubMed

    de Moraes, Josué; Dario, Bruno S; Couto, Ricardo A A; Pinto, Pedro L S; da Costa Ferreira, Ana M

    2015-10-01

    In recent years, a class of oxindole-copper and -zinc complex derivatives have been reported as compounds with efficient proapoptotic activity toward different tumor cells (e.g., neuroblastomas, melanomas, monocytes). Here we assessed the efficacy of synthesized oxindole-copper(II), -zinc(II), and -vanadyl (VO(2+)) complexes against adult Schistosoma mansoni worms. The copper(II) complexes (50% inhibitory concentrations of 30 to 45 μM) demonstrated greater antischistosomal properties than the analogous zinc and vanadyl complexes regarding lethality, reduction of motor activity, and oviposition. PMID:26239976

  20. Synthesis and Biological Evaluation of 2-Oxo/Thioxoquinoxaline and 2-Oxo/Thioxoquinoxaline-Based Nucleoside Analogues.

    PubMed

    El-Sayed, Hassan A; Said, Said A; Moustafa, Ahmed H; Baraka, Mohamed M; Abdel-Kader, Rimaa T

    2016-01-01

    Several O- and S-quinoxaline glycosides have been prepared by glycosidation of 3-methyl-2-oxo(thioxo)-1,2-dihydroquinoxalines 1a,b with α-D-glucopyranosyl, α-D-galactopyranosyl, and α-D-lactosyl bromide in the presence of K2CO3 followed by deacetylation with Et3N/H2O. Furthermore, alkylation of 1a,b with 4-bromobutyl acetate, 2-acetoxyethoxymethyl bromide, and 3-chloropropanol afforded the corresponding O- and S-acycloquinoxaline nucleosides. Reaction of 1b with chloroacetic acid followed by condensation with sulfacetamide and sulfadiazine in the presence of Et3N/THF and ethyl chloroformate gave the corresponding sulfonamide derivatives 14 and 15, respectively. The structures of new compounds were confirmed by using IR, (1)H, (13)C NMR spectra and microanalysis. Some of these compounds were screened in vitro for antitumor and antifungal activities. PMID:26810144

  1. (2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

    SciTech Connect

    Kim, D.; Wang, L.; Beconi, M.; Eiermann, G.; Fisher, M.; He, H.; Hickey, G.; Kowalchick, Jennifer; Leiting, Barbara; Lyons, K.; Marsilio, F.; McCann, F.; Patel, R.; Petrov, A.; Scapin, G.; Patel, S.; Roy, R.; Wu, J.; Wyvratt, M.; Zhang, B.; Zhu, L.; Thornberry, N.; Weber, A.

    2010-11-10

    A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

  2. Adsorption of heavy metals on sonicated activated sludge.

    PubMed

    Commenges-Bernole, N; Marguerie, J

    2009-01-01

    The objective of this work is to assess heavy metals fixation capacity on sonicated activated sludge. Ultrasonic treatment of sludge has lead to its desintegration and changes physico-chemical characteristics such as soluble chemical oxygen demand, proteins or particle size distribution. This study has shown that these modifications have improved significantly the capacity of sludge to fix heavy metals. Indeed, after a sonication of 15 min and storage of three days after irradiation, the equilibrium capacity is increased about 45%. The restructuration of sludge during the storage seems to increase the accessibility to active binding sites. PMID:18599337

  3. 4-Oxo-Aldehydes from the dorsal abdominal glands of the bed bug (hemiptera: cimicidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Analyses of the dorsal abdominal glands of fourth- and fifth-instar nymphs of the bed bud Cimex lectularius L. indicated the predominant constituents were (E)-2-hexenal and (E)-2-octenal with lesser amounts of 4-oxo-(E)-2-hexenal and 4-oxo-(E)-2-octenal. The latter two compounds have not previously...

  4. Heavy metals and adsorbents effects on activated sludge microorganisms.

    PubMed

    Ong, S A; Lim, P E; Seng, C E

    2004-01-01

    The sorption of Cu(II) and Cd(II) from synthetic solution by powdered activated carbon (PAC), biomass, rice husk (RH) and activated rice husk (ARH) were investigate under batch conditions. After activated by concentrated nitric acid for 15 hours at 60-65 degrees C, the adsorption capacity for RH was increased. The adsorbents arranged in the increasing order of adsorption capacities to the Langmuir Q degree parameter were biomass > PAC > ARH > RH. The addition of adsorbents in base mix solution had increased the specific oxygen uptake rate (SOUR) activated sludge microorganisms with and without the presence of metals. The increased of SOUR were due to the ability of PAC and RH in reducing the inhibitory effect of metals on microorganisms and provide a reaction site between activated sludge microorganisms and substrates. PMID:15141467

  5. Microalloying of transition metal silicides by mechanical activation and field-activated reaction

    DOEpatents

    Munir, Zuhair A.; Woolman, Joseph N.; Petrovic, John J.

    2003-09-02

    Alloys of transition metal suicides that contain one or more alloying elements are fabricated by a two-stage process involving mechanical activation as the first stage and densification and field-activated reaction as the second stage. Mechanical activation, preferably performed by high-energy planetary milling, results in the incorporation of atoms of the alloying element(s) into the crystal lattice of the transition metal, while the densification and field-activated reaction, preferably performed by spark plasma sintering, result in the formation of the alloyed transition metal silicide. Among the many advantages of the process are its ability to accommodate materials that are incompatible in other alloying methods.

  6. Lossless propagation in metal-semiconductor-metal plasmonic waveguides using quantum dot active medium.

    PubMed

    Sheikhi, K; Granpayeh, N; Ahmadi, V; Pahlavan, S

    2015-04-01

    In this paper, we analyze and simulate the lossless propagation of lightwaves in the active metal-semiconductor-metal plasmonic waveguides (MSMPWs) at the wavelength range of 1540-1560 nm using a quantum dot (QD) active medium. The Maxwell's equations are solved in the waveguide, and the required gains for achieving lossless propagation are derived. On the other hand, the rate equations in quantum dot active regions are solved by using the Runge-Kutta method, and the achievable optical gain is derived. The analyses results show that the required optical gain for lossless propagation in MSMPWs is achievable using the QD active medium. Also, by adjusting the active medium parameters, the MSMPWs loss can be eliminated in a specific bandwidth, and the propagation length increases obviously. PMID:25967191

  7. Highly active oxygen reduction non-platinum group metal electrocatalyst without direct metal-nitrogen coordination

    NASA Astrophysics Data System (ADS)

    Strickland, Kara; Miner, Elise; Jia, Qingying; Tylus, Urszula; Ramaswamy, Nagappan; Liang, Wentao; Sougrati, Moulay-Tahar; Jaouen, Frédéric; Mukerjee, Sanjeev

    2015-06-01

    Replacement of noble metals in catalysts for cathodic oxygen reduction reaction with transition metals mostly create active sites based on a composite of nitrogen-coordinated transition metal in close concert with non-nitrogen-coordinated carbon-embedded metal atom clusters. Here we report a non-platinum group metal electrocatalyst with an active site devoid of any direct nitrogen coordination to iron that outperforms the benchmark platinum-based catalyst in alkaline media and is comparable to its best contemporaries in acidic media. In situ X-ray absorption spectroscopy in conjunction with ex situ microscopy clearly shows nitrided carbon fibres with embedded iron particles that are not directly involved in the oxygen reduction pathway. Instead, the reaction occurs primarily on the carbon-nitrogen structure in the outer skin of the nitrided carbon fibres. Implications include the potential of creating greater active site density and the potential elimination of any Fenton-type process involving exposed iron ions culminating in peroxide initiated free-radical formation.

  8. Tuned by metals: the TET peptidase activity is controlled by 3 metal binding sites

    PubMed Central

    Colombo, Matteo; Girard, Eric; Franzetti, Bruno

    2016-01-01

    TET aminopeptidases are dodecameric particles shared in the three life domains involved in various biological processes, from carbon source provider in archaea to eye-pressure regulation in humans. Each subunit contains a dinuclear metal site (M1 and M2) responsible for the enzyme catalytic activity. However, the role of each metal ion is still uncharacterized. Noteworthy, while mesophilic TETs are activated by Mn2+, hyperthermophilic TETs prefers Co2+. Here, by means of anomalous x-ray crystallography and enzyme kinetics measurements of the TET3 aminopeptidase from the hyperthermophilic organism Pyrococcus furiosus (PfTET3), we show that M2 hosts the catalytic activity of the enzyme, while M1 stabilizes the TET3 quaternary structure and controls the active site flexibility in a temperature dependent manner. A new third metal site (M3) was found in the substrate binding pocket, modulating the PfTET3 substrate preferences. These data show that TET activity is tuned by the molecular interplay among three metal sites. PMID:26853450

  9. Flexible macrocycles as versatile supports for catalytically active metal clusters.

    PubMed

    Ryan, Jason D; Gagnon, Kevin J; Teat, Simon J; McIntosh, Ruaraidh D

    2016-07-12

    Here we present three structurally diverse clusters stabilised by the same macrocyclic polyphenol; t-butylcalix[8]arene. This work demonstrates the range of conformations the flexible ligand is capable of adopting, highlighting its versatility in metal coordination. In addition, a Ti complex displays activity for the ring-opening polymerisation of lactide. PMID:26892948

  10. Anticancer Activity of Metal Complexes: Involvement of Redox Processes

    PubMed Central

    Jungwirth, Ute; Kowol, Christian R.; Keppler, Bernhard K.; Hartinger, Christian G.; Berger, Walter; Heffeter, Petra

    2012-01-01

    Cells require tight regulation of the intracellular redox balance and consequently of reactive oxygen species for proper redox signaling and maintenance of metal (e.g., of iron and copper) homeostasis. In several diseases, including cancer, this balance is disturbed. Therefore, anticancer drugs targeting the redox systems, for example, glutathione and thioredoxin, have entered focus of interest. Anticancer metal complexes (platinum, gold, arsenic, ruthenium, rhodium, copper, vanadium, cobalt, manganese, gadolinium, and molybdenum) have been shown to strongly interact with or even disturb cellular redox homeostasis. In this context, especially the hypothesis of “activation by reduction” as well as the “hard and soft acids and bases” theory with respect to coordination of metal ions to cellular ligands represent important concepts to understand the molecular modes of action of anticancer metal drugs. The aim of this review is to highlight specific interactions of metal-based anticancer drugs with the cellular redox homeostasis and to explain this behavior by considering chemical properties of the respective anticancer metal complexes currently either in (pre)clinical development or in daily clinical routine in oncology. PMID:21275772

  11. Divalent metal activation of a GH43 β-xylosidase.

    PubMed

    Lee, Charles C; Braker, Jay D; Grigorescu, Arabela A; Wagschal, Kurt; Jordan, Douglas B

    2013-02-01

    Depolymerization of xylan, a major fraction of lignocellulosic biomass, releases xylose which can be converted into transportation fuels and chemical feedstocks. A requisite enzyme for the breakdown of xylan is β-xylosidase. A gene encoding the 324-amino acid β-xylosidase, RS223-BX, was cloned from an anaerobic mixed microbial culture. This glycoside hydrolase belongs to family 43. Unlike other GH43 enzymes, RS223-BX can be strongly activated by exogenously supplied Ca(2+), Co(2+), Fe(2+), Mg(2+), Mn(2+) and Ni(2+) (e.g., 28-fold by Mg(2+)) and it is inhibited by Cu(2+) or Zn(2+). Sedimentation equilibrium centrifugation experiments indicated that the divalent metal cations mediate multimerization of the enzyme from a dimeric to a tetrameric state, which have equal catalytic activity on an active-site basis. Compared to the determined active sites of other GH43 β-xylosidases, the predicted active site of RS223-BX contains two additional amino acids with carboxylated side chains that provide potential sites for divalent metal cations to reside. Thus, the divalent metal cations likely occupy the active site and participate in the catalytic mechanism. RS223-BX accepts as substrate xylobiose, arabinobiose, 4-nitrophenyl-β-D-xylopyranoside, and 4-nitrophenyl-α-L-arabinofuranoside. Additionally, the enzyme has good pH and temperature stabilities and a large K(i) for D-glucose (1.3 M), favorable properties for performance in saccharification reactors. PMID:23273276

  12. Physical Chemistry of TiO2 functionalized with oxo-manganese catalysts

    NASA Astrophysics Data System (ADS)

    Abuabara, Sabas G.; Cady, Clyde W.; Schleicher, Jim M.; Baxter, Jason; Brudvig, Gary W.; Crabtree, Robert H.; Schmuttenmaer, Charles A.; Batista, Victor S.

    2006-03-01

    We describe the development and application of dye-sensitized semiconductors to heterogeneous photocatalysis. Ab initio-DFT electronic structure calculations and molecular dynamics simulations combined with quantum dynamics propagation of transient electronic excitations indicate that a surface complex consisting of a catalytic Mn oxo complex adsorbed onto a TiO2 substrate via a catechol-substituted terpyridine ligand can be activated by photoinduced subpicosecond interfacial electron transfer. Experimental realization of the Mn oxo surface complex, achieved by a novel sequential synthesis technique, is briefly described and computational results supporting the spectroscopic characterization of the nanoscale assembly are presented. Studying the photocatalytic reaction dynamics of these uniquely functionalized semiconductor materials offers the prospect of gaining unprecedented control over a wide range of contrathermodynamic reactions. Furthermore, such biomimetic materials capable of splitting water or fixating CO2 could provide viable solutions to problems ranging from current energy concerns to reducing atmospheric greenhouse gases.

  13. A 3.6 nm Ti52-Oxo Nanocluster with Precise Atomic Structure.

    PubMed

    Fang, Wei-Hui; Zhang, Lei; Zhang, Jian

    2016-06-22

    We report a 3.6 nm Ti52-oxo cluster with precise atomic structure, which presents a largest size record in the family of titanium-oxo clusters (TOCs). The crystal growth of such large Ti52 is based on a stepwise interlayer assembly approach from Ti6 substructures. The possible growth mechanism of Ti52 could be deduced from crystal structures of two substructures, Ti6 and Ti17, which were also synthesized under similar conditions as Ti52. Moreover, these TOCs show cluster-size-dependent photocatalytic hydrogen evolution activities with Ti52 giving a H2 production rate up to 398 μmol/h/g, which is also the highest record in the family of TOCs. This work not only represents a milestone in constructing large TOCs with comparable sizes as TiO2 nanoparticles but also brings significant advances in improving photocatalytic behaviors of TOCs. PMID:27248658

  14. Asymmetric synthesis of bicyclic dihydropyrans via organocatalytic inverse-electron-demand oxo-Diels-Alder reactions of enolizable aliphatic aldehydes.

    PubMed

    Li, Jun-Long; Yang, Kai-Chuan; Li, Yi; Li, Qiang; Zhu, Hong-Ping; Han, Bo; Peng, Cheng; Zhi, Yong-Gang; Gou, Xiao-Jun

    2016-08-23

    A highly enantioselective organocatalytic inverse-electron-demand oxo-Diels-Alder reaction involving aqueous acetaldehyde has been discovered. The reaction, in which cyclic enones serve as dienes in the presence of readily available secondary amine catalysts, allows facile construction of optically active bicyclic dihydropyrans. Other typical enolizable aliphatic aldehydes can also serve as competent dienophiles in the reaction. PMID:27436351

  15. Diagnostics of metal inert gas and metal active gas welding processes

    NASA Astrophysics Data System (ADS)

    Uhrlandt, D.

    2016-08-01

    The paper gives a review on studies on metal inert gas (MIG) and metal active gas (MAG) welding processes with the focus on diagnostics of the arc, the material transfer, and the temporal process behaviour in welding experiments. Recent findings with respect to an improved understanding of the main mechanisms in the welding arc and the welding process are summarized. This is linked to actual developments in welding arc and welding process modelling where measurements are indispensable for validation. Challenges of forthcoming studies are illustrated by means of methods under development for welding process control as well as remaining open questions with respect to arc-surface interaction and arc power balance.

  16. Twelve Year Study of Underground Corrosion of Activated Metals

    SciTech Connect

    M. Kay Adler Flitton; Timothy S. Yoder

    2012-03-01

    The subsurface radioactive disposal facility located at the U.S. Department of Energy’s Idaho site contains neutron-activated metals from non-fuel nuclear-reactor-core components. A long-term corrosion study is being conducted to obtain site-specific corrosion rates to support efforts to more accurately estimate the transfer of activated elements in an arid vadose zone environment. The study uses non-radioactive metal coupons representing the prominent neutron-activated material buried at the disposal location, namely, two types of stainless steels, welded stainless steel, welded nickel-chromium steel alloy, zirconium alloy, beryllium, and aluminum. Additionally, carbon steel (the material used in cask disposal liners and other disposal containers) and duplex stainless steel (high-integrity containers) are also included in the study. This paper briefly describes the test program and presents the corrosion rate results through twelve years of underground exposure.

  17. Snythesis and characterization of the first main group oxo-centered trinuclear carboxylate

    NASA Technical Reports Server (NTRS)

    Duraj, Stan A.

    1994-01-01

    The synthesis and structural characterization of the first main group oxo-centered, trinuclear carboxylato-bridged species is reported, namely (Ga3(mu(sub 3)-O) (mu-O2CC6H5)6 (4-Mepy)3) GaCl4 center dot 4-Mepy (compound 1), where 4-Mepy is 4-methylpyridine. Compound 1 is a main group example of a well-established class of complexes, referred to as 'basic carboxylates' of the general formula (M3(mu(sub 3)-O)(mu-O2CR)6L3)(+), previously observed only for transition metals.

  18. Anticancer activity of Arkeshwara Rasa - A herbo-metallic preparation

    PubMed Central

    Nafiujjaman, Md; Nurunnabi, Md; Saha, Samir Kumar; Jahan, Rownak; Lee, Yong-kyu; Rahmatullah, Mohammed

    2015-01-01

    Introduction: Though metal based drugs have been prescribed in Ayurveda for centuries to treat various diseases, such as rheumatoid arthritis and cancer, toxicity of these drugs containing heavy metal is a great drawback for practical application. So, proper scientific validation of herbo-metallic drugs like Arkeshwara Rasa (AR) have become one of the focused research arena of new drugs against cancers. Aim: To investigate the in vitro anticancer effects of AR. Materials and Methods: Anticancer activity of AR was investigated on two human cancer cell lines, which represent two different tissues (pancreas and skin). Lactate dehydrogenase (LDH) assay for enzyme activity and trypan blue assay for cell morphology were performed for further confirmation. Results: AR showed potent activity against pancreatic cancer cells (MIA-PaCa-2). LDH activity confirmed that AR was active against pancreatic cancer cells. Finally, it was observed that AR exhibited significant effects on cancer cells due to synergistic effects of different compounds of AR. Conclusion: The study strongly suggests that AR has the potential to be an anticancer drug against pancreatic cancer. PMID:27313425

  19. Activated metallic gold as an agent for direct methoxycarbonylation.

    PubMed

    Xu, Bingjun; Madix, Robert J; Friend, Cynthia M

    2011-12-21

    We have discovered that metallic gold is a highly effective vehicle for the low-temperature vapor-phase carbonylation of methanol by insertion of CO into the O-H bond to form methoxycarbonyl. This reaction contrasts sharply to the carbonylation pathway well known for homogeneously catalyzed carbonylation reactions, such as the synthesis of acetic acid. The methoxycarbonyl intermediate can be further employed in a variety of methoxycarbonylation reactions, without the use or production of toxic chemicals. More generally we observe facile, selective methoxycarbonylation of alkyl and aryl alcohols and secondary amines on metallic gold well below room temperature. A specific example is the synthesis of dimethyl carbonate, which has extensive use in organic synthesis. This work establishes a unique framework for using oxygen-activated metallic gold as a catalyst for energy-efficient, environmentally benign production of key synthetic chemical agents. PMID:22035206

  20. Anaerobic bioleaching of metals from waste activated sludge.

    PubMed

    Meulepas, Roel J W; Gonzalez-Gil, Graciela; Teshager, Fitfety Melese; Witharana, Ayoma; Saikaly, Pascal E; Lens, Piet N L

    2015-05-01

    Heavy metal contamination of anaerobically digested waste activated sludge hampers its reuse as fertilizer or soil conditioner. Conventional methods to leach metals require aeration or the addition of leaching agents. This paper investigates whether metals can be leached from waste activated sludge during the first, acidifying stage of two-stage anaerobic digestion without the supply of leaching agents. These leaching experiments were done with waste activated sludge from the Hoek van Holland municipal wastewater treatment plant (The Netherlands), which contained 342 μg g(-1) of copper, 487 μg g(-1) of lead, 793 μg g(-1) of zinc, 27 μg g(-1) of nickel and 2.3 μg g(-1) of cadmium. During the anaerobic acidification of 3 gdry weight L(-1) waste activated sludge, 80-85% of the copper, 66-69% of the lead, 87% of the zinc, 94-99% of the nickel and 73-83% of the cadmium were leached. The first stage of two-stage anaerobic digestion can thus be optimized as an anaerobic bioleaching process and produce a treated sludge (i.e., digestate) that meets the land-use standards in The Netherlands for copper, zinc, nickel and cadmium, but not for lead. PMID:25659306

  1. Active Immobilized Antibiotics Based on Metal Hydroxides1

    PubMed Central

    Kennedy, John F.; Humphreys, John D.

    1976-01-01

    The water-insoluble hydroxides of zirconium (IV), titanium (IV), titanium (III), iron (II), vanadium (III), and tin (II) have been used to prepare insoluble derivatives of a cyclic peptide antibiotic by a facile chelation process. Testing of the antibacterial activities of the products against two gram-positive and two gram-negative bacteria showed that in the majority of cases the water-insoluble antibiotics remained active against those bacteria susceptible to the parent antibiotic. The power of the assay system has been extended by the novel use of colored organisms to aid determinations where the growth of normal organisms could not be distinguished from the appearance of the supporting material. Insoluble derivatives of neomycin, polymyxin B, streptomycin, ampicillin, penicillin G, and chloramphenicol were prepared by chelation with zirconium hydroxide, and these derivatives similarly reflected the antibacterial activities of the parent compounds. Several of the metal hydroxides themselves possess antibacterial activity due to complex formation with the bacteria. However, the use of selected metal hydroxides can afford a simple, inexpensive, and inert matrix for antibiotic immobilization, resulting in an antibacterial product that may possess slow-release properties. The mechanisms by which the metal hydroxide-antibiotic association-dissociation may occur are discussed. PMID:949174

  2. Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae

    SciTech Connect

    Michalska, Karolina; Cuff, Marianne E.; Tesar, Christine; Feldmann, Brian; Joachimiak, Andrzej

    2011-08-01

    The crystal structure of 2-oxo-3-deoxygalactonate kinase from the De Ley–Doudoroff pathway of galactose metabolism has been determined at 2.1 Å resolution. In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De Ley–Doudoroff pathway, d-galactose is metabolized into pyruvate and d-glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1 Å resolution is reported, the first structure of an enzyme from the De Ley–Doudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two α/β domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein.

  3. 5-Oxo-ETE and the OXE receptor

    PubMed Central

    Grant, Gail E.; Rokach, Joshua; Powell, William S.

    2009-01-01

    5-Oxo-ETE is a product of the 5-lipoxygenase pathway that is formed by the oxidation of 5-HETE by 5-hydroxyeicosanoid dehydrogenase (5-HEDH). 5-HEDH is a microsomal NADP+-dependent enzyme that is highly selective for 5-HETE. 5-Oxo-ETE synthesis is regulated by intracellular NADP+ levels and is dramatically increased under conditions that favor oxidation of NADPH to NADP+ such as oxidative stress and the respiratory burst in phagocytic cells. 5-Oxo-ETE is a potent chemoattractant for eosinophils and has similar effects on neutrophils, basophils and monocytes. It elicits infiltration of eosinophils and, to a lesser extent, neutrophils into the skin after intradermal injection in humans. It also promotes the survival of tumor cells and has been shown to block the induction of apoptosis by 5-LO inhibitors. 5-Oxo-ETE acts by the Gi/o-coupled OXE receptor, which was also known as TG1019, R527 and hGPCR48. Although the pathophysiological role of 5-oxo-ETE is not well understood, it may play important roles in asthma and allergic diseases, cancer, and cardiovascular disease. The availability of a selective antagonist would help to clarify the role of 5-oxo-ETE and may be of therapeutic benefit. PMID:19450703

  4. Ligational behavior of Schiff bases towards transition metal ion and metalation effect on their antibacterial activity

    NASA Astrophysics Data System (ADS)

    Devi, Jai; Batra, Nisha; Malhotra, Rajesh

    2012-11-01

    New Schiff bases pyrazine-2-carboxylicacid (phenyl-pyridin-2-yl-methylene)-hydrazide (Hpch-bp) HL1 and pyrazine-2-carboxylicacid (pyridin-2-ylmethylene)-hydrazide (Hpch-pc) HL2 derived from condensation of pyrazine carboxylic hydrazide (Hpch) with 2-benzoyl pyridine (bp) or pyridine 2-carbaldehyde (pc) and their transition metal complexes of type ML(1-2)2 have been synthesized, where M = Mn(II), Co(II), Ni(II), Cu(II) and Zn(II). Characterization of ligands and their metal complexes was carried out by elemental analysis, conductimetric studies, magnetic susceptibility, spectroscopic techniques (IR, UV-VIS, NMR, ESR, Mass) and thermogravimetric analysis. The physico-chemical studies revealed octahedral geometry or distorted octahedral geometry around metal ion. These azomethine Schiff base ligands acted as tridentate ? coordinating through carbonyl, azomethine and pyridine nitrogen present in the ligand. The thermodynamic and thermal properties of the complexes have been investigated and it was observed on the basis of these studies that thermal stability of complexes follows the order Mn < Zn < Cu < Co < Ni. The ligands and their complexes were tested for in vitro antibacterial activity at different concentrations against bacteria viz. Gram positive Bacillus subtilis, Micrococcus luteus and Gram negative Pseudomonas aeruginosa, Pseudomonas mendocina. A marked enhancement in biocidal activity of the ligands under similar experimental conditions was observed as a consequence of coordination with metal ions. The trend of growth inhibition in the complexes was found to be in the order: Cu > Mn > Ni > Co > Zn.

  5. What is the active species of cytochrome P450 during camphor hydroxylation? QM/MM studies of different electronic states of compound I and of reduced and oxidized iron-oxo intermediates.

    PubMed

    Altun, Ahmet; Shaik, Sason; Thiel, Walter

    2007-07-25

    We have investigated C-H hydroxylation of camphor by Compound I (Cpd I) of cytochrome P450cam in different electronic states and by its one-electron reduced and oxidized forms, using QM/MM calculations in the native protein/solvent environment. Cpd I species with five unpaired electrons (pentaradicaloids) are ca. 12 kcal/mol higher in energy than the ground state Cpd I species with three unpaired electrons (triradicaloids). The H-abstraction transition states of pentaradicaloids lie ca. 21 (9) kcal/mol above the triradicaloid (pentaradicaloid) reactants. Hydroxylation via pentaradicaloids is thus facile provided that they can react before relaxing to the ground-state triradicaloids. Excited states of Cpd I with an Fe(V)-oxo moiety lie more than 20 kcal/mol above the triradicaloid ground state in single-point gas-phase calculations, but these electronic configurations are not stable upon including the point-charge protein environment which causes SCF convergence to the triradicaloid ground state. One-electron reduced species (Cpd II) show sluggish reactivity compared with Cpd I in agreement with experimental model studies. One-electron oxidized species are more reactive than Cpd I but seem too high in energy to be accessible. The barriers to hydrogen abstraction for the various forms of Cpd I are generally not affected much by the chosen protonation states of the Asp297 and His355 residues near the propionate side chains of the heme or by the appearance of radical character at Asp297, His355, or the propionates. PMID:17595079

  6. Metal-Metal Interactions in Heterobimetallic Complexes with Dinucleating Redox-Active Ligands.

    PubMed

    Broere, Daniël L J; Modder, Dieuwertje K; Blokker, Eva; Siegler, Maxime A; van der Vlugt, Jarl Ivar

    2016-02-12

    The tuning of metal-metal interactions in multinuclear assemblies is a challenge. Selective P coordination of a redox-active PNO ligand to Au(I) followed by homoleptic metalation of the NO pocket with Ni(II) affords a unique trinuclear Au-Ni-Au complex. This species features two antiferromagnetically coupled ligand-centered radicals and a double intramolecular d(8)-d(10) interaction, as supported by spectroscopic, single-crystal X-ray diffraction, and computational data. A corresponding cationic dinuclear Au-Ni analogue with a stronger d(8)-d(10) interaction is also reported. Although both heterobimetallic structures display rich electrochemistry, only the trinuclear Au-Ni-Au complex facilitates electrocatalytic C-X bond activation of alkyl halides in its doubly reduced state. Hence, the presence of a redox-active ligand framework, an available coordination site at gold, and the nature of the nickel-gold interaction appear to be essential for this reactivity. PMID:26762546

  7. Electrical active defects in HfO2 based metal/oxide/metal devices

    NASA Astrophysics Data System (ADS)

    El Kamel, F.

    2016-01-01

    Dielectric as well as thermally stimulated current measurements were performed on metal/HfO2/Pt capacitors in order to study the electrical active defects in hafnia thin films. Two thermally activated relaxation processes have been carried out from both measurements. At low temperatures, the relaxation process can be ascribed to the shallow traps level localized at 0.65 eV and generally evidenced by the second ionization of oxygen vacancies. At high temperatures, the relaxation process arises from the diffusion of positively charged oxygen vacancies by overcoming an energetic barrier of about 1 eV.

  8. Activation of Autophagy by Metals in Chlamydomonas reinhardtii

    PubMed Central

    Pérez-Martín, Marta; Blaby-Haas, Crysten E.; Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Blaby, Ian K.; Merchant, Sabeeha S.

    2015-01-01

    Autophagy is an intracellular self-degradation pathway by which eukaryotic cells recycle their own material in response to specific stress conditions. Exposure to high concentrations of metals causes cell damage, although the effect of metal stress on autophagy has not been explored in photosynthetic organisms. In this study, we investigated the effect of metal excess on autophagy in the model unicellular green alga Chlamydomonas reinhardtii. We show in cells treated with nickel an upregulation of ATG8 that is independent of CRR1, a global regulator of copper signaling in Chlamydomonas. A similar effect on ATG8 was observed with copper and cobalt but not with cadmium or mercury ions. Transcriptome sequencing data revealed an increase in the abundance of the protein degradation machinery, including that responsible for autophagy, and a substantial overlap of that increased abundance with the hydrogen peroxide response in cells treated with nickel ions. Thus, our results indicate that metal stress triggers autophagy in Chlamydomonas and suggest that excess nickel may cause oxidative damage, which in turn activates degradative pathways, including autophagy, to clear impaired components and recover cellular homeostasis. PMID:26163317

  9. Activation of Autophagy by Metals in Chlamydomonas reinhardtii.

    PubMed

    Pérez-Martín, Marta; Blaby-Haas, Crysten E; Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Blaby, Ian K; Merchant, Sabeeha S; Crespo, José L

    2015-09-01

    Autophagy is an intracellular self-degradation pathway by which eukaryotic cells recycle their own material in response to specific stress conditions. Exposure to high concentrations of metals causes cell damage, although the effect of metal stress on autophagy has not been explored in photosynthetic organisms. In this study, we investigated the effect of metal excess on autophagy in the model unicellular green alga Chlamydomonas reinhardtii. We show in cells treated with nickel an upregulation of ATG8 that is independent of CRR1, a global regulator of copper signaling in Chlamydomonas. A similar effect on ATG8 was observed with copper and cobalt but not with cadmium or mercury ions. Transcriptome sequencing data revealed an increase in the abundance of the protein degradation machinery, including that responsible for autophagy, and a substantial overlap of that increased abundance with the hydrogen peroxide response in cells treated with nickel ions. Thus, our results indicate that metal stress triggers autophagy in Chlamydomonas and suggest that excess nickel may cause oxidative damage, which in turn activates degradative pathways, including autophagy, to clear impaired components and recover cellular homeostasis. PMID:26163317

  10. SEQUESTERING AGENTS FOR ACTIVE CAPS - REMEDIATION OF METALS AND ORGANICS

    SciTech Connect

    Knox, A; Michael Paller, M; Danny D. Reible, D; Xingmao Ma, X; Ioana G. Petrisor, I

    2007-05-10

    This research evaluated organoclays, zeolites, phosphates, and a biopolymer as sequestering agents for inorganic and organic contaminants. Batch experiments were conducted to identify amendments and mixtures of amendments for metal and organic contaminants removal and retention. Contaminant removal was evaluated by calculating partitioning coefficients. Metal retention was evaluated by desorption studies in which residue from the removal studies was extracted with 1 M MgCl{sub 2} solution. The results indicated that phosphate amendments, some organoclays, and the biopolymer, chitosan, were very effective sequestering agents for metals in fresh and salt water. Organoclays were very effective sorbents for phenanthrene, pyrene, and benzo(a)pyrene. Partitioning coefficients for the organoclays were 3000-3500 ml g{sup -1} for benzo(a)pyrene, 400-450 ml g{sup -1} for pyrene, and 50-70 ml g{sup -1} for phenanthrene. Remediation of sites with a mixture of contaminants is more difficult than sites with a single contaminant because metals and organic contaminants have different fate and transport mechanisms in sediment and water. Mixtures of amendments (e.g., organoclay and rock phosphate) have high potential for remediating both organic and inorganic contaminants under a broad range of environmental conditions, and have promise as components in active caps for sediment remediation.

  11. High-nuclearity ruthenium carbonyl cluster complexes derived from 2-amino-6-methylpyridine: synthesis of nonanuclear derivatives containing mu4- and mu5-oxo ligands.

    PubMed

    Cabeza, Javier A; del Río, Ignacio; García-Alvarez, Pablo; Miguel, Daniel

    2006-07-24

    Nonanuclear cluster complexes [Ru9(mu3-H)2(mu-H)(mu5-O)(mu4-ampy)(mu3-Hampy)(CO)21] (4) (H2ampy = 2-amino-6-methylpyridine), [Ru9(mu5-O)2(mu4-ampy)(mu3-Hampy)2(mu-CO)(CO)20] (5), [Ru9(mu5-O)2(mu4-ampy)(mu3-Hampy)2(mu-CO)2(CO)19] (6), and [Ru9(mu4-O)(mu5-O)(mu4-ampy)(mu3-Hampy)(mu-Hampy)(mu-CO)(CO)19] (7), together with the known hexanuclear [Ru6(mu3-H)2(mu5-ampy)(mu-CO)2(CO)14] (2) and the novel pentanuclear [Ru5(mu4-ampy)(2)(mu-CO)(CO)12] (3) complexes, are products of the thermolysis of [Ru3(mu-H)(mu3-Hampy)(CO)9] (1) in decane at 150 degrees C. Two different and very unusual quadruply bridging coordination modes have been observed for the ampy ligand. Compounds 4-7 also feature one (4) or two (5-7) bridging oxo ligands. With the exception of one of the oxo ligands of 7, which is in a distorted tetrahedral environment, the remaining oxo ligands of 4-7 are surrounded by five metal atoms. In carbonyl metal clusters, quadruply bridging oxo ligands are very unusual, whereas quintuply bridging oxo ligands are unprecedented. By using 18O-labeled water, we have unambiguously established that these oxo ligands arise from water. PMID:16842009

  12. Synthesis, Characterization, and Biological Activity of N′-[(Z)-(3-Methyl-5-oxo-1-phenyl-1,5-dihydro-4H-pyrazol-4-ylidene)(phenyl)methyl]benzohydrazide and Its Co(II), Ni(II), and Cu(II) Complexes

    PubMed Central

    Asegbeloyin, Jonnie N.; Ujam, Oguejiofo T.; Okafor, Emmanuel C.; Babahan, Ilknur; Coban, Esin Poyrazoglu; Özmen, Ali; Biyik, Halil

    2014-01-01

    Reaction of 1-phenyl-3-methyl-4-benzoyl-pyrazol-5-one and benzoyl hydrazide in refluxing ethanol gave N′-[(Z)-(3-methyl-5-oxo-1-phenyl-1,5-dihydro-4H-pyrazol-4-ylidene)(phenyl)methyl]benzohydrazide (HL1), which was characterized by NMR spectroscopy and single-crystal X-ray structure study. X-ray diffraction analyses of the crystals revealed a nonplanar molecule, existing in the keto-amine form, with intermolecular hydrogen bonding forming a seven-membered ring system. The reaction of HL1 with Co(II), Ni(II), and Cu(II) halides gave the corresponding complexes, which were characterized by elemental analysis, molar conductance, magnetic measurements, and infrared and electronic spectral studies. The compounds were screened for their in vitro cytotoxic activity against HL-60 human promyelocytic leukemia cells and antimicrobial activity against some bacteria and yeasts. Results showed that the compounds are potent against HL-60 cells with the IC50 value ≤5 μM, while some of the compounds were active against few studied Gram-positive bacteria. PMID:25332694

  13. Microwave assisted one-pot catalyst free green synthesis of new methyl-7-amino-4-oxo-5-phenyl-2-thioxo-2,3,4,5-tetrahydro-1H-pyrano[2,3-d]pyrimidine-6-carboxylates as potent in vitro antibacterial and antifungal activity.

    PubMed

    Bhat, Ajmal R; Shalla, Aabid H; Dongre, Rajendra S

    2015-11-01

    An efficiently simple protocol for the synthesis of methyl 7 amino-4-oxo-5-phenyl-2-thioxo-2, 3, 4,5-tetrahydro-1H-pyrano[2,3-d]pyrimidine-6-carboxylates via one-pot three component condensation pathway is established via microwave irradiation using varied benzaldehyde derivatives, methylcyanoacetate and thio-barbituric acid in water as a green solvent. A variety of functionalized substrates were found to react under this methodology due to its easy operability and offers several advantages like, high yields (78-94%), short reaction time (3-6 min), safety and environment friendly without used any catalyst. The synthesized compounds (4a-4k) showed comparatively good in vitro antimicrobial and antifungal activities against different strains. The Compounds 4a, 4b, 4c, 4d 4e and 4f showed maximum antimicrobial activity against Staphylococcus aureus, Bacillus cereus (gram-positive bacteria), Escherichia coli, Klebshiella pneumonia, Pseudomonas aeruginosa (gram-negative bacteria). The synthesized compound 4f showed maximum antifungal activity against Aspergillus Niger and Penicillium chrysogenum strains. Streptomycin is used as standard for bacterial studies and Mycostatin as standards for fungal studies. Structure of all newly synthesized products was characterized on the basis of IR, (1)H NMR, (13)C NMR and mass spectral analysis. PMID:26644932

  14. A Metal-Based Inhibitor of NEDD8-Activating Enzyme

    PubMed Central

    Chan, Daniel Shiu-Hin; Leung, Chung-Hang; Wang, Hui-Min; Ma, Dik-Lung

    2012-01-01

    A cyclometallated rhodium(III) complex [Rh(ppy)2(dppz)]+ (1) (where ppy = 2-phenylpyridine and dppz = dipyrido[3,2-a:2′,3′-c]phenazine dipyridophenazine) has been prepared and identified as an inhibitor of NEDD8-activating enzyme (NAE). The complex inhibited NAE activity in cell-free and cell-based assays, and suppressed the CRL-regulated substrate degradation and NF-κB activation in human cancer cells with potency comparable to known NAE inhibitor MLN4924. Molecular modeling analysis suggested that the overall binding mode of 1 within the binding pocket of the APPBP1/UBA3 heterodimer resembled that for MLN4924. Complex 1 is the first metal complex reported to suppress the NEDDylation pathway via inhibition of the NEDD8-activating enzyme. PMID:23185368

  15. An active metallic nanomatryushka with two similar super-resonances

    SciTech Connect

    Wu, D. J.; Cheng, Y.; Wu, X. W.; Liu, X. J.

    2014-07-07

    The optical properties of a simple metallic nanomatryushka (nanosphere-in-a-nanoshell) with gain have been investigated theoretically. The spaser (surface plasmon amplification by stimulated emission of radiation) phenomena can be observed at two critical wavelengths in the active metallic nanomatryushkas. With increasing the gain coefficient of the middle layer, a similar super surface plasmon (SP) resonance is first found at the ω₋⁺|₁ mode of the active nanoparticles and then breaks down. With further increasing the gain coefficient, another similar super-resonance occurs at the ω₋⁻|₁ mode. The near-field enhancements in the active nanomatryushkas also have been greatly amplified at the critical wavelengths for ω₋⁺|₊ and ω₋⁻|₁ modes. It is further found that the amplifications of SPs in the active Ag–SiO₂–Au nanoshell are strongest in four kinds of nanoshells and hence the largest near fields. The giant near-field enhancement can greatly enhance the Raman excitation and emission.

  16. Ligational behavior of Schiff bases towards transition metal ion and metalation effect on their antibacterial activity.

    PubMed

    Devi, Jai; Batra, Nisha; Malhotra, Rajesh

    2012-11-01

    New Schiff bases pyrazine-2-carboxylicacid (phenyl-pyridin-2-yl-methylene)-hydrazide (Hpch-bp) HL(1) and pyrazine-2-carboxylicacid (pyridin-2-ylmethylene)-hydrazide (Hpch-pc) HL(2) derived from condensation of pyrazine carboxylic hydrazide (Hpch) with 2-benzoyl pyridine (bp) or pyridine 2-carbaldehyde (pc) and their transition metal complexes of type ML((1-2)2) have been synthesized, where M=Mn(II), Co(II), Ni(II), Cu(II) and Zn(II). Characterization of ligands and their metal complexes was carried out by elemental analysis, conductimetric studies, magnetic susceptibility, spectroscopic techniques (IR, UV-VIS, NMR, ESR, Mass) and thermogravimetric analysis. The physico-chemical studies revealed octahedral geometry or distorted octahedral geometry around metal ion. These azomethine Schiff base ligands acted as tridentate coordinating through carbonyl, azomethine and pyridine nitrogen present in the ligand. The thermodynamic and thermal properties of the complexes have been investigated and it was observed on the basis of these studies that thermal stability of complexes follows the order Mnactivity at different concentrations against bacteria viz. Gram positive Bacillus subtilis, Micrococcus luteus and Gram negative Pseudomonas aeruginosa, Pseudomonas mendocina. A marked enhancement in biocidal activity of the ligands under similar experimental conditions was observed as a consequence of coordination with metal ions. The trend of growth inhibition in the complexes was found to be in the order: Cu>Mn>Ni>Co>Zn. PMID:22813991

  17. Theoretical investigation on the mechanism and dynamics of oxo exchange of neptunyl(VI) hydroxide in aqueous solution.

    PubMed

    Yang, Xia; Chai, Zhifang; Wang, Dongqi

    2015-03-21

    Four types of reaction mechanisms for the oxo ligand exchange of monomeric and dimeric neptunyl(VI) hydroxide in aqueous solution were explored computationally using density functional theory (DFT) and ab initio classical molecular dynamics. The obtained results were compared with previous studies on the oxo exchange of uranyl hydroxide, as well as with experiments. It is found that the stable T-shaped [NpO3(OH)3](3-) intermediate is a key species for oxo exchange in the proton transfer in mononuclear Path I and binuclear Path IV, similar to the case of uranyl(VI) hydroxide. Path I is thought to be the preferred oxo exchange mechanism for neptunyl(VI) hydroxide in our calculations, due to the lower activation energy (22.7 and 13.1 kcal mol(-1) for ΔG(‡) and ΔH(‡), respectively) of the overall reaction. Path II via a cis-neptunyl structure assisted by a water molecule might be a competitive channel against Path I with a mononuclear mechanism, owing to a rapid dynamical process occurring in Path II. In Path IV with the binuclear mechanism, oxo exchange is accomplished via the interaction between [NpO2(OH)4](2-) and T-shaped [NpO3(OH)3](3-) with a low activation energy for the rate-determining step, however, the overall energy required to fulfill the reaction is slightly higher than that in mononuclear Path I, suggesting a possible binuclear process in the higher energy region. The chemical bonding evolution along the reaction pathways was discussed by using topological methodologies of the electron localization function (ELF). PMID:25706188

  18. Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae

    PubMed Central

    Michalska, Karolina; Cuff, Marianne E.; Tesar, Christine; Feldmann, Brian; Joachimiak, Andrzej

    2011-01-01

    In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De Ley–Doudoroff pathway, d-galactose is metabolized into pyruvate and d-­glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-­oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1 Å resolution is reported, the first structure of an enzyme from the De Ley–Doudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two α/β domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein. PMID:21795809

  19. Biofilms Versus Activated Sludge: Considerations in Metal and Metal Oxide Nanoparticle Removal from Wastewater.

    PubMed

    Walden, Connie; Zhang, Wen

    2016-08-16

    The increasing application of metal and metal oxide nanoparticles [Me(O)NPs] in consumer products has led to a growth in concentration of these nanoparticles in wastewater as emerging contaminants. This may pose a threat to ecological communities (e.g., biological nutrient removal units) within treatment plants and those subject to wastewater effluents. Here, the toxicity, fate, and process implications of Me(O)NPs within wastewater treatment, specifically during activated sludge processing and biofilm systems are reviewed and compared. Research showed activated sludge achieves high removal rate of Me(O)NPs by the formation of aggregates through adsorption. However, recent literature reveals evidence that inhibition is likely for nutrient removal capabilities such as nitrification. Biofilm systems were much less studied, but show potential to resist Me(O)NP inhibition and achieve removal through possible retention by sorption. Implicating factors during bacteria-Me(O)NP interactions such as aggregation, surface functionalization, and the presence of organics are summarized. At current modeled levels, neither activated sludge nor biofilm systems can achieve complete removal of Me(O)NPs, thus allowing for long-term environmental exposure of diverse biological communities to Me(O)NPs in streams receiving wastewater effluents. Future research directions are identified throughout in order to minimize the impact of these nanoparticles released. PMID:27437755

  20. Interaction of metallic clusters with biologically active curcumin molecules

    NASA Astrophysics Data System (ADS)

    Gupta, Sanjeev K.; He, Haiying; Liu, Chunhui; Dutta, Ranu; Pandey, Ravindra

    2015-09-01

    We have investigated the interaction of subnano metallic Gd and Au clusters with curcumin, an important biomolecule having pharmacological activity. Gd clusters show different site preference to curcumin and much stronger interaction strength, in support of the successful synthesis of highly stable curcumin-coated Gd nanoparticles as reported recently. It can be attributed to significant charge transfer from the Gd cluster to curcumin together with a relatively strong hybridization of the Gd df-orbitals with curcumin p-orbitals. These results suggest that Gd nanoparticles can effectively be used as delivery carriers for curcumin at the cellular level for therapy and medical imaging applications.

  1. Development of structure-activity relationship for metal oxide nanoparticles

    NASA Astrophysics Data System (ADS)

    Liu, Rong; Zhang, Hai Yuan; Ji, Zhao Xia; Rallo, Robert; Xia, Tian; Chang, Chong Hyun; Nel, Andre; Cohen, Yoram

    2013-05-01

    Nanomaterial structure-activity relationships (nano-SARs) for metal oxide nanoparticles (NPs) toxicity were investigated using metrics based on dose-response analysis and consensus self-organizing map clustering. The NP cellular toxicity dataset included toxicity profiles consisting of seven different assays for human bronchial epithelial (BEAS-2B) and murine myeloid (RAW 264.7) cells, over a concentration range of 0.39-100 mg L-1 and exposure time up to 24 h, for twenty-four different metal oxide NPs. Various nano-SAR building models were evaluated, based on an initial pool of thirty NP descriptors. The conduction band energy and ionic index (often correlated with the hydration enthalpy) were identified as suitable NP descriptors that are consistent with suggested toxicity mechanisms for metal oxide NPs and metal ions. The best performing nano-SAR with the above two descriptors, built with support vector machine (SVM) model and of validated robustness, had a balanced classification accuracy of ~94%. An applicability domain for the present data was established with a reasonable confidence level of 80%. Given the potential role of nano-SARs in decision making, regarding the environmental impact of NPs, the class probabilities provided by the SVM nano-SAR enabled the construction of decision boundaries with respect to toxicity classification under different acceptance levels of false negative relative to false positive predictions.Nanomaterial structure-activity relationships (nano-SARs) for metal oxide nanoparticles (NPs) toxicity were investigated using metrics based on dose-response analysis and consensus self-organizing map clustering. The NP cellular toxicity dataset included toxicity profiles consisting of seven different assays for human bronchial epithelial (BEAS-2B) and murine myeloid (RAW 264.7) cells, over a concentration range of 0.39-100 mg L-1 and exposure time up to 24 h, for twenty-four different metal oxide NPs. Various nano-SAR building models were

  2. Transition metal activation and functionalization of carbon-hydrogen bonds

    SciTech Connect

    Jones, W.D.

    1992-06-01

    We are investigating the fundamental thermodynamic and kinetic factors that influence carbon-hydrogen bond activation at homogeneous transition metal centers and the conversion of hydrocarbons into functionalized products of potential use to the chemical industry. Advances have been made in both understanding the interactions of hydrocarbons with metals and in the functionalization of hydrocarbons. We have found that RhCl(PR{sub 3}){sub 2}(CNR) complexes can catalyze the insertion of isonitriles into the C-H bonds or arenes upon photolysis. The mechanism of these reactions was found to proceed by way of initial phosphine dissociation, followed by C-H activation and isonitrile insertion. We have also examined reactions of a series of arenes with (C{sub 5}Me{sub 5})Rh(PMe{sub 3})PhH and begun to map out the kinetic and thermodynamic preferences for arene coordination. The effects of resonance, specifically the differences in the Hueckel energies of the bound vs free ligand, are now believed to fully control the C-H activation/{eta}{sup 2}-coordination equilibria. We have begun to examine the reactions of rhodium isonitrile pyrazolylborates for alkane and arene C-H bond activation. A new, labile, carbodiimide precursor has been developed for these studies. We have completed studies of the reactions of (C{sub 5}Me{sub 5})Rh(PMe{sub 3})H{sub 2} with D{sub 2} and PMe{sub 3} that indicate that both {eta}{sup 5} {yields} {eta}{sup 3} ring slippage and metal to ring hydride migration occur more facilely than thermal reductive elimination of H{sub 2}. We have examined the reactions of heterocycles with (C{sub 5}Me{sub 5})Rh(PMe{sub 3})PhH and found that pyrrole and furan undergo C-H or N-H activation. Thiophene, however, undergoes C-S bond oxidative addition, and the mechanism of activation has been shown to proceed through sulfur coordination prior to C-S insertion.

  3. Redox-Active Metal-Organic Frameworks: Highly Stable Charge-Separated States through Strut/Guest-to-Strut Electron Transfer.

    PubMed

    Sikdar, Nivedita; Jayaramulu, Kolleboyina; Kiran, Venkayala; Rao, K Venkata; Sampath, Srinivasan; George, Subi J; Maji, Tapas Kumar

    2015-08-10

    Molecular organization of donor and acceptor chromophores in self-assembled materials is of paramount interest in the field of photovoltaics or mimicry of natural light-harvesting systems. With this in mind, a redox-active porous interpenetrated metal-organic framework (MOF), {[Cd(bpdc)(bpNDI)]⋅4.5 H2 O⋅DMF}n (1) has been constructed from a mixed chromophoric system. The μ-oxo-bridged secondary building unit, {Cd2 (μ-OCO)2 }, guides the parallel alignment of bpNDI (N,N'-di(4-pyridyl)-1,4,5,8-naphthalenediimide) acceptor linkers, which are tethered with bpdc (bpdcH2 =4,4'-biphenyldicarboxylic acid) linkers of another entangled net in the framework, resulting in photochromic behaviour through inter-net electron transfer. Encapsulation of electron-donating aromatic molecules in the electron-deficient channels of 1 leads to a perfect donor-acceptor co-facial organization, resulting in long-lived charge-separated states of bpNDI. Furthermore, 1 and guest encapsulated species are characterised through electrochemical studies for understanding of their redox properties. PMID:26206156

  4. A maize death acid, 10-oxo-11-phytoenoic acid, is the predominant cyclopentenone signal present during multiple stress and developmental conditions

    PubMed Central

    Christensen, Shawn A.; Huffaker, Alisa; Hunter, Charles T.; Alborn, Hans T.; Schmelz, Eric A.

    2016-01-01

    abstract Recently we investigated the function of the 9-lipoxygenase (LOX) derived cyclopentenones 10-oxo-11-phytoenoic acid (10-OPEA) and 10-oxo-11,15-phytodienoic acid (10-OPDA) and identified their C-14 and C-12 derivatives. 10-OPEA accumulation is elicited by fungal and insect attack and acts as a strong inhibitor of microbial and herbivore growth. Although structurally similar, comparative analyses between 10-OPEA and its 13-LOX analog 12-oxo-phytodienoic acid (12-OPDA) demonstrate specificity in transcript accumulation linked to detoxification, secondary metabolism, jasmonate regulation, and protease inhibition. As a potent cell death signal, 10-OPEA activates cysteine protease activity leading to ion leakage and apoptotic-like DNA fragmentation. In this study we further elucidate the distribution, abundance, and functional roles of 10-OPEA, 10-OPDA, and 12-OPDA, in diverse organs under pathogen- and insect-related stress. PMID:26669723

  5. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting...

  6. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting...

  7. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting...

  8. Metal complexes of ONO donor Schiff base ligand as a new class of bioactive compounds; Synthesis, characterization and biological evolution

    NASA Astrophysics Data System (ADS)

    Kumar Naik, K. H.; Selvaraj, S.; Naik, Nagaraja

    2014-10-01

    Present work reviews that, the synthesis of (E)-N";-((7-hydroxy-4-methyl-2-oxo-2H-chromen-8-yl)methylene)benzohydrazide [L] ligand and their metal complexes. The colored complexes were prepared of type [M2+L]X2, where M2+ = Mn, Co, Ni, Cu, Sr and Cd, L = (7-hydroxy-4-methyl-2-oxo-2H-chromen-8-yl)methylene)benzohydrazide, X = Cl-. Ligand derived from the condensation of 8-formyl-7-hydroxy-4-methylcoumarin and benzohydrazide in the molar ratio 1:1 and in the molar ratio 1:2 for metal complexes have been prepared. The chelation of the ligand to metal ions occurs through the both oxygen groups, as well as the nitrogen atoms of the azomethine group of the ligand. Reactions of the Schiff base ligand with Manganese(II), Cobalt(II), Nickel(II), Copper(II), Strontium(II), and Cadmium(II) afforded the corresponding metal complexes. The structures of the obtained ligand and their respective metal complexes were elucidated by infra-red, elemental analysis, Double beam UV-visible spectra, conductometric measurements, magnetic susceptibility measurements and also thermochemical studies. The metal complex exhibits octahedral coordination geometrical arrangement. Schiff base ligand and their metal complexes were tested against antioxidants, antidiabetic and antimicrobial activities have been studied. The Schiff base metal complexes emerges effective α-glucosidase inhibitory activity than free Schiff base ligand.

  9. Underground Corrosion of Activated Metals, 6-Year Exposure Analysis

    SciTech Connect

    M. K. Adler Flitton; T. S. Yoder

    2006-03-01

    The subsurface radioactive disposal site located at the Idaho National Laboratory contains neutronactivated metals from non-fuel nuclear-reactor-core components. A long-term underground corrosion test is being conducted to obtain site-specific corrosion rates to support efforts to more accurately estimate the transfer of activated elements in the surrounding arid vadose zone environment. The test uses nonradioactive metal coupons representing the prominent neutron-activated materials buried at the disposal location, namely, Type 304L stainless steel (UNS S30403), Type 316L stainless steel (S31603), nickel-chromium alloy (UNS NO7718), beryllium, aluminum 6061-T6 (A96061), and a zirconium alloy (UNS R60804). In addition, carbon steel (the material presently used in the cask disposal liners and other disposal containers) and a duplex stainless steel (UNS S32550) are also included in the test. This paper briefly describes the ongoing test and presents the results of corrosion analysis from coupons exposed underground for 1, 3, and 6 years.

  10. Formation of high-valent iron-oxo species in superoxide reductase: characterization by resonance Raman spectroscopy.

    PubMed

    Bonnot, Florence; Tremey, Emilie; von Stetten, David; Rat, Stéphanie; Duval, Simon; Carpentier, Philippe; Clemancey, Martin; Desbois, Alain; Nivière, Vincent

    2014-06-01

    Superoxide reductase (SOR), a non-heme mononuclear iron protein that is involved in superoxide detoxification in microorganisms, can be used as an unprecedented model to study the mechanisms of O2 activation and of the formation of high-valent iron-oxo species in metalloenzymes. By using resonance Raman spectroscopy, it was shown that the mutation of two residues in the second coordination sphere of the SOR iron active site, K48 and I118, led to the formation of a high-valent iron-oxo species when the mutant proteins were reacted with H2O2. These data demonstrate that these residues in the second coordination sphere tightly control the evolution and the cleavage of the O-O bond of the ferric iron hydroperoxide intermediate that is formed in the SOR active site. PMID:24777646

  11. Structural and mechanistic aspects of Mn-oxo and co-based compounds in water oxidation catalysis and potential applications in solar fuel production.

    PubMed

    Hou, Harvey J M

    2010-08-01

    To address the issues of energy crisis and global warming, novel renewable carbon-free or carbon-neutral energy sources must be identified and developed. A deeper understanding of photosynthesis is the key to provide a solid foundation to facilitate this transformation. To mimic the water oxidation of photosystem II oxygen evolving complex, Mn-oxo complexes and Co-phosphate catalytic material were discovered in solar energy storage. Building on these discoveries, recent advances in solar energy conversion showed a compelling working principle by combing the active Mn-oxo and Co-based catalysts in water splitting with semiconductor hetero-nanostructures for effective solar energy harnessing. In this review the appealing systems including Mn-oxo tetramer/Nafion, Mn-oxo dimer/TiO(2), Mn-oxo oligomer/WO(3), Co-Pi/Fe(2)O(3), and Co-Pi/ZnO are summarized and discussed. These accomplishments offer a promising framework and have a profound impact in the field of solar fuel production. PMID:20666926

  12. Entangled Electrons Foil Synthesis of Elusive Low-Valent Vanadium Oxo Complex.

    PubMed

    Schlimgen, Anthony W; Heaps, Charles W; Mazziotti, David A

    2016-02-18

    We examine the recently reported first synthesis of the elusive low-valent vanadium(III) in a vanadium oxo complex with a computation representing 10(21) quantum degrees of freedom. While this computation is intractable with a conventionally constructed wave function, it is performed here by a direct calculation of the system's two-electron reduced density matrix (2-RDM), where the 2-RDM is constrained by nontrivial conditions, known as N-representability conditions, that restrict the 2-RDM to represent an N electron quantum system. We show that the added (reducing) electron becomes entangled among the five pyridine ligands. While smaller calculations predict a metal-centered addition, large-scale 2-RDM calculations show that quantum entanglement redirects the electron transfer to the pyridine ligands, resulting in a ligand-centered addition. Beyond its implications for the synthesis of low-valent vanadium oxo complexes, the result suggests new possibilities for using quantum entanglement to predict and control electron transfer in chemical and biological materials. PMID:26824140

  13. DEVELOPMENT OF LOCOMOTOR ACTIVITY OF RAT PUPS EXPOSED TO HEAVY METALS

    EPA Science Inventory

    Cadmium (Cd), triethyltin (TET), and trimethyltin (TMT) are heavy metals which are neurotoxic to developing animals. In the present experiment, preweaning assessment of locomotor activity was used to detect and differentiate between the developmental toxicity of these metals. On ...

  14. Phytochelatin synthase activity as a marker of metal pollution.

    PubMed

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene

    2011-08-30

    The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO(3))(2) for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35°C for 30min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270fkat) in treated cells was more than seven times higher in comparison to control ones. K(m) for PCS was estimated as 2.3mM. PMID:21715087

  15. Bactericidal activity of metal-mediated peroxide-ascorbate systems.

    PubMed

    Drath, D B; Karnovsky, M L

    1974-11-01

    Model systems containing ascorbate, hydrogen peroxide, and divalent copper or cobalt have been shown to possess marked bactericidal activity. At equivalent concentrations, copper-containing systems were more bactericidal than the corresponding mixtures containing cobalt. Cobalt at concentrations below 10(-4) M did not appreciably augment microbicidal activity, whereas systems containing copper at concentrations as low as 5 x 10(-6) M were still capable of causing some bacterial death. Manganese was inactive. None of these systems was as potent as the well known myeloperoxidase-peroxide-halide system. The mechanisms of action of these systems are not as yet clear. The possibility that they function through the generation of superoxide (O(2) (-)), hydroxyl radical (OH.), or other free radicals was explored through the use of superoxide dismutase and several free radical scavengers. It seems likely at present that the two active metal-mediated systems function via separate mechanisms. The copper system acts with dehydroascorbate, whereas the cobalt system does not. Activity in the cobalt system appears to depend upon the generation of free radicals. PMID:16558093

  16. Active-Site-Accessible, Porphyrinic Metal;#8722;Organic Framework Materials

    SciTech Connect

    Farha, Omar K.; Shultz, Abraham M.; Sarjeant, Amy A.; Nguyen, SonBinh T.; Hupp, Joseph T.

    2012-02-06

    On account of their structural similarity to cofactors found in many metallo-enzymes, metalloporphyrins are obvious potential building blocks for catalytically active, metal-organic framework (MOF) materials. While numerous porphyrin-based MOFs have already been described, versions featuring highly accessible active sites and permanent microporosity are remarkably scarce. Indeed, of the more than 70 previously reported porphyrinic MOFs, only one has been shown to be both permanently microporous and contain internally accessible active sites for chemical catalysis. Attempts to generalize the design approach used in this single successful case have failed. Reported here, however, is the synthesis of an extended family of MOFs that directly incorporate a variety of metalloporphyrins (specifically Al{sup 3+}, Zn{sup 2+}, Pd{sup 2+}, Mn{sup 3+}, and Fe{sup 3+} complexes). These robust porphyrinic materials (RPMs) feature large channels and readily accessible active sites. As an illustrative example, one of the manganese-containing RPMs is shown to be catalytically competent for the oxidation of alkenes and alkanes.

  17. Simultaneous determination of 8-oxo-2’-deoxyguanosine and 8-oxo-2’-deoxyadenosine in human retinal DNA by liquid chromatography nanoelectrospray-tandem mass spectrometry

    PubMed Central

    Ma, Bin; Jing, Meng; Villalta, Peter W.; Kapphahn, Rebecca J.; Montezuma, Sandra R.; Ferrington, Deborah A.; Stepanov, Irina

    2016-01-01

    Age-related macular degeneration (AMD) is the leading cause of blindness among older adults in the developed world. Oxidative damage to mitochondrial DNA (mtDNA) in the retinal pigment epithelium (RPE) may play a key role in AMD. Measurement of oxidative DNA lesions such as 8-oxo-2’-deoxyguanosine (8-oxo-dG) and 8-oxo-2’-deoxyadenosine (8-oxo-dA) in diseased RPE could provide important insights into the mechanism of AMD development. We have developed a liquid chromatography-nanoelectrospray ionization-tandem mass spectrometry method for simultaneous analysis of 8-oxo-dG and 8-oxo-dA in human retinal DNA. The developed method was applied to the analysis of retinal DNA from 5 donors with AMD and 5 control donors without AMD. In mtDNA, the levels of 8-oxo-dG in controls and AMD donors averaged 170 and 188, and 8-oxo-dA averaged 11 and 17 adducts per 106 bases, respectively. In nuclear DNA, the levels of 8-oxo-dG in controls and AMD donors averaged 0.54 and 0.96, and 8-oxo-dA averaged 0.04 and 0.05 adducts per 106 bases, respectively. This highly sensitive method allows for the measurement of both adducts in very small amounts of DNA and can be used in future studies investigating the pathophysiological role of 8-oxo-dG and 8-oxo-dA in AMD and other oxidative damage-related diseases in humans. PMID:26979577

  18. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  19. Characterization and metal sorptive properties of oxidized active carbon.

    PubMed

    Strelko, Vladimir; Malik, Danish J

    2002-06-01

    A commercial activated carbon Chemviron F 400 has been oxidized using nitric acid in order to introduce a variety of acidic surface functional groups. Both unoxidized and oxidized carbon samples were characterized using nitrogen porosimetry, elemental analysis, pH titration, Boehm's titration, and electrophoretic mobility measurements. Results show that oxidation treatment reduced surface area and pore volume. However, the carbon surface acquires an acidic character with carboxylic groups being the dominant surface functional groups. The modified sample displays cation-exchange properties over a wide range of pH values and exhibits polyfunctional nature. Both carbon samples were challenged for the removal of transition metals such as copper(II), nickel(II), cobalt(II), zinc(II), and manganese(II). The affinity series Mn2+Zn2+ has been found to coincide with the general stability sequence of metal complexes (the Irving-Williams series). The higher preference displayed by carbons toward copper(II) is a consequence of the fact that copper(II) often forms distorted and more stable octahedral complexes. PMID:16290653

  20. Controlled Chemistry Approach to the Oxo-Functionalization of Graphene.

    PubMed

    Eigler, Siegfried

    2016-05-17

    Graphene is the best-studied 2D material available. However, its production is still challenging and the quality depends on the preparation procedure. Now, more than a decade after the outstanding experiments conducted on graphene, the most successful wet-chemical approach to graphene and functionalized graphene is based on the oxidation of graphite. Graphene oxide has been known for more than a century; however, the structure bears variable large amounts of lattice defects that render the development of a controlled chemistry impossible. The controlled oxo-functionalization of graphene avoids the formation of defects within the σ-framework of carbon atoms, making the synthesis of specific molecular architectures possible. The scope of this review is to introduce the field of oxo-functionalizing graphene. In particular, the differences between GO and oxo-functionalized graphene are described in detail. Moreover analytical methods that allow determining lattice defects and functional groups are introduced followed by summarizing the current state of controlled oxo-functionalization of graphene. PMID:26990805

  1. Wolves in Sheep's Clothing: μ-Oxo-Diiron Corroles Revisited.

    PubMed

    Ganguly, Sumit; Vazquez-Lima, Hugo; Ghosh, Abhik

    2016-07-18

    For well over 20 years, μ-oxo-diiron corroles, first reported by Vogel and co-workers in the form of μ-oxo-bis[(octaethylcorrolato)iron] (Mössbauer δ 0.02 mm s(-1) , ΔEQ 2.35 mm s(-1) ), have been thought of as comprising a pair antiferromagnetically coupled low-spin Fe(IV) centers. The remarkable stability of these complexes, which can be handled at room temperature and crystallographically analyzed, present a sharp contrast to the fleeting nature of enzymatic, iron(IV)-oxo intermediates. An array of experimental and theoretical methods have now shown that the iron centers in these complexes are not Fe(IV) but intermediate-spin Fe(III) coupled to a corrole(.2-) . The intramolecular spin couplings in {Fe[TPC]}2 (μ-O) were analyzed via DFT(B3LYP) calculations in terms of the Heisenberg-Dirac-van Vleck spin Hamiltonian H=JFe-corrole (SFe ⋅Scorrole )+JFe-Fe' (SFe ⋅SFe' )+JFe'-corrole (SFe' ⋅Scorrole' ), which yielded JFe-corrole =JFe'-corrole' =0.355 eV (2860 cm(-1) ) and JFe-Fe' =0.068 eV (548 cm(-1) ). The unexpected stability of μ-oxo-diiron corroles thus appears to be attributable to charge delocalization via ligand noninnocence. PMID:27333259

  2. Transition Metals Catalyzed Element-Cyano Bonds Activations

    PubMed Central

    Wang, Rui; Falck, John R.

    2014-01-01

    Cyano group as a versatile functionalized intermediate has been explored for several decades, as it readily transfers to many useful functionalization groups such as amine, amide, acid, etc., which make it possess high popularization and use value in organic synthesis. Reactions involved with element-cyano bond cleavage can provide not only a new cyano group but also a freshly functionalized skeleton in one-pot, consequently making it of high importance. The highlights reviewed herein include H-CN, Si-CN, C-CN, B-CN, Sn-CN, Ge-CN, S-CN, Halo-CN, N-CN, and O-CN bonds cleavages and will summarize progress in such an important research area. This review article will focus on transition metal catalyzed reactions involving element-cyano bond activation. PMID:25558119

  3. Phase-Transfer Activation of Transition Metal Catalysts.

    PubMed

    Tuba, Robert; Xi, Zhenxing; Bazzi, Hassan S; Gladysz, John A

    2015-11-01

    With metal-based catalysts, it is quite common that a ligand (L) must first dissociate from a catalyst precursor (L'n M-L) to activate the catalyst. The resulting coordinatively unsaturated active species (L'n M) can either back react with the ligand in a k-1 step, or combine with the substrate in a k2 step. When dissociation is not rate determining and k-1 [L] is greater than or comparable to k2 [substrate], this slows the rate of reaction. By introducing a phase label onto the ligand L and providing a suitable orthogonal liquid or solid phase, dramatic rate accelerations can be achieved. This phenomenon is termed "phase-transfer activation". In this Concept, some historical antecedents are reviewed, followed by successful applications involving fluorous/organic and aqueous/organic liquid/liquid biphasic catalysis, and liquid/solid biphasic catalysis. Variants that include a chemical trap for the phase-labeled ligands are also described. PMID:26338471

  4. The activity of calcium in calcium-metal-fluoride fluxes

    NASA Astrophysics Data System (ADS)

    Ochifuji, Yuichiro; Tsukihashi, Fumitaka; Sano, Nobuo

    1995-08-01

    The standard Gibbs energy of reaction Ca (1) + O (mass pct, in Zr) = CaO (s) has been determined as follows by equilibrating molten calcium with solid zirconium in a CaO crucible: Δ G° = -64,300(±700) + 19.8(±3.5) T J/mol (1373 to 1623 K) The activities of calcium in the CaOsatd-Ca- MF2 ( M: Ca, Ba, Mg) and CaOsatd-Ca-NaF systems were measured as a function of calcium composition at high calcium contents at 1473 K on the basis of the standard Gibbs energy. The activities of calcium increase in the order of CaF2, BaF2, and MgF2 at the same calcium fraction of these fluxes. The observed activities are compared with those estimated by using the Temkin model for ionic solutions. Furthermore, the possibility of the removal of tramp elements such as tin, arsenic, antimony, bismuth, and lead from carbon-saturated iron by using calcium-metal-fluoride fluxes is discussed.

  5. The activity of calcium in calcium-metal-fluoride fluxes

    SciTech Connect

    Ochifuji, Yuichiro; Tsukihashi, Fumitaka; Sano, Nobuo

    1995-08-01

    The standard Gibbs energy of reaction Ca (1) + {und O} (mass pct, in Zr) = CaO (s) has been determined as follows by equilibrating molten calcium with solid zirconium in a CaO crucible: {Delta}G{degree} = {minus}64,300({+-}700) + 19.8({+-}3.5)T J/mol (1,373 to 1,623 K). The activities of calcium in the CaO{sub satd.}-Ca-MF{sub 2} (M: Ca, Ba, Mg) and CaO{sub satd.}-Ca-NaF systems were measured as a function of calcium composition at high calcium contents at 1,473 K on the basis of the standard Gibbs energy. The activities of calcium increase in the order of CaF{sub 2}, BaF{sub 2}, and MgF{sub 2} at the same calcium fraction of these fluxes. The observed activities are compared with those estimated by using the Temkin model for ionic solutions. Furthermore, the possibility of the removal of tramp elements such as tin, arsenic, antimony, bismuth, and lead from carbon-saturated iron by using calcium-metal-fluoride fluxes is discussed.

  6. Synthesis, characterization, DNA interactions, DNA cleavage, radical scavenging activity, antibacterial, anti-proliferative and docking studies of new transition metal complexes.

    PubMed

    Chennam, Kishan Prasad; Ravi, Mudavath; Ushaiah, B; Srinu, V; Eslavath, Ravi Kumar; Devi, Ch Sarala

    2016-01-01

    The compound N-(2-hydroxybenzylidene)-1-ethyl-1, 4-dihydro-7-methyl-4-oxo-1, 8 naphthyridine-3-carbohydrazide (LH) and its Cu (II), Co (II) and Zn (II) complexes were synthesized and characterized. The absorption spectral titrations and competitive DNA binding studies depicted those complexes of title compound bind to CT-DNA through intercalation. Interestingly [Cu (II)-(L2)] showed relatively high binding constant value (6.61 x 10(5) M(-1)) compared to [Co (II)-(L2)] (4.378× 10(5) M(-1)) and [Zn (II)-(L2)] (3.1x10(5) M(-1)). Ligand and its complexes were also examined for DNA nuclease activity against pBR-322 plasmid DNA, which showed that [Cu (II)-(L2)] had the best hydrolytic cleavage property displaying prominent double-strand DNA cleavage. In addition, antioxidant activities of the ligand and its metal complexes investigated through scavenging effects for DPPH radical in- vitro, indicated their potentiality as good antioxidants. The in vitro anti-bacterial study inferred the better anti-bacterial activity of [Cu (II)-(L2)] and this was also correlated theoretically by employing docking studies wherein [Cu (II)-(L2)] displayed good Gold score and Chem score. Finally the in vitro anti- proliferative activity of studied compounds was tested against HeLa and MCF-7 cell lines. Interestingly [Cu (II)-(L2)] displayed lower IC50 value and lower percentage of viability in both HeLa and MCF-7 cell lines. PMID:26545354

  7. Synthesis of cobalt stearate as oxidant additive for oxo-biodegradable polyethylene

    SciTech Connect

    Asriza, Ristika O.; Arcana, I Made

    2015-09-30

    Cobalt stearate is an oxidant additives that can initiate a process of degradation in high density polyethylene (HDPE). To determine the effect of cobalt stearate in HDPE, oxo-biodegradable polyethylene film was given an irradiation with UV light or heating at various temperature. After given a heating, the FTIR spectra showed a new absorption peak at wave number 1712 cm{sup −1} indicating the presence of carbonyl groups in polymers, whereas after irradiation with UV light is not visible the presence of this absorption peak. The increase concentration of cobalt stearate added in HDPE and the higher heating temperature, the intensity of the absorption peak of the carbonyl group increased. The increasing intensity of the carbonyl group absorption is caused the presence of damage in the film surface after heating, and this result is supported by analysis the surface properties of the film with using SEM. Biodegradation tests were performed on oxo-biodegradable polyethylene film which has been given heating or UV light with using activated sludge under optimal conditions the growth of microorganisms. After biodegradation, the maximum weight decreased by 23% in the oxo-biodegradable polyethylene film with a cobalt stearate concentration of 0.2% and after heating at a temperature of 75 °C for 10 days, and only 0.69% in the same film after irradiation UV light for 10 days. Based on the results above, cobalt stearate additive is more effective to initiate the oxidative degradation of HDPE when it is initiated by heating compared to irradiation with UV light.

  8. Synthesis of cobalt stearate as oxidant additive for oxo-biodegradable polyethylene

    NASA Astrophysics Data System (ADS)

    Asriza, Ristika O.; Arcana, I. Made

    2015-09-01

    Cobalt stearate is an oxidant additives that can initiate a process of degradation in high density polyethylene (HDPE). To determine the effect of cobalt stearate in HDPE, oxo-biodegradable polyethylene film was given an irradiation with UV light or heating at various temperature. After given a heating, the FTIR spectra showed a new absorption peak at wave number 1712 cm-1 indicating the presence of carbonyl groups in polymers, whereas after irradiation with UV light is not visible the presence of this absorption peak. The increase concentration of cobalt stearate added in HDPE and the higher heating temperature, the intensity of the absorption peak of the carbonyl group increased. The increasing intensity of the carbonyl group absorption is caused the presence of damage in the film surface after heating, and this result is supported by analysis the surface properties of the film with using SEM. Biodegradation tests were performed on oxo-biodegradable polyethylene film which has been given heating or UV light with using activated sludge under optimal conditions the growth of microorganisms. After biodegradation, the maximum weight decreased by 23% in the oxo-biodegradable polyethylene film with a cobalt stearate concentration of 0.2% and after heating at a temperature of 75 °C for 10 days, and only 0.69% in the same film after irradiation UV light for 10 days. Based on the results above, cobalt stearate additive is more effective to initiate the oxidative degradation of HDPE when it is initiated by heating compared to irradiation with UV light.

  9. Mechanism of phenol oxidation by heterodinuclear Ni Cu bis(μ-oxo) complexes involving nucleophilic oxo groups

    PubMed Central

    Kundu, Subrata; Miceli, Enrico; Farquhar, Erik R.

    2014-01-01

    Oxidation of phenols by heterodinuclear CuIII(μ-O)2NiIII complexes containing nucleophilic oxo groups occurs by both proton coupled electron transfer (PCET) and hydrogen atom transfer (HAT) mechanisms; the exact mechanism depends on the nature of the phenol as well as the substitution pattern of the ligand bound to Cu. PMID:24362244

  10. Theoretical study of carbon dioxide activation by metals (Co, Cu, Ni) supported on activated carbon.

    PubMed

    Ha, Nguyen Ngoc; Ha, Nguyen Thi Thu; Van Khu, Le; Cam, Le Minh

    2015-12-01

    The activation of carbon dioxide (CO2) by catalytic systems comprising a transition metal (Co, Cu,Ni) on an activated carbon (AC) support was investigated using a combination of different theoretical calculation methods: Monte Carlo simulation, DFT and DFT-D, molecular dynamics (MD), and a climbing image nudged elastic band (CI-NEB) method. The results obtained indicate that CO2 is easily adsorbed by AC or MAC (M: Cu, Co, Ni). The results also showed that the process of adsorbing CO2 does not involve a transition state, and that NiAC and CoAC are the most effective of the MAC catalysts at adsorbing CO2. Adsorption on NiAC led to the strongest activation of the C-O bond, while adsorption on CuAC led to the weakest activation. Graphical Abstract Models of CO2 activation on: a)- activated carbon; b)- metal supported activated carbon (M-AC), where M: Co, Cu, Ni. PMID:26637187

  11. Activity and diffusion of metals in binary aluminum alloys

    SciTech Connect

    Jao, C. S.

    1980-12-01

    To determine the activity of zinc in Zn-Al alloys, the electromotive force (emf) of the cell: Zn/ZnCl/sub 2/-KC1 (eut)/Zn,Al was measured at temperatures between 569.5 K (296.5C) and 649.5 K (376.5C). The applicability of a two-suffix Margules equation was demonstrated, in good agreement with theoretical expectations. The diffusion coefficient of Zn in Al determined from a planar diffusion model for the experimental data was about 3 x 10/sup -10/ cm/sup 2//sec to 2 x 10/sup -9/ cm/sup 2//sec in the range of temperature studied. This is higher than that found in the literature. The most plausible reason appears to be the high alumina concentration in the working electrode because of partial oxidation. Oxidation of the alloying metals was the primary cause of poor alloying between calcium/or zinc and aluminum, thereby frustrating similar measurements at a Ca-Al/or Zn-Al alloy. The literature on the activity of calcium and zinc is aluminum is reviewed.

  12. Strong metal-support interaction between mononuclear and polynuclear transition metal complexes and oxide supports which dramatically affects catalytic activity

    SciTech Connect

    Hucul, D.A.; Brenner, A.

    1981-03-05

    The interaction of carbonyl complexes with catalyst supports, primarily ..gamma..-alumina, has been studied by temperature-programmed decomposition. In all cases, including cluster complexes and complexes of noble metals, after heating to 600/sup 0/C in flowing He the catalysts are significantly oxidized due to a redox reaction between surface hydroxyl groups and the initially zero-valent metal. Contrary reports are probably incorrect and likely reflect the insensitivity of the experimental techniques used. For all but the most thermally unstable complexes, the oxidation occurs during the latter stages of decarbonylation indicating that there is no significant accumulation of bare zero-valent metal. Hence, decomposition does not in general provide a direct route to supported metals and, contrary to some claims, molecular cluster complexes cannot necessarily be used as precursors to supported metal clusters. Further, knowledge of this redox reaction is critical for understanding patterns of activity and for the development of improved catalysts.

  13. 76 FR 52686 - Agency Information Collection Activities: Comment Request for the Nonferrous Metals Surveys (30...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-23

    ... Geological Survey Agency Information Collection Activities: Comment Request for the Nonferrous Metals Surveys.... II. Data OMB Control Number: 1028-0053. Form Number: Various (30 forms). Title: Nonferrous Metals....S. nonfuel minerals producers of nonferrous and related metals. Respondent Obligation:...

  14. Active vision and sensor fusion for inspection of metallic surfaces

    NASA Astrophysics Data System (ADS)

    Puente Leon, Fernando; Beyerer, Juergen

    1997-09-01

    This paper deals with strategies for reliably obtaining the edges and the surface texture of metallic objects. Since illumination is a critical aspect regarding robustness and image quality, it is considered here as an active component of the image acquisition system. The performance of the methods presented is demonstrated -- among other examples -- with images of needles for blood sugar tests. Such objects show an optimized form consisting of several planar grinded surfaces delimited by sharp edges. To allow a reliable assessment of the quality of each surface, and a measurement of their edges, methods for fusing data obtained with different illumination constellations were developed. The fusion strategy is based on the minimization of suitable energy functions. First, an illumination-based segmentation of the object is performed. To obtain the boundaries of each surface, directional light-field illumination is used. By formulating suitable criteria, nearly binary images are selected by variation of the illumination direction. Hereafter, the surface edges are obtained by fusing the contours of the areas obtained before. Following, an optimally illuminated image is acquired for each surface of the object by varying the illumination direction. For this purpose, a criterion describing the quality of the surface texture has to be maximized. Finally, the images of all textured surfaces of the object are fused to an improved result, in which the whole object is contained with high contrast. Although the methods presented were designed for inspection of needles, they also perform robustly in other computer vision tasks where metallic objects have to be inspected.

  15. Metal-dithiocarbamate complexes: chemistry and biological activity.

    PubMed

    Hogarth, Graeme

    2012-10-01

    Dithiocarbamates are highly versatile mono-anionic chelating ligands which form stable complexes with all the transition elements and also the majority of main group, lanthanide and actinide elements. They are easily prepared from primary or secondary amines and depending upon the nature of the cation can show good solubility in water or organic solvents. They are related to the thiuram disulfides by a one-electron redox process (followed by dimerisation via sulfur-sulfur bond formation) which is easily carried out upon addition of iodide or ferric salts. Dithiocarbamates are lipophilic and generally bind to metals in a symmetrical chelate fashion but examples of other coordination modes are known, the monodentate and anisobidentate modes being most prevalent. They are planar sterically non-demanding ligands which can be electronically tuned by judicious choice of substituents. They stabilize metals in a wide range of oxidation states, this being attributed to the existence of soft dithiocarbamate and hard thioureide resonance forms, the latter formally resulting from delocalization of the nitrogen lone pair onto the sulfurs, and consequently their complexes tend to have a rich electrochemistry. Tetraethyl thiuramdisulfide (disulfiram or antabuse) has been used as a drug since the 1950s but it is only recently that dithiocarbamate complexes have been explored within the medicinal domain. Over the past two decades anti-cancer activity has been noted for gold and copper complexes, technetium and copper complexes have been used in PET-imaging, dithiocarbamates have been used to treat acute cadmium poisoning and copper complexes also have been investigated as SOD inhibitors. PMID:22931592

  16. Structural basis for halogenation by iron- and 2-oxo-glutarate-dependent enzyme WelO5.

    PubMed

    Mitchell, Andrew J; Zhu, Qin; Maggiolo, Ailiena O; Ananth, Nikhil R; Hillwig, Matthew L; Liu, Xinyu; Boal, Amie K

    2016-08-01

    A 2.4-Å-resolution X-ray crystal structure of the carrier-protein-independent halogenase WelO5 in complex with its welwitindolinone precursor substrate, 12-epi-fischerindole U, reveals that the C13 chlorination target is proximal to the anticipated site of the oxo group in a presumptive cis-halo-oxo-iron(IV) (haloferryl) intermediate. Prior study of related halogenases forecasts substrate hydroxylation in this active-site configuration, but X-ray crystallographic verification of C13 halogenation in single crystals mandates that ligand dynamics must reposition the oxygen ligand to enable the observed outcome. S189A WelO5 produces a mixture of halogenation and hydroxylation products, showing that an outer-sphere hydrogen-bonding group orchestrates ligand movements to achieve a configuration that promotes halogen transfer. PMID:27348090

  17. Identification of a novel selective peroxisome proliferator-activated receptor alpha agonist, 2-methyl-2-(4-{3-[1-(4-methylbenzyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-3-yl]propyl}phenoxy)propanoic acid (LY518674), that produces marked changes in serum lipids and apolipoprotein A-1 expression.

    PubMed

    Singh, Jai Pal; Kauffman, Raymond; Bensch, William; Wang, Guoming; McClelland, Pam; Bean, James; Montrose, Chahrzad; Mantlo, Nathan; Wagle, Asavari

    2005-09-01

    Low high-density lipoprotein-cholesterol (HDL-c) is an important risk factor of coronary artery disease (CAD). Optimum therapy for raising HDL-c is still not available. Identification of novel HDL-raising agents would produce a major impact on CAD. In this study, we have identified a potent (IC50 approximately 24 nM) and selective peroxisome proliferator-activated receptor alpha (PPARalpha) agonist, 2-methyl-2-(4-{3-[1-(4-methylbenzyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-3-yl]propyl}phenoxy)propanoic acid (LY518674). In human apolipoprotein A-1 (apoA-1) transgenic mice, LY518674 produced a dose-dependent increase in serum HDL-c, resulting in 208 +/- 15% elevation at optimum dose. A new synthesis of apoA-1 contributed to the increase in HDL-c. LY518674 increased apoA-1 mRNA levels in liver. Moreover, liver slices from animals treated with LY518674 secreted 3- to 6-fold more apoA-1 than control liver slices. In cultured hepatocytes, LY518674 produced 50% higher apoA-1 secretion, which was associated with increase in radiolabeled methionine incorporation in apoA-1. Thus, LY518674 is a potent and selective PPARalpha agonist that produced a much greater increase in serum HDL-c than the known fibrate drugs. The increase in HDL-c was associated with de novo synthesis of apoA-1. PMID:15933217

  18. Assessment of Trace Metals in Soil, Vegetation and Rodents in Relation to Metal Mining Activities in an Arid Environment.

    PubMed

    Méndez-Rodríguez, Lia C; Alvarez-Castañeda, Sergio Ticul

    2016-07-01

    Areas where abandoned metal-extraction mines are located contain large quantities of mineral wastes derived from environmentally unsafe mining practices. These wastes contain many pollutants, such as heavy metals, which could be released to the environment through weathering and leaching, hence becoming an important source of environmental metal pollution. This study evaluates differences in the levels of lead, iron, nickel, manganese, copper and cadmium in rodents sharing the same type of diet under different microhabitat use in arid areas with past mining activities. Samples of soil, roots, branches and seeds of Palo Adán (Fouquieria diguetii) and specimens of two rodent species (Chaetodipus arenarius and C. spinatus) were collected in areas with impact from past metal mining activities as well as from areas with no mining impact. Both rodent species mirrored nickel and iron levels in soil and seeds, as well as lead levels in soil; however, C. arenarius accumulated higher levels of manganese, copper and cadmium. PMID:27207229

  19. Asymmetric photoredox transition-metal catalysis activated by visible light

    NASA Astrophysics Data System (ADS)

    Huo, Haohua; Shen, Xiaodong; Wang, Chuanyong; Zhang, Lilu; Röse, Philipp; Chen, Liang-An; Harms, Klaus; Marsch, Michael; Hilt, Gerhard; Meggers, Eric

    2014-11-01

    Asymmetric catalysis is seen as one of the most economical strategies to satisfy the growing demand for enantiomerically pure small molecules in the fine chemical and pharmaceutical industries. And visible light has been recognized as an environmentally friendly and sustainable form of energy for triggering chemical transformations and catalytic chemical processes. For these reasons, visible-light-driven catalytic asymmetric chemistry is a subject of enormous current interest. Photoredox catalysis provides the opportunity to generate highly reactive radical ion intermediates with often unusual or unconventional reactivities under surprisingly mild reaction conditions. In such systems, photoactivated sensitizers initiate a single electron transfer from (or to) a closed-shell organic molecule to produce radical cations or radical anions whose reactivities are then exploited for interesting or unusual chemical transformations. However, the high reactivity of photoexcited substrates, intermediate radical ions or radicals, and the low activation barriers for follow-up reactions provide significant hurdles for the development of efficient catalytic photochemical processes that work under stereochemical control and provide chiral molecules in an asymmetric fashion. Here we report a highly efficient asymmetric catalyst that uses visible light for the necessary molecular activation, thereby combining asymmetric catalysis and photocatalysis. We show that a chiral iridium complex can serve as a sensitizer for photoredox catalysis and at the same time provide very effective asymmetric induction for the enantioselective alkylation of 2-acyl imidazoles. This new asymmetric photoredox catalyst, in which the metal centre simultaneously serves as the exclusive source of chirality, the catalytically active Lewis acid centre, and the photoredox centre, offers new opportunities for the `green' synthesis of non-racemic chiral molecules.

  20. Lewis Acid Coupled Electron Transfer of Metal-Oxygen Intermediates.

    PubMed

    Fukuzumi, Shunichi; Ohkubo, Kei; Lee, Yong-Min; Nam, Wonwoo

    2015-12-01

    Redox-inactive metal ions and Brønsted acids that function as Lewis acids play pivotal roles in modulating the redox reactivity of metal-oxygen intermediates, such as metal-oxo and metal-peroxo complexes. The mechanisms of the oxidative CH bond cleavage of toluene derivatives, sulfoxidation of thioanisole derivatives, and epoxidation of styrene derivatives by mononuclear nonheme iron(IV)-oxo complexes in the presence of triflic acid (HOTf) and Sc(OTf)3 have been unified as rate-determining electron transfer coupled with binding of Lewis acids (HOTf and Sc(OTf)3 ) by iron(III)-oxo complexes. All logarithms of the observed second-order rate constants of Lewis acid-promoted oxidative CH bond cleavage, sulfoxidation, and epoxidation reactions of iron(IV)-oxo complexes exhibit remarkably unified correlations with the driving forces of proton-coupled electron transfer (PCET) and metal ion-coupled electron transfer (MCET) in light of the Marcus theory of electron transfer when the differences in the formation constants of precursor complexes were taken into account. The binding of HOTf and Sc(OTf)3 to the metal-oxo moiety has been confirmed for Mn(IV) -oxo complexes. The enhancement of the electron-transfer reactivity of metal-oxo complexes by binding of Lewis acids increases with increasing the Lewis acidity of redox-inactive metal ions. Metal ions can also bind to mononuclear nonheme iron(III)-peroxo complexes, resulting in acceleration of the electron-transfer reduction but deceleration of the electron-transfer oxidation. Such a control on the reactivity of metal-oxygen intermediates by binding of Lewis acids provides valuable insight into the role of Ca(2+) in the oxidation of water to dioxygen by the oxygen-evolving complex in photosystem II. PMID:26404482

  1. Antimicrobial Activity of Metal & Metal Oxide Nanoparticles Interfaced With Ligand Complexes Of 8-Hydroxyquinoline And α-Amino Acids

    NASA Astrophysics Data System (ADS)

    Bhanjana, Gaurav; Kumar, Neeraj; Thakur, Rajesh; Dilbaghi, Neeraj; Kumar, Sandeep

    2011-12-01

    Antimicrobial nanotechnology is a recent addition to the fight against disease causing organisms, replacing heavy metals and toxins. In the present work, mixed ligand complexes of metals like zinc, silver etc. and metal oxide have been synthesized using 8-hydroxyquinoline (HQ) as a primary ligand and N-and/O-donor amino acids such as L-serine, L-alanine, glycine, cysteine and histidine as secondary ligands. These complexes were characterized using different spectroscopic techniques. The complexes were tested for antifungal and antibacterial activity by using agar well diffusion bioassay.

  2. Enhanced Antimicrobial Activity Of Antibiotics Mixed With Metal Nanoparticles

    NASA Astrophysics Data System (ADS)

    Kumar, Sandeep; Kumar, Neeraj; Bhanjana, Gaurav; Thakur, Rajesh; Dilbaghi, Neeraj

    2011-12-01

    Current producers of antimicrobial technology have a long lasting, environmentally safe, non-leaching, water soluble solution that will eventually replace all poisons and heavy metals. The transition metal ions inevitably exist as metal complexes in biological systems by interaction with the numerous molecules possessing groupings capable of complexation or chelation. Nanoparticles of metal oxides offer a wide variety of potential applications in medicine due to the unprecedented advances in nanobiotechnology research. the bacterial action of antibiotics like penicillin, erythryomycin, ampicillin, streptomycin, kanamycin etc. and that of a mixture of antibiotics and metal and metal oxide nanoparticles like zinc oxide, zirconium, silver and gold on microbes was examined by the agar-well-diffusion method, enumeration of colony-forming units (CFU) and turbidimetry.

  3. On the origin of high activity of hcp metals for ammonia synthesis.

    PubMed

    Ahmadi, Shideh; Kaghazchi, Payam

    2016-02-10

    Structure and activity of nanoparticles of hexagonal close-packed (hcp) metals are studied using first-principles calculations. Results show that, in contact with a nitrogen environment, high-index {134[combining macron]2} facets are formed on hcp metal nanoparticles. Nitrogen molecules dissociate easily at kink sites on these high-index facets (activation barriers of <0.2 eV). Analysis of the site blocking effect and adsorption energies on {134[combining macron]2} facets explains the order of activity of hcp metals for ammonia synthesis: Re < Os < Ru. Our results indicate that the high activity of hcp metals for ammonia synthesis is due to the N-induced formation of {134[combining macron]2} facets with high activity for the dissociation of nitrogen molecules. However, quite different behavior for adsorption of dissociated N atoms leads to distinctive activity of hcp metals. PMID:26818719

  4. Characterization of AN Actively Cooled Metal Foil Thermal Radiation Shield

    NASA Astrophysics Data System (ADS)

    Feller, J. R.; Kashani, A.; Helvensteijn, B. P. M.; Salerno, L. J.

    2010-04-01

    Zero boil-off (ZBO) or reduced boil-off (RBO) systems that involve active cooling of large cryogenic propellant tanks will most likely be required for future space exploration missions. For liquid oxygen or methane, such systems could be implemented using existing high technology readiness level (TRL) cryocoolers. However, for liquid hydrogen temperatures (˜20 K) no such coolers exist. In order to partially circumvent this technology gap, the concept of broad area cooling (BAC) has been developed, whereby a low mass thermal radiation shield could be maintained at temperatures around 100 K by steady circulation of cold pressurized gas through a network of narrow tubes. By this method it is possible to dramatically reduce the radiative heat leak to the 20 K tank. A series of experiments, designed to investigate the heat transfer capabilities of BAC systems, have been conducted at NASA Ames Research Center (ARC). Results of the final experiment in this series, investigating heat transfer from a metal foil film to a distributed cooling line, are presented here.

  5. CHARACTERIZATION OF AN ACTIVELY COOLED METAL FOIL THERMAL RADIATION SHIELD

    SciTech Connect

    Feller, J. R.; Salerno, L. J.; Kashani, A.; Helvensteijn, B. P. M.

    2010-04-09

    Zero boil-off (ZBO) or reduced boil-off (RBO) systems that involve active cooling of large cryogenic propellant tanks will most likely be required for future space exploration missions. For liquid oxygen or methane, such systems could be implemented using existing high technology readiness level (TRL) cryocoolers. However, for liquid hydrogen temperatures (approx20 K) no such coolers exist. In order to partially circumvent this technology gap, the concept of broad area cooling (BAC) has been developed, whereby a low mass thermal radiation shield could be maintained at temperatures around 100 K by steady circulation of cold pressurized gas through a network of narrow tubes. By this method it is possible to dramatically reduce the radiative heat leak to the 20 K tank. A series of experiments, designed to investigate the heat transfer capabilities of BAC systems, have been conducted at NASA Ames Research Center (ARC). Results of the final experiment in this series, investigating heat transfer from a metal foil film to a distributed cooling line, are presented here.

  6. Regulation of an in vivo metal-exchangeable superoxide dismutase from Propionibacterium shermanii exhibiting activity with different metal cofactors.

    PubMed Central

    Sehn, A P; Meier, B

    1994-01-01

    The anaerobic, but aerotolerant Propionibacterium freudenreichii sp. shermanii contains a single superoxide dismutase [EC 1.15.1.1.] exhibiting comparable activity with iron or manganese as metal cofactor. The formation of superoxide dismutase is not depending on the supplementation of iron or manganese to the culture medium. Even in the absence of these metals the protein is built in comparable amounts. Bacteria grown in the absence of iron and manganese synthesize a superoxide dismutase with very low activity which had incorporated copper. If the medium was also depleted of copper, cobalt was incorporated, leading to an enzymically inactive form. In the absence of cobalt an enzymically inactive superoxide dismutase was built with unknown metal contents. Upon aeration the amount of superoxide dismutase activity increased continuously up to 9 h, due to a de novo synthesis of the protein. This superoxide dismutase had incorporated iron into the active centre. The superoxide dismutase of Propionibacterium shermanii is able to form a much wider variety of complexes with trace metal ions in vivo than previously recognized, leading to the hypothesis that the original function of these proteins was the binding of cytoplasmic trace metals present in excess. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:7818484

  7. LLNL metal finishing and pollution prevention activities with small businesses

    SciTech Connect

    Dini, J.W.; Steffani, C.P.

    1996-07-01

    The Metal Finishing Facility at LLNL has emphasized using environmentally conscious manufacturing principles. Key focus items included minimizing hazardous wastes, minimization of water usage, material and process substitutions, and recycling. Joint efforts with NCAMF (Northern California Association of Metal Finishers), Technic, Inc., EPA, and UC Davis, all directed at pollution prevention, are reviewed.

  8. Investigation of metal binding and activation of Escherichia coli glyoxalase I: kinetic, thermodynamic and mutagenesis studies.

    PubMed Central

    Clugston, Susan L; Yajima, Rieko; Honek, John F

    2004-01-01

    GlxI (glyoxalase I) isomerizes the hemithioacetal formed between glutathione and methylglyoxal. Unlike other GlxI enzymes, Escherichia coli GlxI exhibits no activity with Zn(2+) but maximal activation with Ni(2+). To elucidate further the metal site in E. coli GlxI, several approaches were undertaken. Kinetic studies indicate that the catalytic metal ion affects the k (cat) without significantly affecting the K (m) for the substrate. Inductively coupled plasma analysis and isothermal titration calorimetry confirmed one metal ion bound to the enzyme, including Zn(2+), which produces an inactive enzyme. Isothermal titration calorimetry was utilized to determine the relative binding affinity of GlxI for various bivalent metals. Each metal ion examined bound very tightly to GlxI with an association constant ( K (a))>10(7) M(-1), with the exception of Mn(2+) ( K (a) of the order of 10(6) M(-1)). One of the ligands to the catalytic metal, His(5), was altered to glutamine, a side chain found in the Zn(2+)-active Homo sapiens GlxI. The affinity of the mutant protein for all bivalent metals was drastically decreased. However, low levels of activity were now observed for Zn(2+)-bound GlxI. Although this residue has a marked effect on metal binding and activation, it is not the sole factor determining the differential metal activation between the human and E. coli GlxI enzymes. PMID:14556652

  9. A switch between DNA polymerases δ and λ promotes error-free bypass of 8-oxo-G lesions.

    PubMed

    Markkanen, Enni; Castrec, Benoît; Villani, Giuseppe; Hübscher, Ulrich

    2012-12-11

    7,8-Dihydro-8-oxoguanine (8-oxo-G) is a highly abundant and mutagenic lesion. Replicative DNA polymerases (pols) are slowed down at 8-oxo-G and insert both correct cytosine (C) and incorrect adenine (A) opposite 8-oxo-G, but they preferentially extend A:8-oxo-G mispairs. Nevertheless, 8-oxo-G bypass is fairly accurate in vivo. Thus, the question how correct bypass of 8-oxo-G lesions is accomplished despite the poor extension of C:8-oxo-G base pairs by replicative pols remains unanswered. Here we show that replicative pol δ pauses in front of 8-oxo-G and displays difficulties extending from correct C:8-oxo-G in contrast to extension from incorrect A:8-oxo-G. This leads to stalling of pol δ at 8-oxo-G after incorporation of correct C. This stalling at C:8-oxo-G can be overcome by a switch from pol δ to pols λ, β, or η, all of which are able to assist pol δ in 8-oxo-G bypass by translesion synthesis (TLS). Importantly, however, only pol λ selectively catalyzes the correct TLS past 8-oxo-G, whereas pols β and η show no selectivity and even preferentially enhance incorrect TLS. The selectivity of pol λ to promote the correct bypass depends on its N-terminal domain. Furthermore, pol λ(-/-) mouse embryonic fibroblast extracts display reduced 8-oxo-G TLS. Finally, the correct bypass of 8-oxo-G in gapped plasmids in mouse embryonic fibroblasts and HeLa cells is promoted in the presence of pol λ. Our findings suggest that even though 8-oxo-G is not a blocking lesion per se, correct replication over 8-oxo-G is promoted by a pol switch between pols δ and λ. PMID:23175785

  10. OGG1 mRNA expression and incision activity in rats are higher in foetal tissue than in adult liver tissue while 8-oxo-2'-deoxyguanosine levels are unchanged.

    PubMed

    Riis, Bente; Risom, Lotte; Loft, Steffen; Poulsen, Henrik Enghusen

    2002-09-01

    This study was set up to investigate the relationships between the formation and removal of DNA damage in form of 8-oxodeoxyguanosine (8-oxodG) in neonatal (day 16 of gestation) as compared to adult rats. The hypothesis addressed was whether the rapidly dividing foetal tissue has an enhanced requirement of DNA repair providing protection against potentially mutagenic DNA damages such as 8-oxodG. The activity of the primary 8-oxodG-repair protein OGG1 was measured by a DNA incision assay and the expression of OGG1 mRNA was measured by Real-Time PCR normalised to 18S rRNA. The tissue level of 8-oxodG was measured by HPLC-ECD. We found a 2-3-fold increased incision activity in the foetal control tissue, together with a 3-15-fold increase in mRNA of OGG1 as compared to liver tissue from adult rats. The levels of 8-oxodG in the foetal tissue were unaltered as compared to the adult groups. To increase the levels of 8-oxodG, the rats received an injection (i.p.) of the hepatotoxin 2-nitropropane. The compound induced significant levels of 8-oxodG in male rat livers 5h after the injection and in the foetuses 24h after the injection, while the female rats showed no increase in 8-oxodG. The incision activity was slightly depressed in both male and female liver tissue and in the foetal tissue 5h after the injection, but significantly increased from 5 to 24h after the injection. However, it did not reach levels significantly above the control levels. In conclusion, this study confirms that foetal tissue has increased levels of OGG1 mRNA and correspondingly an enhanced incision activity on an 8-oxodG substrate in a crude tissue extract. PMID:12509275

  11. Coordination sphere of the third metal site is essential to the activity and metal selectivity of alkaline phosphatases.

    PubMed

    Koutsioulis, Dimitris; Lyskowski, Andrzej; Mäki, Seija; Guthrie, Ellen; Feller, Georges; Bouriotis, Vassilis; Heikinheimo, Pirkko

    2010-01-01

    Alkaline phosphatases (APs) are commercially applied enzymes that catalyze the hydrolysis of phosphate monoesters by a reaction involving three active site metal ions. We have previously identified H135 as the key residue for controlling activity of the psychrophilic TAB5 AP (TAP). In this article, we describe three X-ray crystallographic structures on TAP variants H135E and H135D in complex with a variety of metal ions. The structural analysis is supported by thermodynamic and kinetic data. The AP catalysis essentially requires octahedral coordination in the M3 site, but stability is adjusted with the conformational freedom of the metal ion. Comparison with the mesophilic Escherichia coli, AP shows differences in the charge transfer network in providing the chemically optimal metal combination for catalysis. Our results provide explanation why the TAB5 and E. coli APs respond in an opposite way to mutagenesis in their active sites. They provide a lesson on chemical fine tuning and the importance of the second coordination sphere in defining metal specificity in enzymes. Understanding the framework of AP catalysis is essential in the efforts to design even more powerful tools for modern biotechnology. PMID:19916164

  12. LEACHING OF METALS FROM MINERAL PROCESSING WASTE

    EPA Science Inventory

    The purpose of this project is to test the leaching of Mineral Processing Waste (MPW) contaminated with heavy metals using scientifically defendable leaching tests other than TCLP. Past experience and literature have shown that TCLP underestimates the levels of metals such as oxo...

  13. Synthesis, Polymorphism, and Insecticidal Activity of Methyl 4-(4-chlorophenyl)-8-iodo-2-methyl-6-oxo-1,6-dihydro-4H-pyrimido[2,1-b]quinazoline-3-Carboxylate Against Anopheles arabiensis Mosquito.

    PubMed

    Venugopala, Katharigatta N; Nayak, Susanta K; Gleiser, Raquel M; Sanchez-Borzone, Mariela E; Garcia, Daniel A; Odhav, Bharti

    2016-07-01

    Mosquitoes are the major vectors of pathogens and parasites including those causing malaria, the most deadly vector-borne disease. The negative environmental effects of most synthetic compounds combined with widespread development of insecticide resistance encourage an interest in finding and developing alternative products against mosquitoes. In this study, pyrimido[2,1-b]quinazoline derivative DHPM3 has been synthesized by three-step chemical reaction and screened for larvicide, adulticide, and repellent properties against Anopheles arabiensis, one of the dominant vectors of malaria in Africa. The title compound emerged as potential larvicide agent for further research and development, because it exerted 100% mortality, while adulticide activity was considered moderate. PMID:26841246

  14. Metal Catalyzed Fusion: Nuclear Active Environment vs. Process

    NASA Astrophysics Data System (ADS)

    Chubb, Talbot

    2009-03-01

    To achieve radiationless dd fusion and/or other LENR reactions via chemistry: some focus on environment of interior or altered near-surface volume of bulk metal; some on environment inside metal nanocrystals or on their surface; some on the interface between nanometal crystals and ionic crystals; some on a momentum shock-stimulation reaction process. Experiment says there is also a spontaneous reaction process.

  15. Ternary metal complexes of guaifenesin drug: Synthesis, spectroscopic characterization and in vitro anticancer activity of the metal complexes.

    PubMed

    Mahmoud, W H; Mahmoud, N F; Mohamed, G G; El-Sonbati, A Z; El-Bindary, A A

    2015-01-01

    The coordination behavior of a series of transition metal ions named Cr(III), Fe(III), Mn(II), Co(II), Ni(II), Cu(II), Zn(II) and Cd(II) with a mono negative tridentate guaifenesin ligand (GFS) (OOO donation sites) and 1,10-phenanthroline (Phen) is reported. The metal complexes are characterized based on elemental analyses, IR, (1)H NMR, solid reflectance, magnetic moment, molar conductance, UV-vis spectral studies, mass spectroscopy, ESR, XRD and thermal analysis (TG and DTG). The ternary metal complexes were found to have the formulae of [M(GFS)(Phen)Cl]Cl·nH2O (M=Cr(III) (n=1) and Fe(III) (n=0)), [M(GFS)(Phen)Cl]·nH2O (M=Mn(II) (n=0), Zn(II) (n=0) and Cu(II) (n=3)) and [M(GFS)(Phen)(H2O)]Cl·nH2O (M=Co(II) (n=0), Ni(II) (n=0) and Cd(II) (n=4)). All the chelates are found to have octahedral geometrical structures. The ligand and its ternary chelates are subjected to thermal analyses (TG and DTG). The GFS ligand, in comparison to its ternary metal complexes also was screened for their antibacterial activity on gram positive bacteria (Bacillus subtilis and Staphylococcus aureus), gram negative bacteria (Escherichia coli and Neisseria gonorrhoeae) and for in vitro antifungal activity against (Candida albicans). The activity data show that the metal complexes have antibacterial and antifungal activity more than the parent GFS ligand. The complexes were also screened for its in vitro anticancer activity against the Breast cell line (MFC7) and the results obtained show that they exhibit a considerable anticancer activity. PMID:26067934

  16. Role of Metal Ions on the Activity of Mycobacterium tuberculosis Pyrazinamidase

    PubMed Central

    Sheen, Patricia; Ferrer, Patricia; Gilman, Robert H.; Christiansen, Gina; Moreno-Román, Paola; Gutiérrez, Andrés H.; Sotelo, Jun; Evangelista, Wilfredo; Fuentes, Patricia; Rueda, Daniel; Flores, Myra; Olivera, Paula; Solis, José; Pesaresi, Alessandro; Lamba, Doriano; Zimic, Mirko

    2012-01-01

    Pyrazinamidase of Mycobacterium tuberculosis catalyzes the conversion of pyrazinamide to the active molecule pyrazinoic acid. Reduction of pyrazinamidase activity results in a level of pyrazinamide resistance. Previous studies have suggested that pyrazinamidase has a metal-binding site and that a divalent metal cofactor is required for activity. To determine the effect of divalent metals on the pyrazinamidase, the recombinant wild-type pyrazinamidase corresponding to the H37Rv pyrazinamide-susceptible reference strain was expressed in Escherichia coli with and without a carboxy terminal. His-tagged pyrazinamidase was inactivated by metal depletion and reactivated by titration with divalent metals. Although Co2+, Mn2+, and Zn2+ restored pyrazinamidase activity, only Co2+ enhanced the enzymatic activity to levels higher than the wild-type pyrazinamidase. Cu2+, Fe2+, Fe3+, and Mg2+ did not restore the activity under the conditions tested. Various recombinant mutated pyrazinamidases with appropriate folding but different enzymatic activities showed a differential pattern of recovered activity. X-ray fluorescence and atomic absorbance spectroscopy showed that recombinant wild-type pyrazinamidase expressed in E. coli most likely contained Zn. In conclusion, this study suggests that M. tuberculosis pyrazinamidase is a metalloenzyme that is able to coordinate several ions, but in vivo, it is more likely to coordinate Zn2+. However, in vitro, the metal-depleted enzyme could be reactivated by several divalent metals with higher efficiency than Zn. PMID:22764307

  17. Metal-organic framework-immobilized polyhedral metal nanocrystals: reduction at solid-gas interface, metal segregation, core-shell structure, and high catalytic activity.

    PubMed

    Aijaz, Arshad; Akita, Tomoki; Tsumori, Nobuko; Xu, Qiang

    2013-11-01

    For the first time, this work presents surfactant-free monometallic and bimetallic polyhedral metal nanocrystals (MNCs) immobilized to a metal-organic framework (MIL-101) by CO-directed reduction of metal precursors at the solid-gas interface. With this novel method, Pt cubes and Pd tetrahedra were formed by CO preferential bindings on their (100) and (111) facets, respectively. PtPd bimetallic nanocrystals showed metal segregation, leading to Pd-rich core and Pt-rich shell. Core-shell Pt@Pd nanocrystals were immobilized to MIL-101 by seed-mediated two-step reduction, representing the first example of core-shell MNCs formed using only gas-phase reducing agents. These MOF-supported MNCs exhibited high catalytic activities for CO oxidation. PMID:24138338

  18. Measuring the noble metal and iodine composition of extracted noble metal phase from spent nuclear fuel using instrumental neutron activation analysis.

    PubMed

    Palomares, R I; Dayman, K J; Landsberger, S; Biegalski, S R; Soderquist, C Z; Casella, A J; Brady Raap, M C; Schwantes, J M

    2015-04-01

    Masses of noble metal and iodine nuclides in the metallic noble metal phase extracted from spent fuel are measured using instrumental neutron activation analysis. Nuclide presence is predicted using fission yield analysis, and radionuclides are identified and the masses quantified using neutron activation analysis. The nuclide compositions of noble metal phase derived from two dissolution methods, UO2 fuel dissolved in nitric acid and UO2 fuel dissolved in ammonium-carbonate and hydrogen-peroxide solution, are compared. PMID:25644079

  19. Facile synthesis of amino-functionalized titanium metal-organic frameworks and their superior visible-light photocatalytic activity for Cr(VI) reduction.

    PubMed

    Wang, Hou; Yuan, Xingzhong; Wu, Yan; Zeng, Guangming; Chen, Xiaohong; Leng, Lijian; Wu, Zhibin; Jiang, Longbo; Li, Hui

    2015-04-01

    Porous metal-organic frameworks (MOFs) have been arousing a great interest in exploring the application of MOFs as photocatalyst in environment remediation. In this work, two different MOFs, Ti-benzenedicarboxylate (MIL-125(Ti)) and amino-functionalized Ti-benzenedicarboxylate (NH2-MIL-125(Ti)) were successfully synthesized via a facile solvothermal method. The MIL-125(Ti) and NH2-MIL-125(Ti) were well characterized by XRD, SEM, XPS, N2 adsorption-desorption measurements, thermogravimetric analysis and UV-vis diffuse reflectance spectra (DRS). It is revealed that the NH2-MIL-125(Ti) has well crystalline lattice, large surface area and mesoporous structure, chemical and thermal stability, and enhanced visible-light absorption up to 520 nm, which was associated with the chromophore (amino group) in the organic linker. Compared with MIL-125(Ti), NH2-MIL-125(Ti) exhibited more efficient photocatalytic activity for Cr(VI) reduction from aqueous solution under visible-light irradiation. The addition of hole scavenger, the hole scavenger concentration and the pH value of the reaction solution played important roles in the photo-catalytic reduction of Cr(VI). The presence of Ti(3+)-Ti(4+) intervalence electron transfer was the main reason for photo-excited electrons transportation from titanium-oxo clusters to Cr(VI), facilitating the Cr(VI) reduction under the acid condition. It was demonstrated that amino-functionalized Ti(IV)-based MOFs could be promising visible-light photocatalysts for the treatment of Cr(VI)-contained wastewater. PMID:25585267

  20. Quantifying the density and utilization of active sites in non-precious metal oxygen electroreduction catalysts.

    PubMed

    Sahraie, Nastaran Ranjbar; Kramm, Ulrike I; Steinberg, Julian; Zhang, Yuanjian; Thomas, Arne; Reier, Tobias; Paraknowitsch, Jens-Peter; Strasser, Peter

    2015-01-01

    Carbon materials doped with transition metal and nitrogen are highly active, non-precious metal catalysts for the electrochemical conversion of molecular oxygen in fuel cells, metal air batteries, and electrolytic processes. However, accurate measurement of their intrinsic turn-over frequency and active-site density based on metal centres in bulk and surface has remained difficult to date, which has hampered a more rational catalyst design. Here we report a successful quantification of bulk and surface-based active-site density and associated turn-over frequency values of mono- and bimetallic Fe/N-doped carbons using a combination of chemisorption, desorption and (57)Fe Mössbauer spectroscopy techniques. Our general approach yields an experimental descriptor for the intrinsic activity and the active-site utilization, aiding in the catalyst development process and enabling a previously unachieved level of understanding of reactivity trends owing to a deconvolution of site density and intrinsic activity. PMID:26486465

  1. Quantifying the density and utilization of active sites in non-precious metal oxygen electroreduction catalysts

    NASA Astrophysics Data System (ADS)

    Sahraie, Nastaran Ranjbar; Kramm, Ulrike I.; Steinberg, Julian; Zhang, Yuanjian; Thomas, Arne; Reier, Tobias; Paraknowitsch, Jens-Peter; Strasser, Peter

    2015-10-01

    Carbon materials doped with transition metal and nitrogen are highly active, non-precious metal catalysts for the electrochemical conversion of molecular oxygen in fuel cells, metal air batteries, and electrolytic processes. However, accurate measurement of their intrinsic turn-over frequency and active-site density based on metal centres in bulk and surface has remained difficult to date, which has hampered a more rational catalyst design. Here we report a successful quantification of bulk and surface-based active-site density and associated turn-over frequency values of mono- and bimetallic Fe/N-doped carbons using a combination of chemisorption, desorption and 57Fe Mössbauer spectroscopy techniques. Our general approach yields an experimental descriptor for the intrinsic activity and the active-site utilization, aiding in the catalyst development process and enabling a previously unachieved level of understanding of reactivity trends owing to a deconvolution of site density and intrinsic activity.

  2. Quantifying the density and utilization of active sites in non-precious metal oxygen electroreduction catalysts

    PubMed Central

    Sahraie, Nastaran Ranjbar; Kramm, Ulrike I.; Steinberg, Julian; Zhang, Yuanjian; Thomas, Arne; Reier, Tobias; Paraknowitsch, Jens-Peter; Strasser, Peter

    2015-01-01

    Carbon materials doped with transition metal and nitrogen are highly active, non-precious metal catalysts for the electrochemical conversion of molecular oxygen in fuel cells, metal air batteries, and electrolytic processes. However, accurate measurement of their intrinsic turn-over frequency and active-site density based on metal centres in bulk and surface has remained difficult to date, which has hampered a more rational catalyst design. Here we report a successful quantification of bulk and surface-based active-site density and associated turn-over frequency values of mono- and bimetallic Fe/N-doped carbons using a combination of chemisorption, desorption and 57Fe Mössbauer spectroscopy techniques. Our general approach yields an experimental descriptor for the intrinsic activity and the active-site utilization, aiding in the catalyst development process and enabling a previously unachieved level of understanding of reactivity trends owing to a deconvolution of site density and intrinsic activity. PMID:26486465

  3. New hybrid molecules with anticonvulsant and antinociceptive activity derived from 3-methyl- or 3,3-dimethyl-1-[1-oxo-1-(4-phenylpiperazin-1-yl)propan-2-yl]pyrrolidine-2,5-diones.

    PubMed

    Kamiński, Krzysztof; Zagaja, Mirosław; Rapacz, Anna; Łuszczki, Jarogniew J; Andres-Mach, Marta; Abram, Michał; Obniska, Jolanta

    2016-02-15

    The purpose of this study was to synthetize the focused library of 34 new piperazinamides of 3-methyl- and 3,3-dimethyl-(2,5-dioxopyrrolidin-1-yl)propanoic or butanoic acids as potential new hybrid anticonvulsants. These hybrid molecules join the chemical fragments of well-known antiepileptic drugs (AEDs) such as ethosuximide, levetiracetam, and lacosamide. Compounds 5-38 were prepared in a coupling reaction of the 3-methyl- or 3,3-dimethyl-2-(2,5-dioxopyrrolidin-1-yl)propanoic (1, 2) or butanoic acids (3, 4) with the appropriately substituted secondary amines in the presence of the N,N-carbonyldiimidazole reagent. The initial anticonvulsant screening was performed in mice (ip) using the 'classical' maximal electroshock (MES) and subcutaneous pentylenetetrazole (scPTZ) tests as well as in the six-Hertz (6Hz) model of pharmacoresistant limbic seizures. The acute neurological toxicity was determined applying the chimney test. The broad spectra of activity across the preclinical seizure models in mice ip displayed compounds 7, 15, and 36. The most favorable anticonvulsant properties demonstrated 15 (ED50 MES=74.8mg/kg, ED50scPTZ=51.6mg/kg, ED50 6Hz=16.8mg/kg) which showed TD50=213.3mg/kg in the chimney test that yielded satisfying protective indexes (PI MES=2.85, PI scPTZ=4.13, PI 6Hz=12.70) at time point of 0.5h. As a result, compound 15 displayed comparable or better safety profile than clinically relevant AEDs: ethosuximide, lacosamide or valproic acid. In the in vitro assays compound 15 was observed as relatively effective binder to the neuronal voltage-sensitive sodium and L-type calcium channels. Beyond the anticonvulsant properties, 6 compounds diminished the pain responses in the formalin model of tonic pain in mice. PMID:26746343

  4. 8-Oxo-2′-Deoxyguanosine as a Biomarker of Tobacco Smoking-Induced Oxidative Stress

    PubMed Central

    Mesaros, Clementina; Arora, Jasbir S.; Wholer, Ashley; Vachani, Anil; Blair, Ian A.

    2014-01-01

    7,8-Dihydro-8-oxo-2′-deoxyguanosine (8-oxo-dGuo) is a useful biomarker of oxidative stress. However, its analysis can be challenging because 8-oxo-dGuo must be quantified in the presence of dGuo, without artifactual conversion to 8-oxo-dGuo. Urine is the ideal biological fluid for population studies, since it can be obtained non-invasively and it is less likely that artifactual oxidation of dGuo can occur because of the relatively low amounts that are present when compared with hydrolyzed DNA. Stable isotope dilution liquid chromatography/selected reaction monitoring-mass spectrometry (LC-SRM/MS) with [15N5]-8-oxo-dGuo as internal standard provided the highest possible specificity for 8-oxo-dGuo analysis. Furthermore, artifact formation was determined by addition of [13C1015N5]-dGuo and monitoring its conversion to [13C1015N5]-8-oxo-dGuo during the analytical procedure. 8-Oxo-dGuo concentrations were normalized for inter-individual differences in urine flow by analysis of creatinine using stable isotope dilution LC-SRM/MS. A significant increase in urinary 8-oxo-dGuo was observed in tobacco smokers when compared with non-smokers using either simple urinary concentrations or after normalization for creatinine excretion. The mean levels of 8-oxo-dGuo were 1.65 ng/mL and the levels normalized to creatinine were 1.72 μg/g creatinine. Therefore, stable isotope dilution LC-SRM/MS analysis of urinary 8-oxo-dGuo complements urinary isoprostane (isoP) analysis for assessing tobacco-smoking-induced oxidative stress. This method will be particularly useful for studies that employ polyunsaturated fatty acids, where reduction in arachidonic acid precursor could confound isoP measurements. PMID:22613262

  5. Metal-based formulations with high microbicidal activity.

    PubMed

    Sagripanti, J L

    1992-09-01

    Substances were evaluated for their relative potencies in inactivating Junin virus, Escherichia coli, and spores of Bacillus subtilis. Under the conditions of our test, glutaraldehyde was the most efficient agent among all substances currently recommended for disinfecting and sterilizing medical devices. Either copper or iron ions by themselves were able to inactivate virus with an efficiency similar to that of substances currently used for disinfection and sterilization. The microbicidal effect of metals, however, was enhanced further by the addition of peroxide. The mixtures of copper and peroxide described here were more efficient than glutaraldehyde in inactivating viruses and bacteria. The addition of a metal chelator to metal-peroxide mixtures further increased the microbicidal potency of the reagent. The formulations described in this study should be harmless to people but able to quickly and efficiently inactivate microorganisms, particularly viruses. PMID:1332611

  6. (E)-3-(2-(furan-ylmethylene)hydrazinyl)-3-oxo-N-(thiazol-2yl)propanamide complexes: Synthesis, characterization and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Abd El-Hady, M. N.; Zaky, R. R.; Ibrahim, K. M.; Gomaa, E. A.

    2012-05-01

    Schiff base complexes of Co(II), Ni(II), Cu(II), Pd(II), Cd(II), Hg(II), Zn(II) and U(VI)O2 (E)-3-(2-(furan-ylmethylene)hydrazinyl)-3-oxo-N-(thiazol-2yl)propanamide (H2FH) containing N and O donor sites have been synthesized. Both ligand and its metal complexes were characterized by different physicochemical methods, elemental analysis, molar conductivity, (1H NMR, IR, UV-visible) and also thermal analysis (TG and DTG) techniques. The molar conductance reveals that all the isolated complexes are non-electrolytes. IR spectra suggest that the H2FH behaves in a monodentate, bidentate and/or tetradentate manner. The electronic spectra of the complexes as well as their magnetic moments suggest octahedral geometries for all isolated complexes except Pd(II) complex has square planner geometry. The kinetic and thermodynamic parameters for the different decomposition steps in the [Cu(H2FH)Cl2]·2H2O, [Cu(FH)(H2O)2]·H2O and [Zn(FH)(H2O)2]·H2O complexes were calculated using the Coats-Redfern equation. Also, the formation constants of complexes in solution was studied pH-metrically. Moreover, the antimicrobial activities of all compounds were studied using a wide spectrum of bacterial and fungal strains.

  7. Effects of humic acid-metal complexes on hepatic carnitine palmitoyltransferase, carnitine acetyltransferase and catalase activities

    SciTech Connect

    Fungjou Lu; Youngshin Chen . Dept. of Biochemistry); Tienshang Huang . Dept. of Medicine)

    1994-03-01

    A significant increase in activities of hepatic carnitine palmitoyltransferase and carnitine acetyltransferase was observed in male Balb/c mice intraperitoneally injected for 40 d with 0.125 mg/0.1 ml/d humic acid-metal complexes. Among these complexes, the humic acid-As complex was relatively effective, whereas humic acid-25 metal complex was more effective, and humic acid-26 metal complex was most effective. However, humic acid or metal mixtures, or metal such as As alone, was not effective. Humic acid-metal complexes also significantly decreased hepatic catalase activity. A marked decrease of 60-kDa polypeptide in liver cytoplasm was also observed on SDS-polyacrylamide gel electrophoresis after the mice had been injected with the complexes. Morphological analysis of a histopathological biopsy of such treated mice revealed several changes in hepatocytes, including focal necrosis and cell infiltration, mild fatty changes, reactive nuclei, and hypertrophy. Humic acid-metal complexes affect activities of metabolic enzymes of fatty acids, and this results in accumulation of hydrogen peroxide and increase of the lipid peroxidation. The products of lipid peroxidation may be responsible for liver damage and possible carcinogenesis. Previous studies in this laboratory had shown that humic acid-metal complex altered the coagulation system and that humic acid, per se, caused vasculopathy. Therefore, humic acid-metal complexes may be main causal factors of not only so-called blackfoot disease, but also the liver cancer prevailing on the southwestern coast of Taiwan.

  8. Antimalarial and antimicrobial activities of 8-Aminoquinoline-Uracils metal complexes

    PubMed Central

    Phopin, Kamonrat; Sinthupoom, Nujarin; Treeratanapiboon, Lertyot; Kunwittaya, Sarun; Prachayasittikul, Supaluk; Ruchirawat, Somsak; Prachayasittikul, Virapong

    2016-01-01

    8-Aminoquinoline (8AQ) derivatives have been reported to have antimalarial, anticancer, and antioxidant activities. This study investigated the potency of 8AQ-5-substituted (iodo and nitro) uracils metal (Mn, Cu, Ni) complexes (1-6) as antimalarial and antimicrobial agents. Interestingly, all of these metal complexes (1-6) showed fair antimalarial activities. Moreover, Cu complexes 2 (8AQ-Cu-5Iu) and 5 (8AQ-Cu-5Nu) exerted antimicrobial activities against Gram-negative bacteria including P. shigelloides and S. dysenteriae. The results reveal application of 8AQ and its metal complexes as potential compounds to be further developed as novel antimalarial and antibacterial agents. PMID:27103894

  9. Assessing microbial activities in metal contaminated agricultural volcanic soils - An integrative approach.

    PubMed

    Parelho, C; Rodrigues, A S; Barreto, M C; Ferreira, N G C; Garcia, P

    2016-07-01

    Volcanic soils are unique naturally fertile resources, extensively used for agricultural purposes and with particular physicochemical properties that may result in accumulation of toxic substances, such as trace metals. Trace metal contaminated soils have significant effects on soil microbial activities and hence on soil quality. The aim of this study is to determine the soil microbial responses to metal contamination in volcanic soils under different agricultural land use practices (conventional, traditional and organic), based on a three-tier approach: Tier 1 - assess soil microbial activities, Tier 2 - link the microbial activity to soil trace metal contamination and, Tier 3 - integrate the microbial activity in an effect-based soil index (Integrative Biological Response) to score soil health status in metal contaminated agricultural soils. Our results showed that microbial biomass C levels and soil enzymes activities were decreased in all agricultural soils. Dehydrogenase and β-glucosidase activities, soil basal respiration and microbial biomass C were the most sensitive responses to trace metal soil contamination. The Integrative Biological Response value indicated that soil health was ranked as: organic>traditional>conventional, highlighting the importance of integrative biomarker-based strategies for the development of the trace metal "footprint" in Andosols. PMID:27057992

  10. Redox-Active Metal-Organic Composites for Highly Selective Oxygen Separation Applications.

    PubMed

    Zhang, Wen; Banerjee, Debasis; Liu, Jian; Schaef, Herbert T; Crum, Jarrod V; Fernandez, Carlos A; Kukkadapu, Ravi K; Nie, Zimin; Nune, Satish K; Motkuri, Radha K; Chapman, Karena W; Engelhard, Mark H; Hayes, James C; Silvers, Kurt L; Krishna, Rajamani; McGrail, B Peter; Liu, Jun; Thallapally, Praveen K

    2016-05-01

    A redox-active metal-organic composite material shows improved and selective O2 adsorption over N2 with respect to individual components (MIL-101 and ferrocene). The O2 sensitivity of the composite material arises due to the formation of maghemite nanoparticles with the pore of the metal-organic framework material. PMID:26953336

  11. 77 FR 10544 - Agency Information Collection Activities: Comment Request for the Nonferrous Metals Surveys (30...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-22

    ... information. III. Request for Comments On August 23, 2011, we published a Federal Register Notice (76 FR 52686... Geological Survey Agency Information Collection Activities: Comment Request for the Nonferrous Metals Surveys... requirements for the Nonferrous Metals Surveys. This collection consists of 30 forms. The revision...

  12. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified...

  13. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified...

  14. Nitrogen Oxide Atom-Transfer Redox Chemistry; Mechanism of NO(g) to Nitrite Conversion Utilizing μ-oxo Heme-Fe(III)-O-Cu(II)(L) Constructs.

    PubMed

    Hematian, Shabnam; Kenkel, Isabell; Shubina, Tatyana E; Dürr, Maximilian; Liu, Jeffrey J; Siegler, Maxime A; Ivanovic-Burmazovic, Ivana; Karlin, Kenneth D

    2015-05-27

    While nitric oxide (NO, nitrogen monoxide) is a critically important signaling agent, its cellular concentrations must be tightly controlled, generally through its oxidative conversion to nitrite (NO2(-)) where it is held in reserve to be reconverted as needed. In part, this reaction is mediated by the binuclear heme a3/CuB active site of cytochrome c oxidase. In this report, the oxidation of NO(g) to nitrite is shown to occur efficiently in new synthetic μ-oxo heme-Fe(III)-O-Cu(II)(L) constructs (L being a tridentate or tetradentate pyridyl/alkylamino ligand), and spectroscopic and kinetic investigations provide detailed mechanistic insights. Two new X-ray structures of μ-oxo complexes have been determined and compared to literature analogs. All μ-oxo complexes react with 2 mol equiv NO(g) to give 1:1 mixtures of discrete [(L)Cu(II)(NO2(-))](+) plus ferrous heme-nitrosyl compounds; when the first NO(g) equiv reduces the heme center and itself is oxidized to nitrite, the second equiv of NO(g) traps the ferrous heme thus formed. For one μ-oxo heme-Fe(III)-O-Cu(II)(L) compound, the reaction with NO(g) reveals an intermediate species ("intermediate"), formally a bis-NO adduct, [(NO)(porphyrinate)Fe(II)-(NO2(-))-Cu(II)(L)](+) (λmax = 433 nm), confirmed by cryo-spray ionization mass spectrometry and EPR spectroscopy, along with the observation that cooling a 1:1 mixture of [(L)Cu(II)(NO2(-))](+) and heme-Fe(II)(NO) to -125 °C leads to association and generation of the key 433 nm UV-vis feature. Kinetic-thermodynamic parameters obtained from low-temperature stopped-flow measurements are in excellent agreement with DFT calculations carried out which describe the sequential addition of NO(g) to the μ-oxo complex. PMID:25974136

  15. 40 CFR 721.8673 - [(Disubstituted phenyl)]azo dihydro hydroxy alkyl oxo alkyl-substituted-pyridines (generic name).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false azo dihydro hydroxy alkyl oxo alkyl... Significant New Uses for Specific Chemical Substances § 721.8673 azo dihydro hydroxy alkyl oxo alkyl...) The chemical substances identified generically as azo dihydro hydroxy alkyl oxo...

  16. 40 CFR 721.8673 - [(Disubstituted phenyl)]azo dihydro hydroxy alkyl oxo alkyl-substituted-pyridines (generic name).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false azo dihydro hydroxy alkyl oxo alkyl... Significant New Uses for Specific Chemical Substances § 721.8673 azo dihydro hydroxy alkyl oxo alkyl...) The chemical substances identified generically as azo dihydro hydroxy alkyl oxo...

  17. 40 CFR 721.8673 - [(Disubstituted phenyl)]azo dihydro hydroxy alkyl oxo alkyl-substituted-pyridines (generic name).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false azo dihydro hydroxy alkyl oxo alkyl... Significant New Uses for Specific Chemical Substances § 721.8673 azo dihydro hydroxy alkyl oxo alkyl...) The chemical substances identified generically as azo dihydro hydroxy alkyl oxo...

  18. Gas-phase activation of methane by ligated transition-metal cations

    PubMed Central

    Schröder, Detlef; Schwarz, Helmut

    2008-01-01

    Motivated by the search for ways of a more efficient usage of the large, unexploited resources of methane, recent progress in the gas-phase activation of methane by ligated transition-metal ions is discussed. Mass spectrometric experiments demonstrate that the ligands can crucially influence both reactivity and selectivity of transition-metal cations in bond-activation processes, and the most reactive species derive from combinations of transition metals with the electronegative elements fluorine, oxygen, and chlorine. Furthermore, the collected knowledge about intramolecular kinetic isotope effects associated with the activation of C–H(D) bonds of methane can be used to distinguish the nature of the bond activation as a mere hydrogen-abstraction, a metal-assisted mechanism or more complex reactions such as formation of insertion intermediates or σ-bond metathesis. PMID:18955709

  19. Rapidly assessing the activation conditions and porosity of metal-organic frameworks using thermogravimetric analysis

    SciTech Connect

    McDonald, TM; Bloch, ED; Long, JR

    2015-01-01

    A methodology utilizing a thermogravimetric analyzer to monitor propane uptake following incremental increases of the temperature is demonstrated as a means of rapidly identifying porous materials and determining the optimum activation conditions of metal-organic frameworks.

  20. Selective Detection of 8-Oxo-2'-deoxyguanosine in Single-Stranded DNA via Nanopore Sensing Approach.

    PubMed

    Liu, Lei; Li, Yuru; Li, Ting; Xie, Jiani; Chen, Chaofei; Liu, Quansheng; Zhang, Shouwen; Wu, Hai-Chen

    2016-01-19

    We have developed a nanopore sensing approach for the selective detection of 8-oxo-2'-deoxyguanosine (8-oxoG) in single-stranded DNA. First, 1,12-dodecanediamine is coupled with 8-oxoG-containing DNA molecules in high yield which leaves a free amine group for subsequent attaching of an adamantane moiety. After incubation with cucurbit[7]uril, the host-guest complex-modified DNA hybrid is translocated through an α-hemolysin nanopore. Highly characteristic events can be recorded and used to quantify the 8-oxoG-DNA content in a DNA mixture. Compared with the existing methods, this study provides a reliable, quick, and low-cost approach for the detection of 8-oxoG site in single-stranded DNA at the single-molecule level, particularly suitable for high-throughput screening of a massive number of samples. PMID:26699617

  1. Physicochemical properties and catalytic activity of metal tetraphenyl porphins in the oxidation of alkylaromatic hydrocarbons

    NASA Astrophysics Data System (ADS)

    Kobotaeva, N. S.; Skorokhodova, T. S.; Kokova, D. A.

    2013-06-01

    We consider the effect of complexing metal in a tetraphenylporphin molecule on its catalytic activity in oxidizing alkylaromatic hydrocarbons by molecular oxygen. The catalytic activity of metal porphyrins (Co, Cu, Zn, Mn, and In TPP) is found to depend on their oxidation potentials and the distribution of electron density in the molecule. The electron-donating compound imidazole is shown to affect the oxidation rate.

  2. Active Metal Brazing of Carbon-Carbon Composites to Titanium

    NASA Technical Reports Server (NTRS)

    Singh, M.; Shpargel, T. P.; Morscher, G.; Asthana, R.

    2004-01-01

    The Ti-metal/C-C composite joints were formed by reactive brazing with three commercial brazes, namely, Cu-ABA, TiCuNi, and TiCuSil. The joint microstructures were examined using optical microscopy, and scanning electron microscopy (SEM) coupled with energy dispersive spectrometry (EDS). The results of the microstructure analysis indicate solute redistribution across the joint which led to good wetting, spreading, and metallurgical bond formation via interdiffusion.

  3. A DFT study to unravel the ligand exchange kinetics and thermodynamics of Os(VIII) oxo/hydroxido/aqua complexes in aqueous matrices.

    PubMed

    van Niekerk, Daniel M E; Gerber, Wilhelmus J; Koch, Klaus R

    2016-04-19

    The Os(VIII) oxo/hydroxido complexes that are abundant in mild to relatively concentrated basic aqueous solutions are Os(VIII)O4, [Os(VIII)O4(OH)](-) and two cis-[Os(VIII)O4(OH)2](2-) species. Os(VIII) complexes that contain water ligands are thermodynamically unfavoured w.r.t. the abovementioned species. Os(VIII)O4 reacts with hydroxide in two, consecutive, elementary coordination sphere expansion steps to form the [Os(VIII)O4(OH)](-) complex and then the cis-[Os(VIII)O4(OH)2](2-) species. The Gibbs energy of activation for both reactions, in the forward and reverse direction, are in the range of 6-12 kcal mol(-1) and are relatively close to diffusion-controlled. The thermodynamic driving force of the first reaction is the bonding energy of the Os(VIII)-OH metal-hydroxido ligand, while of the second reaction it is the relatively large hydration energy of the doubly-charged cis-[Os(VIII)O4(OH)2](2-) product compared to the singly-charged reactants. The DFT-calculated (PBE-D3 functional) in the simulated aqueous phase (COSMO) is -2.4 kcal mol(-1) for the first reaction and -0.6 kcal mol(-1) for the second reaction and agree to within 1 kcal mol(-1) with reported experimental values, at -2.7 and 0.3 kcal mol(-1) respectively. From QTAIM and EDA analyses it is deduced that the Os(VIII)[double bond, length as m-dash]O bonding interactions are ionic (closed-shell) and that Os(VIII)-OH bonding interactions are polar covalent (dative). In contrast to QTAIM, NCI analysis allowed for the identification of relatively weak intramolecular hydrogen bonding interactions between neighbouring oxo and hydroxido ligands in both [Os(VIII)O4(OH)](-) and cis-[Os(VIII)O4(OH)2](2-) complexes. PMID:26991070

  4. Active-Metal Template Synthesis of a Halogen-Bonding Rotaxane for Anion Recognition.

    PubMed

    Langton, Matthew J; Xiong, Yaoyao; Beer, Paul D

    2015-12-21

    The synthesis of an all-halogen-bonding rotaxane for anion recognition is achieved by using active-metal templation. A flexible bis-iodotriazole-containing macrocycle is exploited for the metal-directed rotaxane synthesis. Endotopic binding of a Cu(I) template facilitates an active-metal CuAAC iodotriazole axle formation reaction that captures the interlocked rotaxane product. Following copper-template removal, exotopic coordination of a more sterically demanding rhenium(I) complex induces an inversion in the conformation of the macrocycle component, directing the iodotriazole halogen-bond donors into the rotaxane's interlocked binding cavity to facilitate anion recognition. PMID:26500150

  5. Activation of gene expression by metal-responsive signal transduction pathways.

    PubMed Central

    Adams, Timothy K; Saydam, Nurten; Steiner, Florian; Schaffner, Walter; Freedman, Jonathan H

    2002-01-01

    Metallothioneins are small, cysteine-rich, metal-binding proteins that play important roles in maintaining intracellular metal homeostasis and in transition metal detoxification. MTF-1 (metal transcription factor-1) plays a central role in regulating the metal-inducible, transcriptional activation of metallothionein. Here we report that the phosphorylation of MTF-1 plays a critical role in the activation of MTF-1/metal-responsive element-mediated transcription. Inhibitor studies indicate that signal transduction cascades, including those mediated by protein kinase C, tyrosine kinase, and casein kinase II, are essential for zinc- and cadmium-inducible transcription. In addition, calcium signaling is also involved in regulating transcription. In contrast, cAMP-dependent protein kinase may not be directly involved in the metal response. Contrary to what has been reported for other transcription factors, the inhibition of transcriptional activation does not impair the binding of MTF-1 to DNA, suggesting that phosphorylation is not regulating DNA binding. Elevated phosphorylation of MTF-1 is observed under conditions of protein kinase C inhibition, suggesting that dephosphorylation of this transcription factor mediates its activation. PMID:12426137

  6. Monouclear niobium imido and oxo complexes supported by N, N{prime}-bis(trimethylsilyl)benzamidinate ligands. X-ray structures of [Nb(NBu{sup t})(PhC(NSiMe{sub 3}){sub 2})Cl{sub 2}(py)] and [Nb(O)((4-C{sub 6}H{sub 4}Me)C(NSiMe{sub 3}){sub 2}){sub 2}Cl

    SciTech Connect

    Stewart, P.J.; Blake, A.J.; Mountford, P.

    1997-04-23

    The study of transition metal oxo and imido compounds continues to be an area of substantial interest. An wide variety of ancillary ligand sets has now been used to support these multiply bonded functional groups resulting in very different reactivity patterns and structural motifs. Somewhat surprisingly, amidinate ligands [having the general formula RC(NR{prime}){sub 2}] have been relatively little used in metal imido or oxo chemistry. Recently, several research groups have reported interesting and novel reaction chemistry of amidinate-supported early transition metal complexes in general, and the authors were interested to develop synthetic routes to new group 5 aminidate complexes containing metal-ligand multiple bonds. Here the authors describe the synthesis and properties of some mononuclear niobium imido and oxo complexes supported by N,N{prime}-bis(trimethylsilyl)benzamidinato ligands.

  7. pH-Dependent Metal Ion Toxicity Influences the Antibacterial Activity of Two Natural Mineral Mixtures

    PubMed Central

    Cunningham, Tanya M.; Koehl, Jennifer L.; Summers, Jack S.; Haydel, Shelley E.

    2010-01-01

    Background Recent studies have demonstrated that several mineral products sold for medicinal purposes demonstrate antimicrobial activity, but little is known about the physicochemical properties involved in antibacterial activity. Methodology/Principal Findings Using in vitro mineral suspension testing, we have identified two natural mineral mixtures, arbitrarily designated BY07 and CB07, with antibacterial activity against a broad-spectrum of bacterial pathogens. Mineral-derived aqueous leachates also exhibited antibacterial activity, revealing that chemical, not physical, mineral characteristics were responsible for the observed activity. The chemical properties essential for bactericidal activity against Escherichia coli were probed by testing antibacterial activity in the presence of metal chelators, the hydroxyl radical scavenger, thiourea, and varying pH levels. Chelation of the BY07 minerals with EDTA or desferrioxamine eliminated or reduced BY07 toxicity, respectively, suggesting a role of an acid-soluble metal species, particularly Fe3+ or other sequestered metal cations, in mineral toxicity. This conclusion was supported by NMR relaxation data, which indicated that BY07 and CB07 leachates contained higher concentrations of chemically accessible metal ions than leachates from non-bactericidal mineral samples. Conclusions/Significance We conclude that the acidic environment of the hydrated minerals significantly contributes to antibacterial activity by increasing the availability and toxicity of metal ions. These findings provide impetus for further investigation of the physiological effects of mineral products and their applications in complementary antibacterial therapies. PMID:20209160

  8. Formation of nanostructured Group IIA metal activated sensors: The transformation of Group IIA metal compound sites

    NASA Astrophysics Data System (ADS)

    Tune, Travis C.; Baker, Caitlin; Hardy, Neil; Lin, Arthur; Widing, Timothy J.; Gole, James L.

    2015-05-01

    Trends in the Group IIA metal oxides and hydroxides of magnesium, calcium, and barium are unique in the periodic table. In this study we find that they display novel trends as decorating nanostructures for extrinsic semiconductor interfaces. The Group IIA metal ions are strong Lewis acids. We form these M2+ ions in aqueous solution and bring these solutions in contact with a porous silicon interface to form interfaces for conductometric measurements. Observed responses are consistent with the formation of MgO whereas the heavier elements display behaviors which suggest the effect of their more basic nature. Mg(OH)2, when formed, represents a weak base whereas the heavier metal hydroxides of Ca, Sr, and Ba are strong bases. However, the hydroxides tend to give up hydrogen and act as Brönsted acids. For the latter elements, the reversible interaction response of nanostructures deposited to the porous silicon (PS) interface is modified, as the formation of more basic sites appears to compete with M2+ Lewis acidity and hydroxide Brönsted acidity. Mg2+ forms an interface whose response to the analytes NH3 and NO is consistent with MgO and well explained by the recently developing Inverse Hard/Soft Acid/Base model. The behavior of the Ca2+ and Ba2+ decorated interfaces as they interact with the hard base NH3 follows a reversal of the model, indicating a decrease in acidic character as the observed conductometric response suggests the interaction with hydroxyl groups. A change from oxide-like to hydroxide-like constituents is supported by XPS studies. The changes in conductometric response is easily monitored in contrast to changes associated with the Group IIA oxides and hydroxides observed in XPS, EDAX, IR, and NMR measurements.

  9. Influence of several metal ions on the gelation activation energy of silicon tetraethoxide

    NASA Technical Reports Server (NTRS)

    Bansal, Narottam P.

    1990-01-01

    The effects of nine metal cations Li(+), Na(+), Mg(2+), Ca(2+), Sr(2+), Cu(2+), Al(3+), La(3+), and Y(3+) on silica gel formation has been investigated by studying the hydrolysis and polycondensation of silicon tetraethoxide (TEOS) in the presence of metal nitrates. The influence of water:TEOS mole ratio, metal ion concentration, and the reaction temperature has been investigated. The overall activation energy for gel formation has been determined from the temperature dependence of the time of gelation for each system. The activation energy for -Si-O-Si- network formation is found to be 54.5 kJ/mol. The gel formation time as well as the activation energy sharply increase in the presence of Cu(2+), Al(3+), La(3+) and Y(3+). In contrast, the presence of Li(+), Na(+), Mg(2+), Ca(2+), or Sr(2+) lowers the gelation time, but has no appreciable effect on the activation energy. This difference may be attributed to the participation or nonparticipation of the metal ions in the formation of the three-dimensional polymeric network during the polycondensation step. The concentration of metal ion Mg(2+), Ca(2+), Y(3+) or the water:TEOS mole ratio had no appreaciable effect on the gelation activation energy. A simple test has been proposed to determine whether a metal ion would act as a network intermediate or modifier in silica and other glassy networks.

  10. Influence of several metal ions on the gelation activation energy of silicon tetraethoxide

    NASA Technical Reports Server (NTRS)

    Bansal, Narottam P.

    1988-01-01

    The effects of nine metal cations (Li(+), Na(+), Mg(2+), Ca(2+), Sr(2+), Cu(2+), Al(3+), La(3+), and Y(3+) on silica gel formation has been investigated by studying the hydrolysis and polycondensation of silicon tetraethoxide (TEOS) in the presence of metal nitrates. The influence of water: TEOS mole ratio, metal ion concentration, and the reaction temperature has been investigated. The overall activation energy for gel formation has been determined from the temperature dependence of the time of gelation for each system. The activation energy for -Si-O-Si- network formation is found to be 54.5 kJ/mol. The gel formation time as well as the activation energy sharply increase in the presence of Cu(2+), Al(3+), La(3+) and Y(3+). In contrast, the presence of Li(+), Na(+), Mg(2+), Ca(2+), or, Sr(2+) lowers the gelation time, but has no appreciable effect on the activation energy. This difference may be attributed to the participation or nonparticipation of the metal ions in the formation of the three-dimensional polymeric network during the polycondensation step. The concentration of metal ion (Mg(2+), Ca(2+), Y(3+) or the water: TEOS mole ratio had no appreciable effect on the gelation activation energy. A simple test has been proposed to determine whether a metal ion would act as a network intermediate or modifier in silica and other glassy networks.

  11. Two oxo complexes with tetranuclear [Fe(4)(mu(3)-O)(2)](8+) and trinuclear [Fe(3)(mu(3)-O)](7+) units.

    PubMed

    Cortés, Piedad; Atria, Ana María; Garland, María Teresa; Baggio, Ricardo

    2006-07-01

    Two new oxo complexes, namely hexa-mu(2)-acetato-acetatoaquabis(di-3-pyridylamine)di-mu(3)-oxo-tetrairon(III) chloride monohydrate ethanol 1.25-solvate, [Fe(4)(C(2)H(3)O(2))(7)O(2)(C(10)H(9)N(3))(2)(H(2)O)]Clx1.25C(2)H(6)OxH(2)O, (I), containing a tetranuclear [Fe(4)(mu(3)-O)(2)](8+) unit, and 2-methylimidazolium hexa-mu(2)-acetato-acetatodiaqua-mu(3)-oxo-triiron(III) chloride dihydrate, (C(4)H(7)N(2))[Fe(3)(C(2)H(3)O(2))(7)O(H(2)O)(2)]Clx2H(2)O, (II), with a trinuclear [Fe(3)(mu(3)-O)](7+) unit, are presented. Both structures are formed by two well differentiated entities, viz. a compact isolated cluster composed of Fe(III) ions coordinated to O(2-) and CH(3)CO(2)(-) anions, and an external group formed by a central Cl(-) ion surrounded by different solvent groups to which the anion is bound through hydrogen bonding. In the case of (I), charge balance cannot be achieved within the groups, so the structure is macroscopically ionic; in the case of (II), in contrast, each group is locally neutral owing to the internal compensation of charges. The trinuclear complex crystallizes with the metal cluster, chloride anion and 2-methylimidazolium cation bisected by a crystallographic mirror plane. PMID:16823197

  12. X-ray Spectroscopic Characterization of Co(IV) and Metal-Metal Interactions in Co4O4: Electronic Structure Contributions to the Formation of High-Valent States Relevant to the Oxygen Evolution Reaction.

    PubMed

    Hadt, Ryan G; Hayes, Dugan; Brodsky, Casey N; Ullman, Andrew M; Casa, Diego M; Upton, Mary H; Nocera, Daniel G; Chen, Lin X

    2016-08-31

    The formation of high-valent states is a key factor in making highly active transition-metal-based catalysts of the oxygen evolution reaction (OER). These high oxidation states will be strongly influenced by the local geometric and electronic structures of the metal ion, which are difficult to study due to spectroscopically active and complex backgrounds, short lifetimes, and limited concentrations. Here, we use a wide range of complementary X-ray spectroscopies coupled to DFT calculations to study Co(III)4O4 cubanes and their first oxidized derivatives, which provide insight into the high-valent Co(IV) centers responsible for the activity of molecular and heterogeneous OER catalysts. The combination of X-ray absorption and 1s3p resonant inelastic X-ray scattering (Kβ RIXS) allows Co(IV) to be isolated and studied against a spectroscopically active Co(III) background. Co K- and L-edge X-ray absorption data allow for a detailed characterization of the 3d-manifold of effectively localized Co(IV) centers and provide a direct handle on the t2g-based redox-active molecular orbital. Kβ RIXS is also shown to provide a powerful probe of Co(IV), and specific spectral features are sensitive to the degree of oxo-mediated metal-metal coupling across Co4O4. Guided by the data, calculations show that electron-hole delocalization can actually oppose Co(IV) formation. Computational extension of Co4O4 to CoM3O4 structures (M = redox-inactive metal) defines electronic structure contributions to Co(IV) formation. Redox activity is shown to be linearly related to covalency, and M(III) oxo inductive effects on Co(IV) oxo bonding can tune the covalency of high-valent sites over a large range and thereby tune E(0) over hundreds of millivolts. Additionally, redox-inactive metal substitution can also switch the ground state and modify metal-metal and antibonding interactions across the cluster. PMID:27515121

  13. Optical activity of catalytic elements of hetero-metallic nanostructures

    NASA Astrophysics Data System (ADS)

    Antosiewicz, Tomasz J.; Apell, S. Peter; Wadell, Carl; Langhammer, Christoph

    2015-05-01

    Interaction of light with metals in the form of surface plasmons is used in a wide range of applications in which the scattering decay channel is important. The absorption channel is usually thought of as unwanted and detrimental to the efficiency of the device. This is true in many applications, however, recent studies have shown that maximization of the decay channel of surface plasmons has potentially significant uses. One of these is the creation of electron-hole pairs or hot electrons which can be used for e.g. catalysis. Here, we study the optical properties of hetero-metallic nanostructures that enhance light interaction with the catalytic elements of the nanostructures. A hybridized LSPR that matches the spectral characteristic of the light source is excited. This LSPR through coupling between the plasmonic elements maximizes light absorption in the catalytic part of the nanostructure. Numerically calculated visible light absorption in the catalytic nanoparticles is enhanced 12-fold for large catalytic disks and by more 30 for small nanoparticles on the order of 5 nm. In experiments we measure a sizable increase in the absorption cross section when small palladium nanoparticles are coupled to a large silver resonator. These observations suggest that heterometallic nanostructures can enhance catalytic reaction rates.

  14. Mutagenic activity of heavy metals in soils of wayside slopes

    NASA Astrophysics Data System (ADS)

    Fedorova, A. I.; Kalaev, V. N.; Prosvirina, Yu. G.; Goryainova, S. A.

    2007-08-01

    The genotoxic properties of soils polluted with heavy metals were studied on two wayside slopes covered with trees in the city of Voronezh. The nucleolar test in cells of the apical meristem of Zebrina pendula Schnizl. roots was used. The genotoxic effect of the soils was revealed according to the increased number of 2-and 3-nucleolar cells (from 41 to 54% and from 19 to 23% in the upper part of the first and second slopes, respectively; in the control, their number was 18 and 7%). The mean number of nucleoli per cell increased from 1.7 to 1.95 in the experiment and 1.31 in the control. The increased vehicle emissions, especially when cars go up the slopes (mainly in the upper and middle parts), correlated with the elevated heavy metal (Pb, Cu, Cd, and Zn) contents in the soil. The mutagenic substances may be removed to the Voronezh Reservoir, where they may be accumulated in some living organisms.

  15. Metal Ion Removal from Wastewaters by Sorption on Activated Carbon, Cement Kiln Dust, and Sawdust.

    PubMed

    Shaheen, Sabry M; Eissa, Fawzy I; Ghanem, Khaled M; El-Din, Hala M Gamal; Al Anany, Fathia S

    2015-06-01

    This study assessed the efficiency of activated carbon, cement kiln dust (CKD), and sawdust for the removal of cadmium (Cd), copper (Cu), lead (Pb), and zinc (Zn) from aqueous solutions under mono-metal and competitive sorption systems and the removal of Cd, Cu, and Zn from different industrial wastewaters. Batch equilibrium experiments were conducted in a mono-metal and competitive sorption system. The efficiency of the sorbents in the removal of Cd, Cu, and Zn from industrial wastewaters was also investigated. Cement kiln dust expressed the highest affinity for the metals followed by activated carbon and sawdust. Competition among the metals changed their distribution coefficient (Kd) with the sorbents. Sorption of Pb and Cu was higher than Cd and Zn. The average metal removal from the wastewaters varied from 74, 61, and 60% for Cd, Cu, and Zn, respectively, to nearly 100%. The efficiencies of CKD and activated carbon in removing metals were higher than sawdust, suggesting their potential as low-cost sorbents for the removal of toxic metals from wastewaters. PMID:26459819

  16. Gas-phase chemistry of bare and oxo-ligated protactinium ions: a contribution to a systematic understanding of actinide chemistry.

    PubMed

    Gibson, John K; Haire, Richard G

    2002-11-01

    Gas-phase chemistry of bare and oxo-ligated protactinium ions has been studied for the first time. Comparisons were made with thorium, uranium, and neptunium ion chemistry to further the systematic understanding of 5f elements. The rates of oxidation of Pa(+) and PaO(+) by ethylene oxide compared with those of the homologous uranium ions indicate that the first and second bond dissociation energies, BDE[Pa(+)-O] and BDE[OPa(+)-O], are approximately 800 kJ mol(-1). The relatively facile fluorination of Pa(+) to PaF(4)(+) by SF(6) is consistent with the high stability of the pentavalent oxidation state of Pa. Reactions with ethene, propene, 1-butene, and iso-butene revealed that Pa(+) is a very reactive metal ion. In analogy with U(+) chemistry, ethene was trimerized by Pa(+) to give PaC(6)H(6)(+). Reactions of Pa(+) with larger alkenes resulted in secondary and tertiary products not observed for U(+) or Np(+). The bare protactinium ion is significantly more reactive with organic substrates than are heavier actinide ions. The greatest difference between Pa and heavier actinide congeners was the exceptional dehydrogenation activity of PaO(+) with alkenes; UO(+) and NpO(+) were comparatively inert. The striking reactivity of PaO(+) is attributed to the distinctive electronic structure at the metal center in this oxide, which is considered to reflect the greater availability of the 5f electrons for participation in bonding, either directly or by promotion/hybridization with higher-energy valence orbitals. PMID:12401099

  17. Antioxidant and anticancer properties and mechanisms of inorganic selenium, oxo-sulfur, and oxo-selenium compounds.

    PubMed

    Ramoutar, Ria R; Brumaghim, Julia L

    2010-09-01

    Inorganic selenium and oxo-sulfur compounds are widely available in dietary supplements and have been extensively studied for their antioxidant and anticancer properties. Although many in vivo and clinical trials have been conducted using these compounds, their biochemical and chemical mechanisms of efficacy are the focus of much current research. This review discusses the ability of inorganic selenium compounds, such as selenite, and selenate, to prevent damage from reactive oxygen species as well as their ability to promote cell death by reactive oxygen species generation. Oxo-sulfur and selenium compounds, such as allicin, dimethyl sulfone, methionine sulfoxide, and methylselenenic acid also have similar abilities to act as both antioxidants and pro-oxidants, but the mechanisms for these behaviors are distinctly different from those of the inorganic selenium compounds. The antioxidant and pro-oxidant properties of these small-molecule sulfur and selenium compounds are extremely complex and often greatly depend on experimental conditions, which may explain contradictory literature reports of their efficacy. PMID:20632128

  18. Two distinct modes of metal ion binding in the nuclease active site of a viral DNA-packaging terminase: insight into the two-metal-ion catalytic mechanism

    PubMed Central

    Zhao, Haiyan; Lin, Zihan; Lynn, Anna Y.; Varnado, Brittany; Beutler, John A.; Murelli, Ryan P.; Le Grice, Stuart F. J.; Tang, Liang

    2015-01-01

    Many dsDNA viruses encode DNA-packaging terminases, each containing a nuclease domain that resolves concatemeric DNA into genome-length units. Terminase nucleases resemble the RNase H-superfamily nucleotidyltransferases in folds, and share a two-metal-ion catalytic mechanism. Here we show that residue K428 of a bacteriophage terminase gp2 nuclease domain mediates binding of the metal cofactor Mg2+. A K428A mutation allows visualization, at high resolution, of a metal ion binding mode with a coupled-octahedral configuration at the active site, exhibiting an unusually short metal-metal distance of 2.42 Å. Such proximity of the two metal ions may play an essential role in catalysis by generating a highly positive electrostatic niche to enable formation of the negatively charged pentacovalent phosphate transition state, and provides the structural basis for distinguishing Mg2+ from Ca2+. Using a metal ion chelator β-thujaplicinol as a molecular probe, we observed a second mode of metal ion binding at the active site, mimicking the DNA binding state. Arrangement of the active site residues differs drastically from those in RNase H-like nucleases, suggesting a drifting of the active site configuration during evolution. The two distinct metal ion binding modes unveiled mechanistic details of the two-metal-ion catalysis at atomic resolution. PMID:26450964

  19. Synthesis and properties of the derivatives of 2-alkylthio-4-oxo-3,4- (and -1,4)-dihydropyrido-[2,3-d]pyrimidine-5- and -6-carboxylic acids.

    PubMed

    Sladowska, H; Bartoszko-Malik, A; Zawisza, T

    1990-01-01

    Condensation of diethyl 2-amino-6-methylpyridine-3,4-dicarboxylate (I) with the corresponding isothiocyanates afforded derivatives of ethyl 4-oxo-2-thioxo-1,2,3,4-tetrahydropyrido [2,3-d]pyrimidine-5-carboxylate (V-VII). Alkylation of (V), (VI) and (XI) gave the corresponding derivatives of ethyl 2-alkylthio-4-oxo-3,4-(and 1,4)-dihydropyrido[2,3-d]pyrimidine-5- and -6- carboxylate [(XII-XVI), (XX-XXII)]. Some of the obtained compounds were active pharmacologically. PMID:2337442

  20. Metal Cofactors in the Structure and Activity of the Fowlpox Resolvase

    PubMed Central

    Culyba, Matthew J.; Hwang, Young; Hu, Jimmy Yan; Minkah, Nana; Ocwieja, Karen E.; Bushman, Frederic D.

    2010-01-01

    Poxvirus DNA replication generates linear concatemers containing many copies of the viral genome with inverted repeat sequences at the junctions between monomers. The inverted repeats refold to generate Holliday junctions, which are cleaved by the virus-encoded resolvase enzyme to form unit-length genomes. Here we report studies of the influence of metal cofactors on the activity and structure of the resolvase of fowlpox virus (FPV), which provides a tractable model for in vitro studies. Small molecule inhibitors of related enzymes bind simultaneously to metal cofactors and nearby surface amino-acid residues, so understanding enzyme-cofactor interactions is important for the design of antiviral agents. Analysis of inferred active site residues (D7, E60, K102, D132, D135) by mutagenesis and metal rescue experiments specified residues that contribute to binding metal ions, and that multiple binding sites are probably involved. Differential electrophoretic analysis was used to map the conformation of the DNA junction when bound by resolvase. For the wild-type complex in the presence of EDTA or Ca2+, migration was consistent with the DNA arms arranged in near tetrahedral geometry. However, the D7N active site mutant resolvase held the arms in a more planar arrangement in EDTA, Ca2+ or Mg2+ conditions, implicating metal-dependent contacts at the active site in the larger architecture of the complex. These data show how divalent metals dictate the conformation of FPV resolvase/ DNA complexes and subsequent DNA cleavage. PMID:20380839

  1. SEQUESTRATION OF METALS IN ACTIVE CAP MATERIALS: A LABORATORY AND NUMERICAL EVALUATION

    SciTech Connect

    Dixon, K.; Knox, A.

    2012-02-13

    Active capping involves the use of capping materials that react with sediment contaminants to reduce their toxicity or bioavailability. Although several amendments have been proposed for use in active capping systems, little is known about their long-term ability to sequester metals. Recent research has shown that the active amendment apatite has potential application for metals contaminated sediments. The focus of this study was to evaluate the effectiveness of apatite in the sequestration of metal contaminants through the use of short-term laboratory column studies in conjunction with predictive, numerical modeling. A breakthrough column study was conducted using North Carolina apatite as the active amendment. Under saturated conditions, a spike solution containing elemental As, Cd, Co, Se, Pb, Zn, and a non-reactive tracer was injected into the column. A sand column was tested under similar conditions as a control. Effluent water samples were periodically collected from each column for chemical analysis. Relative to the non-reactive tracer, the breakthrough of each metal was substantially delayed by the apatite. Furthermore, breakthrough of each metal was substantially delayed by the apatite compared to the sand column. Finally, a simple 1-D, numerical model was created to qualitatively predict the long-term performance of apatite based on the findings from the column study. The results of the modeling showed that apatite could delay the breakthrough of some metals for hundreds of years under typical groundwater flow velocities.

  2. The chemical origin and catalytic activity of coinage metals: from oxidation to dehydrogenation.

    PubMed

    Syu, Cih-Ying; Yang, Hao-Wen; Hsu, Fu-Hsing; Wang, Jeng-Han

    2014-04-28

    The high oxidation activity of coinage metals (Cu, Ag and Au) has been widely applied in various important reactions, such as oxidation of carbon monoxide, alkenes or alcohols. The catalytic behavior of those inert metals has mostly been attributable to their size effect, the physical effect. In the present study, the chemical effects on their high oxidation activity have been investigated. We mechanistically examine the direct and oxidative dehydrogenation (partial oxidation) reactions of ethanol to acetaldehyde on a series of transition metals (groups 9, 10 and 11) with identical physical characteristics and varied chemical origins using density functional theory (DFT) calculations and electronic structure analyses at the GGA-PW91 level. The energetic results show that coinage metals have much lower activation energies and higher exothermicities for the oxidative dehydrogenation steps although they have higher energy for the direct dehydrogenation reaction. In the electronic structure analyses, coinage metals with saturated d bands can efficiently donate electrons to O* and OH*, or other electronegative adspecies, and better promote their p bands to higher energy levels. The negatively charged O* and OH* with high-lying p bands are responsible for lowering the energies in oxidative steps. The mechanistic understanding well explains the better oxidation activity of coinage metals and provides valuable information on their utilization in other useful applications, for example, the dehydrogenation process. PMID:24626959

  3. BORON CATALYSIS. Metal-free catalytic C-H bond activation and borylation of heteroarenes.

    PubMed

    Légaré, Marc-André; Courtemanche, Marc-André; Rochette, Étienne; Fontaine, Frédéric-Georges

    2015-07-31

    Transition metal complexes are efficient catalysts for the C-H bond functionalization of heteroarenes to generate useful products for the pharmaceutical and agricultural industries. However, the costly need to remove potentially toxic trace metals from the end products has prompted great interest in developing metal-free catalysts that can mimic metallic systems. We demonstrated that the borane (1-TMP-2-BH2-C6H4)2 (TMP, 2,2,6,6-tetramethylpiperidine) can activate the C-H bonds of heteroarenes and catalyze the borylation of furans, pyrroles, and electron-rich thiophenes. The selectivities complement those observed with most transition metal catalysts reported for this transformation. PMID:26228143

  4. Lumbricus terrestris L. activity increases the availability of metals and their accumulation in maize and barley.

    PubMed

    Ruiz, E; Alonso-Azcárate, J; Rodríguez, L

    2011-03-01

    The effect of the earthworm Lumbricus terrestris L. on metal availability in two mining soils was assessed by means of chemical extraction methods and a pot experiment using crop plants. Results from single and sequential extractions showed that L. terrestris had a slight effect on metal fractionation in the studied soils: only metals bound to the soil organic matter were significantly increased in some cases. However, we found that L. terrestris significantly increased root, shoot and total Pb and Zn concentrations in maize and barley for the soil with the highest concentrations of total and available metals. Specifically, shoot Pb concentration was increased by a factor of 7.5 and 3.9 for maize and barley, respectively, while shoot Zn concentration was increased by a factor of 3.7 and 1.7 for maize and barley, respectively. Our results demonstrated that earthworm activity increases the bioavailability of metals in soils. PMID:21190761

  5. Spectroscopic and Electronic Structure Studies of Intermediate X in Ribonucleotide Reductase R2 and Two Variants: A Description of the FeIV-Oxo Bond in the FeIII-O-FeIV Dimer

    PubMed Central

    Mití, Nataša; Clay, Michael D.; Saleh, Lana; Solomon, Edward I.

    2008-01-01

    Spectroscopic and electronic structure studies of the class I Escherichia coli ribonucleotide reductase (RNR) intermediate X and three computationally-derived model complexes are presented, compared and evaluated to determine the electronic and geometric structure of the FeIII-FeIV active site of intermediate X. Rapid freeze-quench (RFQ) EPR, absorption and MCD were used to trap intermediate X in R2 wild-type (WT) and two variants, W48A and Y122F/Y356F. RFQ-EPR spin quantitation was used to determine the relative contributions of intermediate X and radicals present, while RFQ-MCD was used to specifically probe the FeIII/FeIV active site, which displayed three FeIV d-d transitions between 16 700 – 22 600 cm-1, two FeIV d-d spin-flip transitions between 23 500 – 24 300 cm-1 and five oxo to FeIV and FeIII charge transfer (CT) transitions between 25 000 – 32 000 cm-1. The FeIV d-d transitions were perturbed in the two variants, confirming that all three d-d transitions derive from the d-π manifold. Furthermore, the FeIV d-π splittings in the WT are too large to correlate with a bis-μ-oxo structure. The assignment of the FeIV d-d transitions in WT intermediate X best correlates with a bridged μ-oxo/μ-hydroxo [FeIII(μ-O)(μ-OH)FeIV] structure. The μ-oxo/μ-hydroxo core structure provides an important σ/π superexchange pathway, which is not present in the bis-μ-oxo structure, to promote facile electron transfer from Y122 to the remote FeIV through the bent oxo bridge, thereby generating the tyrosyl radical for catalysis. PMID:17602477

  6. Study of activation of metal samples from LDEF-1 and Spacelab-2

    NASA Technical Reports Server (NTRS)

    Laird, C. E.

    1991-01-01

    The activation of metal samples and other material orbited onboard the Long Duration Exposure Facility (LDEF) and Spacelab-2 were studied. Measurements of the radioactivities of spacecraft materials were made, and corrections for self-absorption and efficiency were calculated. Activation cross sections for specific metal samples were updated while cross sections for other materials were tabulated from the scientific literature. Activation cross sections for 200 MeV neutrons were experimentally determined. Linear absorption coefficients, half lives, branching ratios and other pertinent technical data needed for LDEF sample analyses were tabulated. The status of the sample counting at low background facilities at national laboratories is reported.

  7. The Origin of the Catalytic Activity of a Metal Hydride in CO2 Reduction.

    PubMed

    Kato, Shunsuke; Matam, Santhosh Kumar; Kerger, Philipp; Bernard, Laetitia; Battaglia, Corsin; Vogel, Dirk; Rohwerder, Michael; Züttel, Andreas

    2016-05-10

    Atomic hydrogen on the surface of a metal with high hydrogen solubility is of particular interest for the hydrogenation of carbon dioxide. In a mixture of hydrogen and carbon dioxide, methane was markedly formed on the metal hydride ZrCoHx in the course of the hydrogen desorption and not on the pristine intermetallic. The surface analysis was performed by means of time-of-flight secondary ion mass spectroscopy and near-ambient pressure X-ray photoelectron spectroscopy, for the in situ analysis. The aim was to elucidate the origin of the catalytic activity of the metal hydride. Since at the initial stage the dissociation of impinging hydrogen molecules is hindered by a high activation barrier of the oxidised surface, the atomic hydrogen flux from the metal hydride is crucial for the reduction of carbon dioxide and surface oxides at interfacial sites. PMID:27061237

  8. Activation of methane by transition metal-substituted aluminophosphate molecular sieves

    DOEpatents

    Iton, Lennox E.; Maroni, Victor A.

    1991-01-01

    Aluminophosphate molecular sieves substituted with cobalt, manganese or iron and having the AlPO.sub.4 -34 or AlPO.sub.4 -5, or related AlPO.sub.4 structure activate methane starting at approximately 350.degree. C. Between 400.degree. and 500.degree. C. and at methane pressures .ltoreq.1 atmosphere the rate of methane conversion increases steadily with typical conversion efficiencies at 500.degree. C. approaching 50% and selectivity to the production of C.sub.2+ hydrocarbons approaching 100%. The activation mechanism is based on reduction of the transition metal(III) form of the molecular sieve to the transition metal(II) form with accompanying oxidative dehydrogenation of the methane. Reoxidation of the - transition metal(II) form to the transition metal(III) form can be done either chemically (e.g., using O.sub.2) or electrochemically.

  9. X-ray crystal structure of divalent metal-activated ß-xyloisdase, RS223BX

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the first X-ray structure of a glycoside hydrolase family 43 ß-xylosidase, RS223BX, which is strongly activated by the addition of divalent metal cations. The 2.69 Å structure reveals that the Ca2+ cation is located at the back of the active site pocket. The Ca2+ coordinates to H274 to sta...

  10. ACTIVATION OF THE EGF RECEPTOR SIGNALING PATHWAY IN HUMAN AIRWAY EPITHELIAL CELLS EXPOSED TO METALS

    EPA Science Inventory

    We have previously shown that exposure to combustion-derived metals rapidly (within 20 min) activated mitogen-activated protein kinases (MAPK), including extracellular signal-regulated kinase (ERK), in the human bronchial epithelial cell line BEAS. To study the mechanisms respons...

  11. Metal ion specificities for folding and cleavage activity in the Schistosoma hammerhead ribozyme

    PubMed Central

    Boots, Jennifer L.; Canny, Marella D.; Azimi, Ehsan; Pardi, Arthur

    2008-01-01

    The effects of various metal ions on cleavage activity and global folding have been studied in the extended Schistosoma hammerhead ribozyme. Fluorescence resonance energy transfer was used to probe global folding as a function of various monovalent and divalent metal ions in this ribozyme. The divalent metals ions Ca2+, Mg2+, Mn2+, and Sr2+ have a relatively small variation (less than sixfold) in their ability to globally fold the hammerhead ribozyme, which contrasts with the very large difference (>10,000-fold) in apparent rate constants for cleavage for these divalent metal ions in single-turnover kinetic experiments. There is still a very large range (>4600-fold) in the apparent rate constants for cleavage for these divalent metal ions measured in high salt (2 M NaCl) conditions where the ribozyme is globally folded. These results demonstrate that the identity of the divalent metal ion has little effect on global folding of the Schistosoma hammerhead ribozyme, whereas it has a very large effect on the cleavage kinetics. Mechanisms by which the identity of the divalent metal ion can have such a large effect on cleavage activity in the Schistosoma hammerhead ribozyme are discussed. PMID:18755844

  12. Isolation and divalent-metal activation of a β-xylosidase, RUM630-BX.

    PubMed

    Jordan, Douglas B; Braker, Jay D; Wagschal, Kurt; Stoller, J Rose; Lee, Charles C

    2016-01-01

    The gene encoding RUM630-BX, a β-xylosidase/arabinofuranosidase, was identified from activity-based screening of a cow rumen metagenomic library. The recombinant enzyme is activated as much as 14-fold (kcat) by divalent metals Mg(2+), Mn(2+) and Co(2+) but not by Ca(2+), Ni(2+), and Zn(2+). Activation of RUM630-BX by Mg(2+) (t0.5 144 s) is slowed two-fold by prior incubation with substrate, consistent with the X-ray structure of closely related xylosidase RS223-BX that shows the divalent-metal activator is at the back of the active-site pocket so that bound substrate could block its entrance. The enzyme is considerably more active on natural substrates than artificial substrates, with activity (kcat/Km) of 299 s(-1) mM(-1) on xylotetraose being the highest reported. PMID:26672463

  13. Real-time active MR-tracking of metallic stylets in MR-guided radiation therapy

    PubMed Central

    Wang, Wei; Dumoulin, Charles L.; Viswanathan, Akila N.; Tse, Zion T. H.; Mehrtash, Alireza; Loew, Wolfgang; Norton, Isaiah; Tokuda, Junichi; Seethamraju, Ravi T.; Kapur, Tina; Damato, Antonio L.; Cormack, Robert A.; Schmidt, Ehud J.

    2014-01-01

    Purpose To develop an active MR-tracking system to guide placement of metallic devices for radiation therapy. Methods An actively tracked metallic stylet for brachytherapy was constructed by adding printed-circuit micro-coils to a commercial stylet. The coil design was optimized by electromagnetic simulation, and has a radio-frequency lobe pattern extending ~5 mm beyond the strong B0 inhomogeneity region near the metal surface. An MR-tracking sequence with phase-field dithering was used to overcome residual effects of B0 and B1 inhomogeneities caused by the metal, as well as from inductive coupling to surrounding metallic stylets. The tracking system was integrated with a graphical workstation for real-time visualization. 3T MRI catheter-insertion procedures were tested in phantoms and ex-vivo animal tissue, and then performed in three patients during interstitial brachytherapy. Results The tracking system provided high-resolution (0.6 × 0.6 × 0.6 mm3) and rapid (16 to 40 frames per second, with three to one phase-field dithering directions) catheter localization in phantoms, animals, and three gynecologic cancer patients. Conclusion This is the first demonstration of active tracking of the shaft of metallic stylet in MR-guided brachytherapy. It holds the promise of assisting physicians to achieve better targeting and improving outcomes in interstitial brachytherapy. PMID:24903165

  14. Metal-VO2 hybrid grating structure for a terahertz active switchable linear polarizer

    NASA Astrophysics Data System (ADS)

    Shin, Jun-Hwan; Moon, Kiwon; Lee, Eui Su; Lee, Il-Min; Park, Kyung Hyun

    2015-08-01

    An active terahertz (THz) wave hybrid grating structure of Au/Ti metallic grating on VO2/Al2O3 (0001) was fabricated and evaluated. In our structure, it is shown that the metallic gratings on the VO2 layer strengthen the metallic characteristics to enhance the contrast of the metallic and dielectric phases of a VO2-based device. Especially, the metal grating-induced optical conductivity of the device is greatly enhanced, three times more than that of a metallic phase of bare VO2 films in the 0.1-2.0 THz spectral range. As an illustrative example, we fabricated an actively on/off switchable THz linear polarizer. The fabricated device has shown commercially comparable values in degree of polarization (DOP) and extinction ratio (ER). A high value of 0.89 in the modulation depth (MD) for the transmission field amplitude, superior to other THz wave modulators, is achieved. The experimental results show that the fabricated device can be highly useful in many applications, including active THz linear polarizers, THz wave modulators and variable THz attenuators.

  15. Effect of heavy metals ions on enzyme activity in the Mediterranean mussel, Donax trunculus

    SciTech Connect

    Mizrahi, L.; Achituv, Y. )

    1989-06-01

    Heavy metal ions strongly are bound by sulfhydryl groups of proteins. Sulfhydryl binding changes the structure and enzymatic activities of proteins and causes toxic effects evident at the whole organism level. Heavy metal ions like Cd, Cu, Hg, Zn, and Pb in sufficiently high concentrations might kill organisms or cause other adverse effects that changing aquatic community structures. Bivalves are known to be heavy metal accumulators. The aim of the present study was to examine the effects of different concentrations of each of five heavy metal ions on the activity of four enzymes in D. trunculus. As it is known that heavy metals inhibit the activity of a wide range of enzymes, the authors chose representative examples of dehydrogenases (lactate and malate dehydrogenases), respiratory enzyme (cytochrome oxidase) and digestive enzyme ({alpha}-amylase). The acute effects of different concentrations of selected metals were examined. These concentrations were higher than those found usually in the locality where the animals occur, but might be encountered during a given event of pollution.

  16. Metal-VO2 hybrid grating structure for a terahertz active switchable linear polarizer.

    PubMed

    Shin, Jun-Hwan; Moon, Kiwon; Lee, Eui Su; Lee, Il-Min; Park, Kyung Hyun

    2015-08-01

    An active terahertz (THz) wave hybrid grating structure of Au/Ti metallic grating on VO2/Al2O3 (0001) was fabricated and evaluated. In our structure, it is shown that the metallic gratings on the VO2 layer strengthen the metallic characteristics to enhance the contrast of the metallic and dielectric phases of a VO2-based device. Especially, the metal grating-induced optical conductivity of the device is greatly enhanced, three times more than that of a metallic phase of bare VO2 films in the 0.1-2.0 THz spectral range. As an illustrative example, we fabricated an actively on/off switchable THz linear polarizer. The fabricated device has shown commercially comparable values in degree of polarization (DOP) and extinction ratio (ER). A high value of 0.89 in the modulation depth (MD) for the transmission field amplitude, superior to other THz wave modulators, is achieved. The experimental results show that the fabricated device can be highly useful in many applications, including active THz linear polarizers, THz wave modulators and variable THz attenuators. PMID:26183858

  17. Necroptosis-Inducing Rhenium(V) Oxo Complexes

    PubMed Central

    Suntharalingam, Kogularamanan; Awuah, Samuel G.; Bruno, Peter M.; Johnstone, Timothy C.; Wang, Fang; Lin, Wei; Zheng, Yao-Rong; Page, Julia E.; Hemann, Michael T.; Lippard, Stephen J.

    2015-01-01

    Rhenium(V) oxo complexes of general formula [ReO(OMe)(N^N)Cl2], where N^N = 4,7-diphenyl-1,10-phenanthroline, 1, or 3,4,7,8-tetramethyl-1,10-phenanthroline, 2, effectively kill cancer cells by triggering necroptsosis, a non-apoptotic form of cell death. Both complexes evoke necrosome (RIP1-RIP3)-dependent intracellular ROS production and propidium iodide uptake. The complexes also induce mitochondrial membrane potential depletion, a possible downstream effect of ROS production. Apparently, 1 and 2 are the first rhenium complexes to evoke cellular events consistent with programmed necrosis in cancer cells. Furthermore, 1 and 2 display low acute toxicity in C57BL/6 mice and reasonable stability in fresh human blood. PMID:25698398

  18. X-ray Crystal Structure of Divalent Metal-Activated β-xylosidase, RS223BX.

    PubMed

    Jordan, Douglas B; Braker, Jay D; Wagschal, Kurt; Lee, Charles C; Chan, Victor J; Dubrovska, Ievgeniia; Anderson, Spencer; Wawrzak, Zdzislaw

    2015-10-01

    We report the X-ray crystal structure of a glycoside hydrolase family 43 β-xylosidase, RS223BX, which is strongly activated by the addition of divalent metal cations. The 2.69 Å structure reveals that the Ca(2+) cation is located at the back of the active-site pocket. The Ca(2+) is held in the active site by the carboxylate of D85, an "extra" acid residue in comparison to other GH43 active sites. The Ca(2+) is in close contact with a histidine imidazole, which in turn is in contact with the catalytic base (D15) thus providing a mechanism for stabilizing the carboxylate anion of the base and achieve metal activation. The active-site pocket is mirrored by an "inactive-site" pocket of unknown function that resides on the opposite side of the monomer. PMID:26201482

  19. Synthesis, spectroscopic characterization and X-ray structure of novel 7-methoxy-4-oxo-N-phenyl-4H-chromene-2-carboxamides

    NASA Astrophysics Data System (ADS)

    Reis, Joana; Gaspar, Alexandra; Borges, Fernanda; Rebelo Gomes, Ligia; Low, John Nicolson

    2014-01-01

    The chromone scaffold has been found to be an important tool in the drug discovery process through its relevant pharmacological activities. Chromone carboxamide derivatives synthesized within our group have shown noteworthy results as inhibitors of monoamino oxidase-B and as ligands for adesonine receptors. Specifically, chromone-2-carboxamide has been shown to be a privileged structure for the development of selective A3 adenosine receptor ligands. In this work two novel substituted 4-oxo-N-phenyl-4H-chromene-2-carboxamides have been synthesized and a complete structural characterization was performed using Fourier Transform Infrared Spectroscopy, one-dimensional and two-dimensional Nuclear Magnetic Resonance techniques and Mass Spectroscopy. Finally, the molecular and supramolecular structures were determined by X-ray analysis. The X-ray crystallographic analysis describes in detail the molecular conformation and supramolecular structure of a hemihydrate of 7-methoxy-4-oxo-N-phenyl-4H-chromene-2-carboxamide.

  20. Bioremediation of heavy metal-contaminated effluent using optimized activated sludge bacteria

    NASA Astrophysics Data System (ADS)

    Bestawy, Ebtesam El.; Helmy, Shacker; Hussien, Hany; Fahmy, Mohamed; Amer, Ranya

    2013-03-01

    Removal of heavy metals from contaminated domestic-industrial effluent using eight resistant indigenous bacteria isolated from acclimatized activated sludge was investigated. Molecular identification using 16S rDNA amplification revealed that all strains were Gram-negative among which two were resistant to each of copper, cadmium and cobalt while one was resistant to each of chromium and the heavy metal mixture. They were identified as Enterobacter sp. (Cu1), Enterobacter sp. (Cu2), Stenotrophomonas sp. (Cd1), Providencia sp. (Cd2), Chryseobacterium sp. (Co1), Comamonas sp. (Co2), Ochrobactrum sp. (Cr) and Delftia sp. (M1) according to their resistance pattern. Strains Cu1, Cd1, Co2 and Cr were able to resist 275 mg Cu/l, 320 mg Cd/l, 140 mg Co/l and 29 mg Cr/l respectively. The four resistant strains were used as a mixture to remove heavy metals (elevated concentrations) and reduce the organic load of wastewater effluent. Results revealed that using the proposed activated sludge with the resistant bacterial mixture was more efficient for heavy metal removal compared to the activated sludge alone. It is therefore recommended that the proposed activated sludge system augmented with the acclimatized strains is the best choice to ensure high treatment efficiency and performance under metal stresses especially when industrial effluents are involved.

  1. Metal Ion Activation of Clostridium sordellii Lethal Toxin and Clostridium difficile Toxin B

    PubMed Central

    Genth, Harald; Schelle, Ilona; Just, Ingo

    2016-01-01

    Lethal Toxin from Clostridium sordellii (TcsL) and Toxin B from Clostridium difficile (TcdB) belong to the family of the “Large clostridial glycosylating toxins.” These toxins mono-O-glucosylate low molecular weight GTPases of the Rho and Ras families by exploiting UDP-glucose as a hexose donor. TcsL is casually involved in the toxic shock syndrome and the gas gangrene. TcdB—together with Toxin A (TcdA)—is causative for the pseudomembranous colitis (PMC). Here, we present evidence for the in vitro metal ion activation of the glucosyltransferase and the UDP-glucose hydrolysis activity of TcsL and TcdB. The following rating is found for activation by divalent metal ions: Mn2+ > Co2+ > Mg2+ >> Ca2+, Cu2+, Zn2+. TcsL and TcdB thus require divalent metal ions providing an octahedral coordination sphere. The EC50 values for TcsL were estimated at about 28 µM for Mn2+ and 180 µM for Mg2+. TcsL and TcdB further require co-stimulation by monovalent K+ (not by Na+). Finally, prebound divalent metal ions were dispensible for the cytopathic effects of TcsL and TcdB, leading to the conclusion that TcsL and TcdB recruit intracellular metal ions for activation of the glucosyltransferase activity. With regard to the intracellular metal ion concentrations, TcsL and TcdB are most likely activated by K+ and Mg2+ (rather than Mn2+) in mammalian target cells. PMID:27089365

  2. Metal Ion Activation of Clostridium sordellii Lethal Toxin and Clostridium difficile Toxin B.

    PubMed

    Genth, Harald; Schelle, Ilona; Just, Ingo

    2016-01-01

    Lethal Toxin from Clostridium sordellii (TcsL) and Toxin B from Clostridium difficile (TcdB) belong to the family of the "Large clostridial glycosylating toxins." These toxins mono-O-glucosylate low molecular weight GTPases of the Rho and Ras families by exploiting UDP-glucose as a hexose donor. TcsL is casually involved in the toxic shock syndrome and the gas gangrene. TcdB-together with Toxin A (TcdA)-is causative for the pseudomembranous colitis (PMC). Here, we present evidence for the in vitro metal ion activation of the glucosyltransferase and the UDP-glucose hydrolysis activity of TcsL and TcdB. The following rating is found for activation by divalent metal ions: Mn(2+) > Co(2+) > Mg(2+) > Ca(2+), Cu(2+), Zn(2+). TcsL and TcdB thus require divalent metal ions providing an octahedral coordination sphere. The EC50 values for TcsL were estimated at about 28 µM for Mn(2+) and 180 µM for Mg(2+). TcsL and TcdB further require co-stimulation by monovalent K⁺ (not by Na⁺). Finally, prebound divalent metal ions were dispensible for the cytopathic effects of TcsL and TcdB, leading to the conclusion that TcsL and TcdB recruit intracellular metal ions for activation of the glucosyltransferase activity. With regard to the intracellular metal ion concentrations, TcsL and TcdB are most likely activated by K⁺ and Mg(2+) (rather than Mn(2+)) in mammalian target cells. PMID:27089365

  3. 'Unconventional' coordination chemistry by metal chelating fragments in a metalloprotein active site.

    PubMed

    Martin, David P; Blachly, Patrick G; Marts, Amy R; Woodruff, Tessa M; de Oliveira, César A F; McCammon, J Andrew; Tierney, David L; Cohen, Seth M

    2014-04-01

    The binding of three closely related chelators: 5-hydroxy-2-methyl-4H-pyran-4-thione (allothiomaltol, ATM), 3-hydroxy-2-methyl-4H-pyran-4-thione (thiomaltol, TM), and 3-hydroxy-4H-pyran-4-thione (thiopyromeconic acid, TPMA) to the active site of human carbonic anhydrase II (hCAII) has been investigated. Two of these ligands display a monodentate mode of coordination to the active site Zn(2+) ion in hCAII that is not recapitulated in model complexes of the enzyme active site. This unprecedented binding mode in the hCAII-thiomaltol complex has been characterized by both X-ray crystallography and X-ray spectroscopy. In addition, the steric restrictions of the active site force the ligands into a 'flattened' mode of coordination compared with inorganic model complexes. This change in geometry has been shown by density functional computations to significantly decrease the strength of the metal-ligand binding. Collectively, these data demonstrate that the mode of binding by small metal-binding groups can be significantly influenced by the protein active site. Diminishing the strength of the metal-ligand bond results in unconventional modes of metal coordination not found in typical coordination compounds or even carefully engineered active site models, and understanding these effects is critical to the rational design of inhibitors that target clinically relevant metalloproteins. PMID:24635441

  4. THE STATE OF MANGANESE IN THE PHOTOSYNTHETIC APPARATUS. I. EXAFS STUDIES ON CHLOROPLASTS AND di-u-oxo BRIDGED di-MANGANESE MODEL COMPOUNDS

    SciTech Connect

    Kirby, J. A.; Robertson, A. S.; Smith, J. P.; Thompson, A. C.; Thompson, A. C.; Klein, M. P.

    1980-11-01

    Extended X-ray Absorption Fine Structure (EXAFS) studies on the manganese contained in spinach chloroplasts and on certain di-u-oxo bridged manganese dimers of the form (X{sub 2}Mn)O{sub 2}(MnX{sub 2} (X=2,2'-bypyridine and 1,10-phenanthroline) are reported. From these studies, the manganese associated with photosynthetic oxygen evolution is suggested to occur as a bridged transition metal dimer with most likely another manganese. Extensive details on the analysis are included.

  5. Roles of Residues Arg-61 and Gln-38 of Human DNA Polymerase η in Bypass of Deoxyguanosine and 7,8-Dihydro-8-oxo-2'-deoxyguanosine.

    PubMed

    Su, Yan; Patra, Amritraj; Harp, Joel M; Egli, Martin; Guengerich, F Peter

    2015-06-26

    Like the other Y-family DNA polymerases, human DNA polymerase η (hpol η) has relatively low fidelity and is able to tolerate damage during DNA synthesis, including 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxoG), one of the most abundant DNA lesions in the genome. Crystal structures show that Arg-61 and Gln-38 are located near the active site and may play important roles in the fidelity and efficiency of hpol η. Site-directed mutagenesis was used to replace these side chains either alone or together, and the wild type or mutant proteins were purified and tested by replicating DNA past deoxyguanosine (G) or 8-oxoG. The catalytic activity of hpol η was dramatically disrupted by the R61M and Q38A/R61A mutations, as opposed to the R61A and Q38A single mutants. Crystal structures of hpol η mutant ternary complexes reveal that polarized water molecules can mimic and partially compensate for the missing side chains of Arg-61 and Gln-38 in the Q38A/R61A mutant. The combined data indicate that the positioning and positive charge of Arg-61 synergistically contribute to the nucleotidyl transfer reaction, with additional influence exerted by Gln-38. In addition, gel filtration chromatography separated multimeric and monomeric forms of wild type and mutant hpol η, indicating the possibility that hpol η forms multimers in vivo. PMID:25947374

  6. Chemical activation of molecules by metals: Experimental studies of electron distributions and bonding

    SciTech Connect

    Lichtenberger, D.L.

    1992-01-01

    Purpose of this research program is to obtain experimental information on the different fundamental ways metals bond and activate organic molecules. Our approach has been to directly probe the electronic interactions between metals and molecules through a wide variety of ionization spectroscopies and other techniques, and to investigate the relationships with bonding modes, structures, and chemical behavior. During this period, we have (1) characterized the electronic features of diphosphines and monophosphines in their coordination to metals, (2) carried out theoretical and experimental investigations of the bonding capabilities of C[sub 60] to transition metals, (3) developed techniques for the imaging of single molecules on gold substrates that emphasizes the electronic backbonding from the metal to the molecule, (4) obtained the high resolution photoelectron spectrum of pure C[sub 70] in the gas phase, (5) compared the bonding of [eta][sup 3]- acetylide ligands to the bonding of other small organic molecules with metals, and (6) reported the photoelectron spectra and bonding of [eta][sup 3]-cyclopropenyl groups to metals.

  7. Current Status of Trace Metal Pollution in Soils Affected by Industrial Activities

    PubMed Central

    Kabir, Ehsanul; Ray, Sharmila; Kim, Ki-Hyun; Yoon, Hye-On; Jeon, Eui-Chan; Kim, Yoon Shin; Cho, Yong-Sung; Yun, Seong-Taek; Brown, Richard J. C.

    2012-01-01

    There is a growing public concern over the potential accumulation of heavy metals in soil, owing to rapid industrial development. In an effort to describe the status of the pollutions of soil by industrial activities, relevant data sets reported by many studies were surveyed and reviewed. The results of our analysis indicate that soils were polluted most significantly by metals such as lead, zinc, copper, and cadmium. If the dominant species are evaluated by the highest mean concentration observed for different industry types, the results were grouped into Pb, Zn, Ni, Cu, Fe, and As in smelting and metal production industries, Mn and Cd in the textile industry, and Cr in the leather industry. In most cases, metal levels in the studied areas were found to exceed the common regulation guideline levels enforced by many countries. The geoaccumulation index (Igeo), calculated to estimate the enrichment of metal concentrations in soil, showed that the level of metal pollution in most surveyed areas is significant, especially for Pb and Cd. It is thus important to keep systematic and continuous monitoring of heavy metals and their derivatives to manage and suppress such pollution. PMID:22645468

  8. Delta ferrite in the weld metal of reduced activation ferritic martensitic steel

    NASA Astrophysics Data System (ADS)

    Sam, Shiju; Das, C. R.; Ramasubbu, V.; Albert, S. K.; Bhaduri, A. K.; Jayakumar, T.; Rajendra Kumar, E.

    2014-12-01

    Formation of delta(δ)-ferrite in the weld metal, during autogenous bead-on-plate welding of Reduced Activation Ferritic Martensitic (RAFM) steel using Gas Tungsten Arc Welding (GTAW) process, has been studied. Composition of the alloy is such that delta-ferrite is not expected in the alloy; but examination of the weld metal revealed presence of delta-ferrite in the weld metal. Volume fraction of delta-ferrite is found to be higher in the weld interface than in the rest of the fusion zone. Decrease in the volume fraction of delta-ferrite, with an increase in preheat temperature or with an increase in heat input, is observed. Results indicate that the cooling rate experienced during welding affects the volume fraction of delta-ferrite retained in the weld metal and variation in the delta-ferrite content with cooling rate is explained with variation in the time that the weld metal spends in various temperature regimes in which delta-ferrite is stable for the alloy during its cooling from the liquid metal to the ambient temperature. This manuscript will discuss the effect of welding parameters on formation of delta-ferrite and its retention in the weld metal of RAFM steel.

  9. A Bioluminescence Assay System for Imaging Metal Cationic Activities in Urban Aerosols.

    PubMed

    Kim, Sung-Bae; Naganawa, Ryuichi; Murata, Shingo; Nakayama, Takayoshi; Miller, Simon; Senda, Toshiya

    2016-01-01

    A bioluminescence-based assay system was fabricated for an efficient determination of the activities of air pollutants. The following four components were integrated into this assay system: (1) an 8-channel assay platform uniquely designed for simultaneously sensing multiple optical samples, (2) single-chain probes illuminating toxic chemicals or heavy metal cations from air pollutants, (3) a microfluidic system for circulating medium mimicking the human body, and (4) the software manimulating the above system. In the protocol, we briefly introduce how to integrate the components into the system and the application to the illumination of the metal cationic activities in air pollutants. PMID:27424913

  10. Activated phosphors having matrices of yttrium-transition metal compound

    DOEpatents

    De Kalb, E.L.; Fassel, V.A.

    1975-07-01

    A method is described for preparing a phosphor composition containing a lanthanide activator element with a host matrix having a transition element as a major component. The host matrix is composed of certain rare earth phosphates or vanadates such as YPO$sub 4$ with a portion of the rare earth replaced with one or more of the transition elements. On x-ray or other electromagnetic excitation, trace lanthanide impurities or additives within the phosphor are spectrometrically determined from their characteristic luminescence. (auth)

  11. Exposure to airborne metals and particulate matter and risk for youth adjudicated for criminal activity

    SciTech Connect

    Haynes, Erin N.; Chen, Aimin; Ryan, Patrick; Succop, Paul; Wright, John; Dietrich, Kim N.

    2011-11-15

    Antisocial behavior is a product of multiple interacting sociohereditary variables, yet there is increasing evidence that metal exposure, particularly, manganese and lead, play a role in its epigenesis. Other metals, such as arsenic, cadmium, chromium, and mercury, and exposure to traffic-related air pollution, such as fine particulate matter ({<=}2.5 {mu}m) have been associated with neurological deficits, yet largely unexplored with respect to their relationship with delinquent behavior. The purpose of this study is to evaluate the ecological relationship between county-wide reported airborne emissions of air metals, particulate matter, and youth adjudicated for criminal activity. Metal exposure data were collected from the Environmental Protection Agency AirData. Population statistics were obtained from the United States Census 2000 and adjudication data was obtained from the Courts of Common Pleases from each Ohio County. Simple correlations were calculated with the percentage of adjudications, all covariates, and estimated metal air emissions. Separate negative binomial regression models for each pollutant were used to provide an estimated risk ratio of pollutant emissions on the risk of adjudication for all Ohio counties adjusting for urban-rural residence, percentage of African Americans, median family income, percentage of family below poverty, percentage of high school graduation in 25 years and older populations, and population density. Metal emissions and PM in 1999 were all correlated with adjudication rate (2003-2005 average). Metal emissions were associated with slightly higher risk of adjudication, with about 3-4% increased risk per natural log unit of metal emission except chromium. The associations achieved statistical significance for manganese and mercury. The particulate matter {<=}2.5 and {<=}10 {mu}m emissions had a higher risk estimate, with 12% and 19% increase per natural log unit emission, respectively, and also achieved statistical

  12. Potential metal impurities in active pharmaceutical substances and finished medicinal products - A market surveillance study.

    PubMed

    Wollein, Uwe; Bauer, Bettina; Habernegg, Renate; Schramek, Nicholas

    2015-09-18

    A market surveillance study has been established by using different atomic spectrometric methods for the determination of selected elemental impurities of particular interest, to gain an overview about the quality of presently marketed drug products and their bulk drug substances. The limit tests were carried out with respect to the existing EMA guideline on the specification limits for residuals of metal catalysts or metal reagents. Also attention was given to the future implementation of two new chapters of the United States Pharmacopoeia (USP) stating limit concentrations of elemental impurities. The methods used for determination of metal residues were inductively coupled plasma-mass spectrometry (ICP-MS), inductively coupled plasma-optical emission spectrometry (ICP-OES), and atomic absorption spectrometry technologies (GFAAS, CVAAS, HGAAS). This article presents the development and validation of the methods used for the determination of 21 selected metals in 113 samples from drug products and their active pharmaceutical ingredients. PMID:26036232

  13. Metal doped carbon nanoneedles and effect of carbon organization with activity for hydrogen evolution reaction (HER).

    PubMed

    Araujo, Rafael A; Rubira, Adley F; Asefa, Tewodros; Silva, Rafael

    2016-02-10

    Cellulose nanowhiskers (CNW) from cotton, was prepared by acid hydrolysis and purified using a size selection process to obtain homogeneous samples with average particle size of 270 nm and 85.5% crystallinity. Purified CNW was used as precursor to carbon nanoneedles (CNN) synthesis. The synthesis of CNN loaded with different metals dopants were carried out by a nanoreactor method and the obtained CNNs applied as electrocatalysts for hydrogen evolution reaction (HER). In the carbon nanoneedles synthesis, Ni, Cu, or Fe worked as graphitization catalyst and the metal were found present as dopants in the final material. The used metal appeared to have direct influence on the degree of organization of the particles and also in the surface density of polar groups. It was evaluated the influence of the graphitic organization on the general properties and nickel was found as the more appropriate metal since it leads to a more organized material and also to a high activity toward HER. PMID:26686184

  14. Regioselective hypervalent iodine-induced Favorskii rearrangement of 3-oxo-5β-steroids.

    PubMed

    Viviano-Posadas, Alejandro O; Flores-Álamo, Marcos; Iglesias-Arteaga, Martín A

    2016-09-01

    Treatment of 3-oxo-5β-steroids with diacetoxyiodobenzene/KOH triggered a fast and regioselective Favorskii rearrangement that exclusively led to 3β-methoxycarbonyl-5β-4-norsteroids in good yields. The outcome of the reaction indicates that although both Cyclopropanone and Semi-benzylic pathways are possible, in the case of 3-oxo-5β-steroids, only the last participates. Unambiguous characterization of the products was achieved by NMR and X-ray Diffraction studies. PMID:27288301

  15. Antihuman Immunodeficiency Virus Type 1 (HIV-1) Activity of Rare Earth Metal Complexes of 4-Hydroxycoumarins in Cell Culture

    PubMed Central

    Manolov, Ilia; Raleva, Sevda; Genova, Petya; Savov, Alexey; Froloshka, Liliana; Dundarova, Daniela; Argirova, Radka

    2006-01-01

    The cerium Ce(III), lanthanum La(III), and neodymium Nd(III) complexes with 4-hydroxy-3-(3-oxo-1-phenylbutyl)-2H-1-benzopyran-2-one (warfarin) (W) and 3,3′-benzylidenebis[4-hydroxycoumarin] (1) were synthesized and studied for the first time for cytotoxicity (on MT-2 cells) and as anti-HIV agents under acute and chronic infection. The complexes were characterized by different physicochemical methods: mass spectrometry, 1H NMR, 13C NMR, and IR spectroscopy. The spectra of the complexes were interpreted on the basis of comparison with the spectrum of the free ligands. Anti-HIV effect of the complexes/ligands was measured in MT-2 cells by microtiter infection assay. Detection of endogenous reverse transcriptase (RT) activity and RT processivity by PCR indicative for proviral DNA synthesis demonstrated that anti-HIV activity has not been linked to early stages of viral replication. No effect on late steps of viral replication has been found using cells chronically producing HIV-1LAI virus. La(W) demonstrated anti-HIV activity (IC50=21.4 μM) close to maximal nontoxic concentration. Nd(W), Ce(1), and Nd(1) demonstrated limited anti-HIV potency, so none of the complexes seems appropriate to be used in clinic. Further targeting of HIV-1 inhibition by La(W) is under progress. PMID:17497016

  16. Metal-based biologically active azoles and β-lactams derived from sulfa drugs.

    PubMed

    Ebrahimi, Hossein Pasha; Hadi, Jabbar S; Almayah, Abdulelah A; Bolandnazar, Zeinab; Swadi, Ali G; Ebrahimi, Amirpasha

    2016-03-01

    Metal complexes of Schiff bases derived from sulfamethoxazole (SMZ) and sulfathiazole (STZ), converted to their β-lactam derivatives have been synthesized and experimentally characterized by elemental analysis, spectral (IR, (1)H NMR, (13)C NMR, and EI-mass), molar conductance measurements and thermal analysis techniques. The structural and electronic properties of the studied molecules were investigated theoretically by performing density functional theory (DFT) to access reliable results to the experimental values. The spectral and thermal analysis reveals that the Schiff bases act as bidentate ligands via the coordination of azomethine nitrogen to metal ions as well as the proton displacement from the phenolic group through the metal ions; therefore, Cu complexes can attain the square planner arrangement and Zn complexes have a distorted tetrahedral structure. The thermogravimetric (TG/DTG) analyses confirm high stability for all complexes followed by thermal decomposition in different steps. In addition, the antibacterial activities of synthesized compounds have been screened in vitro against various pathogenic bacterial species. Inspection of the results revealed that all newly synthesized complexes individually exhibit varying degrees of inhibitory effects on the growth of the tested bacterial species, therefore, they may be considered as drug candidates for bacterial pathogens. The free Schiff base ligands (1-2) exhibited a broad spectrum antibacterial activity against Gram negative Escherichia coli, Pseudomonas aeruginosa, and Proteus spp., and Gram positive Staphylococcus aureus bacterial strains. The results also indicated that the β-lactam derivatives (3-4) have high antibacterial activities on Gram positive bacteria as well as the metal complexes (5-8), particularly Zn complexes, have a significant activity against all Gram negative bacterial strains. It has been shown that the metal complexes have significantly higher activity than corresponding

  17. An approach to preparing porous and hollow metal phosphides with higher hydrodesulfurization activity

    SciTech Connect

    Song Limin; Zhang Shujuan; Wei Qingwu

    2011-06-15

    This paper describes an effective method for the synthesis of metal phosphides. Bulk and supported Ni{sub 2}P, Cu{sub 3}P, and CoP were prepared by thermal treatment of metal and the amorphous red phosphorus mixtures. Porous and hollow Ni{sub 2}P particles were also synthesized successfully using this method. The structural properties of these products are investigated using X-ray powder diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), inductively coupled plasma (ICP-AES) and X-ray photoemission spectroscopy (XPS). A rational mechanism was proposed for the selective formation of Ni{sub 2}P particles. In experimental conditions, the Ni{sub 2}P/SiO{sub 2} catalyst exhibits excellent hydrodesulfurization (HDS) activity for dibenzothiophene (DBT). - Graphical abstract: Bulk and supported Ni{sub 2}P, Cu{sub 3}P, and CoP were prepared by thermal treatment of their metal and amorphous red phosphorus mixtures. Porous and hollow Ni{sub 2}P particles were successfully synthesized by this method also. In the experimental condition, a Ni{sub 2}P/SiO{sub 2} catalyst exhibits excellent hydrodesulfurization activity for dibenzothiophene. Highlights: > A new synthetic route by heat treating mixtures of metal and red phosphorus in flowing N{sub 2} to prepare corresponding metal phosphides. > Porous and hollow Ni{sub 2}P particles may successfully be obtained using the route. > It is very easy to synthesize other bulk and supported metal phosphides using the mixing of bulk and supported metal and red phosphorus by the method. > The Ni{sub 2}P/SiO{sub 2} catalyst synthesized by the route shows a good HDS of dibenzothiophene. > Its operation is simple (only heat treating pure metal and red phosphorus), and the reaction time is short (only 0.5 h).

  18. Metal Complexes of Macrocyclic Schiff-Base Ligand: Preparation, Characterisation, and Biological Activity

    PubMed Central

    Ahmed, Riyadh M.; Yousif, Enaam I.; Hasan, Hasan A.; Al-Jeboori, Mohamad J.

    2013-01-01

    A new macrocyclic multidentate Schiff-base ligand Na4L consisting of two submacrocyclic units (10,21-bis-iminomethyl-3,6,14,17-tricyclo[17.3.1.18,12]tetracosa-1(23),2,6,8,10,12(24),13,17,19,21,-decaene-23,24-disodium) and its tetranuclear metal complexes with Mn(II), Co(II), Ni(II), Cu(II), and Zn(II) are reported. Na4L was prepared via a template approach, which is based on the condensation reaction of sodium 2,4,6-triformyl phenolate with ethylenediamine in mole ratios of 2 : 3. The tetranuclear macrocyclic-based complexes were prepared from the reaction of the corresponding metal chloride with the ligand. The mode of bonding and overall geometry of the compounds were determined through physicochemical and spectroscopic methods. These studies revealed tetrahedral geometries about Mn, Co, and Zn atoms. However, square planar geometries have been suggested for NiII and CuII complexes. Biological activity of the ligand and its metal complexes against Gram positive bacterial strain Staphylococcus aureus and Gram negative bacteria Escherichia coli revealed that the metal complexes become more potentially resistive to the microbial activities as compared to the free ligand. However, these metal complexes do not exhibit any effects on the activity of Pseudomonas aeruginosa bacteria. There is therefore no inhibition zone. PMID:23935414

  19. Secondary cell with orthorhombic alkali metal/manganese oxide phase active cathode material

    DOEpatents

    Doeff, M.M.; Peng, M.Y.; Ma, Y.; Visco, S.J.; DeJonghe, L.C.

    1996-09-24

    An alkali metal manganese oxide secondary cell is disclosed which can provide a high rate of discharge, good cycling capabilities, good stability of the cathode material, high specific energy (energy per unit of weight) and high energy density (energy per unit volume). The active material in the anode is an alkali metal and the active material in the cathode comprises an orthorhombic alkali metal manganese oxide which undergoes intercalation and deintercalation without a change in phase, resulting in a substantially linear change in voltage with change in the state of charge of the cell. The active material in the cathode is an orthorhombic structure having the formula M{sub x}Z{sub y}Mn{sub (1{minus}y)}O{sub 2}, where M is an alkali metal; Z is a metal capable of substituting for manganese in the orthorhombic structure such as iron, cobalt or titanium; x ranges from about 0.2 in the fully charged state to about 0.75 in the fully discharged state, and y ranges from 0 to 60 atomic %. Preferably, the cell is constructed with a solid electrolyte, but a liquid or gelatinous electrolyte may also be used in the cell. 11 figs.

  20. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  1. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    SciTech Connect

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.; Berkovitch, F.; Ringe, D.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with a binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.

  2. Secondary cell with orthorhombic alkali metal/manganese oxide phase active cathode material

    DOEpatents

    Doeff, Marca M.; Peng, Marcus Y.; Ma, Yanping; Visco, Steven J.; DeJonghe, Lutgard C.

    1996-01-01

    An alkali metal manganese oxide secondary cell is disclosed which can provide a high rate of discharge, good cycling capabilities, good stability of the cathode material, high specific energy (energy per unit of weight) and high energy density (energy per unit volume). The active material in the anode is an alkali metal and the active material in the cathode comprises an orthorhombic alkali metal manganese oxide which undergoes intercalation and deintercalation without a change in phase, resulting in a substantially linear change in voltage with change in the state of charge of the cell. The active material in the cathode is an orthorhombic structure having the formula M.sub.x Z.sub.y Mn.sub.(1-y) O.sub.2, where M is an alkali metal; Z is a metal capable of substituting for manganese in the orthorhombic structure such as iron, cobalt or titanium; x ranges from about 0.2 in the fully charged state to about 0.75 in the fully discharged state, and y ranges from 0 to 60 atomic %. Preferably, the cell is constructed with a solid electrolyte, but a liquid or gelatinous electrolyte may also be used in the cell.

  3. Stable isolated metal atoms as active sites for photocatalytic hydrogen evolution.

    PubMed

    Xing, Jun; Chen, Jian Fu; Li, Yu Hang; Yuan, Wen Tao; Zhou, Ying; Zheng, Li Rong; Wang, Hai Feng; Hu, P; Wang, Yun; Zhao, Hui Jun; Wang, Yong; Yang, Hua Gui

    2014-02-17

    The process of using solar energy to split water to produce hydrogen assisted by an inorganic semiconductor is crucial for solving our energy crisis and environmental problems in the future. However, most semiconductor photocatalysts would not exhibit excellent photocatalytic activity without loading suitable co-catalysts. Generally, the noble metals have been widely applied as co-catalysts, but always agglomerate during the loading process or photocatalytic reaction. Therefore, the utilization efficiency of the noble co-catalysts is still very low on a per metal atom basis if no obvious size effect exists, because heterogeneous catalytic reactions occur on the surface active atoms. Here, for the first time, we have synthesized isolated metal atoms (Pt, Pd, Rh, or Ru) stably by anchoring on TiO2 , a model photocatalystic system, by a facile one-step method. The isolated metal atom based photocatalysts show excellent stability for H2 evolution and can lead to a 6-13-fold increase in photocatalytic activity over the metal clusters loaded on TiO2 by the traditional method. Furthermore, the configurations of isolated atoms as well as the originality of their unusual stability were analyzed by a collaborative work from both experiments and theoretical calculations. PMID:24403011

  4. Innovative use of activated carbon for the removal of heavy metals from ground water sources

    SciTech Connect

    Lewis, T. III

    1996-12-31

    This report discusses the evaluation of the ENVIRO-CLEAN PROCESS, a technology developed by Lewis Environmental Services, Inc. for the recovery of metals such as chromium, mercury, copper, cadmium, lead, and zinc from surface and groundwater streams. This new heavy metal removal process (patent-pending) utilizes granular activated carbon with a proprietary conditioning pretreatment to enhance heavy metal adsorption combined with electrolytic metal recovery to produce a saleable metallic product. The process generates no sludge or hazardous waste and the effluent meets EPA limits. A 50 gpm system was installed for recovering hexavalent chromium from a ground water stream at a site located in Fresno, California. The effluent from the activated carbon system was reinjected into the ground water table with the hexavalent chromium concentration < 10 ppb. The system simultaneously removed trichloroethylene (TCE) to concentrations levels < 05 ppb. The activated carbon is regenerated off-site and the chromium electrolytically recovered. The full scale system has treated over 5 million gallons of ground water since installation. 5 refs., 1 fig., 3 tabs.

  5. Highly active oxygen reduction non-platinum group metal electrocatalyst without direct metal–nitrogen coordination

    PubMed Central

    Strickland, Kara; Miner, Elise; Jia, Qingying; Tylus, Urszula; Ramaswamy, Nagappan; Liang, Wentao; Sougrati, Moulay-Tahar; Jaouen, Frédéric; Mukerjee, Sanjeev

    2015-01-01

    Replacement of noble metals in catalysts for cathodic oxygen reduction reaction with transition metals mostly create active sites based on a composite of nitrogen-coordinated transition metal in close concert with non-nitrogen-coordinated carbon-embedded metal atom clusters. Here we report a non-platinum group metal electrocatalyst with an active site devoid of any direct nitrogen coordination to iron that outperforms the benchmark platinum-based catalyst in alkaline media and is comparable to its best contemporaries in acidic media. In situ X-ray absorption spectroscopy in conjunction with ex situ microscopy clearly shows nitrided carbon fibres with embedded iron particles that are not directly involved in the oxygen reduction pathway. Instead, the reaction occurs primarily on the carbon–nitrogen structure in the outer skin of the nitrided carbon fibres. Implications include the potential of creating greater active site density and the potential elimination of any Fenton-type process involving exposed iron ions culminating in peroxide initiated free-radical formation. PMID:26059552

  6. Measuring the Noble Metal and Iodine Composition of Extracted Noble Metal Phase from Spent Nuclear Fuel Using Instrumental Neutron Activation Analysis

    SciTech Connect

    Palomares, R. I.; Dayman, Kenneth J.; Landsberger, Sheldon; Biegalski, Steven R.; Soderquist, Chuck Z.; Casella, Amanda J.; Brady Raap, Michaele C.; Schwantes, Jon M.

    2015-04-01

    Mass quantities of noble metal and iodine nuclides in the metallic noble metal phase extracted from spent fuel are measured using instrumental neutron activation analysis (NAA). Nuclide presence is predicted using fission yield analysis, and mass quantification is derived from standard gamma spectroscopy and radionuclide decay analysis. The nuclide compositions of noble metal phase derived from two dissolution methods, UO2 fuel dissolved in nitric acid and UO2 fuel dissolved in ammonium-carbonate and hydrogen-peroxide solution, are compared. Lastly, the implications of the rapid analytic speed of instrumental NAA are discussed in relation to potential nuclear forensics applications.

  7. Synthesis and characterization of metallic nanoparticles impregnated onto activated carbon using leaf extract of Mukia maderasapatna: Evaluation of antimicrobial activities.

    PubMed

    Saravanan, A; Kumar, P Senthil; Karthiga Devi, G; Arumugam, T

    2016-08-01

    In the present research, in vitro antimicrobial activity of metallic nanoparticles impregnated on activated carbon (MNPI-AC) was investigated. Activated carbon (AC) was successfully prepared from Fishtail palm Caryota urens seeds by using two surface modification process (i) sulphuric acid treated Caryota urens seeds (SMCUS) (ii) ultrasonic assisted Caryota urens seeds (UACUS). Mukia maderasapatna plant extract was used as reducing agent for the synthesis of metallic nanoparticles. The characterization studies of MNPI - AC were performed by using a UV-visible spectrophotometer and Fourier Transform Infrared Spectroscopic (FT-IR) analyses. Different active functional groups were identified by FTIR studies which were responsible for impregnation of metallic nanoparticles on a surface of AC. The antimicrobial activity of MNPI - AC was examined against four bacterial strains: 2 g positive (Staphylococcus aureus and Staphylococcus epidermidis) and 2 g negative (Pseudomonas aeruginosa and Escherichia coli) and one fungal strain (Candida albicans). Among different MNPs, Pb-AC (UACUS) shows that higher zone of inhibition. These results in the literature showed that MNPI - AC are to be effective for deactivation and inactivation of microbes in an efficient manner. PMID:27317855

  8. Overview of EU activities on DEMO liquid metal breeder blanket

    SciTech Connect

    Giancarli, L.; Proust, E.

    1994-12-31

    The European test-blanket development programme, started in 1988, is aiming at the selection by 1995 of two DEMO-relevant blanket lines to be tested in ITER. At present, four lines of blanket are under development, two of them using solid and the other two liquid breeder materials. As far as liquid breeders are concerned, two lines of blankets have been selected within the European Union, the water-cooled lithium-lead (the eutectic Pb-17Li) blankets and the dual-coolant Pb-17Li blankets. Designs have been developed considering an agreed set of DEMO specifications, such as, for instance, a fusion power of 2,200 MW, a neutron wall-loading of 2MW/m{sup 2}, a life-time of 20,000 hours, and the use of martensitic steel as a structural material. Moreover, an experimental program has been set up in order to address the main critical issues for each line. The present paper gives an overview of both design and experimental activities within the European Union concerning these two lines of liquid breeder blankets.

  9. Discovery of an Allosteric Inhibitor Binding Site in 3-Oxo-acyl-ACP Reductase from Pseudomonas aeruginosa

    PubMed Central

    2013-01-01

    3-Oxo-acyl-acyl carrier protein (ACP) reductase (FabG) plays a key role in the bacterial fatty acid synthesis II system in pathogenic microorganisms, which has been recognized as a potential drug target. FabG catalyzes reduction of a 3-oxo-acyl-ACP intermediate during the elongation cycle of fatty acid biosynthesis. Here, we report gene deletion experiments that support the essentiality of this gene in P. aeruginosa and the identification of a number of small molecule FabG inhibitors with IC50 values in the nanomolar to low micromolar range and good physicochemical properties. Structural characterization of 16 FabG-inhibitor complexes by X-ray crystallography revealed that the compounds bind at a novel allosteric site located at the FabG subunit–subunit interface. Inhibitor binding relies primarily on hydrophobic interactions, but specific hydrogen bonds are also observed. Importantly, the binding cavity is formed upon complex formation and therefore would not be recognized by virtual screening approaches. The structure analysis further reveals that the inhibitors act by inducing conformational changes that propagate to the active site, resulting in a displacement of the catalytic triad and the inability to bind NADPH. PMID:24015914

  10. ROS-generating/ARE-activating capacity of metals in roadway particulate matter deposited in urban environment.

    PubMed

    Shuster-Meiseles, Timor; Shafer, Martin M; Heo, Jongbae; Pardo, Michal; Antkiewicz, Dagmara S; Schauer, James J; Rudich, Assaf; Rudich, Yinon

    2016-04-01

    In this study we investigated the possible causal role for soluble metal species extracted from roadway traffic emissions in promoting particulate matter (PM)-induced reactive oxygen species (ROS) production and antioxidant response element (ARE) promoter activation. To this end, these responses have been evaluated in alveolar macrophage and epithelial lung cells that have been exposed to 'Unfiltered', 'Filtered' and 'Filtered+Chelexed' water extracts of PM samples collected from the roadway urban environments of Thessaloniki, Milan and London. Except for Thessaloniki, our results demonstrate that filtration resulted in a minor decrease in ROS activity of the fine PM fraction, suggesting that ROS activity is attributed mainly to water-soluble PM species. In contrast to ROS, ARE activity was mediated predominantly by the water-soluble component of PM present in both the fine and coarse extracts. Further removal of metals by Chelex treatment from filtered water extracts showed that soluble metal species are the major factors mediating ROS and ARE activities of the soluble fraction, especially in the London PM extracts. Finally, utilizing step-wise multiple-regression analysis, we show that 87% and 78% of the total variance observed in ROS and ARE assays, respectively, is accounted for by changes in soluble metal concentration. Using a statistical analysis we find that As, Zn and Fe best predict the ROS-generating/ARE-activating capacity of the near roadway particulate matter in the pulmonary cells studied. Collectively, our findings imply that soluble metals present in roadside PM are potential drivers of both pro- and anti-oxidative effects of PM in respiratory tract. PMID:26775006

  11. Synthesis, structure and properties of (VIVO)2MII (M = Cu, Zn) trinuclear complexes derived from a new macrocyclic oxamido vanadium (IV)-oxo ligand

    NASA Astrophysics Data System (ADS)

    Hu, Hui; Yang, Fan; Zhang, Rui-Hong; Zhang, Yan-Hong; Liu, Da-Ying; Yang, Guang-Ming

    2013-03-01

    A novel macrocyclic oxamidato-bridged vanadium (IV)-oxo mononuclear ligand VOL (VOL = vanadium (IV)-oxo H2L = 2,3-dioxo-5,6:13,14-dibenzo-7,10,12-trimethyl-1,4,8,11-tetraazacyclo-tetradeca-7,12-diene) (1) has been synthesized by solvent-thermal in situ reaction and characterized by electron paramagnanetic resonance (EPR). Subsequently, using VOL as a precursor, its derivative trinuclear complexes [(VOL)2Cu(CH3OH)2](ClO4)2ṡ2CH3OH (2) and [(VOL)2Zn(CH3OH)2](ClO4)2ṡ2CH3OH (3) have been prepared and the crystal structures of the two complexes have been identified by the same method with 1. Thermal stabilities of compounds 1, 2 and 3 were studied and the results revealed that 1, 2 and 3 could be stable up to 205 °C, 234 °C and 250 °C, respectively. Moreover, the simulation of the EPR spectra of 1, 2 and 3 indicated the three oxo-vanadium samples were not oxidized and all of them remained in the active +4 oxidation state.

  12. Cytotoxic and apoptosis-inducing effect of ent-15-oxo-kaur-16-en-19-oic acid, a derivative of grandiflorolic acid from Espeletia schultzii.

    PubMed

    Ruiz, Yarimar; Rodrígues, Juan; Arvelo, Francisco; Usubillaga, Alfredo; Monsalve, Mariugenia; Diez, Nardy; Galindo-Castro, Iván

    2008-01-01

    ent-Kaurenic acid and many natural derivatives of this diterpene are known to have interesting biological properties. ent-15-Oxo-kaur-16-en-19-oic acid can be easily obtained from grandiflorolic acid which was first isolated from Espeletia grandiflora. The present work describes the proapoptotic effect of ent-15-oxo-kaur-16-en-19-oic acid on the human prostate carcinoma epithelial cell line PC-3 as evidenced by the changes in the expression level of proteins associated with the execution and regulation of apoptosis. Cell viability was affected upon exposure to the compound, the IC(50) were determined as 3.7 microg/ml, which is 4 times lower than that corresponding to a primary cell culture of fibroblasts (14.8 microg/mL). Through Western blot analysis, active forms of caspace-3 associated with the specific proteolysis of Poly(ADP-ribose) polymerase (PARP) were detected. Reduced levels of the antiapoptotic protein Bcl-2, as well as the appearance of internucleosomal DNA fragmentation, were also demonstrated. Thus, ent-15-oxo-kaur-16-en-19-oic acid may be a promising lead compound for new chemopreventive strategies, alone or in combination with traditional chemotherapy agents to overcome drug resistance in tumoral cells. PMID:17869315

  13. An amphoteric reactivity of a mixed-valent bis(μ-oxo)dimanganese(III,IV) complex acting as an electrophile and a nucleophile.

    PubMed

    Sankaralingam, Muniyandi; Jeon, So Hyun; Lee, Yong-Min; Seo, Mi Sook; Ohkubo, Kei; Fukuzumi, Shunichi; Nam, Wonwoo

    2016-01-01

    A mixed-valent bis(μ-oxo)dimanganese(III,IV) complex, [(dpaq)Mn(III)(O)2Mn(IV)(dpaq)](+) (1), was prepared by reacting a hydroxomanganese(III) complex, [(dpaq)Mn(III)(OH)](+), with hydrogen peroxide in the presence of triethylamine. The mixed-valent bis(μ-oxo)dimanganese(III,IV) complex (1) was well characterised by UV-vis, EPR and CSI-MS techniques. The electrophilic reactivity of 1 was investigated in the oxidation of 2,6-di-tert-butylphenol derivatives by 1, in which the relative rate afforded a good Hammett correlation with a ρ value of -1.0. The nucleophilic character of 1 was then investigated in aldehyde deformylation reactions, using 2-phenylpropionaldehyde (2-PPA) and benzaldehyde derivatives as substrates. In contrast to the case of the reaction of 1 with 2,6-di-tert-butylphenol derivatives, a positive ρ value of 0.89 was obtained in the Hammett plot, demonstrating that the bis(μ-oxo)-dimanganese(III,IV) complex is an active nucleophilic oxidant. Thus, 1 exhibited an amphoteric reactivity in both electrophilic and nucleophilic oxidative reactions. PMID:26620273

  14. Microbial diversity and activity are increased by compost amendment of metal-contaminated soil.

    PubMed

    Farrell, Mark; Griffith, Gareth W; Hobbs, Phil J; Perkins, William T; Jones, Davey L

    2010-01-01

    Unlike organic pollutants, heavy metals cannot be degraded and can constitute a persistent environmental hazard. Here, we investigated the success of different remediation strategies in promoting microbial diversity and function with depth in an acidic soil heavily contaminated with Cu, Pb and Zn. Remediation involved the incorporation of either a high- or a low-quality compost or inorganic fertilizer into the topsoil and monitoring of microbial activity and diversity with soil depth over a 4-month period. While changes in topsoil microbial activity were expected, the possible effects on the subsurface microbial community due to the downward movement of metals, nutrients and/or soluble organic matter have not been examined previously. The results showed that both compost additions, especially the low-quality compost, resulted in significantly increased bacterial and fungal diversity (as assessed by terminal restriction fragment length polymorphism) and activity compared with the inorganic and control treatments in the topsoil. Although phospholipid fatty acid profiling indicated that compost addition had promoted enhanced microbial diversity in the subsoil, no concomitant increase in subsoil microbial activity was observed, suggesting that amelioration of the heavy metals remained localized in the topsoil. We conclude that although composts can successfully immobilize heavy metals and promote ecosystem diversity/function, surface incorporation had little remedial effect below the surface layer over the course of our short-term trial. PMID:19845764

  15. The calculation of surface orbital energies for specific types of active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.; Cole, F.

    1992-11-01

    An angular overlap calculation has been used to determine the s, p, and d orbital energy levels of the different types of surface sites present on dispersed metal catalysts. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  16. The calculation of surface orbital energies for specific types of active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.; Cole, F.

    1992-01-01

    An angular overlap calculation has been used to determine the s, p, and d orbital energy levels of the different types of surface sites present on dispersed metal catalysts. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  17. Metal and carbene organocatalytic relay activation of alkynes for stereoselective reactions.

    PubMed

    Namitharan, Kayambu; Zhu, Tingshun; Cheng, Jiajia; Zheng, Pengcheng; Li, Xiangyang; Yang, Song; Song, Bao-An; Chi, Yonggui Robin

    2014-01-01

    Transition metal and organic catalysts have established their own domains of excellence. It has been expected that merging the two unique domains should provide complimentary or unprecedented opportunities in converting simple raw materials to functional products. N-heterocyclic carbenes alone are excellent organocatalysts. When used with transition metals such as copper, N-heterocyclic carbenes are routinely practiced as strong-coordinating ligands. Combination of an N-heterocyclic carbene and copper therefore typically leads to deactivation of either or both of the two catalysts. Here we disclose the direct merge of copper as a metal catalyst and N-heterocyclic carbenes as an organocatalyst for relay activation of alkynes. The reaction involves copper-catalysed activation of alkynes to generate ketenimine intermediates that are subsequently activated by an N-heterocyclic carbene organocatalyst for stereoselective reactions. Each of the two catalysts (copper metal catalyst and N-heterocyclic carbene organocatalyst) accomplishes its own missions in the activation steps without quenching each other. PMID:24865392

  18. Sorption of metal ions from multicomponent aqueous solutions by activated carbons produced from waste

    SciTech Connect

    Tikhonova, L.P.; Goba, V.E.; Kovtun, M.F.; Tarasenko, Y.A.; Khavryuchenko, V.D.; Lyubchik, S.B.; Boiko, A.N.

    2008-08-15

    Activated carbons produced by thermal treatment of a mixture of sunflower husks, low-grade coal, and refinery waste were studied as adsorbents of transition ion metals from aqueous solutions of various compositions. The optimal conditions and the mechanism of sorption, as well as the structure of the sorbents, were studied.

  19. Metal-containing Complexes of Lactams, Imidazoles, and Benzimidazoles and Their Biological Activity

    NASA Astrophysics Data System (ADS)

    Kukalenko, S. S.; Bovykin, B. A.; Shestakova, S. I.; Omel'chenko, A. M.

    1985-07-01

    The results of the latest investigations of the problem of the synthesis of metal-containing complexes of lactams, imidazoles, and benzimidazoles, their structure, and their stability in solutions are surveyed. Some data on their biological activity (pesticide and pharmacological) and the mechanism of their physiological action are presented. The bibliography includes 190 references.

  20. The Desulfuromonas acetoxidans Triheme Cytochrome c7 Produced in Desulfovibrio desulfuricans Retains Its Metal Reductase Activity

    PubMed Central

    Aubert, Corinne; Lojou, Elisabeth; Bianco, Pierre; Rousset, Marc; Durand, Marie-Claire; Bruschi, Mireille; Dolla, Alain

    1998-01-01

    Multiheme cytochrome c proteins that belong to class III have been recently shown to exhibit a metal reductase activity, which could be of great environmental interest, especially in metal bioremediation. To get a better understanding of these activities, the gene encoding cytochrome c7 from the sulfur-reducing bacterium Desulfuromonas acetoxidans was cloned from genomic DNA by PCR and expressed in Desulfovibrio desulfuricans G201. The expression system was based on the cyc transcription unit from Desulfovibrio vulgaris Hildenborough and led to the synthesis of holocytochrome c7 when transferred by electrotransformation into the sulfate reducer Desulfovibrio desulfuricans G201. The produced cytochrome was indistinguishable from the protein purified from Desulfuromonas acetoxidans cells with respect to several biochemical and biophysical criteria and exhibited the same metal reductase activities as determined from electrochemical experiments. This suggests that the molecule was correctly folded in the host organism. Desulfovibrio desulfuricans produces functional multiheme c-type cytochromes from bacteria belonging to a different genus and may be considered a suitable host for the heterologous biogenesis of multiheme c-type cytochromes for either structural or engineering studies. This report, which presents the first example of the transformation of a Desulfovibrio desulfuricans strain by electrotransformation, describes work that is the first necessary step of a protein engineering program that aims to specify the structural features that are responsible for the metal reductase activities of multiheme cytochrome c7. PMID:9546165

  1. Field-induced activation of metal oxide semiconductor for low temperature flexible transparent electronic device applications

    NASA Astrophysics Data System (ADS)

    Pudasaini, Pushpa Raj; Noh, Joo Hyon; Wong, Anthony; Haglund, Amada; Ward, Thomas Zac; Mandrus, David; Rack, Philip

    Amorphous metal-oxide semiconductors have been extensively studied as an active channel material in thin film transistors due to their high carrier mobility, and excellent large-area uniformity. Here, we report the athermal activation of amorphous indium gallium zinc oxide semiconductor channels by an electric field-induced oxygen migration via gating through an ionic liquid. Using field-induced activation, a transparent flexible thin film transistor is demonstrated on a polyamide substrate with transistor characteristics having a current ON-OFF ratio exceeding 108, and saturation field effect mobility of 8.32 cm2/(V.s) without a post-deposition thermal treatment. This study demonstrates the potential of field-induced activation as an athermal alternative to traditional post-deposition thermal annealing for metal oxide electronic devices suitable for transparent and flexible polymer substrates. Materials Science and Technology Division, ORBL, Oak Ridge, TN 37831, USA.

  2. Activation of the binuclear metal center through formation of phosphotriesterase-inhibitor complexes.

    PubMed

    Samples, Cynthia R; Raushel, Frank M; DeRose, Victoria J

    2007-03-20

    Phosphotriesterase (PTE) from Pseudomonas diminuta is a binuclear metalloenzyme that catalyzes the hydrolysis of organophosphate nerve agents at rates approaching the diffusion-controlled limit. The proposed catalytic mechanism postulates the interaction of the substrate with the metal center and subsequent nucleophilic attack by the bridging hydroxide. X-band EPR spectroscopy was utilized to monitor the active site of Mn/Mn-substituted PTE upon addition of two inhibitors, diisopropyl methyl phosphonate and triethyl phosphate, and the product of hydrolysis, diethyl phosphate. The effects of inhibitor and product binding on the magnetic properties of the metal center and the hydroxyl bridge were evaluated by measuring changes in the features of the EPR spectra. The EPR spectra support the proposal that the binding of substrate analogues to the binuclear metal center diminishes the population of hydroxide-bridged species. These results, in conjunction with previously published kinetic and crystallographic data, suggest that substrate binding via the phosphoryl oxygen at the beta-metal weakens the coordination of the hydroxide bridge to the beta-metal. The weakened coordination to the beta-metal ion increases the nucleophilic character of the hydroxide and is coupled to the increase in the electrophilic character of the substrate. PMID:17315951

  3. hSSB1 (NABP2/ OBFC2B) is required for the repair of 8-oxo-guanine by the hOGG1-mediated base excision repair pathway

    PubMed Central

    Paquet, Nicolas; Adams, Mark N.; Leong, Vincent; Ashton, Nicholas W.; Touma, Christine; Gamsjaeger, Roland; Cubeddu, Liza; Beard, Sam; Burgess, Joshua T.; Bolderson, Emma; O'Byrne, Ken J.; Richard, Derek J.

    2015-01-01

    The maintenance of genome stability is essential to prevent loss of genetic information and the development of diseases such as cancer. One of the most common forms of damage to the genetic code is the oxidation of DNA by reactive oxygen species (ROS), of which 8-oxo-7,8-dihydro-guanine (8-oxoG) is the most frequent modification. Previous studies have established that human single-stranded DNA-binding protein 1 (hSSB1) is essential for the repair of double-stranded DNA breaks by the process of homologous recombination. Here we show that hSSB1 is also required following oxidative damage. Cells lacking hSSB1 are sensitive to oxidizing agents, have deficient ATM and p53 activation and cannot effectively repair 8-oxoGs. Furthermore, we demonstrate that hSSB1 forms a complex with the human oxo-guanine glycosylase 1 (hOGG1) and is important for hOGG1 localization to the damaged chromatin. In vitro, hSSB1 binds directly to DNA containing 8-oxoguanines and enhances hOGG1 activity. These results underpin the crucial role hSSB1 plays as a guardian of the genome. PMID:26261212

  4. A comparative DFT study of the catalytic activity of the 3d transition metal sulphides surfaces

    SciTech Connect

    Gomez-Balderas, R.; Oviedo-Roa, R; Martinez-Magadan, J M.; Amador, C.; Dixon, David A. )

    2002-10-10

    The catalytic activity of the first transition metal series sulphides for hydrodesulfurization (HDS) reactions exhibits a particular behaviour when analysed as a function of the metal position in the Periodic Table. This work reports a comparative study of the electronic structure of the bulk and of the (0 0 1) metal surface (assumed to be the reactive surface) for the Sc-Zn monosulphides. The systems were modeled using the NiAs prototype crystal structure for the bulk and by applying the supercell model with seven atomic layers for (0 0 1) surfaces. The electronic structure of closed-packed solids code based on the density-functional theory and adopting the muffin-tin approximation to the potential was employed in the calculations of the electronic properties. For the Co and Ni sulphides, the density of states (DOS) variations between the metal atom present in the bulk and the ones exposed at the surface show that at the surface, there exists a higher DOS in the occupied states region just below the Fermi level. This feature might indicate a good performance of these two metal sulphides substrates in the HDS reactions favouring a donation, back-donation mechanism. In contrast, the DOS at the surface of Mn is increased in the unoccupied states region, just above the Fermi level. This suggests the possibility of a strong interaction with charge dontating sulphur adsorbate atoms poisoning the active substrate surface.

  5. Active-matrix organic light-emitting displays on flexible metal foils

    NASA Astrophysics Data System (ADS)

    Chuang, T. K.; Jamshidi Roudbari, A.; Troccoli, M. N.; Chang, Y. L.; Reed, G.; Hatalis, M.; Spirko, J.; Klier, K.; Preis, S.; Pearson, R.; Najafov, H.; Biaggio, I.; Afentakis, T.; Voutsas, A.; Forsythe, E.; Shi, J.; Blomquist, S.

    2005-05-01

    This paper describes the development of a 3.5 inch diagonal Active Matrix Organic Light Emitting Diode Display on flexible metal foils. The active matrix array had the VGA format and was fabricated using the polysilicon TFT technology. The advantages that the metal foil substrates offer for flexible display applications will first be discussed, followed by a discussion on the multilayer coatings that were investigated in order to achieve a high quality insulating layer on the metal foil substrate prior to TFT fabrication. Then the polysilicon TFT device performance will be presented as a function of the polysilicon crystallization method. Both laser crystallized polysilicon and solid phased crystallized polysilicon films were investigated for the TFT device fabrication. Due to the opaque nature of the metal foil substrates the display had a top emission structure. Both small molecule and polymer based organic material were investigated for the display emissive part. The former were evaporated while the latter were applied by spin-cast. Various transparent multi-layer metal films were investigated as the top cathode. The approach used to package the finished AMOLED display in order to protect the organic layers from environmental degradation will be described. The display had integrated polysilicon TFT scan drivers consisting of shift registers and buffers but external data drivers. The driving approach of the display will be discussed in detail. The performance of the finished display will be discussed as a function of the various materials and fabrication processes that were investigated.

  6. Active Adoption of Void Formation in Metal-Oxide for All Transparent Super-Performing Photodetectors

    PubMed Central

    Patel, Malkeshkumar; Kim, Hong-Sik; Park, Hyeong-Ho; Kim, Joondong

    2016-01-01

    Could ‘defect-considered’ void formation in metal-oxide be actively used? Is it possible to realize stable void formation in a metal-oxide layer, beyond unexpected observations, for functional utilization? Herein we demonstrate the effective tailoring of void formation of NiO for ultra-sensitive UV photodetection. NiO was formed onto pre-sputtered ZnO for a large size and spontaneously formed abrupt p-NiO/n-ZnO heterojunction device. To form voids at an interface, rapid thermal process was performed, resulting in highly visible light transparency (85–95%). This heterojunction provides extremely low saturation current (<0.1 nA) with an extraordinary rectifying ratio value of over 3000 and works well without any additional metal electrodes. Under UV illumination, we can observe the fast photoresponse time (10 ms) along with the highest possible responsivity (1.8 A W−1) and excellent detectivity (2 × 1013 Jones) due to the existence of an intrinsic-void layer at the interface. We consider this as the first report on metal-oxide-based void formation (Kirkendall effect) for effective photoelectric device applications. We propose that the active adoption of ‘defect-considered’ Kirkendall-voids will open up a new era for metal-oxide based photoelectric devices. PMID:27151288

  7. Abundance, composition and activity of denitrifier communities in metal polluted paddy soils

    PubMed Central

    Liu, Yuan; Liu, Yongzhuo; Zhou, Huimin; Li, Lianqing; Zheng, Jinwei; Zhang, Xuhui; Zheng, Jufeng; Pan, Genxing

    2016-01-01

    Denitrification is one of the most important soil microbial processes leading to the production of nitrous oxide (N2O). The potential changes with metal pollution in soil microbial community for N2O production and reduction are not well addressed. In this study, topsoil samples were collected both from polluted and non-polluted rice paddy fields and denitrifier communities were characterized with molecular fingerprinting procedures. All the retrieved nirK sequences could be grouped into neither α- nor β- proteobacteria, while most of the nosZ sequences were affiliated with α-proteobacteria. The abundances of the nirK and nosZ genes were reduced significantly in the two polluted soils. Thus, metal pollution markedly affected composition of both nirK and nosZ denitrifiers. While the total denitrifying activity and N2O production rate were both reduced under heavy metal pollution of the two sites, the N2O reduction rate showed no significant change. These findings suggest that N2O production activity could be sensitive to heavy metal pollution, which could potentially lead to a decrease in N2O emission in polluted paddies. Therefore, metal pollution could have potential impacts on soil N transformation and thus on N2O emission from paddy soils. PMID:26739424

  8. Abundance, composition and activity of denitrifier communities in metal polluted paddy soils

    NASA Astrophysics Data System (ADS)

    Liu, Yuan; Liu, Yongzhuo; Zhou, Huimin; Li, Lianqing; Zheng, Jinwei; Zhang, Xuhui; Zheng, Jufeng; Pan, Genxing

    2016-01-01

    Denitrification is one of the most important soil microbial processes leading to the production of nitrous oxide (N2O). The potential changes with metal pollution in soil microbial community for N2O production and reduction are not well addressed. In this study, topsoil samples were collected both from polluted and non-polluted rice paddy fields and denitrifier communities were characterized with molecular fingerprinting procedures. All the retrieved nirK sequences could be grouped into neither α- nor β- proteobacteria, while most of the nosZ sequences were affiliated with α-proteobacteria. The abundances of the nirK and nosZ genes were reduced significantly in the two polluted soils. Thus, metal pollution markedly affected composition of both nirK and nosZ denitrifiers. While the total denitrifying activity and N2O production rate were both reduced under heavy metal pollution of the two sites, the N2O reduction rate showed no significant change. These findings suggest that N2O production activity could be sensitive to heavy metal pollution, which could potentially lead to a decrease in N2O emission in polluted paddies. Therefore, metal pollution could have potential impacts on soil N transformation and thus on N2O emission from paddy soils.

  9. Mycorrhizal fungi modulate phytochemical production and antioxidant activity of Cichorium intybus L. (Asteraceae) under metal toxicity.

    PubMed

    Rozpądek, P; Wężowicz, K; Stojakowska, A; Malarz, J; Surówka, E; Sobczyk, Ł; Anielska, T; Ważny, R; Miszalski, Z; Turnau, K

    2014-10-01

    Cichorium intybus (common chicory), a perennial plant, common in anthropogenic sites, has been the object of a multitude of studies in recent years due to its high content of antioxidants utilized in pharmacy and food industry. Here, the role of arbuscular mycorrhizal fungi (AMF) in the biosynthesis of plant secondary metabolites and the activity of enzymatic antioxidants under toxic metal stress was studied. Plants inoculated with Rhizophagus irregularis and non-inoculated were grown on non-polluted and toxic metal enriched substrata. The results presented here indicate that AMF improves chicory fitness. Fresh and dry weight was found to be severely affected by the fungi and heavy metals. The concentration of hydroxycinnamates was increased in the shoots of mycorrhizal plants cultivated on non-polluted substrata, but no differences were found in plants cultivated on metal enriched substrata. The activity of SOD and H2O2 removing enzymes CAT and POX was elevated in the shoots of mycorrhizal plants regardless of the cultivation environment. Photochemical efficiency of inoculated chicory was significantly improved. Our results indicate that R. irregularis inoculation had a beneficial role in sustaining the plants ability to cope with the deleterious effects of metal toxicity. PMID:25048909

  10. Active Adoption of Void Formation in Metal-Oxide for All Transparent Super-Performing Photodetectors

    NASA Astrophysics Data System (ADS)

    Patel, Malkeshkumar; Kim, Hong-Sik; Park, Hyeong-Ho; Kim, Joondong

    2016-05-01

    Could ‘defect-considered’ void formation in metal-oxide be actively used? Is it possible to realize stable void formation in a metal-oxide layer, beyond unexpected observations, for functional utilization? Herein we demonstrate the effective tailoring of void formation of NiO for ultra-sensitive UV photodetection. NiO was formed onto pre-sputtered ZnO for a large size and spontaneously formed abrupt p-NiO/n-ZnO heterojunction device. To form voids at an interface, rapid thermal process was performed, resulting in highly visible light transparency (85–95%). This heterojunction provides extremely low saturation current (<0.1 nA) with an extraordinary rectifying ratio value of over 3000 and works well without any additional metal electrodes. Under UV illumination, we can observe the fast photoresponse time (10 ms) along with the highest possible responsivity (1.8 A W‑1) and excellent detectivity (2 × 1013 Jones) due to the existence of an intrinsic-void layer at the interface. We consider this as the first report on metal-oxide-based void formation (Kirkendall effect) for effective photoelectric device applications. We propose that the active adoption of ‘defect-considered’ Kirkendall-voids will open up a new era for metal-oxide based photoelectric devices.

  11. Active Adoption of Void Formation in Metal-Oxide for All Transparent Super-Performing Photodetectors.

    PubMed

    Patel, Malkeshkumar; Kim, Hong-Sik; Park, Hyeong-Ho; Kim, Joondong

    2016-01-01

    Could 'defect-considered' void formation in metal-oxide be actively used? Is it possible to realize stable void formation in a metal-oxide layer, beyond unexpected observations, for functional utilization? Herein we demonstrate the effective tailoring of void formation of NiO for ultra-sensitive UV photodetection. NiO was formed onto pre-sputtered ZnO for a large size and spontaneously formed abrupt p-NiO/n-ZnO heterojunction device. To form voids at an interface, rapid thermal process was performed, resulting in highly visible light transparency (85-95%). This heterojunction provides extremely low saturation current (<0.1 nA) with an extraordinary rectifying ratio value of over 3000 and works well without any additional metal electrodes. Under UV illumination, we can observe the fast photoresponse time (10 ms) along with the highest possible responsivity (1.8 A W(-1)) and excellent detectivity (2 × 10(13) Jones) due to the existence of an intrinsic-void layer at the interface. We consider this as the first report on metal-oxide-based void formation (Kirkendall effect) for effective photoelectric device applications. We propose that the active adoption of 'defect-considered' Kirkendall-voids will open up a new era for metal-oxide based photoelectric devices. PMID:27151288

  12. Similarities in the HIV-1 and ASV Integrease Active Site Upon Metal Binding

    SciTech Connect

    Lins, Roberto D.; Straatsma, TP; Briggs, J. M.

    2000-04-05

    The HIV-1 integrase, which is essential for viral replication, catalyzes the insertion of viral DNA into the host chromosome thereby recruiting host cell machinery into making viral proteins. It represents the third main HIV enzyme target for inhibitor design, the first two being the reverse transcriptase and the protease. We report here a fully hydrated 2 ns molecular dynamics simulation performed using parallel NWChem3.2.1 with the AMBER95 force field. The HIV-1 integrase catalytic domain previously determined by crystallography (1B9D) and modeling including two Mg2+ ions placed into the active site based on an alignment against an ASV integrase structure containing two divalent metals (1VSH), was used as the starting structure. The simulation reveals a high degree of flexibility in the region of residues 140-149 even in the presence of a second divalent metal ion and a dramatic conformational change of the side chain of E152 when the second metal ion is present. This study shows similarities in the behavior of the catalytic residues in the HIV-1 and ASV integrases upon metal binding. The present simulation also provides support to the hypothesis that the second metal ion is likely to be carried into the HIV-1 integrase active site by the substrate, a strand of DNA.

  13. Physicochemical characteristics and sorption capacities of heavy metal ions of activated carbons derived by activation with different alkyl phosphate triesters

    NASA Astrophysics Data System (ADS)

    Wang, Jing; Liu, Hai; Yang, Shaokun; Zhang, Jian; Zhang, Chenglu; Wu, Haiming

    2014-10-01

    Five alkyl phosphate triesters (APTEs), including trimethyl phosphate (TMP), triethyl phosphate (TEP), triisopropyl phosphate (TPP), tributyl phosphate (TBP) and trioctyl phosphate (TOP), were used as activating agents for preparing activated carbons (AC-APTEs) with high surface acidity and metal ion sorption capacity. N2 adsorption/desorption isotherms, surface morphologies, elemental compositions, results of Boehm's titration and sorption capacities of heavy metal ions of the carbons were investigated. AC-APTEs contained much more acidic groups and exhibited much less surface area (<500 m2/g) in comparison with activated carbon (AC-PPA, 1145 m2/g) obtained from phosphoric acid activation. For the AC-APTEs, AC-TOP had the highest surface area (488 m2/g), AC-TMP showed the highest yield (41.1%), and AC-TBP possessed the highest acidic groups (2.695 mmol/g), oxygen content (47.0%) and metal ion sorption capacities (40.1 mg/g for Ni(II) and 53.5 mg/g for Cd(II)). For the carbons, AC-APTEs showed much larger Ni(II) and Cd(II) sorption capacities than AC-PPA, except AC-TPP. The differences of the carbons in the physicochemical and sorption properties suggested surface chemistry of the carbons was the main factor influencing their sorption capacities whereas the pore structure played a secondary role.

  14. Passively cooled 405 W ytterbium fibre laser utilising a novel metal coated active fibre

    NASA Astrophysics Data System (ADS)

    Daniel, Jae M. O.; Simakov, Nikita; Hemming, Alexander; Clarkson, W. Andrew; Haub, John

    2016-03-01

    We present a novel metal coated triple clad active fibre design, utilising an all glass inner cladding structure and aluminium outer coating. This metal coated active fibre enables a number of benefits to high power laser design, such as increase robustness and extended operating temperature range. As a demonstration of the advantages of this design a passively cooled ytterbium fibre laser is presented. A 20 m length of active fibre was coiled into a planar arrangement and mounted onto a high emissivity heatsink. Up to 405 W of output power was achieved without the need for active water or forced air cooling. The slope efficiency of this source was 74 % and maximum outer heat sink temperature was ~140°C. This arrangement allowed for significant weight and size savings to be achieved with the active fibre laser head weighing less than 100 g. We will discuss the design choices and trade-offs of metal coated active fibre on high power fibre laser systems as well as the prospects for further power scaling to the kW level.

  15. Structural basis for the metal-selective activation of the manganese transport regulator of Bacillus subtilis.

    PubMed

    Kliegman, Joseph I; Griner, Sarah L; Helmann, John D; Brennan, Richard G; Glasfeld, Arthur

    2006-03-21

    The manganese transport regulator (MntR) of Bacillus subtilis is activated by Mn(2+) to repress transcription of genes encoding transporters involved in the uptake of manganese. MntR is also strongly activated by cadmium, both in vivo and in vitro, but it is poorly activated by other metal cations, including calcium and zinc. The previously published MntR.Mn(2+) structure revealed a binuclear complex of manganese ions with a metal-metal separation of 3.3 A (herein designated the AB conformer). Analysis of four additional crystal forms of MntR.Mn(2+) reveals that the AB conformer is only observed in monoclinic crystals at 100 K, suggesting that this conformation may be stabilized by crystal packing forces. In contrast, monoclinic crystals analyzed at room temperature (at either pH 6.5 or pH 8.5), and a second hexagonal crystal form (analyzed at 100 K), all reveal the shift of one manganese ion by 2.5 A, thereby leading to a newly identified conformation (the AC conformer) with an internuclear distance of 4.4 A. Significantly, the cadmium and calcium complexes of MntR also contain binuclear complexes with a 4.4 A internuclear separation. In contrast, the zinc complex of MntR contains only one metal ion per subunit, in the A site. Isothermal titration calorimetry confirms the stoichiometry of Mn(2+), Cd(2+), and Zn(2+) binding to MntR. We propose that the specificity of MntR activation is tied to productive binding of metal ions at two sites; the A site appears to act as a selectivity filter, determining whether the B or C site will be occupied and thereby fully activate MntR. PMID:16533030

  16. Structural and Mechanistic Studies on Klebsiella pneumoniae 2-Oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline Decarboxylase

    SciTech Connect

    French, Jarrod B.; Ealick, Steven E.

    2010-11-12

    The stereospecific oxidative degradation of uric acid to (S)-allantoin was recently shown to proceed via three enzymatic steps. The final conversion is a decarboxylation of the unstable intermediate 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU) and is catalyzed by OHCU decarboxylase. Here we present the structures of Klebsiella pneumoniae OHCU decarboxylase in unliganded form and with bound allantoin. These structures provide evidence that ligand binding organizes the active site residues for catalysis. Modeling of the substrate and intermediates provides additional support for this hypothesis. In addition we characterize the steady state kinetics of this enzyme and report the first OHCU decarboxylase inhibitor, allopurinol, a structural isomer of hypoxanthine. This molecule is a competitive inhibitor of K. pneumoniae OHCU decarboxylase with a K{sub i} of 30 {+-} 2 {micro}m. Circular dichroism measurements confirm structural observations that this inhibitor disrupts the necessary organization of the active site. Our structural and biochemical studies also provide further insights into the mechanism of catalysis of OHCU decarboxylation.

  17. Bivalent transition metal complexes of cetirizine: Spectroscopic, equilibrium studies and biological activity

    NASA Astrophysics Data System (ADS)

    El-Sherif, Ahmed A.; Shoukry, Mohamed M.; Abobakr, Lamis O.

    2013-08-01

    Metal complexes of cetirizineṡ2HCl (CTZ = 2-[2-[4-[(4-chlorophenyl)phenyl methyl]piperazine-1-yl]-ethoxy]acetic acid, dihydrochloride have been prepared and characterized by elemental analyses, IR, solid reflectance, magnetic moment, molar conductance, and UV-Vis spectra. The analytical data of the complexes show the formation of 1:2 [M:L] ratio, where M represents Ni(II), Co(II) and Cu(II) ions, while L represents the deprotonated CTZ ligand. IR spectra show that CTZ is coordinated to the metal ions in a monodentate manner through carboxylate-O atom. Protonation equilibria of CTZ and its metal complexation by some divalent metal ions were determined in aqueous solution at constant ionic strength (0.1 M NaCl) using an automatic potentiometric technique. Thermodynamic parameters for the protonation equilibria of CTZ were calculated and discussed. The stability order of M(II)-CTZ complexes were found to obey Mn2+ < Co2+ < Ni2+ < Cu2+, in accordance with the Irving-Williams order. The concentration distribution of the complexes in solution is evaluated as a function of pH. The CTZ ligand and its metal complexes were screened for their biological activity against bacterial species (Bacillus subtillis RCMB 010067, Staphylococcus aureus RCMB 010028, Pseudomonas aeuroginosa RCMB 010043, and Escherichia coli RCMB 010052) and fungi as (Aspergillus flavus RCMB 02568, Pencicillium italicum RCMB 03924, Candida albicans RCMB 05031 and Geotricum candidum RCMB 05097). The activity data show that the metal complexes have antibacterial and antifungal activity more than the parent CTZ ligand against one or more bacterial or fungi species. MIC was evaluated for the isolated complexes.

  18. Bivalent transition metal complexes of ONO donor hydrazone ligand: Synthesis, structural characterization and antimicrobial activity.

    PubMed

    Bhaskar, Ravindra; Salunkhe, Nilesh; Yaul, Amit; Aswar, Anand

    2015-12-01

    Mononuclear transition metal complexes of Mn(II), Co(II), Ni(II), Cu(II), Zn(II) and Cd(II) with a new hydrazone ligand derived from pyrazine-2-carbohydrazide and 2-hydroxyacetophenone have been synthesized. The isolated complexes were characterized by elemental analysis, spectral and analytical methods including elemental analyses, IR, diffuse reflectance, (1)H-NMR, mass spectra, molar conductance, magnetic moment, ESR, XRD, TG and SEM analysis. From the elemental analyses data, the stoichiometry of the complexes was found to be 1:1 (metal:ligand) having the general formulae [M(HL)(Cl)(H2O)2], [M=Mn(II), Co(II), Ni(II) and Cu(II)] and [M(L)(H2O)], [M=Zn(II) and Cd(II)]. The molar conductance values indicate the nonelectrolytic nature of metal complexes. The IR spectral data suggest that the ligand behaves as tridentate moiety with ONO donor atoms sequence towards central metal ion. The Mn(II), Co(II), Ni(II) and Cu(II) complexes have been assigned a monomeric octahedral geometry whereas tetrahedral to Zn(II) and Cd(II) complexes. The antibacterial and antifungal activities of the ligand and its metal complexes were studied against bacterial species Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, Bacillus subtilis, Enterococcus faecalis and Streptococcus pyogenes and fungi Candida albicans, Aspergillus niger and Aspergillus clavatus. The activity data show that the metal complexes have a promising biological activity comparable with the parent ligand against all bacterial and fungal species. PMID:26163785

  19. In situ-generated metal oxide catalyst during CO oxidation reaction transformed from redox-active metal-organic framework-supported palladium nanoparticles

    PubMed Central

    2012-01-01

    The preparation of redox-active metal-organic framework (ra-MOF)-supported Pd nanoparticles (NPs) via the redox couple-driven method is reported, which can yield unprotected metallic NPs at room temperature within 10 min without the use of reducing agents. The Pd@ra-MOF has been exploited as a precursor of an active catalyst for CO oxidation. Under the CO oxidation reaction condition, Pd@ra-MOF is transformed into a PdOx-NiOy/C nanocomposite to generate catalytically active species in situ, and the resultant nanocatalyst shows sustainable activity through synergistic stabilization. PMID:22898143

  20. Biological activity of ellagitannins: Effects as anti-oxidants, pro-oxidants and metal chelators.

    PubMed

    Moilanen, Johanna; Karonen, Maarit; Tähtinen, Petri; Jacquet, Rémi; Quideau, Stéphane; Salminen, Juha-Pekka

    2016-05-01

    Ellagitannins are a subclass of hydrolysable tannins that have been suggested to function as defensive compounds of plants against herbivores. However, it is known that the conditions in the digestive tracts of different herbivores are variable, so it seems reasonable to anticipate that the reactivities and modes of actions of these ingested defensive compounds would also be different. A previous study on a few ellagitannins has shown that these polyphenolic compounds are highly oxidizable at high pH and that their bioactivity can be attributed to certain structural features. Herein, the activities of 13 ellagitannins using the deoxyribose assay were measured. The results provided information about the anti-oxidant, pro-oxidant and metal chelating properties of ellagitannins. Surprisingly, many of the tested ellagitannins exhibited pro-oxidant activities even at neutral pH and only moderate to low radical scavenging activities, although the metal chelating capacities of all tested ellagitannins were relatively high. PMID:26899362

  1. Impacts of human activity modes and climate on heavy metal "spread" in groundwater are biased.

    PubMed

    Chen, Ming; Qin, Xiaosheng; Zeng, Guangming; Li, Jian

    2016-06-01

    Groundwater quality deterioration has attracted world-wide concerns due to its importance for human water supply. Although more and more studies have shown that human activities and climate are changing the groundwater status, an investigation on how different groundwater heavy metals respond to human activity modes (e.g. mining, waste disposal, agriculture, sewage effluent and complex activity) in a varying climate has been lacking. Here, for each of six heavy metals (i.e. Fe, Zn, Mn, Pb, Cd and Cu) in groundwater, we use >330 data points together with mixed-effect models to indicate that (i) human activity modes significantly influence the Cu and Mn but not Zn, Fe, Pb and Cd levels, and (ii) annual mean temperature (AMT) only significantly influences Cu and Pb levels, while annual precipitation (AP) only significantly affects Fe, Cu and Mn levels. Given these differences, we suggest that the impacts of human activity modes and climate on heavy metal "spread" in groundwater are biased. PMID:27003366

  2. Active and Durable Hydrogen Evolution Reaction Catalyst Derived from Pd-Doped Metal-Organic Frameworks.

    PubMed

    Chen, Jitang; Xia, Guoliang; Jiang, Peng; Yang, Yang; Li, Ren; Shi, Ruohong; Su, Jianwei; Chen, Qianwang

    2016-06-01

    The water electrolysis is of critical importance for sustainable hydrogen production. In this work, a highly efficient and stable PdCo alloy catalyst (PdCo@CN) was synthesized by direct annealing of Pd-doped metal-organic frameworks (MOFs) under N2 atmosphere. In 0.5 M H2SO4 solution, PdCo@CN displays remarkable electrocatalytic performance with overpotential of 80 mV, a Tafel slope of 31 mV dec(-1), and excellent stability of 10 000 cycles. Our studies reveal that noble metal doped MOFs are ideal precursors for preparing highly active alloy electrocatalysts with low content of noble metal. PMID:27112733

  3. Artificial sweeteners and salts producing a metallic taste sensation activate TRPV1 receptors.

    PubMed

    Riera, Céline E; Vogel, Horst; Simon, Sidney A; le Coutre, Johannes

    2007-08-01

    Throughout the world many people use artificial sweeteners (AS) for the purpose of reducing caloric intake. The most prominently used of these molecules include saccharin, aspartame (Nutrasweet), acesulfame-K, and cyclamate. Despite the caloric advantage they provide, one key concern in their use is their aversive aftertaste that has been characterized on a sensory level as bitter and/or metallic. Recently, it has been shown that the activation of particular T2R bitter taste receptors is partially involved with the bitter aftertaste sensation of saccharin and acesulfame-K. To more fully understand the biology behind these phenomena we have addressed the question of whether AS could stimulate transient receptor potential vanilloid-1 (TRPV1) receptors, as these receptors are activated by a large range of structurally different chemicals. Moreover, TRPV1 receptors and/or their variants are found in taste receptor cells and in nerve terminals throughout the oral cavity. Hence, TRPV1 activation could be involved in the AS aftertaste or even contribute to the poorly understood metallic taste sensation. Using Ca(2+) imaging on TRPV1 receptors heterologously expressed in the human embryonic kidney (HEK) 293 cells and on dissociated primary sensory neurons, we find that in both systems, AS activate TRPV1 receptors, and, moreover, they sensitize these channels to acid and heat. We also found that TRPV1 receptors are activated by CuSO(4), ZnSO(4), and FeSO(4), three salts known to produce a metallic taste sensation. In summary, our results identify a novel group of compounds that activate TRPV1 and, consequently, provide a molecular mechanism that may account for off tastes of sweeteners and metallic tasting salts. PMID:17567713

  4. Synthesis, Fluorescence Properties, and Antiproliferative Potential of Several 3-Oxo-3H-benzo[f]chromene-2-carboxylic Acid Derivatives.

    PubMed

    Fu, Xiao-Bo; Wang, Xian-Fu; Chen, Jia-Nian; Wu, De-Wen; Li, Ting; Shen, Xing-Can; Qin, Jiang-Ke

    2015-01-01

    In this study, two series of 3-oxo-3H-benzo[f]chromene-2-carboxylic acid derivatives (compounds 5a-i and 6a-g) were synthesized. Their in vitro proliferation inhibitory activities against the A549 and NCI-H460 human non-small cell lung cancer (NSCLC) cell lines were evaluated. Their photophysical properties were measured. Among these target compounds, 5e exhibited the strongest antiproliferative activity by inducing apoptosis, arresting cell cycle, and elevating intracellular reactive oxygen species (ROS) level, suggesting that it may be a potent antitumor agent. In addition, compound 6g with very low cytotoxicity, demonstrated excellent fluorescence properties, which could be used as an effective fluorescence probe for biological imaging. PMID:26473819

  5. Identification of substituted 2-thio-6-oxo-1,6-dihydropyrimidines as inhibitors of human lactate dehydrogenase.

    PubMed

    Dragovich, Peter S; Fauber, Benjamin P; Corson, Laura B; Ding, Charles Z; Eigenbrot, Charles; Ge, HongXiu; Giannetti, Anthony M; Hunsaker, Thomas; Labadie, Sharada; Liu, Yichin; Malek, Shiva; Pan, Borlan; Peterson, David; Pitts, Keith; Purkey, Hans E; Sideris, Steve; Ultsch, Mark; VanderPorten, Erica; Wei, BinQing; Xu, Qing; Yen, Ivana; Yue, Qin; Zhang, Huihui; Zhang, Xuying

    2013-06-01

    A novel 2-thio-6-oxo-1,6-dihydropyrimidine-containing inhibitor of human lactate dehydrogenase (LDH) was identified by high-throughput screening (IC50=8.1 μM). Biochemical, surface plasmon resonance, and saturation transfer difference NMR experiments indicated that the compound specifically associated with human LDHA in a manner that required simultaneous binding of the NADH co-factor. Structural variation of the screening hit resulted in significant improvements in LDHA biochemical inhibition activity (best IC50=0.48 μM). A crystal structure of an optimized compound bound to human LDHA was obtained and explained many of the observed structure-activity relationships. PMID:23628333

  6. Design, synthesis and biological evaluation of c-Met kinase inhibitors bearing 2-oxo-1,2-dihydroquinoline scaffold.

    PubMed

    Cui, Hong; Peng, Xia; Liu, Jian; Ma, Chunhua; Ji, Yinchun; Zhang, Wei; Geng, Meiyu; Li, Yingxia

    2016-09-15

    A series of 2-oxo-1,2-dihydroquinoline-containing c-Met inhibitors were designed, synthesized and evaluated for their in vitro activities targeting c-Met. Most compounds showed high potency against c-Met with IC50 values in the single-digit nM range. Among these compounds, two target compounds, namely 1h and 1n, stood out as the most potent c-Met inhibitors with IC50s of 0.6 and 0.7nM, respectively. And 1a exhibited higher potency than BMS-777607 did with respect to the inhibition of cell proliferation. The introduction of electron-donating substituent was favorable for the activities of the compounds to some extent. Furthermore, molecular docking studies also gave encouraging results that supported this work. PMID:27524312

  7. Effect of the chelation of metal cation on the antioxidant activity of chondroitin sulfates.

    PubMed

    Ajisaka, Katsumi; Oyanagi, Yutaka; Miyazaki, Tatsuo; Suzuki, Yasuhiro

    2016-06-01

    The antioxidant potencies of chondroitin sulfates (CSs) from shark cartilage, salmon cartilage, bovine trachea, and porcine intestinal mucosa were compared by three representative methods for the measurement of the antioxidant activity; DPPH radical scavenging activity, superoxide radical scavenging activity, and hydroxyl radical scavenging activity. CSs from salmon cartilage and bovine trachea showed higher potency in comparison with CSs from shark cartilage and porcine intestinal mucosa. Next, CS from salmon cartilage chelating with Ca(2+), Mg(2+), Mn(2+), or Zn(2+) were prepared, and their antioxidant potencies were compared. CS chelating with Ca(2+) or Mg(2+) ions showed rather decreased DPPH radical scavenging activity in comparison with CS of H(+) form. In contrast, CS chelating with Ca(2+) or Mg(2+) ion showed remarkably enhanced superoxide radical scavenging activity than CS of H(+) or Na(+) form. Moreover, CS chelating with divalent metal ions, Ca(2+), Mg(2+), Mn(2+), or Zn(2+), showed noticeably higher hydroxyl radical scavenging activity than CS of H(+) or Na(+) form. The present results revealed that the scavenging activities of, at least, superoxide radical and hydroxyl radical were enhanced by the chelation with divalent metal ions. PMID:26856546

  8. Gill ATPase activity in Procambarus clarkii as an indicator of heavy metal pollution

    SciTech Connect

    Torreblanca, A.; Del Ramo, J.; Diaz-Mayans, J. )

    1989-06-01

    Lake Albufera and the surrounding rice field waters are subjected to very heavy loads of sewage and toxic industrial residues, including heavy metals, from the many urban and waste waters of this area. The American red crayfish, Procambarus clarkii have a high resistance to toxic effects of heavy metals. The sublethal effects of heavy metals on gills of fish and aquatic invertebrates have been extensively studied. Some metabolic disturbances and histologic damages have been reported, as well as osmoregulation alterations. However, little work has been done about the effect of heavy metals on Na,K and Mg-ATPases of freshwater invertebrate gills. Na,K-ATPase is the prime mediator of ion transport across cellular membranes and plays a central role in whole body ion regulation in marine and estuarine animals. Na,K-ATPase has been reviewed and assessed as a potentially useful indicator of pollution stress in aquatic animals. The purpose of this study is look for the relation, if any, between crayfish gill ATP-ase activity changes and metal exposure in laboratory. This find would allow the authors to assay this potential indicator in the field.

  9. Influence of Humic Acid Complexation with Metal Ions on Extracellular Electron Transfer Activity.

    PubMed

    Zhou, Shungui; Chen, Shanshan; Yuan, Yong; Lu, Qin

    2015-01-01

    Humic acids (HAs) can act as electron shuttles and mediate biogeochemical cycles, thereby influencing the transformation of nutrients and environmental pollutants. HAs commonly complex with metals in the environment, but few studies have focused on how these metals affect the roles of HAs in extracellular electron transfer (EET). In this study, HA-metal (HA-M) complexes (HA-Fe, HA-Cu, and HA-Al) were prepared and characterized. The electron shuttle capacities of HA-M complexes were experimentally evaluated through microbial Fe(III) reduction, biocurrent generation, and microbial azoreduction. The results show that the electron shuttle capacities of HAs were enhanced after complexation with Fe but were weakened when using Cu or Al. Density functional theory calculations were performed to explore the structural geometry of the HA-M complexes and revealed the best binding sites of the HAs to metals and the varied charge transfer rate constants (k). The EET activity of the HA-M complexes were in the order HA-Fe > HA-Cu > HA-Al. These findings have important implications for biogeochemical redox processes given the ubiquitous nature of both HAs and various metals in the environment. PMID:26593782

  10. Pesticidal activity of metal oxide nanoparticles on plant pathogenic isolates of Pythium.

    PubMed

    Zabrieski, Zac; Morrell, Elliot; Hortin, Joshua; Dimkpa, Christian; McLean, Joan; Britt, David; Anderson, Anne

    2015-08-01

    CuO and ZnO nanoparticles (NPs) have antimicrobial effects that could lead to formulations as pesticides for agriculture or medicine. The responses of two soil-borne plant pathogenic Pythium isolates to the NPs were studied to determine the potential of these metal oxide NPs as pesticides. Growth of the P. ultimum isolate was more sensitive to CuO NPs than the P. aphanidermatum isolate. Growth in liquid medium with CuO NPs eliminated culturability whereas exposure to ZnO NPs resulted in stasis with growth resuming on transfer to medium lacking NPs. The citrate in the medium used for the growth assays was involved in enhanced release of the toxic metals from the NPs. Both CuO and ZnO NPs affected processes involved in Fe uptake. The NPs reduced levels of Fe-chelating siderophore-like metabolites produced by Pythium hyphae. CuO NPs inhibited, but ZnO NPs increased, ferric reductase activity detected at the mycelial surface. These findings illustrate that the toxicity of the metal oxide NPs towards Pythium was influenced by the medium, especially by the presence of a metal chelator. Environmental factors are likely to alter the pesticide potential of the metal oxide NPs when formulated for agricultural use in soils. PMID:26076749

  11. Screening of catalytic oxygen reduction reaction activity of metal-doped graphene by density functional theory

    NASA Astrophysics Data System (ADS)

    Chen, Xin; Chen, Shuangjing; Wang, Jinyu

    2016-08-01

    Graphene doping is a promising direction for developing effective oxygen reduction reaction (ORR) catalysts. In this paper, we computationally investigated the ORR performance of 10 kinds of metal-doped graphene (M-G) catalysts, namely, Al-, Si-, Mn-, Fe-, Co-, Ni-, Pd-, Ag-, Pt-, and Au-G. The results shown that the binding energies of the metal atoms incorporated into the graphene vacancy are higher than their bulk cohesive energies, indicating the formed M-G catalysts are even more stable than the corresponding bulk metal surfaces, and thus avoid the metals dissolution in the reaction environment. We demonstrated that the linear relation among the binding energies of the ORR intermediates that found on metal-based materials does not hold for the M-G catalysts, therefore a single binding energy of intermediate alone is not sufficient to evaluate the ORR activity of an arbitrary catalyst. By analysis of the detailed ORR processes, we predicted that the Au-, Co-, and Ag-G materials can be used as the ORR catalysts.

  12. Influence of Humic Acid Complexation with Metal Ions on Extracellular Electron Transfer Activity

    PubMed Central

    Zhou, Shungui; Chen, Shanshan; Yuan, Yong; Lu, Qin

    2015-01-01

    Humic acids (HAs) can act as electron shuttles and mediate biogeochemical cycles, thereby influencing the transformation of nutrients and environmental pollutants. HAs commonly complex with metals in the environment, but few studies have focused on how these metals affect the roles of HAs in extracellular electron transfer (EET). In this study, HA-metal (HA-M) complexes (HA-Fe, HA-Cu, and HA-Al) were prepared and characterized. The electron shuttle capacities of HA-M complexes were experimentally evaluated through microbial Fe(III) reduction, biocurrent generation, and microbial azoreduction. The results show that the electron shuttle capacities of HAs were enhanced after complexation with Fe but were weakened when using Cu or Al. Density functional theory calculations were performed to explore the structural geometry of the HA-M complexes and revealed the best binding sites of the HAs to metals and the varied charge transfer rate constants (k). The EET activity of the HA-M complexes were in the order HA-Fe > HA-Cu > HA-Al. These findings have important implications for biogeochemical redox processes given the ubiquitous nature of both HAs and various metals in the environment. PMID:26593782

  13. Influence of Humic Acid Complexation with Metal Ions on Extracellular Electron Transfer Activity

    NASA Astrophysics Data System (ADS)

    Zhou, Shungui; Chen, Shanshan; Yuan, Yong; Lu, Qin

    2015-11-01

    Humic acids (HAs) can act as electron shuttles and mediate biogeochemical cycles, thereby influencing the transformation of nutrients and environmental pollutants. HAs commonly complex with metals in the environment, but few studies have focused on how these metals affect the roles of HAs in extracellular electron transfer (EET). In this study, HA-metal (HA-M) complexes (HA-Fe, HA-Cu, and HA-Al) were prepared and characterized. The electron shuttle capacities of HA-M complexes were experimentally evaluated through microbial Fe(III) reduction, biocurrent generation, and microbial azoreduction. The results show that the electron shuttle capacities of HAs were enhanced after complexation with Fe but were weakened when using Cu or Al. Density functional theory calculations were performed to explore the structural geometry of the HA-M complexes and revealed the best binding sites of the HAs to metals and the varied charge transfer rate constants (k). The EET activity of the HA-M complexes were in the order HA-Fe > HA-Cu > HA-Al. These findings have important implications for biogeochemical redox processes given the ubiquitous nature of both HAs and various metals in the environment.

  14. Metals

    ERIC Educational Resources Information Center

    Kirkemo, Harold; Goudarzi, Gus H.

    1978-01-01

    There has been a general lag in minerals-exploration activity in the past few years. Government concern is reviewed in this article, along with significant developments that included the discovery of additional bauxite, copper, and molybdenum deposits and the reopening of different mining operations. (MA)

  15. Metal based isatin-derived sulfonamides: their synthesis, characterization, coordination behavior and biological activity.

    PubMed

    Chohan, Zahid H; Supuran, Claudiu T; Ben Hadda, Taibi; Nasim, Faiz-Ul-Hassan; Khan, Khalid M

    2009-06-01

    Some isatin derived sulfonamides and their transition metal [Co(II), Cu(II), Ni(II), Zn(II)] complexes have been synthesized and characterized. The structure of synthesized compounds and their nature of bonding have been inferred on the basis of their physical (magnetic susceptibility and conductivity measurements), analytical (elemental analyses) and spectral (IR, (1)H NMR and (13)C NMR) properties. An octahedral geometry has been suggested for Co(II), Ni(II) and Zn(II) and square-planar for Cu(II) complexes. In order to assess the antibacterial and antifungal behavior, the ligands and their metal(II) complexes were screened for their in vitro antibacterial activity against four Gram-negative species, Escherichia coli, Shigella flexneri, Pseudomonas aeruginosa and Salmonella typhi and two Gram-positive species, Staphylococcus aureus and Bacillus subtilis and, for in vitro antifungal activity against Trichophyton longifusus, Candida albicans, Aspergillus flavus, Microsporum canis, Fusarium solani and Candida glaberata. In vitro cytotoxic properties of all the compounds were also studied against Artemia salina by brine shrimp bioassay. The results of average antibacterial/antifungal activity showed that zinc(II) complexes were found to be the most active against one or more bacterial/fungal strains as compared to the other metal complexes. PMID:18825557

  16. Metal analysis, phytotoxic, insecticidal and cytotoxic activities of selected medicinal plants of Khyber Pakhtunkhwa.

    PubMed

    Khuda, Fazli; Iqbal, Zafar; Zakiullah; Khan, Ayub; Nasir, Fazli; Muhammad, Naveed; Khan, Jamshaid Ali; Khan, Muhammad Shafiq

    2012-01-01

    In the present study four medicinal plants traditionally used in Pakistan for treatment of various ailments were evaluated for their heavy metals content, insecticidal, cytotoxic and phytotoxic actions. The metals like Cr, Cu, Zn, Mn, Ni, Pb, Fe and Co were determined in crude extract and various fractions. Soil samples were also tested for heavy metals to determine assimilation of any metal by the plant. Lead, Chromium, copper, nickel and cobalt exceeded the permissible limit in most of the tested samples while the concentration of zinc, manganese and iron was within the permissible limit. Chloroform fraction from Achyranthes aspera and ethyl acetate fraction from Duchesnea indica showed significant phytotoxic activities. Crude extract and chloroform fraction from Xanthium strumarium showed insecticidal activity comparable to that of permethrin and thus could be a significant source of natural insecticide. The butanol fraction from X. strumarium showed significant cytotoxicity with LC(50) 1.9306 μg/ml, having mortality rate 93% at highest dose, while the crude extract from Valeriana wallichii showed 90% mortality rate (LC(50) 4.9730 μg/ml) at highest dose. However, the extracts from other plants were not effective against the brine shrimps tested. PMID:22186309

  17. Effects of activated carbon fibre-supported metal oxide characteristics on toluene removal.

    PubMed

    Liu, Zhen-Shu; Peng, Yu-Hui; Li, Wen-Kai

    2014-01-01

    Few studies have investigated the use of activated carbon fibres (ACFs) impregnated with metal oxides for the catalytic oxidation of volatile organic compounds (VOCs). Thus, the effects of the ACF-supported metal oxides on toluene removal are determined in this study. Three catalysts, namely, Ce, Mn, and Cu, two pretreatment solutions NaOH and H2O2, and three reaction temperatures of 250 degrees C, 300 degrees C, and 350 degrees C, were employed to determine toluene removal. The composition and morphology of the catalysts were analysed using Brunauer-Emmett-Teller (BET), transmission electron microscope (TEM), inductively coupled plasma (ICP), X-ray photoelectron spectroscopy (XPS), Fourier-transform infrared spectrometer (FTIR), and thermo-gravimetric analyser (TGA) to study the effects of the catalyst's characteristics on toluene removal. The results demonstrated that the metal catalysts supported on the ACFs could significantly increase toluene removal. The Mn/ACFs and Cu/ACFs were observed to be most active in toluene removal at a reaction temperature of 250 degrees C with 10% oxygen content. Moreover, the data also indicated that toluene removal was slightly improved after pretreating the ACFs with NaOH and H2O2. The results suggested that surface-metal loading and the surface characteristics of the ACFs were the determinant parameters for toluene removal. Furthermore, the removal of toluene over Mn/ACFs-H202 decreased when the reaction temperature considered was > 300 degrees C. PMID:24701949

  18. Nitrogen Oxide Atom-Transfer Redox Chemistry; Mechanism of NO(g) to Nitrite Conversion Utilizing µ-oxo Heme-FeIII−O−CuII(L) Constructs

    PubMed Central

    Hematian, Shabnam; Kenkel, Isabell; Shubina, Tatyana E.; Dürr, Maximilian; Liu, Jeffrey J.; Siegler, Maxime A.; Ivanovic-Burmazovic, Ivana; Karlin, Kenneth D.

    2015-01-01

    While nitric oxide (NO, nitrogen monoxide) is a critically important signaling agent, its cellular concentrations must be tightly controlled, generally through its oxidative conversion to nitrite (NO2−) where it is held in reserve to be reconverted as needed. In part, this reaction is mediated by the binuclear heme a3/CuB active site of cytochrome c oxidase. In this report, the oxidation of NO(g) to nitrite is shown to occur efficiently in new synthetic µ-oxo heme-FeIII−O−CuII(L) constructs (L being a tridentate or tetradentate pyridyl/alkylamino ligand), and spectroscopic and kinetic investigations provide detailed mechanistic insights. Two new X-ray structures of µ-oxo complexes have been determined and compared to literature analogs. All µ-oxo complexes react with 2 mol equiv NO(g) to give 1:1 mixtures of discrete [(L)CuII(NO2−)]+ plus ferrous heme-nitrosyl compounds; when the first NO(g) equiv reduces the heme center and itself is oxidized to nitrite, the second equiv of NO(g) traps the ferrous heme thus formed. For one µ-oxo heme-FeIII−O−CuII(L) compound, the reaction with NO(g) reveals an intermediate species (“intermediate”), formally a bis-NO adduct, [(NO)(porphyrinate)FeII-(NO2−)−CuII(L)]+ (λmax = 433 nm), confirmed by cryo-spray ionization mass spectrometry and EPR spectroscopy, along with the observation that cooling a 1:1 mixture of [(L)CuII(NO2−)]+ and heme-FeII(NO) to −125 °C leads to association and generation of the key 433 nm UV–vis feature. Kinetic-thermodynamic parameters obtained from low-temperature stopped-flow measurements are in excellent agreement with DFT calculations carried out which describe the sequential addition of NO(g) to the µ-oxo complex. PMID:25974136

  19. Determination of reactions between free radicals and selected Chilean wines and transition metals by ESR and UV-vis technique

    NASA Astrophysics Data System (ADS)

    Espinoza, Mónica; Olea-Azar, Claudio; Speisky, Hernán; Rodríguez, Jorge

    2009-01-01

    Four different types of Chilean wines (Cabernet Sauvignon, Merlot, Carmenere and Syrah) were selected and examined in their free radical scavenging capacities by electron spin resonance (ESR) and spectrophotometric methods. The free radical scavenging properties were evaluated against 2,2-diphenyl-1-picrylhydrazyl (DPPH rad ) radical, 2,6-di- tert-butyl-alpha-(3,5-di- tert-butyl-4-oxo-2,5-cyclohexadien-1-ylidene)- p-tolyloxy (Galvinoxyl) radical and hydroxyl radical (HO rad ). The possible effect on these scavenging properties of added transition metals to these wines was evaluated. Among the wines evaluated, Cabernet Sauvignon was the one with the highest activity against all radicals tested. The presence of added copper or iron to wines resulted in a reduced free radical scavenging capacity for all type of wines studied. The formation of redox inactive complexes between polyphenols of wine and transition metals is the possible cause of this reduction in antioxidant activity.

  20. Local atomic structure modulations activate metal oxide as electrocatalyst for hydrogen evolution in acidic water

    PubMed Central

    Li, Yu Hang; Liu, Peng Fei; Pan, Lin Feng; Wang, Hai Feng; Yang, Zhen Zhong; Zheng, Li Rong; Hu, P.; Zhao, Hui Jun; Gu, Lin; Yang, Hua Gui

    2015-01-01

    Modifications of local structure at atomic level could precisely and effectively tune the capacity of materials, enabling enhancement in the catalytic activity. Here we modulate the local atomic structure of a classical but inert transition metal oxide, tungsten trioxide, to be an efficient electrocatalyst for hydrogen evolution in acidic water, which has shown promise as an alternative to platinum. Structural analyses and theoretical calculations together indicate that the origin of the enhanced activity could be attributed to the tailored electronic structure by means of the local atomic structure modulations. We anticipate that suitable structure modulations might be applied on other transition metal oxides to meet the optimal thermodynamic and kinetic requirements, which may pave the way to unlock the potential of other promising candidates as cost-effective electrocatalysts for hydrogen evolution in industry. PMID:26286479

  1. Local atomic structure modulations activate metal oxide as electrocatalyst for hydrogen evolution in acidic water.

    PubMed

    Li, Yu Hang; Liu, Peng Fei; Pan, Lin Feng; Wang, Hai Feng; Yang, Zhen Zhong; Zheng, Li Rong; Hu, P; Zhao, Hui Jun; Gu, Lin; Yang, Hua Gui

    2015-01-01

    Modifications of local structure at atomic level could precisely and effectively tune the capacity of materials, enabling enhancement in the catalytic activity. Here we modulate the local atomic structure of a classical but inert transition metal oxide, tungsten trioxide, to be an efficient electrocatalyst for hydrogen evolution in acidic water, which has shown promise as an alternative to platinum. Structural analyses and theoretical calculations together indicate that the origin of the enhanced activity could be attributed to the tailored electronic structure by means of the local atomic structure modulations. We anticipate that suitable structure modulations might be applied on other transition metal oxides to meet the optimal thermodynamic and kinetic requirements, which may pave the way to unlock the potential of other promising candidates as cost-effective electrocatalysts for hydrogen evolution in industry. PMID:26286479

  2. Metal-mediated modulation of streptococcal cysteine protease activity and its biological implications.

    PubMed

    Chella Krishnan, Karthickeyan; Mukundan, Santhosh; Landero Figueroa, Julio A; Caruso, Joseph A; Kotb, Malak

    2014-07-01

    Streptococcal cysteine protease (SpeB), the major secreted protease produced by group A streptococcus (GAS), cleaves both host and bacterial proteins and contributes importantly to the pathogenesis of invasive GAS infections. Modulation of SpeB expression and/or its activity during invasive GAS infections has been shown to affect bacterial virulence and infection severity. Expression of SpeB is regulated by the GAS CovR-CovS two-component regulatory system, and we demonstrated that bacteria with mutations in the CovR-CovS two-component regulatory system are selected for during localized GAS infections and that these bacteria lack SpeB expression and exhibit a hypervirulent phenotype. Additionally, in a separate study, we showed that expression of SpeB can also be modulated by human transferrin- and/or lactoferrin-mediated iron chelation. Accordingly, the goal of this study was to investigate the possible roles of iron and other metals in modulating SpeB expression and/or activity in a manner that would potentiate bacterial virulence. Here, we report that the divalent metals zinc and copper inhibit SpeB activity at the posttranslational level. Utilizing online metal-binding site prediction servers, we identified two putative metal-binding sites in SpeB, one of which involves the catalytic-dyad residues (47)Cys and (195)His. Based on our findings, we propose that zinc and/or copper availability in the bacterial microenvironment can modulate the proteolytic activity of SpeB in a manner that preserves the integrity of several other virulence factors essential for bacterial survival and dissemination within the host and thereby may exacerbate the severity of invasive GAS infections. PMID:24799625

  3. Metal-Mediated Modulation of Streptococcal Cysteine Protease Activity and Its Biological Implications

    PubMed Central

    Chella Krishnan, Karthickeyan; Mukundan, Santhosh; Landero Figueroa, Julio A.; Caruso, Joseph A.

    2014-01-01

    Streptococcal cysteine protease (SpeB), the major secreted protease produced by group A streptococcus (GAS), cleaves both host and bacterial proteins and contributes importantly to the pathogenesis of invasive GAS infections. Modulation of SpeB expression and/or its activity during invasive GAS infections has been shown to affect bacterial virulence and infection severity. Expression of SpeB is regulated by the GAS CovR-CovS two-component regulatory system, and we demonstrated that bacteria with mutations in the CovR-CovS two-component regulatory system are selected for during localized GAS infections and that these bacteria lack SpeB expression and exhibit a hypervirulent phenotype. Additionally, in a separate study, we showed that expression of SpeB can also be modulated by human transferrin- and/or lactoferrin-mediated iron chelation. Accordingly, the goal of this study was to investigate the possible roles of iron and other metals in modulating SpeB expression and/or activity in a manner that would potentiate bacterial virulence. Here, we report that the divalent metals zinc and copper inhibit SpeB activity at the posttranslational level. Utilizing online metal-binding site prediction servers, we identified two putative metal-binding sites in SpeB, one of which involves the catalytic-dyad residues 47Cys and 195His. Based on our findings, we propose that zinc and/or copper availability in the bacterial microenvironment can modulate the proteolytic activity of SpeB in a manner that preserves the integrity of several other virulence factors essential for bacterial survival and dissemination within the host and thereby may exacerbate the severity of invasive GAS infections. PMID:24799625

  4. Structure, bonding, and catalytic activity of monodisperse, transition-metal-substituted CeO2 nanoparticles.

    PubMed

    Elias, Joseph S; Risch, Marcel; Giordano, Livia; Mansour, Azzam N; Shao-Horn, Yang

    2014-12-10

    We present a simple and generalizable synthetic route toward phase-pure, monodisperse transition-metal-substituted ceria nanoparticles (M0.1Ce0.9O2-x, M = Mn, Fe, Co, Ni, Cu). The solution-based pyrolysis of a series of heterobimetallic Schiff base complexes ensures a rigorous control of the size, morphology and composition of 3 nm M0.1Ce0.9O2-x crystallites for CO oxidation catalysis and other applications. X-ray absorption spectroscopy confirms the dispersion of aliovalent (M(3+) and M(2+)) transition metal ions into the ceria matrix without the formation of any bulk transition metal oxide phases, while steady-state CO oxidation catalysis reveals an order of magnitude increase in catalytic activity with copper substitution. Density functional calculations of model slabs of these compounds confirm the stabilization of M(3+) and M(2+) in the lattice of CeO2. These results highlight the role of the host CeO2 lattice in stabilizing high oxidation states of aliovalent transition metal dopants that ordinarily would be intractable, such as Cu(3+), as well as demonstrating a rational approach to catalyst design. The current work demonstrates, for the first time, a generalizable approach for the preparation of transition-metal-substituted CeO2 for a broad range of transition metals with unparalleled synthetic control and illustrates that Cu(3+) is implicated in the mechanism for CO oxidation on CuO-CeO2 catalysts. PMID:25406101

  5. Logical regulation of the enzyme-like activity of gold nanoparticles by using heavy metal ions

    NASA Astrophysics Data System (ADS)

    Lien, Chia-Wen; Chen, Ying-Chieh; Chang, Huan-Tsung; Huang, Chih-Ching

    2013-08-01

    In this study we employed self-deposition and competitive or synergistic interactions between metal ions and gold nanoparticles (Au NPs) to develop OR, AND, INHIBIT, and XOR logic gates through regulation of the enzyme-like activity of Au NPs. In the presence of various metal ions (Ag+, Bi3+, Pb2+, Pt4+, and Hg2+), we found that Au NPs (13 nm) exhibited peroxidase-, oxidase-, or catalase-like activity. After Ag+, Bi3+, or Pb2+ ions had been deposited on the Au NPs, the particles displayed strong peroxidase-like activity; on the other hand, they exhibited strong oxidase- and catalase-like activities after reactions with Ag+/Hg2+ and Hg2+/Bi3+ ions, respectively. The catalytic activities of these Au NPs arose mainly from the various oxidation states of the surface metal atoms/ions. Taking advantage of this behavior, we constructed multiplex logic operations--OR, AND, INHIBIT, and XOR logic gates--through regulation of the enzyme-like activity after the introduction of metal ions into the Au NP solution. When we deposited Hg2+ and/or Bi3+ ions onto the Au NPs, the catalase-like activities of the Au NPs were strongly enhanced (>100-fold). Therefore, we could construct an OR logic gate by using Hg2+/Bi3+ as inputs and the catalase-like activity of the Au NPs as the output. Likewise, we constructed an AND logic gate by using Pt4+ and Hg2+ as inputs and the oxidase-like activity of the Au NPs as the output; the co-deposition of Pt and Hg atoms/ions on the Au NPs was responsible for this oxidase-like activity. Competition between Pb2+ and Hg2+ ions for the Au NPs allowed us to develop an INHIBIT logic gate--using Pb2+ and Hg2+ as inputs and the peroxidase-like activity of the Au NPs as the output. Finally, regulation of the peroxidase-like activity of the Au NPs through the two inputs Ag+ and Bi3+ enabled us to construct an XOR logic gate.In this study we employed self-deposition and competitive or synergistic interactions between metal ions and gold nanoparticles (Au NPs

  6. EUV resists based on tin-oxo clusters

    NASA Astrophysics Data System (ADS)

    Cardineau, Brian; Del Re, Ryan; Al-Mashat, Hashim; Marnell, Miles; Vockenhuber, Michaela; Ekinci, Yasin; Sarma, Chandra; Neisser, Mark; Freedman, Daniel A.; Brainard, Robert L.

    2014-03-01

    We have studied the photolysis of tin clusters of the type [(RSn)12O14(OH)6] X2 using extreme ultraviolet (EUV, 13.5 nm) light, and developed these clusters into novel high-resolution photoresists. A thin film of [(BuSn)12O14(OH)6][p-toluenesulfonate]2 (1) was prepared by spin coating a solution of (1) in 2-butanone onto a silicon wafer. Exposure to EUV light caused the compound (1) to be converted into a substance that was markedly less soluble in aqueous isopropanol. To optimize the EUV lithographic performance of resists using tin-oxo clusters, and to gain insight into the mechanism of their photochemical reactions, we prepared several compounds based on [(RSn)12O14(OH)6] X2. The sensitivity of tin-oxide films to EUV light were studied as a function of variations in the structure of the counter-anions (X, primarily carboxylates) and organic ligands bound to tin (R). Correlations were sought between the EUV sensitivity of these complexes vs. the strength of the carbon-carboxylate bonds in the counteranions and vs. the strength of the carbon-tin bonds. No correlation was observed between the strength of the carboncarboxylate bonds in the counter-anions (X) and the EUV photosensitivity. However, the EUV sensitivity of the tinoxide films appears to be well-correlated with the strength of the carbon-tin bonds. We hypothesize this correlation indicates a mechanism of carbon-tin bond homolysis during exposure. Using these tin clusters, 18-nm lines were printed showcasing the high resolution capabilities of these materials as photoresists for EUV lithography.

  7. Isolated metal active site concentration and stability control catalytic CO2 reduction selectivity.

    PubMed

    Matsubu, John C; Yang, Vanessa N; Christopher, Phillip

    2015-03-01

    CO2 reduction by H2 on heterogeneous catalysts is an important class of reactions that has been studied for decades. However, atomic scale details of structure-function relationships are still poorly understood. Particularly, it has been suggested that metal particle size plays a unique role in controlling the stability of CO2 hydrogenation catalysts and the distribution of active sites, which dictates reactivity and selectivity. These studies often have not considered the possible role of isolated metal active sites in the observed dependences. Here, we utilize probe molecule diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) with known site-specific extinction coefficients to quantify the fraction of Rh sites residing as atomically dispersed isolated sites (Rhiso), as well as Rh sites on the surface of Rh nanoparticles (RhNP) for a series of TiO2 supported Rh catalysts. Strong correlations were observed between the catalytic reverse water gas shift turn over frequency (TOF) and the fraction of Rhiso sites and between catalytic methanation TOF and the fraction of RhNP sites. Furthermore, it was observed that reaction condition-induced disintegration of Rh nanoparticles, forming Rhiso active sites, controls the changing reactivity with time on stream. This work demonstrates that isolated atoms and nanoparticles of the same metal on the same support can exhibit uniquely different catalytic selectivity in competing parallel reaction pathways and that disintegration of nanoparticles under reaction conditions can play a significant role in controlling stability. PMID:25671686

  8. Non-precious metal electrocatalysts with high activity for hydrogen oxidation reaction in alkaline electrolytes

    SciTech Connect

    Sheng, WC; Bivens, AP; Myint, M; Zhuang, ZB; Forest, RV; Fang, QR; Chen, JG; Yan, YS

    2014-05-01

    A ternary metallic CoNiMo catalyst is electrochemically deposited on a polycrystalline gold (Au) disk electrode using pulse voltammetry, and characterized for hydrogen oxidation reaction (HOR) activity by temperature-controlled rotating disk electrode measurements in 0.1 M potassium hydroxide (KOH). The catalyst exhibits the highest HOR activity among all non-precious metal catalysts (e.g., 20 fold higher than Ni). At a sufficient loading, the CoNiMo catalyst is expected to outperform Pt and thus provides a promising low cost pathway for alkaline or alkaline membrane fuel cells. Density functional theory (DFT) calculations and parallel H-2-temperature programmed desorption (TPD) experiments on structurally much simpler model alloy systems show a trend that CoNiMo has a hydrogen binding energy (HBE) similar to Pt and much lower than Ni, suggesting that the formation of multi-metallic bonds modifies the HBE of Ni and is likely a significant contributing factor for the enhanced HOR activity.

  9. Origin of photogenerated carrier recombination at the metal-active layer interface in polymer solar cells.

    PubMed

    Kumar, Mukesh; Dubey, Ashish; Reza, Khan Mamun; Adhikari, Nirmal; Qiao, Qiquan; Bommisetty, Venkat

    2015-11-01

    The role of the metal-active layer interface in photogenerated recombination has been investigated using nanoscale current sensing atomic force microscopy (CS-AFM) and intensity modulated photocurrent spectroscopy (IMPS) in as-deposited, pre-annealed and post-annealed bulk heterojunction (BHJ) solar cells. Aluminum (Al) confined post-annealed BHJ solar cells exhibited a significantly improved device efficiency compared to pre-annealed BHJ solar cells having similar photocarrier harvesting ability in the active layer. The nanoscale topography and CS-AFM results indicate a uniform PCBM rich phase at the metal-active layer interface in the post-annealed cells, but PCBM segregation in the pre-annealed cells. These two different annealing processes showed different carrier dynamics revealed using IMPS under various light intensities. The IMPS results suggest reduced photo generated carrier recombination in uniform PCBM rich post-annealed BHJ solar cells. This study reveals the importance of the metal-bend interface in BHJ solar cells in order to obtain efficient charge carrier extraction for high efficiency. PMID:26431263

  10. A Frontier Molecular Orbital determination of the active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.

    1992-01-01

    An angular overlap calculation has been used to determine the s, p and d orbital energy levels of the different types of surface sites present on a dispersed metal catalysts. The basis for these calculations is the reported finding that a large number of catalyzed reactions take place on single atom active sites on the metal surface. Thus, these sites can be considered as surface complexes made up of the central active atom surrounded by near-neighbor metal atom ligands'' with localized surface orbitals perturbed only by these ligands''. These complexes'' are based on a twelve coordinate species with the ligands'' attached to the t{sub 2g} orbitals and the coordinate axes coincident with the direction of the e{sub g} orbitals on the central atom. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  11. A Frontier Molecular Orbital determination of the active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.

    1992-11-01

    An angular overlap calculation has been used to determine the s, p and d orbital energy levels of the different types of surface sites present on a dispersed metal catalysts. The basis for these calculations is the reported finding that a large number of catalyzed reactions take place on single atom active sites on the metal surface. Thus, these sites can be considered as surface complexes made up of the central active atom surrounded by near-neighbor metal atom ``ligands`` with localized surface orbitals perturbed only by these ``ligands``. These ``complexes`` are based on a twelve coordinate species with the ``ligands`` attached to the t{sub 2g} orbitals and the coordinate axes coincident with the direction of the e{sub g} orbitals on the central atom. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  12. Metal clad active fibres for power scaling and thermal management at kW power levels.

    PubMed

    Daniel, Jae M O; Simakov, Nikita; Hemming, Alexander; Clarkson, W Andrew; Haub, John

    2016-08-01

    We present a new approach to high power fibre laser design, consisting of a polymer-free all-glass optical fibre waveguide directly overclad with a high thermal conductivity metal coating. This metal clad active fibre allows a significant reduction in thermal resistance between the active fibre and the laser heat-sink as well as a significant increase in the operating temperature range. In this paper we show the results of a detailed thermal analysis of both polymer and metal coated active fibres under thermal loads typical of kW fibre laser systems. Through several different experiments we present the first demonstration of a cladding pumped aluminium-coated fibre laser and the first demonstration of efficient operation of a cladding-pumped fibre laser at temperatures of greater than 400 °C. Finally, we highlight the versatility of this approach through operation of a passively (radiatively) cooled ytterbium fibre laser head at an output power of 405 W in a compact and ultralight package weighing less than 100 g. PMID:27505822

  13. Comparative study of antioxidant, metal chelating and antiglycation activities of Momordica charantia flesh and pulp fractions.

    PubMed

    Ghous, Tahseen; Aziz, Nouman; Mehmood, Zahid; Andleeb, Saiqa

    2015-07-01

    Momordica charantia is commonly used as a vegetable and folk medicine in most parts of South Asia. This study aims to determine and compare the antioxidant, metal chelating and antiglycation activities of aqueous extracts of M. charantia fruit flesh (MCF) and fruit pulp (MCP) fractions. Our results show that MCP has pronounced DPPH and ABTS radical scavenging potential compared to MCF. In the antiglycation assay both fractions illustrated considerable inhibitory activities against the formation of AGEs induced by glucose with an efficacy of 75 and 67% with 150 μl of MCP and MCF extracts respectively, almost equal to 0.3mM amino guanidine. Results for metal catalysed protein fragmentation and autoxidative and glycoxidation assays demonstrate that MCF and MCP inhibited metal catalysed protein fragmentation. The percentage of relative standard deviation for three replicate measurements of 150 μl of MCF and MCP was < 3.0% for antiglycation. The antioxidant assays with regression values of MCP (0.981 and 0.991) and MCF (0.967 and 0.999) were also recorded. We conclude that both extracts possess high antioxidant and antiglycation activities and are equally good sources of antioxidant and antiglycating agents. PMID:26142512

  14. Spectroscopic analysis, DNA binding and antimicrobial activities of metal complexes with phendione and its derivative

    NASA Astrophysics Data System (ADS)

    Abdus Subhan, Md; Saifur Rahman, Md.; Alam, Khyrul; Mahmud Hasan, Md.

    2014-01-01

    A novel ligand (E)-2-styryl-1H-imidazo [4, 5-f] [1, 10] phenanthroline(L) has been synthesized from 1,10-phenanthroline-5,6-dione. Its transition metal complexes, [FeLCl4][L-H] and [CuL2](NO3)2 have also been synthesized. Besides, three mixed ligand lanthanide metal complexes of Phendione and β-diketones have been synthesized, namely [Eu(TFN)3(Phendione)] (TFN = 4,4,4-trifluoro-1(2-napthyl)-1,3-butanedione), [Eu(HFT)3(Phendione)] (HFT = 4,4,5,5,6,6,6-heptafluoro-1-(2-thienyl)-1,3-hexanedione), [Yb(HFA)3(Phendione)] (hfa = hexafluoroacetylacetonate). The synthesized ligands and metal complexes have been characterized by FTIR, UV-Visible spectroscopy and PL spectra. DNA binding activities of the complexes and the ligands have been studied by DNA gel electrophoresis. DNA binding studies showed that Fe complex of the synthesized ligand is more potent DNA binding and damaging agent compare to others under study. The synthesized compounds were also screened for their antimicrobial activities by disc diffusion method against three microbes, namely Escherichia coli, Staphylococcus aureus, Proteus penneri. The lanthanide complexes of phendione showed great antibacterial activities.

  15. Discovery of an activity cycle in the solar analog HD 45184. Exploring Balmer and metallic lines as activity proxy candidates

    NASA Astrophysics Data System (ADS)

    Flores, M.; González, J. F.; Jaque Arancibia, M.; Buccino, A.; Saffe, C.

    2016-05-01

    Context. Most stellar activity cycles similar to that found in the Sun have been detected by using the chromospheric Ca ii H&K lines as stellar activity proxies. However, it is unclear whether such activity cycles can be identified using other optical lines. Aims: We aim to detect activity cycles in solar-analog stars and determine whether they can be identified through other optical lines, such as Fe II and Balmer lines. We study the solar-analog star HD 45184 using HARPS spectra. The temporal coverage and high quality of the spectra allow us to detect both long- and short-term activity variations. Methods: We analysed the activity signatures of HD 45184 by using 291 HARPS spectra obtained between 2003 and 2014. To search for line-core flux variations, we focused on Ca ii H&K and Balmer Hα and Hβ lines, which are typically used as optical chromospheric activity indicators. We calculated the HARPS-S index from Ca ii H&K lines and converted it into the Mount Wilson scale. In addition, we also considered the equivalent widths of Balmer lines as activity indicators. Moreover, we analysed the possible variability of Fe ii and other metallic lines in the optical spectra. The spectral variations were analysed for periodicity using the Lomb-Scargle periodogram. Results: We report for the first time a long-term 5.14-yr activity cycle in the solar-analog star HD 45184 derived from Mount Wilson S index. This makes HD 45184 one of most similar stars to the Sun with a known activity cycle. The variation is also evident in the first lines of the Balmer series, which do not always show a correlation with activity in solar-type stars. Notably, unlike the solar case, we also found that the equivalent widths of the high photospheric Fe ii lines (4924 Å, 5018 Å and 5169 Å) are modulated (±2 mÅ) by the chromospheric cycle of the star. These metallic lines show variations above 4σ in the rms spectrum, while some Ba ii and Ti ii lines present variations at 3σ level, which

  16. Role of the Uranyl Oxo Group as a Hydrogen Bond Acceptor

    SciTech Connect

    Watson, Lori A; Hay, Benjamin

    2011-01-01

    Density functional theory calculations have been used to evaluate the geometries and energetics of interactions between a number of uranyl complexes and hydrogen bond donor groups. The results reveal that although traditional hydrogen bond donors are repelled by the oxo group in the [UO{sub 2}(OH{sub 2}){sub 5}]{sup 2+} species, they are attracted to the oxo groups in [UO{sub 2}(OH{sub 2}){sub 2}(NO{sub 3}){sub 2}]{sup 0}, [UO{sub 2}(NO{sub 3}){sub 3}]{sup -}, and [UO{sub 2}Cl{sub 4}]{sup 2-} species. Hydrogen bond strength depends on the equatorial ligation and can exceed 15 kcal mol{sup -1}. The results also reveal the existence of directionality at the uranyl oxo acceptor, with a weak preference for linear U=O---H angles.

  17. Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

    PubMed

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

  18. Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

    PubMed Central

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

  19. Synthesis and applications of masked oxo-sulfinamides in asymmetric synthesis.

    PubMed

    Edupuganti, Ramakrishna; Davis, Franklin A

    2012-07-14

    This short perspective reports on the synthesis and applications of a class of chiral amino carbonyl compounds, masked oxo-sulfinamides where the amine is protected with an N-sulfinyl moiety and the carbonyl group is protected as the ketal or 1,3-dithiane. These polyfunctionalized chiral building blocks are prepared by addition of organometallic reagents to masked oxo-sulfinimines (N-sulfinyl imines) or the addition of oxo-organometallic reagents and lithio-1,3-dithianes to sulfinimines. Because unmasking of the amino and carbonyl groups results in cyclic imines, these chiral building blocks are particularly useful for the asymmetric synthesis of functionalized nitrogen heterocycles, including prolines, pipecolic acids, pyrrolidines, homotropinones, tropinones, and tropane alkaloids such as cocaine and C-1 cocaine analogues. PMID:22576951

  20. A trinuclear oxo-chromium(III) complex containing the natural flavonoid primuletin: Synthesis, characterization, and antiradical properties

    SciTech Connect

    Rocha, Reginaldo C.; Alexiou, Anamaria D.P.; Decandio, Carla C.; Almeida, Sabrina da N.; Ferreira, Marcelo J.P.; Romoff, Paulete

    2015-04-10

    A new trinuclear oxo-centered chromium(III) complex with formula [Cr₃O(CH₃CO₂)₆(L)(H₂O)₂] (L = 5-hydroxyflavone, known as primuletin) was synthetized and characterized by ESI mass spectrometry, thermogravimetry, and ¹H-NMR, UV-Vis, and FTIR spectroscopies. In agreement with the experimental results, DFT calculations indicated that the flavonoid ligand is coordinated to one of the three Cr(III) centers in an O,O-bidentate mode through the 5-hydroxy/4-keto groups. In a comparative study involving the uncoordinated primuletin and its corresponding complex, systematic reactions with the free radical 2,2-diphenyl-1-picrylhydrazyl (DPPH) showed that antiradical activity increases upon complexation.

  1. Fabrication of Novel Active Resistor Using Selective Metal Organic Chemical Vapor Deposition (MOCVD) for Monolithic Integration

    NASA Astrophysics Data System (ADS)

    Lee, Young-Jae; Kwon, Young-Se

    2001-02-01

    Using selective epitaxial growth, we fabricated an active resistor in the floated electron channel field effect transistor(FECFET) structure. Compared to the active resistor in the metal semiconductor FET(MESFET) structure, it has large sheet resistance, depending on the number of stripes and etching time. For two SiO2 stripes, it is 600 Ω{\\slash}w=50 μm and for twenty SiO2 stripes, its sheet resistance can reach 6000 Ω{\\slash}{\\Box}. Under light illumination, its current increases nonlinearly with the input light power like two-terminal FET without a gate.

  2. Influence of Traffic Activity on Heavy Metal Concentrations of Roadside Farmland Soil in Mountainous Areas

    PubMed Central

    Zhang, Fan; Yan, Xuedong; Zeng, Chen; Zhang, Man; Shrestha, Suraj; Devkota, Lochan Prasad; Yao, Tandong

    2012-01-01

    Emission of heavy metals from traffic activities is an important pollution source to roadside farmland ecosystems. However, little previous research has been conducted to investigate heavy metal concentrations of roadside farmland soil in mountainous areas. Owing to more complex roadside environments and more intense driving conditions on mountainous highways, heavy metal accumulation and distribution patterns in farmland soil due to traffic activity could be different from those on plain highways. In this study, design factors including altitude, roadside distance, terrain, and tree protection were considered to analyze their influences on Cu, Zn, Cd, and Pb concentrations in farmland soils along a mountain highway around Kathmandu, Nepal. On average, the concentrations of Cu, Zn, Cd, and Pb at the sampling sites are lower than the tolerable levels. Correspondingly, pollution index analysis does not show serious roadside pollution owing to traffic emissions either. However, some maximum Zn, Cd, and Pb concentrations are close to or higher than the tolerable level, indicating that although average accumulations of heavy metals pose no hazard in the region, some spots with peak concentrations may be severely polluted. The correlation analysis indicates that either Cu or Cd content is found to be significantly correlated with Zn and Pb content while there is no significant correlation between Cu and Cd. The pattern can be reasonably explained by the vehicular heavy metal emission mechanisms, which proves the heavy metals’ homology of the traffic pollution source. Furthermore, the independent factors show complex interaction effects on heavy metal concentrations in the mountainous roadside soil, which indicate quite a different distribution pattern from previous studies focusing on urban roadside environments. It is found that the Pb concentration in the downgrade roadside soil is significantly lower than that in the upgrade soil while the Zn concentration in the

  3. Metal complexes of curcumin for cellular imaging, targeting, and photoinduced anticancer activity.

    PubMed

    Banerjee, Samya; Chakravarty, Akhil R

    2015-07-21

    Curcumin is a polyphenolic species. As an active ingredient of turmeric, it is well-known for its traditional medicinal properties. The therapeutic values include antioxidant, anti-inflammatory, antiseptic, and anticancer activity with the last being primarily due to inhibition of the transcription factor NF-κB besides affecting several biological pathways to arrest tumor growth and its progression. Curcumin with all these positive qualities has only remained a potential candidate for cancer treatment over the years without seeing any proper usage because of its hydrolytic instability involving the diketo moiety in a cellular medium and its poor bioavailability. The situation has changed considerably in recent years with the observation that curcumin in monoanionic form could be stabilized on binding to a metal ion. The reports from our group and other groups have shown that curcumin in the metal-bound form retains its therapeutic potential. This has opened up new avenues to develop curcumin-based metal complexes as anticancer agents. Zinc(II) complexes of curcumin are shown to be stable in a cellular medium. They display moderate cytotoxicity against prostate cancer and neuroblastoma cell lines. A similar stabilization and cytotoxic effect is reported for (arene)ruthenium(II) complexes of curcumin against a variety of cell lines. The half-sandwich 1,3,5-triaza-7-phosphatricyclo-[3.3.1.1]decane (RAPTA)-type ruthenium(II) complexes of curcumin are shown to be promising cytotoxic agents with low micromolar concentrations for a series of cancer cell lines. In a different approach, cobalt(III) complexes of curcumin are used for its cellular delivery in hypoxic tumor cells using intracellular agents that reduce the metal and release curcumin as a cytotoxin. Utilizing the photophysical and photochemical properties of the curcumin dye, we have designed and synthesized photoactive curcumin metal complexes that are used for cellular imaging by fluorescence microscopy and

  4. Steric and Electronic Control over the Reactivity of a Thiolate-Ligated Fe(II) Complex with Dioxygen and Superoxide: Reversible μ-Oxo Dimer Formation

    PubMed Central

    Theisen, Roslyn M.; Shearer, Jason; Kaminsky, Werner; Kovacs, Julie A.

    2015-01-01

    The reactivity between a thiolate-ligated five-coordinate complex [FeII(SMe2N4(tren))]+ (1) and dioxygen is examined in order to determine if O2 activation, resembling that of the metalloenzyme cytochrome P450, can be promoted even when O2 binds cis, as opposed to trans, to a thiolate. Previous work in our group showed that [FeII(SMe2N4-(tren))]+ (1) reacts readily with superoxide (O2−) in the presence of a proton source to afford H2O2 via an FeIII–OOH intermediate, thus providing a biomimetic model for the metalloenzyme superoxide reductase (SOR). Addition of O2 to 1 affords binuclear μ-oxo-bridged [FeIII(SMe2N4(tren))]2(μ2-O)(PF6)2•3MeCN (3). At low temperatures, in protic solvents, an intermediate is detected, the details of which will be the subject of a separate paper. Although the thiolate ligand does not appear to perturb the metrical parameters of the unsupported μ-oxo bridge (Fe–O=1.807(8) Å, and Fe–O–Fe= 155.3(5)° fall in the usual range), it decreases the magnetic coupling between the irons (J = −28 cm−1) and creates a rather basic oxo site. Protonation of this oxo using strong (HBF4, HCl) or weak (HOAc, NH4PF6, LutNHCl) acids results in bridge cleavage to cleanly afford the corresponding monomeric anion-ligated (OAc− (6), or Cl− (7)) or solvent-ligated (MeCN (4)) derivatives. Addition of OH− converts [FeIII(SMe2N4-(tren))(MeCN)]2+ (4) back to μ-oxo 3. Thus, μ-oxo bridge cleavage is reversible. The protonated μ-hydroxo-bridged intermediate is not observed. In an attempt to prevent μ-oxo dimer formation, and facilitate the observation of O2-bound intermediates, a bulkier tertiary amine ligand, tren-Et4= N-(2-amino-ethyl)-N-(2-diethylamino-ethyl)-N′,N′-diethyl-ethane-1,2-diamine, and the corresponding [FeII(SMe2N4(tren-Et4))]+ (5) complex was synthesized and structurally characterized. Steric repulsive interactions create unusually long FeII-N(3,4) amine bonds in 5 (mean distance = 2.219(1) Å). The [(tren-Et4)N4SMe2]1

  5. 40 CFR 721.10019 - Benzoic acid, 2-chloro-5-nitro-, 1,1-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester. 721.10019 Section 721.10019 Protection of Environment...-, 1,1-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester. (a) Chemical substance and significant new uses...-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester (PMN P-01-563; CAS No. 174489-76-0) is subject to...

  6. 40 CFR 721.10019 - Benzoic acid, 2-chloro-5-nitro-, 1,1-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester. 721.10019 Section 721.10019 Protection of Environment...-, 1,1-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester. (a) Chemical substance and significant new uses...-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester (PMN P-01-563; CAS No. 174489-76-0) is subject to...

  7. Redox-inactive metal ions promoted the catalytic reactivity of non-heme manganese complexes towards oxygen atom transfer.

    PubMed

    Choe, Cholho; Yang, Ling; Lv, Zhanao; Mo, Wanling; Chen, Zhuqi; Li, Guangxin; Yin, Guochuan

    2015-05-21

    Redox-inactive metal ions can modulate the reactivity of redox-active metal ions in a variety of biological and chemical oxidations. Many synthetic models have been developed to help address the elusive roles of these redox-inactive metal ions. Using a non-heme manganese(II) complex as the model, the influence of redox-inactive metal ions as a Lewis acid on its catalytic efficiency in oxygen atom transfer was investigated. In the absence of redox-inactive metal ions, the manganese(II) catalyst is very sluggish, for example, in cyclooctene epoxidation, providing only 9.9% conversion with 4.1% yield of epoxide. However, addition of 2 equiv. of Al(3+) to the manganese(II) catalyst sharply improves the epoxidation, providing up to 97.8% conversion with 91.4% yield of epoxide. EPR studies of the manganese(II) catalyst in the presence of an oxidant reveal a 16-line hyperfine structure centered at g = 2.0, clearly indicating the formation of a mixed valent di-μ-oxo-bridged diamond core, Mn(III)-(μ-O)2-Mn(IV). The presence of a Lewis acid like Al(3+) causes the dissociation of this diamond Mn(III)-(μ-O)2-Mn(IV) core to form monomeric manganese(iv) species which is responsible for improved epoxidation efficiency. This promotional effect has also been observed in other manganese complexes bearing various non-heme ligands. The findings presented here have provided a promising strategy to explore the catalytic reactivity of some di-μ-oxo-bridged complexes by adding non-redox metal ions to in situ dissociate those dimeric cores and may also provide clues to understand the mechanism of methane monooxygenase which has a similar diiron diamond core as the intermediate. PMID:25904197

  8. Spectroscopic studies and biological activity of some transition metal complexes of unusual Schiff base

    NASA Astrophysics Data System (ADS)

    Abu Al-Nasr, Ahmad K.; Ramadan, Ramadan M.

    2013-03-01

    Unusual Schiff base ligand, 4-ethanimidoyl-6-[(1E)-N-(2-hydroxy-4-methylphenyl)ethanimidoyl]benzene-1,3-diol, L, was synthesized via catalytic process involving the interaction of some metal ions with a macrocyclic Schiff base (MSB). The transition metal derivatives [ML(H2O)4](NO3)3, M = Cr(III) and Fe(III), [NiL(H2O)4](NO3)2, [ML(H2O)2](NO3)2, M = Zn(II) and Cd(II), [Cl2Pd(μ-Cl)2PdL], [PtL(Cl)2] and [PtL(Cl)4] were also synthesized from the corresponding metal species with L. The Schiff bases and complexes were characterized by elemental analysis, mass spectrometry, IR and 1H NMR spectroscopy. The crystal structure of L was determined by X-ray analysis. The spectroscopic studies revealed a variety of structure arrangements for the complexes. The biological activities of L and metal complexes against the Escherchia coli as Gram-negative bacteria and Staphylococcus aureus as Gram-positive bacteria, and the two fungus Aspergillus flavus and Candida albicans were screened. The cytotoxicity of [PtL(Cl)2] complex, a cis-platin analogous, was checked as an antitumor agent on two breast cancer cell lines (MCF7 and T47D) and human liver carcinoma cell line (HepG2).

  9. Accumulation of fossil fuels and metallic minerals in active and ancient rift lakes

    USGS Publications Warehouse

    Robbins, E.I.

    1983-01-01

    A study of active and ancient rift systems around the world suggests that accumulations of fossil fuels and metallic minerals are related to the interactions of processes that form rift valleys with those that take place in and around rift lakes. The deposition of the precursors of petroleum, gas, oil shale, coal, phosphate, barite, Cu-Pb-Zn sulfides, and uranium begins with erosion of uplifted areas, and the consequent input of abundant nutrients and solute loads into swamps and tectonic lakes. Hot springs and volcanism add other nutrients and solutes. The resulting high biological productivity creates oxidized/reduced interfaces, and anoxic and H2S-rich bottom waters which preserves metal-bearing organic tissues and horizons. In the depositional phases, the fine-grained lake deposits are in contact with coarse-grained beach, delta, river, talus, and alluvial fan deposits. Earthquake-induced turbidites also are common coarse-grained deposits of rift lakes. Postdepositional processes in rifts include high heat flow and a resulting concentration of the organic and metallic components that were dispersed throughout the lakebeds. Postdepositional faulting brings organic- and metal-rich sourcebeds in contact with coarse-grained host and reservoir rocks. A suite of potentially economic deposits is therefore a characteristic of rift valleys. ?? 1983.

  10. The divalent metal ion in the active site of uteroferrin modulates substrate binding and catalysis

    PubMed Central

    Mitić, Nataša; Hadler, Kieran S.; Gahan, Lawrence R; Hengge, Alvan C.; Schenk, Gerhard

    2010-01-01

    The purple acid phosphatases (PAP) are binuclear metallohydrolases that catalyze the hydrolysis of a broad range of phosphomonoester substrates. The mode of substrate binding during catalysis and the identity of the nucleophile is subject to debate. Here, we used native Fe3+-Fe2+ pig PAP (uteroferrin; Uf) and its Fe3+-Mn2+ derivative to investigate the effect of metal ion substitution on the mechanism of catalysis. Replacement of the Fe2+ by Mn2+ lowers the reactivity of Uf. However, using stopped-flow measurements it could be shown that this replacement facilitates approximately a ten-fold faster reaction between both substrate and inorganic phosphate with the chromophoric Fe3+ site. These data also indicate that in both metal forms of Uf, phenyl phosphate hydrolysis occurs faster than formation of a μ-1,3 phosphate complex. The slower rate of interaction between substrate and the Fe3+ site relative to catalysis suggests that the substrate is hydrolyzed while coordinated only to the divalent metal ion. The likely nucleophile is a water molecule in the second coordination sphere, activated by a hydroxide terminally coordinated to Fe3+. The faster rates of interaction with the Fe3+ site in the Fe3+-Mn2+ derivative than the native Fe3+-Fe2+ form are likely mediated via a hydrogen bond network connecting the first and second coordination spheres, and illustrate how the selection of metal ions may be important in fine-tuning the function of this enzyme. PMID:20433174

  11. Lidar observations of Ca and K metallic layers from Arecibo and comparison with micrometeor sporadic activity

    NASA Astrophysics Data System (ADS)

    Raizada, S.; Tepley, C. A.; Janches, D.; Friedman, J. S.; Zhou, Q.; Mathews, J. D.

    2004-04-01

    We report on the first simultaneous observations of Ca and K metallic layers using the low-latitude lidar systems located at the Arecibo Observatory in Puerto Rico (18.35°N, 66.75°W). We often observe sudden increases in both Ca and K densities during early morning hours on nights where meteor showers take place. During these periods, the Ca/K abundance ratio varied between 2 and 3. On occasion, differences were observed in Ca and K layers, which relate to differences in the chemistry of the two metals. It is known that metallic layers display distinct seasonal variations, but chemistry alone cannot explain the measured differences. Thus, we examined whether or not the seasonal distribution of micrometeoroids, derived from meteor observations using the Arecibo 430MHz radar, can account for the dissimilar metallic observations. We found that the deposition flux of micrometeoroids, with particle sizes ranging between 0.5 and 100μm, increased by a factor of two during the summer as compared with the winter, suggesting a seasonal variation of their sporadic activity. In addition, our data support the idea that differential ablation leads to a depletion of Ca atoms in the mesosphere.

  12. Mobility of heavy metals from tailings to stream waters in a mining activity contaminated site.

    PubMed

    Concas, A; Ardau, C; Cristini, A; Zuddas, P; Cao, G

    2006-04-01

    In this paper the results of a recent characterization of Rio Piscinas (SW of Sardinia, Italy) hydrological basin are reported. In such area (about 50 km2), previous mining activities caused a serious heavy metal contamination of surface waters, groundwater, soils and biota. Acid mine drainage phenomena were observed in the area. The main sources of contamination are the tailings stored in mine tunnels and abandoned along fluvial banks. A methodological approach was adopted in order to identify relations between tailings and water contamination. Representative samples of tailings and stream sediments samples were collected. XRD analyses were performed for mineralogical characterization, while acid digestion was carried out for determining metal contents. Batch sequential leaching tests were performed in order to assess metal mobility. Also groundwater and stream water were sampled in specific locations and suitably characterized. All information collected allowed the understanding of the effect of tailings on water contamination, thus contributing to the qualitative prediction of pollution evolution on the basis of metal mobility. Finally, a potential remediation strategy of stream water is proposed. PMID:16216301

  13. Synthesis and antimicrobial activity of polysaccharide alginate derived cationic surfactant-metal(II) complexes.

    PubMed

    Tawfik, Salah M; Hefni, Hassan H

    2016-01-01

    New natural polysaccharide carbohydrate derivatives of sodium alginate surfactant and its cobalt, copper and zinc complexes were synthesized. Structures of the synthesized compounds are reported using FTIR, (1)H NMR and UV-vis. The critical micelle concentration (CMC) value of the alginate surfactant and its metal complexes in aqueous solution was found out from surface tension measurements. Surface tension data at different temperatures served for the evaluation of the temperature-dependent CMC and the thermodynamics of micellization (ΔGmic, ΔHmic, ΔSmic) and adsorption (ΔGads, ΔGads, ΔSads). The surface activities of the synthesized polymeric surfactant and its metal complexes were influenced by their chemical structures and the type of the transition metals. These compounds were evaluated against Gram-positive bacteria (Bacillus subtilis and Staphylococcus aureus), Gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa) and fungi (Candida albicans and Asperigllus niger). The antibacterial and antifungal screening tests of the alginate surfactant metal complexes have shown good results compared to its precursor alginate surfactant. PMID:26478092

  14. CHEMICAL ACTIVATION OF MOLECULES BY METALS: EXPERIMENTAL STUDIES OF ELECTRON DISTRIBUTIONS AND BONDING

    SciTech Connect

    LICHTENBERGER, DENNIS L.

    2002-03-26

    This research program is directed at obtaining detailed experimental information on the electronic interactions between metals and organic molecules. These interactions provide low energy pathways for many important chemical and catalytic processes. A major feature of the program is the continued development and application of our special high-resolution valence photoelectron spectroscopy (UPS), and high-precision X-ray core photoelectron spectroscopy (XPS) instrumentation for study of organometallic molecules in the gas phase. The study involves a systematic approach towards understanding the interactions and activation of bound carbonyls, C-H bonds, methylenes, vinylidenes, acetylides, alkenes, alkynes, carbenes, carbynes, alkylidenes, alkylidynes, and others with various monometal, dimetal, and cluster metal species. Supporting ligands include -aryls, alkoxides, oxides, and phosphines. We are expanding our studies of both early and late transition metal species and electron-rich and electron-poor environments in order to more completely understand the electronic factors that serve to stabilize particular organic fragments and intermediates on metals. Additional new directions for this program are being taken in ultra-high vacuum surface UPS, XPS, scanning tunneling microscopy (STM) and atomic force microscopy (AFM) experiments on both physisorbed and chemisorbed organometallic thin films. The combination of these methods provides additional electronic structure information on surface-molecule and molecule-molecule interactions. A very important general result emerging from this program is the identification of a close relationship between the ionization energies of the species and the thermodynamics of the chemical and catalytic reactions of these systems.

  15. Transcription factor activation following exposure of an intact lung preparation to metallic particulate matter.

    PubMed Central

    Samet, James M; Silbajoris, Robert; Huang, Tony; Jaspers, Ilona

    2002-01-01

    Metallic constituents contained in ambient particulate matter have been associated with adverse effects in a number of epidemiologic, in vitro, and in vivo studies. Residual oil fly ash (ROFA) is a metallic by-product of the combustion of fossil fuel oil, which has been shown to induce a variety of proinflammatory responses in lung cells. We have examined signaling pathways activated in response to ROFA exposure and recently reported that ROFA treatment activates multiple mitogen-activated protein (MAP) kinases in the rat lung. In the present study we extended our investigations on the mechanism of toxicity of ROFA to include transcription factors whose activities are regulated by MAP kinases as well as possible effectors of transcriptional changes that mediate the effects of ROFA. We applied immunohistochemical methods to detect ROFA-induced activation of nuclear factor-kappa B (NF kappa B), activating transcription factor-2 (ATF-2), c-Jun, and cAMP response element binding protein (CREB) in intact lung tissue and confirmed and characterized their functional activation using DNA binding assays. We performed these studies using a perfused rabbit lung model that is devoid of blood elements in order to distinguish between intrinsic lung cell effects and effects that are secondary to inflammatory cell influx. We report here that exposure to ROFA results in a rapid activation of all of the transcription factors studied by exerting direct effects on lung cells. These findings validate the use of immunohistochemistry to detect transcription factor activation in vivo and demonstrate the utility of studying signaling changes in response to environmental exposures. PMID:12361922

  16. Antioxidant, Metal Chelating, Anti-glucosidase Activities and Phytochemical Analysis of Selected Tropical Medicinal Plants

    PubMed Central

    Wong, Fai-Chu; Yong, Ann-Li; Ting, Evon Peir-Shan; Khoo, Sim-Chyi; Ong, Hean-Chooi; Chai, Tsun-Thai

    2014-01-01

    The purpose of this investigation was to determine the antioxidant potentials and anti-glucosidase activities of six tropical medicinal plants. The levels of phenolic constituents in these medicinal plants were also quantified and compared. Antioxidation potentials were determined colorimetrically for scavenging activities against DPPH and NO radicals. Metal chelating assay was based on the measurement of iron-ferrozine absorbance at 562 nm. Anti-diabetic potentials were measured by using α-glucosidase as target enzyme. Medicinal plants’ total phenolic, total flavonoid and hydroxycinnamic acid contents were determined using spectrophotometric methods, by comparison to standard plots prepared using gallic acid, quercetin and caffeic acid standards, respectively. Radical scavenging and metal chelating activities were detected in all medicinal plants, in concentration-dependent manners. Among the six plants tested, C. nutans, C. formosana and H. diffusa were found to possess α-glucosidase inhibitory activities. Spectrophotometric analysis indicated that the total phenolic, total flavonoid and hydroxycinnamic acid contents ranged from 12.13-21.39 mg GAE per g of dry sample, 1.83-9.86 mg QE per g of dry sample, and 0.91-2.74 mg CAE per g of dry sample, respectively. Our results suggested that C. nutans and C. formosana could potentially be used for the isolation of potent antioxidants and anti-diabetic compounds. To the best of our knowledge, this study represents the first time that C. nutans (Acanthaceae family) was reported in literature with glucosidase inhibition activity. PMID:25587331

  17. Metal and precursor effect during 1-heptyne selective hydrogenation using an activated carbon as support.

    PubMed

    Lederhos, Cecilia R; Badano, Juan M; Carrara, Nicolas; Coloma-Pascual, Fernando; Almansa, M Cristina; Liprandi, Domingo; Quiroga, Mónica

    2013-01-01

    Palladium, platinum, and ruthenium supported on activated carbon were used as catalysts for the selective hydrogenation of 1-heptyne, a terminal alkyne. All catalysts were characterized by temperature programmed reduction, X-ray diffraction, transmission electron microscopy, and X-ray photoelectron spectroscopy. TPR and XPS suggest that the metal in all catalysts is reduced after the pretreatment with H2 at 673 K. The TPR trace of the PdNRX catalyst shows that the support surface groups are greatly modified as a consequence of the use of HNO3 during the catalyst preparation. During the hydrogenation of 1-heptyne, both palladium catalysts were more active and selective than the platinum and ruthenium catalysts. The activity order of the catalysts is as follows: PdClRX>PdNRX>PtClRX≫RuClRX. This superior performance of PdClRX was attributed in part to the total occupancy of the d electronic levels of the Pd metal that is supposed to promote the rupture of the H2 bond during the hydrogenation reaction. The activity differences between PdClRX and PdNRX catalysts could be attributed to a better accessibility of the substrate to the active sites, as a consequence of steric and electronic effects of the superficial support groups. The order for the selectivity to 1-heptene is as follows: PdClRX=PdNRX>RuClRX>PtClRX, and it can be mainly attributed to thermodynamic effects. PMID:24348168

  18. Highly active non-PGM catalysts prepared from metal organic frameworks

    DOE PAGESBeta

    Barkholtz, Heather M.; Chong, Lina; Kaiser, Zachary B.; Xu, Tao; Liu, Di -Jia

    2015-06-11

    Finding inexpensive alternatives to platinum group metals (PGMs) is essential for reducing the cost of proton exchange membrane fuel cells (PEMFCs). Numerous materials have been investigated as potential replacements of Pt, of which the transition metal and nitrogen-doped carbon composites (TM/Nx/C) prepared from iron doped zeolitic imidazolate frameworks (ZIFs) are among the most active ones in catalyzing the oxygen reduction reaction based on recent studies. In this report, we demonstrate that the catalytic activity of ZIF-based TM/Nx/C composites can be substantially improved through optimization of synthesis and post-treatment processing conditions. Ultimately, oxygen reduction reaction (ORR) electrocatalytic activity must be demonstratedmore » in membrane-electrode assemblies (MEAs) of fuel cells. The process of preparing MEAs using ZIF-based non-PGM electrocatalysts involves many additional factors which may influence the overall catalytic activity at the fuel cell level. Evaluation of parameters such as catalyst loading and perfluorosulfonic acid ionomer to catalyst ratio were optimized. Our overall efforts to optimize both the catalyst and MEA construction process have yielded impressive ORR activity when tested in a fuel cell system.« less

  19. Highly active non-PGM catalysts prepared from metal organic frameworks

    SciTech Connect

    Barkholtz, Heather M.; Chong, Lina; Kaiser, Zachary B.; Xu, Tao; Liu, Di -Jia

    2015-06-11

    Finding inexpensive alternatives to platinum group metals (PGMs) is essential for reducing the cost of proton exchange membrane fuel cells (PEMFCs). Numerous materials have been investigated as potential replacements of Pt, of which the transition metal and nitrogen-doped carbon composites (TM/Nx/C) prepared from iron doped zeolitic imidazolate frameworks (ZIFs) are among the most active ones in catalyzing the oxygen reduction reaction based on recent studies. In this report, we demonstrate that the catalytic activity of ZIF-based TM/Nx/C composites can be substantially improved through optimization of synthesis and post-treatment processing conditions. Ultimately, oxygen reduction reaction (ORR) electrocatalytic activity must be demonstrated in membrane-electrode assemblies (MEAs) of fuel cells. The process of preparing MEAs using ZIF-based non-PGM electrocatalysts involves many additional factors which may influence the overall catalytic activity at the fuel cell level. Evaluation of parameters such as catalyst loading and perfluorosulfonic acid ionomer to catalyst ratio were optimized. Our overall efforts to optimize both the catalyst and MEA construction process have yielded impressive ORR activity when tested in a fuel cell system.

  20. The impact of metal pollution on soil faunal and microbial activity in two grassland ecosystems.

    PubMed

    Boshoff, Magdalena; De Jonge, Maarten; Dardenne, Freddy; Blust, Ronny; Bervoets, Lieven

    2014-10-01

    In this study the influence of metal pollution on soil functional activity was evaluated by means of Bait lamina and BIOLOG(®) EcoPlates™ assays. The in situ bait lamina assay investigates the feeding activity of macrofauna, mesofauna and microarthropods while the BIOLOG(®) EcoPlate™ assay measures the metabolic fingerprint of a selectively extracted microbial community. Both assays proved sensitive enough to reveal changes in the soil community between the plots nearest to and further away from a metal pollution source. Feeding activity (FA) at the less polluted plots reached percentages of 90% while plots nearer to the source of pollution reached percentages as low as 10%. After 2 and 6 days of incubation average well color development (AWCD) and functional richness (R') were significantly lower at the plots closest to the source of pollution. While the Shannon Wiener diversity index (H') decreased significantly at sites nearer to the source of pollution after 2 days but not after 6 days of incubation. Arsenic, Cu and Pb correlated significantly and negatively with feeding activity and functional indices while the role of changing environmental factors such as moisture percentage could not be ruled out completely. Compared to the Bait lamina method that is used in situ and which is therefore more affected by site specific variation, the BIOLOG assay, which excludes confounding factors such as low moisture percentage, may be a more reliable assay to measure soil functional activity. PMID:25173048

  1. Ionic Liquid Activation of Amorphous Metal-Oxide Semiconductors for Flexible Transparent Electronic Devices

    DOE PAGESBeta

    Pudasaini, Pushpa Raj; Noh, Joo Hyon; Wong, Anthony T.; Ovchinnikova, Olga S.; Haglund, Amanda V.; Dai, Sheng; Ward, Thomas Zac; Mandrus, David; Rack, Philip D.

    2016-02-09

    To begin this abstract, amorphous metal-oxide semiconductors offer the high carrier mobilities and excellent large-area uniformity required for high performance, transparent, flexible electronic devices; however, a critical bottleneck to their widespread implementation is the need to activate these materials at high temperatures which are not compatible with flexible polymer substrates. The highly controllable activation of amorphous indium gallium zinc oxide semiconductor channels using ionic liquid gating at room temperature is reported. Activation is controlled by electric field-induced oxygen migration across the ionic liquid-semiconductor interface. In addition to activation of unannealed devices, it is shown that threshold voltages of a transistormore » can be linearly tuned between the enhancement and depletion modes. Finally, the first ever example of transparent flexible thin film metal oxide transistor on a polyamide substrate created using this simple technique is demonstrated. Finally, this study demonstrates the potential of field-induced activation as a promising alternative to traditional postdeposition thermal annealing which opens the door to wide scale implementation into flexible electronic applications.« less

  2. A novel chemical oxo-precipitation (COP) process for efficient remediation of boron wastewater at room temperature.

    PubMed

    Shih, Yu-Jen; Liu, Chia-Hsun; Lan, Wei-Cheng; Huang, Yao-Hui

    2014-09-01

    Chemical oxo-precipitation (COP), which combines treatment with an oxidant and precipitation using metal salts, was developed for treating boron-containing water under milder conditions (room temperature, pH 10) than those of conventional coagulation processes. The concentration of boron compounds was 1000mg-BL(-1). They included boric acid (H3BO3) and perborate (NaBO3). Precipitation using calcium chloride eliminated 80% of the boron from the perborate solution, but was unable to treat boric acid. COP uses hydrogen peroxide (H2O2) to pretreat boric acid, substantially increasing the removal of boron from boric acid solution by chemical precipitation from less than 5% to 80%. Furthermore, of alkaline earth metals, barium ions are the most efficient precipitant, and can increase the 80% boron removal to 98.5% at [H2O2]/[B] and [Ba]/[B] molar ratios of 2 and 1, respectively. The residual boron in the end water of COP contained 15ppm-B: this value cannot be achieved using conventional coagulation processes. PMID:24997923

  3. First structural characterization of a protactinium(V) single oxo bond in aqueous media.

    PubMed

    Le Naour, Claire; Trubert, Didier; Di Giandomenico, Maria V; Fillaux, Clara; Den Auwer, Christophe; Moisy, Philippe; Hennig, Christoph

    2005-12-12

    The present work describes the first structural studies of protactinium(V) in sulfuric and hydrofluoric acid media using X-ray absorption spectroscopy. The results show unambiguously the absence of the trans-dioxo bond that characterizes the other early actinide elements such as U and Np. In concentrated sulfuric acid (13 M), Pa(V) is proved to exhibit a single oxo bond as postulated in the literature for species in more dilute media. In a 0.5 M HF medium, XANES and EXAFS spectra indicate the absence of any oxo bond: Pa(V) exists in the form of a pure fluoro complex. PMID:16323942

  4. Small Titanium Oxo Clusters: Primary Structures of Titanium(IV) in Water.

    PubMed

    Zhang, Guanyun; Hou, Jie; Tung, Chen-Ho; Wang, Yifeng

    2016-04-01

    For sol-gel synthesis of titanium oxide, the titanium(IV) precursors are dissolved in water to form clear solutions. However, the solution status of titanium(IV) remains unclear. Herein three new and rare types of titanium oxo clusters are isolated from aqueous solutions of TiOSO4 and TiCl4 without using organic ligands. Our results indicate that titanium(IV) is readily hydrolyzed into oxo oligomers even in highly acidic solutions. The present clusters provide precise structural information for future characterization of the solution species and structural evolution of titanium(IV) in water and, meanwhile, are new molecular materials for photocatalysis. PMID:26990885

  5. Room temperature perovskite production from bimetallic alkoxides by ketone assisted oxo supplementation (KAOS)

    SciTech Connect

    Gaskins, B.C.; Lannutti, J.J.

    1996-08-01

    Barium titanate has been prepared at room temperature from a well-characterized crystalline barium titanium oxo alkoxide by reaction with acetone. An aldol condensation apparently supplies oxygen to condensing oxo alkoxide clusters. Transmission electron microscopy confirms that the crystallites so formed are dense and perfect with an average size of approximately 85 A. Characterization of reactants and products provides a tentative understanding of structural evolution and the intermediates of the transformation. Crystalline SrTiO{sub 3} and BaZrO{sub 3} were also formed at room temperature by this same method. {copyright} {ital 1996 Materials Research Society.}

  6. Platinum nanoparticles encapsulated metal-organic frameworks for the electrochemical detection of telomerase activity.

    PubMed

    Ling, Pinghua; Lei, Jianping; Jia, Li; Ju, Huangxian

    2016-01-21

    A simple and rapid electrochemical sensor is constructed for the detection of telomerase activity based on the electrocatalysis of platinum nanoparticle (Pt NP) encapsulated metal-organic frameworks (MOFs), which are synthesized by one-pot encapsulation of Pt NPs into prototypal MOFs, UiO-66-NH2. Integrating with the efficient electrocatalysis of Pt@MOFs towards NaBH4 oxidation, this biosensor shows the wide dynamic correlation of telomerase activity from 5 × 10(2) to 10(7) HeLa cells mL(-1) and the telomerase activity in a single HeLa cell was calculated to be 2.0 × 10(-11) IU, providing a powerful platform for detecting telomerase activity. PMID:26612011

  7. Hydrogen Sulfide Induced Carbon Dioxide Activation by Metal-Free Dual Catalysis.

    PubMed

    Kumar, Manoj; Francisco, Joseph S

    2016-03-18

    The role of metal free dual catalysis in the hydrogen sulfide (H2S)-induced activation of carbon dioxide (CO2) and subsequent decomposition of resulting monothiolcarbonic acid in the gas phase has been explored. The results suggest that substituted amines and monocarboxylic type organic or inorganic acids via dual activation mechanisms promote both activation and decomposition reactions, implying that the judicious selection of a dual catalyst is crucial to the efficient C-S bond formation via CO2 activation. Considering that our results also suggest a new mechanism for the formation of carbonyl sulfide from CO2 and H2S, these new insights may help in better understanding the coupling between the carbon and sulfur cycles in the atmospheres of Earth and Venus. PMID:26781129

  8. Synthesis, characterization and biocidal activity of some transition metal(II) complexes with isatin salicylaldehyde acyldihydrazones.

    PubMed

    Singh, Vinod P; Singh, Shweta; Singh, Divya P

    2012-06-01

    Cobalt(II), nickel(II), copper(II), zinc(II) and cadmium(II) complexes with two new unsymmetrical ligands, isatin salicylaldehyde oxalic acid dihydrazide (isodh) and isatin salicylaldehyde malonic acid dihydrazide (ismdh) were synthesized and characterized by elemental analyses, electrical conductance, magnetic moments, electronic, NMR, ESR and IR spectral studies. The isodh acts as a dibasic tetra dentate ligand bonding through two >C=N-, a deprotonated phenolate and deprotonated indole enolate groups to the metal. The ismdh ligand shows monobasic tetra dentate behaviour in bonding with metal ion through two >C=N-, indole >C=O and a deprotonated phenolate group. The electronic spectral data suggest 4-coordinate square planar geometry for Co(II), Ni(II) and Cu(II) complexes of isodh, whereas, 6-coordinate octahedral structure for the ismdh complexes. The ESR studies also indicate a square planar and distorted octahedral environment around Cu(II) for isodh and ismdh complexes, respectively. Most of the metal complexes show better antifungal activity than the standard and a significant antibacterial activity against various fungi and bacteria. PMID:21679052

  9. Visible light active TiO 2 films prepared by electron beam deposition of noble metals

    NASA Astrophysics Data System (ADS)

    Hou, Xing-Gang; Ma, Jun; Liu, An-Dong; Li, De-Jun; Huang, Mei-Dong; Deng, Xiang-Yun

    2010-03-01

    TiO 2 films prepared by sol-gel method were modified by electron beam deposition of noble metals (Pt, Pd, and Ag). Effects of noble metals on the chemical and surface characteristics of the films were studied using XPS, TEM and UV-Vis spectroscopy techniques. Photocatalytic activity of modified TiO 2 films was evaluated by studying the degradation of methyl orange dye solution under visible light UV irradiation. The result of TEM reveals that most of the surface area of TiO 2 is covered by tiny particles of noble metals with diameter less than 1 nm. Broad red shift of UV-Visible absorption band of modified photocatalysts was observed. The catalytic degradation of methyl orange in aqueous solutions under visible light illumination demonstrates a significant enhancement of photocatalytic activity of these films compared with the un-loaded films. The photocatalytic efficiency of modified TiO 2 films by this method is affected by the concentration of impregnating solution.

  10. Enzymatic activity in the rhizosphere of Spartina maritima: potential contribution for phytoremediation of metals.

    PubMed

    Reboreda, Rosa; Caçador, Isabel

    2008-02-01

    Extracellular enzymatic activity (EEA) of five enzymes (peroxidase, phenol oxidase, beta-glucosidase, beta-N-acetylglucosaminidase and acid phosphatase) was analysed in sediments colonised by Spartina maritima in two salt marshes (Rosário and Pancas) of the Tagus estuary (Portugal) with different characteristics such as sediment parameters and metal contaminant levels. Our aim was a better understanding of the influence of the halophyte on microbial activity in the rhizosphere under different site conditions, and its potential consequences for metal cycling and phytoremediation in salt marshes. Acid phosphatase and beta-N-acetylglucosaminidase presented significantly higher EEA in Rosário than in Pancas, whereas the opposite occurred for peroxidase. This was mainly attributed to differences in organic matter between the two sites. A positive correlation between root biomass and EEA of hydrolases (beta-glucosidase, beta-N-acetylglucosaminidase and acid phosphatase) was found, indicating a possible influence of the halophyte in sediment microbial function. This would potentially affect metal cycling in the rhizosphere through microbial reactions. PMID:17935772

  11. Exploring the DNA binding mode of transition metal based biologically active compounds

    NASA Astrophysics Data System (ADS)

    Raman, N.; Sobha, S.

    2012-01-01

    Few novel 4-aminoantipyrine derived Schiff bases and their metal complexes were synthesized and characterized. Their structural features and other properties were deduced from the elemental analysis, magnetic susceptibility and molar conductivity as well as from mass, IR, UV-vis, 1H NMR and EPR spectral studies. The binding of the complexes with CT-DNA was analyzed by electronic absorption spectroscopy, viscosity measurement, and cyclic voltammetry. The interaction of the metal complexes with DNA was also studied by molecular modeling with special reference to docking. The experimental and docking results revealed that the complexes have the ability of interaction with DNA of minor groove binding mode. The intrinsic binding constants ( Kb) of the complexes with CT-DNA were found out which show that they are minor groove binders. Gel electrophoresis assay demonstrated the ability of the complexes to cleave the pUC19 DNA in the presence of AH 2 (ascorbic acid). Moreover, the oxidative cleavage studies using distamycin revealed the minor groove binding for the newly synthesized 4-aminoantipyrine derived Schiff bases and their metal complexes. Evaluation of antibacterial activity of the complexes against Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Staphylococcus epidermidis, and Klebsiella pneumoniae exhibited that the complexes have potent biocidal activity than the free ligands.

  12. ANISOTROPIC METAL-ENRICHED OUTFLOWS DRIVEN BY ACTIVE GALACTIC NUCLEI IN CLUSTERS OF GALAXIES

    SciTech Connect

    Kirkpatrick, C. C.; McNamara, B. R.; Cavagnolo, K. W.

    2011-04-20

    We present an analysis of the spatial distribution of metal-rich gas in 10 galaxy clusters using deep observations from the Chandra X-ray Observatory. The brightest cluster galaxies (BCGs) have experienced recent active galactic nucleus activity in the forms of bright radio emission, cavities, and shock fronts embedded in the hot atmospheres. The heavy elements are distributed anisotropically and are aligned with the large-scale radio and cavity axes. They are apparently being transported from the halo of the BCG into the intracluster medium along large-scale outflows driven by the radio jets. The radial ranges of the metal-enriched outflows are found to scale with jet power as R{sub Fe} {proportional_to} P {sup 0.42}{sub jet}, with a scatter of only 0.5 dex. The heavy elements are transported beyond the extent of the inner cavities in all clusters, suggesting that this is a long-lasting effect sustained over multiple generations of outbursts. Black holes in BCGs will likely have difficulty ejecting metal-enriched gas beyond 1 Mpc unless their masses substantially exceed 10{sup 9} M{sub sun}.

  13. Soluble porous coordination polymers by mechanochemistry: from metal-containing films/membranes to active catalysts for aerobic oxidation.

    PubMed

    Zhang, Pengfei; Li, Haiying; Veith, Gabriel M; Dai, Sheng

    2015-01-14

    Soluble porous coordination polymers from mechanochemical synthesis are presented through a coordination polymerization between highly contorted, rigid tetraphenol and a broad variety of transition metal ions. These polymers can be easily cast as metal-containing films or freestanding membranes. Importantly, as-made coordination polymers are highly active and stable in the aerobic oxidation of allylic C-H bonds. PMID:25389070

  14. The Protonation States of Oxo-Bridged MnIV-Dimers Resolved by Experimental and Computational Mn K Pre-Edge X-Ray Absorption Spectroscopy

    PubMed Central

    Krewald, Vera; Lassalle-Kaiser, Benedikt; Boron, Thaddeus T.; Pollock, Christopher J.; Kern, Jan; Beckwith, Martha A.; Yachandra, Vittal K.; Pecoraro, Vincent L.; Yano, Junko; Neese, Frank; DeBeer, Serena

    2013-01-01

    In nature, the protonation of oxo bridges is a commonly encountered mechanism for fine-tuning chemical properties and reaction pathways. Often, however, the protonation states are difficult to establish experimentally. This is of particular importance in the oxygen evolving complex of Photosystem II, where identification of the bridging oxo protonation states is one of the essential requirements toward unraveling the mechanism. In order to establish a combined experimental and theoretical protocol for the determination of protonation states, we have systematically investigated a series of Mn model complexes by Mn K pre-edge X-ray absorption spectroscopy. An ideal test case for selective bis-μ-oxo-bridge protonation in a Mn-dimer is represented by the system [MnIV2(salpn)2(μ-OH(n))2](n+). Although the three species [MnIV2(salpn)2(μ-O)2], [MnIV2(salpn)2(μ-O)(μ-OH)]+ and [MnIV2(salpn)2(μ-OH)2]2+ differ only in the protonation of the oxo bridges, they exhibit distinct differences in the pre-edge region while maintaining the same edge energy. The experimental spectra are correlated in detail to theoretical ly calculated spectra. A time-dependent density functional theory approach for calculating the pre-edge spectra of molecules with multiple metal centers is presented, using both high-spin (HS) and broken-symmetry (BS) electronic structure solutions. The most intense pre-edge transitions correspond to an excitation of the Mn-1s core electrons into the unoccupied orbitals of local eg character (dz2 and dxy based in the chosen coordinate system). The lowest by energy experimental feature is dominated by excitations of 1s-α electrons and the second observed feature is primarily attributed to 1s-β electron excitations. The observed energetic separation is due to spin polarization effects in spin-unrestricted density functional theory and models final state multiplet effects. The effects of spin polarization on the calculated Mn K pre-edge spectra, in both the HS

  15. Electrical conductivity of activated carbon-metal oxide nanocomposites under compression: a comparison study.

    PubMed

    Barroso-Bogeat, A; Alexandre-Franco, M; Fernández-González, C; Macías-García, A; Gómez-Serrano, V

    2014-12-01

    From a granular commercial activated carbon (AC) and six metal oxide (Al2O3, Fe2O3, SnO2, TiO2, WO3 and ZnO) precursors, two series of AC-metal oxide nanocomposites were prepared by wet impregnation, oven-drying at 120 °C, and subsequent heat treatment at 200 or 850 °C in an inert atmosphere. Here, the electrical conductivity of the resulting products was studied under moderate compression. The influence of the applied pressure, sample volume, mechanical work, and density of the hybrid materials was thoroughly investigated. The DC electrical conductivity of the compressed samples was measured at room temperature by the four-probe method. Compaction assays suggest that the mechanical properties of the nanocomposites are largely determined by the carbon matrix. Both the decrease in volume and the increase in density were relatively small and only significant at pressures lower than 100 kPa for AC and most nanocomposites. In contrast, the bulk electrical conductivity of the hybrid materials was strongly influenced by the intrinsic conductivity, mean crystallite size, content and chemical nature of the supported phases, which ultimately depend on the metal oxide precursor and heat treatment temperature. The supported nanoparticles may be considered to act as electrical switches either hindering or favouring the effective electron transport between the AC cores of neighbouring composite particles in contact under compression. Conductivity values as a rule were lower for the nanocomposites than for the raw AC, all of them falling in the range of semiconductor materials. With the increase in heat treatment temperature, the trend is toward the improvement of conductivity due to the increase in the crystallite size and, in some cases, to the formation of metals in the elemental state and even metal carbides. The patterns of variation of the electrical conductivity with pressure and mechanical work were slightly similar, thus suggesting the predominance of the pressure

  16. Characterization of manganese(V)-oxo polyoxometalate intermediates and their properties in oxygen-transfer reactions.

    PubMed

    Khenkin, Alex M; Kumar, Devesh; Shaik, Sason; Neumann, Ronny

    2006-12-01

    A manganese(III)-substituted polyoxometalate, [alpha2-P2MnIII(L)W17O61]7- (P2W17MnIII), was studied as an oxidation catalyst using iodopentafluorobenzene bis(tifluoroacetate) (F5PhI(TFAc)2) as a monooxygen donor. Pink P2W17MnIII turns green upon addition of F5PhI(TFAc)2. The 19F NMR spectrum of F5PhI(TFAc)2 with excess P2W17MnIII at -50 degrees C showed the formation of an intermediate attributed to P2W17MnIII-F5PhI(TFAc)2 that disappeared upon warming. The 31P NMR spectra of P2W17MnIII with excess F5PhI(TFAc)2 at -50 and -20 degrees C showed a pair of narrow peaks attributed to a diamagnetic, singlet manganese(V)-oxo species, P2W17MnV=O. An additional broad peak at -10.6 ppm was attributed to both the P2W17MnIII-F5PhI(TFAc)2 complex and a paramagnetic, triplet manganese(V)-oxo species. The electronic structure and reactivity of P2W17MnV=O were modeled by DFT calculations using the analogous Keggin compound, [PMnV=OW11O39]4-. Calculations with a pure functional, UBLYP, showed singlet and triplet ground states of similar energy. Further calculations using both the UBLYP and UB3LYP functionals for epoxidation and hydroxylation of propene showed lowest lying triplet transition states for both transformations, while singlet and quintet transition states were of higher energy. The calculations especially after corrections for the solvent effect indicate that [PMnV=OW11O39]4- should be highly reactive, even more reactive than analogous MnV=O porphyrin species. Kinetic measurements of the reaction of P2W17MnV=O with 1-octene indicated, however, that P2W17MnV=O was less reactive than a MnV=O porphyrin. The experimental enthalpy of activation confirmed that the energy barrier for epoxidation is low, but the highly negative entropy of activation leads to a high free energy of activation. This result originates in our view from the strong solvation of the highly charged polyoxometalate by the polar solvent used and adventitious water. The higher negative charge of the

  17. Catalytic Activity of Supported Metal Particles for Sulfuric Acid Decomposition Reaction

    SciTech Connect

    Sergey N. Rashkeev; Daniel M. Ginosar; Lucia M. Petkovic; Helen H. Farrell

    2007-08-01

    Production of hydrogen by splitting water in thermochemical water-splitting cycles, such as the sulfur-based group that employs the catalytic decomposition of sulfuric acid into SO2 and O2 is of considerable interest. Most of these processes occur at high temperatures (T = 1,000 K) and exposes catalysts to the extreme conditions such as steam, oxygen, and acid vapor that severely damage these catalysts within a short time. To develop an understanding of the factors that cause catalyst deactivation, we performed density-functional-theory (DFT)-based first-principles calculations and computer simulations for transition metal (TM) particles positioned on the two types of substrate (?-alumina and TiO2-rutile). The catalytic activity of the considered systems is defined by several factors, namely: (i) The efficiency of detaching oxygen atoms from the sulfur-containing species SOn (n = 1,2,3). The breaking of the S-O bonds may occur at both the substrate and the transition metal cluster. However, the bond-breaking at the substrate is endothermic (and takes about 1.5 eV per bond) while at low-coordinated metal atom of a cluster it is exothermic (with energy gain of about 0.5 eV per bond). This explains why the presence of transition metal clusters is necessary for catalytic activity; (ii) The ability of the cluster to “clean” itself, i.e., to eliminate oxygen from its surface, in order to regain the catalytically active sites and to continue the process. We found that the clusters of Pd and Pt with the size = 2-3 nm are more efficient in this process (at T = 1,000 K) than the clusters of other TM’s considered (Rh, Ir, Ru, and Os); (iii) The ability of the cluster to keep its size to avoid sintering (that reduces the number of low-coordinated catalytically active sites at the surface of the cluster). We found that the sintering of Rh, Ir, Ru, and Os clusters is significantly suppressed in comparison with the sintering of Pd and Pt clusters of the same size (the

  18. Active Interrogation Observables for Enrichment Determination of DU Shielded HEU Metal Assemblies with Limited Geometrical Information

    SciTech Connect

    Pena, Kirsten E; McConchie, Seth M; Crye, Jason Michael; Mihalczo, John T

    2011-01-01

    Determining the enrichment of highly enriched uranium (HEU) metal assemblies shielded by depleted uranium (DU) proves a unique challenge to currently employed measurement techniques. Efforts to match time-correlated neutron distributions obtained through active interrogation to Monte Carlo simulations of the assemblies have shown promising results, given that the exact geometries of both the HEU metal assemblies and DU shields are known from imaging and fission site mapping. In certain situations, however, it is desirable to obtain enrichment with limited or no geometrical information of the assemblies being measured. This paper explores the possibility that the utilization of observables in the interrogation of assemblies by time-tagged D-T neutrons, including time-correlated distribution of neutrons and gammas using liquid scintillators operating on the fission chain time scale, can lead to enrichment determination without a complete set of geometrical information.

  19. An approach to preparing porous and hollow metal phosphides with higher hydrodesulfurization activity

    NASA Astrophysics Data System (ADS)

    Song, Limin; Zhang, Shujuan; Wei, Qingwu

    2011-06-01

    This paper describes an effective method for the synthesis of metal phosphides. Bulk and supported Ni 2P, Cu 3P, and CoP were prepared by thermal treatment of metal and the amorphous red phosphorus mixtures. Porous and hollow Ni 2P particles were also synthesized successfully using this method. The structural properties of these products are investigated using X-ray powder diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), inductively coupled plasma (ICP-AES) and X-ray photoemission spectroscopy (XPS). A rational mechanism was proposed for the selective formation of Ni 2P particles. In experimental conditions, the Ni 2P/SiO 2 catalyst exhibits excellent hydrodesulfurization (HDS) activity for dibenzothiophene (DBT).

  20. Modulating Photoluminescence of Monolayer Molybdenum Disulfide by Metal-Insulator Phase Transition in Active Substrates.

    PubMed

    Hou, Jiwei; Wang, Xi; Fu, Deyi; Ko, Changhyun; Chen, Yabin; Sun, Yufei; Lee, Sangwook; Wang, Kevin X; Dong, Kaichen; Sun, Yinghui; Tongay, Sefaattin; Jiao, Liying; Yao, Jie; Liu, Kai; Wu, Junqiao

    2016-08-01

    The atomic thickness and flatness allow properties of 2D semiconductors to be modulated with influence from the substrate. Reversible modulation of these properties requires an "active," reconfigurable substrate, i.e., a substrate with switchable functionalities that interacts strongly with the 2D overlayer. In this work, the photoluminescence (PL) of monolayer molybdenum disulfide (MoS2 ) is modulated by interfacing it with a phase transition material, vanadium dioxide (VO2 ). The MoS2 PL intensity is enhanced by a factor of up to three when the underlying VO2 undergoes the thermally driven phase transition from the insulating to metallic phase. A nonvolatile, reversible way to rewrite the PL pattern is also demonstrated. The enhancement effect is attributed to constructive optical interference when the VO2 turns metallic. This modulation method requires no chemical or mechanical processes, potentially finding applications in new switches and sensors. PMID:27335137

  1. Metal Nanoparticles Catalyzed Selective Carbon-Carbon Bond Activation in the Liquid Phase.

    PubMed

    Ye, Rong; Yuan, Bing; Zhao, Jie; Ralston, Walter T; Wu, Chung-Yeh; Unel Barin, Ebru; Toste, F Dean; Somorjai, Gabor A

    2016-07-13

    Understanding the C-C bond activation mechanism is essential for developing the selective production of hydrocarbons in the petroleum industry and for selective polymer decomposition. In this work, ring-opening reactions of cyclopropane derivatives under hydrogen catalyzed by metal nanoparticles (NPs) in the liquid phase were studied. 40-atom rhodium (Rh) NPs, encapsulated by dendrimer molecules and supported in mesoporous silica, catalyzed the ring opening of cyclopropylbenzene at room temperature under hydrogen in benzene, and the turnover frequency (TOF) was higher than other metals or the Rh homogeneous catalyst counterparts. Comparison of reactants with various substitution groups showed that electron donation on the three-membered ring boosted the TOF of ring opening. The linear products formed with 100% selectivity for ring opening of all reactants catalyzed by the Rh NP. Surface Rh(0) acted as the active site in the NP. The capping agent played an important role in the ring-opening reaction kinetics. Larger particle size tended to show higher TOF and smaller reaction activation energy for Rh NPs encapsulated in either dendrimer or poly(vinylpyrrolidone). The generation/size of dendrimer and surface group also affected the reaction rate and activation energy. PMID:27322570

  2. Synthesis and anti-fungicidal activity of some transition metal complexes with benzimidazole dithiocarbamate ligand

    NASA Astrophysics Data System (ADS)

    Mohamed, Gehad G.; Ibrahim, Nasser A.; Attia, Hanaa A. E.

    2009-04-01

    Seven transition metal complexes of benzimidazole ligand (HL) are reported and characterized based on elemental analyses, IR, solid reflectance, magnetic moment, molar conductance and thermal analyses (TGA and DTA). From the obtained data, the complexes were proposed to have the general formulae [MX 2(HL)(H 2O)]· yH 2O, where M = Mn(II), Co(II), Ni(II), Cu(II), Zn(II), Cr(III); X = Cl -, SO 42- and y = 0-4. The molar conductance data revealed that all the metal chelates were non-electrolytes. From the magnetic and solid reflectance spectra, it was found that the geometrical structure of these complexes is octahedral. The thermal behaviour of these chelates showed that the hydrated complexes loss water molecules of hydration in the first step followed immediately by decomposition of the anions and ligand molecules in the subsequent steps. Fungicidal activity of the prepared complexes and free ligand was evaluated against three soil borne fungi. Data obtained showed the higher biological activity of the prepared complexes than the parent Schiff base ligand. Formulation of the most potent complex was carried out in the form of 25% WP. Fungicidal activity of the new formulation was evaluated and compared with the standard fungicide Pencycuron (Monceren 25% WP). In most cases, the new formulation possessed higher fungicidal activity than the standard fungicide under the laboratory conditions.

  3. Metal active site elasticity linked to activation of homocysteine in methionine synthases

    SciTech Connect

    Koutmos, Markos; Pejchal, Robert; Bomer, Theresa M.; Matthews, Rowena G.; Smith, Janet L.; Ludwig, Martha L.

    2008-04-02

    Enzymes possessing catalytic zinc centers perform a variety of fundamental processes in nature, including methyl transfer to thiols. Cobalamin-independent (MetE) and cobalamin-dependent (MetH) methionine synthases are two such enzyme families. Although they perform the same net reaction, transfer of a methyl group from methyltetrahydrofolate to homocysteine (Hcy) to form methionine, they display markedly different catalytic strategies, modular organization, and active site zinc centers. Here we report crystal structures of zinc-replete MetE and MetH, both in the presence and absence of Hcy. Structural investigation of the catalytic zinc sites of these two methyltransferases reveals an unexpected inversion of zinc geometry upon binding of Hcy and displacement of an endogenous ligand in both enzymes. In both cases a significant movement of the zinc relative to the protein scaffold accompanies inversion. These structures provide new information on the activation of thiols by zinc-containing enzymes and have led us to propose a paradigm for the mechanism of action of the catalytic zinc sites in these and related methyltransferases. Specifically, zinc is mobile in the active sites of MetE and MetH, and its dynamic nature helps facilitate the active site conformational changes necessary for thiol activation and methyl transfer.

  4. Bis(mu-oxo)dicopper in Cu-ZSM-5 and its role in the decomposition of NO: a combined in situ XAFS, UV-vis-near-IR, and kinetic study.

    PubMed

    Groothaert, Marijke H; van Bokhoven, Jeroen A; Battiston, Andrea A; Weckhuysen, Bert M; Schoonheydt, Robert A

    2003-06-25

    In situ XAFS combined with UV-vis-near-IR spectroscopy are used to identify the active site in copper-loaded ZSM-5 responsible for the catalytic decomposition of NO. Cu-ZSM-5 was probed with in situ XAFS (i) after O(2) activation and (ii) while catalyzing the direct decomposition of NO into N(2) and O(2). A careful R-space fitting of the Cu K-edge EXAFS data is presented, including the use of different k-weightings and the analysis of the individual coordination shells. For the O(2)-activated overexchanged Cu-ZSM-5 sample a Cu.Cu contribution at 2.87 A with a coordination number of 1 is found. The corresponding UV-vis-near-IR spectrum is characterized by an intense absorption band at 22 700 cm(-1) and a relatively weaker band at 30 000 cm(-1), while no corresponding EPR signal is detected. Comparison of these data with the large databank of well-characterized copper centers in enzymes and synthetic model complexes leads to the identification of the bis(mu-oxo)dicopper core, i.e. [Cu(2)(mu-O)(2)](2+). After dehydration in He, Cu-ZSM-5 shows stable NO decomposition activity and the in situ XAFS data indicate the formation of a large fraction of the bis(mu-oxo)dicopper core during reaction. When the Cu/Al ratio of Cu-ZSM-5 exceeds 0.2, both the bis(mu-oxo)dicopper core is formed and the NO decomposition activity increases sharply. On the basis of the in situ measurements, a reaction cycle is proposed in which the bis(mu-oxo)dicopper core forms the product O(2) on a single active site and realizes the continuous O(2) release and concomitant self-reduction. PMID:12812505

  5. In vitro antiplasmodial activity of PDDS-coated metal oxide nanoparticles against Plasmodium falciparum

    NASA Astrophysics Data System (ADS)

    Jacob Inbaneson, Samuel; Ravikumar, Sundaram

    2013-06-01

    Malaria is the most important parasitic disease, leading to annual death of about one million people and the Plasmodium falciparum develops resistant to well-established antimalarial drugs. The newest antiplasmodial drug from metal oxide nanoparticles helps in addressing this problem. Commercial nanoparticles such as Fe3O4, MgO, ZrO2, Al2O3 and CeO2 coated with PDDS and all the coated and non-coated nanoparticles were screened for antiplasmodial activity against P. falciparum. The Al2O3 nanoparticles (71.42 ± 0.49 μg ml-1) showed minimum level of IC50 value and followed by MgO (72.33 ± 0.37 μg ml-1) and Fe3O4 nanoparticles (77.23 ± 0.42 μg ml-1). The PDDS-Fe3O4 showed minimum level of IC50 value (48.66 ± 0.45 μg ml-1), followed by PDDS-MgO (60.28 ± 0.42 μg ml-1) and PDDS-CeO2 (67.06 ± 0.61 μg ml-1). The PDDS-coated metal oxide nanoparticles showed superior antiplasmodial activity than the non-PDDS-coated metal oxide nanoparticles. Statistical analysis reveals that, significant in vitro antiplasmodial activity ( P < 0.05) was observed between the concentrations and time of exposure. The chemical injury to erythrocytes showed no morphological changes in erythrocytes by the nanoparticles after 48 h of incubation. It is concluded from the present study that, the PDDS-Fe3O4 showed good antiplasmodial activity and it might be used for the development of antiplasmodial drugs.

  6. Metabolism of 4-Hydroxy-7-oxo-5-heptenoic Acid (HOHA) Lactone by Retinal Pigmented Epithelial Cells.

    PubMed

    Wang, Hua; Linetsky, Mikhail; Guo, Junhong; Yu, Annabelle O; Salomon, Robert G

    2016-07-18

    4-Hydroxy-7-oxo-5-heptenic acid (HOHA)-lactone is a biologically active oxidative truncation product released (t1/2 = 30 min at 37 °C) by nonenzymatic transesterification/deacylation from docosahexaenoate lipids. We now report that HOHA-lactone readily diffuses into retinal pigmented epithelial (RPE) cells where it is metabolized. A reduced glutathione (GSH) Michael adduct of HOHA-lactone is the most prominent metabolite detected by LC-MS in both the extracellular medium and cell lysates. This molecule appeared inside of ARPE-19 cells within seconds after exposure to HOHA-lactone. The intracellular level reached a maximum concentration at 30 min and then decreased with concomitant increases in its level in the extracellular medium, thus revealing a unidirectional export of the reduced GSH-HOHA-lactone adduct from the cytosol to extracellular medium. This metabolism is likely to modulate the involvement of HOHA-lactone in the pathogenesis of human diseases. HOHA-lactone is biologically active, e.g., low concentrations (0.1-1 μM) induce secretion of vascular endothelial growth factor (VEGF) from ARPE-19 cells. HOHA-lactone is also a precursor of 2-(ω-carboxyethyl)pyrrole (CEP) derivatives of primary amino groups in proteins and ethanolamine phospholipids that have significant pathological and physiological relevance to age-related macular degeneration (AMD), cancer, and wound healing. Both HOHA-lactone and the derived CEP can contribute to the angiogenesis that defines the neovascular "wet" form of AMD and that promotes the growth of tumors. While GSH depletion can increase the lethality of radiotherapy, because it will impair the metabolism of HOHA-lactone, the present study suggests that GSH depletion will also increase levels of HOHA-lactone and CEP that may promote recurrence of tumor growth. PMID:27355557

  7. Metal-based biologically active compounds: synthesis, characterization, DNA interaction, antibacterial, cytotoxic and SOD mimic activities.

    PubMed

    Patel, Mohan N; Patel, Chintan R; Joshi, Hardik N

    2013-02-01

    The square pyramidal copper(II) complexes of N, O- donor ligand and ciprofloxacin have been synthesized. Synthesized complexes were characterized by physicochemical parameters like elemental analysis, electronic, FT-IR and LC-MS spectra. The complexes were screened for their antimicrobial activity against Gram(+Ve), i.e. Staphylococcus aureus, Bacillus subtilis, and Gram(-Ve), i.e. Serratia marcescens, Pseudomonas aeruginosa and Escherichia coli, microorganisms in terms of minimum inhibitory concentration and colony-forming unit. To determine the binding mode of complexes with Herring Sperm DNA, absorption titration and viscosity measurement were employed. DNA cleavage activity was carried out by gel electrophoresis experiment using supercoiled form of pUC19 DNA. The complexes were tested for their superoxide dismutase mimic activity in terms of IC(50) value. Synthesized complexes were also screened for their cytotoxicity using brine shrimp lethality assay method. PMID:23306896

  8. Development of novel catalytically active polymer-metal-nanocomposites based on activated foams and textile fibers

    PubMed Central

    2013-01-01

    In this paper, we report the intermatrix synthesis of Ag nanoparticles in different polymeric matrices such as polyurethane foams and polyacrylonitrile or polyamide fibers. To apply this technique, the polymer must bear functional groups able to bind and retain the nanoparticle ion precursors while ions should diffuse through the matrix. Taking into account the nature of some of the chosen matrices, it was essential to try to activate the support material to obtain an acceptable value of ion exchange capacity. To evaluate the catalytic activity of the developed nanocomposites, a model catalytic reaction was carried out in batch experiments: the reduction of p-nitrophenol by sodium borohydride. PMID:23680063

  9. Development of novel catalytically active polymer-metal-nanocomposites based on activated foams and textile fibers

    NASA Astrophysics Data System (ADS)

    Domènech, Berta; Ziegler, Kharla K.; Carrillo, Fernando; Muñoz, Maria; Muraviev, Dimitri N.; Macanás, Jorge

    2013-05-01

    In this paper, we report the intermatrix synthesis of Ag nanoparticles in different polymeric matrices such as polyurethane foams and polyacrylonitrile or polyamide fibers. To apply this technique, the polymer must bear functional groups able to bind and retain the nanoparticle ion precursors while ions should diffuse through the matrix. Taking into account the nature of some of the chosen matrices, it was essential to try to activate the support material to obtain an acceptable value of ion exchange capacity. To evaluate the catalytic activity of the developed nanocomposites, a model catalytic reaction was carried out in batch experiments: the reduction of p-nitrophenol by sodium borohydride.

  10. In Silico Design of Highly Selective Mo-V-Te-Nb-O Mixed Metal Oxide Catalysts for Ammoxidation and Oxidative Dehydrogenation of Propane and Ethane.

    PubMed

    Cheng, Mu-Jeng; Goddard, William A

    2015-10-21

    We used density functional theory quantum mechanics with periodic boundary conditions to determine the atomistic mechanism underlying catalytic activation of propane by the M1 phase of Mo-V-Nb-Te-O mixed metal oxides. We find that propane is activated by Te═O through our recently established reduction-coupled oxo activation mechanism. More importantly, we find that the C-H activation activity of Te═O is controlled by the distribution of nearby V atoms, leading to a range of activation barriers from 34 to 23 kcal/mol. On the basis of the new insight into this mechanism, we propose a synthesis strategy that we expect to form a much more selective single-phase Mo-V-Nb-Te-O catalyst. PMID:26423704

  11. Method of synthesizing a plurality of reactants and producing thin films of electro-optically active transition metal oxides

    DOEpatents

    Tracy, C.E.; Benson, D.K.; Ruth, M.R.

    1985-08-16

    A method of synthesizing a plurality of reactants by inducing a reaction by plasma deposition among the reactants. The plasma reaction is effective for consolidating the reactants and producing thin films of electro-optically active transition metal oxides.

  12. Oxidative stress in the mollusk Echinolittorina peruviana (Gasteropoda: Littorinidae, Lamarck, 1822) and trace metals in coastal sectors with mining activity.

    PubMed

    Jara, C; Gaete, H; Lobos, G; Hidalgo, M E

    2014-08-01

    The aim of the study was to evaluate the effect of coastal waters of sites with mining activity in Echinolittorina peruviana, through oxidative stress biomarkers and heavy metals determination both in water and in tissue. Organisms were collected in the intertidal zone in areas with and without mining activity. Metal concentrations in the water and tissues, and also, the following biomarkers of oxidative stress: antioxidant enzyme activity, superoxide dismutase and catalase, non-enzymatic oxidative capacity (TRAP), oxidative damage to proteins (carbonyls) and TBARS, were measured The concentrations of accumulated metals had the following order Fe > Cu > Cd > Zn > Cr > Mo > As; the highest concentrations of metals in water and tissues were found in Caleta Palito and Chañaral. Results suggest that the coastal waters with mining activity and greatest concentrations of copper and iron induced the greater antioxidant response and oxidative damage to lipids in E. peruviana. PMID:24829115

  13. Metal Ion Adsorption by Activated Carbons Made from Pecan Shells: Effect of Oxygen Level During Activation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Agricultural by-products represent a considerable quantity of harvested commodity crops. The use of by-products as precursors for the production of widely used adsorbents, such as activated carbons, may impart a value-added component of the overall biomass harvested. Our objective in this presenta...

  14. Observation of a Cu(II)2(μ-1,2-peroxo)/Cu(III)2(μ-oxo)2 Equilibrium and its Implications for Copper-Dioxygen Reactivity**

    PubMed Central

    Kieber-Emmons, Matthew T.; Ginsbach, Jake W.; Wick, Patrick K.; Lucas, Heather R.; Helton, Matthew E.; Lucchese, Baldo; Suzuki, Masatatsu; Zuberbühler, Andreas

    2014-01-01

    Synthesis of small molecule Cu2O2 adducts has provided insight into the related biological systems and their reactivity patterns including the interconversion of the CuII2(μ-η2:η2-peroxo) and CuIII2(μ-oxo)2 isomers. In this study, absorption spectroscopy, kinetics, and resonance Raman data show that the oxygenated product of [(BQPA)CuI]+ initially yields an “end-on peroxo” species, that subsequently converts to the thermodynamically more stable “bis-μ-oxo” isomer (Keq = 3.2 at −90 °C). Calibration of density functional theory calculations to these experimental data suggest that the electrophilic reactivity previously ascribed to end-on peroxo species is in fact a result of an accessible bis-μ-oxo isomer, an electrophilic Cu2O2 isomer in contrast to the nucleophilic reactivity of binuclear CuII end-on peroxo species. This study is the first report of the interconversion of an end-on peroxo to bis-μ-oxo species in transition metal-dioxygen chemistry. PMID:24700427

  15. Divergent effects of oxidatively induced modification to the C8 of 2'-deoxyadenosine on transcription factor binding: 8,5'(S)-cyclo-2'-deoxyadenosine inhibits the binding of multiple sequence specific transcription factors, while 8-oxo-2'-deoxyadenosine increases binding of CREB and NF-kappa B to DNA.

    PubMed

    Abraham, Jessy; Brooks, Philip J

    2011-05-01

    DNA is exposed to endogenous and environmental factors that can form stable lesions. If not repaired, these lesions can lead to transcription/replication blocking or mutagenic bypass. Our previous work has focused on 8,5'-cyclopurine 2'-deoxyribonucleosides, a unique class of oxidatively induced DNA lesions that are specifically repaired by the NER pathway (see Brooks PJ [2008]: DNA Repair 7:1168-1179). Here we used EMSA to monitor the ability of sequence-specific transcription factors, HSF1, CREB, and NF-kappaB and "architectural" transcription factor, HMGA, to bind to their target sequences when 8, 5'(S)-cyclo-2'-deoxyadenosine (cyclo-dAdo) is present within their recognition sequences. For comparison, we also tested the effect of 8-oxo-7,8-dihydro-2'-deoxyadenosine (8-oxo-dAdo) in the same recognition sequences. The presence of a cyclo-dAdo lesion in the target sequence essentially eliminated the binding activity of HSF1, CREB, and NF-kappa B whereas HMGA retained some of its binding activity. In contrast, 8-oxo-dAdo had no obvious effect on the binding activity of HSF1 and HMGA in comparison to lesion-free DNA. Notably, though, CREB and NFκB binding increased when an 8-oxo-dAdo lesion was present in their target sequence. Competition EMSA showed about 2-3-fold increased affinity of both proteins for the 8-oxo-dAdo containing target sequence compared to lesion-free DNA. Molecular modeling of the lesions in the NF-kappaB sequence indicated that 8-oxo-dAdo may form an additional hydrogen bond with the protein, thereby strengthening the binding of NF-kappa B to its DNA target. The cyclo-dAdo lesion, in contrast, distorted the DNA structure, providing an explanation for the inhibition of NF-kappaB binding. PMID:20872830

  16. QSAR studies on 3-(4-biphenylmethyl) 4, 5-dihydro-4-oxo-3H-imidazo [4, 5-c] Pyridine derivatives as angiotensin II (AT1) receptor antagonist.

    PubMed

    Sharma, Mukesh C

    2015-06-01

    QSAR studies were performed for correlating the chemical composition of 3-(4-biphenylmethyl) 4, 5-dihydro-4-oxo-3H-imidazo [4, 5-c] pyridines bearing aryl acetic acid esters and acetamides as angiotensin II AT(1) receptor antagonist. Four different quantitative structure-property relationship (QSAR) methods namely two-dimensional (2D-QSAR), group-based QSAR, k-nearest neighbor and Pharmacophore Modeling were employed to obtain statistically significant models. The statistically significant best 2D-QSAR model having correlation coefficient r(2) = 0:8940 and cross-validated squared correlation coefficient q(2) = 0:7648 with external predictive ability of pred_r(2) = 0:8177,pred_r(2)se = 0.4119 and best group-based QSAR model having r(2) = 0:7392 and q(2) = 0:6710with pred_r(2) = 0:7503was developed by SA-principal component regression. The most predictive k-nearest neighbor model derived from the superposition of conformations has good cross-validated q(2) = 0:7637 and satisfied predictive ability r(2)_pred = 0.7143. Continuing with compounds of substituted 4, 5-dihydro-4-oxo-3H-imidazo [4, 5-c] pyridine derivatives chemical feature-based pharmacophore models with lowest RMSD value (0.3292 Å) consists of two Hac (Hydrogen bond acceptor), negative ionizable, and two AroC (Aromatic) features are important for the activity. The study suggested that substitution of group at R, R 1, R 2 and Ar, and position on 4, 5-dihydro-4-oxo-3H-imidazo [4, 5-c] pyridine ring with more electronegative nature and low bulkiness are favorable for the antihypertensive activity. These theoretical results may provide a useful reference for understanding the action mechanism and designing potential angiotensin II (AT1) receptor antagonist. PMID:26215494

  17. A 3-hydroxy β-end group in xanthophylls is preferentially oxidized to a 3-oxo ε-end group in mammals[S

    PubMed Central

    Nagao, Akihiko; Maoka, Takashi; Ono, Hiroshi; Kotake-Nara, Eiichi; Kobayashi, Miyuki; Tomita, Mie

    2015-01-01

    We previously found that mice fed lutein accumulated its oxidative metabolites (3′-hydroxy-ε,ε-caroten-3-one and ε,ε-carotene-3,3′-dione) as major carotenoids, suggesting that mammals can convert xanthophylls to keto-carotenoids by the oxidation of hydroxyl groups. Here we elucidated the metabolic activities of mouse liver for several xanthophylls. When lutein was incubated with liver postmitochondrial fraction in the presence of NAD+, (3′R,6′R)-3′-hydroxy-β,ε-caroten-3-one and (6RS,3′R,6′R)-3′-hydroxy-ε,ε-caroten-3-one were produced as major oxidation products. The former accumulated only at the early stage and was assumed to be an intermediate, followed by isomerization to the latter. The configuration at the C3′ and C6′ of the ε-end group in lutein was retained in the two oxidation products. These results indicate that the 3-hydroxy β-end group in lutein was preferentially oxidized to a 3-oxo ε-end group via a 3-oxo β-end group. Other xanthophylls such as β-cryptoxanthin and zeaxanthin, which have a 3-hydroxy β-end group, were also oxidized in the same manner as lutein. These keto-carotenoids, derived from dietary xanthophylls, were confirmed to be present in plasma of normal human subjects, and β,ε-caroten-3′-one was significantly increased by the ingestion of β-cryptoxanthin. Thus, humans as well as mice have oxidative activity to convert the 3-hydroxy β-end group of xanthophylls to a 3-oxo ε-end group. PMID:25502844

  18. Fluorous-assisted metal chelate affinity extraction technique for analysis of protein kinase activity.

    PubMed

    Hayama, Tadashi; Kiyokawa, Ena; Yoshida, Hideyuki; Imakyure, Osamu; Yamaguchi, Masatoshi; Nohta, Hitoshi

    2016-08-15

    We have developed a fluorous affinity-based extraction method for measurement of protein kinase activity. In this method, a fluorescent peptide substrate was phosphorylated by a protein kinase, and the obtained phosphopeptide was selectively captured with Fe(III)-immobilized perfluoroalkyliminodiacetic acid reagent via a metal chelate affinity technique. Next, the captured phosphopeptide was selectively extracted into a fluorous solvent mixture, tetradecafluorohexane and 1H,1H,2H,2H-tridecafluoro-1-n-octanol (3:1, v/v), using the specificity of fluorous affinity (fluorophilicity). In contrast, the remained substrate peptide in the aqueous (non-fluorous) phase was easily measured fluorimetrically. Finally, the enzyme activity could be assayed by measuring the decrease in fluorescence. The feasibility of this method was demonstrated by applying the method for measurement of the activity of cAMP-dependent protein kinase (PKA) using its substrate peptide (kemptide) pre-labeled with carboxytetramethylrhodamine (TAMRA). PMID:27260427

  19. Catalytic activity of metal oxides in hydrogen sulfide oxidation by oxygen and sulfur dioxide

    SciTech Connect

    Marshneva, V.I.; Mokrinskii, V.V.

    1989-02-01

    Separate investigations have been made of the catalytic activities of a wide range of oxides by groups I-VIII metals in the Claus reaction and oxidation of H/sub 2/S by oxygen. Only 9 of 21 oxides used in the Claus reaction exhibit stable activity. The remaining oxides are deactivated, mainly by absorbing H/sub 2/S and being converted into sulfides. There are similar tendencies in the changes of sulfur formation specific velocities in both processes in the series of stable oxides V/sub 2/O/sub 5/, TiO/sub 2/, Mn/sub 2/O/sub 3/, Al/sub 2/O/sub 3/, MgO, Cr/sub 2/O/sub 3/. Vanadium pentoxide is the most active catalyst in the total and partial oxidations of H/sub 2/S and the Claus reaction.

  20. Partially Hydrogenated Graphene Materials Exhibit High Electrocatalytic Activities Related to Unintentional Doping with Metallic Impurities.

    PubMed

    Jankovský, Ondřej; Libánská, Alena; Bouša, Daniel; Sedmidubský, David; Matějková, Stanislava; Sofer, Zdeněk

    2016-06-13

    Partially hydrogenated graphene materials, synthesized by the chemical reduction/hydrogenation of two different graphene oxides using zinc powder in acidic environment or aluminum powder in alkaline environment, exhibit high electrocatalytic activities, as well as electrochemical sensing properties. The starting graphene oxides and the resultant hydrogenated graphenes were characterized in detail. Their electrocatalytic activity was examined in the oxygen reduction reaction, whereas sensing properties towards explosives were tested by using picric acid as a redox probe. Findings indicate that the high electrocatalytic performance originates not only from the hydrogenation of graphene, but also from unintentional contamination of graphene with manganese and other metals during synthesis. A careful evaluation of the obtained data and a detailed chemical analysis are necessary to identify the origin of this anomalous electrocatalytic activity. PMID:27167069