Science.gov

Sample records for active metal oxo

  1. A Mononuclear Non-Heme Manganese(IV)-Oxo Complex Binding Redox-Inactive Metal Ions

    SciTech Connect

    Chen, Junying; Lee, Yong-Min; Davis, Katherine M.; Wu, Xiujuan; Seo, Mi Sook; Cho, Kyung-Bin; Yoon, Heejung; Park, Young Jun; Fukuzumi, Shunichi; Pushkar, Yulia N.; Nam, Wonwoo

    2013-05-29

    Redox-inactive metal ions play pivotal roles in regulating the reactivities of high-valent metal–oxo species in a variety of enzymatic and chemical reactions. A mononuclear non-heme Mn(IV)–oxo complex bearing a pentadentate N5 ligand has been synthesized and used in the synthesis of a Mn(IV)–oxo complex binding scandium ions. The Mn(IV)–oxo complexes were characterized with various spectroscopic methods. The reactivities of the Mn(IV)–oxo complex are markedly influenced by binding of Sc3+ ions in oxidation reactions, such as a ~2200-fold increase in the rate of oxidation of thioanisole (i.e., oxygen atom transfer) but a ~180-fold decrease in the rate of C–H bond activation of 1,4-cyclohexadiene (i.e., hydrogen atom transfer). The present results provide the first example of a non-heme Mn(IV)–oxo complex binding redox-inactive metal ions that shows a contrasting effect of the redox-inactive metal ions on the reactivities of metal–oxo species in the oxygen atom transfer and hydrogen atom transfer reactions.

  2. Revisiting the Polyoxometalate-Based Late-Transition-Metal-Oxo Complexes: The “Oxo Wall” Stands

    SciTech Connect

    O; Halloran, Kevin P.; Zhao, Chongchao; Ando, Nicole S.; Schultz, Arthur J.; Koetzle, Thomas F.; Piccoli, Paula M. B.; Hedman, Britt; Hodgson, Keith O.; Bobyr, Elena; Kirk, Martin L.; Knottenbelt, Sushilla; Depperman, Ezra C.; Stein, Benjamin: Anderson, Travis M.; Cao, Rui; Geletii, Yurii V.; Hardcastle, Kenneth I.; Musaev, Djamaladdin G.; Neiwert, Wade A.; Fang, Xikui; Morokuma, Keiji; Wu, Shaoxiong; Koegerler, Paul, Hill, Craig L.

    2012-06-13

    Terminal oxo complexes of the late transition metals Pt, Pd, and Au have been reported by us in Science and Journal of the American Chemical Society. Despite thoroughness in characterizing these complexes (multiple independent structural methods and up to 17 analytical methods in one case), we have continued to study these structures. Initial work on these systems was motivated by structural data from X-ray crystallography and neutron diffraction and 17O and 31P NMR signatures which all indicated differences from all previously published compounds. With significant new data, we now revisit these studies. New X-ray crystal structures of previously reported complexes K14[P2W19O69(OH2)] and “K10Na3[PdIV(O)(OH)WO(OH2)(PW9O34)2]” and a closer examination of these structures are provided. Also presented are the 17O NMR spectrum of an 17O-enriched sample of [PW11O39]7– and a careful combined 31P NMR-titration study of the previously reported “K7H2[Au(O)(OH2)P2W20O70(OH2)2].” These and considerable other data collectively indicate that previously assigned terminal Pt-oxo and Au-oxo complexes are in fact cocrystals of the all-tungsten structural analogues with noble metal cations, while the Pd-oxo complex is a disordered Pd(II)-substituted polyoxometalate. The neutron diffraction data have been re-analyzed, and new refinements are fully consistent with the all-tungsten formulations of the Pt-oxo and Au-oxo polyoxometalate species.

  3. A Manganese(V)-Oxo Complex: Synthesis by Dioxygen Activation and Enhancement of Its Oxidizing Power by Binding Scandium Ion.

    PubMed

    Hong, Seungwoo; Lee, Yong-Min; Sankaralingam, Muniyandi; Vardhaman, Anil Kumar; Park, Young Jun; Cho, Kyung-Bin; Ogura, Takashi; Sarangi, Ritimukta; Fukuzumi, Shunichi; Nam, Wonwoo

    2016-07-13

    A mononuclear non-heme manganese(V)-oxo complex, [Mn(V)(O)(TAML)](-) (1), was synthesized by activating dioxygen in the presence of olefins with weak allylic C-H bonds and characterized structurally and spectroscopically. In mechanistic studies, the formation rate of 1 was found to depend on the allylic C-H bond dissociation energies (BDEs) of olefins, and a kinetic isotope effect (KIE) value of 16 was obtained in the reactions of cyclohexene and cyclohexene-d10. These results suggest that a hydrogen atom abstraction from the allylic C-H bonds of olefins by a putative Mn(IV)-superoxo species, which is formed by binding O2 by a high-spin (S = 2) [Mn(III)(TAML)](-) complex, is the rate-determining step. A Mn(V)-oxo complex binding Sc(3+) ion, [Mn(V)(O)(TAML)](-)-(Sc(3+)) (2), was also synthesized in the reaction of 1 with Sc(3+) ion and then characterized using various spectroscopic techniques. The binding site of the Sc(3+) ion was proposed to be the TAML ligand, not the Mn-O moiety, probably due to the low basicity of the oxo group compared to the basicity of the amide carbonyl group in the TAML ligand. Reactivity studies of the Mn(V)-oxo intermediates, 1 and 2, in oxygen atom transfer and electron-transfer reactions revealed that the binding of Sc(3+) ion at the TAML ligand of Mn(V)-oxo enhanced its oxidizing power with a positively shifted one-electron reduction potential (ΔEred = 0.70 V). This study reports the first example of tuning the second coordination sphere of high-valent metal-oxo species by binding a redox-inactive metal ion at the supporting ligand site, thereby modulating their electron-transfer properties as well as their reactivities in oxidation reactions.

  4. A Manganese(V)-Oxo Complex: Synthesis by Dioxygen Activation and Enhancement of Its Oxidizing Power by Binding Scandium Ion.

    PubMed

    Hong, Seungwoo; Lee, Yong-Min; Sankaralingam, Muniyandi; Vardhaman, Anil Kumar; Park, Young Jun; Cho, Kyung-Bin; Ogura, Takashi; Sarangi, Ritimukta; Fukuzumi, Shunichi; Nam, Wonwoo

    2016-07-13

    A mononuclear non-heme manganese(V)-oxo complex, [Mn(V)(O)(TAML)](-) (1), was synthesized by activating dioxygen in the presence of olefins with weak allylic C-H bonds and characterized structurally and spectroscopically. In mechanistic studies, the formation rate of 1 was found to depend on the allylic C-H bond dissociation energies (BDEs) of olefins, and a kinetic isotope effect (KIE) value of 16 was obtained in the reactions of cyclohexene and cyclohexene-d10. These results suggest that a hydrogen atom abstraction from the allylic C-H bonds of olefins by a putative Mn(IV)-superoxo species, which is formed by binding O2 by a high-spin (S = 2) [Mn(III)(TAML)](-) complex, is the rate-determining step. A Mn(V)-oxo complex binding Sc(3+) ion, [Mn(V)(O)(TAML)](-)-(Sc(3+)) (2), was also synthesized in the reaction of 1 with Sc(3+) ion and then characterized using various spectroscopic techniques. The binding site of the Sc(3+) ion was proposed to be the TAML ligand, not the Mn-O moiety, probably due to the low basicity of the oxo group compared to the basicity of the amide carbonyl group in the TAML ligand. Reactivity studies of the Mn(V)-oxo intermediates, 1 and 2, in oxygen atom transfer and electron-transfer reactions revealed that the binding of Sc(3+) ion at the TAML ligand of Mn(V)-oxo enhanced its oxidizing power with a positively shifted one-electron reduction potential (ΔEred = 0.70 V). This study reports the first example of tuning the second coordination sphere of high-valent metal-oxo species by binding a redox-inactive metal ion at the supporting ligand site, thereby modulating their electron-transfer properties as well as their reactivities in oxidation reactions. PMID:27310336

  5. Spectroscopic capture and reactivity of a low-spin cobalt(IV)-oxo complex stabilized by binding redox-inactive metal ions.

    PubMed

    Hong, Seungwoo; Pfaff, Florian F; Kwon, Eunji; Wang, Yong; Seo, Mi-Sook; Bill, Eckhard; Ray, Kallol; Nam, Wonwoo

    2014-09-22

    High-valent cobalt-oxo intermediates are proposed as reactive intermediates in a number of cobalt-complex-mediated oxidation reactions. Herein we report the spectroscopic capture of low-spin (S=1/2) Co(IV)-oxo species in the presence of redox-inactive metal ions, such as Sc(3+), Ce(3+), Y(3+), and Zn(2+), and the investigation of their reactivity in C-H bond activation and sulfoxidation reactions. Theoretical calculations predict that the binding of Lewis acidic metal ions to the cobalt-oxo core increases the electrophilicity of the oxygen atom, resulting in the redox tautomerism of a highly unstable [(TAML)Co(III)(O˙)](2-) species to a more stable [(TAML)Co(IV)(O)(M(n+))] core. The present report supports the proposed role of the redox-inactive metal ions in facilitating the formation of high-valent metal-oxo cores as a necessary step for oxygen evolution in chemistry and biology.

  6. Molecular metal-Oxo catalysts for generating hydrogen from water

    SciTech Connect

    Long, Jeffrey R; Chang, Christopher J; Karunadasa, Hemamala I

    2015-02-24

    A composition of matter suitable for the generation of hydrogen from water is described, the positively charged cation of the composition having the general formula [(PY5W.sub.2)MO].sup.2+, wherein PY5W.sub.2 is (NC.sub.5XYZ)(NC.sub.5H.sub.4).sub.4C.sub.2W.sub.2, M is a transition metal, and W, X, Y, and Z can be H, R, a halide, CF.sub.3, or SiR.sub.3, where R can be an alkyl or aryl group. The two accompanying counter anions, in one embodiment, can be selected from the following Cl.sup.-, I.sup.-, PF.sub.6.sup.-, and CF.sub.3SO.sub.3.sup.-. In embodiments of the invention, water, such as tap water containing electrolyte or straight sea water can be subject to an electric potential of between 1.0 V and 1.4 V relative to the standard hydrogen electrode, which at pH 7 corresponds to an overpotential of 0.6 to 1.0 V, with the result being, among other things, the generation of hydrogen with an optimal turnover frequency of ca. 1.5 million mol H.sub.2/mol catalyst per h.

  7. High-valent metal-oxo intermediates in energy demanding processes: from dioxygen reduction to water splitting.

    PubMed

    Ray, Kallol; Heims, Florian; Schwalbe, Matthias; Nam, Wonwoo

    2015-04-01

    Four-electron reduction of dioxygen to water and splitting of water to dioxygen are extremely important processes in the context of attaining clean renewable energy sources. High-valent metal-oxo cores are proposed as reactive intermediates in these vital processes, although they have only been isolated in extremely rare cases in the biological systems thereby making the mechanism ambiguous. Recent biomimetic studies have, however, aided in our understanding of the fundamental reactivity of the high-valent metal-oxo species in various reactions relevant to energy conversion. All these studies are summarized in the present review.

  8. Metal-oxo containing polymer nanobeads as potential contrast agents for magnetic resonance imaging

    NASA Astrophysics Data System (ADS)

    Pablico, Michele Huelar

    Magnetic resonance imaging (MRI) has greatly revolutionized the way diseases are detected and treated, as it is a non-invasive imaging modality solely based on the interaction of radiowaves and hydrogen nuclei in the presence of an external magnetic field. It is widely used today for the diagnosis of diseases as it offers an efficient method of mapping structure and function of soft tissues in the body. Most MRI examinations utilize paramagnetic materials known as contrast agents, which enhance the MR signal by decreasing the longitudinal (T1) and transverse (T2) relaxation times of the surrounding water protons in biological systems. This results into increased signal intensity differences thereby allowing better interpretation and analysis of pathological tissues. Contrast agents function by lowering the T1 or lowering the T2, resulting into bright and dark contrasts, respectively. The most common MRI contrast agents that are in clinical use today are gadolinium chelates and superparamagnetic iron oxide nanoparticles, both of which have their own advantages in terms of contrast enhancement properties. In the past few years, however, there has been interest in utilizing metal-containing clusters for MRI contrast enhancement as these materials bridge the gap between the constrained structure and magnetic properties of the gadolinium chelates with the superparamagnetic behavior of the iron oxide nanoparticles. Recently, metallic clusters containing Mn and Fe metal centers have received increased attention mainly because of their potential for high spin states and benign nature. In the quest to further develop novel imaging agents, this research has focused on investigating the use of metal-oxo clusters as potential contrast agents for MRI. The primary goal of this project is to identify clusters that meet the following criteria: high paramagnetic susceptibility, water-soluble, stable, cheap, contain environmentally benign metals, and easily derivatized. This work is

  9. 13-Oxo-9(Z),11(E),15(Z)-octadecatrienoic acid activates peroxisome proliferator-activated receptor γ in adipocytes.

    PubMed

    Takahashi, Haruya; Hara, Hideyuki; Goto, Tsuyoshi; Kamakari, Kosuke; Wataru, Nomura; Mohri, Shinsuke; Takahashi, Nobuyuki; Suzuki, Hideyuki; Shibata, Daisuke; Kawada, Teruo

    2015-01-01

    Peroxisome proliferator-activated receptor (PPAR)γ is expressed in adipose tissue and plays a key role in the regulation of adipogenesis. PPARγ activators are known to have potent antihyperglycemic activity and are used to treat insulin resistance associated with diabetes. Therefore, many natural and synthetic agonists of PPARγ are used in the treatment of glucose disorders. In the present study, we found that 13-oxo-9(Z),11(E),15(Z)-octadecatrienoic acid (13-oxo-OTA), a linolenic acid derivative, is present in the extract of tomato (Solanum lycopersicum), Mandarin orange (Citrus reticulata), and bitter gourd (Momordica charantia). We also found that 13-oxo-OTA activated PPARγ and induced the mRNA expression of PPARγ target genes in adipocytes, thereby promoting differentiation. Furthermore, 13-oxo-OTA induced secretion of adiponectin and stimulated glucose uptake in adipocytes. To our knowledge, this is the first study to report that 13-oxo-OTA induces adipogenesis through PPARγ activation and to present 13-oxo-OTA as a valuable food-derived compound that may be applied in the management of glucose metabolism disorders. PMID:25425149

  10. High-valent oxo-molybdenum and oxo-rhenium complexes as efficient catalysts for X-H (X = Si, B, P and H) bond activation and for organic reductions.

    PubMed

    Sousa, Sara C A; Cabrita, Ivânia; Fernandes, Ana C

    2012-09-01

    High-valent oxo-complexes have recently emerged as powerful catalysts for the activation of X-H (X = Si, B, P and H) bonds and for the reduction of several functional groups. This new reactivity represents a complete reversal from the traditional role of these complexes as oxidation catalysts and opened a new research area for high-valent oxo-complexes. This tutorial review highlights the work developed using high-valent oxo-molybdenum and oxo-rhenium complexes as excellent catalysts for X-H (X = Si, B, P and H) bond activation and for organic reductions. PMID:22786441

  11. To rebound or dissociate? This is the mechanistic question in C-H hydroxylation by heme and nonheme metal-oxo complexes.

    PubMed

    Cho, Kyung-Bin; Hirao, Hajime; Shaik, Sason; Nam, Wonwoo

    2016-03-01

    Enzymatic reactions that involve C-H bond activation of alkanes by high-valent iron-oxo species can be explained by the rebound mechanism (RM). Hydroxylation reactions of alkane substrates effected by the reactive compound I (Cpd I) species of cytochrome P450 enzymes are good examples. There was initially little doubt that the rebound paradigm could be carried over in the same form to the arena of synthetic nonheme high-valent iron-oxo or other metal-oxo complexes. However, the active reaction centres of these synthetic systems are not well-caged, in contrast to the active sites of enzymes; therefore, the relative importance of the radical dissociation pathway can become prominent. Indeed, accumulating experimental and theoretical evidence shows that introduction of the non-rebound mechanism (non-RM) is necessary to rationalise the different reactivity patterns observed for synthetic nonheme complexes. In this tutorial review, we discuss several specific examples involving the non-RM while making frequent comparisons to the RM, mainly from the perspective of computational chemistry. We also provide a technical guide to DFT calculations of RM and non-RM and to the interpretations of computational outcomes. PMID:26690848

  12. To rebound or dissociate? This is the mechanistic question in C-H hydroxylation by heme and nonheme metal-oxo complexes.

    PubMed

    Cho, Kyung-Bin; Hirao, Hajime; Shaik, Sason; Nam, Wonwoo

    2016-03-01

    Enzymatic reactions that involve C-H bond activation of alkanes by high-valent iron-oxo species can be explained by the rebound mechanism (RM). Hydroxylation reactions of alkane substrates effected by the reactive compound I (Cpd I) species of cytochrome P450 enzymes are good examples. There was initially little doubt that the rebound paradigm could be carried over in the same form to the arena of synthetic nonheme high-valent iron-oxo or other metal-oxo complexes. However, the active reaction centres of these synthetic systems are not well-caged, in contrast to the active sites of enzymes; therefore, the relative importance of the radical dissociation pathway can become prominent. Indeed, accumulating experimental and theoretical evidence shows that introduction of the non-rebound mechanism (non-RM) is necessary to rationalise the different reactivity patterns observed for synthetic nonheme complexes. In this tutorial review, we discuss several specific examples involving the non-RM while making frequent comparisons to the RM, mainly from the perspective of computational chemistry. We also provide a technical guide to DFT calculations of RM and non-RM and to the interpretations of computational outcomes.

  13. 9-Oxo-10(E),12(Z),15(Z)-Octadecatrienoic Acid Activates Peroxisome Proliferator-Activated Receptor α in Hepatocytes.

    PubMed

    Takahashi, Haruya; Kamakari, Kosuke; Goto, Tsuyoshi; Hara, Hideyuki; Mohri, Shinsuke; Suzuki, Hideyuki; Shibata, Daisuke; Nakata, Rieko; Inoue, Hiroyasu; Takahashi, Nobuyuki; Kawada, Teruo

    2015-11-01

    The peroxisome proliferator-activated receptor (PPAR)α is mainly expressed in the liver and plays an important role in the regulation of lipid metabolism. It has been reported that PPARα activation enhances fatty acid oxidation and reduces fat storage. Therefore, PPARα agonists are used to treat dyslipidemia. In the present study, we found that 9-oxo-10(E),12(Z),15(Z)-octadecatrienoic acid (9-oxo-OTA), which is a α-linolenic acid (ALA) derivative, is present in tomato (Solanum lycopersicum) extract. We showed that 9-oxo-OTA activated PPARα and induced the mRNA expression of PPARα target genes in murine primary hepatocytes. These effects promoted fatty acid uptake and the secretion of β-hydroxybutyrate, which is one of the endogenous ketone bodies. We also demonstrated that these effects of 9-oxo-OTA were not observed in PPARα-knockout (KO) primary hepatocytes. To our knowledge, this is the first study to report that 9-oxo-OTA promotes fatty acid metabolism via PPARα activation and discuss its potential as a valuable food-derived compound for use in the management of dyslipidemia. PMID:26387026

  14. Ab Initio Study of the Adsorption of Small Molecules on Metal-Organic Frameworks with Oxo-centered Trimetallic Building Units: The Role of the Undercoordinated Metal Ion.

    PubMed

    Mavrandonakis, Andreas; Vogiatzis, Konstantinos D; Boese, A Daniel; Fink, Karin; Heine, Thomas; Klopper, Wim

    2015-09-01

    The interactions of H2, CO, CO2, and H2O with the undercoordinated metal centers of the trimetallic oxo-centered M3(III)(μ3-O)(X) (COO)6 moiety are studied by means of wave function and density functional theory. This trimetallic oxo-centered cluster is a common building unit in several metal-organic frameworks (MOFs) such as MIL-100, MIL-101, and MIL-127 (also referred to as soc-MOF). A combinatorial computational screening is performed for a large variety of trimetallic oxo-centered units M3(III)O (M = Al(3+), Sc(3+), V(3+), Cr(3+), Fe(3+), Ga(3+), Rh(3+), In(3+), Ir(3+)) interacting with H2O, H2, CO, and CO2. The screening addresses interaction energies, adsorption enthalpies, and vibrational properties. The results show that the Rh and Ir analogues are very promising materials for gas storage and separations.

  15. Probing the selective antitumor activity of 22-oxo-26-selenocyanocholestane derivatives.

    PubMed

    Fernández-Herrera, María A; Sandoval-Ramírez, Jesús; Sánchez-Sánchez, Luis; López-Muñoz, Hugo; Escobar-Sánchez, María L

    2014-03-01

    Diverse steroidal compounds have shown antiproliferative activity on certain tumor cell lines; however, their complete role on cancer cells has not been extensively established since the research is quite recent. Hence, deeper study in this field is required. Due to the importance of selenium in animal and human health; herein, we report the synthesis, characterization, and biological evaluation of two novel 22-oxo-26-selenocyanocholestanic steroids on cervicouterine cancer cells and non-tumor cells. The title compounds were straightforward prepared from diosgenin and hecogenin in excellent overall yields. We determined their effect on cell proliferation on HeLa, CaSki, and ViBo cell cultures. Their cytotoxic effect on tumor cells, as well as on peripheral blood lymphocytes was also evaluated. The increase in the expression of active caspase-3 along with the fragmentation of DNA confirm that the new 22-oxo-26-selenocyanocholestane frameworks potentiate apoptosis in tumor cells. The antiproliferative activity on tumor cells affects to some extent the proliferative potential of peripheral blood lymphocytes, so an immunosuppressive effect has also been established. The novel 22-oxo-26-selenocyanocholestane compounds show selective antitumor activity and therefore are promising lead candidates for further in vivo evaluation.

  16. Cationic tungsten-oxo-alkylidene-N-heterocyclic carbene complexes: highly active olefin metathesis catalysts.

    PubMed

    Schowner, Roman; Frey, Wolfgang; Buchmeiser, Michael R

    2015-05-20

    The synthesis, structure, and olefin metathesis activity of the first neutral and cationic W-oxo-alkylidene-N-heterocyclic carbene (NHC) catalysts are reported. Neutral W-oxo-alkylidene-NHC catalysts can be prepared in up to 90% isolated yield. Depending on the ligands used, they possess either an octahedral (Oh) or trigonal bipyramidal ligand sphere. They can be activated with excess AlCl3 to form cationic olefin metathesis-active W-complexes; however, these readily convert into neutral chloro-complexes. Well-defined, stable cationic species can be prepared by stoichiometric substitution of one chloro ligand in the parent, neutral W-oxo-alkylidene-NHC complexes with Ag(MeCN)2B(Ar(F))4 or NaB(Ar(F))4; B(Ar(F))4 = B(3,5-(CF3)2-C6H3)4. They are highly active olefin metathesis catalysts, allowing for turnover numbers up to 10,000 in various olefin metathesis reactions including alkenes bearing nitrile, sec-amine, and thioether groups. PMID:25938340

  17. Cationic tungsten-oxo-alkylidene-N-heterocyclic carbene complexes: highly active olefin metathesis catalysts.

    PubMed

    Schowner, Roman; Frey, Wolfgang; Buchmeiser, Michael R

    2015-05-20

    The synthesis, structure, and olefin metathesis activity of the first neutral and cationic W-oxo-alkylidene-N-heterocyclic carbene (NHC) catalysts are reported. Neutral W-oxo-alkylidene-NHC catalysts can be prepared in up to 90% isolated yield. Depending on the ligands used, they possess either an octahedral (Oh) or trigonal bipyramidal ligand sphere. They can be activated with excess AlCl3 to form cationic olefin metathesis-active W-complexes; however, these readily convert into neutral chloro-complexes. Well-defined, stable cationic species can be prepared by stoichiometric substitution of one chloro ligand in the parent, neutral W-oxo-alkylidene-NHC complexes with Ag(MeCN)2B(Ar(F))4 or NaB(Ar(F))4; B(Ar(F))4 = B(3,5-(CF3)2-C6H3)4. They are highly active olefin metathesis catalysts, allowing for turnover numbers up to 10,000 in various olefin metathesis reactions including alkenes bearing nitrile, sec-amine, and thioether groups.

  18. The reactions of Cr(CO)6, Fe(CO)5, and Ni(CO)4 with O2 yield viable oxo-metal carbonyls.

    PubMed

    Sun, Zhi; Schaefer, Henry F; Xie, Yaoming; Liu, Yongdong; Zhong, Rugang

    2014-05-15

    Transition metal complexes with terminal oxo and dioxygen ligands exist in metal oxidation reactions, and many are key intermediates in various catalytic and biological processes. The prototypical oxo-metal [(OC)5Cr-O, (OC)4Fe-O, and (OC)3 Ni-O] and dioxygen-metal carbonyls [(OC)5Cr-OO, (OC)4Fe-OO, and (OC)3Ni-OO] are studied theoretically. All three oxo-metal carbonyls were found to have triplet ground states, with metal-oxo bond dissociation energies of 77 (Cr-O), 74 (Fe-O), and 51 (Ni-O) kcal/mol. Natural bond orbital and quantum theory of atoms in molecules analyses predict metal-oxo bond orders around 1.3. Their featured ν(MO, M = metal) vibrational frequencies all reflect very low IR intensities, suggesting Raman spectroscopy for experimental identification. The metal interactions with O2 are much weaker [dissociation energies 13 (Cr-OO), 21 (Fe-OO), and 4 (Ni-OO) kcal/mol] for the dioxygen-metal carbonyls. The classic parent compounds Cr(CO)6, Fe(CO)5, and Ni(CO)4 all exhibit thermodynamic instability in the presence of O2 , driven to displacement of CO to form CO2. The latter reactions are exothermic by 47 [Cr(CO)6], 46 [Fe(CO)5], and 35 [Ni(CO)4] kcal/mol. However, the barrier heights for the three reactions are very large, 51 (Cr), 39 (Fe), and 40 (Ni) kcal/mol. Thus, the parent metal carbonyls should be kinetically stable in the presence of oxygen.

  19. [Synthesis and investigation on antidiabetic activity of 4-(1-aryl-3-oxo-5-phenylpentylamino) benzenesulfonamide].

    PubMed

    Yang, Da-Cheng; Yan, Ju-Fang; Xu, Jin; Ye, Fei; Zhou, Zu-Wen; Zhang, Wei-Yu; Fan, Li; Chen, Xin

    2010-01-01

    Searching for new antidiabetic lead compound, 4-(1-aryl-3-oxo-5-phenylpentylamino) benzenesulfonamides were designed and synthesized directly by three component one-pot condensation of 4-phenyl-2-butanone and sulfanilamide with some aromatic aldehydes at an yield of 23%-97%. The chemical structures of the twelve new Mannich bases were confirmed by 1H NMR, 13C NMR, FTIR, ESI-MS and HR-MS. The screening results of antidiabetic activity indicated that most of these title compounds possess alpha-glucosidase inhibitory activity, among which compound le is the strongest one. And compound 11 possesses good peroxisome proliferator-activated receptor response element (PPRE) agonist activity. The structure-activity relationship of these new beta-amino ketones containing benzenesulfonamide unit was also discussed preliminarily. PMID:21351452

  20. Switching on the Metathesis Activity of Re Oxo Alkylidene Surface Sites through a Tailor-Made Silica-Alumina Support.

    PubMed

    Valla, Maxence; Stadler, David; Mougel, Victor; Copéret, Christophe

    2016-01-18

    Re oxo alkylidene surface species are putative active sites in classical heterogeneous Re-based alkene-metathesis catalysts. However, the lack of evidence for such species questions their existence and/or relevance as reaction intermediates. Using Re(O)(=CH-CH=CPh2)(OtBuF6)3(THF), the corresponding well-defined Re oxo alkylidene surface species can be generated on both silica and silica-alumina supports. While inactive on the silica support, it displays very good activity, even for functionalized olefins, on the silica-alumina support. PMID:26756446

  1. Highly Active Gold(I)-Silver(I) Oxo Cluster Activating sp³ C-H Bonds of Methyl Ketones under Mild Conditions.

    PubMed

    Pei, Xiao-Li; Yang, Yang; Lei, Zhen; Chang, Shan-Shan; Guan, Zong-Jie; Wan, Xian-Kai; Wen, Ting-Bin; Wang, Quan-Ming

    2015-04-29

    The activation of C(sp(3))-H bonds is challenging, due to their high bond dissociation energy, low proton acidity, and highly nonpolar character. Herein we report a unique gold(I)-silver(I) oxo cluster protected by hemilabile phosphine ligands [OAu3Ag3(PPhpy2)3](BF4)4 (1), which can activate C(sp(3))-H bonds under mild conditions for a broad scope of methyl ketones (RCOCH3, R = methyl, phenyl, 2-methylphenyl, 2-aminophenyl, 2-hydroxylphenyl, 2-pyridyl, 2-thiazolyl, tert-butyl, ethyl, isopropyl). Activation happens via triple deprotonation of the methyl group, leading to formation of heterometallic Au(I)-Ag(I) clusters with formula RCOCAu4Ag4(PPhpy2)4(BF4)5 (PPhpy2 = bis(2-pyridyl)phenylphosphine). Cluster 1 can be generated in situ via the reaction of [OAu3Ag(PPhpy2)3](BF4)2 with 2 equiv of AgBF4. The oxo ion and the metal centers are found to be essential in the cleavage of sp(3) C-H bonds of methyl ketones. Interestingly, cluster 1 selectively activates the C-H bonds in -CH3 rather than the N-H bonds in -NH2 or the O-H bond in -OH which is traditionally thought to be more reactive than C-H bonds. Control experiments with butanone, 3-methylbutanone, and cyclopentanone as substrates show that the auration of the C-H bond of the terminal methyl group is preferred over secondary or tertiary sp(3) C-H bonds; in other words, the C-H bond activation is influenced by steric effect. This work highlights the powerful reactivity of metal clusters toward C-H activation and sheds new light on gold(I)-mediated catalysis.

  2. A late-transition metal oxo complex: K7Na9[O=PtIV(H2O)L2], L = [PW9O34]9-.

    PubMed

    Anderson, Travis M; Neiwert, Wade A; Kirk, Martin L; Piccoli, Paula M B; Schultz, Arthur J; Koetzle, Thomas F; Musaev, Djamaladdin G; Morokuma, Keiji; Cao, Rui; Hill, Craig L

    2004-12-17

    Terminal mono-oxo complexes of the late transition metal elements have long been considered too unstable to synthesize because of repulsion between the oxygen electrons and the mostly filled metal d orbitals. A platinum(IV)-oxo compound flanked by two polytungstate ligands, K7Na9[O=Pt(H2O)L2], L = [PW9O34(9-)], has now been prepared and isolated at room temperature as air-stable brown crystals. X-ray and neutron diffraction at 30 kelvin revealed a very short [1.720(18) angstrom] Pt-O bond and no evidence of a hydrogen atom at the terminal oxygen, ruling out a better precedented Pt-OH complex. Density functional theory and spectroscopic data account for the stability of the Pt(IV)-oxo unit by electron withdrawal into delocalized orbitals of the polytungstates. PMID:15564312

  3. A Highly Reactive Mononuclear Non-Heme Manganese(IV)-Oxo Complex That Can Activate the Strong C-H Bonds of Alkanes

    SciTech Connect

    Wu, Xiujuan; Seo, Mi Sook; Davis, Katherine M; Lee, Yong-Min; Chen, Junying; Cho, Kyung-Bin; Pushkar, Yulia N; Nam, Wonwoo

    2012-03-15

    A mononuclear non-heme manganese(IV)-oxo complex has been synthesized and characterized using various spectroscopic methods. The Mn(IV)-oxo complex shows high reactivity in oxidation reactions, such as C-H bond activation, oxidations of olefins, alcohols, sulfides, and aromatic compounds, and N-dealkylation. In C-H bond activation, the Mn(IV)-oxo complex can activate C-H bonds as strong as those in cyclohexane. It is proposed that C-H bond activation by the non-heme Mn(IV)-oxo complex does not occur via an oxygen-rebound mechanism. The electrophilic character of the non-heme Mn(IV)-oxo complex is demonstrated by a large negative ρ value of ~4.4 in the oxidation of para-substituted thioanisoles.

  4. A Metal-Organic Framework Containing Unusual Eight-Connected Zr–-Oxo Secondary Building Units and Orthogonal Carboxylic Acids for Ultra-sensitive Metal Detection

    SciTech Connect

    Carboni, Michaël; Lin, Zekai; Abney, Carter W.; Zhang, Teng; Lin, Wenbin

    2015-08-21

    Two metal-organic frameworks (MOFs) with Zr-oxo secondary building units (SBUs) were prepared by using p,p'-terphenyldicarboxylate (TPDC) bridging ligands pre-functionalized with orthogonal succinic acid (MOF-1) and maleic acid groups (MOF-2). Single-crystal X-ray structure analysis of MOF-1 provides the first direct evidence for eight-connected SBUs in UiO-type MOFs. In contrast, MOF-2 contains twelve-connected SBUs as seen in the traditional UiO MOF topology. These structural assignments were confirmed by extended X-ray absorption fine structure (EXAFS) analysis. The highly porous MOF-1 is an excellent fluorescence sensor for metal ions with the detection limit of <0.5 ppb for Mn2+ and three to four orders of magnitude greater sensitivity for metal ions than previously reported luminescent MOFs.

  5. Characterization and catalytic activity of covalently linked bipyridyl ruthenium OXO dimers

    SciTech Connect

    Petach, H.H.; Elliott, C.M. . Dept. of Chemistry)

    1992-08-01

    This paper reports that covalently linked bipyridyl ligands (L-L) with alkyl linkages varying from (-CH[sub 2]-)[sub 2] to (-CH[sub 2]-)[sub 12] were used to prepare ruthenium oxo dimers of the form [bpy (H[sub 2]O)RuO(L-L)Ru(H[sub 2]O) (bpy)][sup 4+]. The bridging alkyl linkage increased the stability of these oxo dimers by maintaining the relative proximity of the two ruthenium centers even when the oxo bridge is cleaved. These complexes have been characterized by electronic spectroscopy and electrochemistry. The electrochemistry in CH[sub 3]CN/0.1M TBAP exhibits a reversible one-electron oxidation followed by a second reversible two-electron oxidation which becomes catalytic in aqueous solution. The catalytic generation of dioxygen from water was observed upon bulk electrolysis of the oxo dimer at + 1.39 V.

  6. Control of oxo-group functionalization and reduction of the uranyl ion.

    PubMed

    Arnold, Polly L; Pécharman, Anne-Frédérique; Lord, Rianne M; Jones, Guy M; Hollis, Emmalina; Nichol, Gary S; Maron, Laurent; Fang, Jian; Davin, Thomas; Love, Jason B

    2015-04-01

    Uranyl complexes of a large, compartmental N8-macrocycle adopt a rigid, "Pacman" geometry that stabilizes the U(V) oxidation state and promotes chemistry at a single uranyl oxo-group. We present here new and straightforward routes to singly reduced and oxo-silylated uranyl Pacman complexes and propose mechanisms that account for the product formation, and the byproduct distributions that are formed using alternative reagents. Uranyl(VI) Pacman complexes in which one oxo-group is functionalized by a single metal cation are activated toward single-electron reduction. As such, the addition of a second equivalent of a Lewis acidic metal complex such as MgN″2 (N″ = N(SiMe3)2) forms a uranyl(V) complex in which both oxo-groups are Mg functionalized as a result of Mg-N bond homolysis. In contrast, reactions with the less Lewis acidic complex [Zn(N″)Cl] favor the formation of weaker U-O-Zn dative interactions, leading to reductive silylation of the uranyl oxo-group in preference to metalation. Spectroscopic, crystallographic, and computational analysis of these reactions and of oxo-metalated products isolated by other routes have allowed us to propose mechanisms that account for pathways to metalation or silylation of the exo-oxo-group.

  7. Oxidations of Organic and Inorganic Substrates by Superoxo-, hydroperoxo-, and oxo-compounds of the transition metals.

    SciTech Connect

    Vasbinder, Michael John

    2006-01-01

    fitting the observed rate constants to the Hammett correlation. It was found that the values of the Hammett reaction constant PN were -1.0(1) for 4-nitro-2-methylpyridine-N-oxide and -2.6(4) for 4-methylpyridine-N-oxide as substrates. The negative value confirms pyridine is acting as a nucleophile. Nucleophiles other than pyridine derivatives were also tested. In the end, it was found that the most effective nucleophiles were the pyridine-N-oxides themselves, meaning that a second equivalent of substrate serves as the most efficient promoter of this oxygen-atom transfer reaction. This relative nucleophilicity of pyridines and pyridine-N-oxides is similar to what is observed in other OAT reactions generating high-valent metal-oxo species.

  8. Anti-inflammatory, analgesic and antioxidant activities of 3,4-oxo-isopropylidene-shikimic acid.

    PubMed

    Sun, Jin-Yao; You, Cui-Yu; Dong, Kai; You, Hai-Sheng; Xing, Jian-Feng

    2016-10-01

    Context 3,4-Oxo-isopropylidene-shikimic acid (ISA) is an analog of shikimic acid (SA). SA is extracted from the dry fruit of Illicium verum Hook. f. (Magnoliaceae), which has been used for treating stomachaches, skin inflammation and rheumatic pain. Objective To investigate the anti-inflammatory, analgesic and antioxidant activities of ISA. Materials and methods Analgesic and anti-inflammatory activities of ISA were evaluated using writhing, hot plate, xylene-induced ear oedema, carrageenan-induced paw oedema and cotton pellets-induced granuloma test, meanwhile the prostaglandin E2 (PGE2) and malondialdehyde (MDA) levels were assessed in the oedema paw tissue. ISA (60, 120 and 240 mg/kg in mice model and 50, 120 and 200 mg/kg in rat model) was administered orally, 30 min before induction of inflammation/pain. Additionally, ISA was administered for 12 d in rats from the day of cotton pellet implantation. The active oxygen species scavenging potencies of ISA (10(-3)-10(-5) M) were evaluated by the electron spin resonance spin-trapping technique. Results ISA caused a reduction of inflammation induced by xylene (18.1-31.4%), carrageenan (7.8-51.0%) and cotton pellets (11.4-24.0%). Furthermore, ISA decreased the production of PGE2 and MDA in the rat paw tissue by 1.0-15.6% and 6.3-27.6%, respectively. ISA also reduced pain induced by acetic acid (15.6-48.9%) and hot plate (10.5-28.5%). Finally, ISA exhibited moderate antioxidant activity by scavenging the superoxide radical and hydroxyl radical with IC50 values of 0.214 and 0.450 μg/mL, respectively. Discussion and conclusion Our findings confirmed the anti-inflammatory, analgesic and antioxidant activities of ISA. PMID:27609150

  9. Structural, spectral, thermal and biological studies on 2-oxo-N‧-((4-oxo-4H-chromen-3-yl)methylene)-2-(phenylamino)acetohydrazide (H2L) and its metal complexes

    NASA Astrophysics Data System (ADS)

    El-Gammal, Ola A.; El-Reash, Gaber Abu; Ahmed, Sara F.

    2012-01-01

    A new series of metal complexes formed by the reaction of 2-oxo-N'-((4-oxo-4H-chromen-3-yl)methylene)-2-(phenylamino)acetohydrazide(H 2L) and Cu(II), Co(II), Ni(II), Cd(II), Zn(II), Hg(II) and U(VI) O22+ ions. The isolated complexes have been characterized by elemental analyses, spectral (IR, UV-visible and 1H NMR) as well as magnetic and thermal measurements. The data revealed that the ligand acts as neutral ON or ONO as well as mononegative ONO. On the basis of magnetic and electronic spectral data an octahedral geometry for the Co(II), Cu(II) and U(VI)O 2 complexes, a tetrahedral structure for the Ni(II), Cd(II), Zn(II) and Hg(II) complexes have been proposed. The bond length, bond angle, HOMO, LUMO, dipole moment and charges on the atoms have been calculated to confirm the geometry of the ligand and the investigated complexes. Also, kinetic parameters were determined for each thermal degradation stage of some complexes using Coats-Redfern and Horowitz-Metzger methods. Moreover, the ligand and its complexes were screened against Bacillus thuringiensis ( Bt) as Gram positive bacteria and Pseudomonas aeuroginosa ( Pa) Gram negative bacteria using the inhibitory zone diameter.

  10. Terminal Gold-Oxo Complexes

    SciTech Connect

    Cao, R.; Anderson, T.M.; Piccoli, P.M.B.; Schultz, A.J.; Koetzle, T.F.; Geletii, Y.V.; Slonkina, E.; Hedman, B.; Hodgson, K.O.; Hardcastle, K.I.; Fang, X.; Kirk, M.L.; Knottenbelt, S.; Kogerler, P.; Musaev, D.G.; Morokuma, K.; Takahashi, M.; Hill, C.L.; /Emory U. /Argonne /SLAC, SSRL /New Mexico U. /Iowa State U. /Toho U.

    2007-10-19

    In contradiction to current bonding paradigms, two terminal Au-oxo molecular complexes have been synthesized by reaction of AuCl{sub 3} with metal oxide-cluster ligands that model redox-active metal oxide surfaces. Use of K{sub 10}[{alpha}{sub 2}-P{sub 2}W{sub 17}O{sub 61}] x 20H{sub 2}O and K{sub 2}WO{sub 4} (forming the [A-PW{sub 9}O{sub 34}]{sup 9-} ligand in situ) produces K{sub 15}H{sub 2}[Au(O)(OH{sub 2})P{sub 2}W{sub 18}O{sub 68}] x 25H{sub 2}O (1); use of K{sub 10}[P{sub 2}W{sub 20}O{sub 70}(OH{sub 2}){sub 2}] x 22H{sub 2}O (3) produces K{sub 7}H{sub 2}[Au(O)(OH{sub 2})P{sub 2}W{sub 20}O{sub 70}(OH{sub 2}){sub 2}] x 27H{sub 2}O (2). Complex 1 crystallizes in orthorhombic Fddd, with a = 28.594(4) Angstroms, b = 31.866(4) Angstroms, c = 38.241(5) Angstroms, V = 34844(7) Angstroms{sup 3}, Z = 16 (final R = 0.0540), and complex 2 crystallizes in hexagonal P6(3)/mmc, with a = 16.1730(9) Angstroms, b = 16.1730(9) Angstroms, c = 19.7659(15) Angstroms, V = 4477.4(5) Angstroms{sup 3}, Z = 2 (final R = 0.0634). The polyanion unit in 1 is disorder-free. Very short ({approx}1.76 Angstroms) Au-oxo distances are established by both X-ray and 30 K neutron diffraction studies, and the latter confirms oxo and trans aqua (H2O) ligands on Au. Seven findings clarify that Au and not W is present in the Au-oxo position in 1 and 2. Five lines of evidence are consistent with the presence of d8 Au(III) centers that are stabilized by the flanking polytungstate ligands in both 1 and 2: redox titrations, electrochemical measurements, 17 K optical spectra, Au L2 edge X-ray absorption spectroscopy, and Au-oxo bond distances. Variable-temperature magnetic susceptibility data for crystalline 1 and 2 establish that both solids are diamagnetic, and {sup 31}P and {sup 17}O NMR spectroscopy confirm that both remain diamagnetic in solution. Both complexes have been further characterized by FT-IR, thermogravimetric analysis (TGA), differential scanning calorimetry (DSC), and other techniques.

  11. A Highly Reactive Seven-Coordinate Osmium(V) Oxo Complex: [Os(V)(O)(qpy)(pic)Cl](2+).

    PubMed

    Liu, Yingying; Ng, Siu-Mui; Lam, William W Y; Yiu, Shek-Man; Lau, Tai-Chu

    2016-01-01

    Seven-coordinate ruthenium oxo species have been proposed as active intermediates in catalytic water oxidation by a number of highly active ruthenium catalysts, however such species have yet to be isolated. Reported herein is the first example of a seven-coordinate group 8 metal-oxo species, [Os(V)(O)(qpy)(pic)Cl](2+) (qpy = 2,2':6',2'':6'',2'''-quaterpyridine, pic = 4-picoline). The X-ray crystal structure of this complex shows that it has a distorted pentagonal bipyramidal geometry with an Os=O distance of 1.7375 Å. This oxo species undergoes facile O-atom and H-atom-transfer reactions with various organic substrates. Notably it can abstract H atoms from alkylaromatics with C-H bond dissociation energy as high as 90 kcal mol(-1). This work suggests that highly active oxidants may be designed based on group 8 seven-coordinate metal oxo species.

  12. Metal ion effect on the switch of mechanism from direct oxygen transfer to metal ion-coupled electron transfer in the sulfoxidation of thioanisoles by a non-heme iron(IV)-oxo complex.

    PubMed

    Park, Jiyun; Morimoto, Yuma; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

    2011-04-13

    The mechanism of sulfoxidation of thioaniosoles by a non-heme iron(IV)-oxo complex is switched from direct oxygen transfer to metal ion-coupled electron transfer by the presence of Sc(3+). The switch in the sulfoxidation mechanism is dependent on the one-electron oxidation potentials of thioanisoles. The rate of sulfoxidation is accelerated as much as 10(2)-fold by the addition of Sc(3+).

  13. QSAR Study on Anti-HIV-1 Activity of 4-Oxo-1,4-dihydroquinoline and 4-Oxo-4H-pyrido[1,2-a]pyrimidine Derivatives Using SW-MLR, Artificial Neural Network and Filtering Methods

    PubMed Central

    Hajimahdi, Zahra; Ranjbar, Amin; Abolfazl Suratgar, Amir; Zarghi, Afshin

    2015-01-01

    Predictive quantitative structure–activity relationship was performed on the novel4-oxo-1,4-dihydroquinoline and 4-oxo-4H-pyrido[1,2-a]pyrimidine derivatives to explore relationship between the structure of synthesized compounds and their anti-HIV-1 activities. In this way, the suitable set of the molecular descriptors was calculated and the important descriptors using the variable selections of the stepwise technique were selected. Multiple linear regression (MLR) and artificial neural network (ANN) as nonlinear system were used for constructing QSAR models. The predictive quality of the quantitative structure–activity relationship models was tested for an external set of five compounds, randomly chosen out of 25 compounds. The findings exhibited that stepwise-ANN model was more efficient at prediction activity of both training and test sets with high statistical qualities. Based on QSAR models results, electronegativity, the atomic masses, the atomic van der Waals volumes, the molecular symmetry and polarizability were found to be important factors controlling the anti-HIV-1 activity. PMID:26185507

  14. Tuning reactivity and mechanism in oxidation reactions by mononuclear nonheme iron(IV)-oxo complexes.

    PubMed

    Nam, Wonwoo; Lee, Yong-Min; Fukuzumi, Shunichi

    2014-04-15

    Mononuclear nonheme iron enzymes generate high-valent iron(IV)-oxo intermediates that effect metabolically important oxidative transformations in the catalytic cycle of dioxygen activation. In 2003, researchers first spectroscopically characterized a mononuclear nonheme iron(IV)-oxo intermediate in the reaction of taurine: α-ketogultarate dioxygenase (TauD). This nonheme iron enzyme with an iron active center was coordinated to a 2-His-1- carboxylate facial triad motif. In the same year, researchers obtained the first crystal structure of a mononuclear nonheme iron(IV)-oxo complex bearing a macrocyclic supporting ligand, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecene), in studies that mimicked the biological enzymes. With these breakthrough results, many other studies have examined mononuclear nonheme iron(IV)-oxo intermediates trapped in enzymatic reactions or synthesized in biomimetic reactions. Over the past decade, researchers in the fields of biological, bioinorganic, and oxidation chemistry have extensively investigated the structure, spectroscopy, and reactivity of nonheme iron(IV)-oxo species, leading to a wealth of information from these enzymatic and biomimetic studies. This Account summarizes the reactivity and mechanisms of synthetic mononuclear nonheme iron(IV)-oxo complexes in oxidation reactions and examines factors that modulate their reactivities and change their reaction mechanisms. We focus on several reactions including the oxidation of organic and inorganic compounds, electron transfer, and oxygen atom exchange with water by synthetic mononuclear nonheme iron(IV)-oxo complexes. In addition, we recently observed that the C-H bond activation by nonheme iron(IV)-oxo and other nonheme metal(IV)-oxo complexes does not follow the H-atom abstraction/oxygen-rebound mechanism, which has been well-established in heme systems. The structural and electronic effects of supporting ligands on the oxidizing power of iron(IV)-oxo

  15. Synthesis and antimicrobial activity of acyclo C-nucleosides: 3-(alditol-1-yl)-7-oxo-5-phenyl-1,2,4-triazolo[4,3-a]pyrimidines.

    PubMed

    Shaban, M A; Nasr, A Z; Morgaan, A E

    2000-02-01

    Condensation of 2-hydrazino-4-oxo-6-phenylpyrimidine (1) with aldopentoses 2a-d or aldohexoses 2e-g gave the corresponding aldehydo-sugar (4-oxo-6-phenylpyrimidin-2-yl)hydrazones 3a-g which were acetylated to the corresponding poly-O-acetyl-aldehydo-sugar (3-acetyl-4-oxo-6-phenylpyrimidin-2-yl)hydrazones 4a-g. The latter compounds underwent oxidative cyclization with bromine in acetic acid and in the presence of sodium acetate to the corresponding 8-acetyl-3- (poly-O-acetyl-alditol-1-yl)-7-oxo-5-phenyl-1,2,4-triazolo[4,3-a]pyrimid ines 6a-g. Compounds 6a-g were also obtained by consecutive one-pot oxidative cyclization/acetylation in which the parent hydrazones 3a-g were treated with bromine/acetic acid/sodium acetate followed by acetic anhydride. Deacetylation of 6a-g with ammonium hydroxide in methanol gave the title compounds 7a-g. The antibacterial and antifungal activities of compounds 3c, 3f, 7c and 7f are reported. PMID:10723764

  16. Retention of the Cluster Core Structure during Ligand Exchange Reactions of Carboxylato-Substituted Metal Oxo Clusters

    PubMed Central

    Kreutzer, Johannes; Puchberger, Michael; Artner, Christine; Schubert, Ulrich

    2015-01-01

    The exchange of the carboxylato ligands of Zr4O2(methacrylato)12 in reactions with carboxylic acids proceeds with retention of the composition and structure of the cluster core. This was concluded from exchange/re-exchange experiments and from comparison of the IR bands of the cluster core of the original and ligand-exchanged clusters. The IR bands were assigned on the basis of DFT calculations. Scrambling reactions between two Zr4O2(OOCR)12 clusters with different carboxylato ligands are a new way to prepare mixed-ligand oxo clusters. PMID:26113799

  17. Sulfur K-Edge X-ray Absorption Spectroscopy and Density Functional Theory Calculations on Monooxo MoIV and Bisoxo MoVI Bis-dithiolenes: Insights into the Mechanism of Oxo Transfer in Sulfite Oxidase and Its Relation to the Mechanism of DMSO Reductase

    PubMed Central

    2015-01-01

    Sulfur K-edge X-ray absorption spectroscopy (XAS) and density functional theory (DFT) calculations have been used to determine the electronic structures of two complexes [MoIVO(bdt)2]2– and [MoVIO2(bdt)2]2– (bdt = benzene-1,2-dithiolate(2−)) that relate to the reduced and oxidized forms of sulfite oxidase (SO). These are compared with those of previously studied dimethyl sulfoxide reductase (DMSOr) models. DFT calculations supported by the data are extended to evaluate the reaction coordinate for oxo transfer to a phosphite ester substrate. Three possible transition states are found with the one at lowest energy, stabilized by a P–S interaction, in good agreement with experimental kinetics data. Comparison of both oxo transfer reactions shows that in DMSOr, where the oxo is transferred from the substrate to the metal ion, the oxo transfer induces electron transfer, while in SO, where the oxo transfer is from the metal site to the substrate, the electron transfer initiates oxo transfer. This difference in reactivity is related to the difference in frontier molecular orbitals (FMO) of the metal–oxo and substrate–oxo bonds. Finally, these experimentally related calculations are extended to oxo transfer by sulfite oxidase. The presence of only one dithiolene at the enzyme active site selectively activates the equatorial oxo for transfer, and allows facile structural reorganization during turnover. PMID:24884723

  18. An electrochemiluminescence biosensor for 8-oxo-7,8-dihydro-2'-deoxyguanosine quantification and DNA repair enzyme activity analysis using a novel bifunctional probe.

    PubMed

    Wu, Yiping; Yang, Xiqiang; Zhang, Bintian; Guo, Liang-Hong

    2015-07-15

    A new electrochemiluminescence (ECL) sensor was developed for 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) quantification and Escherichia coli formamidopyrimidine-DNA glycosylase (FPG) activity assay. The sensor employed a novel spermine conjugated ruthenium tris-(bipyridine) derivative (spermine-Ru) which binds specifically with 8-oxodGuo through a one-step reaction and also acts as an ECL signal reporter. In the sensor, an 8-oxodGuo-containing ds-DNA film was first immobilized on a gold electrode by self-assembly. The DNA film was then incubated with spermine-Ru under oxidative condition for 8-oxodGuo labeling. The ECL intensity was found to correlate with the amount of 8-oxodGuo on the surface and the detection limit was estimated to be about 1 lesion in 500 DNA bases. Addition of FPG resulted in some loss of the signal due to the excision of 8-oxodGuo by the enzyme. An inverse relationship between ECL intensity and FPG concentration was observed in a range from 0 to 4.0U/µL, demonstrating that this sensor could be used for FPG activity assay. A number of metal ions were screened by the sensor for their inhibition effect on FPG activity. Among them, Hg(2+) and methyl Hg(II) shown very potent inhibition, with IC50 values of 4.04µM and 4.34nM respectively. The result may suggest that interference on the DNA repair system could be another mechanism for the high toxicity of MeHg.

  19. Effect of diet and starvation on the activity state of branched-chain 2-oxo-acid dehydrogenase complex in rat liver and heart.

    PubMed

    Solomon, M; Cook, K G; Yeaman, S J

    1987-12-10

    In rats fed a high-protein diet, the branched-chain 2-oxo-acid dehydrogenase complex in liver was essentially fully active and its activity state was unaffected by subsequent starvation for 48 h. Feeding with a low-protein diet led to a decrease in the activity state which was essentially reversed by 48 h of starvation. In heart, the enzyme was primarily inactive (activity state 18%) in rats fed a high-protein diet, with both low-protein diet and starvation leading to a further decrease in the activity state. PMID:3676350

  20. X-ray Crystal Structure of Arsenite-Inhibited Xanthine Oxidase:[mu]-Sulfido,[mu]-Oxo Double Bridge between Molybdenum and Arsenic in the Active Site

    SciTech Connect

    Cao, Hongnan; Hall, James; Hille, Russ

    2012-10-23

    Xanthine oxidoreductase is a molybdenum-containing enzyme that catalyzes the hydroxylation reaction of sp{sup 2}-hybridized carbon centers of a variety of substrates, including purines, aldehydes, and other heterocyclic compounds. The complex of arsenite-inhibited xanthine oxidase has been characterized previously by UV-vis, electron paramagnetic resonance, and X-ray absorption spectroscopy (XAS), and the catalytically essential sulfido ligand of the square-pyrimidal molybdenum center has been suggested to be involved in arsenite binding through either a {mu}-sulfido,{mu}-oxo double bridge or a single {mu}-sulfido bridge. However, this is contrary to the crystallographically observed single {mu}-oxo bridge between molybdenum and arsenic in the desulfo form of aldehyde oxidoreductase from Desulfovibrio gigas (an enzyme closely related to xanthine oxidase), whose molybdenum center has an oxo ligand replacing the catalytically essential sulfur, as seen in the functional form of xanthine oxidase. Here we use X-ray crystallography to characterize the molybdenum center of arsenite-inhibited xanthine oxidase and solve the structures of the oxidized and reduced inhibition complexes at 1.82 and 2.11 {angstrom} resolution, respectively. We observe {mu}-sulfido,{mu}-oxo double bridges between molybdenum and arsenic in the active sites of both complexes. Arsenic is four-coordinate with a distorted trigonal-pyramidal geometry in the oxidized complex and three-coordinate with a distorted trigonal-planar geometry in the reduced complex. The doubly bridged binding mode is in agreement with previous XAS data indicating that the catalytically essential sulfur is also essential for the high affinity of reduced xanthine oxidoreductase for arsenite.

  1. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  2. Dicobalt-μ-oxo polyoxometalate compound, [(α(2)-P2W17O61Co)2O](14-): a potent species for water oxidation, C-H bond activation, and oxygen transfer.

    PubMed

    Barats-Damatov, Delina; Shimon, Linda J W; Weiner, Lev; Schreiber, Roy E; Jiménez-Lozano, Pablo; Poblet, Josep M; de Graaf, Coen; Neumann, Ronny

    2014-02-01

    High-valent oxo compounds of transition metals are often implicated as active species in oxygenation of hydrocarbons through carbon-hydrogen bond activation or oxygen transfer and also in water oxidation. Recently, several examples of cobalt-catalyzed water oxidation have been reported, and cobalt(IV) species have been suggested as active intermediates. A reactive species, formally a dicobalt(IV)-μ-oxo polyoxometalate compound [(α2-P2W17O61Co)2O](14-), [(POMCo)2O], has now been isolated and characterized by the oxidation of a monomeric [α2-P2W17O61Co(II)(H2O)](8-), [POMCo(II)H2O], with ozone in water. The crystal structure shows a nearly linear Co-O-Co moiety with a Co-O bond length of ∼1.77 Å. In aqueous solution [(POMCo)2O] was identified by (31)P NMR, Raman, and UV-vis spectroscopy. Reactivity studies showed that [(POMCo)2O]2O] is an active compound for the oxidation of H2O to O2, direct oxygen transfer to water-soluble sulfoxides and phosphines, indirect epoxidation of alkenes via a Mn porphyrin, and the selective oxidation of alcohols by carbon-hydrogen bond activation. The latter appears to occur via a hydrogen atom transfer mechanism. Density functional and CASSCF calculations strongly indicate that the electronic structure of [(POMCo)2O]2O] is best defined as a compound having two cobalt(III) atoms with two oxidized oxygen atoms.

  3. Label-free colorimetric detection of mercury via Hg2+ ions-accelerated structural transformation of nanoscale metal-oxo clusters

    PubMed Central

    Chen, Kun; She, Shan; Zhang, Jiangwei; Bayaguud, Aruuhan; Wei, Yongge

    2015-01-01

    Mercury and its compounds are known to be extremely toxic but widely distributed in environment. Although many works have been reported to efficiently detect mercury, development of simple and convenient sensors is still longed for quick analyzing mercury in water. In this work, a nanoscale metal-oxo cluster, (n-Bu4N)2[Mo5NaO13(OCH3)4(NO)], (MLPOM), organically-derivatized from monolacunary Lindqvist-type polyoxomolybdate, is found to specifically react with Hg2+ in methanol/water via structural transformation. The MLPOM methanol solution displays a color change from purple to brown within seconds after being mixed with an aqueous solution containing Hg2+. By comparing the structure of polyoxomolybdate before and after reaction, the color change is revealed to be the essentially structural transformation of MLPOM accelerated by Hg2+. Based on this discovery, MLPOM could be utilized as a colorimetric sensor to sense the existence of Hg2+, and a simple and label-free method is developed to selectively detect aqueous Hg2+. Furthermore, the colorimetric sensor has been applied to indicating mercury contamination in industrial sewage. PMID:26559602

  4. Tautomeric switching and metal-cation sensing of ligand-equipped 4-hydroxy-/4-oxo-1,4-dihydroquinolines.

    PubMed

    Todorov, Aleksandar R; Nieger, Martin; Helaja, Juho

    2012-06-01

    Novel 4-hydroxyquinoline (4HQ) based tautomeric switches are reported. 4HQs equipped with coordinative side arms (8-arylimino and 3-piperidin-1-ylmethyl groups) were synthesized to access O- or N-selective chelation of Zn(2+) and Cd(2+) ions by 4HQ. In the case of the monodentate arylimino group, O chelation of metal ions induces concomitant switching of phenol tautomer to the keto form in nonpolar or aprotic media. This change is accompanied by selective and highly sensitive fluorometric sensing of Zn(2+) ions. In the case of the bidentate 8-(quinolin-8-ylimino)methyl side arm, NMR studies in CD(3) OD indicated that both Cd(2+) and Zn(2+) ions afford N chelation for 4HQ, coexisting with tautomeric switching from quinolin-4(1H)-one to quinolin-4-olate. In corroboration, UV/Vis-monitored metal-ion titrations in toluene and methanol implied similar structural changes. Additionally, fluorescence measurements indicated that the metal-triggered tautomeric switching is associated with compound signaling properties. The results are supported by DFT calculations at the B3LYP 6-31G* level. Several X-ray structures of metal-free and metal-chelating 4HQ are presented to support the solution studies.

  5. The Recently Identified Isoleucine Conjugate of cis-12-Oxo-Phytodienoic Acid Is Partially Active in cis-12-Oxo-Phytodienoic Acid-Specific Gene Expression of Arabidopsis thaliana

    PubMed Central

    Floková, Kristýna; Miersch, Otto; Strnad, Miroslav; Novák, Ondřej; Wasternack, Claus; Hause, Bettina

    2016-01-01

    Oxylipins of the jasmonate family are active as signals in plant responses to biotic and abiotic stresses as well as in development. Jasmonic acid (JA), its precursor cis-12-oxo-phytodienoic acid (OPDA) and the isoleucine conjugate of JA (JA-Ile) are the most prominent members. OPDA and JA-Ile have individual signalling properties in several processes and differ in their pattern of gene expression. JA-Ile, but not OPDA, is perceived by the SCFCOI1-JAZ co-receptor complex. There are, however, numerous processes and genes specifically induced by OPDA. The recently identified OPDA-Ile suggests that OPDA specific responses might be mediated upon formation of OPDA-Ile. Here, we tested OPDA-Ile-induced gene expression in wild type and JA-deficient, JA-insensitive and JA-Ile-deficient mutant background. Tests on putative conversion of OPDA-Ile during treatments revealed only negligible conversion. Expression of two OPDA-inducible genes, GRX480 and ZAT10, by OPDA-Ile could be detected in a JA-independent manner in Arabidopsis seedlings but less in flowering plants. The data suggest a bioactivity in planta of OPDA-Ile. PMID:27611078

  6. The Recently Identified Isoleucine Conjugate of cis-12-Oxo-Phytodienoic Acid Is Partially Active in cis-12-Oxo-Phytodienoic Acid-Specific Gene Expression of Arabidopsis thaliana.

    PubMed

    Arnold, Monika D; Gruber, Cornelia; Floková, Kristýna; Miersch, Otto; Strnad, Miroslav; Novák, Ondřej; Wasternack, Claus; Hause, Bettina

    2016-01-01

    Oxylipins of the jasmonate family are active as signals in plant responses to biotic and abiotic stresses as well as in development. Jasmonic acid (JA), its precursor cis-12-oxo-phytodienoic acid (OPDA) and the isoleucine conjugate of JA (JA-Ile) are the most prominent members. OPDA and JA-Ile have individual signalling properties in several processes and differ in their pattern of gene expression. JA-Ile, but not OPDA, is perceived by the SCFCOI1-JAZ co-receptor complex. There are, however, numerous processes and genes specifically induced by OPDA. The recently identified OPDA-Ile suggests that OPDA specific responses might be mediated upon formation of OPDA-Ile. Here, we tested OPDA-Ile-induced gene expression in wild type and JA-deficient, JA-insensitive and JA-Ile-deficient mutant background. Tests on putative conversion of OPDA-Ile during treatments revealed only negligible conversion. Expression of two OPDA-inducible genes, GRX480 and ZAT10, by OPDA-Ile could be detected in a JA-independent manner in Arabidopsis seedlings but less in flowering plants. The data suggest a bioactivity in planta of OPDA-Ile. PMID:27611078

  7. Synthesis, structure, optical properties, antifungal and antibacterial activities of 2-(1-oxo-1H-2,3-dihydroisoindol-2-yl)-3-imidazolyl-L-lactamic acid

    NASA Astrophysics Data System (ADS)

    Jia, Ting; Zhang, Wei-Long; Chen, Yun; Cai, Shuang-Lian; Yi, Hai-Bo

    2013-10-01

    2-(1-oxo-1H-2,3-dihydroisoindol-2-yl)-3-imidazolyl-L-lactamic acid has been prepared conveniently by the condensation reaction of o-phthalaldehyde (OPA) with L-Histidine, and its single crystal structure has been characterized by X-ray crystallography method. The in vitro antifungal and antibacterial activities of the compound were investigated with the representative strains of Candida albicans, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. Its luminescent and nonlinear optical properties have also been investigated. Second-harmonic-generation (SHG) measurements indicate that compound 1 displays a weak SHG response of about 0.75 times that of KH2PO4.

  8. Metabolic characteristics of 13-cis-retinoic acid (isotretinoin) and anti-tumour activity of the 13-cis-retinoic acid metabolite 4-oxo-13-cis-retinoic acid in neuroblastoma

    PubMed Central

    Sonawane, Poonam; Cho, Hwang Eui; Tagde, Ashujit; Verlekar, Dattesh; Yu, Alice L; Reynolds, C Patrick; Kang, Min H

    2014-01-01

    Background and Purpose Isotretinoin (13-cis-retinoic acid; 13-cRA) is a differentiation inducer used to treat minimal residual disease after myeloablative therapy for high-risk neuroblastoma. However, more than 40% of children develop recurrent disease during or after 13-cRA treatment. The plasma concentrations of 13-cRA in earlier studies were considered subtherapeutic while 4-oxo-13-cis-RA (4-oxo-13-cRA), a metabolite of 13-cRA considered by some investigators as inactive, were greater than threefold higher than 13-cRA. We sought to define the metabolic pathways of 13-cRA and investigated the anti-tumour activity of its major metabolite, 4-oxo-13-cRA. Experimental Approach Effects of 13-cRA and 4-oxo-13-cRA on human neuroblastoma cell lines were assessed by DIMSCAN and flow cytometry for cell proliferation, MYCN down-regulation by reverse transcription PCR and immunoblotting, and neurite outgrowth by confocal microscopy. 13-cRA metabolism was determined using tandem MS in human liver microsomes and in patient samples. Key Results Six major metabolites of 13-cRA were identified in patient samples. Of these, 4-oxo-13-cRA was the most abundant, and 4-oxo-13-cRA glucuronide was also detected at a higher level in patients. CYP3A4 was shown to play a major role in catalysing 13-cRA to 4-oxo-13-cRA. In human neuroblastoma cell lines, 4-oxo-13-cRA and 13-cRA were equi-effective at inducing neurite outgrowth, inhibiting proliferation, decreasing MYCN mRNA and protein, and increasing the expression of retinoic acid receptor-β mRNA and protein levels. Conclusions and Implications We showed that 4-oxo-13-cRA is as active as 13-cRA against neuroblastoma cell lines. Plasma levels of both 13-cRA and 4-oxo-13-cRA should be evaluated in pharmacokinetic studies of isotretinoin in neuroblastoma. PMID:25039756

  9. A combination of both arginine- and lysine-specific gingipain activity of Porphyromonas gingivalis is necessary for the generation of the micro-oxo bishaem-containing pigment from haemoglobin.

    PubMed Central

    Smalley, John W; Thomas, Michael F; Birss, Andrew J; Withnall, Robert; Silver, Jack

    2004-01-01

    The black pigment of Porphyromonas gingivalis is composed of the mu-oxo bishaem complex of Fe(III) protoporphyrin IX (mu-oxo oligomer, dimeric haem), namely [Fe(III)PPIX]2O. P. gingivalis W50 and Rgp (Arg-gingipain)- and Kgp (Lys-gingipain)-deficient mutants K1A, D7, E8 and W501 [Aduse-Opoku, Davies, Gallagher, Hashim, Evans, Rangarajan, Slaney and Curtis (2000) Microbiology 146, 1933-1940] were grown on horse blood/agar for 14 days and examined for the production of mu-oxo bishaem. Mu-oxo Bishaem was detected by UV-visible, Mössbauer and Raman spectroscopies in wild-type W50 and in the black-pigmented RgpA- and RgpB-deficient mutants (W501 and D7 respectively), whereas no haem species were detected in the straw-coloured colonies of Kgp-deficient strain K1A. The dark brown pigment of the double RgpA/RgpB knockout mutant (E8) was not composed of mu-oxo bishaem, but of a high-spin monomeric Fe(III) protoporphyrin IX species (possibly a haem-albumin complex). In vitro incubation of oxyhaemoglobin with cells of the W50 strain and the RgpA- and RgpB-deficient mutants (W501 and D7) resulted in the formation of mu-oxo bishaem via methaemoglobin as an intermediate. Although the Kgp-deficient strain K1A converted oxyhaemoglobin into methaemoglobin, this was not further degraded into mu-oxo bishaem. The double RgpA/RgpB knockout was also not capable of producing mu-oxo bishaem from oxyhaemoglobin, but instead generated a haemoglobin haemichrome. Inhibition of Arg-X protease activity of W50, W501, D7 and K1A with leupeptin, under conditions where Lys-X protease activity was unaffected, prevented the production of mu-oxo bishaem from oxyhaemoglobin, but resulted in the formation of a haemoglobin haemichrome. These results show that one or both of RgpA and RgpB gingipains, in addition to the lysine-specific gingipain, is necessary for the production of mu-oxo bishaem from haemoglobin by whole cells of P. gingivalis. PMID:14741050

  10. Synthesis and Structure–Activity Relationships of N-(2-Oxo-3-oxetanyl)amides as N-Acylethanolamine-hydrolyzing Acid Amidase Inhibitors

    PubMed Central

    Solorzano, Carlos; Antonietti, Francesca; Duranti, Andrea; Tontini, Andrea; Rivara, Silvia; Lodola, Alessio; Vacondio, Federica; Tarzia, Giorgio; Piomelli, Daniele; Mor, Marco

    2010-01-01

    The fatty acid ethanolamides (FAEs) are a family of bioactive lipid mediators that include the endogenous agonist of peroxisome proliferator-activated receptor-α, palmitoylethanolamide (PEA). FAEs are hydrolyzed intracellularly by either fatty acid amide hydrolase or N-acylethanolamine-hydrolyzing acid amidase (NAAA). Selective inhibition of NAAA by (S)-N-(2-oxo-3-oxetanyl)-3-phenylpropionamide [(S)-OOPP, 7a] prevents PEA degradation in mouse leukocytes and attenuates responses to proinflammatory stimuli. Starting from the structure of 7a a series of β-lactones was prepared and tested on recombinant rat NAAA to explore structure-activity relationships (SARs) for this class of inhibitors and improve their in vitro potency. Following the hypothesis that these compounds inhibit NAAA by acylation of the catalytic cysteine, we identified several requirements for recognition at the active site and obtained new potent inhibitors. In particular, (S)-N-(2-oxo-3-oxetanyl)biphenyl-4-carboxamide (7h) was more potent than 7a at inhibiting recombinant rat NAAA activity (7a, IC50 = 420 nM; 7h, IC50 = 115 nM) in vitro and at reducing carrageenan-induced leukocyte infiltration in vivo. PMID:20604568

  11. 2-oxo-N-aryl-1,2,3,4-tetrahydroquinoline-6-sulfonamides as activators of the tumor cell specific M2 isoform of pyruvate kinase

    PubMed Central

    Walsh, Martin J.; Brimacombe, Kyle R.; Veith, Henrike; Bougie, James M.; Daniel, Thomas; Leister, William; Cantley, Lewis C.; Israelsen, William J.; Vander Heiden, Matthew G.; Shen, Min; Auld, Douglas S.; Thomas, Craig J.; Boxer, Matthew B.

    2011-01-01

    Compared to normal differentiated cells, cancer cells have altered metabolic regulation to support biosynthesis and the expression of the M2 isozyme of pyruvate kinase (PKM2) plays an important role in this anabolic metabolism. While the M1 isoform is a highly active enzyme, the alternatively spliced M2 variant is considerably less active and expressed in tumors. While the exact mechanism by which decreased pyruvate kinase activity contributes to anabolic metabolism remains unclear, it is hypothesized that activation of PKM2 to levels seen with PKM1 may promote a metabolic program that is not conducive to cell proliferation. Here we report the third chemotype in a series of PKM2 activators based on the 2-oxo-N-aryl-1,2,3,4-tetrahydroquinoline-6-sulfonamide scaffold. The synthesis, structure activity relationships, selectivity and notable physiochemical properties are described. PMID:21958545

  12. Synthesis and Antibacterial Activity of 3-(Substituted)-2-(4-oxo-2-phenylquinazolin-3(4H)-ylamino)quinazolin-4(3H)-one

    PubMed Central

    Appani, Ramgopal; Bhukya, Baburao; Gangarapu, Kiran

    2016-01-01

    A series of novel 3-(substituted)-2-(substituted quinazolinylamino)quinazolin-4(3H)-ones were synthesized by the reaction of 3-(substituted)-2-hydrazino-quinazoline-4(3H)-ones with 2-phenyl-3,1-benzoxazin-4-one. The starting materials 3-(substituted)-2-hydrazino-quinazolin-4(3H)-ones were synthesized from various primary amines by a multistep synthesis. All the title compounds were tested for their antibacterial activity using ciprofloxacin as reference standard. Compounds 3-(4-fluorophenyl)-2-(4-oxo-2-phenylquinazolin-3(4H)-ylamino)quinazolin-4(3H)-one (9a) and 3-(4-chlorophenyl)-2-(4-oxo-2-phenylquinazolin-3(4H)-ylamino)quinazolin-4(3H)-one (9h) emerged as the most active compounds of the series. These compounds have shown most potent antibacterial activity against the tested organisms of Proteus vulgaris and Bacillus subtilis having zone of inhibition values of 1.1 cm and 1.4 cm for compound 9a 1.2 cm and 1.0 cm for compound 9h, respectively. PMID:27190676

  13. Luminescence properties of three structures built from 3-cyano-4-dicyanomethylene-5-oxo-4,5-dihydro-1H-pyrrol-2-olate and alkaline metals (Na, K and Rb).

    PubMed

    Tafeenko, Viktor A; Gurskiy, Stanislav I; Baranov, Andrey N; Kaisarova, Tatiana V; Aslanov, Leonid A

    2009-02-01

    The structures of three salts of 3-cyano-4-dicyanomethylene-5-oxo-4,5-dihydro-1H-pyrrol-2-olate with alkali metals (Na, K and Rb) are related to their luminescence properties. The Rb salt, rubidium(I) 3-cyano-4-dicyanomethylene-5-oxo-4,5-dihydro-1H-pyrrol-2-olate, Rb(+).C(8)HN(4)O(2)(-), is isomorphous with the previously reported potassium salt. For the Na compound, sodium(I) 3-cyano-4-dicyanomethylene-5-oxo-4,5-dihydro-1H-pyrrol-2-olate dihydrate, Na(+).C(8)HN(4)O(2)(-).2H(2)O, two independent sodium ions, located on inversion centers, are coordinated by four water molecules each and additionally by two cyano groups for one and two carbonyl groups for the other. The luminescence spectra in solution are unaffected by the nature of the cation but vary strongly with the dielectric constant of the solvent. In the solid state, the emission maxima vary with structural features; the redshift of the maximum luminescence varies inversely with the distance between the stacked anions. PMID:19190369

  14. The plant limonoid 7-oxo-deacetoxygedunin inhibits RANKL-induced osteoclastogenesis by suppressing activation of the NF-{kappa}B and MAPK pathways

    SciTech Connect

    Wisutsitthiwong, Chonnaree; Buranaruk, Chayanit; Pudhom, Khanitha; Palaga, Tanapat

    2011-11-18

    Highlights: Black-Right-Pointing-Pointer A gedunin type limonoid from seeds of mangroves, 7-oxo-7-deacetoxygedunin, exhibits strong anti-osteoclastogenic activity. Black-Right-Pointing-Pointer Treatment with this limonoid results in significant decrease in expression of NFATc1 and osteoclast-related genes. Black-Right-Pointing-Pointer The mode of action of this limonoid is by inhibiting activation of the NF-{kappa}B and MAPK pathways which are activated by RANKL. -- Abstract: Osteoclasts together with osteoblasts play pivotal roles in bone remodeling. Aberrations in osteoclast differentiation and activity contribute to osteopenic disease. Osteoclasts differentiate from monocyte/macrophage progenitors, a process that is initiated by the interaction between receptor activator of NF-{kappa}B (RANK) and its ligand, RANKL. In this study, we identified 7-oxo-7-deacetoxygedunin (7-OG), a gedunin type limonoid from seeds of the mangrove Xylocarpus moluccensis, as a potent inhibitor of osteoclastogenesis. Additionally, 7-OG showed strong anti-osteoclastogenic activity with low cytotoxicity against the monocyte/macrophage progenitor cell line, RAW264.7. The IC50 for anti-osteoclastogenic activity was 4.14 {mu}M. Treatment with 7-OG completely abolished the appearance of multinucleated giant cells with tartrate-resistant acid phosphatase activity in RAW264.7 cells stimulated with RANKL. When the expression of genes related to osteoclastogenesis was investigated, a complete downregulation of NFATc1 and cathepsin K and a delayed downregulation of irf8 were observed upon 7-OG treatment in the presence of RANKL. Furthermore, treatment with this limonoid suppressed RANKL-induced activation of p38, MAPK and Erk and nuclear localization of NF-{kappa}B p65. Taken together, we present evidence indicating a plant limonoid as a novel osteoclastogenic inhibitor that could be used for osteoporosis and related conditions.

  15. Porous metal-organic framework based on mu4-oxo tetrazinc clusters: sorption and guest-dependent luminescent properties.

    PubMed

    Hou, Lei; Lin, Yan-Yong; Chen, Xiao-Ming

    2008-02-18

    A three-dimensional, highly porous metal-organic framework [Zn 4O(bdc)(bpz) 2].4DMF.6H 2O ( 1) (bdc = 1,4-benzenedicarboxylate, bpz = 3,3',5,5'-tetramethyl-4,4'-bipyrazolate) constructed by Zn 4O clusters with bdc and bpz linkers, has been prepared and structurally characterized. The N 2 sorption measurements reveal that 1 exhibits high porosity with a Langmuir surface area of 1908 m (2)/g and a pore volume of 0.58 cm (3)/g. Compound 1 features hydrophobic channels with a free passage of approximately 8.2 A defined by the methyl groups from bpz, and it exhibits nice sorption capability for benzene and toluene and interesting two-step sorption behavior for methanol. Meanwhile, 1 also exhibits interesting guest-dependent luminescent properties.

  16. The activity of HYDROPEROXIDE LYASE 1 regulates accumulation of galactolipids containing 12-oxo-phytodienoic acid in Arabidopsis

    PubMed Central

    Nilsson, Anders K.; Fahlberg, Per; Johansson, Oskar N.; Hamberg, Mats; Andersson, Mats X.; Ellerström, Mats

    2016-01-01

    Arabidopsis produces galactolipids containing esters of 12-oxo-phytodienoic acid (OPDA) and dinor-12-oxo-phytodienoic acid (dnOPDA). These lipids are referred to as arabidopsides and accumulate in response to abiotic and biotic stress. We explored the natural genetic variation found in 14 different Arabidopsis accessions to identify genes involved in the formation of arabidopsides. The accession C24 was identified as a poor accumulator of arabidopsides whereas the commonly used accession Col-0 was found to accumulate comparably large amounts of arabidopsides in response to tissue damage. A quantitative trait loci analysis of an F2 population created from a cross between C24 and Col-0 located a region on chromosome four strongly linked to the capacity to form arabidopsides. Expression analysis of HYDROPEROXIDE LYASE 1 (HPL1) showed large differences in transcript abundance between accessions. Transformation of Col-0 plants with the C24 HPL1 allele under transcriptional regulation of the 35S promoter revealed a strong negative correlation between HPL1 expression and arabidopside accumulation after tissue damage, thereby strengthening the view that HPL1 competes with ALLENE OXIDE SYNTHASE (AOS) for lipid-bound hydroperoxide fatty acids. We further show that the last step in the synthesis of galactolipid-bound OPDA and dnOPDA from unstable allene oxides is exclusively enzyme-catalyzed and not the result of spontaneous cyclization. Thus, the results presented here together with previous studies suggest that all steps in arabidopside biosynthesis are enzyme-dependent and apparently all reactions can take place with substrates being esterified to galactolipids. PMID:27422994

  17. 10-oxo-12(Z)-octadecenoic acid, a linoleic acid metabolite produced by gut lactic acid bacteria, potently activates PPARγ and stimulates adipogenesis

    SciTech Connect

    Goto, Tsuyoshi; Kim, Young-Il; Furuzono, Tomoya; Takahashi, Nobuyuki; Yamakuni, Kanae; Yang, Ha-Eun; Li, Yongjia; Ohue, Ryuji; Nomura, Wataru; Sugawara, Tatsuya; Yu, Rina; Kitamura, Nahoko; and others

    2015-04-17

    Our previous study has shown that gut lactic acid bacteria generate various kinds of fatty acids from polyunsaturated fatty acids such as linoleic acid (LA). In this study, we investigated the effects of LA and LA-derived fatty acids on the activation of peroxisome proliferator-activated receptors (PPARs) which regulate whole-body energy metabolism. None of the fatty acids activated PPARδ, whereas almost all activated PPARα in luciferase assays. Two fatty acids potently activated PPARγ, a master regulator of adipocyte differentiation, with 10-oxo-12(Z)-octadecenoic acid (KetoA) having the most potency. In 3T3-L1 cells, KetoA induced adipocyte differentiation via the activation of PPARγ, and increased adiponectin production and insulin-stimulated glucose uptake. These findings suggest that fatty acids, including KetoA, generated in gut by lactic acid bacteria may be involved in the regulation of host energy metabolism. - Highlights: • Most LA-derived fatty acids from gut lactic acid bacteria potently activated PPARα. • Among tested fatty acids, KetoA and KetoC significantly activated PPARγ. • KetoA induced adipocyte differentiation via the activation of PPARγ. • KetoA enhanced adiponectin production and glucose uptake during adipogenesis.

  18. A well-defined terminal vanadium(III) oxo complex.

    PubMed

    King, Amanda E; Nippe, Michael; Atanasov, Mihail; Chantarojsiri, Teera; Wray, Curtis A; Bill, Eckhard; Neese, Frank; Long, Jeffrey R; Chang, Christopher J

    2014-11-01

    The ubiquity of vanadium oxo complexes in the V+ and IV+ oxidation states has contributed to a comprehensive understanding of their electronic structure and reactivity. However, despite being predicted to be stable by ligand-field theory, the isolation and characterization of a well-defined terminal mononuclear vanadium(III) oxo complex has remained elusive. We present the synthesis and characterization of a unique terminal mononuclear vanadium(III) oxo species supported by the pentadentate polypyridyl ligand 2,6-bis[1,1-bis(2-pyridyl)ethyl]pyridine (PY5Me2). Exposure of [V(II)(NCCH3)(PY5Me2)](2+) (1) to either dioxygen or selected O-atom-transfer reagents yields [V(IV)(O)(PY5Me2)](2+) (2). The metal-centered one-electron reduction of this vanadium(IV) oxo complex furnishes a stable, diamagnetic [V(III)(O)(PY5Me2)](+) (3) species. The vanadium(III) oxo species is unreactive toward H- and O-atom transfer but readily reacts with protons to form a putative vanadium hydroxo complex. Computational results predict that further one-electron reduction of the vanadium(III) oxo species will result in ligand-based reduction, even though pyridine is generally considered to be a poor π-accepting ligand. These results have implications for future efforts toward low-valent vanadyl chemistry, particularly with regard to the isolation and study of formal vanadium(II) oxo species.

  19. A Highly Reactive Seven-Coordinate Osmium(V) Oxo Complex: [Os(V)(O)(qpy)(pic)Cl](2+).

    PubMed

    Liu, Yingying; Ng, Siu-Mui; Lam, William W Y; Yiu, Shek-Man; Lau, Tai-Chu

    2016-01-01

    Seven-coordinate ruthenium oxo species have been proposed as active intermediates in catalytic water oxidation by a number of highly active ruthenium catalysts, however such species have yet to be isolated. Reported herein is the first example of a seven-coordinate group 8 metal-oxo species, [Os(V)(O)(qpy)(pic)Cl](2+) (qpy = 2,2':6',2'':6'',2'''-quaterpyridine, pic = 4-picoline). The X-ray crystal structure of this complex shows that it has a distorted pentagonal bipyramidal geometry with an Os=O distance of 1.7375 Å. This oxo species undergoes facile O-atom and H-atom-transfer reactions with various organic substrates. Notably it can abstract H atoms from alkylaromatics with C-H bond dissociation energy as high as 90 kcal mol(-1). This work suggests that highly active oxidants may be designed based on group 8 seven-coordinate metal oxo species. PMID:26554748

  20. Activation of phospholipase A2 by 1-palmitoyl-2-(9'-oxo-nonanoyl)-sn-glycero-3-phosphocholine in vitro.

    PubMed

    Code, Christian; Mahalka, Ajay K; Bry, Kristian; Kinnunen, Paavo K J

    2010-08-01

    Oxidative stress leads to drastic modifications of both the biophysical properties of biomembranes and their associated chemistry imparted upon the formation of oxidatively modified lipids. To this end, oxidized phospholipid derivatives bearing an aldehyde function, such as 1-palmitoyl-2-(9'-oxo-nonanoyl)-sn-glycero-3-phosphocholine (PoxnoPC) can covalently react with proteins that come into direct contact. Intriguingly, we observed PoxnoPC in a 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) matrix to shorten and abolish the lag time in the action of phospholipase A2 (PLA2) on this composite substrate, with concomitant augmented decrement in pH, indicating more extensive hydrolysis, which was in keeping with enhanced 90 degrees light scattering. The latter was abolished by the aldehyde scavenger methoxyamine, thus suggesting the involvement of Schiff base. Enhanced hydrolysis of a fluorescent phospholipid analogue was seen for PLA2 preincubated with PoxnoPC. Mixing PLA2 with submicellar (22 microM) PoxnoPC caused a pronounced increase in Thioflavin T fluorescence, in keeping with the formation of amyloid-type fibers, which were seen also by electron microscopy.

  1. Actively convected liquid metal divertor

    NASA Astrophysics Data System (ADS)

    Shimada, Michiya; Hirooka, Yoshi

    2014-12-01

    The use of actively convected liquid metals with j × B force is proposed to facilitate heat handling by the divertor, a challenging issue associated with magnetic fusion experiments such as ITER. This issue will be aggravated even more for DEMO and power reactors because the divertor heat load will be significantly higher and yet the use of copper would not be allowed as the heat sink material. Instead, reduced activation ferritic/martensitic steel alloys with heat conductivities substantially lower than that of copper, will be used as the structural materials. The present proposal is to fill the lower part of the vacuum vessel with liquid metals with relatively low melting points and low chemical activities including Ga and Sn. The divertor modules, equipped with electrodes and cooling tubes, are immersed in the liquid metal. The electrode, placed in the middle of the liquid metal, can be biased positively or negatively with respect to the module. The j × B force due to the current between the electrode and the module provides a rotating motion for the liquid metal around the electrodes. The rise in liquid temperature at the separatrix hit point can be maintained at acceptable levels from the operation point of view. As the rotation speed increases, the current in the liquid metal is expected to decrease due to the v × B electromotive force. This rotating motion in the poloidal plane will reduce the divertor heat load significantly. Another important benefit of the convected liquid metal divertor is the fast recovery from unmitigated disruptions. Also, the liquid metal divertor concept eliminates the erosion problem.

  2. The plant limonoid 7-oxo-deacetoxygedunin inhibits RANKL-induced osteoclastogenesis by suppressing activation of the NF-κB and MAPK pathways.

    PubMed

    Wisutsitthiwong, Chonnaree; Buranaruk, Chayanit; Pudhom, Khanitha; Palaga, Tanapat

    2011-11-18

    Osteoclasts together with osteoblasts play pivotal roles in bone remodeling. Aberrations in osteoclast differentiation and activity contribute to osteopenic disease. Osteoclasts differentiate from monocyte/macrophage progenitors, a process that is initiated by the interaction between receptor activator of NF-κB (RANK) and its ligand, RANKL. In this study, we identified 7-oxo-7-deacetoxygedunin (7-OG), a gedunin type limonoid from seeds of the mangrove Xylocarpus moluccensis, as a potent inhibitor of osteoclastogenesis. Additionally, 7-OG showed strong anti-osteoclastogenic activity with low cytotoxicity against the monocyte/macrophage progenitor cell line, RAW264.7. The IC50 for anti-osteoclastogenic activity was 4.14μM. Treatment with 7-OG completely abolished the appearance of multinucleated giant cells with tartrate-resistant acid phosphatase activity in RAW264.7 cells stimulated with RANKL. When the expression of genes related to osteoclastogenesis was investigated, a complete downregulation of NFATc1 and cathepsin K and a delayed downregulation of irf8 were observed upon 7-OG treatment in the presence of RANKL. Furthermore, treatment with this limonoid suppressed RANKL-induced activation of p38, MAPK and Erk and nuclear localization of NF-κB p65. Taken together, we present evidence indicating a plant limonoid as a novel osteoclastogenic inhibitor that could be used for osteoporosis and related conditions. PMID:22037580

  3. Antifungal activities of (E)-4-benzylidene-5-oxopyrrolidine- 2-carboxamides and 6-oxo-1,2,3,6-tetrahydropyridin-2- carboxamides synthezed via ugi reaction from baylis-hillman bromides

    NASA Astrophysics Data System (ADS)

    Zeng, X. H.; Xiang, L. C.; Li, H. L.; Wang, H. M.; Wang, X. B.

    2016-08-01

    The derivatives of N-containing heterocycles containing the pyrrolidone or pyridinone moiety are of high importance because they have extensive biological properties including antifungal, anti-muscarinic, anti-cancer, anti-viral and anti-HIV activities. In our previous work, we described an one-pot transition-metal-free, base-mediated synthesis of pyrrolidinones ((E)-4-benzylidene-5-oxopyrrolidine-2-carboxamides 6) and an one-pot regioselective synthesis of previously seldom reported pyridinones (6-oxo-1,2,3,6- tetrahydropyridin-2-carboxamides 9) via Ugi reaction from Baylis-Hillman Bromides. Herein, the growth inhibitory effect of one concentration (50mg/L) of compounds 6 and 9 against fungi (Gibberella zeae) in vitro was tested by the method of toxic medium. Ihe results showed that the inhibitory effects of compounds 6 against Gibberella zeae are not obvious, but compounds 9 showed moderate to good inhibitory effects against Gibberella zeae. Compound 9h showed the best inhibition rate against Gibberella zeae with 95%.

  4. Synthesis, antibacterial and antioxidant activities of new 1-alkyl-4-(1-alkyl-4-oxo-1,4-dihydroquinolin-2-yl)pyridinium bromides.

    PubMed

    Kahriman, Nuran; Yaylı, Büşra; Aktaş, Ayça; Iskefiyeli, Zeynep; Beriş, Fatih Şaban; Yaylı, Nurettin

    2013-11-01

    New 1-alkyl-4-(1-alkyl-4-oxo-1,4-dihydroquinolin-2-yl)pyridinium bromides (3a-k) were synthesized from 1,4'-diazaflavone [2-pyridin-4-ylquinolin-4(1H)-one] and evaluated for antibacterial and antioxidant activities. A rapid one-pot preparation of 1,4'-diazaflavone (2) was done from 2'-amino substituted chalcone (1) by intramolecular Michael addition using solvent-free microwave heating. New N,N'-dialkyl substituted (C₅-C₁₅) 1,4'-diazaflavonium bromides were synthesized from compound 2 with corresponding alkyl halides. Compounds 3a-k were active against six bacteria (MIC: 7.8-500.0 μg/mL). They also showed good antioxidant activities in DPPH scavenging (SC₅₀: 45-133 μg/mL) and ferric reducing/antioxidant power (14-141 μM TEAC) tests. The biological activities decreased as alkyl chain length increased. The reason behind the obvious negative effect of alkyl chain elongation is unclear and requires investigations about the intermolecular interactions of these pyridinium salts with bioassay components.

  5. Studying Activity Series of Metals.

    ERIC Educational Resources Information Center

    Hoon, Tien-Ghun; And Others

    1995-01-01

    Presents teaching strategies that illustrate the linking together of numerous chemical concepts involving the activity of metals (quantitative analysis, corrosion, and electrolysis) through the use of deep-level processing strategies. Concludes that making explicit links in the process of teaching chemistry can lead effectively to meaningful…

  6. (E)-4-aryl-4-oxo-2-butenoic acid amides, chalcone–aroylacrylic acid chimeras: Design, antiproliferative activity and inhibition of tubulin polymerization

    PubMed Central

    Vitorović-Todorović, Maja D.; Erić-Nikolić, Aleksandra; Kolundžija, Branka; Hamel, Ernest; Ristić, Slavica; Juranić, Ivan O.; Drakulić, Branko J.

    2013-01-01

    Antiproliferative activity of twenty-nine (E)-4-aryl-4-oxo-2-butenoic acid amides against three human tumor cell lines (HeLa, FemX, and K562) is reported. Compounds showed antiproliferative activity in one-digit micromolar to submicromolar concentrations. The most active derivatives toward all the cell lines tested bear alkyl substituents on the aroyl moiety of the molecules. Fourteen compounds showed tubulin assembly inhibition at concentrations <20 μM. The most potent inhibitor of tubulin assembly was unsubstituted compound 1, with IC50 = 2.9 μM. Compound 23 had an oral LD50 in vivo of 45 mg/kg in mice. Cell cycle analysis on K562 cells showed that compounds 1, 2 and 23 caused accumulation of cells in the G2/M phase, but inhibition of microtubule polymerization is not the principal mode of action of the compounds. Nevertheless, they may be useful leads for the design of a new class of antitubulin agents. PMID:23353745

  7. Synthesis and pharmacological activity of 1,3,6-trisubstituted-4-oxo-1,4-dihydroquinoline-2-carboxylic acids as selective ET(A) antagonists.

    PubMed

    Patel, Hardik J; Olgun, Nicole; Lengyel, István; Reznik, Sandra; Stephani, Ralph A

    2010-11-15

    A series of 1,3,6-trisubsituted-4-oxo-1,4-dihyroquinoline-2-carboxylic acid analogs (2a-m) were designed and synthesized and their pharmacological activity determined, with the objective to better understand their SAR as potential ET(A) selective inhibitors. Most of the compounds displayed significant ET(A) antagonist activity having IC(50) for inhibition of binding of the [(125)I]ET-1 to ET(A) receptor <10 nM, with good selectivity for ET(A) antagonism over ET(B) receptor. Based on the in vitro results, SAR of this series of compounds requires an alkoxy substituent at the 6-position to be a straight and saturated chain up to three carbons long, since substitution of unsaturated and branched alkyloxy groups results in decrease in ET(A) antagonist activity. In this series, compound 2c (6-O-n-propyl analog) was found to be most potent (IC(50)=0.11 nM) with ET(B)/ET(A) selectivity of 8303.

  8. Synthesis, Characterization, Antimicrobial and Antioxidant Activities of The Homocyclotrimer Of 4-Oxo-4h-Thieno[3,4-C]Chromene-3-Diazonium Sulfate

    PubMed Central

    Sopbue Fondjo, Emmanuel; Sorel, Djeukoua Dimo Kamal; Jean-de-Dieu, Tamokou; Joseph, Tsemeugne; Sylvian, Kouamo; Doriane, Ngouanet; Rodolphe, Chouna Jean; Pepin, Nkeng-Efouet-Alango; Jules-Roger, Kuiate; Arnaud, Ngongang Ndjintchui; Lucas, Sondengam Beibam

    2016-01-01

    The in situ formed 4-oxo-4H-thieno[3,4-c]chromene-3-diazonium sulfate (5) in the coupling reactions involving the parent 2-aminothiophene (4) and various phenolic and arylamines’ couplers, readily undergoes homocyclotrimerization at low temperature to afford in fairly good yield the first ever reported eighteen member ring heteroaromatic holigomer 6. Compound 6 was fully characterized by its elemental analysis, IR, UV-Vis, 1H-NMR, 13C-NMR and HRMS spectral data. The HMBC and HSQC techniques were used to ascertain the structural assignments. A comparative study on the antimicrobial and antioxidant activities of compounds 3, 4 and 6 was carried out to assess the SAR due to the transformations (from 3 to 6 via 4) on the tested compounds. It was found that compounds 6 and 4 were respectively the most active compounds against bacteria (MIC = 32-64 μg/ml) and yeasts (MIC = 16–64 μg/ml). Compound 6 also showed high radical-scavenging activities and ferric reducing power when compared with vitamin C and BHT used as reference antioxidants. PMID:27583034

  9. Synthesis, Characterization, Antimicrobial and Antioxidant Activities of The Homocyclotrimer Of 4-Oxo-4h-Thieno[3,4-C]Chromene-3-Diazonium Sulfate.

    PubMed

    Sopbue Fondjo, Emmanuel; Sorel, Djeukoua Dimo Kamal; Jean-de-Dieu, Tamokou; Joseph, Tsemeugne; Sylvian, Kouamo; Doriane, Ngouanet; Rodolphe, Chouna Jean; Pepin, Nkeng-Efouet-Alango; Jules-Roger, Kuiate; Arnaud, Ngongang Ndjintchui; Lucas, Sondengam Beibam

    2016-01-01

    The in situ formed 4-oxo-4H-thieno[3,4-c]chromene-3-diazonium sulfate (5) in the coupling reactions involving the parent 2-aminothiophene (4) and various phenolic and arylamines' couplers, readily undergoes homocyclotrimerization at low temperature to afford in fairly good yield the first ever reported eighteen member ring heteroaromatic holigomer 6. Compound 6 was fully characterized by its elemental analysis, IR, UV-Vis, (1)H-NMR, (13)C-NMR and HRMS spectral data. The HMBC and HSQC techniques were used to ascertain the structural assignments. A comparative study on the antimicrobial and antioxidant activities of compounds 3, 4 and 6 was carried out to assess the SAR due to the transformations (from 3 to 6 via 4) on the tested compounds. It was found that compounds 6 and 4 were respectively the most active compounds against bacteria (MIC = 32-64 μg/ml) and yeasts (MIC = 16-64 μg/ml). Compound 6 also showed high radical-scavenging activities and ferric reducing power when compared with vitamin C and BHT used as reference antioxidants. PMID:27583034

  10. Short communication inhibitory activity of 4-[(1,2-dihydro-2-oxo-3H-indol-3-ylidene)amino]-N-(4,6-dimethylpyrimidin-2-yl) benzenesulphonamide and its derivatives against orthopoxvirus replication in vitro.

    PubMed

    Selvam, Periyasamy; Murugesh, Narayanan; Chandramohan, Markandavel; Keith, Kathy A; Kern, Earl R

    2006-01-01

    4-[(1,2-Dihydro-2-oxo-3H-indol-3-ylidene)amino]-N-(4,6-dimethylpyrimidin-2-yl) benzenesulphonamide and its derivatives were tested in vitro for antiviral activity against vaccinia and cowpox virus replication in human foreskin fibroblast (HFF) cells, and their activity was compared with cidofovir (CDV). Among the tested compounds, 4-[(5-methyl-1,2-dihydro-2-oxo-3-H-indol-3-ylidene)amino]-N-(4,6-dimethylpyrimidin-2-yl)benzene-sulphonamide was the most active against vaccinia virus, with a 50% effective concentration (EC50) value of 18 microM and 4-[(N-acetyl-1,2-dihydro-2-oxo-3-H-indol-3-ylidene)amino]-N-(4,6-dimethylpyrimidin-2-yl) benzenesulphonamide was the most active against cowpox virus (EC50=33 microM). Cidofovir was found to have an EC50 of 20 microM and 32 microM against vaccinia and cowpox virus, respectively. Most of the tested compounds were non-cytotoxic (>300 microM) in HFF cells as determined by a neutral red uptake assay. The substitution of a halogen atom at the 5-position of isatin abolished the antiviral activity.

  11. C-H bond activation by metal-superoxo species: what drives high reactivity?

    PubMed

    Ansari, Azaj; Jayapal, Prabha; Rajaraman, Gopalan

    2015-01-01

    Metal-superoxo species are ubiquitous in metalloenzymes and bioinorganic chemistry and are known for their high reactivity and their ability to activate inert C-H bonds. The comparative oxidative abilities of M-O2(.-) species (M = Cr(III), Mn(III), Fe(III), and Cu(II)) towards C-H bond activation reaction are presented. These superoxo species generated by oxygen activation are found to be aggressive oxidants compared to their high-valent metal-oxo counterparts generated by O⋅⋅⋅O bond cleavage. Our calculations illustrate the superior oxidative abilities of Fe(III)- and Mn(III)-superoxo species compared to the others and suggest that the reactivity may be correlated to the magnetic exchange parameter.

  12. An orally active cathepsin K inhibitor, furan-2-carboxylic acid, 1-{1-[4-fluoro-2-(2-oxo-pyrrolidin-1-yl)-phenyl]-3-oxo-piperidin-4-ylcarbamoyl}-cyclohexyl)-amide (OST-4077), inhibits osteoclast activity in vitro and bone loss in ovariectomized rats.

    PubMed

    Kim, M K; Kim, H D; Park, J H; Lim, J I; Yang, J S; Kwak, W Y; Sung, S Y; Kim, H J; Kim, S H; Lee, C H; Shim, J Y; Bae, M H; Shin, Y A; Huh, Y; Han, T D; Chong, W; Choi, H; Ahn, B N; Yang, S O; Son, M H

    2006-08-01

    Human cathepsin K, a cysteine proteinase of the papain family, has been recognized as a potential drug target for the treatment of osteoporosis. The predominant expression of cathepsin K in osteoclasts has rendered the enzyme into a major target for the development of novel antiresorptive drugs. Now, we report the pharmacological properties of OST-4077 [furan-2-carboxylic acid (1-{1-[4-fluoro-2-(2-oxo-pyrrolidin-1-yl)-phenyl]-3-oxo-piperidin-4-ylcarbamoyl}-cyclohexyl)-amide] as a novel selective cathepsin K inhibitor. Human and rat cathepsin K were inhibited in vitro by OST-4077 with the IC50 values of 11 and 427 nM, respectively. OST-4077 suppressed bone resorption induced by rabbit osteoclasts (IC50, 37 nM) but did not affect bone mineralization or cellular alkaline phosphatase activity in MC3T3-E1 cells. Parathyroid hormone-induced bone resorption was inhibited in a dose-dependent manner in thyroparathyroidectomized rats gavaged with a single dose of OST-4077 (ED50, 69 mg/kg). When given orally twice daily for 4 weeks to 3-month-old ovariectomized (OVX) rats, OST-4077 dose-dependently prevented bone loss, as monitored by bone densitometry, ash content, and urinary excretion of deoxypyridinoline. No change in serum osteocalcin in the OVX rats by OST-4077 suggested that bone formation might not be affected by the agent. In summary, OST-4077 selectively inhibited bone resorbing activities of osteoclasts and prevented bone loss induced by estrogen deficiency but did not affect bone formation. OST-4077, an orally active selective human cathepsin K inhibitor, may have the therapeutic potential for the treatment of diseases characterized by excessive bone loss including osteoporosis.

  13. Oxo-group-14-element bond formation in binuclear uranium(V) Pacman complexes.

    PubMed

    Jones, Guy M; Arnold, Polly L; Love, Jason B

    2013-07-29

    Simple and versatile routes to the functionalization of uranyl-derived U(V)-oxo groups are presented. The oxo-lithiated, binuclear uranium(V)-oxo complexes [{(py)3LiOUO}2(L)] and [{(py)3LiOUO}(OUOSiMe3)(L)] were prepared by the direct combination of the uranyl(VI) silylamide "ate" complex [Li(py)2][(OUO)(N")3] (N" = N(SiMe3)2) with the polypyrrolic macrocycle H4L or the mononuclear uranyl (VI) Pacman complex [UO2(py)(H2L)], respectively. These oxo-metalated complexes display distinct U-O single and multiple bonding patterns and an axial/equatorial arrangement of oxo ligands. Their ready availability allows the direct functionalization of the uranyl oxo group leading to the binuclear uranium(V) oxo-stannylated complexes [{(R3Sn)OUO}2(L)] (R = nBu, Ph), which represent rare examples of mixed uranium/tin complexes. Also, uranium-oxo-group exchange occurred in reactions with [TiCl(OiPr)3] to form U-O-C bonds [{(py)3LiOUO}(OUOiPr)(L)] and [(iPrOUO)2(L)]. Overall, these represent the first family of uranium(V) complexes that are oxo-functionalised by Group 14 elements.

  14. Mechanistic insights into the C-H bond activation of hydrocarbons by chromium(IV) oxo and chromium(III) superoxo complexes.

    PubMed

    Cho, Kyung-Bin; Kang, Hyeona; Woo, Jaeyoung; Park, Young Jun; Seo, Mi Sook; Cho, Jaeheung; Nam, Wonwoo

    2014-01-01

    The mechanism of the C-H bond activation of hydrocarbons by a nonheme chromium(IV) oxo complex bearing an N-methylated tetraazamacrocyclic cyclam (TMC) ligand, [Cr(IV)(O)(TMC)(Cl)](+) (2), has been investigated experimentally and theoretically. In experimental studies, reaction rates of 2 with substrates having weak C-H bonds were found to depend on the concentration and bond dissociation energies of the substrates. A large kinetic isotope effect value of 60 was determined in the oxidation of dihydroanthracene (DHA) and deuterated DHA by 2. These results led us to propose that the C-H bond activation reaction occurs via a H-atom abstraction mechanism, in which H-atom abstraction of substrates by 2 is the rate-determining step. In addition, formation of a chromium(III) hydroxo complex, [Cr(III)(OH)(TMC)(Cl)](+) (3), was observed as a decomposed product of 2 in the C-H bond activation reaction. The Cr(III)OH product was characterized unambiguously with various spectroscopic methods and X-ray crystallography. Density functional theory (DFT) calculations support the experimental observations that the C-H bond activation by 2 does not occur via the conventional H-atom-abstraction/oxygen-rebound mechanism and that 3 is the product formed in this C-H bond activation reaction. DFT calculations also propose that 2 may have some Cr(III)O(•-) character. The oxidizing power of 2 was then compared with that of a chromium(III) superoxo complex bearing the identical TMC ligand, [Cr(III)(O2)(TMC)(Cl)](+) (1), in the C-H bond activation reaction. By performing reactions of 1 and 2 with substrates under identical conditions, we were able to demonstrate that the reactivity of 2 is slightly greater than that of 1. DFT calculations again support this experimental observation, showing that the rate-limiting barrier for the reaction with 2 is slightly lower than that of 1.

  15. Comparison of the active-site design of molybdenum oxo-transfer enzymes by quantum mechanical calculations.

    PubMed

    Li, Jilai; Ryde, Ulf

    2014-11-17

    There are three families of mononuclear molybdenum enzymes that catalyze oxygen atom transfer (OAT) reactions, named after a typical example from each family, viz., dimethyl sulfoxide reductase (DMSOR), sulfite oxidase (SO), and xanthine oxidase (XO). These families differ in the construction of their active sites, with two molybdopterin groups in the DMSOR family, two oxy groups in the SO family, and a sulfido group in the XO family. We have employed density functional theory calculations on cluster models of the active sites to understand the selection of molybdenum ligands in the three enzyme families. Our calculations show that the DMSOR active site has a much stronger oxidative power than the other two sites, owing to the extra molybdopterin ligand. However, the active sites do not seem to have been constructed to make the OAT reaction as exergonic as possible, but instead to keep the reaction free energy close to zero (to avoid excessive loss of energy), thereby making the reoxidation (SO and XO) or rereduction of the active sites (DMSOR) after the OAT reaction facile. We also show that active-site models of the three enzyme families can all catalyze the reduction of DMSO and that the DMSOR model does not give the lowest activation barrier. Likewise, all three models can catalyze the oxidation of sulfite, provided that the Coulombic repulsion between the substrate and the enzyme model can be overcome, but for this harder reaction, the SO model gives the lowest activation barrier, although the differences are not large. However, only the XO model can catalyze the oxidation of xanthine, owing to its sulfido ligand.

  16. Cationic Silica-Supported N-Heterocyclic Carbene Tungsten Oxo Alkylidene Sites: Highly Active and Stable Catalysts for Olefin Metathesis.

    PubMed

    Pucino, Margherita; Mougel, Victor; Schowner, Roman; Fedorov, Alexey; Buchmeiser, Michael R; Copéret, Christophe

    2016-03-18

    Designing supported alkene metathesis catalysts with high activity and stability is still a challenge, despite significant advances in the last years. Described herein is the combination of strong σ-donating N-heterocyclic carbene ligands with weak σ-donating surface silanolates and cationic tungsten sites leading to highly active and stable alkene metathesis catalysts. These well-defined silica-supported catalysts, [(≡SiO)W(=O)(=CHCMe2 Ph)(IMes)(OTf)] and [(≡SiO)W(=O)(=CHCMe2 Ph)(IMes)(+) ][B(Ar(F) )4 (-) ] [IMes=1,3-bis(2,4,6-trimethylphenyl)-imidazol-2-ylidene, B(Ar(F) )4 =B(3,5-(CF3 )2 C6 H3 )4 ] catalyze alkene metathesis, and the cationic species display unprecedented activity for a broad range of substrates, especially for terminal olefins with turnover numbers above 1.2 million for propene.

  17. Cationic Silica-Supported N-Heterocyclic Carbene Tungsten Oxo Alkylidene Sites: Highly Active and Stable Catalysts for Olefin Metathesis.

    PubMed

    Pucino, Margherita; Mougel, Victor; Schowner, Roman; Fedorov, Alexey; Buchmeiser, Michael R; Copéret, Christophe

    2016-03-18

    Designing supported alkene metathesis catalysts with high activity and stability is still a challenge, despite significant advances in the last years. Described herein is the combination of strong σ-donating N-heterocyclic carbene ligands with weak σ-donating surface silanolates and cationic tungsten sites leading to highly active and stable alkene metathesis catalysts. These well-defined silica-supported catalysts, [(≡SiO)W(=O)(=CHCMe2 Ph)(IMes)(OTf)] and [(≡SiO)W(=O)(=CHCMe2 Ph)(IMes)(+) ][B(Ar(F) )4 (-) ] [IMes=1,3-bis(2,4,6-trimethylphenyl)-imidazol-2-ylidene, B(Ar(F) )4 =B(3,5-(CF3 )2 C6 H3 )4 ] catalyze alkene metathesis, and the cationic species display unprecedented activity for a broad range of substrates, especially for terminal olefins with turnover numbers above 1.2 million for propene. PMID:26928967

  18. A sialic acid aldolase from Peptoclostridium difficile NAP08 with 4-hydroxy-2-oxo-pentanoate aldolase activity.

    PubMed

    Chen, Qijia; Han, Lei; Chen, Xi; Cui, Yunfeng; Feng, Jinhui; Wu, Qiaqing; Zhu, Dunming

    2016-10-01

    Sialic acid aldolases (E.C.4.1.3.3) catalyze the reversible aldol cleavage of N-acetyl-d-neuraminic acid (Neu5Ac) to from N-acetyl-d-mannosamine (ManNAc) and pyruvate. In this study, a sialic acid aldolase (PdNAL) from Peptoclostridium difficile NAP08 was expressed in Escherichia coli BL21 (DE3). This homotetrameric enzyme was purified with a specific activity of 18.34U/mg for the cleavage of Neu5Ac. The optimal pH and temperature for aldol addition reaction were 7.4 and 65°C, respectively. PdNAL was quite stable at neutral and alkaline pH (6.0-10.0) and maintained about 89% of the activity after incubation at pH 10.0 for 24h. After incubation at 70°C for 15min, almost no activity loss was observed. The high thermostability simplified the purification of this enzyme. Interestingly, substrate profiling showed that PdNAL not only accepted ManNAc but also short chain aliphatic aldehydes such as acetaldehyde, propionaldehyde and n-butyraldehyde as the substrates. This is the first example that a sialic acid aldolase is active toward aliphatic aldehyde acceptors with two or more carbons. The amino acid sequence analysis indicates that PdNAL belongs to the NAL subfamily rather than 4-hydroxy-2-oxopentanoate (HOPA) aldolase, but it is interesting that the enzyme possesses the activity of HOPA aldolase. PMID:27542750

  19. Synthesis, spectroscopic characterization and thermal behavior of metal complexes formed with N'-(1-(4-hydroxyphenyl) ethylidene)-2-oxo-2-(phenylamino) acetohydrazide (H 3OPAH)

    NASA Astrophysics Data System (ADS)

    Ahmed, Sara F.; El-Gammal, Ola A.; El-Reash, Gaber Abu

    2011-12-01

    Complexes of Co(II), Ni(II), Cu(II), Mn(II), Cd(II), Zn(II), Hg(II) and U(IV)O 22+ with N'-(1-(4-hydroxyphenyl) ethylidene)-2-oxo-2-(phenylamino) acetohydrazide (H 3OPAH) are reported and have been characterized by various spectroscopic techniques like IR, UV-visible, 1H NMR and ESR as well as magnetic and thermal (TG and DTA) measurements. It is found that the ligand behaves as a neutral bidentate, monoanionic tridentate or tetradentate and dianionic tetradentate. An octahedral geometry for [Mn(H 3OPAH) 2Cl 2], [Co 2(H 2OPAH) 2Cl 2(H 2O) 4] and [(UO 2) 2(HOPAH)(OAc) 2(H 2O) 2] complexes, a square planar geometry for [Cu 2(H 2OPAH)Cl 3(H 2O)]H 2O complex, a tetrahedral structure for [Cd(H 3OPAH)Cl 2], [Zn(H 3OPAH)(OAc) 2] and [Hg(H 3OPAH)Cl 2]H 2O complexes. The binuclear [Ni 2(HOPAH)Cl 2(H 2O) 2]H 2O complex contains a mixed geometry of both tetrahedral and square planar structures. The protonation constants of ligand and stepwise stability constants of its complexes at 298, 308 and 318 K as well as the thermodynamic parameters are being calculated. The bond lengths, bond angles, HOMO, LUMO and dipole moments have been calculated to confirm the geometry of the ligand and the investigated complexes. Also, thermal properties and decomposition kinetics of all compounds are investigated. The interpretation, mathematical analysis and evaluation of kinetic parameters ( Ea, A, Δ H, Δ S and Δ G) of all thermal decomposition stages have been evaluated using Coats-Redfern and Horowitz-Metzger methods.

  20. Factors Controlling the Chemoselectivity in the Oxidation of Olefins by Nonheme Manganese(IV)-Oxo Complexes.

    PubMed

    Kim, Surin; Cho, Kyung-Bin; Lee, Yong-Min; Chen, Junying; Fukuzumi, Shunichi; Nam, Wonwoo

    2016-08-24

    We report the oxidation of cyclic olefins, such as cyclohexene, cyclohexene-d10, and cyclooctene, by mononuclear nonheme manganese(IV)-oxo (Mn(IV)O) and triflic acid (HOTf)-bound Mn(IV)O complexes. In the oxidation of cyclohexene, the Mn(IV)O complexes prefer the C-H bond activation to the C═C double bond epoxidation, whereas the C═C double bond epoxidation becomes a preferred reaction pathway in the cyclohexene oxidation by HOTf-bound Mn(IV)O complexes. In contrast, the oxidation of cyclohexene-d10 and cyclooctene by the Mn(IV)O complexes occurs predominantly via the C═C double bond epoxidation. This conclusion is drawn from the product analysis and kinetic studies of the olefin oxidation reactions, such as the epoxide versus allylic oxidation products, the formation of Mn(II) versus Mn(III) products, and the kinetic analyses. Overall, the experimental results suggest that the energy barrier of the C═C double bond epoxidation is very close to that of the allylic C-H bond activation in the oxidation of cyclic olefins by high-valent metal-oxo complexes. Thus, the preference of the reaction pathways is subject to changes upon small manipulation of the reaction environments, such as the supporting ligands and metal ions in metal-oxo species, the presence of HOTf (i.e., HOTf-bound Mn(IV)O species), and the allylic C-H(D) bond dissociation energies of olefins. This is confirmed by DFT calculations in the oxidation of cyclohexene and cyclooctene, which show multiple pathways with similar rate-limiting energy barriers and depending on the allylic C-H bond dissociation energies. In addition, the possibility of excited state reactivity in the current system is confirmed for epoxidation reactions. PMID:27462828

  1. Factors Controlling the Chemoselectivity in the Oxidation of Olefins by Nonheme Manganese(IV)-Oxo Complexes.

    PubMed

    Kim, Surin; Cho, Kyung-Bin; Lee, Yong-Min; Chen, Junying; Fukuzumi, Shunichi; Nam, Wonwoo

    2016-08-24

    We report the oxidation of cyclic olefins, such as cyclohexene, cyclohexene-d10, and cyclooctene, by mononuclear nonheme manganese(IV)-oxo (Mn(IV)O) and triflic acid (HOTf)-bound Mn(IV)O complexes. In the oxidation of cyclohexene, the Mn(IV)O complexes prefer the C-H bond activation to the C═C double bond epoxidation, whereas the C═C double bond epoxidation becomes a preferred reaction pathway in the cyclohexene oxidation by HOTf-bound Mn(IV)O complexes. In contrast, the oxidation of cyclohexene-d10 and cyclooctene by the Mn(IV)O complexes occurs predominantly via the C═C double bond epoxidation. This conclusion is drawn from the product analysis and kinetic studies of the olefin oxidation reactions, such as the epoxide versus allylic oxidation products, the formation of Mn(II) versus Mn(III) products, and the kinetic analyses. Overall, the experimental results suggest that the energy barrier of the C═C double bond epoxidation is very close to that of the allylic C-H bond activation in the oxidation of cyclic olefins by high-valent metal-oxo complexes. Thus, the preference of the reaction pathways is subject to changes upon small manipulation of the reaction environments, such as the supporting ligands and metal ions in metal-oxo species, the presence of HOTf (i.e., HOTf-bound Mn(IV)O species), and the allylic C-H(D) bond dissociation energies of olefins. This is confirmed by DFT calculations in the oxidation of cyclohexene and cyclooctene, which show multiple pathways with similar rate-limiting energy barriers and depending on the allylic C-H bond dissociation energies. In addition, the possibility of excited state reactivity in the current system is confirmed for epoxidation reactions.

  2. Antimicrobial activity of the metals and metal oxide nanoparticles.

    PubMed

    Dizaj, Solmaz Maleki; Lotfipour, Farzaneh; Barzegar-Jalali, Mohammad; Zarrintan, Mohammad Hossein; Adibkia, Khosro

    2014-11-01

    The ever increasing resistance of pathogens towards antibiotics has caused serious health problems in the recent years. It has been shown that by combining modern technologies such as nanotechnology and material science with intrinsic antimicrobial activity of the metals, novel applications for these substances could be identified. According to the reports, metal and metal oxide nanoparticles represent a group of materials which were investigated in respect to their antimicrobial effects. In the present review, we focused on the recent research works concerning antimicrobial activity of metal and metal oxide nanoparticles together with their mechanism of action. Reviewed literature indicated that the particle size was the essential parameter which determined the antimicrobial effectiveness of the metal nanoparticles. Combination therapy with the metal nanoparticles might be one of the possible strategies to overcome the current bacterial resistance to the antibacterial agents. However, further studies should be performed to minimize the toxicity of metal and metal oxide nanoparticles to apply as proper alternatives for antibiotics and disinfectants especially in biomedical applications. PMID:25280707

  3. A novel hexanuclear titanium(iv)-oxo-iminodiacetate cluster with a Ti6O9 core: single-crystal structure and photocatalytic activities.

    PubMed

    Ni, Lubin; Liang, Dashuai; Cai, Yin; Diao, Guowang; Zhou, Zhaohui

    2016-05-01

    A new family of hexanuclear titanium(iv)-oxo-carboxylate cluster K7H[Ti6O9(ida)6]Cl2·13H2O {Ti6O9} has been synthesized via the H2O2-assisted reaction between TiCl4 and iminodiacetate ligands. This cluster was fully characterized by single-crystal X-ray diffraction and a wide range of analytical methods, including FT-IR, UV/vis spectroscopy as well as electrochemistry and thermogravimetric analysis. As a new type of carboxylate substituted Ti-oxo-cluster, the structural motif of the {Ti6O9} cluster consists of one symmetric {Ti6O6} hexagonal prism with two staggered triangular {Ti3O3} subunits linked by three μ2-O bridges. The {Ti6O9} polyanions are linked by K(+) cations to form a novel 3D architecture. The structural information and stability of the {Ti6O9} polyanion in aqueous solution were thoroughly investigated by solid-state/solution NMR, ESI-MS spectroscopy. Moreover, this Ti-oxo cluster exhibits remarkable potential as a visible-light homogeneous photocatalyst for degradation of rhodamine B (RhB). Finally, a proposed peroxotitanium(iv)-mediated photocatalytic pathway involved is illustrated by spectroscopic data.

  4. Chemistry of metal oxo alkyl complexes. Mechanistic studies on the anaerobic and aerobic decompositions of molybdenum(VI) dioxo dialkyl complexes

    SciTech Connect

    Vetter, W.M.; Sen, A. )

    1991-01-01

    The anaerobic and aerobic decompositions of L{sub 2}Mo(O){sub 2}R{sub 2} (L{sub 2} = 4,4{prime}-dimethyl-2,2{prime}-dipyridyl, R = CH{sub 2}Ph, 1; R = CH{sub 2}C{sub 6}H{sub 4}CH{sub 3}-p, 2; R = (CH{sub 2}){sub 4}CH:CH{sub 2}, 3; R = CH{sub 2}CHMe{sub 2}, 4; R = CH{sub 2}CMe{sub 3}, 5; R = CH{sub 2}CMe{sub 2}Ph, 6) were studied. The anaerobic decomposition mode chosen by a given L{sub 2}Mo(O){sub 2}R{sub 2} complex is a sensitive function of the hydrocarbyl group, R. If accessible {beta}-hydrogens are present on R (as in 3 and 4), equal amounts of alkane and alkene are formed through a {beta}-hydrogen abstraction pathway. In the case of 4, an additional pathway involving Mo-R bond homolysis accounts for 10% of the products formed. When {beta}-hydrogens are absent from R (as in 1, 2, and 6), the free radical, R{sup {sm bullet}}, formed by Mo-R bond homolysis is the predominant product. The reaction of the L{sub 2}Mo(O){sub 2}R{sub 2} complexes with O{sub 2} appears to proceed almost exclusively through the intermediacy of the free radical, R{sup {sm bullet}}. In inert solvents, the principal organic product is the corresponding aldehyde, and the role of O{sub 2} in its formation from L{sub 2}Mo(O){sub 2}R{sub 2} is 2-fold: (a) O{sub 2} promotes the homolysis of the Mo-R bond to form R{sup {sm bullet}}, and (b) O{sub 2} traps the resultant radical to yield the aldehyde. Labeling studies indicated that O{sub 2}, rather than the Mo{double bond}O group, was the predominant source of oxygen for the aldehydes. Mechanistic implications of the authors' observations for the heterogeneous oxidation of alkanes and alkenes by Mo(VI)- and V(V)-oxo species are discussed.

  5. 1-Ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(1H-pyrrol-1-yl)-quinoline-3-carb oxylic acid, a new fluorinated compounds of oxacin family with high broad-spectrum antibacterial activities.

    PubMed

    Stefancich, G; Artico, M; Corelli, F; Massa, S; Panico, S; Simonetti, N

    1985-04-01

    The synthesis of 1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(1H-pyrrol-1-yl)quinoline-3-carboxy lic acid, a new fluorinated high broad-spectrum antibacterial agent related to nalidixic acid is described. The title compound has been prepared by the reaction of 4-fluoro-3-(1H-pyrrol-1-yl)aniline with diethyl ethoxymethylenemalonate, cyclization of the malonate obtained to the quinolinecarboxylate ester, ethylation of the ester, followed by hydrolysis with aqueous sodium hydroxide. The new derivative proved very active against both gram-positive and gram-negative bacteria. Its activities in comparison with those of nalidixic acid, pipemidic acid, piromidic acid and enoxacin were found to be greatly superior with regard to the unfluorinated compounds and somewhat superior also to enoxacin. The known 1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(pyrrolidin-1-yl)quinoline-3- carboxylic acid, here prepared by catalytic hydrogenation of the pyrrole moiety of the title compound, has been found to be less active as an antibacterial agent. PMID:3926533

  6. Design, Synthesis, and Structure-Activity Relationship of a Novel Series of 2-Aryl 5-(4-oxo-3-phenethyl-2-thioxothiazolidin-ylidenemethyl)furans as HIV-1 entry inhibitors*

    PubMed Central

    Tala, Srinivasa R.; Lu, Hong; Vakulenko, Anatoliy V.; Chen, Qi-Yin; Sivapackiam, Jothilingam; Pandya, Keyur

    2009-01-01

    We previously identified two small molecules targeting the HIV-1 gp41, N-(4-carboxy-3-hydroxy)phenyl-2,5-dimethylpyrrole 12 (NB-2) and N-(3-carboxy-4-chloro) phenylpyrrole 13 (NB-64) that inhibit HIV-1 infection at low μM level. Based on molecular docking analysis, we designed a series of 2-aryl 5-(4-oxo-3-phenethyl-2-thioxothiazolidinylidenemethyl)furans. Compared with 12 and 13, these compounds have bigger molecular size (437–515 Da) and could occupy more space in the deep hydrophobic pocket on the gp41 NHR-trimer. Fifteen 2-aryl 5-(4-oxo-3-phenethyl-2-thioxothiazolidinylidenemethyl)furans (11a–o) were synthesized by Suzuki-Miyaura cross coupling, followed by a Knoevenagel condensation and tested for their anti-HIV-1activity and cytotoxicity on MT-2 cells. We found that all 15 compounds had improved anti-HIV-1 activity and 3 of them (11a, 11b, and 11d) exhibited inhibitory activity against replication of HIV-1 IIIB and 94UG103 at <100 nM range, more than 20-fold more potent than 12 and 13, suggesting that these compounds can serve as leads for development of novel small molecule HIV fusion inhibitors. PMID:19746983

  7. Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

    PubMed Central

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

  8. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    PubMed

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

  9. Synthesis, structures, electrochemical studies and antioxidant activity of 5-aryl-4-oxo-3,4,5,8-tetrahydropyrido[2,3-d]pyrimidine-7-carboxylic acids

    NASA Astrophysics Data System (ADS)

    Quiroga, Jairo; Romo, Pablo E.; Ortiz, Alejandro; Isaza, José Hipólito; Insuasty, Braulio; Abonia, Rodrigo; Nogueras, Manuel; Cobo, Justo

    2016-09-01

    The synthesis of 5-aryl-4-oxo-3,4,5,8-tetrahydropyrido[2,3-d]pyrimidine-7-carboxylic acids 3 from the reaction of 6-aminopyrimidines 1 with arylidene derivatives of pyruvic acid 2 under microwave and ultrasound irradiation is described. The orientation of cyclization process was determined by NMR measurements. The methodology provides advantages such as high yields and friendly to the environment without the use of solvents. The antioxidant properties, DPPH free radical scavenging, ORAC, and anodic potential oxidation of the new pyridopyrimidines were studied.

  10. A GGA+U approach to effective electronic correlations in thiolate-ligated iron-oxo (IV) porphyrin

    NASA Astrophysics Data System (ADS)

    Elenewski, Justin E.; Hackett, John C.

    2012-09-01

    High-valent oxo-metal complexes exhibit correlated electronic behavior on dense, low-lying electronic state manifolds, presenting challenging systems for electronic structure methods. Among these species, the iron-oxo (IV) porphyrin denoted Compound I occupies a privileged position, serving a broad spectrum of catalytic roles. The most reactive members of this family bear a thiolate axial ligand, exhibiting high activity toward molecular oxygen activation and substrate oxidation. The default approach to such systems has entailed the use of hybrid density functionals or multi-configurational/multireference methods to treat electronic correlation. An alternative approach is presented based on the GGA+U approximation to density functional theory, in which a generalized gradient approximation (GGA) functional is supplemented with a localization correction to treat on-site correlation as inspired by the Hubbard model. The electronic structure of thiolate-ligated iron-oxo (IV) porphyrin and corresponding Coulomb repulsion U are determined both empirically and self-consistently, yielding spin-distributions, state level splittings, and electronic densities of states consistent with prior hybrid functional calculations. Comparison of this detailed electronic structure with model Hamiltonian calculations suggests that the localized 3d iron moments induce correlation in the surrounding electron gas, strengthening local moment formation. This behavior is analogous to strongly correlated electronic systems such as Mott insulators, in which the GGA+U scheme serves as an effective single-particle representation for the full, correlated many-body problem.

  11. Transition metals activate TFEB in overexpressing cells.

    PubMed

    Peña, Karina A; Kiselyov, Kirill

    2015-08-15

    Transition metal toxicity is an important factor in the pathogenesis of numerous human disorders, including neurodegenerative diseases. Lysosomes have emerged as important factors in transition metal toxicity because they handle transition metals via endocytosis, autophagy, absorption from the cytoplasm and exocytosis. Transcription factor EB (TFEB) regulates lysosomal biogenesis and the expression of lysosomal proteins in response to lysosomal and/or metabolic stresses. Since transition metals cause lysosomal dysfunction, we proposed that TFEB may be activated to drive gene expression in response to transition metal exposure and that such activation may influence transition metal toxicity. We found that transition metals copper (Cu) and iron (Fe) activate recombinant TFEB and stimulate the expression of TFEB-dependent genes in TFEB-overexpressing cells. In cells that show robust lysosomal exocytosis, TFEB was cytoprotective at moderate levels of Cu exposure, decreasing oxidative stress as reported by the expression of heme oxygenase-1 (HMOX1) gene. However, at high levels of Cu exposure, particularly in cells with low levels of lysosomal exocytosis, activation of overexpressed TFEB was toxic, increasing oxidative stress and mitochondrial damage. Based on these data, we conclude that TFEB-driven gene network is a component of the cellular response to transition metals. These data suggest limitations and disadvantages of TFEB overexpression as a therapeutic approach. PMID:26251447

  12. Transition metals activate TFEB in overexpressing cells

    PubMed Central

    Peña, Karina A.; Kiselyov, Kirill

    2015-01-01

    Transition metal toxicity is an important factor in the pathogenesis of numerous human disorders, including neurodegenerative diseases. Lysosomes have emerged as important factors in transition metal toxicity because they handle transition metals via endocytosis, autophagy, absorption from the cytoplasm and exocytosis. Transcription factor EB (TFEB) regulates lysosomal biogenesis and the expression of lysosomal proteins in response to lysosomal and/or metabolic stresses. Since transition metals cause lysosomal dysfunction, we proposed that TFEB may be activated to drive gene expression in response to transition metal exposure and that such activation may influence transition metal toxicity. We found that transition metals copper (Cu) and iron (Fe) activate recombinant TFEB and stimulate the expression of TFEB-dependent genes in TFEB-overexpressing cells. In cells that show robust lysosomal exocytosis, TFEB was cytoprotective at moderate levels of Cu exposure, decreasing oxidative stress as reported by the expression of heme oxygenase-1 (HMOX1) gene. However, at high levels of Cu exposure, particularly in cells with low levels of lysosomal exocytosis, activation of overexpressed TFEB was toxic, increasing oxidative stress and mitochondrial damage. Based on these data, we conclude that TFEB-driven gene network is a component of the cellular response to transition metals. These data suggest limitations and disadvantages of TFEB overexpression as a therapeutic approach. PMID:26251447

  13. Active Site Metal Occupancy and Cyclic Di-GMP Phosphodiesterase Activity of Thermotoga maritima HD-GYP.

    PubMed

    Miner, Kyle D; Kurtz, Donald M

    2016-02-16

    HD-GYPs make up a subclass of the metal-dependent HD phosphohydrolase superfamily and catalyze conversion of cyclic di(3',5')-guanosine monophosphate (c-di-GMP) to 5'-phosphoguanylyl-(3'→5')-guanosine (pGpG) and GMP. Until now, the only reported crystal structure of an HD-GYP that also exhibits c-di-GMP phosphodiesterase activity contains a His/carboxylate ligated triiron active site. However, other structural and phylogenetic correlations indicate that some HD-GYPs contain dimetal active sites. Here we provide evidence that an HD-GYP c-di-GMP phosphodiesterase, TM0186, from Thermotoga maritima can accommodate both di- and trimetal active sites. We show that an as-isolated iron-containing TM0186 has an oxo/carboxylato-bridged diferric site, and that the reduced (diferrous) form is necessary and sufficient to catalyze conversion of c-di-GMP to pGpG, but that conversion of pGpG to GMP requires more than two metals per active site. Similar c-di-GMP phosphodiesterase activities were obtained with divalent iron or manganese. On the basis of activity correlations with several putative metal ligand residue variants and molecular dynamics simulations, we propose that TM0186 can accommodate both di- and trimetal active sites. Our results also suggest that a Glu residue conserved in a subset of HD-GYPs is required for formation of the trimetal site and can also serve as a labile ligand to the dimetal site. Given the anaerobic growth requirement of T. maritima, we suggest that this HD-GYP can function in vivo with either divalent iron or manganese occupying di- and trimetal sites.

  14. Dichotomous Hydrogen Atom Transfer vs. Proton Coupled Electron Transfer During Activation of X-H Bonds (X = C, N, O) by Nonheme Iron-Oxo Complexes of Variable Basicity

    PubMed Central

    Usharani, Dandamudi; Lacy, David C.; Borovik, A. S.; Shaik, Sason

    2013-01-01

    We describe herein the hydrogen-atom transfer (HAT)/ proton-coupled electron-transfer (PCET) reactivity for FeIV-oxo and FeIII-oxo complexes (1–4) that activate C-H, N-H, and O-H bonds in 9,10 dihydroanthracene (S1), dimethylformamide (S2), 1,2 diphenylhydrazine (S3), p-methoxyphenol (S4), and 1,4-cyclohexadiene (S5). In 1–3, the iron is pentacoordinated by tris[N'-tert-butylureaylato)-N-ethylene]aminato ([H3buea]3−) or its derivatives. These complexes are basic, in the order 3 >> 1 > 2. Oxidant 4, [FeIVN4Py(O)]2+ (N4Py: N,N-bis(2-pyridylmethyl)-bis(2-pyridyl) methylamine), is the least basic oxidant. The DFT results match experimental trends and exhibit a mechanistic spectrum ranging from concerted HAT and PCET reactions to concerted-asynchronous proton transfer (PT) / electron transfer (ET) mechanisms, all the way to PT. The singly occupied orbital along the O---H---X (X= C, N, O) moiety in the TS shows clearly that in the PCET cases, the electron is transferred separately from the proton. The Bell-Evans-Polanyi principle does not account for the observed reactivity pattern, as evidenced by the scatter in the plot of calculated barrier vs. reactions driving forces. However, a plot of the deformation energy in the TS vs. the respective barrier provides a clear signature of the HAT/PCET dichotomy. Thus, in all C-H bond activations, the barrier derives from the deformation energy required to create the TS, whereas in N-H/O-H bond activations, the deformation energy is much larger than the corresponding barrier, indicating the presence of stabilizing interaction between the TS fragments. A valence bond model is used to link the observed results with the basicity/acidity of the reactants. PMID:24124906

  15. Preferential affinity of /sup 3/H-2-oxo-quazepam for type I benzodiazepine recognition sites in the human brain

    SciTech Connect

    Corda, M.G.; Giorgi, O.; Longoni, B.; Ongini, E.; Montaldo, S.; Biggio, G.

    1988-01-01

    The hypnotic drug quazepam and its active metabolite 2-oxo-quazepam (2-oxo-quaz) are two benzodiazepines (BZ) containing a trifluoroethyl moiety on the ring nitrogen at position 1, characterized by their preferential affinity for Type I BZ recognition sites. In the present study we characterized the binding of /sup 3/H-2-oxo-quaz in discrete areas of the human brain. Saturation analysis demonstrated specific and saturable binding of /sup 3/H-2-oxo-quaz to membrane preparations from human cerebellum. Hill plot analysis of displacement curves of /sup 3/H-flunitrazepam binding by 2-oxo-quaz yielded Hill coefficients of approximately 1 in the cerebellum and significantly less than 1 in the cerebral cortex, hippocampus, caudate nucleus, thalamus and pons. Self and cross displacement curves for /sup 3/H-FNT and /sup 3/H-2-oxo-quaz binding in these brain areas indicated that 2-oxo-quaz binds with different affinities to two populations of binding sites. High affinity binding sites were more abundant in the cerebellum, cerebral cortex, hippocampus and thalamus, whereas low affinity sites were predominant in the caudate nucleus and pons. Competition studies of /sup 3/H-2-oxo-quaz and /sup 3/H-FNT using unlabelled ligands indicated that compounds which preferentially bind to Type I sites are more potent at displacing /sup 3/H-2-oxo-quaz than /sup 3/H-FNT from cerebral cortex membrane preparations. 26 references, 2 figures, 3 tables.

  16. Metal removal by thermally activated clay marl.

    PubMed

    Stefanova, R Y

    2001-01-01

    A sorption active product has been obtained from Bulgarian clay marl by thermal activation at 750 degrees C. The modified aluminosilicate material is characterized, as well as its use for the removal of metal ions. The effect of the initial metal ion concentration, the contact time, pH, the solution temperature and the ionic strength on the uptake of lead, copper and zinc ions from aqueous solutions were studied in batch experiments. The kinetics of removal of metal ions on modified clay marl appears dependent on the sorbate/sorbent ratio. At low cation concentrations sorption follows a Langmuir isotherm, while at higher sorbate/sorbent ratios the sorption isotherms of metal ions are described by Freundlich's equation. At the pH region of the sorption edge the removal of metal ions by surface complexation and surface precipitation mechanisms is indistinguishable. It is observed that the influence of temperature on the uptake ability of the clay marl is most considerable up to 40 degrees C. These studies show that the thermally modified clay marl can be successfully used for removal of metal ions from water solutions in a wide range of concentrations.

  17. Scavenging 4-Oxo-2-nonenal.

    PubMed

    Amarnath, Venkataraman; Amarnath, Kalyani

    2015-10-19

    4-Oxo-2-nonenal (ONE), a product of cellular lipid oxidation, reacts nonspecifically with the lysine residues of proteins and is generated in increased amounts during degenerative diseases and cancer. We show that pyridoxamine, salicylamine, and related 2-aminomethylphenols react with ONE, to form pyrrolo[2,1-b][1,3]oxazines with the participation of both the amino and the phenolic groups. 2-Aminomethylphenols react with ONE as well as with the Michael adducts of ONE much more rapidly than lysine, suggesting their use for therapeutically scavenging ONE. PMID:26355561

  18. Synthesis and structure-activity relationships of novel 7-substituted 1,4-dihydro-4-oxo-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acids as antitumor agents. Part 1.

    PubMed

    Tomita, Kyoji; Tsuzuki, Yasunori; Shibamori, Koh-ichiro; Tashima, Masanori; Kajikawa, Fumie; Sato, Yuji; Kashimoto, Shigeki; Chiba, Katsumi; Hino, Katsuhiko

    2002-12-01

    In an attempt to search for clinically useful antitumor agents, we have discovered that a series of 1,7-disubstituted-6-fluoro-1,4-dihydro-4-oxo-1,8-naphthyridine-3-carboxylic acids possessed moderate cytotoxic activity. We investigated the structure-activity relationships in this series of compounds by changing N-1 and C-7 positions and the core ring structure itself and evaluated the synthesized compounds against several murine and human tumor cell lines. These modifications led us to the following findings. (1) The 2-thiazolyl group at the N-1 position of the naphthyridine structure is the best substituent for antitumor activity. (2) Regarding core ring structure, the naphthyridine derivative is the most active followed by pyridopyrimidine analogue. (3) At the C-7 position, aminopyrrolidine derivatives are more effective than other amines or thioether derivatives. Finally, the trans-3-amino-4-methoxypyrrolidinyl derivative (43j) and the 3-amino-3-methylpyrrolidinyl derivative (43f) as well as 3-aminopyrrolidinyl derivative (AT-3639, 1) were determined to be effective in in vitro and in vivo antitumor assays, and their activity was comparable to that of etoposide.

  19. Electrocatalytic oxidation of small organic molecules in acid medium: enhancement of activity of noble metal nanoparticles and their alloys by supporting or modifying them with metal oxides

    PubMed Central

    Kulesza, Pawel J.; Pieta, Izabela S.; Rutkowska, Iwona A.; Wadas, Anna; Marks, Diana; Klak, Karolina; Stobinski, Leszek; Cox, James A.

    2013-01-01

    Different approaches to enhancement of electrocatalytic activity of noble metal nanoparticles during oxidation of small organic molecules (namely potential fuels for low-temperature fuel cells such as methanol, ethanol and formic acid) are described. A physical approach to the increase of activity of catalytic nanoparticles (e.g. platinum or palladium) involves nanostructuring to obtain highly dispersed systems of high surface area. Recently, the feasibility of enhancing activity of noble metal systems through the formation of bimetallic (e.g. PtRu, PtSn, and PdAu) or even more complex (e.g. PtRuW, PtRuSn) alloys has been demonstrated. In addition to possible changes in the electronic properties of alloys, specific interactions between metals as well as chemical reactivity of the added components have been postulated. We address and emphasize here the possibility of utilization of noble metal and alloyed nanoparticles supported on robust but reactive high surface area metal oxides (e.g. WO3, MoO3, TiO2, ZrO2, V2O5, and CeO2) in oxidative electrocatalysis. This paper concerns the way in which certain inorganic oxides and oxo species can act effectively as supports for noble metal nanoparticles or their alloys during electrocatalytic oxidation of hydrogen and representative organic fuels. Among important issues are possible changes in the morphology and dispersion, as well as specific interactions leading to the improved chemisorptive and catalytic properties in addition to the feasibility of long time operation of the discussed systems. PMID:24443590

  20. Electrocatalytic oxidation of small organic molecules in acid medium: enhancement of activity of noble metal nanoparticles and their alloys by supporting or modifying them with metal oxides.

    PubMed

    Kulesza, Pawel J; Pieta, Izabela S; Rutkowska, Iwona A; Wadas, Anna; Marks, Diana; Klak, Karolina; Stobinski, Leszek; Cox, James A

    2013-11-01

    Different approaches to enhancement of electrocatalytic activity of noble metal nanoparticles during oxidation of small organic molecules (namely potential fuels for low-temperature fuel cells such as methanol, ethanol and formic acid) are described. A physical approach to the increase of activity of catalytic nanoparticles (e.g. platinum or palladium) involves nanostructuring to obtain highly dispersed systems of high surface area. Recently, the feasibility of enhancing activity of noble metal systems through the formation of bimetallic (e.g. PtRu, PtSn, and PdAu) or even more complex (e.g. PtRuW, PtRuSn) alloys has been demonstrated. In addition to possible changes in the electronic properties of alloys, specific interactions between metals as well as chemical reactivity of the added components have been postulated. We address and emphasize here the possibility of utilization of noble metal and alloyed nanoparticles supported on robust but reactive high surface area metal oxides (e.g. WO3, MoO3, TiO2, ZrO2, V2O5, and CeO2) in oxidative electrocatalysis. This paper concerns the way in which certain inorganic oxides and oxo species can act effectively as supports for noble metal nanoparticles or their alloys during electrocatalytic oxidation of hydrogen and representative organic fuels. Among important issues are possible changes in the morphology and dispersion, as well as specific interactions leading to the improved chemisorptive and catalytic properties in addition to the feasibility of long time operation of the discussed systems.

  1. Characterizations of Metal Binding in the Active Sites of Acireductone Dioxygenase Isoforms from Klebsiella ATCC 8724

    SciTech Connect

    Chai,S.; Ju, T.; Dang, M.; Goldsmith, R.; Maroney, M.; Pochapsky, T.

    2008-01-01

    The two acireductone dioxygenase (ARD) isozymes from the methionine salvage pathway of Klebsiella ATCC 8724 present an unusual case in which two enzymes with different structures and distinct activities toward their common substrates (1, 2-dihydroxy-3-oxo-5-(methylthio)pent-1-ene and dioxygen) are derived from the same polypeptide chain. Structural and functional differences between the two isozymes are determined by the type of M2+ metal ion bound in the active site. The Ni2+-bound NiARD catalyzes an off-pathway shunt from the methionine salvage pathway leading to the production of formate, methylthiopropionate, and carbon monoxide, while the Fe2+-bound FeARD' catalyzes the on-pathway formation of methionine precursor 2-keto-4-methylthiobutyrate and formate. Four potential protein-based metal ligands were identified by sequence homology and structural considerations. Based on the results of site-directed mutagenesis experiments, X-ray absorption spectroscopy (XAS), and isothermal calorimetry measurements, it is concluded that the same four residues, His96, His98, Glu102 and His140, provide the protein-based ligands for the metal in both the Ni- and Fe-containing forms of the enzyme, and subtle differences in the local backbone conformations trigger the observed structural and functional differences between the FeARD' and NiARD isozymes. Furthermore, both forms of the enzyme bind their respective metals with pseudo-octahedral geometry, and both may lose a histidine ligand upon binding of substrate under anaerobic conditions. However, mutations at two conserved nonligand acidic residues, Glu95 and Glu100, result in low metal contents for the mutant proteins as isolated, suggesting that some of the conserved charged residues may aid in transfer of metal from in vivo sources or prevent the loss of metal to stronger chelators. The Glu100 mutant reconstitutes readily but has low activity. Mutation of Asp101 results in an active enzyme that incorporates metal in vivo but

  2. Characterization of Metal Binding in the Active Sites of acireductone dioxygenase Isoforms from Klebsiella ATCC 8724

    SciTech Connect

    S Chai; T Ju; M Dang; R Goldsmith; M Maroney; T Pochapsky

    2011-12-31

    The two acireductone dioxygenase (ARD) isozymes from the methionine salvage pathway of Klebsiella ATCC 8724 present an unusual case in which two enzymes with different structures and distinct activities toward their common substrates (1,2-dihydroxy-3-oxo-5-(methylthio)pent-1-ene and dioxygen) are derived from the same polypeptide chain. Structural and functional differences between the two isozymes are determined by the type of M{sup 2+} metal ion bound in the active site. The Ni{sup 2+}-bound NiARD catalyzes an off-pathway shunt from the methionine salvage pathway leading to the production of formate, methylthiopropionate, and carbon monoxide, while the Fe{sup 2+}-bound FeARD catalyzes the on-pathway formation of methionine precursor 2-keto-4-methylthiobutyrate and formate. Four potential protein-based metal ligands were identified by sequence homology and structural considerations. Based on the results of site-directed mutagenesis experiments, X-ray absorption spectroscopy (XAS), and isothermal calorimetry measurements, it is concluded that the same four residues, His96, His98, Glu102 and His140, provide the protein-based ligands for the metal in both the Ni- and Fe-containing forms of the enzyme, and subtle differences in the local backbone conformations trigger the observed structural and functional differences between the FeARD and NiARD isozymes. Furthermore, both forms of the enzyme bind their respective metals with pseudo-octahedral geometry, and both may lose a histidine ligand upon binding of substrate under anaerobic conditions. However, mutations at two conserved nonligand acidic residues, Glu95 and Glu100, result in low metal contents for the mutant proteins as isolated, suggesting that some of the conserved charged residues may aid in transfer of metal from in vivo sources or prevent the loss of metal to stronger chelators. The Glu100 mutant reconstitutes readily but has low activity. Mutation of Asp101 results in an active enzyme that incorporates

  3. Mechanism of Oxidation of Ethane to Ethanol at Iron(IV)-Oxo Sites in Magnesium-Diluted Fe2(dobdc).

    PubMed

    Verma, Pragya; Vogiatzis, Konstantinos D; Planas, Nora; Borycz, Joshua; Xiao, Dianne J; Long, Jeffrey R; Gagliardi, Laura; Truhlar, Donald G

    2015-05-01

    The catalytic properties of the metal-organic framework Fe2(dobdc), containing open Fe(II) sites, include hydroxylation of phenol by pure Fe2(dobdc) and hydroxylation of ethane by its magnesium-diluted analogue, Fe0.1Mg1.9(dobdc). In earlier work, the latter reaction was proposed to occur through a redox mechanism involving the generation of an iron(IV)-oxo species, which is an intermediate that is also observed or postulated (depending on the case) in some heme and nonheme enzymes and their model complexes. In the present work, we present a detailed mechanism by which the catalytic material, Fe0.1Mg1.9(dobdc), activates the strong C-H bonds of ethane. Kohn-Sham density functional and multireference wave function calculations have been performed to characterize the electronic structure of key species. We show that the catalytic nonheme-Fe hydroxylation of the strong C-H bond of ethane proceeds by a quintet single-state σ-attack pathway after the formation of highly reactive iron-oxo intermediate. The mechanistic pathway involves three key transition states, with the highest activation barrier for the transfer of oxygen from N2O to the Fe(II) center. The uncatalyzed reaction, where nitrous oxide directly oxidizes ethane to ethanol is found to have an activation barrier of 280 kJ/mol, in contrast to 82 kJ/mol for the slowest step in the iron(IV)-oxo catalytic mechanism. The energetics of the C-H bond activation steps of ethane and methane are also compared. Dehydrogenation and dissociation pathways that can compete with the formation of ethanol were shown to involve higher barriers than the hydroxylation pathway. PMID:25882096

  4. Crystal structure, Hirshfeld surfaces and DFT computation of NLO active (2E)-2-(ethoxycarbonyl)-3-[(1-methoxy-1-oxo-3-phenylpropan-2-yl)amino] prop-2-enoic acid

    NASA Astrophysics Data System (ADS)

    Venkatesan, Perumal; Thamotharan, Subbiah; Ilangovan, Andivelu; Liang, Hongze; Sundius, Tom

    2016-01-01

    Nonlinear optical (NLO) activity of the compound (2E)-2-(ethoxycarbonyl)-3-[(1-methoxy-1-oxo-3-phenylpropan-2-yl)amino] prop-2-enoic acid is investigated experimentally and theoretically using X-ray crystallography and quantum chemical calculations. The NLO activity is confirmed by both powder Second Harmonic Generation (SHG) experiment and first hyper polarizability calculation. The title compound displays 8 fold excess of SHG activity when compared with the standard compound KDP. The gas phase geometry optimization and vibrational frequencies calculations are performed using density functional theory (DFT) incorporated in B3LYP with 6-311G++(d,p) basis set. The title compound crystallizes in non-centrosymmetric space group P21. Moreover, the crystal structure is primarily stabilized through intramolecular N-H···O and O-H···O hydrogen bonds and intermolecular C-H···O and C-H···π interactions. These intermolecular interactions are analyzed and quantified using Hirshfeld surface analysis and PIXEL method. The detailed vibrational assignments are performed on the basis of the potential energy distributions (PED) of the vibrational modes.

  5. Crystal structure, Hirshfeld surfaces and DFT computation of NLO active (2E)-2-(ethoxycarbonyl)-3-[(1-methoxy-1-oxo-3-phenylpropan-2-yl)amino] prop-2-enoic acid.

    PubMed

    Venkatesan, Perumal; Thamotharan, Subbiah; Ilangovan, Andivelu; Liang, Hongze; Sundius, Tom

    2016-01-15

    Nonlinear optical (NLO) activity of the compound (2E)-2-(ethoxycarbonyl)-3-[(1-methoxy-1-oxo-3-phenylpropan-2-yl)amino] prop-2-enoic acid is investigated experimentally and theoretically using X-ray crystallography and quantum chemical calculations. The NLO activity is confirmed by both powder Second Harmonic Generation (SHG) experiment and first hyper polarizability calculation. The title compound displays 8 fold excess of SHG activity when compared with the standard compound KDP. The gas phase geometry optimization and vibrational frequencies calculations are performed using density functional theory (DFT) incorporated in B3LYP with 6-311G++(d,p) basis set. The title compound crystallizes in non-centrosymmetric space group P21. Moreover, the crystal structure is primarily stabilized through intramolecular N-H···O and O-H···O hydrogen bonds and intermolecular C-H···O and C-H···π interactions. These intermolecular interactions are analyzed and quantified using Hirshfeld surface analysis and PIXEL method. The detailed vibrational assignments are performed on the basis of the potential energy distributions (PED) of the vibrational modes.

  6. The stability of copper oxo species in zeolite frameworks

    DOE PAGES

    Vilella, Laia; Studt, Felix

    2016-03-07

    Cu-exchanged zeolites are promising heterogeneous catalysts, as they provide a confined environment to carry out highly selective reactions. Furthermore, the knowledge of how the zeolite framework and the location of Al atoms therein affect the adsorption of copper species is still not well understood. In this work, DFT was used to investigate the adsorption of potential Cu oxo active species suggested in the literature [Cu(η2-O2), Cu(µ-O)Cu, and Cu2O2] into zeolites with different pore sizes and shapes (AFI, CHA, TON, MOR, and MFI). The calculations revealed that both monomeric and dimeric Cu oxo species bind strongly to the O atoms ofmore » the lattice. For the monometallic species similar adsorption energies are obtained with the different zeolite frameworks, whereas an optimum Al–Al distance is required for the dimeric species.« less

  7. Oxo chemistry in supercritical carbon dioxide

    SciTech Connect

    Krause, T.R.; Rathke, J.W.; Klingler, R.J.

    1991-01-01

    We report an investigation of the cobalt carbonyl-catalyzed oxo process in supercritical CO{sub 2} using in situ high pressure NMR spectroscopy. The use of supercritical CO{sub 2} as the solvent medium eliminates gas-liquid mixing problems. The effect of supercritical CO{sub 2} on the oxo reaction was determined by comparing the linear to branched aldehyde yield and rate and other equilibrium processes involved in the catalytic cycle with measured values in conventional liquid solvents.

  8. Breast milk metal ion levels in a young and active patient with a metal-on-metal hip prosthesis.

    PubMed

    Nelis, Raymond; de Waal Malefijt, Jan; Gosens, Taco

    2013-01-01

    Metal-on-metal resurfacing arthroplasty of the hip has been used increasingly over the last 10 years in younger active patients. The dissolution of the metal wear particles results in measurable increases in cobalt and chromium ions in the serum and urine of patients with a metal-on-metal bearing. We measured the cobalt, chromium, and molybdenum ion levels in urine; serum; and breast milk in a young and active patient with a metal-on-metal hip prosthesis after a pathologic fracture of the femoral neck. Metal-on-metal hip prosthesis leads to increasing levels of molybdenum in breast milk in the short-term follow-up. There are no increasing levels of chromium and cobalt ions in breast milk. Besides the already known elevated concentrations in serum of chromium and cobalt after implantation of a metal-on-metal hip prosthesis, we found no increasing levels of chromium and cobalt in urine. PMID:22868068

  9. Design and synthesis of novel 4-(4-oxo-2-arylthiazolidin-3-yl)benzenesulfonamides as selective inhibitors of carbonic anhydrase IX over I and II with potential anticancer activity.

    PubMed

    Suthar, Sharad Kumar; Bansal, Sumit; Lohan, Sandeep; Modak, Vikarm; Chaudhary, Anil; Tiwari, Amit

    2013-08-01

    The novel 4-(4-oxo-2-arylthiazolidin-3-yl)benzenesulfonamide derivatives were designed and synthesized for selective carbonic anhydrase IX (CA IX) inhibitory activity with anticancer potential. In the CA inhibition assay, 3f was found to be the most potent and selective inhibitor of CA IX with inhibitory constant (K(I)) value of 2.2 nM. Among the synthesized compounds, 3f showed IC₅₀ values of 5.03 μg/ml (cisplatin: 6.56 μg/ml), 5.81 μg/ml (cisplatin: 5.85 μg/ml), and 23.93 μg/ml (cisplatin: 2.75 μg/ml) against COLO-205, MDA-MB-231, and DU-145 cell lines, respectively. At IC₅₀, 3f caused cell shrinkage, nuclear condensation, and nuclear fragmentation events characteristic to apoptosis in the Hoechst 33258 and acridine orange-ethidium bromide staining studies of COLO-205 cells. In the Dalton's lymphoma ascites (DLA) solid tumor model 3f decreased tumor volume by 64.83% (cisplatin: 71.62%), while increase in mean body weight was found to be only 4.09% (cisplatin: 3.47%). PMID:23827177

  10. Active site directed irreversible inactivation of brewers' yeast pyruvate decarboxylase by the conjugated substrate analogue (E)-4-(4-chlorophenyl)-2-oxo-3-butenoic acid: development of a suicide substrate.

    PubMed

    Kuo, D J; Jordan, F

    1983-08-01

    (E)-4-(4-Chlorophenyl)-2-oxo-3-butenoic acid (CPB) was found to irreversibly inactivate brewers' yeast pyruvate decarboxylase (PDC, EC 4.1.1.1) in a biphasic, sigmoidal manner, as is found for the kinetic behavior of substrate. An expression was derived for two-site irreversible inhibition of allosteric enzymes, and the kinetic behavior of CPB fit the expression for two-site binding. The calculated Ki's of 0.7 mM and 0.3 mM for CPB were assigned to the catalytic site and the regulatory site, respectively. The presence of pyruvic acid at high concentrations protected PDC from inactivation, whereas low concentrations of pyruvic acid accelerated inactivation by CPB. Pyruvamide, a known allosteric activator of PDC, was found to enhance inactivation by CPB. The results can be explained if pyruvamide binds only to a regulatory site, but CPB and pyruvic acid compete for both the regulatory and the catalytic centers. [1-14C]CPB was found to lose 14CO2 concurrently with the inactivation of the enzyme. Therefore, CPB was being turned over by PDC, in addition to inactivating it. CPB can be labeled a suicide-type inactivator for PDC.

  11. Anti-influenza virus activities of 4-[(1,2-dihydro-2-oxo-3H-indol-3-ylidene)amino]-N-(4,6-dimethyl-2-pyrimidin-2-yl)benzenesulphonamide and its derivatives.

    PubMed

    Selvam, Periyasamy; Murugesh, Narayanan; Chandramohan, Markandavel; Sidwell, Robert W; Wandersee, Miles K; Smee, Donald F

    2006-01-01

    4-[(1,2-Dihydro-2-oxo-3H-indol-3-ylidene)amino]-N-(4,6-dimethyl-2-pyrimidinyl)-benzenesulphonamide (SPIII-5H) and related compounds were tested for antiviral activity against influenza A (H1N1, H3N2, and H5N1) and B viruses in Madin Darby canine kidney (MDCK) cell culture. Among the compounds tested, SPIII-5H and four derivatives (5-chloro [SPill-5Cl], 5-bromo [SPIII-5Br], 5-methyl [SPIII-5Me] and N-acetyl [SPIII-NA]) showed similar antiviral potencies, with only the 5-fluoro (SPIII-5F) derivative being ineffective. Fifty percent effective concentration (EC50) values were determined in cytopathic effect (CPE) inhibition assays quantified by neutral red dye uptake. By this method, the active compounds were inhibitory to the H1N1 strain of influenza A at 2.7-5.2 microg/ml, to the H3N2 strain of influenza A at 13.8-26.0 microg/ml, to the H5N1 strain of influenza A at 3.1-6.3 microg/ml and to influenza B at 7.7-11.5 microg/ml. Confirmatory virus yield reduction studies against influenza A (H1N1) virus demonstrated antiviral activity (90% inhibition) at concentrations of 2-10 microg/ml. No cytotoxic effects were evident in actively growing uninfected cells or stationary monolayers at 100 microg/ml. Potencies of the compounds were similar to those of ribavirin, but much less than those of oseltamivir carboxylate against the various viruses. Time-of-addition studies indicated the compounds inhibited an early step in the virus replication cycle, probably virus adsorption/penetration, and no virucidal activity was evident. The basic molecule is amenable to diverse chemical modifications, which may improve water solubility and antiviral potency.

  12. A non-diazo approach to α-oxo gold carbenes via gold-catalyzed alkyne oxidation.

    PubMed

    Zhang, Liming

    2014-03-18

    For the past dozen years, homogeneous gold catalysis has evolved from a little known topic in organic synthesis to a fully blown research field of significant importance to synthetic practitioners, due to its novel reactivities and reaction modes. Cationic gold(I) complexes are powerful soft Lewis acids that can activate alkynes and allenes toward efficient attack by nucleophiles, leading to the generation of alkenyl gold intermediates. Some of the most versatile aspects of gold catalysis involve the generation of gold carbene intermediates, which occurs through the approach of an electrophile to the distal end of the alkenyl gold moiety, and their diverse transformations thereafter. On the other hand, α-oxo metal carbene/carbenoids are highly versatile intermediates in organic synthesis and can undergo various synthetically challenging yet highly valuable transformations such as C-H insertion, ylide formation, and cyclopropanation reactions. Metal-catalyzed dediazotizations of diazo carbonyl compounds are the principle and most reliable strategy to access them. Unfortunately, the substrates contain a highly energetic diazo moiety and are potentially explosive. Moreover, chemists need to use energetic reagents to prepare them, putting further constrains on operational safety. In this Account, we show that the unique access to the gold carbene species in homogeneous gold catalysis offers an opportunity to generate α-oxo gold carbenes if both nucleophile and electrophile are oxygen. Hence, this approach would enable readily available and safer alkynes to replace hazardous α-diazo carbonyl compounds as precursors in the realm of gold carbene chemistry. For the past several years, we have demonstrated that alkynes can indeed effectively serve as precursors to versatile α-oxo gold carbenes. In our initial study, we showed that a tethered sulfoxide can be a suitable oxidant, which in some cases leads to the formation of α-oxo gold carbene intermediates. The

  13. A Non-Diazo Approach to α-Oxo Gold Carbenes via Gold-Catalyzed Alkyne Oxidation

    PubMed Central

    2015-01-01

    For the past dozen years, homogeneous gold catalysis has evolved from a little known topic in organic synthesis to a fully blown research field of significant importance to synthetic practitioners, due to its novel reactivities and reaction modes. Cationic gold(I) complexes are powerful soft Lewis acids that can activate alkynes and allenes toward efficient attack by nucleophiles, leading to the generation of alkenyl gold intermediates. Some of the most versatile aspects of gold catalysis involve the generation of gold carbene intermediates, which occurs through the approach of an electrophile to the distal end of the alkenyl gold moiety, and their diverse transformations thereafter. On the other hand, α-oxo metal carbene/carbenoids are highly versatile intermediates in organic synthesis and can undergo various synthetically challenging yet highly valuable transformations such as C–H insertion, ylide formation, and cyclopropanation reactions. Metal-catalyzed dediazotizations of diazo carbonyl compounds are the principle and most reliable strategy to access them. Unfortunately, the substrates contain a highly energetic diazo moiety and are potentially explosive. Moreover, chemists need to use energetic reagents to prepare them, putting further constrains on operational safety. In this Account, we show that the unique access to the gold carbene species in homogeneous gold catalysis offers an opportunity to generate α-oxo gold carbenes if both nucleophile and electrophile are oxygen. Hence, this approach would enable readily available and safer alkynes to replace hazardous α-diazo carbonyl compounds as precursors in the realm of gold carbene chemistry. For the past several years, we have demonstrated that alkynes can indeed effectively serve as precursors to versatile α-oxo gold carbenes. In our initial study, we showed that a tethered sulfoxide can be a suitable oxidant, which in some cases leads to the formation of α-oxo gold carbene intermediates. The

  14. Tailorable chiroptical activity of metallic nanospiral arrays

    NASA Astrophysics Data System (ADS)

    Deng, Junhong; Fu, Junxue; Ng, Jack; Huang, Zhifeng

    2016-02-01

    The engineering of the chiroptical activity of the emerging chiral metamaterial, metallic nanospirals, is in its infancy. We utilize glancing angle deposition (GLAD) to facilely sculpture the helical structure of silver nanospirals (AgNSs), so that the scope of chiroptical engineering factors is broadened to include the spiral growth of homochiral AgNSs, the combination of left- and right-handed helical chirality to create heterochiral AgNSs, and the coil-axis alignment of the heterochiral AgNSs. It leads to flexible control over the chiroptical activity of AgNS arrays with respect to the sign, resonance wavelength and amplitude of circular dichroism (CD) in the UV and visible regime. The UV chiroptical mode has a distinct response from the visible mode. Finite element simulation together with LC circuit theory illustrates that the UV irradiation is mainly adsorbed in the metal and the visible is preferentially scattered by the AgNSs, accounting for the wavelength-related chiroptical distinction. This work contributes to broadening the horizons in understanding and engineering chiroptical responses, primarily desired for developing a wide range of potential chiroplasmonic applications.The engineering of the chiroptical activity of the emerging chiral metamaterial, metallic nanospirals, is in its infancy. We utilize glancing angle deposition (GLAD) to facilely sculpture the helical structure of silver nanospirals (AgNSs), so that the scope of chiroptical engineering factors is broadened to include the spiral growth of homochiral AgNSs, the combination of left- and right-handed helical chirality to create heterochiral AgNSs, and the coil-axis alignment of the heterochiral AgNSs. It leads to flexible control over the chiroptical activity of AgNS arrays with respect to the sign, resonance wavelength and amplitude of circular dichroism (CD) in the UV and visible regime. The UV chiroptical mode has a distinct response from the visible mode. Finite element simulation

  15. Substrate Specificity of Thiamine Pyrophosphate-Dependent 2-Oxo-Acid Decarboxylases in Saccharomyces cerevisiae

    PubMed Central

    Romagnoli, Gabriele; Luttik, Marijke A. H.; Kötter, Peter; Pronk, Jack T.

    2012-01-01

    Fusel alcohols are precursors and contributors to flavor and aroma compounds in fermented beverages, and some are under investigation as biofuels. The decarboxylation of 2-oxo acids is a key step in the Ehrlich pathway for fusel alcohol production. In Saccharomyces cerevisiae, five genes share sequence similarity with genes encoding thiamine pyrophosphate-dependent 2-oxo-acid decarboxylases (2ODCs). PDC1, PDC5, and PDC6 encode differentially regulated pyruvate decarboxylase isoenzymes; ARO10 encodes a 2-oxo-acid decarboxylase with broad substrate specificity, and THI3 has not yet been shown to encode an active decarboxylase. Despite the importance of fusel alcohol production in S. cerevisiae, the substrate specificities of these five 2ODCs have not been systematically compared. When the five 2ODCs were individually overexpressed in a pdc1Δ pdc5Δ pdc6Δ aro10Δ thi3Δ strain, only Pdc1, Pdc5, and Pdc6 catalyzed the decarboxylation of the linear-chain 2-oxo acids pyruvate, 2-oxo-butanoate, and 2-oxo-pentanoate in cell extracts. The presence of a Pdc isoenzyme was also required for the production of n-propanol and n-butanol in cultures grown on threonine and norvaline, respectively, as nitrogen sources. These results demonstrate the importance of pyruvate decarboxylases in the natural production of n-propanol and n-butanol by S. cerevisiae. No decarboxylation activity was found for Thi3 with any of the substrates tested. Only Aro10 and Pdc5 catalyzed the decarboxylation of the aromatic substrate phenylpyruvate, with Aro10 showing superior kinetic properties. Aro10, Pdc1, Pdc5, and Pdc6 exhibited activity with all branched-chain and sulfur-containing 2-oxo acids tested but with markedly different decarboxylation kinetics. The high affinity of Aro10 identified it as a key contributor to the production of branched-chain and sulfur-containing fusel alcohols. PMID:22904058

  16. Physcomitrella patens activates reinforcement of the cell wall, programmed cell death and accumulation of evolutionary conserved defence signals, such as salicylic acid and 12-oxo-phytodienoic acid, but not jasmonic acid, upon Botrytis cinerea infection.

    PubMed

    Ponce De León, Inés; Schmelz, Eric A; Gaggero, Carina; Castro, Alexandra; Álvarez, Alfonso; Montesano, Marcos

    2012-10-01

    The moss Physcomitrella patens is an evolutionarily basal model system suitable for the analysis of plant defence responses activated after pathogen assault. Upon infection with the necrotroph Botrytis cinerea, several defence mechanisms are induced in P. patens, including the fortification of the plant cell wall by the incorporation of phenolic compounds and the induced expression of related genes. Botrytis cinerea infection also activates the accumulation of reactive oxygen species and cell death with hallmarks of programmed cell death in moss tissues. Salicylic acid (SA) levels also increase after fungal infection, and treatment with SA enhances transcript accumulation of the defence gene phenylalanine ammonia-lyase (PAL) in P. patens colonies. The expression levels of the genes involved in 12-oxo-phytodienoic acid (OPDA) synthesis, including lipoxygenase (LOX) and allene oxide synthase (AOS), increase in P. patens gametophytes after pathogen assault, together with a rise in free linolenic acid and OPDA concentrations. However, jasmonic acid (JA) could not be detected in healthy or infected tissues of this plant. Our results suggest that, although conserved defence signals, such as SA and OPDA, are synthesized and are probably involved in the defence response of P. patens against B. cinerea infection, JA production appears to be missing. Interestingly, P. patens responds to OPDA and methyl jasmonate by reducing moss colony growth and rhizoid length, suggesting that jasmonate perception is present in mosses. Thus, P. patens can provide clues with regard to the evolution of different defence pathways in plants, including signalling and perception of OPDA and jasmonates in nonflowering and flowering plants.

  17. Strongly coupled binuclear uranium-oxo complexes from uranyl oxo rearrangement and reductive silylation

    NASA Astrophysics Data System (ADS)

    Arnold, Polly L.; Jones, Guy M.; Odoh, Samuel O.; Schreckenbach, Georg; Magnani, Nicola; Love, Jason B.

    2012-03-01

    The most common motif in uranium chemistry is the d0f0 uranyl ion [UO2]2+ in which the oxo groups are rigorously linear and inert. Alternative geometries, such as the cis-uranyl, have been identified theoretically and implicated in oxo-atom transfer reactions that are relevant to environmental speciation and nuclear waste remediation. Single electron reduction is now known to impart greater oxo-group reactivity, but with retention of the linear OUO motif, and reactions of the oxo groups to form new covalent bonds remain rare. Here, we describe the synthesis, structure, reactivity and magnetic properties of a binuclear uranium-oxo complex. Formed through a combination of reduction and oxo-silylation and migration from a trans to a cis position, the new butterfly-shaped Si-OUO2UO-Si molecule shows remarkably strong UV-UV coupling and chemical inertness, suggesting that this rearranged uranium oxo motif might exist for other actinide species in the environment, and have relevance to the aggregation of actinide oxide clusters.

  18. Characterization of chloroquine-hematin mu-oxo dimer binding by isothermal titration calorimetry.

    PubMed

    Vippagunta, S R; Dorn, A; Ridley, R G; Vennerstrom, J L

    2000-07-01

    Numerous studies indicate that a key feature of chloroquine's (CQ) antimalarial activity is its interaction with hematin. We now characterize this CQ-hematin interaction in detail using isothermal titration calorimetry (ITC). Between pH 5.6 and 9.0, association constants (K(a) values) for enthalpy-driven CQ-hematin mu-oxo dimer binding fell in the narrow range of 2.3-4.4 x 10(5) M(-1). It is therefore probable that CQ-hematin mu-oxo dimer binding affinity does not diminish at the pH range (4.8-5.4) of the parasite food vacuole. The binding affinity was unaffected by high salt concentrations, suggesting that ionic interactions do not contribute significantly to this complexation. With increasing ionic strength, the entropic penalty of CQ-hematin mu-oxo dimer binding decreased accompanied by increased hematin mu-oxo dimer aggregation. A stoichiometry (n) of 1:4 in the pH range 6.5-9.0 indicates that CQ binds to two hematin mu-oxo dimers. At pH 5.6, a stoichiometry of 1:8 suggests that CQ binds to an aggregate of four hematin mu-oxo dimers. This work adds further evidence supporting the hypothesis that CQ impedes hematin monomer incorporation into hemozoin by producing a forward shift in the hematin monomer-hematin mu-oxo dimer equilibrium, contributing to a destructive accumulation of soluble forms of hematin in the parasite and leading to its death by hematin poisoning.

  19. Structure of Human DNL Polymerase k Inserting dATP Opposite an 8-OxoG DNA Lesion

    SciTech Connect

    Vasquez-Del Carpio, R.; Silverstein, T; Lone, S; Swan, M; Choudhury, J; Johnson, R; Pratkash, S; Aggarwal, A

    2009-01-01

    The structure we present here is the first for a eukaryotic translesion synthesis (TLS) DNA polymerase with an 8-oxoG:A base pair in the active site. The structure shows why Pol? is more efficient at inserting an A opposite the 8-oxoG lesion than a C. The structure also provides a basis for why Pol? is more efficient at inserting an A opposite the lesion than other Y-family DNA polymerases.

  20. On divorcing isomers, dissecting reactivity, and resolving mechanisms of propane Csbnd H and aryl Csbnd X (X = halogen) bond activations mediated by a ligated copper(III) oxo complex

    NASA Astrophysics Data System (ADS)

    Rijs, Nicole J.; Weiske, Thomas; Schlangen, Maria; Schwarz, Helmut

    2014-07-01

    The long suspected presence of two isomeric copper complexes (A and B), proportionally dependent on ESI cone voltage, was confirmed by their isolation, separation and characterization in a travelling wave ion mobility spectrometry-mass spectrometer (TWIMS-MS) with modifications to allow for ion/molecule reactions to be performed. Despite their small difference in cross-sectional area (∼1%) the isomers were well resolved, in part due to a strong interaction of isomer B with the N2 buffer gas. The reactivity of each TWIMS-separated isomer was probed: propane reacted with isomer A via Csbnd H bond activation and O-atom transfer, while no such reactions were observed for isomer B; the aryl halides PhX (X = F, Cl, Br, I) also reacted solely with A, via either concerted oxidation and halide transfer, or O-atom transfer. DFT calculations reveal that the aryl Csbnd X bond activation of PhX by isomer A involves several mechanistic pathways. Are the suspected structural isomers of the copper species resolvable via TWIMS-MS? If so, what type of reactivity does each isomer have toward hydrocarbons? Further, the ability to selectively activate aryl halides is highly sought-after in order to carry out selective functionalizations. The halogen exchange of X is a desirable reaction and can be mediated by copper catalysts [56-58]. As well known, the Csbnd F and Csbnd Cl bonds are more stable than the Csbnd Br and Csbnd I bonds, the latter being more reactive and thus used more often in organic transformations. An understanding of the underlying mechanisms is thus key to using these underutilized substrates in catalytic reactions.Thus we also address the question: Can any isomer-separated reactive copper oxo species also activate other strong bonds, such as the Csbnd X bonds in aryl halides (PhX)? In addition, we carry out careful electronic structure calculations in order to gain additional mechanistic insight into the mechanism(s) of halogen-atom and O-atom transfer reactions

  1. Oxidation of ethane to ethanol by N2O in a metal-organic framework with coordinatively unsaturated iron(II) sites.

    PubMed

    Xiao, Dianne J; Bloch, Eric D; Mason, Jarad A; Queen, Wendy L; Hudson, Matthew R; Planas, Nora; Borycz, Joshua; Dzubak, Allison L; Verma, Pragya; Lee, Kyuho; Bonino, Francesca; Crocellà, Valentina; Yano, Junko; Bordiga, Silvia; Truhlar, Donald G; Gagliardi, Laura; Brown, Craig M; Long, Jeffrey R

    2014-07-01

    Enzymatic haem and non-haem high-valent iron-oxo species are known to activate strong C-H bonds, yet duplicating this reactivity in a synthetic system remains a formidable challenge. Although instability of the terminal iron-oxo moiety is perhaps the foremost obstacle, steric and electronic factors also limit the activity of previously reported mononuclear iron(IV)-oxo compounds. In particular, although nature's non-haem iron(IV)-oxo compounds possess high-spin S = 2 ground states, this electronic configuration has proved difficult to achieve in a molecular species. These challenges may be mitigated within metal-organic frameworks that feature site-isolated iron centres in a constrained, weak-field ligand environment. Here, we show that the metal-organic framework Fe2(dobdc) (dobdc(4-) = 2,5-dioxido-1,4-benzenedicarboxylate) and its magnesium-diluted analogue, Fe0.1Mg1.9(dobdc), are able to activate the C-H bonds of ethane and convert it into ethanol and acetaldehyde using nitrous oxide as the terminal oxidant. Electronic structure calculations indicate that the active oxidant is likely to be a high-spin S = 2 iron(IV)-oxo species.

  2. Oxidation of ethane to ethanol by N2O in a metal-organic framework with coordinatively unsaturated iron(II) sites

    NASA Astrophysics Data System (ADS)

    Xiao, Dianne J.; Bloch, Eric D.; Mason, Jarad A.; Queen, Wendy L.; Hudson, Matthew R.; Planas, Nora; Borycz, Joshua; Dzubak, Allison L.; Verma, Pragya; Lee, Kyuho; Bonino, Francesca; Crocellà, Valentina; Yano, Junko; Bordiga, Silvia; Truhlar, Donald G.; Gagliardi, Laura; Brown, Craig M.; Long, Jeffrey R.

    2014-07-01

    Enzymatic haem and non-haem high-valent iron-oxo species are known to activate strong C-H bonds, yet duplicating this reactivity in a synthetic system remains a formidable challenge. Although instability of the terminal iron-oxo moiety is perhaps the foremost obstacle, steric and electronic factors also limit the activity of previously reported mononuclear iron(IV)-oxo compounds. In particular, although nature's non-haem iron(IV)-oxo compounds possess high-spin S = 2 ground states, this electronic configuration has proved difficult to achieve in a molecular species. These challenges may be mitigated within metal-organic frameworks that feature site-isolated iron centres in a constrained, weak-field ligand environment. Here, we show that the metal-organic framework Fe2(dobdc) (dobdc4- = 2,5-dioxido-1,4-benzenedicarboxylate) and its magnesium-diluted analogue, Fe0.1Mg1.9(dobdc), are able to activate the C-H bonds of ethane and convert it into ethanol and acetaldehyde using nitrous oxide as the terminal oxidant. Electronic structure calculations indicate that the active oxidant is likely to be a high-spin S = 2 iron(IV)-oxo species.

  3. Synthesis, structure and catechol-oxidase activity of copper(II) complexes of 17-hydroxy-16-(N-3-oxo-prop-1-enyl)amino steroids.

    PubMed

    Wegner, Rainer; Dubs, Manuela; Görls, Helmar; Robl, Christian; Schönecker, Bruno; Jäger, Ernst-G

    2002-09-01

    Copper is next to iron the most important element in the biological transport, storage and in redox reactions of dioxygen. A bioanalogous activation of dioxygen with copper complexes is used for catalytical epoxidation, allylic hydroxylation and oxidative coupling of aromatic substrates, for example. With stereochemical information in form of chiral ligands, enantioselective reactions may be possible. Another aspect of interest on copper catalyzed reactions with dioxygen is that the exact mechanism and biological function of some enzymes (especially catechol oxidase) is yet not fully clear. For studies mimicking the copper-containing catechol oxidase appropriate chiral steroid ligands with defined stereochemistry and conformation have been synthesized. The four diastereomeric 16,17-aminoalcohols of the 3-methoxy-estra-1,3,5(10)-triene series have been condensed with salicylic aldehyde and different beta-ketoenols to the chiral ligand types 1-5. These compounds with different steric and electronic properties and different arrangements of the neighboring hydroxy and nitrogen functions were reacted with copper(II) acetate to copper complexes. The structure of these complexes will be discussed. The bioanalogous oxidation of 3,5-di-tbutyl-catechol (dtbc) to the corresponding quinone was catalyzed by most of the complexes, indicating their ability to activate dioxygen. The trans configurations c and d showed an activity one magnitude higher than the cis configurations a and b. Comparing compounds with the same diastereomeric configuration, the main influence was that of the peripheral R(1-3) substituents at the beta-ketoenaminic group which are useful for the fine-tuning of the properties of the copper atoms like redox potential and Lewis acidity.

  4. Synthesis, spectroscopic characterization and thermal behavior of metal complexes formed with ( Z)-2-oxo-2-(2-(2-oxoindolin-3-ylidene)hydrazinyl)- N-phenylacetamide (H 2OI)

    NASA Astrophysics Data System (ADS)

    Yousef, T. A.; Rakha, T. H.; El Ayaan, Usama; Abu El Reash, G. M.

    2012-01-01

    Complexes of Co(II), Ni(II), Cu(II), Cd(II), Zn(II) and U(IV)O 2 with ( Z)-2-oxo-2-(2-(2-oxoindolin-3-ylidene)hydrazinyl)- N-phenylacetamide (H 2OI) are reported and have been characterized by various spectroscopic techniques like (IR, UV-Vis, ESR 1H and 13C NMR) as well as magnetic and thermal (TG and DTA) measurements. It is found that the ligand behaves as a neutral tridentate, neutral tetradentate, monoanionic tridentate, monoanionic tridentate and dianionic tridentate. An octahedral geometry for all complexes except [Cu 2(H 2OI)(OAc) 4](H 2O) 2 and [Cu(HOI)Cl](H 2O) 2 which have a square planar geometry. Furthermore, kinetic parameters were determined for each thermal degradation stage of some studied complexes using Coats-Redfern and Horowitz-Metzger methods. The bond lengths, bond angles, HOMO, LUMO and dipole moments have been calculated to confirm the geometry of the ligand and the investigated complexes.

  5. Characterization of 2,4-Diamino-6-oxo-1,6-dihydropyrimidin-5-yl Ureido Based Inhibitors of Trypanosoma brucei FolD and Testing for Antiparasitic Activity.

    PubMed

    Eadsforth, Thomas C; Pinto, Andrea; Luciani, Rosaria; Tamborini, Lucia; Cullia, Gregorio; De Micheli, Carlo; Marinelli, Luciana; Cosconati, Sandro; Novellino, Ettore; Lo Presti, Leonardo; Cordeiro da Silva, Anabela; Conti, Paola; Hunter, William N; Costi, Maria P

    2015-10-22

    The bifunctional enzyme N(5),N(10)-methylenetetrahydrofolate dehydrogenase/cyclo hydrolase (FolD) is essential for growth in Trypanosomatidae. We sought to develop inhibitors of Trypanosoma brucei FolD (TbFolD) as potential antiparasitic agents. Compound 2 was synthesized, and the molecular structure was unequivocally assigned through X-ray crystallography of the intermediate compound 3. Compound 2 showed an IC50 of 2.2 μM, against TbFolD and displayed antiparasitic activity against T. brucei (IC50 49 μM). Using compound 2, we were able to obtain the first X-ray structure of TbFolD in the presence of NADP(+) and the inhibitor, which then guided the rational design of a new series of potent TbFolD inhibitors. PMID:26322631

  6. Characterization of 2,4-Diamino-6-oxo-1,6-dihydropyrimidin-5-yl Ureido Based Inhibitors of Trypanosoma brucei FolD and Testing for Antiparasitic Activity

    PubMed Central

    2015-01-01

    The bifunctional enzyme N5,N10-methylenetetrahydrofolate dehydrogenase/cyclo hydrolase (FolD) is essential for growth in Trypanosomatidae. We sought to develop inhibitors of Trypanosoma brucei FolD (TbFolD) as potential antiparasitic agents. Compound 2 was synthesized, and the molecular structure was unequivocally assigned through X-ray crystallography of the intermediate compound 3. Compound 2 showed an IC50 of 2.2 μM, against TbFolD and displayed antiparasitic activity against T. brucei (IC50 49 μM). Using compound 2, we were able to obtain the first X-ray structure of TbFolD in the presence of NADP+ and the inhibitor, which then guided the rational design of a new series of potent TbFolD inhibitors. PMID:26322631

  7. Distinct Metal Isoforms Underlie Promiscuous Activity Profiles of Metalloenzymes.

    PubMed

    Baier, Florian; Chen, John; Solomonson, Matthew; Strynadka, Natalie C J; Tokuriki, Nobuhiko

    2015-07-17

    Within a superfamily, functionally diverged metalloenzymes often favor different metals as cofactors for catalysis. One hypothesis is that incorporation of alternative metals expands the catalytic repertoire of metalloenzymes and provides evolutionary springboards toward new catalytic functions. However, there is little experimental evidence that incorporation of alternative metals changes the activity profile of metalloenzymes. Here, we systematically investigate how metals alter the activity profiles of five functionally diverged enzymes of the metallo-β-lactamase (MBL) superfamily. Each enzyme was reconstituted in vitro with six different metals, Cd(2+), Co(2+), Fe(2+), Mn(2+), Ni(2+), and Zn(2+), and assayed against eight catalytically distinct hydrolytic reactions (representing native functions of MBL enzymes). We reveal that each enzyme metal isoform has a significantly different activity level for native and promiscuous reactions. Moreover, metal preferences for native versus promiscuous activities are not correlated and, in some cases, are mutually exclusive; only particular metal isoforms disclose cryptic promiscuous activities but often at the expense of the native activity. For example, the L1 B3 β-lactamase displays a 1000-fold catalytic preference for Zn(2+) over Ni(2+) for its native activity but exhibits promiscuous thioester, phosphodiester, phosphotriester, and lactonase activity only with Ni(2+). Furthermore, we find that the five MBL enzymes exist as an ensemble of various metal isoforms in vivo, and this heterogeneity results in an expanded activity profile compared to a single metal isoform. Our study suggests that promiscuous activities of metalloenzymes can stem from an ensemble of metal isoforms in the cell, which could facilitate the functional divergence of metalloenzymes.

  8. Pharmacological activity of metal binding agents that alter copper bioavailability

    PubMed Central

    Helsel, Marian E.

    2015-01-01

    Iron, copper and zinc are required nutrients for many organisms but also potent toxins if misappropriated. An overload of any of these metals can be cytotoxic and ultimately lead to organ failure, whereas deficiencies can result in anemia, weakened immune system function, and other medical conditions. Cellular metal imbalances have been implicated in neurodegenerative diseases, cancer and infection. It is therefore critical for living organisms to maintain careful control of both the total levels and subcellular distributions of these metals to maintain healthy function. This perspective explores several strategies envisioned to alter the bioavailability of metal ions by using synthetic metal-binding agents targeted for diseases where misappropriated metal ions are suspected of exacerbating cellular damage. Specifically, we discuss chemical properties that influence the pharmacological outcome of a subset of metal-binding agents known as ionophores, and review several examples that have shown multiple pharmacological activities in metal-related diseases, with a specific focus on copper. PMID:25797044

  9. Pulsed EPR investigations of systems modeling molybdenum enzymes: hyperfine and quadrupole parameters of oxo-17O in [Mo 17O(SPh)4]-.

    PubMed

    Astashkin, Andrei V; Neese, Frank; Raitsimring, Arnold M; Cooney, J Jon A; Bultman, Eric; Enemark, John H

    2005-11-30

    Ka band ESEEM spectroscopy was used to determine the hyperfine (hfi) and nuclear quadrupole (nqi) interaction parameters for the oxo-17O ligand in [Mo 17O(SPh)4]-, a spectroscopic model of the oxo-Mo(V) centers of enzymes. The isotropic hfi constant of 6.5 MHz found for the oxo-17O is much smaller than the values of approximately 20-40 MHz typical for the 17O nucleus of an equatorial OH(2) ligand in molybdenum enzymes. The 17O nqi parameter (e2qQ/h = 1.45 MHz, eta approximately = 0) is the first to be obtained for an oxo group in a metal complex. The parameters of the oxo-17O ligand, as well as other magnetic resonance parameters of [Mo 17O(SPh)4]- predicted by quasi-relativistic DFT calculations, were in good agreement with those obtained in experiment. From the electronic structure of the complex revealed by DFT, it follows that the SOMO is almost entirely molybdenum d(xy) and sulfur p, while the spin density on the oxo-17O is negative, determined by spin polarization mechanisms. The results of this work will enable direct experimental identification of the oxo ligand in a variety of chemical and biological systems.

  10. Nucleotide binding interactions modulate dNTP selectivity and facilitate 8-oxo-dGTP incorporation by DNA polymerase lambda

    PubMed Central

    Burak, Matthew J.; Guja, Kip E.; Garcia-Diaz, Miguel

    2015-01-01

    8-Oxo-7,8,-dihydro-2′-deoxyguanosine triphosphate (8-oxo-dGTP) is a major product of oxidative damage in the nucleotide pool. It is capable of mispairing with adenosine (dA), resulting in futile, mutagenic cycles of base excision repair. Therefore, it is critical that DNA polymerases discriminate against 8-oxo-dGTP at the insertion step. Because of its roles in oxidative DNA damage repair and non-homologous end joining, DNA polymerase lambda (Pol λ) may frequently encounter 8-oxo-dGTP. Here, we have studied the mechanisms of 8-oxo-dGMP incorporation and discrimination by Pol λ. We have solved high resolution crystal structures showing how Pol λ accommodates 8-oxo-dGTP in its active site. The structures indicate that when mispaired with dA, the oxidized nucleotide assumes the mutagenic syn-conformation, and is stabilized by multiple interactions. Steady-state kinetics reveal that two residues lining the dNTP binding pocket, Ala510 and Asn513, play differential roles in dNTP selectivity. Specifically, Ala510 and Asn513 facilitate incorporation of 8-oxo-dGMP opposite dA and dC, respectively. These residues also modulate the balance between purine and pyrimidine incorporation. Our results shed light on the mechanisms controlling 8-oxo-dGMP incorporation in Pol λ and on the importance of interactions with the incoming dNTP to determine selectivity in family X DNA polymerases. PMID:26220180

  11. A ligand field chemistry of oxygen generation by the oxygen-evolving complex and synthetic active sites

    PubMed Central

    Betley, Theodore A; Surendranath, Yogesh; Childress, Montana V; Alliger, Glen E; Fu, Ross; Cummins, Christopher C; Nocera, Daniel G

    2007-01-01

    Oxygen–oxygen bond formation and O2 generation occur from the S4 state of the oxygen-evolving complex (OEC). Several mechanistic possibilities have been proposed for water oxidation, depending on the formal oxidation state of the Mn atoms. All fall under two general classifications: the AB mechanism in which nucleophilic oxygen (base, B) attacks electrophilic oxygen (acid, A) of the Mn4Ca cluster or the RC mechanism in which radical-like oxygen species couple within OEC. The critical intermediate in either mechanism involves a metal oxo, though the nature of this oxo for AB and RC mechanisms is disparate. In the case of the AB mechanism, assembly of an even-electron count, high-valent metal-oxo proximate to a hydroxide is needed whereas, in an RC mechanism, two odd-electron count, high-valent metal oxos are required. Thus the two mechanisms give rise to very different design criteria for functional models of the OEC active site. This discussion presents the electron counts and ligand geometries that support metal oxos for AB and RC O–O bond-forming reactions. The construction of architectures that bring two oxygen functionalities together under the purview of the AB and RC scenarios are described. PMID:17971328

  12. Platinum(II) 1,5-COD oxo complexes

    SciTech Connect

    Shan, H.; James, A.; Sharp, P.R.

    1998-11-02

    Three new types of platinum(II) oxo complexes--[(1,5-COD)Pt({mu}{sup 3}-O)(AuL)]{sub 2}(BF{sub 4}){sub 2} [1, L = PPh{sub 3}, PPh{sub 2}Et, PPh{sub 2}-i-Pr, P(o-tol){sub 3}, P(p-tol){sub 3}, P(p-MeOC{sub 6}H{sub 4}){sub 3}, P(p-CF{sub 3}C{sub 6}H{sub 4}){sub 3}], [(1,5-COD)Pt{l_brace}{mu}{sup 3}-O(AuL){sub 2}{r_brace}{sub 2}](BF{sub 4}){sub 2} (2), and [(1,5-COD){sub 4}Pt{sub 4}({mu}{sup 3}-O){sub 2}Cl{sub 2}]X{sub 2} (3, X = BF{sub 4}; 3a, X = CF{sub 3}SO{sub 3})--are obtained from oxo/chloro exchange reactions between (1,5-COD)PtCl{sub 2} and [(LAu){sub 3}({mu}{sup 3}-O)]BF{sub 4}. Crystals of 1 (L = PPh{sub 3}) from CDCl{sub 3} are triclinic. Crystals of 3a from CH{sub 2}Cl{sub 2}/toluene are trigonal. The structure of the cationic portion of 1 shows a planar (COD)-Pt({mu}-O){sub 2}Pt(COD) unit with slightly out-of-plane LAu{sup +} groups linearly coordinated to the oxo ligands. The structure of the cationic portion of 3a is similar and shows a slightly folded (COD)Pt({mu}-O){sub 2}Pt(COD) unit with out-of-plane [(COD)PtCl]{sup +} groups coordinated to the oxo ligands. Solutions of 3 in untreated CH{sub 2}Cl{sub 2} or CD{sub 2}Cl{sup 2} deposit crystals of [(1,5-COD){sub 4}Pt{sub 4}({mu}{sup 3}-O){sub 2}({mu}{sup 2}-OH)](BF{sub 4}){sub 3} (4) which are monoclinic. The core structure of the cationic portion of 4 shows a tetranuclear platinum cation in which the metal atoms occupy the corners of a distorted tetrahedron and two {mu}{sup 3}-oxo ligands and one {mu}{sup 2}-hydroxo ligand bridge the four platinum atoms. Reaction of 1 (L = PPh{sub 3}) with PPh{sub 3} gives OPPh{sub 3} and [(Ph{sub 3}P){sub 3}PtAuPPh{sub 3}]BF{sub 4} (5) which is also obtained from (Ph{sub 3}P){sub 4}Pt and Ph{sub 3}-PAuBF{sub 4}. Crystals of 5 from THF are monoclinic. The structure of 5 consists of an L{sub 3}Pt-AuL cation where the Au atom is linear 2-coordinate and the Pt atom is distorted square-planar 4-coordinate.

  13. [Biological activity of selenorganic compounds at heavy metal salts intoxication].

    PubMed

    Rusetskaya, N Y; Borodulin, V B

    2015-01-01

    Possible mechanisms of the antitoxic action of organoselenium compounds in heavy metal poisoning have been considered. Heavy metal toxicity associated with intensification of free radical oxidation, suppression of the antioxidant system, damage to macromolecules, mitochondria and the genetic material can cause apoptotic cell death or the development of carcinogenesis. Organic selenium compounds are effective antioxidants during heavy metal poisoning; they exhibit higher bioavailability in mammals than inorganic ones and they are able to activate antioxidant defense, bind heavy metal ions and reactive oxygen species formed during metal-induced oxidative stress. One of promising organoselenium compounds is diacetophenonyl selenide (DAPS-25), which is characterized by antioxidant and antitoxic activity, under conditions including heavy metal intoxication.

  14. Kinetic parameters and tissue distribution of 5-oxo-L-prolinase determined by a fluorimetric assay.

    PubMed

    Weber, P; Jäger, M; Bangsow, T; Knell, G; Piechaczek, K; Koch, J; Wolf, S

    1999-01-13

    5-Oxo-L-prolinase (5-OPase) catalyses the hydrolysis of 5-oxo-L-proline to glutamate with concomitant stoichiometric cleavage of ATP to ADP, a reaction which is known to be part of the gamma-glutamyl cycle-an interrelated series of reactions involved in the synthesis and metabolism of glutathione. As recent studies indicate, this cyclic pathway plays a crucial role in the regulation of amino acid transport. Apparently, the intermediate product 5-oxo-L-proline functions as a second messenger molecule that upregulates the activity of certain amino acid transport systems. Thus, the degradation of 5-oxo-L-proline by 5-OPase leads to the downregulation of this stimulus. In this study, a new sensitive fluorimetric assay for 5-OPase activity was established which is based on the derivatization of glutamate with o-phthaldialdehyde in the presence of thiols and subsequent separation of the products by HPLC. The method is suitable for the screening of chromatography fractions as well as for the determination of the kinetic parameters Km and Vmax of purified 5-OPase. Additionally, it can be used for the measurement of enzyme activity in crude cell extracts and evaluation of tissue distribution.

  15. Metal-carbon nanocomposites based on activated IR pyrolized polyacrylonitrile

    NASA Astrophysics Data System (ADS)

    Efimov, Mikhail N.; Zhilyaeva, Natalya A.; Vasilyev, Andrey A.; Muratov, Dmitriy G.; Zemtsov, Lev M.; Karpacheva, Galina P.

    2016-05-01

    In this paper we report about new approach to preparation of metal-carbon nanocomposites based on activated carbon. Polyacrylonitrile is suggested as a precursor for Co, Pd and Ru nanoparticles carbon support which is prepared under IR pyrolysis conditions of a precursor. The first part of the paper is devoted to study activated carbon structural characteristics dependence on activation conditions. In the second part the effect of type of metal introduced in precursor on metal-carbon nanocomposite structural characteristics is shown. Prepared AC and nanocomposite samples are characterized by BET, TEM, SEM and X-ray diffraction.

  16. The effect of the metal-on-metal hip controversy on Internet search activity.

    PubMed

    Phelan, Nigel; Kelly, John C; Moore, David P; Kenny, Patrick

    2014-10-01

    The recall of the articular surface replacement (ASR) hip prosthesis in 2010 represents one of the most controversial areas in orthopaedic surgery in recent years. The aim of this study was to compare the impact of the metal-on-metal hip controversy on Internet search activity in four different regions and determine whether the number of related news reports affected Internet search activity. The Google Trends, Keywords and News applications were used to record the number of news articles and Internet search activity for the terms "hip recall", "metal-on-metal hip" and "ASR hip" from October 2009 to October 2012 in the USA, the UK, Australia and Ireland. There was a large increase in search activity following the official recall in August 2010 in all countries. There was significantly greater search activity after the recall in Ireland compared with the UK for the search term "hip recall" (P = 0.004). For the term "metal-on-metal hip", the UK had significantly more search activity (P = 0.0009). There was a positive correlation between the number of news stories in UK and Ireland with Internet search activity but not in the USA or Australia. Differences between countries affected by the same recall highlight the complex effects of the media on public awareness. The data demonstrates a window of opportunity prior to the official recall for the development of an awareness campaign to provide patients with accurate information.

  17. How absorbed hydrogen affects the catalytic activity of transition metals.

    PubMed

    Aleksandrov, Hristiyan A; Kozlov, Sergey M; Schauermann, Swetlana; Vayssilov, Georgi N; Neyman, Konstantin M

    2014-12-01

    Heterogeneous catalysis is commonly governed by surface active sites. Yet, areas just below the surface can also influence catalytic activity, for instance, when fragmentation products of catalytic feeds penetrate into catalysts. In particular, H absorbed below the surface is required for certain hydrogenation reactions on metals. Herein, we show that a sufficient concentration of subsurface hydrogen, H(sub) , may either significantly increase or decrease the bond energy and the reactivity of the adsorbed hydrogen, H(ad) , depending on the metal. We predict a representative reaction, ethyl hydrogenation, to speed up on Pd and Pt, but to slow down on Ni and Rh in the presence of H(sub) , especially on metal nanoparticles. The identified effects of subsurface H on surface reactivity are indispensable for an atomistic understanding of hydrogenation processes on transition metals and interactions of hydrogen with metals in general.

  18. Synthesis and aggregation behavior of meso-sulfinylporphyrins: evaluation of S-chirality effects on the self-organization to S-oxo-tethered cofacial porphyrin dimers.

    PubMed

    Matano, Yoshihiro; Shinokura, Tomonori; Matsumoto, Kazuaki; Imahori, Hiroshi; Nakano, Haruyuki

    2007-11-01

    The synthesis and aggregation behavior of meso-sulfinylporphyrins are described. The copper-catalyzed C-S cross-coupling reaction of a meso-iodoporphyrin with benzenethiol and n-octanethiol has proved to be an efficient method for the synthesis of meso-sulfanylporphyrins, which are oxygenated by m-chloroperbenzoic acid to produce the corresponding meso-sulfinylporphyrins. Optically active zinc meso-sulfinylporphyrins were successfully isolated by means of optical resolution of the racemates on a chiral HPLC column. Zinc sulfinylporphyrins readily undergo self-organization through S-oxo-zinc coordination to form cofacial porphyrin dimers in solution, in which the hetero- and homodimers are present as a diastereomeric mixture. The aggregation modes of the S-oxo-tethered porphyrin dimers were fully characterized by 1H NMR, IR, and UV/Vis spectroscopy as well as DFT calculations on their model compounds, thus revealing that the self-aggregation behavior depends on the combination of S chirality. The absolute configurations at the sulfur center can be determined by the exciton-coupled CD method. The observed self-association constant for the S-oxo-tethered dimerization of (S)-phenylsulfinylporphyrin in toluene is larger than that in dichloromethane, which reflects the difference in dipole moments between the homodimer and the monomer. In cyclic and differential pulse voltammetry, the first oxidation process of the cofacial dimers is split into two reversible steps, which indicates that the initially produced pi radical cations are delocalized efficiently between the two porphyrin rings. The present findings demonstrate the potential utility of meso-sulfinyl groups as promising ligands for investigating the effects of peripheral chirality on the structures and optical and electrochemical properties of metal-assisted porphyrin self-assemblies. PMID:17893892

  19. Efficiency of metal activators of accelerated sulfur vulcanization

    SciTech Connect

    Duchacek, V.; Kuta, A.; Pribyl, P. )

    1993-01-20

    The effects of copper, mercury, nickel, zinc, cadmium, indium, magnesium, and calcium stearates on the course of N-cyclohexyl-2-benzthiazylsulphenamide-accelerated sulfur vulcanization of natural rubber have been investigated on the basis of curemeter measurements at 145 C. The differences in the efficiencies of these metal activators of accelerated sulfur vulcanization have been discussed from the points of view of the electron configurations of the metals and their affinities to sulfur. The authors attempted to determine why zinc oxide is generally accepted as the best metal vulcanization activator.

  20. Molecular designs for controlling the local environments around metal ions.

    PubMed

    Cook, Sarah A; Borovik, A S

    2015-08-18

    The functions of metal complexes are directly linked to the local environment in which they are housed; modifications to the local environment (or secondary coordination sphere) are known to produce changes in key properties of the metal centers that can affect reactivity. Noncovalent interactions are the most common and influential forces that regulate the properties of secondary coordination spheres, which leads to complexities in structure that are often difficult to achieve in synthetic systems. Using key architectural features from the active sites of metalloproteins as inspiration, we have developed molecular systems that enforce intramolecular hydrogen bonds (H-bonds) around a metal center via incorporation of H-bond donors and acceptors into rigid ligand scaffolds. We have utilized these molecular species to probe mechanistic aspects of biological dioxygen activation and water oxidation. This Account describes the stabilization and characterization of unusual M-oxo and heterobimetallic complexes. These types of species have been implicated in a range of oxidative processes in biology but are often difficult to study because of their inherent reactivity. Our H-bonding ligand systems allowed us to prepare an Fe(III)-oxo species directly from the activation of O2 that was subsequently oxidized to form a monomeric Fe(IV)-oxo species with an S = 2 spin state, similar to those species proposed as key intermediates in non-heme monooxygenases. We also demonstrated that a single Mn(III)-oxo center that was prepared from water could be converted to a high-spin Mn(V)-oxo species via stepwise oxidation, a process that mimics the oxidative charging of the oxygen-evolving complex (OEC) of photosystem II. Current mechanisms for photosynthetic O-O bond formation invoke a Mn(IV)-oxyl species rather than the isoelectronic Mn(V)-oxo system as the key oxidant based on computational studies. However, there is no experimental information to support the existence of a Mn

  1. A molecular molybdenum-oxo catalyst for generating hydrogen from water.

    PubMed

    Karunadasa, Hemamala I; Chang, Christopher J; Long, Jeffrey R

    2010-04-29

    A growing awareness of issues related to anthropogenic climate change and an increase in global energy demand have made the search for viable carbon-neutral sources of renewable energy one of the most important challenges in science today. The chemical community is therefore seeking efficient and inexpensive catalysts that can produce large quantities of hydrogen gas from water. Here we identify a molybdenum-oxo complex that can catalytically generate gaseous hydrogen either from water at neutral pH or from sea water. This work shows that high-valency metal-oxo species can be used to create reduction catalysts that are robust and functional in water, a concept that has broad implications for the design of 'green' and sustainable chemistry cycles.

  2. Structural and Functional Elucidation of the Mechanism Promoting Error-prone Synthesis by Human DNA Polymerase [kappa] Opposite the 7,8-Dihydro-8-oxo-2'-deoxyguanosine Adduct

    SciTech Connect

    Irimia, Adriana; Eoff, Robert L.; Guengerich, F.Peter; Egli, Martin

    2009-09-25

    Human polymerase kappa (hPol {kappa}) is one of four eukaryotic Y-class DNA polymerases and may be an important element in the cellular response to polycyclic aromatic hydrocarbons such as benzo[a]pyrene, which can lead to reactive oxygenated metabolite-mediated oxidative stress. Here, we present a detailed analysis of the activity and specificity of hPol {kappa} bypass opposite the major oxidative adduct 7,8-dihydro-8-oxo-2{prime}-deoxyguanosine (8-oxoG). Unlike its archaeal homolog Dpo4, hPol {kappa} bypasses this lesion in an error-prone fashion by inserting mainly dATP. Analysis of transient-state kinetics shows diminished 'bursts' for dATP:8-oxoG and dCTP:8-oxoG incorporation, indicative of non-productive complex formation, but dATP:8-oxoG insertion events that do occur are 2-fold more efficient than dCTP:G insertion events. Crystal structures of ternary hPol {kappa} complexes with adducted template-primer DNA reveal non-productive (dGTP and dATP) alignments of incoming nucleotide and 8-oxoG. Structural limitations placed upon the hPol {kappa} by interactions between the N-clasp and finger domains combined with stabilization of the syn-oriented template 8-oxoG through the side chain of Met-135 both appear to contribute to error-prone bypass. Mutating Leu-508 in the little finger domain of hPol {kappa} to lysine modulates the insertion opposite 8-oxoG toward more accurate bypass, similar to previous findings with Dpo4. Our structural and activity data provide insight into important mechanistic aspects of error-prone bypass of 8-oxoG by hPol {kappa} compared with accurate and efficient bypass of the lesion by Dpo4 and polymerase {eta}.

  3. Functionalized Metallated Cavitands via Imidation and Late-Stage Elaboration

    PubMed Central

    Zhao, Yanchuan

    2015-01-01

    Efficient methods for the preparation of functionalized metallated cavitands are described. Functional groups can be either introduced by an imidation of metal-oxo complexes or by a late-stage elaboration of the imido ligands. By using diversified iminophosphorane (PPh3=NR) reagents, π-conjugated pyrene, redox active ferrocene and polymerizable norbornene moieties were successfully introduced. Furthermore, the iodo and alkynyl groups on the imido ligands are capable of undergoing efficient Sonogashira cross-coupling and copper-catalyzed azide alkyne cycloaddition reactions, thereby providing facile access to complex architectures containing metallated cavitands. PMID:26962300

  4. Biologically active compounds of semi-metals.

    PubMed

    Rezanka, Tomás; Sigler, Karel

    2008-02-01

    Semi-metals (boron, silicon, arsenic and selenium) form organo-metal compounds, some of which are found in nature and affect the physiology of living organisms. They include, e.g., the boron-containing antibiotics aplasmomycin, borophycin, boromycin, and tartrolon or the silicon compounds present in "silicate" bacteria, relatives of the genus Bacillus, which release silicon from aluminosilicates through the secretion of organic acids. Arsenic is incorporated into arsenosugars and arsenobetaines by marine algae and invertebrates, and fungi and bacteria can produce volatile methylated arsenic compounds. Some prokaryotes can use arsenate as a terminal electron acceptor while others can utilize arsenite as an electron donor to generate energy. Selenium is incorporated into selenocysteine that is found in some proteins. Biomethylation of selenide produces methylselenide and dimethylselenide. Selenium analogues of amino acids, antitumor, antibacterial, antifungal, antiviral, anti-infective drugs are often used as analogues of important pharmacological sulfur compounds. Other metalloids, i.e. the rare and toxic tellurium and the radioactive short-lived astatine, have no biological significance. PMID:17991498

  5. Analysis of 7,8-Dihydro-8-oxo-2′-deoxyguanosine in Cellular DNA during Oxidative Stress

    PubMed Central

    2009-01-01

    Analysis of cellular 7,8-dihydro-8-oxo-2′-deoxyguanosine (8-oxo-dGuo) as a biomarker of oxidative DNA damage has been fraught with numerous methodological problems. This is primarily due to artifactual oxidation of dGuo that occurs during DNA isolation and hydrolysis. Therefore, it has become necessary to rely on using the comet assay, which is not necessarily specific for 8-oxo-dGuo. A highly specific and sensitive method based on immunoaffinity purification and stable isotope dilution liquid chromatography (LC)-multiple reaction monitoring (MRM)/mass spectrometry (MS) that avoids artifact formation has now been developed. Cellular DNA was isolated using cold DNAzol (a proprietary product that contains guanidine thiocyanate) instead of chaotropic- or phenol-based methodology. Chelex-treated buffers were used to prevent Fenton chemistry-mediated generation of reactive oxygen species (ROS) and artifactual oxidation of DNA bases. Deferoxamine was also added to all buffers in order to complex any residual transition metal ions remaining after Chelex treatment. The LC-MRM/MS method was used to determine that the basal 8-oxo-dGuo level in DNA from human bronchoalveolar H358 cells was 2.2 ± 0.4 8-oxo-dGuo/107 dGuo (mean ± standard deviation) or 5.5 ± 1.0 8-oxo-dGuo/108 nucleotides. Similar levels were observed in human lung adenocarcinoma A549 cells, mouse hepatoma Hepa-1c1c7 cells, and human HeLa cervical epithelial adenocarcinoma cells. These values are an order of magnitude lower than is typically reported for basal 8-oxo-dGuo levels in DNA as determined by other MS- or chromatography-based assays. H358 cells were treated with increasing concentrations of potassium bromate (KBrO3) as a positive control or with the methylating agent methyl methanesulfonate (MMS) as a negative control. A linear dose−response for 8-oxo-dGuo formation (r2 = 0.962) was obtained with increasing concentrations of KBrO3 in the range of 0.05 mM to 2.50 mM. In contrast, no 8-oxo-dGuo was

  6. Specific features of technetium mononuclear octahedral oxo complexes: A review

    SciTech Connect

    Sergienko, V. S. Churakov, A. V.

    2013-01-15

    The specific structural features of technetium mononuclear octahedral oxo complexes have been considered. The structures of d{sup 2}-Tc(V) mono- and dioxo complexes, d{sup 2}-Tc(V) pseudodioxo compounds (Tc(V) mono-oxo complexes with an additional multiply bonded RO{sup -} ligand), and d{sup 0}-Tc(VII) trioxo compounds are analyzed.

  7. Synthesis and Biological Evaluation of 2-Oxo/Thioxoquinoxaline and 2-Oxo/Thioxoquinoxaline-Based Nucleoside Analogues.

    PubMed

    El-Sayed, Hassan A; Said, Said A; Moustafa, Ahmed H; Baraka, Mohamed M; Abdel-Kader, Rimaa T

    2016-01-01

    Several O- and S-quinoxaline glycosides have been prepared by glycosidation of 3-methyl-2-oxo(thioxo)-1,2-dihydroquinoxalines 1a,b with α-D-glucopyranosyl, α-D-galactopyranosyl, and α-D-lactosyl bromide in the presence of K2CO3 followed by deacetylation with Et3N/H2O. Furthermore, alkylation of 1a,b with 4-bromobutyl acetate, 2-acetoxyethoxymethyl bromide, and 3-chloropropanol afforded the corresponding O- and S-acycloquinoxaline nucleosides. Reaction of 1b with chloroacetic acid followed by condensation with sulfacetamide and sulfadiazine in the presence of Et3N/THF and ethyl chloroformate gave the corresponding sulfonamide derivatives 14 and 15, respectively. The structures of new compounds were confirmed by using IR, (1)H, (13)C NMR spectra and microanalysis. Some of these compounds were screened in vitro for antitumor and antifungal activities. PMID:26810144

  8. Antischistosomal Activity of Oxindolimine-Metal Complexes

    PubMed Central

    Dario, Bruno S.; Couto, Ricardo A. A.; Pinto, Pedro L. S.; da Costa Ferreira, Ana M.

    2015-01-01

    In recent years, a class of oxindole-copper and -zinc complex derivatives have been reported as compounds with efficient proapoptotic activity toward different tumor cells (e.g., neuroblastomas, melanomas, monocytes). Here we assessed the efficacy of synthesized oxindole-copper(II), -zinc(II), and -vanadyl (VO2+) complexes against adult Schistosoma mansoni worms. The copper(II) complexes (50% inhibitory concentrations of 30 to 45 μM) demonstrated greater antischistosomal properties than the analogous zinc and vanadyl complexes regarding lethality, reduction of motor activity, and oviposition. PMID:26239976

  9. (2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

    SciTech Connect

    Kim, D.; Wang, L.; Beconi, M.; Eiermann, G.; Fisher, M.; He, H.; Hickey, G.; Kowalchick, Jennifer; Leiting, Barbara; Lyons, K.; Marsilio, F.; McCann, F.; Patel, R.; Petrov, A.; Scapin, G.; Patel, S.; Roy, R.; Wu, J.; Wyvratt, M.; Zhang, B.; Zhu, L.; Thornberry, N.; Weber, A.

    2010-11-10

    A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

  10. 4-Oxo-Aldehydes from the dorsal abdominal glands of the bed bug (hemiptera: cimicidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Analyses of the dorsal abdominal glands of fourth- and fifth-instar nymphs of the bed bud Cimex lectularius L. indicated the predominant constituents were (E)-2-hexenal and (E)-2-octenal with lesser amounts of 4-oxo-(E)-2-hexenal and 4-oxo-(E)-2-octenal. The latter two compounds have not previously...

  11. Metals in the active site of native protein phosphatase-1.

    PubMed

    Heroes, Ewald; Rip, Jens; Beullens, Monique; Van Meervelt, Luc; De Gendt, Stefan; Bollen, Mathieu

    2015-08-01

    Protein phosphatase-1 (PP1) is a major protein Ser/Thr phosphatase in eukaryotic cells. Its activity depends on two metal ions in the catalytic site, which were identified as manganese in the bacterially expressed phosphatase. However, the identity of the metal ions in native PP1 is unknown. In this study, total reflection X-ray fluorescence (TXRF) was used to detect iron and zinc in PP1 that was purified from rabbit skeletal muscle. Metal exchange experiments confirmed that the distinct substrate specificity of recombinant and native PP1 is determined by the nature of their associated metals. We also found that the iron level associated with native PP1 is decreased by incubation with inhibitor-2, consistent with a function of inhibitor-2 as a PP1 chaperone. PMID:25890482

  12. Mononuclear Nonheme Iron(III)-Iodosylarene and High-Valent Iron-Oxo Complexes in Olefin Epoxidation Reactions.

    PubMed

    Wang, Bin; Lee, Yong-Min; Seo, Mi Sook; Nam, Wonwoo

    2015-09-28

    High-spin iron(III)-iodosylarene complexes are highly reactive in the epoxidation of olefins, in which epoxides are formed as the major products with high stereospecificity and enantioselectivity. The reactivity of the iron(III)-iodosylarene intermediates is much greater than that of the corresponding iron(IV)-oxo complex in these reactions. The iron(III)-iodosylarene species-not high-valent iron(IV)-oxo and iron(V)-oxo species-are also shown to be the active oxidants in catalytic olefin epoxidation reactions. The present results are discussed in light of the long-standing controversy on the one oxidant versus multiple oxidants hypothesis in oxidation reactions.

  13. Highly active oxygen reduction non-platinum group metal electrocatalyst without direct metal-nitrogen coordination

    NASA Astrophysics Data System (ADS)

    Strickland, Kara; Miner, Elise; Jia, Qingying; Tylus, Urszula; Ramaswamy, Nagappan; Liang, Wentao; Sougrati, Moulay-Tahar; Jaouen, Frédéric; Mukerjee, Sanjeev

    2015-06-01

    Replacement of noble metals in catalysts for cathodic oxygen reduction reaction with transition metals mostly create active sites based on a composite of nitrogen-coordinated transition metal in close concert with non-nitrogen-coordinated carbon-embedded metal atom clusters. Here we report a non-platinum group metal electrocatalyst with an active site devoid of any direct nitrogen coordination to iron that outperforms the benchmark platinum-based catalyst in alkaline media and is comparable to its best contemporaries in acidic media. In situ X-ray absorption spectroscopy in conjunction with ex situ microscopy clearly shows nitrided carbon fibres with embedded iron particles that are not directly involved in the oxygen reduction pathway. Instead, the reaction occurs primarily on the carbon-nitrogen structure in the outer skin of the nitrided carbon fibres. Implications include the potential of creating greater active site density and the potential elimination of any Fenton-type process involving exposed iron ions culminating in peroxide initiated free-radical formation.

  14. Highly active oxygen reduction non-platinum group metal electrocatalyst without direct metal-nitrogen coordination.

    PubMed

    Strickland, Kara; Miner, Elise; Jia, Qingying; Tylus, Urszula; Ramaswamy, Nagappan; Liang, Wentao; Sougrati, Moulay-Tahar; Jaouen, Frédéric; Mukerjee, Sanjeev

    2015-06-10

    Replacement of noble metals in catalysts for cathodic oxygen reduction reaction with transition metals mostly create active sites based on a composite of nitrogen-coordinated transition metal in close concert with non-nitrogen-coordinated carbon-embedded metal atom clusters. Here we report a non-platinum group metal electrocatalyst with an active site devoid of any direct nitrogen coordination to iron that outperforms the benchmark platinum-based catalyst in alkaline media and is comparable to its best contemporaries in acidic media. In situ X-ray absorption spectroscopy in conjunction with ex situ microscopy clearly shows nitrided carbon fibres with embedded iron particles that are not directly involved in the oxygen reduction pathway. Instead, the reaction occurs primarily on the carbon-nitrogen structure in the outer skin of the nitrided carbon fibres. Implications include the potential of creating greater active site density and the potential elimination of any Fenton-type process involving exposed iron ions culminating in peroxide initiated free-radical formation.

  15. Highly active oxygen reduction non-platinum group metal electrocatalyst without direct metal-nitrogen coordination.

    PubMed

    Strickland, Kara; Miner, Elise; Jia, Qingying; Tylus, Urszula; Ramaswamy, Nagappan; Liang, Wentao; Sougrati, Moulay-Tahar; Jaouen, Frédéric; Mukerjee, Sanjeev

    2015-01-01

    Replacement of noble metals in catalysts for cathodic oxygen reduction reaction with transition metals mostly create active sites based on a composite of nitrogen-coordinated transition metal in close concert with non-nitrogen-coordinated carbon-embedded metal atom clusters. Here we report a non-platinum group metal electrocatalyst with an active site devoid of any direct nitrogen coordination to iron that outperforms the benchmark platinum-based catalyst in alkaline media and is comparable to its best contemporaries in acidic media. In situ X-ray absorption spectroscopy in conjunction with ex situ microscopy clearly shows nitrided carbon fibres with embedded iron particles that are not directly involved in the oxygen reduction pathway. Instead, the reaction occurs primarily on the carbon-nitrogen structure in the outer skin of the nitrided carbon fibres. Implications include the potential of creating greater active site density and the potential elimination of any Fenton-type process involving exposed iron ions culminating in peroxide initiated free-radical formation. PMID:26059552

  16. Microalloying of transition metal silicides by mechanical activation and field-activated reaction

    DOEpatents

    Munir, Zuhair A.; Woolman, Joseph N.; Petrovic, John J.

    2003-09-02

    Alloys of transition metal suicides that contain one or more alloying elements are fabricated by a two-stage process involving mechanical activation as the first stage and densification and field-activated reaction as the second stage. Mechanical activation, preferably performed by high-energy planetary milling, results in the incorporation of atoms of the alloying element(s) into the crystal lattice of the transition metal, while the densification and field-activated reaction, preferably performed by spark plasma sintering, result in the formation of the alloyed transition metal silicide. Among the many advantages of the process are its ability to accommodate materials that are incompatible in other alloying methods.

  17. Tuned by metals: the TET peptidase activity is controlled by 3 metal binding sites

    PubMed Central

    Colombo, Matteo; Girard, Eric; Franzetti, Bruno

    2016-01-01

    TET aminopeptidases are dodecameric particles shared in the three life domains involved in various biological processes, from carbon source provider in archaea to eye-pressure regulation in humans. Each subunit contains a dinuclear metal site (M1 and M2) responsible for the enzyme catalytic activity. However, the role of each metal ion is still uncharacterized. Noteworthy, while mesophilic TETs are activated by Mn2+, hyperthermophilic TETs prefers Co2+. Here, by means of anomalous x-ray crystallography and enzyme kinetics measurements of the TET3 aminopeptidase from the hyperthermophilic organism Pyrococcus furiosus (PfTET3), we show that M2 hosts the catalytic activity of the enzyme, while M1 stabilizes the TET3 quaternary structure and controls the active site flexibility in a temperature dependent manner. A new third metal site (M3) was found in the substrate binding pocket, modulating the PfTET3 substrate preferences. These data show that TET activity is tuned by the molecular interplay among three metal sites. PMID:26853450

  18. Design and evaluation of novel 8-oxo-pyridopyrimidine Jak1/2 inhibitors.

    PubMed

    Labadie, Sharada; Barrett, Kathy; Blair, Wade S; Chang, Christine; Deshmukh, Gauri; Eigenbrot, Charles; Gibbons, Paul; Johnson, Adam; Kenny, Jane R; Kohli, Pawan Bir; Liimatta, Marya; Lupardus, Patrick J; Shia, Steven; Steffek, Micah; Ubhayakar, Savita; van Abbema, Anne; Zak, Mark

    2013-11-01

    A highly ligand efficient, novel 8-oxo-pyridopyrimidine containing inhibitor of Jak1 and Jak2 isoforms with a pyridone moiety as the hinge-binding motif was discovered. Structure-based design strategies were applied to significantly improve enzyme potency and the polarity of the molecule was adjusted to gain cellular activity. The crystal structures of two representative inhibitors bound to Jak1 were obtained to enable SAR exploration.

  19. Biosynthesis, biological effects, and receptors of hydroxyeicosatetraenoic acids (HETEs) and oxoeicosatetraenoic acids (oxo-ETEs) derived from arachidonic acid.

    PubMed

    Powell, William S; Rokach, Joshua

    2015-04-01

    Arachidonic acid can be oxygenated by a variety of different enzymes, including lipoxygenases, cyclooxygenases, and cytochrome P450s, and can be converted to a complex mixture of oxygenated products as a result of lipid peroxidation. The initial products in these reactions are hydroperoxyeicosatetraenoic acids (HpETEs) and hydroxyeicosatetraenoic acids (HETEs). Oxoeicosatetraenoic acids (oxo-ETEs) can be formed by the actions of various dehydrogenases on HETEs or by dehydration of HpETEs. Although a large number of different HETEs and oxo-ETEs have been identified, this review will focus principally on 5-oxo-ETE, 5S-HETE, 12S-HETE, and 15S-HETE. Other related arachidonic acid metabolites will also be discussed in less detail. 5-Oxo-ETE is synthesized by oxidation of the 5-lipoxygenase product 5S-HETE by the selective enzyme, 5-hydroxyeicosanoid dehydrogenase. It actions are mediated by the selective OXE receptor, which is highly expressed on eosinophils, suggesting that it may be important in eosinophilic diseases such as asthma. 5-Oxo-ETE also appears to stimulate tumor cell proliferation and may also be involved in cancer. Highly selective and potent OXE receptor antagonists have recently become available and could help to clarify its pathophysiological role. The 12-lipoxygenase product 12S-HETE acts by the GPR31 receptor and promotes tumor cell proliferation and metastasis and could therefore be a promising target in cancer therapy. It may also be involved as a proinflammatory mediator in diabetes. In contrast, 15S-HETE may have a protective effect in cancer. In addition to GPCRs, higher concentration of HETEs and oxo-ETEs can activate peroxisome proliferator-activated receptors (PPARs) and could potentially regulate a variety of processes by this mechanism. This article is part of a Special Issue entitled "Oxygenated metabolism of PUFA: analysis and biological relevance".

  20. Anticancer Activity of Metal Complexes: Involvement of Redox Processes

    PubMed Central

    Jungwirth, Ute; Kowol, Christian R.; Keppler, Bernhard K.; Hartinger, Christian G.; Berger, Walter; Heffeter, Petra

    2012-01-01

    Cells require tight regulation of the intracellular redox balance and consequently of reactive oxygen species for proper redox signaling and maintenance of metal (e.g., of iron and copper) homeostasis. In several diseases, including cancer, this balance is disturbed. Therefore, anticancer drugs targeting the redox systems, for example, glutathione and thioredoxin, have entered focus of interest. Anticancer metal complexes (platinum, gold, arsenic, ruthenium, rhodium, copper, vanadium, cobalt, manganese, gadolinium, and molybdenum) have been shown to strongly interact with or even disturb cellular redox homeostasis. In this context, especially the hypothesis of “activation by reduction” as well as the “hard and soft acids and bases” theory with respect to coordination of metal ions to cellular ligands represent important concepts to understand the molecular modes of action of anticancer metal drugs. The aim of this review is to highlight specific interactions of metal-based anticancer drugs with the cellular redox homeostasis and to explain this behavior by considering chemical properties of the respective anticancer metal complexes currently either in (pre)clinical development or in daily clinical routine in oncology. PMID:21275772

  1. An active metallic nanomatryushka with two similar super-resonances

    NASA Astrophysics Data System (ADS)

    Wu, D. J.; Cheng, Y.; Wu, X. W.; Liu, X. J.

    2014-07-01

    The optical properties of a simple metallic nanomatryushka (nanosphere-in-a-nanoshell) with gain have been investigated theoretically. The spaser (surface plasmon amplification by stimulated emission of radiation) phenomena can be observed at two critical wavelengths in the active metallic nanomatryushkas. With increasing the gain coefficient of the middle layer, a similar super surface plasmon (SP) resonance is first found at the ω-+|1 mode of the active nanoparticles and then breaks down. With further increasing the gain coefficient, another similar super-resonance occurs at the ω--|1 mode. The near-field enhancements in the active nanomatryushkas also have been greatly amplified at the critical wavelengths for ω-+|1 and ω--|1 modes. It is further found that the amplifications of SPs in the active Ag-SiO2-Au nanoshell are strongest in four kinds of nanoshells and hence the largest near fields. The giant near-field enhancement can greatly enhance the Raman excitation and emission.

  2. Diagnostics of metal inert gas and metal active gas welding processes

    NASA Astrophysics Data System (ADS)

    Uhrlandt, D.

    2016-08-01

    The paper gives a review on studies on metal inert gas (MIG) and metal active gas (MAG) welding processes with the focus on diagnostics of the arc, the material transfer, and the temporal process behaviour in welding experiments. Recent findings with respect to an improved understanding of the main mechanisms in the welding arc and the welding process are summarized. This is linked to actual developments in welding arc and welding process modelling where measurements are indispensable for validation. Challenges of forthcoming studies are illustrated by means of methods under development for welding process control as well as remaining open questions with respect to arc-surface interaction and arc power balance.

  3. Physical Chemistry of TiO2 functionalized with oxo-manganese catalysts

    NASA Astrophysics Data System (ADS)

    Abuabara, Sabas G.; Cady, Clyde W.; Schleicher, Jim M.; Baxter, Jason; Brudvig, Gary W.; Crabtree, Robert H.; Schmuttenmaer, Charles A.; Batista, Victor S.

    2006-03-01

    We describe the development and application of dye-sensitized semiconductors to heterogeneous photocatalysis. Ab initio-DFT electronic structure calculations and molecular dynamics simulations combined with quantum dynamics propagation of transient electronic excitations indicate that a surface complex consisting of a catalytic Mn oxo complex adsorbed onto a TiO2 substrate via a catechol-substituted terpyridine ligand can be activated by photoinduced subpicosecond interfacial electron transfer. Experimental realization of the Mn oxo surface complex, achieved by a novel sequential synthesis technique, is briefly described and computational results supporting the spectroscopic characterization of the nanoscale assembly are presented. Studying the photocatalytic reaction dynamics of these uniquely functionalized semiconductor materials offers the prospect of gaining unprecedented control over a wide range of contrathermodynamic reactions. Furthermore, such biomimetic materials capable of splitting water or fixating CO2 could provide viable solutions to problems ranging from current energy concerns to reducing atmospheric greenhouse gases.

  4. A 3.6 nm Ti52-Oxo Nanocluster with Precise Atomic Structure.

    PubMed

    Fang, Wei-Hui; Zhang, Lei; Zhang, Jian

    2016-06-22

    We report a 3.6 nm Ti52-oxo cluster with precise atomic structure, which presents a largest size record in the family of titanium-oxo clusters (TOCs). The crystal growth of such large Ti52 is based on a stepwise interlayer assembly approach from Ti6 substructures. The possible growth mechanism of Ti52 could be deduced from crystal structures of two substructures, Ti6 and Ti17, which were also synthesized under similar conditions as Ti52. Moreover, these TOCs show cluster-size-dependent photocatalytic hydrogen evolution activities with Ti52 giving a H2 production rate up to 398 μmol/h/g, which is also the highest record in the family of TOCs. This work not only represents a milestone in constructing large TOCs with comparable sizes as TiO2 nanoparticles but also brings significant advances in improving photocatalytic behaviors of TOCs.

  5. Snythesis and characterization of the first main group oxo-centered trinuclear carboxylate

    NASA Technical Reports Server (NTRS)

    Duraj, Stan A.

    1994-01-01

    The synthesis and structural characterization of the first main group oxo-centered, trinuclear carboxylato-bridged species is reported, namely (Ga3(mu(sub 3)-O) (mu-O2CC6H5)6 (4-Mepy)3) GaCl4 center dot 4-Mepy (compound 1), where 4-Mepy is 4-methylpyridine. Compound 1 is a main group example of a well-established class of complexes, referred to as 'basic carboxylates' of the general formula (M3(mu(sub 3)-O)(mu-O2CR)6L3)(+), previously observed only for transition metals.

  6. Asymmetric synthesis of bicyclic dihydropyrans via organocatalytic inverse-electron-demand oxo-Diels-Alder reactions of enolizable aliphatic aldehydes.

    PubMed

    Li, Jun-Long; Yang, Kai-Chuan; Li, Yi; Li, Qiang; Zhu, Hong-Ping; Han, Bo; Peng, Cheng; Zhi, Yong-Gang; Gou, Xiao-Jun

    2016-08-23

    A highly enantioselective organocatalytic inverse-electron-demand oxo-Diels-Alder reaction involving aqueous acetaldehyde has been discovered. The reaction, in which cyclic enones serve as dienes in the presence of readily available secondary amine catalysts, allows facile construction of optically active bicyclic dihydropyrans. Other typical enolizable aliphatic aldehydes can also serve as competent dienophiles in the reaction. PMID:27436351

  7. Are 8-oxoguanine (8-oxoGua) and 5-hydroxymethyluracil (5-hmUra) oxidatively damaged DNA bases or transcription (epigenetic) marks?

    PubMed

    Zarakowska, Ewelina; Gackowski, Daniel; Foksinski, Marek; Olinski, Ryszard

    2014-04-01

    The oxidatively modified DNA base 8-oxo-7,8-dihydroguanine (8-oxoGua) is nontoxic and weakly mutagenic. Here we report on new data suggesting a potential for 8-oxoGua to affect the expression of several genes via epigenetic changes resulting in chromatin relaxation. Using pig thymus extract, we analyzed the distribution of 8-oxoGua among different nuclei fractions representative of transcriptionally active and silenced regions. The levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) found in transcriptionally active euchromatin (4.37/10(6) nucleotides) and in the matrix fraction (4.16/10(6) nucleotides) were about 5 times higher than in transcriptionally silenced heterochromatin (0.91/10(6) nucleotides). Other experimental data are presented which suggest that 8-oxoGua present in specific DNA sequences may be widely used for transcription regulation. Like 8-oxoGua, 5-hydroxymethyluracil (5-hmUra) is another oxidatively modified DNA base (the derivative is formed by thymine oxidation). Recent experimental evidence supports the notion that 5-hmUra plays an important role in active DNA demethylation. This involves overexpression of activation-induced cytidine deaminase (AID) and ten-eleven translocation 1 (TET1) protein (the key proteins involved in active demethylation), which leads to global accumulation of 5-hmUra. Our preliminary data demonstrate a significant increase of the 5-hmUra levels in pig brain extract when compared with liver extract. The lack of 5-hmUra in Escherichia coli DNA also speaks for a role of this modification in the active demethylation process. It is concluded that 8-oxodG and 5-hmUra in DNA may be considered as epigenetic marks.

  8. Twelve Year Study of Underground Corrosion of Activated Metals

    SciTech Connect

    M. Kay Adler Flitton; Timothy S. Yoder

    2012-03-01

    The subsurface radioactive disposal facility located at the U.S. Department of Energy’s Idaho site contains neutron-activated metals from non-fuel nuclear-reactor-core components. A long-term corrosion study is being conducted to obtain site-specific corrosion rates to support efforts to more accurately estimate the transfer of activated elements in an arid vadose zone environment. The study uses non-radioactive metal coupons representing the prominent neutron-activated material buried at the disposal location, namely, two types of stainless steels, welded stainless steel, welded nickel-chromium steel alloy, zirconium alloy, beryllium, and aluminum. Additionally, carbon steel (the material used in cask disposal liners and other disposal containers) and duplex stainless steel (high-integrity containers) are also included in the study. This paper briefly describes the test program and presents the corrosion rate results through twelve years of underground exposure.

  9. Anticancer activity of Arkeshwara Rasa - A herbo-metallic preparation

    PubMed Central

    Nafiujjaman, Md; Nurunnabi, Md; Saha, Samir Kumar; Jahan, Rownak; Lee, Yong-kyu; Rahmatullah, Mohammed

    2015-01-01

    Introduction: Though metal based drugs have been prescribed in Ayurveda for centuries to treat various diseases, such as rheumatoid arthritis and cancer, toxicity of these drugs containing heavy metal is a great drawback for practical application. So, proper scientific validation of herbo-metallic drugs like Arkeshwara Rasa (AR) have become one of the focused research arena of new drugs against cancers. Aim: To investigate the in vitro anticancer effects of AR. Materials and Methods: Anticancer activity of AR was investigated on two human cancer cell lines, which represent two different tissues (pancreas and skin). Lactate dehydrogenase (LDH) assay for enzyme activity and trypan blue assay for cell morphology were performed for further confirmation. Results: AR showed potent activity against pancreatic cancer cells (MIA-PaCa-2). LDH activity confirmed that AR was active against pancreatic cancer cells. Finally, it was observed that AR exhibited significant effects on cancer cells due to synergistic effects of different compounds of AR. Conclusion: The study strongly suggests that AR has the potential to be an anticancer drug against pancreatic cancer. PMID:27313425

  10. Activated metallic gold as an agent for direct methoxycarbonylation.

    PubMed

    Xu, Bingjun; Madix, Robert J; Friend, Cynthia M

    2011-12-21

    We have discovered that metallic gold is a highly effective vehicle for the low-temperature vapor-phase carbonylation of methanol by insertion of CO into the O-H bond to form methoxycarbonyl. This reaction contrasts sharply to the carbonylation pathway well known for homogeneously catalyzed carbonylation reactions, such as the synthesis of acetic acid. The methoxycarbonyl intermediate can be further employed in a variety of methoxycarbonylation reactions, without the use or production of toxic chemicals. More generally we observe facile, selective methoxycarbonylation of alkyl and aryl alcohols and secondary amines on metallic gold well below room temperature. A specific example is the synthesis of dimethyl carbonate, which has extensive use in organic synthesis. This work establishes a unique framework for using oxygen-activated metallic gold as a catalyst for energy-efficient, environmentally benign production of key synthetic chemical agents. PMID:22035206

  11. Metal-organic cooperative catalysis in C-H and C-C bond activation and its concurrent recovery.

    PubMed

    Park, Young Jun; Park, Jung-Woo; Jun, Chul-Ho

    2008-02-01

    The development of an efficient catalytic activation (cleavage) system for C-H and C-C bonds is an important challenge in organic synthesis, because these bonds comprise a variety of organic molecules such as natural products, petroleum oils, and polymers on the earth. Among many elegant approaches utilizing transition metals to activate C-H and C-C bonds facilely, chelation-assisted protocols based on the coordinating ability of an organic moiety have attracted great attention, though they have often suffered from the need for an intact coordinating group in a substrate. In this Account, we describe our entire efforts to activate C-H or C-C bonds adjacent to carbonyl groups by employing a new concept of metal-organic cooperative catalysis (MOCC), which enables the temporal installation of a 2-aminopyridyl group into common aldehydes or ketones in a catalytic way. Consequently, a series of new catalytic reactions such as alcohol hydroacylation, oxo-ester synthesis, C-C triple bond cleavage, hydrative dimerization of alkynes, and skeletal rearrangements of cyclic ketones was realized through MOCC. In particular, in the quest for an optimized MOCC system composed of a Wilkinson's catalyst (Ph 3P) 3RhCl and an organic catalyst (2-amino-3-picoline), surprising efficiency enhancements could be achieved when benzoic acid and aniline were introduced as promoters for the aldimine formation process. Furthermore, a notable accomplishment of C-C bond activation has been made using 2-amino-3-picoline as a temporary chelating auxiliary in the reactions of unstrained ketones with various terminal olefins and Wilkinson's catalyst. In the case of seven-membered cyclic ketones, an interesting ring contraction to five- or six-membered ones takes place through skeletal rearrangements initiated by the C-C bond activation of MOCC. On the other hand, the fundamental advances of these catalytic systems into recyclable processes could be achieved by immobilizing both metal and organic

  12. Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae

    SciTech Connect

    Michalska, Karolina; Cuff, Marianne E.; Tesar, Christine; Feldmann, Brian; Joachimiak, Andrzej

    2011-08-01

    The crystal structure of 2-oxo-3-deoxygalactonate kinase from the De Ley–Doudoroff pathway of galactose metabolism has been determined at 2.1 Å resolution. In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De Ley–Doudoroff pathway, d-galactose is metabolized into pyruvate and d-glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1 Å resolution is reported, the first structure of an enzyme from the De Ley–Doudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two α/β domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein.

  13. Ligational behavior of Schiff bases towards transition metal ion and metalation effect on their antibacterial activity

    NASA Astrophysics Data System (ADS)

    Devi, Jai; Batra, Nisha; Malhotra, Rajesh

    2012-11-01

    New Schiff bases pyrazine-2-carboxylicacid (phenyl-pyridin-2-yl-methylene)-hydrazide (Hpch-bp) HL1 and pyrazine-2-carboxylicacid (pyridin-2-ylmethylene)-hydrazide (Hpch-pc) HL2 derived from condensation of pyrazine carboxylic hydrazide (Hpch) with 2-benzoyl pyridine (bp) or pyridine 2-carbaldehyde (pc) and their transition metal complexes of type ML(1-2)2 have been synthesized, where M = Mn(II), Co(II), Ni(II), Cu(II) and Zn(II). Characterization of ligands and their metal complexes was carried out by elemental analysis, conductimetric studies, magnetic susceptibility, spectroscopic techniques (IR, UV-VIS, NMR, ESR, Mass) and thermogravimetric analysis. The physico-chemical studies revealed octahedral geometry or distorted octahedral geometry around metal ion. These azomethine Schiff base ligands acted as tridentate ? coordinating through carbonyl, azomethine and pyridine nitrogen present in the ligand. The thermodynamic and thermal properties of the complexes have been investigated and it was observed on the basis of these studies that thermal stability of complexes follows the order Mn < Zn < Cu < Co < Ni. The ligands and their complexes were tested for in vitro antibacterial activity at different concentrations against bacteria viz. Gram positive Bacillus subtilis, Micrococcus luteus and Gram negative Pseudomonas aeruginosa, Pseudomonas mendocina. A marked enhancement in biocidal activity of the ligands under similar experimental conditions was observed as a consequence of coordination with metal ions. The trend of growth inhibition in the complexes was found to be in the order: Cu > Mn > Ni > Co > Zn.

  14. Chiral magnetic effect and natural optical activity in (Weyl) metals

    NASA Astrophysics Data System (ADS)

    Pesin, Dmytro; Ma, Jing

    We consider the phenomenon of natural optical activity, and related chiral magnetic effect in metals with low carrier concentration. To reveal the correspondence between the two phenomena, we compute the optical conductivity of a noncentrosymmetric metal to linear order in the wave vector of the light wave, specializing to the low-frequency regime. We show that it is the orbital magnetic moment of quasiparticles that is responsible for the natural optical activity, and thus the chiral magnetic effect. While for purely static magnetic fields the chiral magnetic effect is known to have a topological origin and to be related to the presence of Berry curvature monopoles (Weyl points) in the band structure, we show that the existence of Berry monopoles is not required for the dynamic chiral magnetic effect to appear; the latter is thus not unique to Weyl metals. The magnitude of the dynamic chiral magnetic effect in a material is related to the trace of its gyrotropic tensor. We discuss the conditions under which this trace is non-zero; in noncentrosymmetric Weyl metals it is found to be proportional to the energy-space dipole moment of Berry curvature monopoles. The calculations are done within both the semiclassical kinetic equation, and Kubo linear response formalisms. This work was supported by NSF Grant No. DMR-1409089.

  15. Anaerobic bioleaching of metals from waste activated sludge.

    PubMed

    Meulepas, Roel J W; Gonzalez-Gil, Graciela; Teshager, Fitfety Melese; Witharana, Ayoma; Saikaly, Pascal E; Lens, Piet N L

    2015-05-01

    Heavy metal contamination of anaerobically digested waste activated sludge hampers its reuse as fertilizer or soil conditioner. Conventional methods to leach metals require aeration or the addition of leaching agents. This paper investigates whether metals can be leached from waste activated sludge during the first, acidifying stage of two-stage anaerobic digestion without the supply of leaching agents. These leaching experiments were done with waste activated sludge from the Hoek van Holland municipal wastewater treatment plant (The Netherlands), which contained 342 μg g(-1) of copper, 487 μg g(-1) of lead, 793 μg g(-1) of zinc, 27 μg g(-1) of nickel and 2.3 μg g(-1) of cadmium. During the anaerobic acidification of 3 gdry weight L(-1) waste activated sludge, 80-85% of the copper, 66-69% of the lead, 87% of the zinc, 94-99% of the nickel and 73-83% of the cadmium were leached. The first stage of two-stage anaerobic digestion can thus be optimized as an anaerobic bioleaching process and produce a treated sludge (i.e., digestate) that meets the land-use standards in The Netherlands for copper, zinc, nickel and cadmium, but not for lead.

  16. Biologically active metal-independent superoxide dismutase mimics

    SciTech Connect

    Mitchell, J.B.; Samuni, A.; Krishna, M.C.; DeGraff, W.G.; Ahn, M.S.; Samuni, U.; Russo, A. )

    1990-03-20

    Superoxide dismutase (SOD) is an enzyme that detoxifies superoxide (O2.-), a potentially toxic oxygen-derived species. Attempts to increase intracellular concentrations of SOD by direct application are complicated because SOD, being a relatively large molecule, does not readily cross cell membranes. We have identified a set of stable nitroxides that possess SOD-like activity, have the advantage of being low molecular weight, membrane permeable, and metal independent, and at pH 7.0 have reaction rate constants with O2.- ranging from 1.1 x 10(3) to 1.3 x 10(6) M-1 s-1. These SOD mimics protect mammalian cells from damage induced by hypoxanthine/xanthine oxidase and H{sub 2}O{sub 2}, although they exhibit no catalase-like activity. In addition, the nitroxide SOD mimics rapidly oxidize DNA-FeII and thus may interrupt the Fenton reaction and prevent formation of deleterious OH radicals and/or higher oxidation states of metal ions. Whether by SOD-like activity and/or interception of an electron from redox-active metal ions they protect cells from oxidative stress and may have use in basic and applied biological studies.

  17. Synthesis and antitumor evaluation of 6-thioxo-, 6-oxo- and 2,4-dioxopyrimidine derivatives.

    PubMed

    Cocco, M T; Congiu, C; Onnis, V; Piras, R

    2001-10-01

    A series of 6-thioxopyrimidines (5, 6), their 6-oxo- analogs (11-14), and pyrimidine-2,4-diones (20-26), were synthesized and evaluated for their antitumoral activity against 60 tumoral cell lines. The activity of propenethioamide (3, 4) and propeneamide (7-10 and 15-19) intermediates is also reported. Among the tested compounds the thioxopyrimidine 5c, bearing an N'-benzyl group, showed the best cytostatic activity. Furthermore, high selectivity and cytotoxic activity on the HOP-92 cell line of non-small cell lung cancer was exhibited by 3-amino-2-[(methylamino)thioxamethyl]-3-pyrrolidino-2-propenenitrile (3a).

  18. Mononuclear nonheme iron(IV)-oxo and manganese(IV)-oxo complexes in oxidation reactions: experimental results prove theoretical prediction.

    PubMed

    Chen, Junying; Cho, Kyung-Bin; Lee, Yong-Min; Kwon, Yoon Hye; Nam, Wonwoo

    2015-08-25

    Reactivities of mononuclear nonheme iron(IV)-oxo and manganese(IV)-oxo complexes bearing a pentadentate N4Py ligand, [M(IV)O(N4Py)](2+) (M = Fe and Mn), are compared in hydrogen atom transfer (HAT) and oxygen atom transfer (OAT) reactions; theoretical and experimental results show that Fe(IV)O is more reactive than Mn(IV)O. The latter is shown to react through excited state reactivity (ESR).

  19. What is the active species of cytochrome P450 during camphor hydroxylation? QM/MM studies of different electronic states of compound I and of reduced and oxidized iron-oxo intermediates.

    PubMed

    Altun, Ahmet; Shaik, Sason; Thiel, Walter

    2007-07-25

    We have investigated C-H hydroxylation of camphor by Compound I (Cpd I) of cytochrome P450cam in different electronic states and by its one-electron reduced and oxidized forms, using QM/MM calculations in the native protein/solvent environment. Cpd I species with five unpaired electrons (pentaradicaloids) are ca. 12 kcal/mol higher in energy than the ground state Cpd I species with three unpaired electrons (triradicaloids). The H-abstraction transition states of pentaradicaloids lie ca. 21 (9) kcal/mol above the triradicaloid (pentaradicaloid) reactants. Hydroxylation via pentaradicaloids is thus facile provided that they can react before relaxing to the ground-state triradicaloids. Excited states of Cpd I with an Fe(V)-oxo moiety lie more than 20 kcal/mol above the triradicaloid ground state in single-point gas-phase calculations, but these electronic configurations are not stable upon including the point-charge protein environment which causes SCF convergence to the triradicaloid ground state. One-electron reduced species (Cpd II) show sluggish reactivity compared with Cpd I in agreement with experimental model studies. One-electron oxidized species are more reactive than Cpd I but seem too high in energy to be accessible. The barriers to hydrogen abstraction for the various forms of Cpd I are generally not affected much by the chosen protonation states of the Asp297 and His355 residues near the propionate side chains of the heme or by the appearance of radical character at Asp297, His355, or the propionates. PMID:17595079

  20. Electrical active defects in HfO2 based metal/oxide/metal devices

    NASA Astrophysics Data System (ADS)

    El Kamel, F.

    2016-01-01

    Dielectric as well as thermally stimulated current measurements were performed on metal/HfO2/Pt capacitors in order to study the electrical active defects in hafnia thin films. Two thermally activated relaxation processes have been carried out from both measurements. At low temperatures, the relaxation process can be ascribed to the shallow traps level localized at 0.65 eV and generally evidenced by the second ionization of oxygen vacancies. At high temperatures, the relaxation process arises from the diffusion of positively charged oxygen vacancies by overcoming an energetic barrier of about 1 eV.

  1. Activation of Autophagy by Metals in Chlamydomonas reinhardtii.

    PubMed

    Pérez-Martín, Marta; Blaby-Haas, Crysten E; Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Blaby, Ian K; Merchant, Sabeeha S; Crespo, José L

    2015-09-01

    Autophagy is an intracellular self-degradation pathway by which eukaryotic cells recycle their own material in response to specific stress conditions. Exposure to high concentrations of metals causes cell damage, although the effect of metal stress on autophagy has not been explored in photosynthetic organisms. In this study, we investigated the effect of metal excess on autophagy in the model unicellular green alga Chlamydomonas reinhardtii. We show in cells treated with nickel an upregulation of ATG8 that is independent of CRR1, a global regulator of copper signaling in Chlamydomonas. A similar effect on ATG8 was observed with copper and cobalt but not with cadmium or mercury ions. Transcriptome sequencing data revealed an increase in the abundance of the protein degradation machinery, including that responsible for autophagy, and a substantial overlap of that increased abundance with the hydrogen peroxide response in cells treated with nickel ions. Thus, our results indicate that metal stress triggers autophagy in Chlamydomonas and suggest that excess nickel may cause oxidative damage, which in turn activates degradative pathways, including autophagy, to clear impaired components and recover cellular homeostasis.

  2. Activation of Autophagy by Metals in Chlamydomonas reinhardtii

    PubMed Central

    Pérez-Martín, Marta; Blaby-Haas, Crysten E.; Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Blaby, Ian K.; Merchant, Sabeeha S.

    2015-01-01

    Autophagy is an intracellular self-degradation pathway by which eukaryotic cells recycle their own material in response to specific stress conditions. Exposure to high concentrations of metals causes cell damage, although the effect of metal stress on autophagy has not been explored in photosynthetic organisms. In this study, we investigated the effect of metal excess on autophagy in the model unicellular green alga Chlamydomonas reinhardtii. We show in cells treated with nickel an upregulation of ATG8 that is independent of CRR1, a global regulator of copper signaling in Chlamydomonas. A similar effect on ATG8 was observed with copper and cobalt but not with cadmium or mercury ions. Transcriptome sequencing data revealed an increase in the abundance of the protein degradation machinery, including that responsible for autophagy, and a substantial overlap of that increased abundance with the hydrogen peroxide response in cells treated with nickel ions. Thus, our results indicate that metal stress triggers autophagy in Chlamydomonas and suggest that excess nickel may cause oxidative damage, which in turn activates degradative pathways, including autophagy, to clear impaired components and recover cellular homeostasis. PMID:26163317

  3. SEQUESTERING AGENTS FOR ACTIVE CAPS - REMEDIATION OF METALS AND ORGANICS

    SciTech Connect

    Knox, A; Michael Paller, M; Danny D. Reible, D; Xingmao Ma, X; Ioana G. Petrisor, I

    2007-05-10

    This research evaluated organoclays, zeolites, phosphates, and a biopolymer as sequestering agents for inorganic and organic contaminants. Batch experiments were conducted to identify amendments and mixtures of amendments for metal and organic contaminants removal and retention. Contaminant removal was evaluated by calculating partitioning coefficients. Metal retention was evaluated by desorption studies in which residue from the removal studies was extracted with 1 M MgCl{sub 2} solution. The results indicated that phosphate amendments, some organoclays, and the biopolymer, chitosan, were very effective sequestering agents for metals in fresh and salt water. Organoclays were very effective sorbents for phenanthrene, pyrene, and benzo(a)pyrene. Partitioning coefficients for the organoclays were 3000-3500 ml g{sup -1} for benzo(a)pyrene, 400-450 ml g{sup -1} for pyrene, and 50-70 ml g{sup -1} for phenanthrene. Remediation of sites with a mixture of contaminants is more difficult than sites with a single contaminant because metals and organic contaminants have different fate and transport mechanisms in sediment and water. Mixtures of amendments (e.g., organoclay and rock phosphate) have high potential for remediating both organic and inorganic contaminants under a broad range of environmental conditions, and have promise as components in active caps for sediment remediation.

  4. Activation of Autophagy by Metals in Chlamydomonas reinhardtii.

    PubMed

    Pérez-Martín, Marta; Blaby-Haas, Crysten E; Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Blaby, Ian K; Merchant, Sabeeha S; Crespo, José L

    2015-09-01

    Autophagy is an intracellular self-degradation pathway by which eukaryotic cells recycle their own material in response to specific stress conditions. Exposure to high concentrations of metals causes cell damage, although the effect of metal stress on autophagy has not been explored in photosynthetic organisms. In this study, we investigated the effect of metal excess on autophagy in the model unicellular green alga Chlamydomonas reinhardtii. We show in cells treated with nickel an upregulation of ATG8 that is independent of CRR1, a global regulator of copper signaling in Chlamydomonas. A similar effect on ATG8 was observed with copper and cobalt but not with cadmium or mercury ions. Transcriptome sequencing data revealed an increase in the abundance of the protein degradation machinery, including that responsible for autophagy, and a substantial overlap of that increased abundance with the hydrogen peroxide response in cells treated with nickel ions. Thus, our results indicate that metal stress triggers autophagy in Chlamydomonas and suggest that excess nickel may cause oxidative damage, which in turn activates degradative pathways, including autophagy, to clear impaired components and recover cellular homeostasis. PMID:26163317

  5. Synthesis, Characterization, and Biological Activity of N′-[(Z)-(3-Methyl-5-oxo-1-phenyl-1,5-dihydro-4H-pyrazol-4-ylidene)(phenyl)methyl]benzohydrazide and Its Co(II), Ni(II), and Cu(II) Complexes

    PubMed Central

    Asegbeloyin, Jonnie N.; Ujam, Oguejiofo T.; Okafor, Emmanuel C.; Babahan, Ilknur; Coban, Esin Poyrazoglu; Özmen, Ali; Biyik, Halil

    2014-01-01

    Reaction of 1-phenyl-3-methyl-4-benzoyl-pyrazol-5-one and benzoyl hydrazide in refluxing ethanol gave N′-[(Z)-(3-methyl-5-oxo-1-phenyl-1,5-dihydro-4H-pyrazol-4-ylidene)(phenyl)methyl]benzohydrazide (HL1), which was characterized by NMR spectroscopy and single-crystal X-ray structure study. X-ray diffraction analyses of the crystals revealed a nonplanar molecule, existing in the keto-amine form, with intermolecular hydrogen bonding forming a seven-membered ring system. The reaction of HL1 with Co(II), Ni(II), and Cu(II) halides gave the corresponding complexes, which were characterized by elemental analysis, molar conductance, magnetic measurements, and infrared and electronic spectral studies. The compounds were screened for their in vitro cytotoxic activity against HL-60 human promyelocytic leukemia cells and antimicrobial activity against some bacteria and yeasts. Results showed that the compounds are potent against HL-60 cells with the IC50 value ≤5 μM, while some of the compounds were active against few studied Gram-positive bacteria. PMID:25332694

  6. Microwave-assisted synthesis, structural elucidation and biological assessment of 2-(2-acetamidophenyl)-2-oxo-N phenyl acetamide and N-(2-(2-oxo-2(phenylamino)acetyl)phenyl)propionamide derivatives

    NASA Astrophysics Data System (ADS)

    Ghazzali, Mohamed; El-Faham, Ayman; Abdel-Megeed, Ahmed; Al-Farhan, Khalid

    2012-04-01

    A facile solid-state synthesis of 2-(2-acetamidophenyl)-2-oxo-N phenyl acetamide and N-(2-(2-oxo-2(phenylamino)acetyl)phenyl)propionamide six derivatives has been achieved by microwave promoted condensation of N-acylisatin or N-propionylisatin with various aniline derivatives. The six products were characterized by IR and NMR (H1 and C13). Only two of them, The N-[2-(4-Bromo-phenylaminooxalyl)-phenyl]-propionamide and 2-(2-Acetylamino-phenyl)-2-oxo-N-p-tolyl-acetamide molecular structures were verified by X-ray single-crystal diffraction. The Br⋯Br intermolecular interaction in the crystal structure of N-[2-(4-Bromo-phenylaminooxalyl)-phenyl]-propionamide was evaluated by DFT/B3LYP calculation. The antimicrobial activity was evaluated against eight bacterial strains and two fungal species. The N-[2-(4-Bromo-phenylaminooxalyl)-phenyl]-propionamide and 2-(2-Acetylamino-phenyl)-2-oxo-N-p-tolyl-acetamide exhibit selective high inhibitory effects against Aspergillus niger and Staphylococcus aureus, respectively.

  7. Laser beam active brazing of metal ceramic joints

    NASA Astrophysics Data System (ADS)

    Haferkamp, Heinz; Bach, Friedrich W.; von Alvensleben, Ferdinand; Kreutzburg, K.

    1996-04-01

    The use of engineering ceramics is becoming more and more important. Reasons for this are the specific properties of these materials, such as high strength, corrosion resistance and wear resistance. To apply the advantages of ceramics, joining techniques of metal ceramic parts are required. In this paper, joining of metal ceramic joints by laser beam brazing is presented. This joining technique is characterized by local heat input, and the minimal thermal stress of the brazed components. During the investigations, an Nd:YAG laser and a vacuum chamber were applied. The advantages of Nd:YAG lasers are the simple mechanical construction, and laser beam guidance via quartz glass fibers, which leads to high handling flexibility. In addition, most of the materials show a high absorption rate for this kind of radiation. As materials, ceramic Al2O3 with a purity of 99.4% and metals such as X5CrNi189 and Fe54Ni29Co17 were used. As a filler material, commercially available silver and silver- copper brazes with chemically active elements like titanium were employed. During this study, the brazing wetting behavior and the formation of diffusion layers in dependence on processing parameters were investigated. The results have shown that high brazing qualities can be achieved by means of the laser beam brazing process. Crack-free joining of metal ceramic parts is currently only possible by the use of metals such as Fe54Ni29Co17 because of its low thermal expansion coefficient, which reduces thermal stresses within the joining zone.

  8. Metal concentration and antioxidant activity of edible mushrooms from Turkey.

    PubMed

    Sarikurkcu, Cengiz; Tepe, Bektas; Kocak, Mehmet Sefa; Uren, Mehmet Cemil

    2015-05-15

    This study presents information on the antioxidant activity and heavy metal concentrations of Polyporus sulphureus, Macrolepiota procera, Lycoperdon perlatum and Gomphus clavatus mushrooms collected from the province of Mugla in the South-Aegean Region of Turkey. Antioxidant activities of mushroom samples were evaluated by four complementary tests. All tests showed L. perlatum and G. clavatus to possess extremely high antioxidant potential. Antioxidant activity of the samples was strongly correlated with total phenolic-flavonoid content. In terms of heavy metal content, L. perlatum exceeded the legal limits for daily intake of Pb, Fe, Mn, Cr, Ni and Co contents (0.461, 738.00, 14.52, 1.27, 1.65, 0.417 mg/day, respectively) by a 60-kg consumer. Co contents of M. procera (0.026 mg/day) and P. sulphureus (0.030 mg/day) and Cd contents of G. clavatus (0.071 mg/day) were also above the legal limits. According to these results, L. perlatum should not be consumed, despite the potentially beneficial antioxidant activity. Additionally, M. procera and G. clavatus should not be consumed daily due to their high levels of Cd and Co.

  9. An active metallic nanomatryushka with two similar super-resonances

    SciTech Connect

    Wu, D. J.; Cheng, Y.; Wu, X. W.; Liu, X. J.

    2014-07-07

    The optical properties of a simple metallic nanomatryushka (nanosphere-in-a-nanoshell) with gain have been investigated theoretically. The spaser (surface plasmon amplification by stimulated emission of radiation) phenomena can be observed at two critical wavelengths in the active metallic nanomatryushkas. With increasing the gain coefficient of the middle layer, a similar super surface plasmon (SP) resonance is first found at the ω₋⁺|₁ mode of the active nanoparticles and then breaks down. With further increasing the gain coefficient, another similar super-resonance occurs at the ω₋⁻|₁ mode. The near-field enhancements in the active nanomatryushkas also have been greatly amplified at the critical wavelengths for ω₋⁺|₊ and ω₋⁻|₁ modes. It is further found that the amplifications of SPs in the active Ag–SiO₂–Au nanoshell are strongest in four kinds of nanoshells and hence the largest near fields. The giant near-field enhancement can greatly enhance the Raman excitation and emission.

  10. Reactivity of high-valent iron-oxo species in enzymes and synthetic reagents: a tale of many states.

    PubMed

    Shaik, Sason; Hirao, Hajime; Kumar, Devesh

    2007-07-01

    The Account discusses the phenomenon of two-state reactivity (TSR) or multistate reactivity (MSR) in high-valent metal-oxo reagents, projecting its wide-ranging applicability starting from the bare species, through the reagents made by Que, Nam, and collaborators, to the Mn(V)-oxo substituted polyoxometalate, all the way to Compound I species of heme enzymes. The Account shows how the behaviors of all these variegated species derive from a simple set of electronic structure principles. Experimental trends that demonstrate TSR and MSR are discussed. Diagnostic mechanistic probes are proposed for the TSR/MSR scenario, based on kinetic isotope effect, stereochemical studies, and magnetic- and electric-field effects. PMID:17488054

  11. Structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae

    PubMed Central

    Michalska, Karolina; Cuff, Marianne E.; Tesar, Christine; Feldmann, Brian; Joachimiak, Andrzej

    2011-01-01

    In most organisms, efficient d-galactose utilization requires the highly conserved Leloir pathway that converts d-galactose to d-glucose 1-phosphate. However, in some bacterial and fungal species alternative routes of d-galactose assimilation have been identified. In the so-called De Ley–Doudoroff pathway, d-galactose is metabolized into pyruvate and d-­glyceraldehyde 3-phosphate in five consecutive reactions carried out by specific enzymes. The penultimate step in this pathway involves the phosphorylation of 2-oxo-3-deoxygalactonate to 2-oxo-3-deoxygalactonate 6-phosphate catalyzed by 2-­oxo-3-deoxygalactonate kinase, with ATP serving as a phosphoryl-group donor. Here, a crystal structure of 2-oxo-3-deoxygalactonate kinase from Klebsiella pneumoniae determined at 2.1 Å resolution is reported, the first structure of an enzyme from the De Ley–Doudoroff pathway. Structural comparison indicates that the enzyme belongs to the ASKHA (acetate and sugar kinases/hsc70/actin) family of phosphotransferases. The protein is composed of two α/β domains, each of which contains a core common to all family members. Additional elements introduced between conserved structural motifs define the unique features of 2-oxo-3-deoxygalactonate kinase and possibly determine the biological function of the protein. PMID:21795809

  12. Theoretical investigation on the mechanism and dynamics of oxo exchange of neptunyl(VI) hydroxide in aqueous solution.

    PubMed

    Yang, Xia; Chai, Zhifang; Wang, Dongqi

    2015-03-21

    Four types of reaction mechanisms for the oxo ligand exchange of monomeric and dimeric neptunyl(VI) hydroxide in aqueous solution were explored computationally using density functional theory (DFT) and ab initio classical molecular dynamics. The obtained results were compared with previous studies on the oxo exchange of uranyl hydroxide, as well as with experiments. It is found that the stable T-shaped [NpO3(OH)3](3-) intermediate is a key species for oxo exchange in the proton transfer in mononuclear Path I and binuclear Path IV, similar to the case of uranyl(VI) hydroxide. Path I is thought to be the preferred oxo exchange mechanism for neptunyl(VI) hydroxide in our calculations, due to the lower activation energy (22.7 and 13.1 kcal mol(-1) for ΔG(‡) and ΔH(‡), respectively) of the overall reaction. Path II via a cis-neptunyl structure assisted by a water molecule might be a competitive channel against Path I with a mononuclear mechanism, owing to a rapid dynamical process occurring in Path II. In Path IV with the binuclear mechanism, oxo exchange is accomplished via the interaction between [NpO2(OH)4](2-) and T-shaped [NpO3(OH)3](3-) with a low activation energy for the rate-determining step, however, the overall energy required to fulfill the reaction is slightly higher than that in mononuclear Path I, suggesting a possible binuclear process in the higher energy region. The chemical bonding evolution along the reaction pathways was discussed by using topological methodologies of the electron localization function (ELF).

  13. Design and discovery of 5-hydroxy-6-oxo-1,6-dihydropyrimidine-4-carboxamide inhibitors of HIV-1 integrase.

    PubMed

    Zhang, Daoguang; Debnath, Bikash; Yu, Shenghui; Sanchez, Tino Wilson; Christ, Frauke; Liu, Yang; Debyser, Zeger; Neamati, Nouri; Zhao, Guisen

    2014-10-01

    Raltegravir (RAL) is a first clinically approved integrase (IN) inhibitor for the treatment of HIV but rapid mutation of the virus has led to chemo-resistant strains. Therefore, there is a medical need to develop new IN inhibitors to overcome drug resistance. At present, several IN inhibitors are in different phases of clinical trials and few have been discontinued due to toxicity and lack of efficacy. The development of potent second-generation IN inhibitors with improved safety profiles is key for selecting new clinical candidates. In this article, we report the design and synthesis of potent 5-hydroxy-6-oxo-1,6-dihydropyrimidine-4-carboxamide analogues as second-generation IN inhibitors. These compounds satisfy two structural requirements known for potent inhibition of HIV-1 IN catalysis: a metal chelating moiety and a hydrophobic functionality necessary for selectivity against the strand transfer reaction. Most of the new compounds described herein are potent and selective for the strand transfer reaction and show antiviral activity in cell-based assays. Furthermore, this class of compounds are drug-like and suitable for further optimization and preclinical studies.

  14. Interaction of metallic clusters with biologically active curcumin molecules

    NASA Astrophysics Data System (ADS)

    Gupta, Sanjeev K.; He, Haiying; Liu, Chunhui; Dutta, Ranu; Pandey, Ravindra

    2015-09-01

    We have investigated the interaction of subnano metallic Gd and Au clusters with curcumin, an important biomolecule having pharmacological activity. Gd clusters show different site preference to curcumin and much stronger interaction strength, in support of the successful synthesis of highly stable curcumin-coated Gd nanoparticles as reported recently. It can be attributed to significant charge transfer from the Gd cluster to curcumin together with a relatively strong hybridization of the Gd df-orbitals with curcumin p-orbitals. These results suggest that Gd nanoparticles can effectively be used as delivery carriers for curcumin at the cellular level for therapy and medical imaging applications.

  15. Immunologically active metallic ion-containing polysaccharides of Achyrocline satureioides.

    PubMed

    Puhlmann, J; Knaus, U; Tubaro, L; Schaefer, W; Wagner, H

    1992-08-01

    Two homogeneous, metallic ion-containing pectic polysaccharides with mean M(r)s of 7600 and 15,000 were isolated from dried aerial parts of Achyrocline satureioides by anion exchange column chromatography on DEAE-Sepharose CL-6B and gel filtration column chromatography on Fractogel TSK HW-50 (S). The structures, as determined by methylation analysis, carboxyl reduction, and partial acid hydrolysis, were shown to be rhamnogalacturonans. Both pectins show a pronounced anticomplementary effect in vitro. The larger carbohydrate AS 4 of higher M(r) exerts anti-inflammatory activity and a strong enhancement of phagocytosis in vivo.

  16. Fragrance material review on methyl hexyl oxo cyclopentanone carboxylate.

    PubMed

    Scognamiglio, J; Jones, L; Letizia, C S; Api, A M

    2012-10-01

    A toxicologic and dermatologic review of methyl hexyl oxo cyclopentanone carboxylate when used as a fragrance ingredient is presented. Methyl hexyl oxo cyclopentanone carboxylate is a member of the fragrance structural group ketones cyclopentanones and cyclopentenones. The common characteristic structural element of the group members is a cyclopentanone or cyclopentenone ring with a straight or branched chain alkane or alkene substituent. This review contains a detailed summary of all available toxicology and dermatology papers that are related to this individual fragrance ingredient and is not intended as a stand-alone document. Available data for methyl hexyl oxo cyclopentanone carboxylate were evaluated then summarized and includes physical properties, acute toxicity, skin irritation, skin sensitization, and genotoxicity data. A safety assessment of the entire ketones cyclopentanones and cyclopentenones will be published simultaneously with this document; please refer to Belsito et al. (this issue) for an overall assessment of the safe use of this material and all ketones cyclopentanones and cyclopentenones in fragrances.

  17. Development of structure-activity relationship for metal oxide nanoparticles

    NASA Astrophysics Data System (ADS)

    Liu, Rong; Zhang, Hai Yuan; Ji, Zhao Xia; Rallo, Robert; Xia, Tian; Chang, Chong Hyun; Nel, Andre; Cohen, Yoram

    2013-05-01

    Nanomaterial structure-activity relationships (nano-SARs) for metal oxide nanoparticles (NPs) toxicity were investigated using metrics based on dose-response analysis and consensus self-organizing map clustering. The NP cellular toxicity dataset included toxicity profiles consisting of seven different assays for human bronchial epithelial (BEAS-2B) and murine myeloid (RAW 264.7) cells, over a concentration range of 0.39-100 mg L-1 and exposure time up to 24 h, for twenty-four different metal oxide NPs. Various nano-SAR building models were evaluated, based on an initial pool of thirty NP descriptors. The conduction band energy and ionic index (often correlated with the hydration enthalpy) were identified as suitable NP descriptors that are consistent with suggested toxicity mechanisms for metal oxide NPs and metal ions. The best performing nano-SAR with the above two descriptors, built with support vector machine (SVM) model and of validated robustness, had a balanced classification accuracy of ~94%. An applicability domain for the present data was established with a reasonable confidence level of 80%. Given the potential role of nano-SARs in decision making, regarding the environmental impact of NPs, the class probabilities provided by the SVM nano-SAR enabled the construction of decision boundaries with respect to toxicity classification under different acceptance levels of false negative relative to false positive predictions.Nanomaterial structure-activity relationships (nano-SARs) for metal oxide nanoparticles (NPs) toxicity were investigated using metrics based on dose-response analysis and consensus self-organizing map clustering. The NP cellular toxicity dataset included toxicity profiles consisting of seven different assays for human bronchial epithelial (BEAS-2B) and murine myeloid (RAW 264.7) cells, over a concentration range of 0.39-100 mg L-1 and exposure time up to 24 h, for twenty-four different metal oxide NPs. Various nano-SAR building models were

  18. Reductions of nitro and 9-Oxo groups of environmental nitrofluorenes by the rat mammary gland in vitro.

    PubMed

    Ritter, C L; Decker, R W; Malejka-Giganti, D

    2000-08-01

    Nitrofluorenes and C-9-oxidized nitrofluorenes are widespread environmental genotoxins which may be relevant for breast cancer on the basis of their carcinogenicities, particularly of 2, 7-dinitrofluorene (2,7-diNF), for the rat mammary gland. Since their metabolism to active carcinogens may involve nitroreduction, this study examined the reduction of 2-nitrofluorene (2-NF) and 2,7-diNF and their 9-oxo- and 9-hydroxy (OH) derivatives by the rat mammary gland. Cytosolic fractions catalyze NADH- and NADPH-dependent reductions of the 2-nitro and 9-oxo to the respective 2-amino and 9-OH compounds at rates 4- and >/=10-fold greater than those with microsomes. Rates of amine formation catalyzed by cytosol from 2, 7-diNF are greater than the rate from 2-NF and increase for C-9-oxidized derivatives: 9-oxo-2-NF > 9-OH-2-NF > 2-NF and 9-OH-2, 7-diNF > 9-oxo-2,7-diNF > 2,7-diNF. Nitroreduction is inhibited by O(2) or allopurinol (20 microM), dicoumarol (100 microM), and rutin (50 microM). 9-Oxoreduction is inhibited by rutin, dicoumarol, and indomethacin (100 microM), but not by O(2) or allopurinol. Pyrazole or menadione does not inhibit nitro or 9-oxoreduction. Xanthine, hypoxanthine, 2-hydroxypyrimidine, and N'-methylnicotinamide support cytosol-catalyzed nitro, but not 9-oxo, reduction. The data suggest that the nitroreduction is catalyzed largely by a xanthine oxidase and partially by a diaphorase and 9-oxoreduction by a carbonyl reductase. The extents of the nitro and carbonyl reductions of the nitrofluorenes may determine their reactivities with DNA, and thus genotoxicities for the mammary gland. PMID:10956068

  19. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting...

  20. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting...

  1. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting...

  2. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting...

  3. 40 CFR 721.430 - Oxo-substituted amino-al-kanoic acid derivative.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Oxo-substituted amino-al-kanoic acid... Specific Chemical Substances § 721.430 Oxo-substituted amino-al-kanoic acid derivative. (a) Chemical... as oxo-substituted amino al-kan-oic acid derivative (PMN No. P-92-692) is subject to reporting...

  4. Water-Soluble Pentagonal-Prismatic Titanium-Oxo Clusters.

    PubMed

    Zhang, Guanyun; Liu, Caiyun; Long, De-Liang; Cronin, Leroy; Tung, Chen-Ho; Wang, Yifeng

    2016-09-01

    By using solubility control to crystallize the prenucleation clusters of hydrosol, a family of titanium-oxo clusters possessing the {Ti18O27} core in which the 18 Ti(IV)-ions are uniquely connected with μ-oxo ligands into a triple-decked pentagonal prism was obtained. The cluster cores are wrapped by external sulfate and aqua ligands, showing good solubilities and stabilities in a variety of solvents including acetonitrile and water and allowing their solution chemistry being studied by means of electrospray ionization mass spectroscopy, (17)O NMR, and vibrational spectroscopy. Furthermore, this study provides new titanium oxide candidates for surface modifications and homogeneous photocatalysis. PMID:27525444

  5. Redox-Active Metal-Organic Frameworks: Highly Stable Charge-Separated States through Strut/Guest-to-Strut Electron Transfer.

    PubMed

    Sikdar, Nivedita; Jayaramulu, Kolleboyina; Kiran, Venkayala; Rao, K Venkata; Sampath, Srinivasan; George, Subi J; Maji, Tapas Kumar

    2015-08-10

    Molecular organization of donor and acceptor chromophores in self-assembled materials is of paramount interest in the field of photovoltaics or mimicry of natural light-harvesting systems. With this in mind, a redox-active porous interpenetrated metal-organic framework (MOF), {[Cd(bpdc)(bpNDI)]⋅4.5 H2 O⋅DMF}n (1) has been constructed from a mixed chromophoric system. The μ-oxo-bridged secondary building unit, {Cd2 (μ-OCO)2 }, guides the parallel alignment of bpNDI (N,N'-di(4-pyridyl)-1,4,5,8-naphthalenediimide) acceptor linkers, which are tethered with bpdc (bpdcH2 =4,4'-biphenyldicarboxylic acid) linkers of another entangled net in the framework, resulting in photochromic behaviour through inter-net electron transfer. Encapsulation of electron-donating aromatic molecules in the electron-deficient channels of 1 leads to a perfect donor-acceptor co-facial organization, resulting in long-lived charge-separated states of bpNDI. Furthermore, 1 and guest encapsulated species are characterised through electrochemical studies for understanding of their redox properties. PMID:26206156

  6. Nicotine-modulated formation of spiroiminodihydantoin nucleoside via 8-oxo-7,8-dihydro-2'-deoxyguanosine in 2'-deoxyguanosine-hypochlorous acid reaction.

    PubMed

    Suzuki, Toshinori; Ohshima, Hiroshi

    2002-04-10

    Hypochlorous acid (HOCl) is generated by myeloperoxidase of activated neutrophils which kill invading microorganisms, but also cause DNA damage in inflamed tissues. We report here that spiroiminodihydantoin nucleoside (dS), a further oxidized product of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dG), is formed, in addition to 8-chloro-2'-deoxyguanosine and 8-oxo-dG, by reaction of 2'-deoxyguanosine with HOCl. Presence of low concentrations of nicotine significantly enhanced the yields of these HOCl-modified nucleosides. Our results imply that nicotine may enhance genotoxicity and tissue damage caused by neutrophil activation. dS may also serve as a new biomarker for oxidative DNA damage induced by oxidants such as HOCl. PMID:11959105

  7. Metal complexes of ONO donor Schiff base ligand as a new class of bioactive compounds; Synthesis, characterization and biological evolution

    NASA Astrophysics Data System (ADS)

    Kumar Naik, K. H.; Selvaraj, S.; Naik, Nagaraja

    2014-10-01

    Present work reviews that, the synthesis of (E)-N";-((7-hydroxy-4-methyl-2-oxo-2H-chromen-8-yl)methylene)benzohydrazide [L] ligand and their metal complexes. The colored complexes were prepared of type [M2+L]X2, where M2+ = Mn, Co, Ni, Cu, Sr and Cd, L = (7-hydroxy-4-methyl-2-oxo-2H-chromen-8-yl)methylene)benzohydrazide, X = Cl-. Ligand derived from the condensation of 8-formyl-7-hydroxy-4-methylcoumarin and benzohydrazide in the molar ratio 1:1 and in the molar ratio 1:2 for metal complexes have been prepared. The chelation of the ligand to metal ions occurs through the both oxygen groups, as well as the nitrogen atoms of the azomethine group of the ligand. Reactions of the Schiff base ligand with Manganese(II), Cobalt(II), Nickel(II), Copper(II), Strontium(II), and Cadmium(II) afforded the corresponding metal complexes. The structures of the obtained ligand and their respective metal complexes were elucidated by infra-red, elemental analysis, Double beam UV-visible spectra, conductometric measurements, magnetic susceptibility measurements and also thermochemical studies. The metal complex exhibits octahedral coordination geometrical arrangement. Schiff base ligand and their metal complexes were tested against antioxidants, antidiabetic and antimicrobial activities have been studied. The Schiff base metal complexes emerges effective α-glucosidase inhibitory activity than free Schiff base ligand.

  8. Metal complexes of ONO donor Schiff base ligand as a new class of bioactive compounds: synthesis, characterization and biological evolution.

    PubMed

    Kumar Naik, K H; Selvaraj, S; Naik, Nagaraja

    2014-10-15

    Present work reviews that, the synthesis of (E)-N'-((7-hydroxy-4-methyl-2-oxo-2H-chromen-8-yl)methylene)benzohydrazide [L] ligand and their metal complexes. The colored complexes were prepared of type [M(2+)L]X2, where M(2+)=Mn, Co, Ni, Cu, Sr and Cd, L=(7-hydroxy-4-methyl-2-oxo-2H-chromen-8-yl)methylene)benzohydrazide, X=Cl(-). Ligand derived from the condensation of 8-formyl-7-hydroxy-4-methylcoumarin and benzohydrazide in the molar ratio 1:1 and in the molar ratio 1:2 for metal complexes have been prepared. The chelation of the ligand to metal ions occurs through the both oxygen groups, as well as the nitrogen atoms of the azomethine group of the ligand. Reactions of the Schiff base ligand with Manganese(II), Cobalt(II), Nickel(II), Copper(II), Strontium(II), and Cadmium(II) afforded the corresponding metal complexes. The structures of the obtained ligand and their respective metal complexes were elucidated by infra-red, elemental analysis, Double beam UV-visible spectra, conductometric measurements, magnetic susceptibility measurements and also thermochemical studies. The metal complex exhibits octahedral coordination geometrical arrangement. Schiff base ligand and their metal complexes were tested against antioxidants, antidiabetic and antimicrobial activities have been studied. The Schiff base metal complexes emerges effective α-glucosidase inhibitory activity than free Schiff base ligand.

  9. Entangled Electrons Foil Synthesis of Elusive Low-Valent Vanadium Oxo Complex.

    PubMed

    Schlimgen, Anthony W; Heaps, Charles W; Mazziotti, David A

    2016-02-18

    We examine the recently reported first synthesis of the elusive low-valent vanadium(III) in a vanadium oxo complex with a computation representing 10(21) quantum degrees of freedom. While this computation is intractable with a conventionally constructed wave function, it is performed here by a direct calculation of the system's two-electron reduced density matrix (2-RDM), where the 2-RDM is constrained by nontrivial conditions, known as N-representability conditions, that restrict the 2-RDM to represent an N electron quantum system. We show that the added (reducing) electron becomes entangled among the five pyridine ligands. While smaller calculations predict a metal-centered addition, large-scale 2-RDM calculations show that quantum entanglement redirects the electron transfer to the pyridine ligands, resulting in a ligand-centered addition. Beyond its implications for the synthesis of low-valent vanadium oxo complexes, the result suggests new possibilities for using quantum entanglement to predict and control electron transfer in chemical and biological materials.

  10. Recognition and excision properties of 8-halogenated-7-deaza-2'-deoxyguanosine as 8-oxo-2'-deoxyguanosine analogues and Fpg and hOGG1 inhibitors.

    PubMed

    Yin, Yizhen; Sasaki, Shigeki; Taniguchi, Yosuke

    2015-05-26

    Cellular DNA continuously suffers various types of damage, and unrepaired damage increases disease progression risk. 8-Oxo-2'-deoxyguanine (8-oxo-dG) is excised by repair enzymes, and their analogues are of interest as inhibitors and as bioprobes for study of these enzymes. We have developed 8-halogenated-7-deaza-2'-deoxyguanosine derivatives that resemble 8-oxo-dG in that they adopt the syn conformation. In this study, we investigated their effects on Fpg (formamidopyrimidine DNA glycosylase) and hOGG1 (human 8-oxoguanine DNA N-glycosylase 1). Relative to 8-oxo-dG, Cl- and Br-deaza-dG were good substrates for Fpg, whereas they were less efficient substrates for hOGG1. Kinetics and binding experiments indicated that, although hOGG1 effectively binds Cl- and Br-deaza-dG analogues with low Km values, their lower kcat values result in low glycosylase activities. The benefits of the high binding affinities and low reactivities of 8-oxo-dG analogues with hOGG1 have been successfully applied to the competitive inhibition of the excision of 8-oxoguanine from duplex DNA by hOGG1.

  11. Structural and mechanistic aspects of Mn-oxo and co-based compounds in water oxidation catalysis and potential applications in solar fuel production.

    PubMed

    Hou, Harvey J M

    2010-08-01

    To address the issues of energy crisis and global warming, novel renewable carbon-free or carbon-neutral energy sources must be identified and developed. A deeper understanding of photosynthesis is the key to provide a solid foundation to facilitate this transformation. To mimic the water oxidation of photosystem II oxygen evolving complex, Mn-oxo complexes and Co-phosphate catalytic material were discovered in solar energy storage. Building on these discoveries, recent advances in solar energy conversion showed a compelling working principle by combing the active Mn-oxo and Co-based catalysts in water splitting with semiconductor hetero-nanostructures for effective solar energy harnessing. In this review the appealing systems including Mn-oxo tetramer/Nafion, Mn-oxo dimer/TiO(2), Mn-oxo oligomer/WO(3), Co-Pi/Fe(2)O(3), and Co-Pi/ZnO are summarized and discussed. These accomplishments offer a promising framework and have a profound impact in the field of solar fuel production. PMID:20666926

  12. Structural and mechanistic aspects of Mn-oxo and co-based compounds in water oxidation catalysis and potential applications in solar fuel production.

    PubMed

    Hou, Harvey J M

    2010-08-01

    To address the issues of energy crisis and global warming, novel renewable carbon-free or carbon-neutral energy sources must be identified and developed. A deeper understanding of photosynthesis is the key to provide a solid foundation to facilitate this transformation. To mimic the water oxidation of photosystem II oxygen evolving complex, Mn-oxo complexes and Co-phosphate catalytic material were discovered in solar energy storage. Building on these discoveries, recent advances in solar energy conversion showed a compelling working principle by combing the active Mn-oxo and Co-based catalysts in water splitting with semiconductor hetero-nanostructures for effective solar energy harnessing. In this review the appealing systems including Mn-oxo tetramer/Nafion, Mn-oxo dimer/TiO(2), Mn-oxo oligomer/WO(3), Co-Pi/Fe(2)O(3), and Co-Pi/ZnO are summarized and discussed. These accomplishments offer a promising framework and have a profound impact in the field of solar fuel production.

  13. Active-Site-Accessible, Porphyrinic Metal;#8722;Organic Framework Materials

    SciTech Connect

    Farha, Omar K.; Shultz, Abraham M.; Sarjeant, Amy A.; Nguyen, SonBinh T.; Hupp, Joseph T.

    2012-02-06

    On account of their structural similarity to cofactors found in many metallo-enzymes, metalloporphyrins are obvious potential building blocks for catalytically active, metal-organic framework (MOF) materials. While numerous porphyrin-based MOFs have already been described, versions featuring highly accessible active sites and permanent microporosity are remarkably scarce. Indeed, of the more than 70 previously reported porphyrinic MOFs, only one has been shown to be both permanently microporous and contain internally accessible active sites for chemical catalysis. Attempts to generalize the design approach used in this single successful case have failed. Reported here, however, is the synthesis of an extended family of MOFs that directly incorporate a variety of metalloporphyrins (specifically Al{sup 3+}, Zn{sup 2+}, Pd{sup 2+}, Mn{sup 3+}, and Fe{sup 3+} complexes). These robust porphyrinic materials (RPMs) feature large channels and readily accessible active sites. As an illustrative example, one of the manganese-containing RPMs is shown to be catalytically competent for the oxidation of alkenes and alkanes.

  14. Phytochelatin synthase activity as a marker of metal pollution.

    PubMed

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene

    2011-08-30

    The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO(3))(2) for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35°C for 30min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270fkat) in treated cells was more than seven times higher in comparison to control ones. K(m) for PCS was estimated as 2.3mM. PMID:21715087

  15. Antimicrobial activity of metal oxide nanoparticles supported onto natural clinoptilolite.

    PubMed

    Hrenovic, Jasna; Milenkovic, Jelena; Daneu, Nina; Kepcija, Renata Matonickin; Rajic, Nevenka

    2012-08-01

    The antimicrobial activity of Cu(2)O, ZnO and NiO nanoparticles supported onto natural clinoptilolite was investigated in the secondary effluent under dark conditions. After 24h of contact the Cu(2)O and ZnO nanoparticles reduced the numbers of viable bacterial cells of Escherichia coli and Staphylococcus aureus in pure culture for four to six orders of magnitude and showed consistent 100% of antibacterial activity against native E. coli after 1h of contact during 48 exposures. The antibacterial activity of NiO nanoparticles was less efficient. The Cu(2)O and NiO nanoparticles showed 100% of antiprotozoan activity against Paramecium caudatum and Euplotes affinis after 1h of contact, while ZnO nanoparticles were less efficient. The morphology and crystallinity of the nanoparticles were not affected by microorganisms. The metal oxide nanoparticles could find a novel application in the disinfection of secondary effluent and removal of pathogenic microorganisms in the tertiary stage of wastewater treatment.

  16. Wolves in Sheep's Clothing: μ-Oxo-Diiron Corroles Revisited.

    PubMed

    Ganguly, Sumit; Vazquez-Lima, Hugo; Ghosh, Abhik

    2016-07-18

    For well over 20 years, μ-oxo-diiron corroles, first reported by Vogel and co-workers in the form of μ-oxo-bis[(octaethylcorrolato)iron] (Mössbauer δ 0.02 mm s(-1) , ΔEQ 2.35 mm s(-1) ), have been thought of as comprising a pair antiferromagnetically coupled low-spin Fe(IV) centers. The remarkable stability of these complexes, which can be handled at room temperature and crystallographically analyzed, present a sharp contrast to the fleeting nature of enzymatic, iron(IV)-oxo intermediates. An array of experimental and theoretical methods have now shown that the iron centers in these complexes are not Fe(IV) but intermediate-spin Fe(III) coupled to a corrole(.2-) . The intramolecular spin couplings in {Fe[TPC]}2 (μ-O) were analyzed via DFT(B3LYP) calculations in terms of the Heisenberg-Dirac-van Vleck spin Hamiltonian H=JFe-corrole (SFe ⋅Scorrole )+JFe-Fe' (SFe ⋅SFe' )+JFe'-corrole (SFe' ⋅Scorrole' ), which yielded JFe-corrole =JFe'-corrole' =0.355 eV (2860 cm(-1) ) and JFe-Fe' =0.068 eV (548 cm(-1) ). The unexpected stability of μ-oxo-diiron corroles thus appears to be attributable to charge delocalization via ligand noninnocence. PMID:27333259

  17. Clickable 4-Oxo-β-lactam-Based Selective Probing for Human Neutrophil Elastase Related Proteomes.

    PubMed

    Ruivo, Eduardo F P; Gonçalves, Lídia M; Carvalho, Luís A R; Guedes, Rita C; Hofbauer, Stefan; Brito, José A; Archer, Margarida; Moreira, Rui; Lucas, Susana D

    2016-09-20

    Human neutrophil elastase (HNE) is a serine protease associated with several inflammatory processes such as chronic obstructive pulmonary disease (COPD). The precise involvement of HNE in COPD and other inflammatory disease mechanisms has yet to be clarified. Herein we report a copper-catalyzed alkyne-azide 1,3-dipolar cycloaddition (CuAAC, or 'click' chemistry) approach based on the 4-oxo-β-lactam warhead that yielded potent HNE inhibitors containing a triazole moiety. The resulting structure-activity relationships set the basis to develop fluorescent and biotinylated activity-based probes as tools for molecular functional analysis. Attaching the tags to the 4-oxo-β-lactam scaffold did not affect HNE inhibitory activity, as revealed by the IC50 values in the nanomolar range (56-118 nm) displayed by the probes. The nitrobenzoxadiazole (NBD)-based probe presented the best binding properties (ligand efficiency (LE)=0.31) combined with an excellent lipophilic ligand efficiency (LLE=4.7). Moreover, the probes showed adequate fluorescence properties, internalization in human neutrophils, and suitable detection of HNE in the presence of a large excess of cell lysate proteins. This allows the development of activity-based probes with promising applications in target validation and identification, as well as diagnostic tools. PMID:27465595

  18. Guanine-Specific Oxidation of Double-Stranded DNA by Cr(VI) and Ascorbic Acid Forms Spiroiminodihydantoin and 8-Oxo-2′-deoxyguanosine

    PubMed Central

    Slade, Peter G.; Hailer, M. Katie; Martin, Brooke D.; Sugden, Kent D.

    2005-01-01

    7,8-dihydro-8-oxoguanine (8-oxoG) is thought to be a major lesion formed in DNA by oxidative attack at the nucleobase guanine. Recent studies have shown that 8-oxoG has a lower reduction potential than the parent guanine and is a hot spot for further oxidation. Spiroiminodihydantoin (Sp) has been identified as one of these further oxidation products. Chromium(VI) is a human carcinogen that, when reduced by a cellular reductant such as ascorbate, can oxidize DNA. In this study, duplex DNA was reacted with Cr(VI) and ascorbate to identify and quantify the base lesions formed. Guanine bases were observed to be preferentially oxidized with 5′ guanines within purine repeats showing enhanced oxidation. Trapping of the guanine lesions by the base excision repair enzymes hOGG1 and mNEIL2 showed nearly exclusive trapping by mNEIL2, suggesting that 8-oxoG was not the major lesion but rather a lesion recognized by mNEIL2 such as Sp. Formation of the Sp lesion in the Cr(VI)/Asc oxidation reaction with DNA was confirmed by LC–ESI-MS detection. HPLC-ECD was used to identify and quantify any 8-oxoG arising from Cr(VI)/Asc oxidation of DNA. Concentrations of Cr(VI) (3.1–50 μM) with a corresponding 1:10 ratio of Asc oxidized between 0.3% and 1.5% of all guanines within the duplex DNA strand to Sp. 8-oxoG was also identified but with the highest Cr(VI) concentration converting ~0.1% of all guanines to 8-oxoG. These results show that Sp was present in concentrations ~20 times greater than that of 8-oxoG in this system. The results indicate that 8-oxoG, while present, was not the major product of Cr(VI)/Asc oxidation of DNA and that Sp predominates under these conditions. These results further imply that Sp may be the lesion that accounts for the carcinogenicity of this metal in cellular systems. PMID:16022506

  19. High-valent corrole metal complexes.

    PubMed

    Gross, Z

    2001-09-01

    This commentary concentrates on corrole complexes with the three metal ions that are most relevant to oxidation catalysis: chromium, manganese, and iron. Particular emphasis is devoted to the only recently introduced meso-triarylcorroles and a comparison with the traditionally investigated beta-pyrrole-substituted corroles. Based on a combination of spectroscopic methods, electrochemistry, and X-ray crystallography, it is concluded that in most high-valent metallocorroles the corrole is not oxidized. Both experimental (for (oxo)chromium(V) corrole) and computational (for (oxo)manganese(V) corrole) evidence indicate that the stabilization of high-valent metal ions by corroles originates from a combination of short metal-nitrogen bonds and large metal out-of-plane displacements in the corrole, which lead to quite unexpected interactions of the oxo-metal pi* orbitals with the in-plane orbitals of the corrole.

  20. Characterization and metal sorptive properties of oxidized active carbon.

    PubMed

    Strelko, Vladimir; Malik, Danish J

    2002-06-01

    A commercial activated carbon Chemviron F 400 has been oxidized using nitric acid in order to introduce a variety of acidic surface functional groups. Both unoxidized and oxidized carbon samples were characterized using nitrogen porosimetry, elemental analysis, pH titration, Boehm's titration, and electrophoretic mobility measurements. Results show that oxidation treatment reduced surface area and pore volume. However, the carbon surface acquires an acidic character with carboxylic groups being the dominant surface functional groups. The modified sample displays cation-exchange properties over a wide range of pH values and exhibits polyfunctional nature. Both carbon samples were challenged for the removal of transition metals such as copper(II), nickel(II), cobalt(II), zinc(II), and manganese(II). The affinity series Mn2+Zn2+ has been found to coincide with the general stability sequence of metal complexes (the Irving-Williams series). The higher preference displayed by carbons toward copper(II) is a consequence of the fact that copper(II) often forms distorted and more stable octahedral complexes. PMID:16290653

  1. Transition Metals Catalyzed Element-Cyano Bonds Activations

    PubMed Central

    Wang, Rui; Falck, John R.

    2014-01-01

    Cyano group as a versatile functionalized intermediate has been explored for several decades, as it readily transfers to many useful functionalization groups such as amine, amide, acid, etc., which make it possess high popularization and use value in organic synthesis. Reactions involved with element-cyano bond cleavage can provide not only a new cyano group but also a freshly functionalized skeleton in one-pot, consequently making it of high importance. The highlights reviewed herein include H-CN, Si-CN, C-CN, B-CN, Sn-CN, Ge-CN, S-CN, Halo-CN, N-CN, and O-CN bonds cleavages and will summarize progress in such an important research area. This review article will focus on transition metal catalyzed reactions involving element-cyano bond activation. PMID:25558119

  2. Frustrated Lewis pairs: metal-free hydrogen activation and more.

    PubMed

    Stephan, Douglas W; Erker, Gerhard

    2010-01-01

    Sterically encumbered Lewis acid and Lewis base combinations do not undergo the ubiquitous neutralization reaction to form "classical" Lewis acid/Lewis base adducts. Rather, both the unquenched Lewis acidity and basicity of such sterically "frustrated Lewis pairs (FLPs)" is available to carry out unusual reactions. Typical examples of frustrated Lewis pairs are inter- or intramolecular combinations of bulky phosphines or amines with strongly electrophilic RB(C(6)F(5))(2) components. Many examples of such frustrated Lewis pairs are able to cleave dihydrogen heterolytically. The resulting H(+)/H(-) pairs (stabilized for example, in the form of the respective phosphonium cation/hydridoborate anion salts) serve as active metal-free catalysts for the hydrogenation of, for example, bulky imines, enamines, or enol ethers. Frustrated Lewis pairs also react with alkenes, aldehydes, and a variety of other small molecules, including carbon dioxide, in cooperative three-component reactions, offering new strategies for synthetic chemistry. PMID:20025001

  3. Transition metal bimetallic oxycarbides: Synthesis, characterization, and activity studies

    SciTech Connect

    Oyama, S.T.; Yu, C.C.; Ramanathan, S.

    1999-06-10

    A new family of bimetallic oxycarbide compounds M{sup I}-M{sup II}-O-C (M{sup I} = Mo, W; M{sup II} = V, Nb, Cr, Fe, Co, Ni) has been synthesized by carburizing bimetallic oxide precursors using a temperature-programmed method. The oxide precursors are prepared by conventional solid-state reaction between two appropriate monometallic oxides. The synthesis involves passing a 20 mol% CH{sub 4} in H{sub 2} mixture over the oxide precursors while raising the temperature at a linear rate of 8.3 {times} 10{sup {minus}2} K/s (5 K/min) to a final temperature (T{sub max}) which is held for a period of time (t{sub hold}). The synthesis, chemisorption properties, and reactivation of the materials indicate that the compounds can be divided into two groups of different reducibility (high and low). Their surface activity and surface area are evaluated based on CO chemisorption and N{sub 2} physisorption measurements. It is found that the CO number density correlates with the reducibility of the compounds. The catalysts were evaluated for hydroprocessing in a three-phase trickle-bed reactor operated at 3.1 MPa and 643 K. The feed was a model liquid mixture containing 3000 ppm sulfur (dibenzothiophene), 2000 ppm nitrogen (quinoline), 500 ppm oxygen (benzofuran), 20 wt% aromatics (tetralin), and balance aliphatics (tetradecane). The bimetallic oxycarbides had moderate activity for HDN of quinoline, with Nb-Mo-O-C showing higher HDN than a commercial sulfided Ni-Mo/Al{sub 2}O{sub 3} catalyst tested at the same conditions. X-ray diffraction of the spent catalysts indicated that the oxycarbides of the early transition metals were tolerant of sulfur, while those involving the late transition metals showed bulk sulfide phases.

  4. Cupryphans, metal-binding, redox-active, redesigned conopeptides

    PubMed Central

    Barba, Marco; Sobolev, Anatoli P; Romeo, Cristina; Schininà, M Eugenia; Pietraforte, Donatella; Mannina, Luisa; Musci, Giovanni; Polticelli, Fabio

    2009-01-01

    Contryphans are bioactive peptides, isolated from the venom of marine snails of the genus Conus, which are characterized by the short length of the polypeptide chain and the high degree of unusual post-translational modifications. The cyclization of the polypeptide chain through a single disulphide bond, the presence of two conserved Pro residues, and the epimerization of a Trp/Leu residue confer to Contryphans a stable and well-defined structure in solution, conserved in all members of the family, and tolerant to multiple substitutions. The potential of Contryphans as scaffolds for the design of redox-active (macro)molecules was tested by engineering a copper-binding site on two different variants of the natural peptide Contryphan-Vn. The binding site was designed by computational modeling, and the redesigned peptides were synthesized and characterized by optical, fluorescence, electron spin resonance, and nuclear magnetic resonance spectroscopy. The novel peptides, named Cupryphan and Arg–Cupryphan, bind Cu2+ ions with a 1:1 stoichiometry and a Kd in the 100 nM range. Other divalent metals (e.g., Zn2+ and Mg2+) are bound with much lower affinity. In addition, Cupryphans catalyze the dismutation of superoxide anions with an activity comparable to other nonpeptidic superoxide dismutase mimics. We conclude that the Contryphan motif represents a natural robust scaffold which can be engineered to perform different functions, providing additional means for the design of catalytically active mini metalloproteins. PMID:19241383

  5. Resonant Metallic Nanostructures for Active Metamaterials and Photovoltaics

    NASA Astrophysics Data System (ADS)

    Pryce, Imogen Mary

    2011-07-01

    Electromagnetic metamaterials are composites consisting of sub-wavelength structures designed to exhibit particular responses to an incident electromagnetic wave. In general, the properties of a metamaterial are fixed at the time of fabrication by the dimensions of each unit cell and the materials used. By incorporating dynamic components to the metamaterial system, a new type of tunable design can be accessed. This thesis describes the design and development of resonant metallic nanostructures for use in active metamaterials. We begin by examining passive systems and introduce concepts that are critical for the design of more complex, tunable structures. We show how a simple metamaterial design, a plasmonic nanoparticle array, can be used to enhance the photocurrent of an ultrathin InGaN quantum well photovoltaic cell. We then explore how more complex resonator shapes can be coupled together in a single unit cell in order to access more complex resonant behavior. In the second half of this thesis, we use several material systems as the basis for the design of active metamaterials. We demonstrate the first tunable metamaterial at optical frequencies using vanadium dioxide, a phase transition material. We exploit this material's transition from a semiconducting to a metallic state and show how a novel fabrication scheme can be used to achieve a frequency tunable resonant response. We then abandon traditional hard and brittle substrates and develop a lithographic transfer process for adhering metallic nanostructures to highly compliant polymeric substrates. Mechanical deformation is then used to distort the resonator shapes and achieve resonant tunability of a full linewidth. This system is exploited to demonstrate interesting resonant hybridization phenomena, such as Fano resonance modulation, and sets the stage for the more elusive goal of driving two resonant nanostructures into contact. Finally, we describe the use of compliant tunable metamaterials as both

  6. Organocatalyzed enantioselective synthesis of 2-amino-5-oxo-5,6,7,8-tetrahydro-4H-chromene-3-carboxylates

    PubMed Central

    Ramireddy, Naresh; Abbaraju, Santhi; Zhao, Cong-Gui

    2011-01-01

    The organocatalyzed enantioselective synthesis of biologically active 2-amino-5-oxo-5,6,7,8-tetrahydro-4H-chromene-3-carboxylate derivatives was achieved using bifunctional cinchona alkaloids as the catalysts. Using quinine thiourea as the catalyst, the tandem Michael addition-cyclization reaction between 1,3-cyclohexanediones and alkylidenecyanoacetate derivatives gives the desired products in high yields (up to 92%) and good ee values (up to 82%). PMID:22081731

  7. Vitamin D3 analogs and their 24-oxo metabolites equally inhibit clonal proliferation of a variety of cancer cells but have differing molecular effects.

    PubMed

    Campbell, M J; Reddy, G S; Koeffler, H P

    1997-09-01

    The seco-steroid hormone, 1 alpha, 25 dihydroxyvitamin D3 (1 alpha,25(OH)2D3) binds to a specific nuclear receptor that acts as a ligand-inducible transcription factor. The resulting genomic effects include partial arrest in G0/G1 of the cell cycle and induction of differentiation; these effects have been observed in various types of cancer. Recently, we produced enzymatically the natural 24-oxo metabolites of 1 alpha,25(OH)2D3 and two of its potent synthetic analogs (1 alpha,25-(OH)2-16-ene-D3 and 1 alpha,25-(OH)2-20-epi-D3) using a rat kidney perfusion system. We have found that the 24-oxo metabolites of both 1 alpha,25(OH)2D3 and its analogs have either the same or greater antiproliferative activity against various cancer cells as their parental compounds. Notably, two cell lines (DU-145 (prostate cancer) and MDA-MB-436 [breast cancer]) that were extremely resistant to the antiproliferative effects of vitamin D3 analogs displayed greater sensitivity towards the 24-oxo metabolite of the vitamin D3 analog. Similarly, the 24-oxo metabolites had the capacity to induce differentiation and apoptosis and to diminish the proportion of cells in S phase. Most interestingly, while the analog 1 alpha,25(OH)2-20-epi-D3 induced expression of BRCA1 in MCF-7 breast cancer cells; its 24-oxo metabolite dramatically suppressed BRAC1 expression. Thus, we have shown for the first time that the various biological activities produced by the hormone 1 alpha,25(OH)2D3 and some of its analogs may represent a combination of actions by the hormone 1 alpha,25(OH)2D3 and its natural 24-oxo metabolites.

  8. Synthesis, characterization, DNA interactions, DNA cleavage, radical scavenging activity, antibacterial, anti-proliferative and docking studies of new transition metal complexes.

    PubMed

    Chennam, Kishan Prasad; Ravi, Mudavath; Ushaiah, B; Srinu, V; Eslavath, Ravi Kumar; Devi, Ch Sarala

    2016-01-01

    The compound N-(2-hydroxybenzylidene)-1-ethyl-1, 4-dihydro-7-methyl-4-oxo-1, 8 naphthyridine-3-carbohydrazide (LH) and its Cu (II), Co (II) and Zn (II) complexes were synthesized and characterized. The absorption spectral titrations and competitive DNA binding studies depicted those complexes of title compound bind to CT-DNA through intercalation. Interestingly [Cu (II)-(L2)] showed relatively high binding constant value (6.61 x 10(5) M(-1)) compared to [Co (II)-(L2)] (4.378× 10(5) M(-1)) and [Zn (II)-(L2)] (3.1x10(5) M(-1)). Ligand and its complexes were also examined for DNA nuclease activity against pBR-322 plasmid DNA, which showed that [Cu (II)-(L2)] had the best hydrolytic cleavage property displaying prominent double-strand DNA cleavage. In addition, antioxidant activities of the ligand and its metal complexes investigated through scavenging effects for DPPH radical in- vitro, indicated their potentiality as good antioxidants. The in vitro anti-bacterial study inferred the better anti-bacterial activity of [Cu (II)-(L2)] and this was also correlated theoretically by employing docking studies wherein [Cu (II)-(L2)] displayed good Gold score and Chem score. Finally the in vitro anti- proliferative activity of studied compounds was tested against HeLa and MCF-7 cell lines. Interestingly [Cu (II)-(L2)] displayed lower IC50 value and lower percentage of viability in both HeLa and MCF-7 cell lines.

  9. Highly active gold-based catalyst for the reaction of benzaldehyde with ethyl diazoacetate.

    PubMed

    Fructos, Manuel R; Díaz-Requejo, M Mar; Pérez, Pedro J

    2009-09-14

    The gold complex [IPrAu(NCMe)]BF(4) catalyzes the reaction of ethyl diazoacetate with benzaldehyde to give mixtures of ethyl 3-oxo-3-phenylpropanoate and ethyl 3-hydroxy-2-phenylacrylate in the first example of a group 11 metal-based catalyst for this transformation; the catalyst activity is improved by a factor of 2500 compared to those of previously reported iron-based catalysts.

  10. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  11. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  12. Synthesis of cobalt stearate as oxidant additive for oxo-biodegradable polyethylene

    NASA Astrophysics Data System (ADS)

    Asriza, Ristika O.; Arcana, I. Made

    2015-09-01

    Cobalt stearate is an oxidant additives that can initiate a process of degradation in high density polyethylene (HDPE). To determine the effect of cobalt stearate in HDPE, oxo-biodegradable polyethylene film was given an irradiation with UV light or heating at various temperature. After given a heating, the FTIR spectra showed a new absorption peak at wave number 1712 cm-1 indicating the presence of carbonyl groups in polymers, whereas after irradiation with UV light is not visible the presence of this absorption peak. The increase concentration of cobalt stearate added in HDPE and the higher heating temperature, the intensity of the absorption peak of the carbonyl group increased. The increasing intensity of the carbonyl group absorption is caused the presence of damage in the film surface after heating, and this result is supported by analysis the surface properties of the film with using SEM. Biodegradation tests were performed on oxo-biodegradable polyethylene film which has been given heating or UV light with using activated sludge under optimal conditions the growth of microorganisms. After biodegradation, the maximum weight decreased by 23% in the oxo-biodegradable polyethylene film with a cobalt stearate concentration of 0.2% and after heating at a temperature of 75 °C for 10 days, and only 0.69% in the same film after irradiation UV light for 10 days. Based on the results above, cobalt stearate additive is more effective to initiate the oxidative degradation of HDPE when it is initiated by heating compared to irradiation with UV light.

  13. Synthesis of cobalt stearate as oxidant additive for oxo-biodegradable polyethylene

    SciTech Connect

    Asriza, Ristika O.; Arcana, I Made

    2015-09-30

    Cobalt stearate is an oxidant additives that can initiate a process of degradation in high density polyethylene (HDPE). To determine the effect of cobalt stearate in HDPE, oxo-biodegradable polyethylene film was given an irradiation with UV light or heating at various temperature. After given a heating, the FTIR spectra showed a new absorption peak at wave number 1712 cm{sup −1} indicating the presence of carbonyl groups in polymers, whereas after irradiation with UV light is not visible the presence of this absorption peak. The increase concentration of cobalt stearate added in HDPE and the higher heating temperature, the intensity of the absorption peak of the carbonyl group increased. The increasing intensity of the carbonyl group absorption is caused the presence of damage in the film surface after heating, and this result is supported by analysis the surface properties of the film with using SEM. Biodegradation tests were performed on oxo-biodegradable polyethylene film which has been given heating or UV light with using activated sludge under optimal conditions the growth of microorganisms. After biodegradation, the maximum weight decreased by 23% in the oxo-biodegradable polyethylene film with a cobalt stearate concentration of 0.2% and after heating at a temperature of 75 °C for 10 days, and only 0.69% in the same film after irradiation UV light for 10 days. Based on the results above, cobalt stearate additive is more effective to initiate the oxidative degradation of HDPE when it is initiated by heating compared to irradiation with UV light.

  14. Redox interplay of oxo-thio-tungsten centers with sulfur-donor co-ligands.

    PubMed

    Thomas, Simon; Eagle, Aston A; Sproules, Stephen A; Hill, Jason P; White, Jonathan M; Tiekink, Edward R T; George, Graham N; Young, Charles G

    2003-09-22

    The oxo-thio-W(VI) complexes TpWOS(S(2)PR(2)-S) and TpWOS(pyS-S) (Tp = hydrotris(3,5-dimethylpyrazol-1-yl)borate, R = OEt, Ph; pyS = pyridine-2-thiolate) have been prepared and characterized by microanalytical, spectroscopic, and structural techniques. Crystals of the 1,2-dichloroethane hemisolvate of TpWOS(S(2)PPh(2)-S) belong to the triclinic space group Ponemacr; with a = 10.732(6) A, b = 16.91(1) A, c = 10.021(4) A, alpha = 104.40(4) degrees, beta = 107.52(3) degrees, gamma = 96.09(5) degrees, V = 1647(1) A(3) for Z = 2. The complex exhibits a distorted octahedral structure featuring a facial tridentate Tp ligand and mutually cis terminal oxo (W-O(1) = 1.712(7) A), terminal thio (W-S(1) = 2.162(3) A), and monodentate dithiophosphinate ligands. X-ray absorption and extended X-ray absorption fine structure results support a related oxo-thio formulation for TpWOS(pyS-S). The complexes are reduced to the corresponding oxo-thio-W(V) anions, [TpWOS(S(2)PR(2)-S)](-) and [TpWOS(pyS-S)](-), which exhibit highly anisotropic EPR spectra. They are oxidized to form the EPR-active (dithio)oxo-W(V) cations, [TpWO(S(3)PR(2)-S,S')](+) and [TpWO(pyS(2)-N,S)](+) (pyS(2) = pyridine-2-dithio). Green [TpWO(pyS(2)-N,S)]BF(4), formed in the reaction of TpWOS(pyS) and NOBF(4), has been isolated and spectroscopically and structurally characterized. Crystals of [TpWO(pyS(2)-N,S)]BF(4) belong to the monoclinic space group Cc with a = 16.007(5) A, b = 14.091(4) A, c = 13.608(4) A, beta = 124.525(4) degrees, V = 2528.8(13) A(3) for Z = 4. The cation exhibits a distorted octahedral structure featuring facial tridentate Tp, terminal oxo (W-O(1) = 1.632(12) A), and bidentate pyridine-2-dithio-N,S (W-S(1) = 2.317(7) A, S(1)-S(2) = 2.037(9) A) ligands. The structures and redox behavior of the complexes are compared and contrasted with those of the related molybdenum complexes, TpMo(VI)OS(S(2)PR(2)-S) and TpMo(IV)O(pyS(2)-N,S) (Hill, J. P.; Laughlin, L. J.; Gable, R. W.; Young, C. G. Inorg. Chem

  15. Synthesis and antitumor activity of 5-(5-halogenated-2-oxo-1H-pyrrolo[2,3-b]pyridin-(3Z)-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxamides.

    PubMed

    Wang, Minghua; Ye, Cheng; Liu, Mingliang; Wu, Zhaoyang; Li, Linhu; Wang, Chunlan; Liu, Xiujun; Guo, Huiyuan

    2015-07-15

    We report herein the design and synthesis of a series of novel 5-halogenated-7-azaindolin-2-one derivatives containing a 2,4-dimethylpyrrole moiety. Nine target compounds with ⩾70% inhibition against MCF-7 at 30 μM were further evaluated for their in vitro antitumor activity against seven human cancer cell lines by SRB assay. Results reveal that some compounds have potent antitumor activity, and the most active 13c7 (IC50s: 4.49-15.39 μM) was found to be more active than Sunitinib (IC50s: 4.70->30 μM) against all of the tested cancer cell lines.

  16. Thermally Induced Deformation in Metallic Glass: the Activations and Relaxations

    NASA Astrophysics Data System (ADS)

    Fan, Yue; Iwashita, Takuya; Egami, Takeshi

    2015-03-01

    Thermally induced deformation in metallic glasses was investigated by sampling the potential energy landscape (PEL) and probing the changes in the atomic properties (e.g. energy, displacement, stress). The complete deformation processes consist of two stages: the activation (i.e. trigger, from initial minima to nearby saddle states on PEL), and relaxation (i.e. from saddle states to final minima on PEL). We show that the activation stages are triggered by local rearrangements of a small number of atoms, typically 5 atoms in average. Surprisingly, the individual triggers are invariant of the cooling history or elastic structure of the system. However, the organizations between different trigger centers can be varied and are related to the overall stability of the system. On the other hand, relaxation stages consist of two branches, a localized branch, and a cascade branch. While the localized branch is insensitive to the cooling history the system, the cascade branch is highly related with the processing conditions. In particular, for a faster quenched system, the cascade relaxation is found more prominent than in a slowly quenched system. The work is supported by Department of Energy.

  17. Metal-dithiocarbamate complexes: chemistry and biological activity.

    PubMed

    Hogarth, Graeme

    2012-10-01

    Dithiocarbamates are highly versatile mono-anionic chelating ligands which form stable complexes with all the transition elements and also the majority of main group, lanthanide and actinide elements. They are easily prepared from primary or secondary amines and depending upon the nature of the cation can show good solubility in water or organic solvents. They are related to the thiuram disulfides by a one-electron redox process (followed by dimerisation via sulfur-sulfur bond formation) which is easily carried out upon addition of iodide or ferric salts. Dithiocarbamates are lipophilic and generally bind to metals in a symmetrical chelate fashion but examples of other coordination modes are known, the monodentate and anisobidentate modes being most prevalent. They are planar sterically non-demanding ligands which can be electronically tuned by judicious choice of substituents. They stabilize metals in a wide range of oxidation states, this being attributed to the existence of soft dithiocarbamate and hard thioureide resonance forms, the latter formally resulting from delocalization of the nitrogen lone pair onto the sulfurs, and consequently their complexes tend to have a rich electrochemistry. Tetraethyl thiuramdisulfide (disulfiram or antabuse) has been used as a drug since the 1950s but it is only recently that dithiocarbamate complexes have been explored within the medicinal domain. Over the past two decades anti-cancer activity has been noted for gold and copper complexes, technetium and copper complexes have been used in PET-imaging, dithiocarbamates have been used to treat acute cadmium poisoning and copper complexes also have been investigated as SOD inhibitors.

  18. Metal-dithiocarbamate complexes: chemistry and biological activity.

    PubMed

    Hogarth, Graeme

    2012-10-01

    Dithiocarbamates are highly versatile mono-anionic chelating ligands which form stable complexes with all the transition elements and also the majority of main group, lanthanide and actinide elements. They are easily prepared from primary or secondary amines and depending upon the nature of the cation can show good solubility in water or organic solvents. They are related to the thiuram disulfides by a one-electron redox process (followed by dimerisation via sulfur-sulfur bond formation) which is easily carried out upon addition of iodide or ferric salts. Dithiocarbamates are lipophilic and generally bind to metals in a symmetrical chelate fashion but examples of other coordination modes are known, the monodentate and anisobidentate modes being most prevalent. They are planar sterically non-demanding ligands which can be electronically tuned by judicious choice of substituents. They stabilize metals in a wide range of oxidation states, this being attributed to the existence of soft dithiocarbamate and hard thioureide resonance forms, the latter formally resulting from delocalization of the nitrogen lone pair onto the sulfurs, and consequently their complexes tend to have a rich electrochemistry. Tetraethyl thiuramdisulfide (disulfiram or antabuse) has been used as a drug since the 1950s but it is only recently that dithiocarbamate complexes have been explored within the medicinal domain. Over the past two decades anti-cancer activity has been noted for gold and copper complexes, technetium and copper complexes have been used in PET-imaging, dithiocarbamates have been used to treat acute cadmium poisoning and copper complexes also have been investigated as SOD inhibitors. PMID:22931592

  19. Assessment of Trace Metals in Soil, Vegetation and Rodents in Relation to Metal Mining Activities in an Arid Environment.

    PubMed

    Méndez-Rodríguez, Lia C; Alvarez-Castañeda, Sergio Ticul

    2016-07-01

    Areas where abandoned metal-extraction mines are located contain large quantities of mineral wastes derived from environmentally unsafe mining practices. These wastes contain many pollutants, such as heavy metals, which could be released to the environment through weathering and leaching, hence becoming an important source of environmental metal pollution. This study evaluates differences in the levels of lead, iron, nickel, manganese, copper and cadmium in rodents sharing the same type of diet under different microhabitat use in arid areas with past mining activities. Samples of soil, roots, branches and seeds of Palo Adán (Fouquieria diguetii) and specimens of two rodent species (Chaetodipus arenarius and C. spinatus) were collected in areas with impact from past metal mining activities as well as from areas with no mining impact. Both rodent species mirrored nickel and iron levels in soil and seeds, as well as lead levels in soil; however, C. arenarius accumulated higher levels of manganese, copper and cadmium. PMID:27207229

  20. Assessment of Trace Metals in Soil, Vegetation and Rodents in Relation to Metal Mining Activities in an Arid Environment.

    PubMed

    Méndez-Rodríguez, Lia C; Alvarez-Castañeda, Sergio Ticul

    2016-07-01

    Areas where abandoned metal-extraction mines are located contain large quantities of mineral wastes derived from environmentally unsafe mining practices. These wastes contain many pollutants, such as heavy metals, which could be released to the environment through weathering and leaching, hence becoming an important source of environmental metal pollution. This study evaluates differences in the levels of lead, iron, nickel, manganese, copper and cadmium in rodents sharing the same type of diet under different microhabitat use in arid areas with past mining activities. Samples of soil, roots, branches and seeds of Palo Adán (Fouquieria diguetii) and specimens of two rodent species (Chaetodipus arenarius and C. spinatus) were collected in areas with impact from past metal mining activities as well as from areas with no mining impact. Both rodent species mirrored nickel and iron levels in soil and seeds, as well as lead levels in soil; however, C. arenarius accumulated higher levels of manganese, copper and cadmium.

  1. Multinuclear oxo-bridged manganese complexes with a bulky substituted benzoate ligand: novel species obtained by using steric control.

    PubMed

    Mukhopadhyay, Sumitra; Armstrong, William H

    2003-10-29

    A sterically hindered carboxylate ligand is used to synthesize the first transition metal complex containing both bis-mu-oxo and bis-mu-carboxylato groups, [Mn2(mu-O)2(mu-ArtolCO2)2(bpy)2]+. However, methyl substitution on the chelating bipyridine ligand results in the formation of a strikingly different and novel hexanuclear species, [Mn6(mu-O)4(mu3-O)4(mu-ArtolCO2)2(dmb)6]4+. Steric interactions between the bridging carboxylates and chelating pyridine-based ligands determine the nuclearity of the complexes formed.

  2. Identification of a novel selective peroxisome proliferator-activated receptor alpha agonist, 2-methyl-2-(4-{3-[1-(4-methylbenzyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-3-yl]propyl}phenoxy)propanoic acid (LY518674), that produces marked changes in serum lipids and apolipoprotein A-1 expression.

    PubMed

    Singh, Jai Pal; Kauffman, Raymond; Bensch, William; Wang, Guoming; McClelland, Pam; Bean, James; Montrose, Chahrzad; Mantlo, Nathan; Wagle, Asavari

    2005-09-01

    Low high-density lipoprotein-cholesterol (HDL-c) is an important risk factor of coronary artery disease (CAD). Optimum therapy for raising HDL-c is still not available. Identification of novel HDL-raising agents would produce a major impact on CAD. In this study, we have identified a potent (IC50 approximately 24 nM) and selective peroxisome proliferator-activated receptor alpha (PPARalpha) agonist, 2-methyl-2-(4-{3-[1-(4-methylbenzyl)-5-oxo-4,5-dihydro-1H-1,2,4-triazol-3-yl]propyl}phenoxy)propanoic acid (LY518674). In human apolipoprotein A-1 (apoA-1) transgenic mice, LY518674 produced a dose-dependent increase in serum HDL-c, resulting in 208 +/- 15% elevation at optimum dose. A new synthesis of apoA-1 contributed to the increase in HDL-c. LY518674 increased apoA-1 mRNA levels in liver. Moreover, liver slices from animals treated with LY518674 secreted 3- to 6-fold more apoA-1 than control liver slices. In cultured hepatocytes, LY518674 produced 50% higher apoA-1 secretion, which was associated with increase in radiolabeled methionine incorporation in apoA-1. Thus, LY518674 is a potent and selective PPARalpha agonist that produced a much greater increase in serum HDL-c than the known fibrate drugs. The increase in HDL-c was associated with de novo synthesis of apoA-1. PMID:15933217

  3. Transition metal complexes of a salen-fullerene diad: redox and catalytically active nanostructures for delivery of metals in nanotubes.

    PubMed

    Lebedeva, Maria A; Chamberlain, Thomas W; Davies, E Stephen; Mancel, Dorothée; Thomas, Bradley E; Suyetin, Mikhail; Bichoutskaia, Elena; Schröder, Martin; Khlobystov, Andrei N

    2013-09-01

    A covalently-linked salen-C60 (H2L) assembly binds a range of transition metal cations in close proximity to the fullerene cage to give complexes [M(L)] (M=Mn, Co, Ni, Cu, Zn, Pd), [MCl(L)] (M=Cr, Fe) and [V(O)L]. Attaching salen covalently to the C60 cage only marginally slows down metal binding at the salen functionality compared to metal binding to free salen. Coordination of metal cations to salen-C60 introduces to these fullerene derivatives strong absorption bands across the visible spectrum from 400 to 630 nm, the optical features of which are controlled by the nature of the transition metal. The redox properties of the metal-salen-C60 complexes are determined both by the fullerene and by the nature of the transition metal, enabling the generation of a wide range of fullerene-containing charged species, some of which possess two or more unpaired electrons. The presence of the fullerene cage enhances the affinity of these complexes for carbon nanostructures, such as single-, double- and multiwalled carbon nanotubes and graphitised carbon nanofibres, without detrimental effects on the catalytic activity of the metal centre, as demonstrated in styrene oxidation catalysed by [Cu(L)]. This approach shows promise for applications of salen-C60 complexes in heterogeneous catalysis.

  4. Antimicrobial Activity of Metal & Metal Oxide Nanoparticles Interfaced With Ligand Complexes Of 8-Hydroxyquinoline And α-Amino Acids

    NASA Astrophysics Data System (ADS)

    Bhanjana, Gaurav; Kumar, Neeraj; Thakur, Rajesh; Dilbaghi, Neeraj; Kumar, Sandeep

    2011-12-01

    Antimicrobial nanotechnology is a recent addition to the fight against disease causing organisms, replacing heavy metals and toxins. In the present work, mixed ligand complexes of metals like zinc, silver etc. and metal oxide have been synthesized using 8-hydroxyquinoline (HQ) as a primary ligand and N-and/O-donor amino acids such as L-serine, L-alanine, glycine, cysteine and histidine as secondary ligands. These complexes were characterized using different spectroscopic techniques. The complexes were tested for antifungal and antibacterial activity by using agar well diffusion bioassay.

  5. Carrier effects of active carbon for methanol carbonylation with supported transition metal catalysts

    SciTech Connect

    Fujimoto, K.; Omata, K.; Yagita, H.

    1996-10-01

    Transition metals such as nickel or noble metals showed excellent catalytic activities for the vapor phase carbonylation of methanol to acetic acid. Reaction proceeded via the carbonylation of methanol to methyl acetate and its successive carbonylation to acetic acid anhydride followed by the hydrolysis. Under slightly pressurized conditions and at around 250{degrees}C methanol was completely carbonylated to acetic acid with the selectivity of 97% or higher. Also, other group 8 metals including noble metals showed excellent catalytic activity only when they were supported on active carbon, whose activity, ordered by strength of metal-halogen bonding showed a volcano-shape relationship with the peak at Rh. The role of active carbon as the active carrier was clarified by kinetics and catalyst characterization which showed that active carbon promoted the reductive elimination of intermediate for acetic acid formation by donating electron from carbon to nickel species.

  6. Lewis Acid Coupled Electron Transfer of Metal-Oxygen Intermediates.

    PubMed

    Fukuzumi, Shunichi; Ohkubo, Kei; Lee, Yong-Min; Nam, Wonwoo

    2015-12-01

    Redox-inactive metal ions and Brønsted acids that function as Lewis acids play pivotal roles in modulating the redox reactivity of metal-oxygen intermediates, such as metal-oxo and metal-peroxo complexes. The mechanisms of the oxidative CH bond cleavage of toluene derivatives, sulfoxidation of thioanisole derivatives, and epoxidation of styrene derivatives by mononuclear nonheme iron(IV)-oxo complexes in the presence of triflic acid (HOTf) and Sc(OTf)3 have been unified as rate-determining electron transfer coupled with binding of Lewis acids (HOTf and Sc(OTf)3 ) by iron(III)-oxo complexes. All logarithms of the observed second-order rate constants of Lewis acid-promoted oxidative CH bond cleavage, sulfoxidation, and epoxidation reactions of iron(IV)-oxo complexes exhibit remarkably unified correlations with the driving forces of proton-coupled electron transfer (PCET) and metal ion-coupled electron transfer (MCET) in light of the Marcus theory of electron transfer when the differences in the formation constants of precursor complexes were taken into account. The binding of HOTf and Sc(OTf)3 to the metal-oxo moiety has been confirmed for Mn(IV) -oxo complexes. The enhancement of the electron-transfer reactivity of metal-oxo complexes by binding of Lewis acids increases with increasing the Lewis acidity of redox-inactive metal ions. Metal ions can also bind to mononuclear nonheme iron(III)-peroxo complexes, resulting in acceleration of the electron-transfer reduction but deceleration of the electron-transfer oxidation. Such a control on the reactivity of metal-oxygen intermediates by binding of Lewis acids provides valuable insight into the role of Ca(2+) in the oxidation of water to dioxygen by the oxygen-evolving complex in photosystem II.

  7. Asymmetric photoredox transition-metal catalysis activated by visible light

    NASA Astrophysics Data System (ADS)

    Huo, Haohua; Shen, Xiaodong; Wang, Chuanyong; Zhang, Lilu; Röse, Philipp; Chen, Liang-An; Harms, Klaus; Marsch, Michael; Hilt, Gerhard; Meggers, Eric

    2014-11-01

    Asymmetric catalysis is seen as one of the most economical strategies to satisfy the growing demand for enantiomerically pure small molecules in the fine chemical and pharmaceutical industries. And visible light has been recognized as an environmentally friendly and sustainable form of energy for triggering chemical transformations and catalytic chemical processes. For these reasons, visible-light-driven catalytic asymmetric chemistry is a subject of enormous current interest. Photoredox catalysis provides the opportunity to generate highly reactive radical ion intermediates with often unusual or unconventional reactivities under surprisingly mild reaction conditions. In such systems, photoactivated sensitizers initiate a single electron transfer from (or to) a closed-shell organic molecule to produce radical cations or radical anions whose reactivities are then exploited for interesting or unusual chemical transformations. However, the high reactivity of photoexcited substrates, intermediate radical ions or radicals, and the low activation barriers for follow-up reactions provide significant hurdles for the development of efficient catalytic photochemical processes that work under stereochemical control and provide chiral molecules in an asymmetric fashion. Here we report a highly efficient asymmetric catalyst that uses visible light for the necessary molecular activation, thereby combining asymmetric catalysis and photocatalysis. We show that a chiral iridium complex can serve as a sensitizer for photoredox catalysis and at the same time provide very effective asymmetric induction for the enantioselective alkylation of 2-acyl imidazoles. This new asymmetric photoredox catalyst, in which the metal centre simultaneously serves as the exclusive source of chirality, the catalytically active Lewis acid centre, and the photoredox centre, offers new opportunities for the `green' synthesis of non-racemic chiral molecules.

  8. Enhanced Antimicrobial Activity Of Antibiotics Mixed With Metal Nanoparticles

    NASA Astrophysics Data System (ADS)

    Kumar, Sandeep; Kumar, Neeraj; Bhanjana, Gaurav; Thakur, Rajesh; Dilbaghi, Neeraj

    2011-12-01

    Current producers of antimicrobial technology have a long lasting, environmentally safe, non-leaching, water soluble solution that will eventually replace all poisons and heavy metals. The transition metal ions inevitably exist as metal complexes in biological systems by interaction with the numerous molecules possessing groupings capable of complexation or chelation. Nanoparticles of metal oxides offer a wide variety of potential applications in medicine due to the unprecedented advances in nanobiotechnology research. the bacterial action of antibiotics like penicillin, erythryomycin, ampicillin, streptomycin, kanamycin etc. and that of a mixture of antibiotics and metal and metal oxide nanoparticles like zinc oxide, zirconium, silver and gold on microbes was examined by the agar-well-diffusion method, enumeration of colony-forming units (CFU) and turbidimetry.

  9. Characterization of AN Actively Cooled Metal Foil Thermal Radiation Shield

    NASA Astrophysics Data System (ADS)

    Feller, J. R.; Kashani, A.; Helvensteijn, B. P. M.; Salerno, L. J.

    2010-04-01

    Zero boil-off (ZBO) or reduced boil-off (RBO) systems that involve active cooling of large cryogenic propellant tanks will most likely be required for future space exploration missions. For liquid oxygen or methane, such systems could be implemented using existing high technology readiness level (TRL) cryocoolers. However, for liquid hydrogen temperatures (˜20 K) no such coolers exist. In order to partially circumvent this technology gap, the concept of broad area cooling (BAC) has been developed, whereby a low mass thermal radiation shield could be maintained at temperatures around 100 K by steady circulation of cold pressurized gas through a network of narrow tubes. By this method it is possible to dramatically reduce the radiative heat leak to the 20 K tank. A series of experiments, designed to investigate the heat transfer capabilities of BAC systems, have been conducted at NASA Ames Research Center (ARC). Results of the final experiment in this series, investigating heat transfer from a metal foil film to a distributed cooling line, are presented here.

  10. Association of metals and proteasome activity in erythrocytes of prostate cancer patients and controls.

    PubMed

    Neslund-Dudas, Christine; Mitra, Bharati; Kandegedara, Ashoka; Chen, Di; Schmitt, Sara; Shen, Min; Cui, Qiuzhi; Rybicki, Benjamin A; Dou, Q Ping

    2012-10-01

    Information is lacking on the effects toxic environmental metals may have on the 26S proteasome. The proteasome is a primary vehicle for selective degradation of damaged proteins in a cell and due to its role in cell proliferation, inhibition of the proteasome has become a target for cancer therapy. Metals are essential to the proteasome's normal function and have been used within proteasome-inhibiting complexes for cancer therapy. This study evaluated the association of erythrocyte metal levels and proteasome chymotrypsin-like (CT-like) activity in age- and race-matched prostate cancer cases (n=61) and controls (n=61). Erythrocyte metals were measured by inductively coupled plasma mass spectrometry (ICP-MS). CT-like activity was measured by proteasome activity assay using a fluorogenic peptide substrate. Among cases, significant correlations between individual toxic metals were observed (r(arsenic-cadmium)=0.49, p<0.001; r(arsenic-lead)=0.26, p=0.04, r(cadmium-lead) 0.53, p<0.001), but there were no significant associations between metals and CT-like activity. In contrast, within controls there were no significant associations between metals, however, copper and lead levels were significantly associated with CT-like activity. The associations between copper and lead and proteasome activity (r(copper-CT-like)=-0.28, p=0.002 ; r(lead-CT-like)=0.23, p=0.011) remained significant in multivariable models that included all of the metals. These findings suggest that biologically essential metals and toxic metals may affect proteasome activity in healthy controls and, further, show that prostate cancer cases and controls differ in associations between metals and proteasome activity in erythrocytes. More research on toxic metals and the proteasome in prostate cancer is warranted.

  11. Biotransformation of 7alpha-hydroxy- and 7-oxo-ent-atis-16-ene derivatives by the fungus Gibberella fujikuroi.

    PubMed

    Fraga, Braulio M; Gonzalez, Pedro; Gonzalez-Vallejo, Victoria; Guillermo, Ricardo; Diaz, Luz N

    2010-08-01

    The microbiological transformation of 7alpha,19-dihydroxy-ent-atis-16-ene by the fungus Gibberella fujikuroi gave 19-hydroxy-7-oxo-ent-atis-16-ene, 13(R),19-dihydroxy-7-oxo-ent-atis-16-ene, 7alpha,11beta,19-trihydroxy-ent-atis-16-ene and 7alpha,16beta,19-trihydroxy-ent-atis-16-ene, while the incubation of 19-hydroxy-7-oxo-ent-atis-16-ene afforded 13(R),19-dihydroxy-7-oxo-ent-atis-16-ene and 16beta,17-dihydroxy-7-oxo-ent-atisan-19-al. The biotransformation of 7-oxo-ent-atis-16-en-19-oic acid gave 6beta-hydroxy-7-oxo-ent-atis-16-en-19-oic acid, 6beta,16beta,17-trihydroxy-7-oxo-19-nor-ent-atis-4(18)-ene and 3beta,7alpha-dihydroxy-6-oxo-ent-atis-16-en-19-oic acid.

  12. Design and synthesis of pyrrolidine-5,5'-trans-lactams (5-oxo-hexahydropyrrolo[3,2-b]pyrroles) as novel mechanism-based inhibitors of human cytomegalovirus protease. 4. Antiviral activity and plasma stability.

    PubMed

    Borthwick, Alan D; Davies, Dave E; Ertl, Peter F; Exall, Anne M; Haley, Terry M; Hart, Graham J; Jackson, Deborah L; Parry, Nigel R; Patikis, Angela; Trivedi, Naimisha; Weingarten, Gordon G; Woolven, James M

    2003-10-01

    A series of chiral, (S)-proline-alpha-methylpyrrolidine-5,5-trans-lactam serine protease inhibitors has been developed as antivirals of human cytomegalovirus (HCMV). The SAR of the functionality on the proline nitrogen has shown that derivatives of para-substituted phenyl ureas > para-substituted phenyl sulfonamides > para-substituted phenyl carboxamide for activity against HCMV deltaAla protease, producing para-substituted phenyl ureas with single figure nM potency (K(i)) against the viral enzyme. The SAR of the functionality on the lactam nitrogen has defined the steric and electronic requirements for high human plasma stability while retaining good activity against HCMV protease. The combination of high potency against HCMV deltaAla protease and high human plasma stability has produced compounds with significant in vitro antiviral activity against human cytomegalovirus with the 6-hydroxymethyl benzothiazole derivative 72 being equivalent in potency to ganciclovir. The parent benzothiazole 56 had good pharmacokinetics in dogs with 29% bioavailability and good brain and ocular penetration in guinea pigs.

  13. A switch between DNA polymerases δ and λ promotes error-free bypass of 8-oxo-G lesions.

    PubMed

    Markkanen, Enni; Castrec, Benoît; Villani, Giuseppe; Hübscher, Ulrich

    2012-12-11

    7,8-Dihydro-8-oxoguanine (8-oxo-G) is a highly abundant and mutagenic lesion. Replicative DNA polymerases (pols) are slowed down at 8-oxo-G and insert both correct cytosine (C) and incorrect adenine (A) opposite 8-oxo-G, but they preferentially extend A:8-oxo-G mispairs. Nevertheless, 8-oxo-G bypass is fairly accurate in vivo. Thus, the question how correct bypass of 8-oxo-G lesions is accomplished despite the poor extension of C:8-oxo-G base pairs by replicative pols remains unanswered. Here we show that replicative pol δ pauses in front of 8-oxo-G and displays difficulties extending from correct C:8-oxo-G in contrast to extension from incorrect A:8-oxo-G. This leads to stalling of pol δ at 8-oxo-G after incorporation of correct C. This stalling at C:8-oxo-G can be overcome by a switch from pol δ to pols λ, β, or η, all of which are able to assist pol δ in 8-oxo-G bypass by translesion synthesis (TLS). Importantly, however, only pol λ selectively catalyzes the correct TLS past 8-oxo-G, whereas pols β and η show no selectivity and even preferentially enhance incorrect TLS. The selectivity of pol λ to promote the correct bypass depends on its N-terminal domain. Furthermore, pol λ(-/-) mouse embryonic fibroblast extracts display reduced 8-oxo-G TLS. Finally, the correct bypass of 8-oxo-G in gapped plasmids in mouse embryonic fibroblasts and HeLa cells is promoted in the presence of pol λ. Our findings suggest that even though 8-oxo-G is not a blocking lesion per se, correct replication over 8-oxo-G is promoted by a pol switch between pols δ and λ. PMID:23175785

  14. Synthesis, Polymorphism, and Insecticidal Activity of Methyl 4-(4-chlorophenyl)-8-iodo-2-methyl-6-oxo-1,6-dihydro-4H-pyrimido[2,1-b]quinazoline-3-Carboxylate Against Anopheles arabiensis Mosquito.

    PubMed

    Venugopala, Katharigatta N; Nayak, Susanta K; Gleiser, Raquel M; Sanchez-Borzone, Mariela E; Garcia, Daniel A; Odhav, Bharti

    2016-07-01

    Mosquitoes are the major vectors of pathogens and parasites including those causing malaria, the most deadly vector-borne disease. The negative environmental effects of most synthetic compounds combined with widespread development of insecticide resistance encourage an interest in finding and developing alternative products against mosquitoes. In this study, pyrimido[2,1-b]quinazoline derivative DHPM3 has been synthesized by three-step chemical reaction and screened for larvicide, adulticide, and repellent properties against Anopheles arabiensis, one of the dominant vectors of malaria in Africa. The title compound emerged as potential larvicide agent for further research and development, because it exerted 100% mortality, while adulticide activity was considered moderate.

  15. Computational and experimental study of the mechanism of hydrogen generation from water by a molecular molybdenum-oxo electrocatalyst.

    PubMed

    Sundstrom, Eric J; Yang, Xinzheng; Thoi, V Sara; Karunadasa, Hemamala I; Chang, Christopher J; Long, Jeffrey R; Head-Gordon, Martin

    2012-03-21

    We investigate the mechanism for the electrocatalytic generation of hydrogen from water by the molecular molybdenum-oxo complex, [(PY5Me(2))MoO](2+) (PY5Me(2) = 2,6-bis(1,1-bis(2-pyridyl)ethyl)pyridine). Computational and experimental evidence suggests that the electrocatalysis consists of three distinct electrochemical reductions, which precede the onset of catalysis. Cyclic voltammetry studies indicate that the first two reductions are accompanied by protonations to afford the Mo-aqua complex, [(PY5Me(2))Mo(OH(2))](+). Calculations support hydrogen evolution from this complex upon the third reduction, via the oxidative addition of a proton from the bound water to the metal center and finally an α-H abstraction to release hydrogen. Calculations further suggest that introducing electron-withdrawing substituents such as fluorides in the para positions of the pyridine rings can reduce the potential associated with the reductive steps, without substantially affecting the kinetics. After the third reduction, there are kinetic bottlenecks to the formation of the Mo-hydride and subsequent hydrogen release. Computational evidence also suggests an alternative to direct α-H abstraction as a mechanism for H(2) release which exhibits a lower barrier. The new mechanism is one in which a water acts as an intramolecular proton relay between the protons of the hydroxide and the hydride ligands. The calculated kinetics are in reasonable agreement with experimental measurements. Additionally, we propose a mechanism for the stoichiometric reaction of [(PY5Me(2))Mo(CF(3)SO(3))](+) with water to yield hydrogen and [(PY(5)Me(2))MoO](2+) along with the implications for the viability of an alternate catalytic cycle involving just two reductions to generate the active catalyst. PMID:22356562

  16. Coordination sphere of the third metal site is essential to the activity and metal selectivity of alkaline phosphatases.

    PubMed

    Koutsioulis, Dimitris; Lyskowski, Andrzej; Mäki, Seija; Guthrie, Ellen; Feller, Georges; Bouriotis, Vassilis; Heikinheimo, Pirkko

    2010-01-01

    Alkaline phosphatases (APs) are commercially applied enzymes that catalyze the hydrolysis of phosphate monoesters by a reaction involving three active site metal ions. We have previously identified H135 as the key residue for controlling activity of the psychrophilic TAB5 AP (TAP). In this article, we describe three X-ray crystallographic structures on TAP variants H135E and H135D in complex with a variety of metal ions. The structural analysis is supported by thermodynamic and kinetic data. The AP catalysis essentially requires octahedral coordination in the M3 site, but stability is adjusted with the conformational freedom of the metal ion. Comparison with the mesophilic Escherichia coli, AP shows differences in the charge transfer network in providing the chemically optimal metal combination for catalysis. Our results provide explanation why the TAB5 and E. coli APs respond in an opposite way to mutagenesis in their active sites. They provide a lesson on chemical fine tuning and the importance of the second coordination sphere in defining metal specificity in enzymes. Understanding the framework of AP catalysis is essential in the efforts to design even more powerful tools for modern biotechnology. PMID:19916164

  17. LEACHING OF METALS FROM MINERAL PROCESSING WASTE

    EPA Science Inventory

    The purpose of this project is to test the leaching of Mineral Processing Waste (MPW) contaminated with heavy metals using scientifically defendable leaching tests other than TCLP. Past experience and literature have shown that TCLP underestimates the levels of metals such as oxo...

  18. Di-μ-oxo dimetal core of Mn(IV) and Ti(IV) as a linker between two chiral salen complexes leading to the stereoselective formation of different M- and P-helical structures.

    PubMed

    Kurahashi, Takuya; Hada, Masahiko; Fujii, Hiroshi

    2014-01-21

    Because of restricted rotational freedom along the metal-metal axis, a di-μ-oxo dimetal core could be an excellent building block to create dinuclear compounds with well-defined stereochemistry, but their stereoselective synthesis remains a challenge. We herein report the formation of di-μ-oxo dimanganese(IV) complexes with tetradentate salen ligands bearing different degrees of steric bulk, in order to study stereochemical aspects of the dimerization reaction that potentially generates multiple stereoisomers. X-ray crystallography shows that the di-μ-oxo dimanganese(IV) complex with salen, where salen is (R,R)-N,N'-bis(3,5-di-tert-butylsalicylidene)-1,2-cyclohexanediamine, adopts a unique structure in which two salen complexes are arranged in an M-helical fashion. According to the solution study using (1)H, (2)H NMR, and circular dichroism spectroscopies, the dimerization reaction is highly diastereoselective in the presence of the tert-butyl group at the 3/3' position as a determinant steric factor. In contrast, the di-μ-oxo dititanium(IV) complex with the same salen ligand was previously reported to afford an opposite P-helical dimer. The present DFT study clarifies that a less-covalent Ti-O bonding causes a distortion of the di-μ-oxo dititanium(IV) core structure, generating a completely different framework for interligand interaction. The present study provides a solid basis to understand the stereochemistry for the formation of the di-μ-oxo dimetal core.

  19. Metal Catalyzed Fusion: Nuclear Active Environment vs. Process

    NASA Astrophysics Data System (ADS)

    Chubb, Talbot

    2009-03-01

    To achieve radiationless dd fusion and/or other LENR reactions via chemistry: some focus on environment of interior or altered near-surface volume of bulk metal; some on environment inside metal nanocrystals or on their surface; some on the interface between nanometal crystals and ionic crystals; some on a momentum shock-stimulation reaction process. Experiment says there is also a spontaneous reaction process.

  20. Measuring the noble metal and iodine composition of extracted noble metal phase from spent nuclear fuel using instrumental neutron activation analysis.

    PubMed

    Palomares, R I; Dayman, K J; Landsberger, S; Biegalski, S R; Soderquist, C Z; Casella, A J; Brady Raap, M C; Schwantes, J M

    2015-04-01

    Masses of noble metal and iodine nuclides in the metallic noble metal phase extracted from spent fuel are measured using instrumental neutron activation analysis. Nuclide presence is predicted using fission yield analysis, and radionuclides are identified and the masses quantified using neutron activation analysis. The nuclide compositions of noble metal phase derived from two dissolution methods, UO2 fuel dissolved in nitric acid and UO2 fuel dissolved in ammonium-carbonate and hydrogen-peroxide solution, are compared. PMID:25644079

  1. Ternary metal complexes of guaifenesin drug: Synthesis, spectroscopic characterization and in vitro anticancer activity of the metal complexes.

    PubMed

    Mahmoud, W H; Mahmoud, N F; Mohamed, G G; El-Sonbati, A Z; El-Bindary, A A

    2015-01-01

    The coordination behavior of a series of transition metal ions named Cr(III), Fe(III), Mn(II), Co(II), Ni(II), Cu(II), Zn(II) and Cd(II) with a mono negative tridentate guaifenesin ligand (GFS) (OOO donation sites) and 1,10-phenanthroline (Phen) is reported. The metal complexes are characterized based on elemental analyses, IR, (1)H NMR, solid reflectance, magnetic moment, molar conductance, UV-vis spectral studies, mass spectroscopy, ESR, XRD and thermal analysis (TG and DTG). The ternary metal complexes were found to have the formulae of [M(GFS)(Phen)Cl]Cl·nH2O (M=Cr(III) (n=1) and Fe(III) (n=0)), [M(GFS)(Phen)Cl]·nH2O (M=Mn(II) (n=0), Zn(II) (n=0) and Cu(II) (n=3)) and [M(GFS)(Phen)(H2O)]Cl·nH2O (M=Co(II) (n=0), Ni(II) (n=0) and Cd(II) (n=4)). All the chelates are found to have octahedral geometrical structures. The ligand and its ternary chelates are subjected to thermal analyses (TG and DTG). The GFS ligand, in comparison to its ternary metal complexes also was screened for their antibacterial activity on gram positive bacteria (Bacillus subtilis and Staphylococcus aureus), gram negative bacteria (Escherichia coli and Neisseria gonorrhoeae) and for in vitro antifungal activity against (Candida albicans). The activity data show that the metal complexes have antibacterial and antifungal activity more than the parent GFS ligand. The complexes were also screened for its in vitro anticancer activity against the Breast cell line (MFC7) and the results obtained show that they exhibit a considerable anticancer activity. PMID:26067934

  2. New hybrid molecules with anticonvulsant and antinociceptive activity derived from 3-methyl- or 3,3-dimethyl-1-[1-oxo-1-(4-phenylpiperazin-1-yl)propan-2-yl]pyrrolidine-2,5-diones.

    PubMed

    Kamiński, Krzysztof; Zagaja, Mirosław; Rapacz, Anna; Łuszczki, Jarogniew J; Andres-Mach, Marta; Abram, Michał; Obniska, Jolanta

    2016-02-15

    The purpose of this study was to synthetize the focused library of 34 new piperazinamides of 3-methyl- and 3,3-dimethyl-(2,5-dioxopyrrolidin-1-yl)propanoic or butanoic acids as potential new hybrid anticonvulsants. These hybrid molecules join the chemical fragments of well-known antiepileptic drugs (AEDs) such as ethosuximide, levetiracetam, and lacosamide. Compounds 5-38 were prepared in a coupling reaction of the 3-methyl- or 3,3-dimethyl-2-(2,5-dioxopyrrolidin-1-yl)propanoic (1, 2) or butanoic acids (3, 4) with the appropriately substituted secondary amines in the presence of the N,N-carbonyldiimidazole reagent. The initial anticonvulsant screening was performed in mice (ip) using the 'classical' maximal electroshock (MES) and subcutaneous pentylenetetrazole (scPTZ) tests as well as in the six-Hertz (6Hz) model of pharmacoresistant limbic seizures. The acute neurological toxicity was determined applying the chimney test. The broad spectra of activity across the preclinical seizure models in mice ip displayed compounds 7, 15, and 36. The most favorable anticonvulsant properties demonstrated 15 (ED50 MES=74.8mg/kg, ED50scPTZ=51.6mg/kg, ED50 6Hz=16.8mg/kg) which showed TD50=213.3mg/kg in the chimney test that yielded satisfying protective indexes (PI MES=2.85, PI scPTZ=4.13, PI 6Hz=12.70) at time point of 0.5h. As a result, compound 15 displayed comparable or better safety profile than clinically relevant AEDs: ethosuximide, lacosamide or valproic acid. In the in vitro assays compound 15 was observed as relatively effective binder to the neuronal voltage-sensitive sodium and L-type calcium channels. Beyond the anticonvulsant properties, 6 compounds diminished the pain responses in the formalin model of tonic pain in mice. PMID:26746343

  3. Single-Site Cobalt Catalysts at New Zr8(μ2-O)8(μ2-OH)4 Metal-Organic Framework Nodes for Highly Active Hydrogenation of Alkenes, Imines, Carbonyls, and Heterocycles.

    PubMed

    Ji, Pengfei; Manna, Kuntal; Lin, Zekai; Urban, Ania; Greene, Francis X; Lan, Guangxu; Lin, Wenbin

    2016-09-21

    We report here the synthesis of robust and porous metal-organic frameworks (MOFs), M-MTBC (M = Zr or Hf), constructed from the tetrahedral linker methane-tetrakis(p-biphenylcarboxylate) (MTBC) and two types of secondary building units (SBUs): cubic M8(μ2-O)8(μ2-OH)4 and octahedral M6(μ3-O)4(μ3-OH)4. While the M6-SBU is isostructural with the 12-connected octahedral SBUs of UiO-type MOFs, the M8-SBU is composed of eight M(IV) ions in a cubic fashion linked by eight μ2-oxo and four μ2-OH groups. The metalation of Zr-MTBC SBUs with CoCl2, followed by treatment with NaBEt3H, afforded highly active and reusable solid Zr-MTBC-CoH catalysts for the hydrogenation of alkenes, imines, carbonyls, and heterocycles. Zr-MTBC-CoH was impressively tolerant of a range of functional groups and displayed high activity in the hydrogenation of tri- and tetra-substituted alkenes with TON > 8000 for the hydrogenation of 2,3-dimethyl-2-butene. Our structural and spectroscopic studies show that site isolation of and open environments around the cobalt-hydride catalytic species at Zr8-SBUs are responsible for high catalytic activity in the hydrogenation of a wide range of challenging substrates. MOFs thus provide a novel platform for discovering and studying new single-site base-metal solid catalysts with enormous potential for sustainable chemical synthesis. PMID:27598720

  4. Z-Selective Olefin Metathesis Reactions Promoted by Tungsten Oxo Alkylidene Complexes

    PubMed Central

    Peryshkov, Dmitry V.; Schrock, Richard R.; Takase, Michael K.; Müller, Peter; Hoveyda, Amir H.

    2011-01-01

    Addition of LiOHMT (OHMT = O-2,6-dimesitylphenoxide) to W(O)(CH-t-Bu)(PMe2Ph)2Cl2 led to WO(CH-t-Bu)Cl(OHMT)(PMe2Ph) (4). Subsequent addition of Li(2,5-Me2C4H2N) to 4 yielded yellow W(O)(CH-t-Bu)(OHMT)(Me2Pyr)(PMe2Ph) (5). Compound 5 is a highly effective catalyst for the Z-selective coupling of selected terminal olefins (at 0.2% loading) to give product in >75% yield with >99% Z configuration. Addition of two equivalents of B(C6F5)3 to 5 led to catalyst activated at the oxo ligand by B(C6F5)3. 5.B(C6F5)3 is a highly active catalyst that produces thermodynamic products (~20% Z). PMID:22107254

  5. Quantifying the density and utilization of active sites in non-precious metal oxygen electroreduction catalysts

    PubMed Central

    Sahraie, Nastaran Ranjbar; Kramm, Ulrike I.; Steinberg, Julian; Zhang, Yuanjian; Thomas, Arne; Reier, Tobias; Paraknowitsch, Jens-Peter; Strasser, Peter

    2015-01-01

    Carbon materials doped with transition metal and nitrogen are highly active, non-precious metal catalysts for the electrochemical conversion of molecular oxygen in fuel cells, metal air batteries, and electrolytic processes. However, accurate measurement of their intrinsic turn-over frequency and active-site density based on metal centres in bulk and surface has remained difficult to date, which has hampered a more rational catalyst design. Here we report a successful quantification of bulk and surface-based active-site density and associated turn-over frequency values of mono- and bimetallic Fe/N-doped carbons using a combination of chemisorption, desorption and 57Fe Mössbauer spectroscopy techniques. Our general approach yields an experimental descriptor for the intrinsic activity and the active-site utilization, aiding in the catalyst development process and enabling a previously unachieved level of understanding of reactivity trends owing to a deconvolution of site density and intrinsic activity. PMID:26486465

  6. Facile synthesis of amino-functionalized titanium metal-organic frameworks and their superior visible-light photocatalytic activity for Cr(VI) reduction.

    PubMed

    Wang, Hou; Yuan, Xingzhong; Wu, Yan; Zeng, Guangming; Chen, Xiaohong; Leng, Lijian; Wu, Zhibin; Jiang, Longbo; Li, Hui

    2015-04-01

    Porous metal-organic frameworks (MOFs) have been arousing a great interest in exploring the application of MOFs as photocatalyst in environment remediation. In this work, two different MOFs, Ti-benzenedicarboxylate (MIL-125(Ti)) and amino-functionalized Ti-benzenedicarboxylate (NH2-MIL-125(Ti)) were successfully synthesized via a facile solvothermal method. The MIL-125(Ti) and NH2-MIL-125(Ti) were well characterized by XRD, SEM, XPS, N2 adsorption-desorption measurements, thermogravimetric analysis and UV-vis diffuse reflectance spectra (DRS). It is revealed that the NH2-MIL-125(Ti) has well crystalline lattice, large surface area and mesoporous structure, chemical and thermal stability, and enhanced visible-light absorption up to 520 nm, which was associated with the chromophore (amino group) in the organic linker. Compared with MIL-125(Ti), NH2-MIL-125(Ti) exhibited more efficient photocatalytic activity for Cr(VI) reduction from aqueous solution under visible-light irradiation. The addition of hole scavenger, the hole scavenger concentration and the pH value of the reaction solution played important roles in the photo-catalytic reduction of Cr(VI). The presence of Ti(3+)-Ti(4+) intervalence electron transfer was the main reason for photo-excited electrons transportation from titanium-oxo clusters to Cr(VI), facilitating the Cr(VI) reduction under the acid condition. It was demonstrated that amino-functionalized Ti(IV)-based MOFs could be promising visible-light photocatalysts for the treatment of Cr(VI)-contained wastewater. PMID:25585267

  7. Facile synthesis of amino-functionalized titanium metal-organic frameworks and their superior visible-light photocatalytic activity for Cr(VI) reduction.

    PubMed

    Wang, Hou; Yuan, Xingzhong; Wu, Yan; Zeng, Guangming; Chen, Xiaohong; Leng, Lijian; Wu, Zhibin; Jiang, Longbo; Li, Hui

    2015-04-01

    Porous metal-organic frameworks (MOFs) have been arousing a great interest in exploring the application of MOFs as photocatalyst in environment remediation. In this work, two different MOFs, Ti-benzenedicarboxylate (MIL-125(Ti)) and amino-functionalized Ti-benzenedicarboxylate (NH2-MIL-125(Ti)) were successfully synthesized via a facile solvothermal method. The MIL-125(Ti) and NH2-MIL-125(Ti) were well characterized by XRD, SEM, XPS, N2 adsorption-desorption measurements, thermogravimetric analysis and UV-vis diffuse reflectance spectra (DRS). It is revealed that the NH2-MIL-125(Ti) has well crystalline lattice, large surface area and mesoporous structure, chemical and thermal stability, and enhanced visible-light absorption up to 520 nm, which was associated with the chromophore (amino group) in the organic linker. Compared with MIL-125(Ti), NH2-MIL-125(Ti) exhibited more efficient photocatalytic activity for Cr(VI) reduction from aqueous solution under visible-light irradiation. The addition of hole scavenger, the hole scavenger concentration and the pH value of the reaction solution played important roles in the photo-catalytic reduction of Cr(VI). The presence of Ti(3+)-Ti(4+) intervalence electron transfer was the main reason for photo-excited electrons transportation from titanium-oxo clusters to Cr(VI), facilitating the Cr(VI) reduction under the acid condition. It was demonstrated that amino-functionalized Ti(IV)-based MOFs could be promising visible-light photocatalysts for the treatment of Cr(VI)-contained wastewater.

  8. Metals affect the structure and activity of human plasminogen activator inhibitor-1. II. Binding affinity and conformational changes

    PubMed Central

    Thompson, Lawrence C; Goswami, Sumit; Peterson, Cynthia B

    2011-01-01

    Human plasminogen activator inhibitor type 1 (PAI-1) is a serine protease inhibitor with a metastable active conformation. The lifespan of the active form of PAI-1 is modulated via interaction with the plasma protein, vitronectin, and various metal ions. These metal ions fall into two categories: Type I metals, including calcium, magnesium, and manganese, stabilize PAI-1 in the absence of vitronectin, whereas Type II metals, including cobalt, copper, and nickel, destabilize PAI-1 in the absence of vitronectin, but stabilize PAI-1 in its presence. To provide a mechanistic basis for understanding the unusual modulation of PAI-1 structure and activity, the binding characteristics and conformational effects of these two types of metals were further evaluated. Steady-state binding measurements using surface plasmon resonance indicated that both active and latent PAI-1 exhibit a dissociation constant in the low micromolar range for binding to immobilized nickel. Stopped-flow measurements of approach-to-equilibrium changes in intrinsic protein fluorescence indicated that the Type I and Type II metals bind in different modes that induce distinct conformational effects on PAI-1. Changes in the observed rate constants with varying concentrations of metal allowed accurate determination of binding affinities for cobalt, nickel, and copper, yielding dissociation constants of ∼40, 30, and 0.09 μM, respectively. Competition experiments that tested effects on PAI-1 stability were consistent with these measurements of affinity and indicate that copper binds tightly to PAI-1. PMID:21280128

  9. New tacrine-4-oxo-4H-chromene hybrids as multifunctional agents for the treatment of Alzheimer's disease, with cholinergic, antioxidant, and β-amyloid-reducing properties.

    PubMed

    Fernández-Bachiller, María Isabel; Pérez, Concepción; Monjas, Leticia; Rademann, Jörg; Rodríguez-Franco, María Isabel

    2012-02-01

    By using fragments endowed with interesting and complementary properties for the treatment of Alzheimer's disease (AD), a new family of tacrine-4-oxo-4H-chromene hybrids has been designed, synthesized, and evaluated biologically. The tacrine fragment was selected for its inhibition of cholinesterases, and the flavonoid scaffold derived from 4-oxo-4H -chromene was chosen for its radical capture and β-secretase 1 (BACE-1) inhibitory activities. At nano- and picomolar concentrations, the new tacrine-4-oxo-4H-chromene hybrids inhibit human acetyl- and butyrylcholinesterase (h-AChE and h-BuChE), being more potent than the parent inhibitor, tacrine. They are also potent inhibitors of human BACE-1, better than the parent flavonoid, apigenin. They show interesting antioxidant properties and could be able to penetrate into the CNS according to the in vitro PAMPA-BBB assay. Among the hybrids investigated, 6-hydroxy-4-oxo- N-{10-[(1,2,3,4-tetrahydroacridin-9-yl)amino]decyl}-4 H-chromene-2-carboxamide (19) shows potent combined inhibition of human BACE-1 and ChEs, as well as good antioxidant and CNS-permeable properties.

  10. Effects of humic acid-metal complexes on hepatic carnitine palmitoyltransferase, carnitine acetyltransferase and catalase activities

    SciTech Connect

    Fungjou Lu; Youngshin Chen . Dept. of Biochemistry); Tienshang Huang . Dept. of Medicine)

    1994-03-01

    A significant increase in activities of hepatic carnitine palmitoyltransferase and carnitine acetyltransferase was observed in male Balb/c mice intraperitoneally injected for 40 d with 0.125 mg/0.1 ml/d humic acid-metal complexes. Among these complexes, the humic acid-As complex was relatively effective, whereas humic acid-25 metal complex was more effective, and humic acid-26 metal complex was most effective. However, humic acid or metal mixtures, or metal such as As alone, was not effective. Humic acid-metal complexes also significantly decreased hepatic catalase activity. A marked decrease of 60-kDa polypeptide in liver cytoplasm was also observed on SDS-polyacrylamide gel electrophoresis after the mice had been injected with the complexes. Morphological analysis of a histopathological biopsy of such treated mice revealed several changes in hepatocytes, including focal necrosis and cell infiltration, mild fatty changes, reactive nuclei, and hypertrophy. Humic acid-metal complexes affect activities of metabolic enzymes of fatty acids, and this results in accumulation of hydrogen peroxide and increase of the lipid peroxidation. The products of lipid peroxidation may be responsible for liver damage and possible carcinogenesis. Previous studies in this laboratory had shown that humic acid-metal complex altered the coagulation system and that humic acid, per se, caused vasculopathy. Therefore, humic acid-metal complexes may be main causal factors of not only so-called blackfoot disease, but also the liver cancer prevailing on the southwestern coast of Taiwan.

  11. Preparation of functionalized and metal-impregnated activated carbon by a single-step activation method

    NASA Astrophysics Data System (ADS)

    Dastgheib, Seyed A.; Ren, Jianli; Rostam-Abadi, Massoud; Chang, Ramsay

    2014-01-01

    A rapid method to prepare functionalized and metal-impregnated activated carbon from coal is described in this paper. A mixture of ferric chloride and a sub-bituminous coal was used to demonstrate simultaneous coal activation, chlorine functionalization, and iron/iron oxides impregnation in the resulting porous carbon products. The FeCl3 concentration in the mixture, the method to prepare the FeCl3-coal mixture (solid mixing or liquid impregnation), and activation atmosphere and temperature impacted the surface area and porosity development, Cl functionalization, and iron species impregnation and dispersion in the carbon products. Samples activated in nitrogen or a simulated flue gas at 600 or 1000 °C for 1-2 min had surface areas up to ∼800 m2/g, bulk iron contents up to 18 wt%, and surface chlorine contents up to 27 wt%. Potential catalytic and adsorption application of the carbon materials was explored in catalytic wet air oxidation (CWAO) of phenol and adsorption of ionic mercury from aqueous solutions. Results indicated that impregnated activated carbons outperformed their non-impregnated counterparts in both the CWAO and adsorption tests.

  12. Antimalarial and antimicrobial activities of 8-Aminoquinoline-Uracils metal complexes

    PubMed Central

    Phopin, Kamonrat; Sinthupoom, Nujarin; Treeratanapiboon, Lertyot; Kunwittaya, Sarun; Prachayasittikul, Supaluk; Ruchirawat, Somsak; Prachayasittikul, Virapong

    2016-01-01

    8-Aminoquinoline (8AQ) derivatives have been reported to have antimalarial, anticancer, and antioxidant activities. This study investigated the potency of 8AQ-5-substituted (iodo and nitro) uracils metal (Mn, Cu, Ni) complexes (1-6) as antimalarial and antimicrobial agents. Interestingly, all of these metal complexes (1-6) showed fair antimalarial activities. Moreover, Cu complexes 2 (8AQ-Cu-5Iu) and 5 (8AQ-Cu-5Nu) exerted antimicrobial activities against Gram-negative bacteria including P. shigelloides and S. dysenteriae. The results reveal application of 8AQ and its metal complexes as potential compounds to be further developed as novel antimalarial and antibacterial agents. PMID:27103894

  13. Assessing microbial activities in metal contaminated agricultural volcanic soils--An integrative approach.

    PubMed

    Parelho, C; Rodrigues, A S; Barreto, M C; Ferreira, N G C; Garcia, P

    2016-07-01

    Volcanic soils are unique naturally fertile resources, extensively used for agricultural purposes and with particular physicochemical properties that may result in accumulation of toxic substances, such as trace metals. Trace metal contaminated soils have significant effects on soil microbial activities and hence on soil quality. The aim of this study is to determine the soil microbial responses to metal contamination in volcanic soils under different agricultural land use practices (conventional, traditional and organic), based on a three-tier approach: Tier 1 - assess soil microbial activities, Tier 2 - link the microbial activity to soil trace metal contamination and, Tier 3 - integrate the microbial activity in an effect-based soil index (Integrative Biological Response) to score soil health status in metal contaminated agricultural soils. Our results showed that microbial biomass C levels and soil enzymes activities were decreased in all agricultural soils. Dehydrogenase and β-glucosidase activities, soil basal respiration and microbial biomass C were the most sensitive responses to trace metal soil contamination. The Integrative Biological Response value indicated that soil health was ranked as: organic>traditional>conventional, highlighting the importance of integrative biomarker-based strategies for the development of the trace metal "footprint" in Andosols. PMID:27057992

  14. A mechanochemical strategy for IRMOF assembly based on pre-designed oxo-zinc precursors.

    PubMed

    Prochowicz, D; Sokołowski, K; Justyniak, I; Kornowicz, A; Fairen-Jimenez, D; Friščić, T; Lewiński, J

    2015-03-01

    We demonstrate a mechanochemical strategy that allowed the first successful mechanosynthesis of IRMOFs based on an oxo-centred secondary building unit (SBU). The presented study indicates that controlling the acid-base relationship between reagents is key to mechanochemical synthesis of IRMOFs, revealing a pre-assembled oxo-zinc amidate cluster as an efficient precursor for IRMOF mechanosynthesis.

  15. In the Maze of Chemical Nomenclature--How Students Name Oxo Salts.

    ERIC Educational Resources Information Center

    Schmidt, Hans-Jurgen

    2000-01-01

    Discusses students' (n=10,058) problems with naming oxo salts following a given formula. Many students incorrectly named oxo salts as oxides, and the students' own names for the compounds were more helpful to find the correct formula than the common names. Concludes that high school students are more interested in intellectually challenging…

  16. Heavy metal-activated synthesis of peptides in Chlamydomonas reinhardtii

    SciTech Connect

    Howe, G.; Merchant, S. )

    1992-01-01

    In this study, the authors have addressed the capacity of the green alga Chlamydomonas reinhardtii to produce metal-binding peptides in response to stress induced by the heavy metals Cd{sup 2+}, Hg{sup 2+}, and Ag{sup +}. Cells cultured in the presence of sublethal concentrations of Cd{sup 2+} synthesized and accumulated oligopeptides consisting solely of glutamic acid, cysteine, and glycine in an average ratio of 3:3:1. Cadmium-induced peptides were isolated in their native form as higher molecular weight peptide-metal complexes with an apparent molecular weight of approximately 6.5 {times} 10{sup 3}. The isolated complex bound cadmium (as evidenced by absorption spectroscopy) and sequestered (with a stoichiometry of 0.7 moles of cadmium per mole of cysteine) up to 70% of the total cadmium found in extracts of cadmium-treated cells. In Hg{sup 2+}-treated cells, the principal thiol-containing compound induced by Hg{sup 2+} ion was glutathione. It is possible that glutathione functions in plant cells (as it does in animal cells) to detoxify heavy metals. Cells treated with Ag{sup +} ions also synthesized a sulfur-containing component with a charge to mass ratio similar to Cd{sup 2+}-induced peptides. But, in contrast to the results obtained using Cd{sup 2+} as an inducer, these molecules did not accumulate to significant levels in Ag{sup +}-treated cells. The presence of physiological concentrations of Cu{sup 2+} in the growth medium blocked the synthesis of the Ag{sup +}-inducible component(s) and rendered cells resistant to the toxic effects of Ag{sup +}, suggesting competition between Cu{sup 2+} and Ag{sup +} ions, possibly at the level of metal uptake.

  17. Nitrogen Oxide Atom-Transfer Redox Chemistry; Mechanism of NO(g) to Nitrite Conversion Utilizing μ-oxo Heme-Fe(III)-O-Cu(II)(L) Constructs.

    PubMed

    Hematian, Shabnam; Kenkel, Isabell; Shubina, Tatyana E; Dürr, Maximilian; Liu, Jeffrey J; Siegler, Maxime A; Ivanovic-Burmazovic, Ivana; Karlin, Kenneth D

    2015-05-27

    While nitric oxide (NO, nitrogen monoxide) is a critically important signaling agent, its cellular concentrations must be tightly controlled, generally through its oxidative conversion to nitrite (NO2(-)) where it is held in reserve to be reconverted as needed. In part, this reaction is mediated by the binuclear heme a3/CuB active site of cytochrome c oxidase. In this report, the oxidation of NO(g) to nitrite is shown to occur efficiently in new synthetic μ-oxo heme-Fe(III)-O-Cu(II)(L) constructs (L being a tridentate or tetradentate pyridyl/alkylamino ligand), and spectroscopic and kinetic investigations provide detailed mechanistic insights. Two new X-ray structures of μ-oxo complexes have been determined and compared to literature analogs. All μ-oxo complexes react with 2 mol equiv NO(g) to give 1:1 mixtures of discrete [(L)Cu(II)(NO2(-))](+) plus ferrous heme-nitrosyl compounds; when the first NO(g) equiv reduces the heme center and itself is oxidized to nitrite, the second equiv of NO(g) traps the ferrous heme thus formed. For one μ-oxo heme-Fe(III)-O-Cu(II)(L) compound, the reaction with NO(g) reveals an intermediate species ("intermediate"), formally a bis-NO adduct, [(NO)(porphyrinate)Fe(II)-(NO2(-))-Cu(II)(L)](+) (λmax = 433 nm), confirmed by cryo-spray ionization mass spectrometry and EPR spectroscopy, along with the observation that cooling a 1:1 mixture of [(L)Cu(II)(NO2(-))](+) and heme-Fe(II)(NO) to -125 °C leads to association and generation of the key 433 nm UV-vis feature. Kinetic-thermodynamic parameters obtained from low-temperature stopped-flow measurements are in excellent agreement with DFT calculations carried out which describe the sequential addition of NO(g) to the μ-oxo complex. PMID:25974136

  18. 40 CFR 721.8673 - [(Disubstituted phenyl)]azo dihydro hydroxy alkyl oxo alkyl-substituted-pyridines (generic name).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false azo dihydro hydroxy alkyl oxo alkyl... Significant New Uses for Specific Chemical Substances § 721.8673 azo dihydro hydroxy alkyl oxo alkyl...) The chemical substances identified generically as azo dihydro hydroxy alkyl oxo...

  19. 40 CFR 721.8673 - [(Disubstituted phenyl)]azo dihydro hydroxy alkyl oxo alkyl-substituted-pyridines (generic name).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false azo dihydro hydroxy alkyl oxo alkyl... Significant New Uses for Specific Chemical Substances § 721.8673 azo dihydro hydroxy alkyl oxo alkyl...) The chemical substances identified generically as azo dihydro hydroxy alkyl oxo...

  20. 40 CFR 721.8673 - [(Disubstituted phenyl)]azo dihydro hydroxy alkyl oxo alkyl-substituted-pyridines (generic name).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false azo dihydro hydroxy alkyl oxo alkyl... Significant New Uses for Specific Chemical Substances § 721.8673 azo dihydro hydroxy alkyl oxo alkyl...) The chemical substances identified generically as azo dihydro hydroxy alkyl oxo...

  1. 40 CFR 721.8673 - [(Disubstituted phenyl)]azo dihydro hydroxy alkyl oxo alkyl-substituted-pyridines (generic name).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false azo dihydro hydroxy alkyl oxo alkyl... Significant New Uses for Specific Chemical Substances § 721.8673 azo dihydro hydroxy alkyl oxo alkyl...) The chemical substances identified generically as azo dihydro hydroxy alkyl oxo...

  2. 40 CFR 721.8673 - [(Disubstituted phenyl)]azo dihydro hydroxy alkyl oxo alkyl-substituted-pyridines (generic name).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false azo dihydro hydroxy alkyl oxo alkyl... Significant New Uses for Specific Chemical Substances § 721.8673 azo dihydro hydroxy alkyl oxo alkyl...) The chemical substances identified generically as azo dihydro hydroxy alkyl oxo...

  3. Rapidly assessing the activation conditions and porosity of metal-organic frameworks using thermogravimetric analysis

    SciTech Connect

    McDonald, TM; Bloch, ED; Long, JR

    2015-01-01

    A methodology utilizing a thermogravimetric analyzer to monitor propane uptake following incremental increases of the temperature is demonstrated as a means of rapidly identifying porous materials and determining the optimum activation conditions of metal-organic frameworks.

  4. Physicochemical properties and catalytic activity of metal tetraphenyl porphins in the oxidation of alkylaromatic hydrocarbons

    NASA Astrophysics Data System (ADS)

    Kobotaeva, N. S.; Skorokhodova, T. S.; Kokova, D. A.

    2013-06-01

    We consider the effect of complexing metal in a tetraphenylporphin molecule on its catalytic activity in oxidizing alkylaromatic hydrocarbons by molecular oxygen. The catalytic activity of metal porphyrins (Co, Cu, Zn, Mn, and In TPP) is found to depend on their oxidation potentials and the distribution of electron density in the molecule. The electron-donating compound imidazole is shown to affect the oxidation rate.

  5. Active Metal Brazing of Carbon-Carbon Composites to Titanium

    NASA Technical Reports Server (NTRS)

    Singh, M.; Shpargel, T. P.; Morscher, G.; Asthana, R.

    2004-01-01

    The Ti-metal/C-C composite joints were formed by reactive brazing with three commercial brazes, namely, Cu-ABA, TiCuNi, and TiCuSil. The joint microstructures were examined using optical microscopy, and scanning electron microscopy (SEM) coupled with energy dispersive spectrometry (EDS). The results of the microstructure analysis indicate solute redistribution across the joint which led to good wetting, spreading, and metallurgical bond formation via interdiffusion.

  6. [Activity of digestive enzymes during intraperitoneal intake of metal compounds].

    PubMed

    Zdol'nik, T D

    2001-01-01

    Digestive function was studied when three compounds from Group VIB of the Mendeleev periodic system of elements were intraperitoneally administered during 100 days. Potassium bichromate, ammonium molybdate in a dose of 0.2 mg/kg and sodium tungstate in a dose of 5.0 mg/kg (in terms of metal) were found to have a resorptive effect on pancreatic function and a local effect on the small intestinal mucosa.

  7. Cloning and divalent-metal activation of a ß-xylosidase, RUM630-BX

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The gene encoding RUM630-BX, a ß-xylosidase/arabinofuranosidase, was identified from activity-based screening of a cow rumen metagenomic library. The recombinant enzyme is activated as much as 14-fold (kcat) by divalent metals Mg2+, Mn2+ and Co2+ but not by Ca2+, Ni2+, and Zn2+. Activation of RUM6...

  8. Alkane functionalization at ([mu]-Oxo)diiron(III) centers

    SciTech Connect

    Leising, R.A.; Kim, J.; Perez, M.A.; Que, L. Jr. )

    1993-10-20

    The reactivity of ([mu]-oxo)diferric complexes with [sup t]BuOOH (TBHP) for the functionalization of alkanes in CH[sub 3]CN has been investigated as part of our efforts to model dinuclear sites in nonheme iron enzymes. [Fe[sub 2](TPA)[sub 2]O(OAc)](CIO[sub 4])[sub 3] (1) (TPA = tris(2-pyridylmethyl)amine, OAc = acetate) is an efficient catalyst for cyclohexane oxidation, affording cyclohexanol (A, 9 equiv), cyclohexanone (K, 11 equiv), and (tert-butylperoxy)cyclohexane (P, 16 equiv) in 0.25 h at ambient temperature and pressure under an argon atmosphere. The catalyst is remarkably robust, as indicated by the [sup 1]H NMR and UV-vis spectra of the reaction mixture during the catalytic reaction and by its ability to maintain its turnover efficiency with subsequent additions of oxidant. The catalytic mechanism for TBHP utilization was explored by observing the effects of varying the tripodal ligands on the ([mu]-oxo)([mu]-carboxylato)diferric catalysts and varying the bridge on Fe[sub 2]O(TPA)[sub 2] catalysts. The (A + K)/P ratio increased as the ligands became more electron donating. Solvent also played an important role in determining the partitioning of products between A + K and P, with benzonitrile favoring hydroxylated products at the expense of P and pyridine having the opposite effect. 49 refs., 2 figs., 3 tabs.

  9. pH-Dependent Metal Ion Toxicity Influences the Antibacterial Activity of Two Natural Mineral Mixtures

    PubMed Central

    Cunningham, Tanya M.; Koehl, Jennifer L.; Summers, Jack S.; Haydel, Shelley E.

    2010-01-01

    Background Recent studies have demonstrated that several mineral products sold for medicinal purposes demonstrate antimicrobial activity, but little is known about the physicochemical properties involved in antibacterial activity. Methodology/Principal Findings Using in vitro mineral suspension testing, we have identified two natural mineral mixtures, arbitrarily designated BY07 and CB07, with antibacterial activity against a broad-spectrum of bacterial pathogens. Mineral-derived aqueous leachates also exhibited antibacterial activity, revealing that chemical, not physical, mineral characteristics were responsible for the observed activity. The chemical properties essential for bactericidal activity against Escherichia coli were probed by testing antibacterial activity in the presence of metal chelators, the hydroxyl radical scavenger, thiourea, and varying pH levels. Chelation of the BY07 minerals with EDTA or desferrioxamine eliminated or reduced BY07 toxicity, respectively, suggesting a role of an acid-soluble metal species, particularly Fe3+ or other sequestered metal cations, in mineral toxicity. This conclusion was supported by NMR relaxation data, which indicated that BY07 and CB07 leachates contained higher concentrations of chemically accessible metal ions than leachates from non-bactericidal mineral samples. Conclusions/Significance We conclude that the acidic environment of the hydrated minerals significantly contributes to antibacterial activity by increasing the availability and toxicity of metal ions. These findings provide impetus for further investigation of the physiological effects of mineral products and their applications in complementary antibacterial therapies. PMID:20209160

  10. Synthesis and antimalarial activity of metal complexes of cross-bridged tetraazamacrocyclic ligands

    PubMed Central

    Hubin, Timothy J.; Amoyaw, Prince N. -A.; Roewe, Kimberly D.; Simpson, Natalie C.; Maples, Randall D.; Carder Freeman, TaRynn N.; Cain, Amy N.; Le, Justin G.; Archibald, Stephen J.; Khan, Shabana I.; Tekwani, Babu L.; Khan, M. O. Faruk

    2014-01-01

    Using transition metals such as manganese(II), iron(II), cobalt(II), nickel(II), copper(II), and zinc(II), several new metal complexes of cross-bridged tetraazamacrocyclic chelators namely, cyclen- and cyclam-analogs with benzyl groups, were synthesized and screened for in vitro antimalarial activity against chloroquine-resistant (W2) and chloroquine-sensitive (D6) strains of Plasmodium falciparum. The metal-free chelators tested showed little or no antimalarial activity. All the metal complexes of the dibenzyl cross-bridged cyclam ligand exhibited potent antimalarial activity. The Mn2+ complex of this ligand was the most potent with IC50s of 0.127 and 0.157 µM against the chloroquine-sensitive (D6) and chloroquine-resistant (W2) P. falciparum strains, respectively. In general, the dibenzyl hydrophobic ligands showed better antimalarial activity compared to the activity of monobenzyl ligands, potentially because of their higher lipophilicity and thus better cell penetration ability. The higher antimalarial activity displayed by the manganese complex for the cyclam ligand in comparison to that of the cyclen, correlates with the larger pocket of cyclam compared to that of cyclen which produces a more stable complex with the Mn2+. Few of the Cu2+ and Fe2+ complexes also showed improvement in activity but Ni2+, Co2+ and Zn2+ complexes did not show any improvement in activity upon the metal-free ligands for anti-malarial development. PMID:24857776

  11. Discovery of 4-aryl-2-oxo-2H-chromenes as a new series of apoptosis inducers using a cell- and caspase-based high-throughput screening assay.

    PubMed

    Kemnitzer, William; Jiang, Songchun; Zhang, Hong; Kasibhatla, Shailaja; Crogan-Grundy, Candace; Blais, Charles; Attardo, Giorgio; Denis, Real; Lamothe, Serge; Gourdeau, Henriette; Tseng, Ben; Drewe, John; Cai, Sui Xiong

    2008-10-15

    As a continuation of our efforts to discover and develop the apoptosis inducing 4-aryl-4H-chromenes as potential anticancer agents, we explored the removal of the chiral center at the 4-position and prepared a series of 4-aryl-2-oxo-2H-chromenes. It was found that, in general, removal of the chiral center and replacement of the 2-amino group with a 2-oxo group were tolerated and 4-aryl-2-oxo-2H-chromenes exhibited SAR similar to 4-aryl-2-amino-4H-chromenes. The 4-aryl-2-oxo-2H-chromenes with a N-methyl pyrrole fused at the 7,8-positions were highly active with compound 2a having an EC(50) value of 13 nM in T47D cells. It was found that an OMe group was preferred at the 7-position. 7-NMe(2), 7-NH(2), 7-Cl and 7,8 fused pyrido analogs all had low potency. These 4-aryl-2-oxo-2H-chromenes are a series of potent apoptosis inducers with potential advantage over the 4-aryl-2-amino-4H-chromenes series via elimination of the chiral center at the 4-position.

  12. Formation of nanostructured Group IIA metal activated sensors: The transformation of Group IIA metal compound sites

    NASA Astrophysics Data System (ADS)

    Tune, Travis C.; Baker, Caitlin; Hardy, Neil; Lin, Arthur; Widing, Timothy J.; Gole, James L.

    2015-05-01

    Trends in the Group IIA metal oxides and hydroxides of magnesium, calcium, and barium are unique in the periodic table. In this study we find that they display novel trends as decorating nanostructures for extrinsic semiconductor interfaces. The Group IIA metal ions are strong Lewis acids. We form these M2+ ions in aqueous solution and bring these solutions in contact with a porous silicon interface to form interfaces for conductometric measurements. Observed responses are consistent with the formation of MgO whereas the heavier elements display behaviors which suggest the effect of their more basic nature. Mg(OH)2, when formed, represents a weak base whereas the heavier metal hydroxides of Ca, Sr, and Ba are strong bases. However, the hydroxides tend to give up hydrogen and act as Brönsted acids. For the latter elements, the reversible interaction response of nanostructures deposited to the porous silicon (PS) interface is modified, as the formation of more basic sites appears to compete with M2+ Lewis acidity and hydroxide Brönsted acidity. Mg2+ forms an interface whose response to the analytes NH3 and NO is consistent with MgO and well explained by the recently developing Inverse Hard/Soft Acid/Base model. The behavior of the Ca2+ and Ba2+ decorated interfaces as they interact with the hard base NH3 follows a reversal of the model, indicating a decrease in acidic character as the observed conductometric response suggests the interaction with hydroxyl groups. A change from oxide-like to hydroxide-like constituents is supported by XPS studies. The changes in conductometric response is easily monitored in contrast to changes associated with the Group IIA oxides and hydroxides observed in XPS, EDAX, IR, and NMR measurements.

  13. Self-assembled biomimetic nanoreactors II: Noble metal active centers

    NASA Astrophysics Data System (ADS)

    McTaggart, Matt; Malardier-Jugroot, Cecile; Jugroot, Manish

    2015-09-01

    The structure and stability of polymer-metal nanoreactors is detailed, including a complete characterization of the first successful synthesis of stable, dispersible, atomically thin gold nanosheets. Further developments in the synthesis of monodisperse, ∼2.5 nm platinum nanoclusters in aqueous solution and ambient conditions are described and pH stability of the composite material is established. The facile nanoreactor synthesis, environmentally friendly reaction conditions, and structural stability makes these biomimetic systems attractive for applications ranging from chemical detoxification to nanoelectronics.

  14. Influence of several metal ions on the gelation activation energy of silicon tetraethoxide

    NASA Technical Reports Server (NTRS)

    Bansal, Narottam P.

    1990-01-01

    The effects of nine metal cations Li(+), Na(+), Mg(2+), Ca(2+), Sr(2+), Cu(2+), Al(3+), La(3+), and Y(3+) on silica gel formation has been investigated by studying the hydrolysis and polycondensation of silicon tetraethoxide (TEOS) in the presence of metal nitrates. The influence of water:TEOS mole ratio, metal ion concentration, and the reaction temperature has been investigated. The overall activation energy for gel formation has been determined from the temperature dependence of the time of gelation for each system. The activation energy for -Si-O-Si- network formation is found to be 54.5 kJ/mol. The gel formation time as well as the activation energy sharply increase in the presence of Cu(2+), Al(3+), La(3+) and Y(3+). In contrast, the presence of Li(+), Na(+), Mg(2+), Ca(2+), or Sr(2+) lowers the gelation time, but has no appreciable effect on the activation energy. This difference may be attributed to the participation or nonparticipation of the metal ions in the formation of the three-dimensional polymeric network during the polycondensation step. The concentration of metal ion Mg(2+), Ca(2+), Y(3+) or the water:TEOS mole ratio had no appreaciable effect on the gelation activation energy. A simple test has been proposed to determine whether a metal ion would act as a network intermediate or modifier in silica and other glassy networks.

  15. Influence of several metal ions on the gelation activation energy of silicon tetraethoxide

    NASA Technical Reports Server (NTRS)

    Bansal, Narottam P.

    1988-01-01

    The effects of nine metal cations (Li(+), Na(+), Mg(2+), Ca(2+), Sr(2+), Cu(2+), Al(3+), La(3+), and Y(3+) on silica gel formation has been investigated by studying the hydrolysis and polycondensation of silicon tetraethoxide (TEOS) in the presence of metal nitrates. The influence of water: TEOS mole ratio, metal ion concentration, and the reaction temperature has been investigated. The overall activation energy for gel formation has been determined from the temperature dependence of the time of gelation for each system. The activation energy for -Si-O-Si- network formation is found to be 54.5 kJ/mol. The gel formation time as well as the activation energy sharply increase in the presence of Cu(2+), Al(3+), La(3+) and Y(3+). In contrast, the presence of Li(+), Na(+), Mg(2+), Ca(2+), or, Sr(2+) lowers the gelation time, but has no appreciable effect on the activation energy. This difference may be attributed to the participation or nonparticipation of the metal ions in the formation of the three-dimensional polymeric network during the polycondensation step. The concentration of metal ion (Mg(2+), Ca(2+), Y(3+) or the water: TEOS mole ratio had no appreciable effect on the gelation activation energy. A simple test has been proposed to determine whether a metal ion would act as a network intermediate or modifier in silica and other glassy networks.

  16. Acute and chronic metal exposure impairs locomotion activity in Drosophila melanogaster: a model to study Parkinsonism.

    PubMed

    Bonilla-Ramirez, Leonardo; Jimenez-Del-Rio, Marlene; Velez-Pardo, Carlos

    2011-12-01

    The biometals iron (Fe), manganese (Mn) and copper (Cu) have been associated to Parkinson's disease (PD) and Parkinsonism. In this work, we report for the first time that acute (15 mM for up to 5 days) or chronic (0.5 mM for up to 15 days) Fe, Mn and Cu exposure significantly reduced life span and locomotor activity (i.e. climbing capabilities) in Drosophila melanogaster. It is shown that the concentration of those biometals dramatically increase in Drosophila's brain acutely or chronically fed with metal. We demonstrate that the metal accumulation in the fly's head is associated with the neurodegeneration of several dopaminergic neuronal clusters. Interestingly, it is found that the PPL2ab DAergic neuronal cluster was erode by the three metals in acute and chronic metal exposure and the PPL3 DAergic cluster was also erode by the three metals but in acute metal exposure only. Furthermore, we found that the chelator desferoxamine, ethylenediaminetetraacetic acid, and D: -penicillamine were able to protect but not rescue D. melanogaster against metal intoxication. Taken together these data suggest that iron, manganese and copper are capable to destroy DAergic neurons in the fly's brain, thereby impairing their movement capabilities. This work provides for the first time metal-induced Parkinson-like symptoms in D. melanogaster. Understanding therefore the effects of biometals in the Drosophila model may provide insights into the toxic effect of metal ions and more effective therapeutic approaches to Parkinsonism. PMID:21594680

  17. The role of metals in modulating metalloprotease activity in the AD brain.

    PubMed

    Filiz, Gulay; Price, Katherine A; Caragounis, Aphrodite; Du, Tai; Crouch, Peter J; White, Anthony R

    2008-03-01

    Biometals such as copper and zinc have an important role in Alzheimer's disease (AD). Accumulating evidence indicates that copper homeostasis is altered in AD brain with elevated extracellular and low intracellular copper levels. Studies in animals and cell cultures have suggested that increasing intracellular copper can ameliorate AD-like pathology including amyloid deposition and tau phosphorylation. Modulating copper homeostasis can also improve cognitive function in animal models of AD. Treatments are now being developed that may result in redistribution of copper within the brain. Metal ligands such as clioquinol (CQ), DP-109 or pyrrolidine dithiocarbamate (PDTC) have shown promising results in animal models of AD, however, the actual mode of action in vivo has not been fully determined. We previously reported that CQ-metal complexes were able to increase intracellular copper levels in vitro. This resulted in stimulation of phosphoinositol-3-kinase activity and mitogen activated protein kinases (MAPK). Increased kinase activity resulted in up-regulated matrix metalloprotease (MMP2 and MMP3) activity resulting in enhanced degradation of secreted A beta. These findings are consistent with previous studies reporting metal-mediated activation of MAPKs and MMPs. How this activation occurs is unknown but evidence suggests that copper may be able to activate membrane receptors such as the epidermal growth factor receptor (EGFR) and result in downstream activation of MAPK pathways. This has been supported by studies showing metal-mediated activation of EGFR through ligand-independent processes in a number of cell-types. Our initial studies reveal that copper complexes can in fact activate EGFR. However, further studies are necessary to determine if metal complexes such as CQ-copper induce up-regulation of A beta-degrading MMP activity through this mechanism. Elucidation of this pathway may have important implications for the development of metal ligand based

  18. Metal Ion Removal from Wastewaters by Sorption on Activated Carbon, Cement Kiln Dust, and Sawdust.

    PubMed

    Shaheen, Sabry M; Eissa, Fawzy I; Ghanem, Khaled M; El-Din, Hala M Gamal; Al Anany, Fathia S

    2015-06-01

    This study assessed the efficiency of activated carbon, cement kiln dust (CKD), and sawdust for the removal of cadmium (Cd), copper (Cu), lead (Pb), and zinc (Zn) from aqueous solutions under mono-metal and competitive sorption systems and the removal of Cd, Cu, and Zn from different industrial wastewaters. Batch equilibrium experiments were conducted in a mono-metal and competitive sorption system. The efficiency of the sorbents in the removal of Cd, Cu, and Zn from industrial wastewaters was also investigated. Cement kiln dust expressed the highest affinity for the metals followed by activated carbon and sawdust. Competition among the metals changed their distribution coefficient (Kd) with the sorbents. Sorption of Pb and Cu was higher than Cd and Zn. The average metal removal from the wastewaters varied from 74, 61, and 60% for Cd, Cu, and Zn, respectively, to nearly 100%. The efficiencies of CKD and activated carbon in removing metals were higher than sawdust, suggesting their potential as low-cost sorbents for the removal of toxic metals from wastewaters.

  19. Metal Ion Removal from Wastewaters by Sorption on Activated Carbon, Cement Kiln Dust, and Sawdust.

    PubMed

    Shaheen, Sabry M; Eissa, Fawzy I; Ghanem, Khaled M; El-Din, Hala M Gamal; Al Anany, Fathia S

    2015-06-01

    This study assessed the efficiency of activated carbon, cement kiln dust (CKD), and sawdust for the removal of cadmium (Cd), copper (Cu), lead (Pb), and zinc (Zn) from aqueous solutions under mono-metal and competitive sorption systems and the removal of Cd, Cu, and Zn from different industrial wastewaters. Batch equilibrium experiments were conducted in a mono-metal and competitive sorption system. The efficiency of the sorbents in the removal of Cd, Cu, and Zn from industrial wastewaters was also investigated. Cement kiln dust expressed the highest affinity for the metals followed by activated carbon and sawdust. Competition among the metals changed their distribution coefficient (Kd) with the sorbents. Sorption of Pb and Cu was higher than Cd and Zn. The average metal removal from the wastewaters varied from 74, 61, and 60% for Cd, Cu, and Zn, respectively, to nearly 100%. The efficiencies of CKD and activated carbon in removing metals were higher than sawdust, suggesting their potential as low-cost sorbents for the removal of toxic metals from wastewaters. PMID:26459819

  20. Quantitative assessment on soil enzyme activities of heavy metal contaminated soils with various soil properties.

    PubMed

    Xian, Yu; Wang, Meie; Chen, Weiping

    2015-11-01

    Soil enzyme activities are greatly influenced by soil properties and could be significant indicators of heavy metal toxicity in soil for bioavailability assessment. Two groups of experiments were conducted to determine the joint effects of heavy metals and soil properties on soil enzyme activities. Results showed that arylsulfatase was the most sensitive soil enzyme and could be used as an indicator to study the enzymatic toxicity of heavy metals under various soil properties. Soil organic matter (SOM) was the dominant factor affecting the activity of arylsulfatase in soil. A quantitative model was derived to predict the changes of arylsulfatase activity with SOM content. When the soil organic matter content was less than the critical point A (1.05% in our study), the arylsulfatase activity dropped rapidly. When the soil organic matter content was greater than the critical point A, the arylsulfatase activity gradually rose to higher levels showing that instead of harm the soil microbial activities were enhanced. The SOM content needs to be over the critical point B (2.42% in our study) to protect its microbial community from harm due to the severe Pb pollution (500mgkg(-1) in our study). The quantitative model revealed the pattern of variation of enzymatic toxicity due to heavy metals under various SOM contents. The applicability of the model under wider soil properties need to be tested. The model however may provide a methodological basis for ecological risk assessment of heavy metals in soil.

  1. Microfungi and Microbial Activity Along a Heavy Metal Gradient

    PubMed Central

    Nordgren, Anders; Bååth, Erland; Söderström, Bengt

    1983-01-01

    Soil fungal biomass, microfungal species composition, and soil respiration rate of conifer mor soil were studied along a steep copper and zinc gradient (up to 20,000 μg of Cu and 20,000 μg of Zn g−1 dry soil) around a brass mill near the town of Gusum in South Sweden. Fungal biomass and soil respiration rate decreased by about 75% along the metal gradient. Above 1,000 μg of Cu g−1, the decrease was clearly evident; below 1,000 μg of Cu g−1, no obvious effects were observed, but there was a tendency for a decrease in total mycelial length. No decrease in CFU was found along the gradient, but fungal species composition was drastically changed. The frequency of the genera Penicillium and Oidiodendron decreased from about 30 and 20%, respectively, at the control sites to only a few percent close to the mill. Mortierella was most frequently isolated in moderately polluted sites, but at the highest pollution levels, a decrease in isolation frequency was evident. Some fungal taxa increased in abundance towards the mill, e.g., Geomyces (from 1 to 10%), Paecilomyces (0 to 10%), and sterile forms (from 10 to 20%). Analyses with a multivariate statistical method (partial least squares) showed that organic matter content and soil moisture had little influence on the fungal community compared with the heavy metal pollution. PMID:16346316

  2. Optical activity of catalytic elements of hetero-metallic nanostructures

    NASA Astrophysics Data System (ADS)

    Antosiewicz, Tomasz J.; Apell, S. Peter; Wadell, Carl; Langhammer, Christoph

    2015-05-01

    Interaction of light with metals in the form of surface plasmons is used in a wide range of applications in which the scattering decay channel is important. The absorption channel is usually thought of as unwanted and detrimental to the efficiency of the device. This is true in many applications, however, recent studies have shown that maximization of the decay channel of surface plasmons has potentially significant uses. One of these is the creation of electron-hole pairs or hot electrons which can be used for e.g. catalysis. Here, we study the optical properties of hetero-metallic nanostructures that enhance light interaction with the catalytic elements of the nanostructures. A hybridized LSPR that matches the spectral characteristic of the light source is excited. This LSPR through coupling between the plasmonic elements maximizes light absorption in the catalytic part of the nanostructure. Numerically calculated visible light absorption in the catalytic nanoparticles is enhanced 12-fold for large catalytic disks and by more 30 for small nanoparticles on the order of 5 nm. In experiments we measure a sizable increase in the absorption cross section when small palladium nanoparticles are coupled to a large silver resonator. These observations suggest that heterometallic nanostructures can enhance catalytic reaction rates.

  3. X-ray Spectroscopic Characterization of Co(IV) and Metal-Metal Interactions in Co4O4: Electronic Structure Contributions to the Formation of High-Valent States Relevant to the Oxygen Evolution Reaction.

    PubMed

    Hadt, Ryan G; Hayes, Dugan; Brodsky, Casey N; Ullman, Andrew M; Casa, Diego M; Upton, Mary H; Nocera, Daniel G; Chen, Lin X

    2016-08-31

    The formation of high-valent states is a key factor in making highly active transition-metal-based catalysts of the oxygen evolution reaction (OER). These high oxidation states will be strongly influenced by the local geometric and electronic structures of the metal ion, which are difficult to study due to spectroscopically active and complex backgrounds, short lifetimes, and limited concentrations. Here, we use a wide range of complementary X-ray spectroscopies coupled to DFT calculations to study Co(III)4O4 cubanes and their first oxidized derivatives, which provide insight into the high-valent Co(IV) centers responsible for the activity of molecular and heterogeneous OER catalysts. The combination of X-ray absorption and 1s3p resonant inelastic X-ray scattering (Kβ RIXS) allows Co(IV) to be isolated and studied against a spectroscopically active Co(III) background. Co K- and L-edge X-ray absorption data allow for a detailed characterization of the 3d-manifold of effectively localized Co(IV) centers and provide a direct handle on the t2g-based redox-active molecular orbital. Kβ RIXS is also shown to provide a powerful probe of Co(IV), and specific spectral features are sensitive to the degree of oxo-mediated metal-metal coupling across Co4O4. Guided by the data, calculations show that electron-hole delocalization can actually oppose Co(IV) formation. Computational extension of Co4O4 to CoM3O4 structures (M = redox-inactive metal) defines electronic structure contributions to Co(IV) formation. Redox activity is shown to be linearly related to covalency, and M(III) oxo inductive effects on Co(IV) oxo bonding can tune the covalency of high-valent sites over a large range and thereby tune E(0) over hundreds of millivolts. Additionally, redox-inactive metal substitution can also switch the ground state and modify metal-metal and antibonding interactions across the cluster. PMID:27515121

  4. X-ray Spectroscopic Characterization of Co(IV) and Metal-Metal Interactions in Co4O4: Electronic Structure Contributions to the Formation of High-Valent States Relevant to the Oxygen Evolution Reaction.

    PubMed

    Hadt, Ryan G; Hayes, Dugan; Brodsky, Casey N; Ullman, Andrew M; Casa, Diego M; Upton, Mary H; Nocera, Daniel G; Chen, Lin X

    2016-08-31

    The formation of high-valent states is a key factor in making highly active transition-metal-based catalysts of the oxygen evolution reaction (OER). These high oxidation states will be strongly influenced by the local geometric and electronic structures of the metal ion, which are difficult to study due to spectroscopically active and complex backgrounds, short lifetimes, and limited concentrations. Here, we use a wide range of complementary X-ray spectroscopies coupled to DFT calculations to study Co(III)4O4 cubanes and their first oxidized derivatives, which provide insight into the high-valent Co(IV) centers responsible for the activity of molecular and heterogeneous OER catalysts. The combination of X-ray absorption and 1s3p resonant inelastic X-ray scattering (Kβ RIXS) allows Co(IV) to be isolated and studied against a spectroscopically active Co(III) background. Co K- and L-edge X-ray absorption data allow for a detailed characterization of the 3d-manifold of effectively localized Co(IV) centers and provide a direct handle on the t2g-based redox-active molecular orbital. Kβ RIXS is also shown to provide a powerful probe of Co(IV), and specific spectral features are sensitive to the degree of oxo-mediated metal-metal coupling across Co4O4. Guided by the data, calculations show that electron-hole delocalization can actually oppose Co(IV) formation. Computational extension of Co4O4 to CoM3O4 structures (M = redox-inactive metal) defines electronic structure contributions to Co(IV) formation. Redox activity is shown to be linearly related to covalency, and M(III) oxo inductive effects on Co(IV) oxo bonding can tune the covalency of high-valent sites over a large range and thereby tune E(0) over hundreds of millivolts. Additionally, redox-inactive metal substitution can also switch the ground state and modify metal-metal and antibonding interactions across the cluster.

  5. Gas-phase chemistry of bare and oxo-ligated protactinium ions: a contribution to a systematic understanding of actinide chemistry.

    PubMed

    Gibson, John K; Haire, Richard G

    2002-11-01

    Gas-phase chemistry of bare and oxo-ligated protactinium ions has been studied for the first time. Comparisons were made with thorium, uranium, and neptunium ion chemistry to further the systematic understanding of 5f elements. The rates of oxidation of Pa(+) and PaO(+) by ethylene oxide compared with those of the homologous uranium ions indicate that the first and second bond dissociation energies, BDE[Pa(+)-O] and BDE[OPa(+)-O], are approximately 800 kJ mol(-1). The relatively facile fluorination of Pa(+) to PaF(4)(+) by SF(6) is consistent with the high stability of the pentavalent oxidation state of Pa. Reactions with ethene, propene, 1-butene, and iso-butene revealed that Pa(+) is a very reactive metal ion. In analogy with U(+) chemistry, ethene was trimerized by Pa(+) to give PaC(6)H(6)(+). Reactions of Pa(+) with larger alkenes resulted in secondary and tertiary products not observed for U(+) or Np(+). The bare protactinium ion is significantly more reactive with organic substrates than are heavier actinide ions. The greatest difference between Pa and heavier actinide congeners was the exceptional dehydrogenation activity of PaO(+) with alkenes; UO(+) and NpO(+) were comparatively inert. The striking reactivity of PaO(+) is attributed to the distinctive electronic structure at the metal center in this oxide, which is considered to reflect the greater availability of the 5f electrons for participation in bonding, either directly or by promotion/hybridization with higher-energy valence orbitals.

  6. Gas-phase chemistry of bare and oxo-ligated protactinium ions: a contribution to a systematic understanding of actinide chemistry.

    PubMed

    Gibson, John K; Haire, Richard G

    2002-11-01

    Gas-phase chemistry of bare and oxo-ligated protactinium ions has been studied for the first time. Comparisons were made with thorium, uranium, and neptunium ion chemistry to further the systematic understanding of 5f elements. The rates of oxidation of Pa(+) and PaO(+) by ethylene oxide compared with those of the homologous uranium ions indicate that the first and second bond dissociation energies, BDE[Pa(+)-O] and BDE[OPa(+)-O], are approximately 800 kJ mol(-1). The relatively facile fluorination of Pa(+) to PaF(4)(+) by SF(6) is consistent with the high stability of the pentavalent oxidation state of Pa. Reactions with ethene, propene, 1-butene, and iso-butene revealed that Pa(+) is a very reactive metal ion. In analogy with U(+) chemistry, ethene was trimerized by Pa(+) to give PaC(6)H(6)(+). Reactions of Pa(+) with larger alkenes resulted in secondary and tertiary products not observed for U(+) or Np(+). The bare protactinium ion is significantly more reactive with organic substrates than are heavier actinide ions. The greatest difference between Pa and heavier actinide congeners was the exceptional dehydrogenation activity of PaO(+) with alkenes; UO(+) and NpO(+) were comparatively inert. The striking reactivity of PaO(+) is attributed to the distinctive electronic structure at the metal center in this oxide, which is considered to reflect the greater availability of the 5f electrons for participation in bonding, either directly or by promotion/hybridization with higher-energy valence orbitals. PMID:12401099

  7. Two distinct modes of metal ion binding in the nuclease active site of a viral DNA-packaging terminase: insight into the two-metal-ion catalytic mechanism.

    PubMed

    Zhao, Haiyan; Lin, Zihan; Lynn, Anna Y; Varnado, Brittany; Beutler, John A; Murelli, Ryan P; Le Grice, Stuart F J; Tang, Liang

    2015-12-15

    Many dsDNA viruses encode DNA-packaging terminases, each containing a nuclease domain that resolves concatemeric DNA into genome-length units. Terminase nucleases resemble the RNase H-superfamily nucleotidyltransferases in folds, and share a two-metal-ion catalytic mechanism. Here we show that residue K428 of a bacteriophage terminase gp2 nuclease domain mediates binding of the metal cofactor Mg(2+). A K428A mutation allows visualization, at high resolution, of a metal ion binding mode with a coupled-octahedral configuration at the active site, exhibiting an unusually short metal-metal distance of 2.42 Å. Such proximity of the two metal ions may play an essential role in catalysis by generating a highly positive electrostatic niche to enable formation of the negatively charged pentacovalent phosphate transition state, and provides the structural basis for distinguishing Mg(2+) from Ca(2+). Using a metal ion chelator β-thujaplicinol as a molecular probe, we observed a second mode of metal ion binding at the active site, mimicking the DNA binding state. Arrangement of the active site residues differs drastically from those in RNase H-like nucleases, suggesting a drifting of the active site configuration during evolution. The two distinct metal ion binding modes unveiled mechanistic details of the two-metal-ion catalysis at atomic resolution.

  8. Lumbricus terrestris L. activity increases the availability of metals and their accumulation in maize and barley.

    PubMed

    Ruiz, E; Alonso-Azcárate, J; Rodríguez, L

    2011-03-01

    The effect of the earthworm Lumbricus terrestris L. on metal availability in two mining soils was assessed by means of chemical extraction methods and a pot experiment using crop plants. Results from single and sequential extractions showed that L. terrestris had a slight effect on metal fractionation in the studied soils: only metals bound to the soil organic matter were significantly increased in some cases. However, we found that L. terrestris significantly increased root, shoot and total Pb and Zn concentrations in maize and barley for the soil with the highest concentrations of total and available metals. Specifically, shoot Pb concentration was increased by a factor of 7.5 and 3.9 for maize and barley, respectively, while shoot Zn concentration was increased by a factor of 3.7 and 1.7 for maize and barley, respectively. Our results demonstrated that earthworm activity increases the bioavailability of metals in soils. PMID:21190761

  9. Metal cofactors in the structure and activity of the fowlpox resolvase.

    PubMed

    Culyba, Matthew J; Hwang, Young; Hu, Jimmy Yan; Minkah, Nana; Ocwieja, Karen E; Bushman, Frederic D

    2010-05-28

    Poxvirus DNA replication generates linear concatemers containing many copies of the viral genome with inverted repeat sequences at the junctions between monomers. The inverted repeats refold to generate Holliday junctions, which are cleaved by the virus-encoded resolvase enzyme to form unit-length genomes. Here we report studies of the influence of metal cofactors on the activity and structure of the resolvase of fowlpox virus, which provides a tractable model for in vitro studies. Small-molecule inhibitors of related enzymes bind simultaneously to metal cofactors and nearby surface amino acid residues, so understanding enzyme-cofactor interactions is important for the design of antiviral agents. Analysis of inferred active-site residues (D7, E60, K102, D132, and D135) by mutagenesis and metal rescue experiments specified residues that contribute to binding metal ions and that multiple binding sites are probably involved. Differential electrophoretic analysis was used to map the conformation of the DNA junction when bound by resolvase. For the wild-type complex in the presence of EDTA (ethylenediaminetetraacetic acid) or Ca(2+), migration was consistent with the DNA arms arranged in near-tetrahedral geometry. However, the D7N active-site mutant resolvase held the arms in a more planar arrangement in EDTA, Ca(2+), or Mg(2+) conditions, implicating metal-dependent contacts at the active site in the larger architecture of the complex. These data show how divalent metals dictate the conformation of FPV resolvase-DNA complexes and subsequent DNA cleavage.

  10. The chemical origin and catalytic activity of coinage metals: from oxidation to dehydrogenation.

    PubMed

    Syu, Cih-Ying; Yang, Hao-Wen; Hsu, Fu-Hsing; Wang, Jeng-Han

    2014-04-28

    The high oxidation activity of coinage metals (Cu, Ag and Au) has been widely applied in various important reactions, such as oxidation of carbon monoxide, alkenes or alcohols. The catalytic behavior of those inert metals has mostly been attributable to their size effect, the physical effect. In the present study, the chemical effects on their high oxidation activity have been investigated. We mechanistically examine the direct and oxidative dehydrogenation (partial oxidation) reactions of ethanol to acetaldehyde on a series of transition metals (groups 9, 10 and 11) with identical physical characteristics and varied chemical origins using density functional theory (DFT) calculations and electronic structure analyses at the GGA-PW91 level. The energetic results show that coinage metals have much lower activation energies and higher exothermicities for the oxidative dehydrogenation steps although they have higher energy for the direct dehydrogenation reaction. In the electronic structure analyses, coinage metals with saturated d bands can efficiently donate electrons to O* and OH*, or other electronegative adspecies, and better promote their p bands to higher energy levels. The negatively charged O* and OH* with high-lying p bands are responsible for lowering the energies in oxidative steps. The mechanistic understanding well explains the better oxidation activity of coinage metals and provides valuable information on their utilization in other useful applications, for example, the dehydrogenation process. PMID:24626959

  11. The chemical origin and catalytic activity of coinage metals: from oxidation to dehydrogenation.

    PubMed

    Syu, Cih-Ying; Yang, Hao-Wen; Hsu, Fu-Hsing; Wang, Jeng-Han

    2014-04-28

    The high oxidation activity of coinage metals (Cu, Ag and Au) has been widely applied in various important reactions, such as oxidation of carbon monoxide, alkenes or alcohols. The catalytic behavior of those inert metals has mostly been attributable to their size effect, the physical effect. In the present study, the chemical effects on their high oxidation activity have been investigated. We mechanistically examine the direct and oxidative dehydrogenation (partial oxidation) reactions of ethanol to acetaldehyde on a series of transition metals (groups 9, 10 and 11) with identical physical characteristics and varied chemical origins using density functional theory (DFT) calculations and electronic structure analyses at the GGA-PW91 level. The energetic results show that coinage metals have much lower activation energies and higher exothermicities for the oxidative dehydrogenation steps although they have higher energy for the direct dehydrogenation reaction. In the electronic structure analyses, coinage metals with saturated d bands can efficiently donate electrons to O* and OH*, or other electronegative adspecies, and better promote their p bands to higher energy levels. The negatively charged O* and OH* with high-lying p bands are responsible for lowering the energies in oxidative steps. The mechanistic understanding well explains the better oxidation activity of coinage metals and provides valuable information on their utilization in other useful applications, for example, the dehydrogenation process.

  12. SEQUESTRATION OF METALS IN ACTIVE CAP MATERIALS: A LABORATORY AND NUMERICAL EVALUATION

    SciTech Connect

    Dixon, K.; Knox, A.

    2012-02-13

    Active capping involves the use of capping materials that react with sediment contaminants to reduce their toxicity or bioavailability. Although several amendments have been proposed for use in active capping systems, little is known about their long-term ability to sequester metals. Recent research has shown that the active amendment apatite has potential application for metals contaminated sediments. The focus of this study was to evaluate the effectiveness of apatite in the sequestration of metal contaminants through the use of short-term laboratory column studies in conjunction with predictive, numerical modeling. A breakthrough column study was conducted using North Carolina apatite as the active amendment. Under saturated conditions, a spike solution containing elemental As, Cd, Co, Se, Pb, Zn, and a non-reactive tracer was injected into the column. A sand column was tested under similar conditions as a control. Effluent water samples were periodically collected from each column for chemical analysis. Relative to the non-reactive tracer, the breakthrough of each metal was substantially delayed by the apatite. Furthermore, breakthrough of each metal was substantially delayed by the apatite compared to the sand column. Finally, a simple 1-D, numerical model was created to qualitatively predict the long-term performance of apatite based on the findings from the column study. The results of the modeling showed that apatite could delay the breakthrough of some metals for hundreds of years under typical groundwater flow velocities.

  13. Activation of Peroxymonosulfate by Surface-Loaded Noble Metal Nanoparticles for Oxidative Degradation of Organic Compounds.

    PubMed

    Ahn, Yong-Yoon; Yun, Eun-Tae; Seo, Ji-Won; Lee, Changha; Kim, Sang Hoon; Kim, Jae-Hong; Lee, Jaesang

    2016-09-20

    This study demonstrates the capability of noble metal nanoparticles immobilized on Al2O3 or TiO2 support to effectively activate peroxymonosulfate (PMS) and degrade select organic compounds in water. The noble metals outperformed a benchmark PMS activator such as Co(2+) (water-soluble) for PMS activation and organic compound degradation at acidic pH and showed the comparable activation capacity at neutral pH. The efficiency was found to depend on the type of noble metal (following the order of Pd > Pt ≈ Au ≫ Ag), the amount of noble metal deposited onto the support, solution pH, and the type of target organic substrate. In contrast to common PMS-activated oxidation processes that involve sulfate radical as a main oxidant, the organic compound degradation kinetics were not affected by sulfate radical scavengers and exhibited substrate dependency that resembled the PMS activated by carbon nanotubes. The results presented herein suggest that noble metals can mediate electron transfer from organic compounds to PMS to achieve persulfate-driven oxidation, rather than through reductive conversion of PMS to reactive sulfate radical. PMID:27564590

  14. Activation of Peroxymonosulfate by Surface-Loaded Noble Metal Nanoparticles for Oxidative Degradation of Organic Compounds.

    PubMed

    Ahn, Yong-Yoon; Yun, Eun-Tae; Seo, Ji-Won; Lee, Changha; Kim, Sang Hoon; Kim, Jae-Hong; Lee, Jaesang

    2016-09-20

    This study demonstrates the capability of noble metal nanoparticles immobilized on Al2O3 or TiO2 support to effectively activate peroxymonosulfate (PMS) and degrade select organic compounds in water. The noble metals outperformed a benchmark PMS activator such as Co(2+) (water-soluble) for PMS activation and organic compound degradation at acidic pH and showed the comparable activation capacity at neutral pH. The efficiency was found to depend on the type of noble metal (following the order of Pd > Pt ≈ Au ≫ Ag), the amount of noble metal deposited onto the support, solution pH, and the type of target organic substrate. In contrast to common PMS-activated oxidation processes that involve sulfate radical as a main oxidant, the organic compound degradation kinetics were not affected by sulfate radical scavengers and exhibited substrate dependency that resembled the PMS activated by carbon nanotubes. The results presented herein suggest that noble metals can mediate electron transfer from organic compounds to PMS to achieve persulfate-driven oxidation, rather than through reductive conversion of PMS to reactive sulfate radical.

  15. High reactivity of metal-free nitrogen-doped carbon nanotube for the C-H activation

    NASA Astrophysics Data System (ADS)

    Hu, Xingbang; Zhou, Zheng; Lin, Qiuxing; Wu, Youting; Zhang, Zhibing

    2011-02-01

    Generally speaking, metal is necessary to serve as the active center in C-H activation. Herein, we found that the N-C part of the metal-free nitrogen-doped carbon nanotube (NCNT) can be used as the active center in methane C-H activation. The NCNT can activate O 2 and further activate methane by the adsorbed oxygen atoms. The catalytic ability of this metal-free NCNT is comparable to these reported noble metal catalysts and enzymes. Another character being different from many previous catalysts is that both two O atoms of O 2 can be effectively used as oxidant in the catalytic cycle of NCNT.

  16. Effect of pH and metal ions on DPPH radical scavenging activity of tea.

    PubMed

    Pękal, Anna; Pyrzynska, Krystyna

    2015-02-01

    The 2,2'-diphenyl-1-picrylhydrazyl (DPPH) assay is commonly applied for the estimation of antioxidant activity of plant extracts. This article discusses the effect of a sample pH and the presence of metal ions on the results obtained using DPPH method for several tea infusions. Higher radical quenching was observed in less acidic media. The impact of metal ions depends of the types of metal ion and its concentration. Quercetin and epigallocatechin gallate were less efficient in the reaction with DPPH in the presence of Al(III). Desalting process using cation-exchange resin Dowex 50Wx8 decreased the content of metal ions in all studied tea infusions. The DPPH scavenging activity of the effluents after this process were higher than those of the primary extracts and this may be related to the actual antioxidant capacity of these samples.

  17. Activation of methane by transition metal-substituted aluminophosphate molecular sieves

    DOEpatents

    Iton, Lennox E.; Maroni, Victor A.

    1991-01-01

    Aluminophosphate molecular sieves substituted with cobalt, manganese or iron and having the AlPO.sub.4 -34 or AlPO.sub.4 -5, or related AlPO.sub.4 structure activate methane starting at approximately 350.degree. C. Between 400.degree. and 500.degree. C. and at methane pressures .ltoreq.1 atmosphere the rate of methane conversion increases steadily with typical conversion efficiencies at 500.degree. C. approaching 50% and selectivity to the production of C.sub.2+ hydrocarbons approaching 100%. The activation mechanism is based on reduction of the transition metal(III) form of the molecular sieve to the transition metal(II) form with accompanying oxidative dehydrogenation of the methane. Reoxidation of the - transition metal(II) form to the transition metal(III) form can be done either chemically (e.g., using O.sub.2) or electrochemically.

  18. The Origin of the Catalytic Activity of a Metal Hydride in CO2 Reduction.

    PubMed

    Kato, Shunsuke; Matam, Santhosh Kumar; Kerger, Philipp; Bernard, Laetitia; Battaglia, Corsin; Vogel, Dirk; Rohwerder, Michael; Züttel, Andreas

    2016-05-10

    Atomic hydrogen on the surface of a metal with high hydrogen solubility is of particular interest for the hydrogenation of carbon dioxide. In a mixture of hydrogen and carbon dioxide, methane was markedly formed on the metal hydride ZrCoHx in the course of the hydrogen desorption and not on the pristine intermetallic. The surface analysis was performed by means of time-of-flight secondary ion mass spectroscopy and near-ambient pressure X-ray photoelectron spectroscopy, for the in situ analysis. The aim was to elucidate the origin of the catalytic activity of the metal hydride. Since at the initial stage the dissociation of impinging hydrogen molecules is hindered by a high activation barrier of the oxidised surface, the atomic hydrogen flux from the metal hydride is crucial for the reduction of carbon dioxide and surface oxides at interfacial sites. PMID:27061237

  19. The active metal brazing of TZM-Mo and SiN ceramics

    NASA Astrophysics Data System (ADS)

    Stephens, J. J.; Vianco, P. T.; Hosking, F. M.

    1996-01-01

    The active metal brazing of ceramics holds the opportunity to design metal-ceramic brazing processes without conventional metallization and nickel-plating steps. Because of their intermediate thermal coefficient of expansion (TCE) properties, molybdenum and the TZM-Mo alloy (Mo-0.5Ti-0.08Zr) are attractive candidates for joining to silicon- nitride ceramics. The recently developed Fe-Ni-Co-based Thermo-Span™ alloy, with reduced TCE from room temperature up to ≈400°C, is also an attractive candidate material for 700°C joint service applications. This article discusses the wetting, solid-state aging, and mechanical behavior of unalloyed molybdenum, TZM-Moalloy, Thermo-Span alloy, and silicon-nitride ceramic brazes made with three different active-metal braze alloys.

  20. Synthesis of 24-phenyl-24-oxo steroids derived from bile acids by palladium-catalyzed cross coupling with phenylboronic acid. NMR characterization and X-ray structures.

    PubMed

    Mayorquín-Torres, Martha C; Romero-Ávila, Margarita; Flores-Álamo, Marcos; Iglesias-Arteaga, Martin A

    2013-11-01

    Palladium-catalyzed cross coupling of phenyboronic acid with acetylated bile acids in which the carboxyl functions have been activated by formation of a mixed anhydride with pivalic anhydride afforded moderate to good yield of 24-phenyl-24-oxo-steroids. Unambiguous assignments of the NMR signals were made with the aid of combined 1D and 2D NMR techniques. X-ray diffraction studies confirmed the obtained structures.

  1. Trace metals in sediments of a Mediterranean estuary affected by human activities (Acheloos river estuary, Greece).

    PubMed

    Dassenakis, M; Degaita, A; Scoullos, M

    1995-05-19

    Trace metals were studied in the sediments of the ecologically, economically and scientifically important estuary of the Acheloos river, in western Greece. Human activities (dams, agriculture, traffic, etc.) influence the estuarine system of Acheloos and in combination with the hydrological, mineralogical and morphological characteristics of the estuary affect the chemical behaviour and the distribution patterns of trace metals in its sediments. The large scale disturbance of the system is imminent in the near future as it is planned to divert approximately 50% of the river water. A study of the distribution patterns of trace metals revealed that in the estuary there are zones with different metal levels. The concentrations of most metals (Al, Fe, Cu, Ni, Zn) are elevated in three of these zones (upstream, sill, seawards). A different behaviour was observed for Mn due to its association with carbonates that were observed in significant concentrations throughout the estuarine zone. A sequential extraction procedure, applied to the sediments, indicated low percentages of easily exchangeable metals, increased mobility of Cu and Zn and increased association of Ni, Cr and Fe with the aluminosilicate lattice. Although the river is not considered to be heavily polluted, some metals have shown an enrichment in the surface sediments as a result of general anthropogenic activities not derived from point sources.

  2. Metal ion specificities for folding and cleavage activity in the Schistosoma hammerhead ribozyme

    PubMed Central

    Boots, Jennifer L.; Canny, Marella D.; Azimi, Ehsan; Pardi, Arthur

    2008-01-01

    The effects of various metal ions on cleavage activity and global folding have been studied in the extended Schistosoma hammerhead ribozyme. Fluorescence resonance energy transfer was used to probe global folding as a function of various monovalent and divalent metal ions in this ribozyme. The divalent metals ions Ca2+, Mg2+, Mn2+, and Sr2+ have a relatively small variation (less than sixfold) in their ability to globally fold the hammerhead ribozyme, which contrasts with the very large difference (>10,000-fold) in apparent rate constants for cleavage for these divalent metal ions in single-turnover kinetic experiments. There is still a very large range (>4600-fold) in the apparent rate constants for cleavage for these divalent metal ions measured in high salt (2 M NaCl) conditions where the ribozyme is globally folded. These results demonstrate that the identity of the divalent metal ion has little effect on global folding of the Schistosoma hammerhead ribozyme, whereas it has a very large effect on the cleavage kinetics. Mechanisms by which the identity of the divalent metal ion can have such a large effect on cleavage activity in the Schistosoma hammerhead ribozyme are discussed. PMID:18755844

  3. Primary amine stabilization of a dicopper(III) bis(μ-oxo) species: modeling the ligation in pMMO.

    PubMed

    Citek, Cooper; Lin, Bo-Lin; Phelps, Tim E; Wasinger, Erik C; Stack, T Daniel P

    2014-10-15

    Here we report the formation of the first examples of dicopper(III) bis(μ-oxo) complexes ligated by the primary amines, propylenediamine, and N,N,-dimethyl propylenediamine. Stabilization of these new compounds is effected at -125 °C by "core capture"- introduction of exogenous ligand to a preformed dicopper(III) bis(μ-oxo) complex supported by the peralkylated tetramethyl propylenediamine. Primary amine ligation in these compounds matches the single primary amine coordination of the putative active site of particulate methane monooxygenase (pMMO) and polysaccharide monooxygenase. Reactivity studies presented here show primary amine ligated cores are competent oxidants, capable of activating C-H bonds by an H-atom abstraction mechanism. Trends in spectroscopy, structure, and reactivity provide hints to the potential role of primary amine ligation in pMMO: increased substrate accessibility to the redox active orbitals of the Cu2O2 core and greater stabilization of the oxidant without attenuation of oxidizing power.

  4. Primary amine stabilization of a dicopper(III) bis(μ-oxo) species: modeling the ligation in pMMO.

    PubMed

    Citek, Cooper; Lin, Bo-Lin; Phelps, Tim E; Wasinger, Erik C; Stack, T Daniel P

    2014-10-15

    Here we report the formation of the first examples of dicopper(III) bis(μ-oxo) complexes ligated by the primary amines, propylenediamine, and N,N,-dimethyl propylenediamine. Stabilization of these new compounds is effected at -125 °C by "core capture"- introduction of exogenous ligand to a preformed dicopper(III) bis(μ-oxo) complex supported by the peralkylated tetramethyl propylenediamine. Primary amine ligation in these compounds matches the single primary amine coordination of the putative active site of particulate methane monooxygenase (pMMO) and polysaccharide monooxygenase. Reactivity studies presented here show primary amine ligated cores are competent oxidants, capable of activating C-H bonds by an H-atom abstraction mechanism. Trends in spectroscopy, structure, and reactivity provide hints to the potential role of primary amine ligation in pMMO: increased substrate accessibility to the redox active orbitals of the Cu2O2 core and greater stabilization of the oxidant without attenuation of oxidizing power. PMID:25268334

  5. The regulation of branched-chain 2-oxo acid dehydrogenase of liver, kidney and heart by phosphorylation.

    PubMed Central

    Hughes, W A; Halestrap, A P

    1981-01-01

    1. Incubation of mitochondria from heart, liver and kidney with [32P]phosphate allowed 32P incorporation into two intramitochondrial proteins, the decarboxylase alpha-subunit of the pyruvate dehydrogenase complex (mol.wt 42000) and a protein of mol.wt. 48000. 2. This latter protein incorporated 32P more slowly than did pyruvate dehydrogenase, was not precipitated by antibody to pyruvate dehydrogenase and showed behaviour distinct from that of pyruvate dehydrogenase towards high-speed centrifugation and pyruvate dehydrogenase phosphate phosphatase. 3. 32P incorporation into the protein was greatly diminished by the presence of 0.1 mM-4-methyl-2-oxopentanoate, but enhanced by pyruvate (1 mM), hypo-osmotic treatment of mitochondria and, under some conditions, by uncoupler. 4. The activity of branched-chain 2-oxo acid dehydrogenase was assayed in parallel experiments. Under appropriate conditions the enzyme was inhibited when 32P incorporation was increased and activated when incorporation was decreased. The data suggest that the 48000-mol.wt. phosphorylated protein is identical with the decarboxylase subunit of branched-chain 2-oxo acid dehydrogenase and that this enzyme may be controlled by a phosphorylation-dephosphorylation cycle akin to that for pyruvate dehydrogenase. 5. Strict correlation between activity and 32P incorporation was not observed, and a scheme for the regulation of the enzyme is proposed to account for these discrepancies. PMID:7316988

  6. Spectroscopic and Electronic Structure Studies of Intermediate X in Ribonucleotide Reductase R2 and Two Variants: A Description of the FeIV-Oxo Bond in the FeIII-O-FeIV Dimer

    PubMed Central

    Mití, Nataša; Clay, Michael D.; Saleh, Lana; Solomon, Edward I.

    2008-01-01

    Spectroscopic and electronic structure studies of the class I Escherichia coli ribonucleotide reductase (RNR) intermediate X and three computationally-derived model complexes are presented, compared and evaluated to determine the electronic and geometric structure of the FeIII-FeIV active site of intermediate X. Rapid freeze-quench (RFQ) EPR, absorption and MCD were used to trap intermediate X in R2 wild-type (WT) and two variants, W48A and Y122F/Y356F. RFQ-EPR spin quantitation was used to determine the relative contributions of intermediate X and radicals present, while RFQ-MCD was used to specifically probe the FeIII/FeIV active site, which displayed three FeIV d-d transitions between 16 700 – 22 600 cm-1, two FeIV d-d spin-flip transitions between 23 500 – 24 300 cm-1 and five oxo to FeIV and FeIII charge transfer (CT) transitions between 25 000 – 32 000 cm-1. The FeIV d-d transitions were perturbed in the two variants, confirming that all three d-d transitions derive from the d-π manifold. Furthermore, the FeIV d-π splittings in the WT are too large to correlate with a bis-μ-oxo structure. The assignment of the FeIV d-d transitions in WT intermediate X best correlates with a bridged μ-oxo/μ-hydroxo [FeIII(μ-O)(μ-OH)FeIV] structure. The μ-oxo/μ-hydroxo core structure provides an important σ/π superexchange pathway, which is not present in the bis-μ-oxo structure, to promote facile electron transfer from Y122 to the remote FeIV through the bent oxo bridge, thereby generating the tyrosyl radical for catalysis. PMID:17602477

  7. Active and Durable Hydrogen Evolution Reaction Catalyst Derived from Pd-Doped Metal-Organic Frameworks.

    PubMed

    Chen, Jitang; Xia, Guoliang; Jiang, Peng; Yang, Yang; Li, Ren; Shi, Ruohong; Su, Jianwei; Chen, Qianwang

    2016-06-01

    The water electrolysis is of critical importance for sustainable hydrogen production. In this work, a highly efficient and stable PdCo alloy catalyst (PdCo@CN) was synthesized by direct annealing of Pd-doped metal-organic frameworks (MOFs) under N2 atmosphere. In 0.5 M H2SO4 solution, PdCo@CN displays remarkable electrocatalytic performance with overpotential of 80 mV, a Tafel slope of 31 mV dec(-1), and excellent stability of 10 000 cycles. Our studies reveal that noble metal doped MOFs are ideal precursors for preparing highly active alloy electrocatalysts with low content of noble metal.

  8. X-ray crystal structure of divalent metal-activated ß-xyloisdase, RS223BX

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the first X-ray structure of a glycoside hydrolase family 43 ß-xylosidase, RS223BX, which is strongly activated by the addition of divalent metal cations. The 2.69 Å structure reveals that the Ca2+ cation is located at the back of the active site pocket. The Ca2+ coordinates to H274 to sta...

  9. ACTIVATION OF THE EGF RECEPTOR SIGNALING PATHWAY IN HUMAN AIRWAY EPITHELIAL CELLS EXPOSED TO METALS

    EPA Science Inventory

    We have previously shown that exposure to combustion-derived metals rapidly (within 20 min) activated mitogen-activated protein kinases (MAPK), including extracellular signal-regulated kinase (ERK), in the human bronchial epithelial cell line BEAS. To study the mechanisms respons...

  10. Regional distribution pattern of groundwater heavy metals resulting from agricultural activities

    NASA Astrophysics Data System (ADS)

    Nouri, J.; Mahvi, A. H.; Jahed, G. R.; Babaei, A. A.

    2008-09-01

    Contaminations of groundwater by heavy metals due to agricultural activities are growing recently. The objective of this study was to evaluate and map regional patterns of heavy metals (Cd, Zn and Cu) in groundwater on a plain with high agricultural activities. The study was conducted to investigate the concentration of heavy metals and distribution in groundwater in regions of Shush Danial and Andimeshk aquifers in the southern part of Iran. Presently, groundwater is the only appropriate and widely used source of drinking water for rural and urban communities in this region. The region covers an area of 1,100 km2 between the Dez and Karkhe rivers, which lead to the Persian Gulf. For this study, the region was divided into four sub-regions A, B, C and D. Additionally, 168 groundwater samples were collected from 42 water wells during the earlier months of 2004. The flame atomic absorption spectrometry (AAS-Flame) was used to measure the concentration of heavy metals in water samples and the Surfer software was used for determination of the contour map of metal distribution. The results demonstrated that in all of the samples, Cd and Zn concentrations were below the EPA MCLG and EPA secondary standard, respectively. However, the Cu contents of 4.8 % of all samples were higher than EPA MCL. It is also indicated that the concentrations of metals were more pronounced at the southern part of the studied region than at the others. The analysis of fertilizers applied for agricultural activities at this region also indicated that a great majority of the above-mentioned heavy metals were discharged into the environment. Absence of confining layers, proximity to land surface, excess agricultural activities in the southern part and groundwater flow direction that is generally from the north to the southern parts in this area make the southern region of the Shush plain especially vulnerable to pollution by heavy metals than by other contaminants.

  11. Necroptosis-Inducing Rhenium(V) Oxo Complexes

    PubMed Central

    Suntharalingam, Kogularamanan; Awuah, Samuel G.; Bruno, Peter M.; Johnstone, Timothy C.; Wang, Fang; Lin, Wei; Zheng, Yao-Rong; Page, Julia E.; Hemann, Michael T.; Lippard, Stephen J.

    2015-01-01

    Rhenium(V) oxo complexes of general formula [ReO(OMe)(N^N)Cl2], where N^N = 4,7-diphenyl-1,10-phenanthroline, 1, or 3,4,7,8-tetramethyl-1,10-phenanthroline, 2, effectively kill cancer cells by triggering necroptsosis, a non-apoptotic form of cell death. Both complexes evoke necrosome (RIP1-RIP3)-dependent intracellular ROS production and propidium iodide uptake. The complexes also induce mitochondrial membrane potential depletion, a possible downstream effect of ROS production. Apparently, 1 and 2 are the first rhenium complexes to evoke cellular events consistent with programmed necrosis in cancer cells. Furthermore, 1 and 2 display low acute toxicity in C57BL/6 mice and reasonable stability in fresh human blood. PMID:25698398

  12. Necroptosis-inducing rhenium(V) oxo complexes.

    PubMed

    Suntharalingam, Kogularamanan; Awuah, Samuel G; Bruno, Peter M; Johnstone, Timothy C; Wang, Fang; Lin, Wei; Zheng, Yao-Rong; Page, Julia E; Hemann, Michael T; Lippard, Stephen J

    2015-03-01

    Rhenium(V) oxo complexes of general formula [ReO(OMe)(N^N)Cl2], where N^N = 4,7-diphenyl-1,10-phenanthroline, 1, or 3,4,7,8-tetramethyl-1,10-phenanthroline, 2, effectively kill cancer cells by triggering necroptosis, a non-apoptotic form of cell death. Both complexes evoke necrosome (RIP1-RIP3)-dependent intracellular reactive oxygen species (ROS) production and propidium iodide uptake. The complexes also induce mitochondrial membrane potential depletion, a possible downstream effect of ROS production. Apparently, 1 and 2 are the first rhenium complexes to evoke cellular events consistent with programmed necrosis in cancer cells. Furthermore, 1 and 2 display low acute toxicity in C57BL/6 mice and reasonable stability in fresh human blood.

  13. Isolation and divalent-metal activation of a β-xylosidase, RUM630-BX.

    PubMed

    Jordan, Douglas B; Braker, Jay D; Wagschal, Kurt; Stoller, J Rose; Lee, Charles C

    2016-01-01

    The gene encoding RUM630-BX, a β-xylosidase/arabinofuranosidase, was identified from activity-based screening of a cow rumen metagenomic library. The recombinant enzyme is activated as much as 14-fold (kcat) by divalent metals Mg(2+), Mn(2+) and Co(2+) but not by Ca(2+), Ni(2+), and Zn(2+). Activation of RUM630-BX by Mg(2+) (t0.5 144 s) is slowed two-fold by prior incubation with substrate, consistent with the X-ray structure of closely related xylosidase RS223-BX that shows the divalent-metal activator is at the back of the active-site pocket so that bound substrate could block its entrance. The enzyme is considerably more active on natural substrates than artificial substrates, with activity (kcat/Km) of 299 s(-1) mM(-1) on xylotetraose being the highest reported. PMID:26672463

  14. Approach to study of heavy metal contamination effect on biological activity in Mediterranean Spanish soils

    NASA Astrophysics Data System (ADS)

    Roca-Pérez, L.; Gil, C.; Mormeneo, S.; Abad, M.; Cervera, M.; González, A.; Boluda, R.

    2009-04-01

    Heavy metal contaminated soils results in various negative environmental effects such as a decrease in biological diversity, decline crop productivity or human exposure to toxic elements in the others. The influence of heavy metal contamination in Spanish Mediterranean soils on its biological activity was studied. Non-polluted soils and heavy metal contaminated soils were sampled from different sites affected by several industrial activities. Soil characteristics, heavy metals (As, Ba, Cd, Cr, Cu, Ni, Pb, Se, Sr, Zn and V), soil organic matter, microorganism numbers, biomass microbial carbon, soil respiration and dehydrogenase activity were determined. Except to a rice farming soil, the results indicate that soils with high concentrations of As, Cd, Cr, Cu, Ni, Pb, Sr and Zn showed low soil respiration, biomass carbon and dehydrogenase activity with respect non-polluted soils with similar characteristics. Our results provide evidence that these parameters are good approach to study of heavy metal contamination effect on biological activity in Mediterranean soils. We would like to thank Spanish government-MICINN for funding and support (MICINN, project CGL2006-09776).

  15. Effect of heavy metals ions on enzyme activity in the Mediterranean mussel, Donax trunculus

    SciTech Connect

    Mizrahi, L.; Achituv, Y. )

    1989-06-01

    Heavy metal ions strongly are bound by sulfhydryl groups of proteins. Sulfhydryl binding changes the structure and enzymatic activities of proteins and causes toxic effects evident at the whole organism level. Heavy metal ions like Cd, Cu, Hg, Zn, and Pb in sufficiently high concentrations might kill organisms or cause other adverse effects that changing aquatic community structures. Bivalves are known to be heavy metal accumulators. The aim of the present study was to examine the effects of different concentrations of each of five heavy metal ions on the activity of four enzymes in D. trunculus. As it is known that heavy metals inhibit the activity of a wide range of enzymes, the authors chose representative examples of dehydrogenases (lactate and malate dehydrogenases), respiratory enzyme (cytochrome oxidase) and digestive enzyme ({alpha}-amylase). The acute effects of different concentrations of selected metals were examined. These concentrations were higher than those found usually in the locality where the animals occur, but might be encountered during a given event of pollution.

  16. Biologically activated noble metal alloys at the nanoscale: for lithium ion battery anodes.

    PubMed

    Lee, Yun Jung; Lee, Youjin; Oh, Dahyun; Chen, Tiffany; Ceder, Gerbrand; Belcher, Angela M

    2010-07-14

    We report the synthesis and electrochemical activity of gold and silver noble metals and their alloy nanowires using multiple virus clones as anode materials for lithium ion batteries. Using two clones, one for specificity (p8#9 virus) and one versatility (E4 virus), noble metal nanowires of high-aspect ratio with diameters below 50 nm were successfully synthesized with control over particle sizes, morphologies, and compositions. The biologically derived noble metal alloy nanowires showed electrochemical activities toward lithium even when the electrodes were prepared from bulk powder forms. The improvement in capacity retention was accomplished by alloy formation and surface stabilization. Although the cost of noble metals renders them a less ideal choice for lithium ion batteries, these noble metal/alloy nanowires serve as great model systems to study electrochemically induced transformation at the nanoscale. Given the demonstration of the electrochemical activity of noble metal alloy nanowires with various compositions, the M13 biological toolkit extended its utility for the study on the basic electrochemical property of materials.

  17. Observation of a Cu(II)(2) (μ-1,2-peroxo)/Cu(III)(2) (μ-oxo)(2) equilibrium and its implications for copper-dioxygen reactivity.

    PubMed

    Kieber-Emmons, Matthew T; Ginsbach, Jake W; Wick, Patrick K; Lucas, Heather R; Helton, Matthew E; Lucchese, Baldo; Suzuki, Masatatsu; Zuberbühler, Andreas D; Karlin, Kenneth D; Solomon, Edward I

    2014-05-01

    Synthesis of small-molecule Cu2 O2 adducts has provided insight into the related biological systems and their reactivity patterns including the interconversion of the Cu(II) 2 (μ-η(2) :η(2) -peroxo) and Cu(III) 2 (μ-oxo)2 isomers. In this study, absorption spectroscopy, kinetics, and resonance Raman data show that the oxygenated product of [(BQPA)Cu(I) ](+) initially yields an "end-on peroxo" species, that subsequently converts to the thermodynamically more stable "bis-μ-oxo" isomer (Keq =3.2 at -90 °C). Calibration of density functional theory calculations to these experimental data suggest that the electrophilic reactivity previously ascribed to end-on peroxo species is in fact a result of an accessible bis-μ-oxo isomer, an electrophilic Cu2 O2 isomer in contrast to the nucleophilic reactivity of binuclear Cu(II) end-on peroxo species. This study is the first report of the interconversion of an end-on peroxo to bis-μ-oxo species in transition metal-dioxygen chemistry. PMID:24700427

  18. Acute toxicity of lead, chromium, and other heavy metals to ciliates from activated sludge plants

    SciTech Connect

    Madoni, P.; Gorbi, G. ); Davoli, D. )

    1994-09-01

    Numerous papers deal with the occurrence of heavy metals in the various components of freshwater ecosystems and sewage treatment systems. However, few papers refer to the presence and effect of heavy metals in populations of aquatic cilated protozoa. In particular, the lethal concentrations (LC50) of heavy metals in ciliate populations that colonize the activated sludge or the biofilm of waste treatment plants. Ciliated protozoa are very numerous in all types of aerobic biological-treatment systems. They play an important role in the purification process removing, through predation, the major part of dispersed bacteria that cause high turbidity in the final effluent. Changes in the community structure and types of ciliate species may affect the food web of these artifical ecosystems, and may also influence the biological performance of plants. Heavy metals can limit growth of protozoa in aquatic environments. The toxicity of heavy metals in biological treatment depends mainly upon two factors, namely, metal species and concentration. Although the resistance of biological systems to metal toxicity may be enhanced greatly by proper acclimatization, a too-high metal concentration may cause serious upsets in the system. It is important to determine the concentrations of heavy metals causing lethal effects on ciliates. Madoni recently studied the acute toxicity of cadmium, copper, mercury, and zinc on six species of ciliated protozoa from activated sludge plants. The present paper describes the toxic effects of lead and chromium (VI) on 6 cilate species. The acute toxicity of Cd, Cr, Cu, Hg, Pb, and Zn on two other ciliates (Drepanomonas revoluta and Spirostomum teres) is also reported. 18 refs., 4 tabs.

  19. Density functional theory study of oxygen-atom insertion into metal-methyl bonds of iron(II), ruthenium(II), and osmium(II) complexes: study of metal-mediated C-O bond formation.

    PubMed

    Pardue, Daniel B; Mei, Jiajun; Cundari, Thomas R; Gunnoe, T Brent

    2014-03-17

    Metal-mediated C-O bond formation is a key step in hydrocarbon oxygenation catalytic cycles; however, few examples of this reaction have been reported for low-oxidation-state complexes. Oxygen insertion into a metal-carbon bond of Cp*M(CO)(OPy)R (Cp* = η(5)-pentamethylcyclopentadienyl; R = Me, Ph; OPy = pyridine-N-oxide; M = Fe, Ru, Os) was analyzed via density functional theory calculations. Oxygen-atom insertions through a concerted single-step organometallic Baeyer-Villiger pathway and a two-step pathway via a metal-oxo intermediate were studied; calculations predict that the former pathway was lower in energy. The results indicated that functionalization of M-R to M-OR (R = Me, Ph) is plausible using iron(II) complexes. Starting from Cp*Fe(CO)(OPy)Ph, the intermediate Fe-oxo showed oxyl character and, thus, is best considered an Fe(III)O(•-) complex. Oxidation of the π-acid ancillary ligand CO was facile. Substitutions of CO with dimethylamide and NH3 were calculated to lower the activation barrier by ∼1-2 kcal/mol for formation of the Fe(III)O(•-) intermediate, whereas a chloride ligand raised the activation barrier to 26 kcal/mol from 22.9 kcal/mol. PMID:24571202

  20. Roles of exogenous divalent metals in the nucleolytic activity of Cu,Zn superoxide dismutase.

    PubMed

    Jiang, Wei; Han, Yingchun; Pan, Qunhui; Shen, Tao; Liu, Changlin

    2007-04-01

    It is well known that the wild type Cu,Zn superoxide dismutase (holo SOD) catalyzes the conversion of superoxide anion to peroxide hydrogen and dioxygen. However, a new function of holo SOD, i.e., nucleolytic activity has been found [W. Jiang, T. Shen, Y. Han, Q. Pan, C. Liu, J. Biol. Inorg. Chem. 11 (2006) 835-848], which is linked to the incorporation of exogenous divalent metals into the enzyme-DNA complex. In this study, the roles of exogenous divalent metals in the nucleolytic activity were explored in detail by a series of biochemical experiments. Based on a non-equivalent multi-site binding model, affinity of a divalent metal for the enzyme-DNA complex was determined by absorption titration, indicating that the complex can provide at least a high and a low affinity site for the metal ion. These mean that the holo SOD may use a "two exogenous metal ion pathway" as a mechanism in which both metal ions are directly involved in the catalytic process of DNA cleavage. In addition, the pH versus DNA cleavage rate profiles can be fitted to two ionizing-group models, indicating the presence of a general acid and a general base in catalysis. A model that requires histidine residues, metal-bound water molecules and two hydrated metal ions to operate in concert could be used to interpret the catalysis of DNA hydrolysis, supported by the dependences of loss of the nucleolytic activity on time and on the concentration of the specific chemical modifier to the histidine residues on the enzyme. PMID:17292965

  1. X-ray Crystal Structure of Divalent Metal-Activated β-xylosidase, RS223BX.

    PubMed

    Jordan, Douglas B; Braker, Jay D; Wagschal, Kurt; Lee, Charles C; Chan, Victor J; Dubrovska, Ievgeniia; Anderson, Spencer; Wawrzak, Zdzislaw

    2015-10-01

    We report the X-ray crystal structure of a glycoside hydrolase family 43 β-xylosidase, RS223BX, which is strongly activated by the addition of divalent metal cations. The 2.69 Å structure reveals that the Ca(2+) cation is located at the back of the active-site pocket. The Ca(2+) is held in the active site by the carboxylate of D85, an "extra" acid residue in comparison to other GH43 active sites. The Ca(2+) is in close contact with a histidine imidazole, which in turn is in contact with the catalytic base (D15) thus providing a mechanism for stabilizing the carboxylate anion of the base and achieve metal activation. The active-site pocket is mirrored by an "inactive-site" pocket of unknown function that resides on the opposite side of the monomer. PMID:26201482

  2. THE STATE OF MANGANESE IN THE PHOTOSYNTHETIC APPARATUS. I. EXAFS STUDIES ON CHLOROPLASTS AND di-u-oxo BRIDGED di-MANGANESE MODEL COMPOUNDS

    SciTech Connect

    Kirby, J. A.; Robertson, A. S.; Smith, J. P.; Thompson, A. C.; Thompson, A. C.; Klein, M. P.

    1980-11-01

    Extended X-ray Absorption Fine Structure (EXAFS) studies on the manganese contained in spinach chloroplasts and on certain di-u-oxo bridged manganese dimers of the form (X{sub 2}Mn)O{sub 2}(MnX{sub 2} (X=2,2'-bypyridine and 1,10-phenanthroline) are reported. From these studies, the manganese associated with photosynthetic oxygen evolution is suggested to occur as a bridged transition metal dimer with most likely another manganese. Extensive details on the analysis are included.

  3. State of manganese in the photosynthetic apparatus. 1. Extended x-ray absorption fine structure studies on chloroplasts and di-.mu.-oxo-bridged dimanganese model compounds

    SciTech Connect

    Kirby, J. A.; Robertson, A. S.; Smith, J. P.; Thompson, A. C.; Cooper, S. R.; Klein, M. P.

    1981-09-01

    In this paper, extended X-ray absorption fine structure studies on the manganese contained in spinach chloroplasts and on certain di-p-oxo-bridged manganese dimers of the form (X2Mn)O2(MnX2) (X = 2,2'-bipyridine and 1 ,10-phenanthroline) are reported. From these studies, the manganese associated with photosynthetic oxygen evolution is suggested to occur as a bridged transition-metal dimer with most likely another manganese. Finally, extensive details on the analysis are included.

  4. Metal Ion Activation of Clostridium sordellii Lethal Toxin and Clostridium difficile Toxin B.

    PubMed

    Genth, Harald; Schelle, Ilona; Just, Ingo

    2016-04-01

    Lethal Toxin from Clostridium sordellii (TcsL) and Toxin B from Clostridium difficile (TcdB) belong to the family of the "Large clostridial glycosylating toxins." These toxins mono-O-glucosylate low molecular weight GTPases of the Rho and Ras families by exploiting UDP-glucose as a hexose donor. TcsL is casually involved in the toxic shock syndrome and the gas gangrene. TcdB-together with Toxin A (TcdA)-is causative for the pseudomembranous colitis (PMC). Here, we present evidence for the in vitro metal ion activation of the glucosyltransferase and the UDP-glucose hydrolysis activity of TcsL and TcdB. The following rating is found for activation by divalent metal ions: Mn(2+) > Co(2+) > Mg(2+) > Ca(2+), Cu(2+), Zn(2+). TcsL and TcdB thus require divalent metal ions providing an octahedral coordination sphere. The EC50 values for TcsL were estimated at about 28 µM for Mn(2+) and 180 µM for Mg(2+). TcsL and TcdB further require co-stimulation by monovalent K⁺ (not by Na⁺). Finally, prebound divalent metal ions were dispensible for the cytopathic effects of TcsL and TcdB, leading to the conclusion that TcsL and TcdB recruit intracellular metal ions for activation of the glucosyltransferase activity. With regard to the intracellular metal ion concentrations, TcsL and TcdB are most likely activated by K⁺ and Mg(2+) (rather than Mn(2+)) in mammalian target cells. PMID:27089365

  5. 'Unconventional' coordination chemistry by metal chelating fragments in a metalloprotein active site.

    PubMed

    Martin, David P; Blachly, Patrick G; Marts, Amy R; Woodruff, Tessa M; de Oliveira, César A F; McCammon, J Andrew; Tierney, David L; Cohen, Seth M

    2014-04-01

    The binding of three closely related chelators: 5-hydroxy-2-methyl-4H-pyran-4-thione (allothiomaltol, ATM), 3-hydroxy-2-methyl-4H-pyran-4-thione (thiomaltol, TM), and 3-hydroxy-4H-pyran-4-thione (thiopyromeconic acid, TPMA) to the active site of human carbonic anhydrase II (hCAII) has been investigated. Two of these ligands display a monodentate mode of coordination to the active site Zn(2+) ion in hCAII that is not recapitulated in model complexes of the enzyme active site. This unprecedented binding mode in the hCAII-thiomaltol complex has been characterized by both X-ray crystallography and X-ray spectroscopy. In addition, the steric restrictions of the active site force the ligands into a 'flattened' mode of coordination compared with inorganic model complexes. This change in geometry has been shown by density functional computations to significantly decrease the strength of the metal-ligand binding. Collectively, these data demonstrate that the mode of binding by small metal-binding groups can be significantly influenced by the protein active site. Diminishing the strength of the metal-ligand bond results in unconventional modes of metal coordination not found in typical coordination compounds or even carefully engineered active site models, and understanding these effects is critical to the rational design of inhibitors that target clinically relevant metalloproteins.

  6. Chemical activation of molecules by metals: Experimental studies of electron distributions and bonding

    SciTech Connect

    Lichtenberger, D.L.

    1992-01-01

    Purpose of this research program is to obtain experimental information on the different fundamental ways metals bond and activate organic molecules. Our approach has been to directly probe the electronic interactions between metals and molecules through a wide variety of ionization spectroscopies and other techniques, and to investigate the relationships with bonding modes, structures, and chemical behavior. During this period, we have (1) characterized the electronic features of diphosphines and monophosphines in their coordination to metals, (2) carried out theoretical and experimental investigations of the bonding capabilities of C[sub 60] to transition metals, (3) developed techniques for the imaging of single molecules on gold substrates that emphasizes the electronic backbonding from the metal to the molecule, (4) obtained the high resolution photoelectron spectrum of pure C[sub 70] in the gas phase, (5) compared the bonding of [eta][sup 3]- acetylide ligands to the bonding of other small organic molecules with metals, and (6) reported the photoelectron spectra and bonding of [eta][sup 3]-cyclopropenyl groups to metals.

  7. Metal dispersion resulting from mining activities in coastal environments: a pathways approach

    USGS Publications Warehouse

    Koski, Randolph A.

    2012-01-01

    Acid rock drainage (ARD) and disposal of tailings that result from mining activities impact coastal areas in many countries. The dispersion of metals from mine sites that are both proximal and distal to the shoreline can be examined using a pathways approach in which physical and chemical processes guide metal transport in the continuum from sources (sulfide minerals) to bioreceptors (marine biota). Large amounts of metals can be physically transported to the coastal environment by intentional or accidental release of sulfide-bearing mine tailings. Oxidation of sulfide minerals results in elevated dissolved metal concentrations in surface waters on land (producing ARD) and in pore waters of submarine tailings. Changes in pH, adsorption by insoluble secondary minerals (e.g., Fe oxyhydroxides), and precipitation of soluble salts (e.g., sulfates) affect dissolved metal fluxes. Evidence for bioaccumulation includes anomalous metal concentrations in bivalves and reef corals, and overlapping Pb isotope ratios for sulfides, shellfish, and seaweed in contaminated environments. Although bioavailability and potential toxicity are, to a large extent, functions of metal speciation, specific uptake pathways, such as adsorption from solution and ingestion of particles, also play important roles. Recent emphasis on broader ecological impacts has led to complementary methodologies involving laboratory toxicity tests and field studies of species richness and diversity.

  8. Current Status of Trace Metal Pollution in Soils Affected by Industrial Activities

    PubMed Central

    Kabir, Ehsanul; Ray, Sharmila; Kim, Ki-Hyun; Yoon, Hye-On; Jeon, Eui-Chan; Kim, Yoon Shin; Cho, Yong-Sung; Yun, Seong-Taek; Brown, Richard J. C.

    2012-01-01

    There is a growing public concern over the potential accumulation of heavy metals in soil, owing to rapid industrial development. In an effort to describe the status of the pollutions of soil by industrial activities, relevant data sets reported by many studies were surveyed and reviewed. The results of our analysis indicate that soils were polluted most significantly by metals such as lead, zinc, copper, and cadmium. If the dominant species are evaluated by the highest mean concentration observed for different industry types, the results were grouped into Pb, Zn, Ni, Cu, Fe, and As in smelting and metal production industries, Mn and Cd in the textile industry, and Cr in the leather industry. In most cases, metal levels in the studied areas were found to exceed the common regulation guideline levels enforced by many countries. The geoaccumulation index (Igeo), calculated to estimate the enrichment of metal concentrations in soil, showed that the level of metal pollution in most surveyed areas is significant, especially for Pb and Cd. It is thus important to keep systematic and continuous monitoring of heavy metals and their derivatives to manage and suppress such pollution. PMID:22645468

  9. Current status of trace metal pollution in soils affected by industrial activities.

    PubMed

    Kabir, Ehsanul; Ray, Sharmila; Kim, Ki-Hyun; Yoon, Hye-On; Jeon, Eui-Chan; Kim, Yoon Shin; Cho, Yong-Sung; Yun, Seong-Taek; Brown, Richard J C

    2012-01-01

    There is a growing public concern over the potential accumulation of heavy metals in soil, owing to rapid industrial development. In an effort to describe the status of the pollutions of soil by industrial activities, relevant data sets reported by many studies were surveyed and reviewed. The results of our analysis indicate that soils were polluted most significantly by metals such as lead, zinc, copper, and cadmium. If the dominant species are evaluated by the highest mean concentration observed for different industry types, the results were grouped into Pb, Zn, Ni, Cu, Fe, and As in smelting and metal production industries, Mn and Cd in the textile industry, and Cr in the leather industry. In most cases, metal levels in the studied areas were found to exceed the common regulation guideline levels enforced by many countries. The geoaccumulation index (I(geo)), calculated to estimate the enrichment of metal concentrations in soil, showed that the level of metal pollution in most surveyed areas is significant, especially for Pb and Cd. It is thus important to keep systematic and continuous monitoring of heavy metals and their derivatives to manage and suppress such pollution.

  10. Roles of Residues Arg-61 and Gln-38 of Human DNA Polymerase η in Bypass of Deoxyguanosine and 7,8-Dihydro-8-oxo-2'-deoxyguanosine.

    PubMed

    Su, Yan; Patra, Amritraj; Harp, Joel M; Egli, Martin; Guengerich, F Peter

    2015-06-26

    Like the other Y-family DNA polymerases, human DNA polymerase η (hpol η) has relatively low fidelity and is able to tolerate damage during DNA synthesis, including 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxoG), one of the most abundant DNA lesions in the genome. Crystal structures show that Arg-61 and Gln-38 are located near the active site and may play important roles in the fidelity and efficiency of hpol η. Site-directed mutagenesis was used to replace these side chains either alone or together, and the wild type or mutant proteins were purified and tested by replicating DNA past deoxyguanosine (G) or 8-oxoG. The catalytic activity of hpol η was dramatically disrupted by the R61M and Q38A/R61A mutations, as opposed to the R61A and Q38A single mutants. Crystal structures of hpol η mutant ternary complexes reveal that polarized water molecules can mimic and partially compensate for the missing side chains of Arg-61 and Gln-38 in the Q38A/R61A mutant. The combined data indicate that the positioning and positive charge of Arg-61 synergistically contribute to the nucleotidyl transfer reaction, with additional influence exerted by Gln-38. In addition, gel filtration chromatography separated multimeric and monomeric forms of wild type and mutant hpol η, indicating the possibility that hpol η forms multimers in vivo. PMID:25947374

  11. Adsorption of aqueous metal ions on cattle-manure-compost based activated carbons.

    PubMed

    Zaini, Muhammad Abbas Ahmad; Okayama, Reiko; Machida, Motoi

    2009-10-30

    The objective of this study is to examine the suitability and performance of cattle-manure-compost (CMC) based activated carbons in removing heavy metal ions from aqueous solution. The influence of ZnCl(2) activation ratios and solution pH on the removal of Cu(II) and Pb(II) were studied. Pore texture, available surface functional groups, pH of point zero charge (pH(PZC)), thermogravimetric analysis and elemental compositions were obtained to characterize the activated carbons. Batch adsorption technique was used to determine the metal-binding ability of activated carbons. The equilibrium data were characterized using Langmuir, Freundlich and Redlich-Peterson models. It was found that the uptake of aqueous metal ions by activated carbons could be well described by Langmuir equation. It is suggested that the increase of surface area and mesopore ratio as a result of increasing activation ratios favored the removal of Cu(II), while activated carbon rich in acidic groups showed selective adsorption towards Pb(II). The preferable removal of Cu(II) over Pb(II) could be due to the rich nitrogen content as well as the higher mesoporous surface area in the CMC activated carbons. The impregnated CMC activated carbons also showed a better performance for Cu(II) removal at varying solution pH than Filtrasorb 400 (F400), while a similar performance was observed for Pb(II) removal. PMID:19541418

  12. Activation and inhibition of rubber transferases by metal cofactors and pyrophosphate substrates.

    PubMed

    Scott, Deborah J; da Costa, Bernardo M T; Espy, Stephanie C; Keasling, Jay D; Cornish, Katrina

    2003-09-01

    Metal cofactors are necessary for the activity of alkylation by prenyl transfer in enzyme-catalyzed reactions. Rubber transferase (RuT, a cis-prenyl transferase) associated with purified rubber particles from Hevea brasiliensis, Parthenium argentatum and Ficus elastica can use magnesium and manganese interchangably to achieve maximum velocity. We define the concentration of activator required for maximum velocity as [A](max). The [A](max)(Mg2+) in F. elastica (100 mM) is 10 times the [A](max)(Mg2+) for either H. brasiliensis (10 mM) or P. argentatum (8 mM). The [A](max)(Mn2+) in F. elastica (11 mM), H. brasiliensis (3.8 mM) and P. argentatum (6.8 mM) and the [A](max)(Mg2+) in H. brasiliensis (10 mM) and P. argentatum (8 mM) are similar. The differences in [A](max)(Mg2+) correlate with the actual endogenous Mg(2+) concentrations in the latex of living plants. Extremely low Mn(2+) levels in vivo indicate that Mg(2+) is the RuT cofactor in living H. brasiliensis and F. elastica trees. Kinetic analyses demonstrate that FPP-Mg(2+) and FPP-Mn(2+) are active substrates for rubber molecule initiation, although free FPP and metal cations, Mg(2+) and Mn(2+), can interact independently at the active site with the following relative dissociation constants K(d)(FPP) Metal) Metal). Similarly, IPP-Mg(2+) and IPP-Mn(2+) are active substrates for rubber molecule polymerization. Although metal cations can interact independently at the active site with the relative dissociation constant K(d)(IPP-Metal) Metal), unlike FPP, IPP alone does not interact independently. All three RuTs have similar characteristics-indeterminate sized products, high K(m)(IPP), high metal [A](max), metal cofactor requirements, and are membrane-bound enzymes. PMID:12946411

  13. A Bioluminescence Assay System for Imaging Metal Cationic Activities in Urban Aerosols.

    PubMed

    Kim, Sung-Bae; Naganawa, Ryuichi; Murata, Shingo; Nakayama, Takayoshi; Miller, Simon; Senda, Toshiya

    2016-01-01

    A bioluminescence-based assay system was fabricated for an efficient determination of the activities of air pollutants. The following four components were integrated into this assay system: (1) an 8-channel assay platform uniquely designed for simultaneously sensing multiple optical samples, (2) single-chain probes illuminating toxic chemicals or heavy metal cations from air pollutants, (3) a microfluidic system for circulating medium mimicking the human body, and (4) the software manimulating the above system. In the protocol, we briefly introduce how to integrate the components into the system and the application to the illumination of the metal cationic activities in air pollutants. PMID:27424913

  14. A Bioluminescence Assay System for Imaging Metal Cationic Activities in Urban Aerosols.

    PubMed

    Kim, Sung-Bae; Naganawa, Ryuichi; Murata, Shingo; Nakayama, Takayoshi; Miller, Simon; Senda, Toshiya

    2016-01-01

    A bioluminescence-based assay system was fabricated for an efficient determination of the activities of air pollutants. The following four components were integrated into this assay system: (1) an 8-channel assay platform uniquely designed for simultaneously sensing multiple optical samples, (2) single-chain probes illuminating toxic chemicals or heavy metal cations from air pollutants, (3) a microfluidic system for circulating medium mimicking the human body, and (4) the software manimulating the above system. In the protocol, we briefly introduce how to integrate the components into the system and the application to the illumination of the metal cationic activities in air pollutants.

  15. Exposure to airborne metals and particulate matter and risk for youth adjudicated for criminal activity

    SciTech Connect

    Haynes, Erin N.; Chen, Aimin; Ryan, Patrick; Succop, Paul; Wright, John; Dietrich, Kim N.

    2011-11-15

    Antisocial behavior is a product of multiple interacting sociohereditary variables, yet there is increasing evidence that metal exposure, particularly, manganese and lead, play a role in its epigenesis. Other metals, such as arsenic, cadmium, chromium, and mercury, and exposure to traffic-related air pollution, such as fine particulate matter ({<=}2.5 {mu}m) have been associated with neurological deficits, yet largely unexplored with respect to their relationship with delinquent behavior. The purpose of this study is to evaluate the ecological relationship between county-wide reported airborne emissions of air metals, particulate matter, and youth adjudicated for criminal activity. Metal exposure data were collected from the Environmental Protection Agency AirData. Population statistics were obtained from the United States Census 2000 and adjudication data was obtained from the Courts of Common Pleases from each Ohio County. Simple correlations were calculated with the percentage of adjudications, all covariates, and estimated metal air emissions. Separate negative binomial regression models for each pollutant were used to provide an estimated risk ratio of pollutant emissions on the risk of adjudication for all Ohio counties adjusting for urban-rural residence, percentage of African Americans, median family income, percentage of family below poverty, percentage of high school graduation in 25 years and older populations, and population density. Metal emissions and PM in 1999 were all correlated with adjudication rate (2003-2005 average). Metal emissions were associated with slightly higher risk of adjudication, with about 3-4% increased risk per natural log unit of metal emission except chromium. The associations achieved statistical significance for manganese and mercury. The particulate matter {<=}2.5 and {<=}10 {mu}m emissions had a higher risk estimate, with 12% and 19% increase per natural log unit emission, respectively, and also achieved statistical

  16. Photoreduction of SERS-active metallic nanostructures on chemically patterned ferroelectric crystals.

    PubMed

    Carville, N Craig; Manzo, Michele; Damm, Signe; Castiella, Marion; Collins, Liam; Denning, Denise; Weber, Stefan A L; Gallo, Katia; Rice, James H; Rodriguez, Brian J

    2012-08-28

    Photodeposition of metallic nanostructures onto ferroelectric surfaces is typically based on patterning local surface reactivity via electric field poling. Here, we demonstrate metal deposition onto substrates which have been chemically patterned via proton exchange (i.e., without polarization reversal). The chemical patterning provides the ability to tailor the electrostatic fields near the surface of lithium niobate crystals, and these engineered fields are used to fabricate metallic nanostructures. The effect of the proton exchange process on the piezoelectric and electrostatic properties of the surface is characterized using voltage-modulated atomic force microscopy techniques, which, combined with modeling of the electric fields at the surface of the crystal, reveal that the deposition occurs preferentially along the boundary between ferroelectric and proton-exchanged regions. The metallic nanostructures have been further functionalized with a target probe molecule, 4-aminothiophenol, from which surface-enhanced Raman scattering (SERS) signal is detected, demonstrating the suitability of chemically patterned ferroelectrics as SERS-active templates.

  17. Periodic trends in the hydrodenitrogenation activity of carbon-supported transition metal sulfide catalysts

    SciTech Connect

    Eijsbouts, S.; De Beer, V.H.J.; Prins, R.

    1988-01-01

    Periodic trends of transition metals for the catalysis of reactions such as hydrogenation, hydrogenolysis, isomerization and hydrogen oxidation have been well studied. When activity versus position of the transition metal in the periodic table is plotted, quite often these trends are manifested in the form of so-called volcano-type curves. In the present study, the authors have chosen the HDN of quinoline at moderately high pressure as a model reaction, and they have used the same carbon-supported transition metal sulfide catalysts studied by Vissers et al. Results are shown for the following transition metals: V, Cr, Mn, Fe, Co, Ni, Mo, Ru, Rh, Pd, W, Re, Os, Ir, and Pt. 9 references.

  18. Potential metal impurities in active pharmaceutical substances and finished medicinal products - A market surveillance study.

    PubMed

    Wollein, Uwe; Bauer, Bettina; Habernegg, Renate; Schramek, Nicholas

    2015-09-18

    A market surveillance study has been established by using different atomic spectrometric methods for the determination of selected elemental impurities of particular interest, to gain an overview about the quality of presently marketed drug products and their bulk drug substances. The limit tests were carried out with respect to the existing EMA guideline on the specification limits for residuals of metal catalysts or metal reagents. Also attention was given to the future implementation of two new chapters of the United States Pharmacopoeia (USP) stating limit concentrations of elemental impurities. The methods used for determination of metal residues were inductively coupled plasma-mass spectrometry (ICP-MS), inductively coupled plasma-optical emission spectrometry (ICP-OES), and atomic absorption spectrometry technologies (GFAAS, CVAAS, HGAAS). This article presents the development and validation of the methods used for the determination of 21 selected metals in 113 samples from drug products and their active pharmaceutical ingredients.

  19. Potential metal impurities in active pharmaceutical substances and finished medicinal products - A market surveillance study.

    PubMed

    Wollein, Uwe; Bauer, Bettina; Habernegg, Renate; Schramek, Nicholas

    2015-09-18

    A market surveillance study has been established by using different atomic spectrometric methods for the determination of selected elemental impurities of particular interest, to gain an overview about the quality of presently marketed drug products and their bulk drug substances. The limit tests were carried out with respect to the existing EMA guideline on the specification limits for residuals of metal catalysts or metal reagents. Also attention was given to the future implementation of two new chapters of the United States Pharmacopoeia (USP) stating limit concentrations of elemental impurities. The methods used for determination of metal residues were inductively coupled plasma-mass spectrometry (ICP-MS), inductively coupled plasma-optical emission spectrometry (ICP-OES), and atomic absorption spectrometry technologies (GFAAS, CVAAS, HGAAS). This article presents the development and validation of the methods used for the determination of 21 selected metals in 113 samples from drug products and their active pharmaceutical ingredients. PMID:26036232

  20. Regioselective hypervalent iodine-induced Favorskii rearrangement of 3-oxo-5β-steroids.

    PubMed

    Viviano-Posadas, Alejandro O; Flores-Álamo, Marcos; Iglesias-Arteaga, Martín A

    2016-09-01

    Treatment of 3-oxo-5β-steroids with diacetoxyiodobenzene/KOH triggered a fast and regioselective Favorskii rearrangement that exclusively led to 3β-methoxycarbonyl-5β-4-norsteroids in good yields. The outcome of the reaction indicates that although both Cyclopropanone and Semi-benzylic pathways are possible, in the case of 3-oxo-5β-steroids, only the last participates. Unambiguous characterization of the products was achieved by NMR and X-ray Diffraction studies.

  1. Activated phosphors having matrices of yttrium-transition metal compound

    DOEpatents

    De Kalb, E.L.; Fassel, V.A.

    1975-07-01

    A method is described for preparing a phosphor composition containing a lanthanide activator element with a host matrix having a transition element as a major component. The host matrix is composed of certain rare earth phosphates or vanadates such as YPO$sub 4$ with a portion of the rare earth replaced with one or more of the transition elements. On x-ray or other electromagnetic excitation, trace lanthanide impurities or additives within the phosphor are spectrometrically determined from their characteristic luminescence. (auth)

  2. An approach to preparing porous and hollow metal phosphides with higher hydrodesulfurization activity

    SciTech Connect

    Song Limin; Zhang Shujuan; Wei Qingwu

    2011-06-15

    This paper describes an effective method for the synthesis of metal phosphides. Bulk and supported Ni{sub 2}P, Cu{sub 3}P, and CoP were prepared by thermal treatment of metal and the amorphous red phosphorus mixtures. Porous and hollow Ni{sub 2}P particles were also synthesized successfully using this method. The structural properties of these products are investigated using X-ray powder diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), inductively coupled plasma (ICP-AES) and X-ray photoemission spectroscopy (XPS). A rational mechanism was proposed for the selective formation of Ni{sub 2}P particles. In experimental conditions, the Ni{sub 2}P/SiO{sub 2} catalyst exhibits excellent hydrodesulfurization (HDS) activity for dibenzothiophene (DBT). - Graphical abstract: Bulk and supported Ni{sub 2}P, Cu{sub 3}P, and CoP were prepared by thermal treatment of their metal and amorphous red phosphorus mixtures. Porous and hollow Ni{sub 2}P particles were successfully synthesized by this method also. In the experimental condition, a Ni{sub 2}P/SiO{sub 2} catalyst exhibits excellent hydrodesulfurization activity for dibenzothiophene. Highlights: > A new synthetic route by heat treating mixtures of metal and red phosphorus in flowing N{sub 2} to prepare corresponding metal phosphides. > Porous and hollow Ni{sub 2}P particles may successfully be obtained using the route. > It is very easy to synthesize other bulk and supported metal phosphides using the mixing of bulk and supported metal and red phosphorus by the method. > The Ni{sub 2}P/SiO{sub 2} catalyst synthesized by the route shows a good HDS of dibenzothiophene. > Its operation is simple (only heat treating pure metal and red phosphorus), and the reaction time is short (only 0.5 h).

  3. Metal-based biologically active azoles and β-lactams derived from sulfa drugs.

    PubMed

    Ebrahimi, Hossein Pasha; Hadi, Jabbar S; Almayah, Abdulelah A; Bolandnazar, Zeinab; Swadi, Ali G; Ebrahimi, Amirpasha

    2016-03-01

    Metal complexes of Schiff bases derived from sulfamethoxazole (SMZ) and sulfathiazole (STZ), converted to their β-lactam derivatives have been synthesized and experimentally characterized by elemental analysis, spectral (IR, (1)H NMR, (13)C NMR, and EI-mass), molar conductance measurements and thermal analysis techniques. The structural and electronic properties of the studied molecules were investigated theoretically by performing density functional theory (DFT) to access reliable results to the experimental values. The spectral and thermal analysis reveals that the Schiff bases act as bidentate ligands via the coordination of azomethine nitrogen to metal ions as well as the proton displacement from the phenolic group through the metal ions; therefore, Cu complexes can attain the square planner arrangement and Zn complexes have a distorted tetrahedral structure. The thermogravimetric (TG/DTG) analyses confirm high stability for all complexes followed by thermal decomposition in different steps. In addition, the antibacterial activities of synthesized compounds have been screened in vitro against various pathogenic bacterial species. Inspection of the results revealed that all newly synthesized complexes individually exhibit varying degrees of inhibitory effects on the growth of the tested bacterial species, therefore, they may be considered as drug candidates for bacterial pathogens. The free Schiff base ligands (1-2) exhibited a broad spectrum antibacterial activity against Gram negative Escherichia coli, Pseudomonas aeruginosa, and Proteus spp., and Gram positive Staphylococcus aureus bacterial strains. The results also indicated that the β-lactam derivatives (3-4) have high antibacterial activities on Gram positive bacteria as well as the metal complexes (5-8), particularly Zn complexes, have a significant activity against all Gram negative bacterial strains. It has been shown that the metal complexes have significantly higher activity than corresponding

  4. Stable isolated metal atoms as active sites for photocatalytic hydrogen evolution.

    PubMed

    Xing, Jun; Chen, Jian Fu; Li, Yu Hang; Yuan, Wen Tao; Zhou, Ying; Zheng, Li Rong; Wang, Hai Feng; Hu, P; Wang, Yun; Zhao, Hui Jun; Wang, Yong; Yang, Hua Gui

    2014-02-17

    The process of using solar energy to split water to produce hydrogen assisted by an inorganic semiconductor is crucial for solving our energy crisis and environmental problems in the future. However, most semiconductor photocatalysts would not exhibit excellent photocatalytic activity without loading suitable co-catalysts. Generally, the noble metals have been widely applied as co-catalysts, but always agglomerate during the loading process or photocatalytic reaction. Therefore, the utilization efficiency of the noble co-catalysts is still very low on a per metal atom basis if no obvious size effect exists, because heterogeneous catalytic reactions occur on the surface active atoms. Here, for the first time, we have synthesized isolated metal atoms (Pt, Pd, Rh, or Ru) stably by anchoring on TiO2 , a model photocatalystic system, by a facile one-step method. The isolated metal atom based photocatalysts show excellent stability for H2 evolution and can lead to a 6-13-fold increase in photocatalytic activity over the metal clusters loaded on TiO2 by the traditional method. Furthermore, the configurations of isolated atoms as well as the originality of their unusual stability were analyzed by a collaborative work from both experiments and theoretical calculations.

  5. Secondary cell with orthorhombic alkali metal/manganese oxide phase active cathode material

    DOEpatents

    Doeff, M.M.; Peng, M.Y.; Ma, Y.; Visco, S.J.; DeJonghe, L.C.

    1996-09-24

    An alkali metal manganese oxide secondary cell is disclosed which can provide a high rate of discharge, good cycling capabilities, good stability of the cathode material, high specific energy (energy per unit of weight) and high energy density (energy per unit volume). The active material in the anode is an alkali metal and the active material in the cathode comprises an orthorhombic alkali metal manganese oxide which undergoes intercalation and deintercalation without a change in phase, resulting in a substantially linear change in voltage with change in the state of charge of the cell. The active material in the cathode is an orthorhombic structure having the formula M{sub x}Z{sub y}Mn{sub (1{minus}y)}O{sub 2}, where M is an alkali metal; Z is a metal capable of substituting for manganese in the orthorhombic structure such as iron, cobalt or titanium; x ranges from about 0.2 in the fully charged state to about 0.75 in the fully discharged state, and y ranges from 0 to 60 atomic %. Preferably, the cell is constructed with a solid electrolyte, but a liquid or gelatinous electrolyte may also be used in the cell. 11 figs.

  6. Highly active oxygen reduction non-platinum group metal electrocatalyst without direct metal–nitrogen coordination

    PubMed Central

    Strickland, Kara; Miner, Elise; Jia, Qingying; Tylus, Urszula; Ramaswamy, Nagappan; Liang, Wentao; Sougrati, Moulay-Tahar; Jaouen, Frédéric; Mukerjee, Sanjeev

    2015-01-01

    Replacement of noble metals in catalysts for cathodic oxygen reduction reaction with transition metals mostly create active sites based on a composite of nitrogen-coordinated transition metal in close concert with non-nitrogen-coordinated carbon-embedded metal atom clusters. Here we report a non-platinum group metal electrocatalyst with an active site devoid of any direct nitrogen coordination to iron that outperforms the benchmark platinum-based catalyst in alkaline media and is comparable to its best contemporaries in acidic media. In situ X-ray absorption spectroscopy in conjunction with ex situ microscopy clearly shows nitrided carbon fibres with embedded iron particles that are not directly involved in the oxygen reduction pathway. Instead, the reaction occurs primarily on the carbon–nitrogen structure in the outer skin of the nitrided carbon fibres. Implications include the potential of creating greater active site density and the potential elimination of any Fenton-type process involving exposed iron ions culminating in peroxide initiated free-radical formation. PMID:26059552

  7. Metal Complexes of Macrocyclic Schiff-Base Ligand: Preparation, Characterisation, and Biological Activity

    PubMed Central

    Ahmed, Riyadh M.; Yousif, Enaam I.; Hasan, Hasan A.; Al-Jeboori, Mohamad J.

    2013-01-01

    A new macrocyclic multidentate Schiff-base ligand Na4L consisting of two submacrocyclic units (10,21-bis-iminomethyl-3,6,14,17-tricyclo[17.3.1.18,12]tetracosa-1(23),2,6,8,10,12(24),13,17,19,21,-decaene-23,24-disodium) and its tetranuclear metal complexes with Mn(II), Co(II), Ni(II), Cu(II), and Zn(II) are reported. Na4L was prepared via a template approach, which is based on the condensation reaction of sodium 2,4,6-triformyl phenolate with ethylenediamine in mole ratios of 2 : 3. The tetranuclear macrocyclic-based complexes were prepared from the reaction of the corresponding metal chloride with the ligand. The mode of bonding and overall geometry of the compounds were determined through physicochemical and spectroscopic methods. These studies revealed tetrahedral geometries about Mn, Co, and Zn atoms. However, square planar geometries have been suggested for NiII and CuII complexes. Biological activity of the ligand and its metal complexes against Gram positive bacterial strain Staphylococcus aureus and Gram negative bacteria Escherichia coli revealed that the metal complexes become more potentially resistive to the microbial activities as compared to the free ligand. However, these metal complexes do not exhibit any effects on the activity of Pseudomonas aeruginosa bacteria. There is therefore no inhibition zone. PMID:23935414

  8. Spectroscopic characterization of metal complexes of novel Schiff base. Synthesis, thermal and biological activity studies

    NASA Astrophysics Data System (ADS)

    Omar, M. M.; Mohamed, Gehad G.; Ibrahim, Amr A.

    2009-07-01

    Novel Schiff base (HL) ligand is prepared via condensation of 4-aminoantipyrine and 2-aminobenzoic acid. The ligand is characterized based on elemental analysis, mass, IR and 1H NMR spectra. Metal complexes are reported and characterized based on elemental analyses, IR, 1H NMR, solid reflectance, magnetic moment, molar conductance and thermal analyses (TGA, DrTGA and DTA). The molar conductance data reveal that all the metal chelates are non-electrolytes. IR spectra show that HL is coordinated to the metal ions in a uninegatively tridentate manner with NNO donor sites of the azomethine N, amino N and deprotonated caroxylic-O. From the magnetic and solid reflectance spectra, it is found that the geometrical structures of these complexes are octahedral. The thermal behaviour of these chelates shows that the hydrated complexes losses water molecules of hydration in the first step followed immediately by decomposition of the anions and ligand molecules in the subsequent steps. The activation thermodynamic parameters, such as, E*, ΔH*, ΔS* and ΔG* are calculated from the DrTG curves using Coats-Redfern method. The synthesized ligands, in comparison to their metal complexes also were screened for their antibacterial activity against bacterial species, Escherichia Coli, Pseudomonas aeruginosa, Staphylococcus Pyogones and Fungi (Candida). The activity data show that the metal complexes to be more potent/antibacterial than the parent Shciff base ligand against one or more bacterial species.

  9. Secondary cell with orthorhombic alkali metal/manganese oxide phase active cathode material

    DOEpatents

    Doeff, Marca M.; Peng, Marcus Y.; Ma, Yanping; Visco, Steven J.; DeJonghe, Lutgard C.

    1996-01-01

    An alkali metal manganese oxide secondary cell is disclosed which can provide a high rate of discharge, good cycling capabilities, good stability of the cathode material, high specific energy (energy per unit of weight) and high energy density (energy per unit volume). The active material in the anode is an alkali metal and the active material in the cathode comprises an orthorhombic alkali metal manganese oxide which undergoes intercalation and deintercalation without a change in phase, resulting in a substantially linear change in voltage with change in the state of charge of the cell. The active material in the cathode is an orthorhombic structure having the formula M.sub.x Z.sub.y Mn.sub.(1-y) O.sub.2, where M is an alkali metal; Z is a metal capable of substituting for manganese in the orthorhombic structure such as iron, cobalt or titanium; x ranges from about 0.2 in the fully charged state to about 0.75 in the fully discharged state, and y ranges from 0 to 60 atomic %. Preferably, the cell is constructed with a solid electrolyte, but a liquid or gelatinous electrolyte may also be used in the cell.

  10. Measuring the Noble Metal and Iodine Composition of Extracted Noble Metal Phase from Spent Nuclear Fuel Using Instrumental Neutron Activation Analysis

    SciTech Connect

    Palomares, R. I.; Dayman, Kenneth J.; Landsberger, Sheldon; Biegalski, Steven R.; Soderquist, Chuck Z.; Casella, Amanda J.; Brady Raap, Michaele C.; Schwantes, Jon M.

    2015-04-01

    Mass quantities of noble metal and iodine nuclides in the metallic noble metal phase extracted from spent fuel are measured using instrumental neutron activation analysis (NAA). Nuclide presence is predicted using fission yield analysis, and mass quantification is derived from standard gamma spectroscopy and radionuclide decay analysis. The nuclide compositions of noble metal phase derived from two dissolution methods, UO2 fuel dissolved in nitric acid and UO2 fuel dissolved in ammonium-carbonate and hydrogen-peroxide solution, are compared. Lastly, the implications of the rapid analytic speed of instrumental NAA are discussed in relation to potential nuclear forensics applications.

  11. Discovery of an Allosteric Inhibitor Binding Site in 3-Oxo-acyl-ACP Reductase from Pseudomonas aeruginosa

    PubMed Central

    2013-01-01

    3-Oxo-acyl-acyl carrier protein (ACP) reductase (FabG) plays a key role in the bacterial fatty acid synthesis II system in pathogenic microorganisms, which has been recognized as a potential drug target. FabG catalyzes reduction of a 3-oxo-acyl-ACP intermediate during the elongation cycle of fatty acid biosynthesis. Here, we report gene deletion experiments that support the essentiality of this gene in P. aeruginosa and the identification of a number of small molecule FabG inhibitors with IC50 values in the nanomolar to low micromolar range and good physicochemical properties. Structural characterization of 16 FabG-inhibitor complexes by X-ray crystallography revealed that the compounds bind at a novel allosteric site located at the FabG subunit–subunit interface. Inhibitor binding relies primarily on hydrophobic interactions, but specific hydrogen bonds are also observed. Importantly, the binding cavity is formed upon complex formation and therefore would not be recognized by virtual screening approaches. The structure analysis further reveals that the inhibitors act by inducing conformational changes that propagate to the active site, resulting in a displacement of the catalytic triad and the inability to bind NADPH. PMID:24015914

  12. Electro-active Polymer Actuator Based on Sulfonated Polyimide with Highly Conductive Silver Electrodes Via Self-metallization.

    PubMed

    Song, Jiangxuan; Jeon, Jin-Han; Oh, Il-Kwon; Park, K C

    2011-10-01

    We report here a facile synthesis of high performance electro-active polymer actuator based on a sulfonated polyimide with well-defined silver electrodes via self-metallization. The proposed method greatly reduces fabrication time and cost, and obviates a cation exchange process required in the fabrication of ionic polymer-metal composite actuators. Also, the self-metallized silver electrodes exhibit outstanding metal-polymer adhesion with high conductivity, resulting in substantially larger tip displacements compared with Nafion-based actuators.

  13. Overview of EU activities on DEMO liquid metal breeder blanket

    SciTech Connect

    Giancarli, L.; Proust, E.

    1994-12-31

    The European test-blanket development programme, started in 1988, is aiming at the selection by 1995 of two DEMO-relevant blanket lines to be tested in ITER. At present, four lines of blanket are under development, two of them using solid and the other two liquid breeder materials. As far as liquid breeders are concerned, two lines of blankets have been selected within the European Union, the water-cooled lithium-lead (the eutectic Pb-17Li) blankets and the dual-coolant Pb-17Li blankets. Designs have been developed considering an agreed set of DEMO specifications, such as, for instance, a fusion power of 2,200 MW, a neutron wall-loading of 2MW/m{sup 2}, a life-time of 20,000 hours, and the use of martensitic steel as a structural material. Moreover, an experimental program has been set up in order to address the main critical issues for each line. The present paper gives an overview of both design and experimental activities within the European Union concerning these two lines of liquid breeder blankets.

  14. Sonochemically-Produced Metal-Containing Polydopamine Nanoparticles and Their Antibacterial and Antibiofilm Activity.

    PubMed

    Yeroslavsky, Gil; Lavi, Ronit; Alishaev, Abraham; Rahimipour, Shai

    2016-05-24

    A facile one-pot sonochemical synthesis of Cu-, Ag-, and hybrid Cu/Ag-based polydopamine nanoparticles (Cu-, Ag-, and Cu/Ag-PDA-NPs) and the mechanisms by which they exert antibacterial and antibiofilm activities are reported. We showed that the nanoparticles are spherical with a core-shell structure. Whereas Cu is chelated to the shell of Cu-PDA-NPs in oxidation states of +1/+2, the core of Ag-PDA-NPs is filled with elemental Ag°. Sonochemical irradiation of dopamine in the presence of both Cu(2+) and Ag(+) generates hybrid Cu/Ag-PDA-NPs, whose shells are composed of Cu-chelated PDA with Ag° in the core. The redox potential of the metals was found to be the main determinant of the location and oxidation state of the metals. Leaching studies under physiological conditions reveal a relatively fast release of Cu ions from the shell, whereas Ag leaches very slowly from the core. The metal-containing PDA-NPs are highly microbicidal and exhibit potent antibiofilm activity. The combination of both metals in Cu/Ag-PDA-NPs is especially effective against bacteria and robust biofilms, owing to the dual bactericidal mechanisms of the metals. Most importantly, both Ag- and Cu/Ag-PDA-NPs proved to be significantly more antibacterial than commercial Ag-NPs while exhibiting lower toxicity toward NIH 3T3 mouse embryonic fibroblasts. Mechanistically, the metal-containing PDA-NPs generate stable PDA-semiquinone and reactive oxygen species under physiological conditions, which contribute at least partly to the antimicrobial activity. We also demonstrated that simple treatment of surfaces with Ag-PDA-NPs converts them to antibacterial, the activity of which was preserved even after prolonged storage under ambient conditions. PMID:27133213

  15. ROS-generating/ARE-activating capacity of metals in roadway particulate matter deposited in urban environment.

    PubMed

    Shuster-Meiseles, Timor; Shafer, Martin M; Heo, Jongbae; Pardo, Michal; Antkiewicz, Dagmara S; Schauer, James J; Rudich, Assaf; Rudich, Yinon

    2016-04-01

    In this study we investigated the possible causal role for soluble metal species extracted from roadway traffic emissions in promoting particulate matter (PM)-induced reactive oxygen species (ROS) production and antioxidant response element (ARE) promoter activation. To this end, these responses have been evaluated in alveolar macrophage and epithelial lung cells that have been exposed to 'Unfiltered', 'Filtered' and 'Filtered+Chelexed' water extracts of PM samples collected from the roadway urban environments of Thessaloniki, Milan and London. Except for Thessaloniki, our results demonstrate that filtration resulted in a minor decrease in ROS activity of the fine PM fraction, suggesting that ROS activity is attributed mainly to water-soluble PM species. In contrast to ROS, ARE activity was mediated predominantly by the water-soluble component of PM present in both the fine and coarse extracts. Further removal of metals by Chelex treatment from filtered water extracts showed that soluble metal species are the major factors mediating ROS and ARE activities of the soluble fraction, especially in the London PM extracts. Finally, utilizing step-wise multiple-regression analysis, we show that 87% and 78% of the total variance observed in ROS and ARE assays, respectively, is accounted for by changes in soluble metal concentration. Using a statistical analysis we find that As, Zn and Fe best predict the ROS-generating/ARE-activating capacity of the near roadway particulate matter in the pulmonary cells studied. Collectively, our findings imply that soluble metals present in roadside PM are potential drivers of both pro- and anti-oxidative effects of PM in respiratory tract. PMID:26775006

  16. ROS-generating/ARE-activating capacity of metals in roadway particulate matter deposited in urban environment.

    PubMed

    Shuster-Meiseles, Timor; Shafer, Martin M; Heo, Jongbae; Pardo, Michal; Antkiewicz, Dagmara S; Schauer, James J; Rudich, Assaf; Rudich, Yinon

    2016-04-01

    In this study we investigated the possible causal role for soluble metal species extracted from roadway traffic emissions in promoting particulate matter (PM)-induced reactive oxygen species (ROS) production and antioxidant response element (ARE) promoter activation. To this end, these responses have been evaluated in alveolar macrophage and epithelial lung cells that have been exposed to 'Unfiltered', 'Filtered' and 'Filtered+Chelexed' water extracts of PM samples collected from the roadway urban environments of Thessaloniki, Milan and London. Except for Thessaloniki, our results demonstrate that filtration resulted in a minor decrease in ROS activity of the fine PM fraction, suggesting that ROS activity is attributed mainly to water-soluble PM species. In contrast to ROS, ARE activity was mediated predominantly by the water-soluble component of PM present in both the fine and coarse extracts. Further removal of metals by Chelex treatment from filtered water extracts showed that soluble metal species are the major factors mediating ROS and ARE activities of the soluble fraction, especially in the London PM extracts. Finally, utilizing step-wise multiple-regression analysis, we show that 87% and 78% of the total variance observed in ROS and ARE assays, respectively, is accounted for by changes in soluble metal concentration. Using a statistical analysis we find that As, Zn and Fe best predict the ROS-generating/ARE-activating capacity of the near roadway particulate matter in the pulmonary cells studied. Collectively, our findings imply that soluble metals present in roadside PM are potential drivers of both pro- and anti-oxidative effects of PM in respiratory tract.

  17. The calculation of surface orbital energies for specific types of active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.; Cole, F.

    1992-11-01

    An angular overlap calculation has been used to determine the s, p, and d orbital energy levels of the different types of surface sites present on dispersed metal catalysts. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  18. The calculation of surface orbital energies for specific types of active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.; Cole, F.

    1992-01-01

    An angular overlap calculation has been used to determine the s, p, and d orbital energy levels of the different types of surface sites present on dispersed metal catalysts. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  19. Inhibition by metals of a canine renal calcium, magnesium-activated adenosinetriphosphatase

    SciTech Connect

    Thompson, J.D.; Nechay, B.R.

    1981-06-01

    A number of metals were examined for inhibition of a canine renal calcium, magnesium-activated adenosinetriphosphatase (Ca/sup 2 +/, Mg/sup 2 +/-ATPase). Of the 27 metals investigated, only compounds of mercury, silver, gold, and uranium demonstrated 50% inhibition of the enzyme at concentrations lower than 10/sup -4/ M. The order of inhibitory potency was Hg > Ag > U > Au. Organic mercury (chlormerodin, mersalyl, p-chloromercuribenzoate) was less potent than inorganic mercuric chloride, but organic gold sodium thiomalate was equipotent with inorganic gold chloride. The inhibition produced by each metal decreased parallel to the decrease in enzyme activity, seen as the source of enzyme moved from the outer cortex inward to the papilla of the kidney. The regions of highest activity showed the greatest inhibition by each metal, and inhibition decreased as the control activity of the tissue decreased. This variability of inhibition was not related to the protein content of the enzyme preparation. As the ATP concentration increased, the inhibition produced by U was reduced; if the Mg (but not the Ca concentration was increased while the ATP concentration remained constant, the inhibition increased. Changes in the Ca, Mg, and ATP concentrations did not alter the inhibition produced by Hg, Ag, and Au.

  20. Sorption of metal ions from multicomponent aqueous solutions by activated carbons produced from waste

    SciTech Connect

    Tikhonova, L.P.; Goba, V.E.; Kovtun, M.F.; Tarasenko, Y.A.; Khavryuchenko, V.D.; Lyubchik, S.B.; Boiko, A.N.

    2008-08-15

    Activated carbons produced by thermal treatment of a mixture of sunflower husks, low-grade coal, and refinery waste were studied as adsorbents of transition ion metals from aqueous solutions of various compositions. The optimal conditions and the mechanism of sorption, as well as the structure of the sorbents, were studied.

  1. Metal-containing Complexes of Lactams, Imidazoles, and Benzimidazoles and Their Biological Activity

    NASA Astrophysics Data System (ADS)

    Kukalenko, S. S.; Bovykin, B. A.; Shestakova, S. I.; Omel'chenko, A. M.

    1985-07-01

    The results of the latest investigations of the problem of the synthesis of metal-containing complexes of lactams, imidazoles, and benzimidazoles, their structure, and their stability in solutions are surveyed. Some data on their biological activity (pesticide and pharmacological) and the mechanism of their physiological action are presented. The bibliography includes 190 references.

  2. TRANSCRIPTION FACTOR ACTIVATION FOLLOWING EXPOSURE OF AN INTACT LUNG PREPARATION TO METALLIC PARTICULATE MATTER

    EPA Science Inventory

    TRANSCRIPTION FACTOR ACTIVATION FOLLOWING EXPOSURE OF AN INTACT LUNG PREPARATION TO METALLIC PARTICULATE MATTER

    James M. Samet1,2, Robert Silbajoris1, Tony Huang1 and Ilona Jaspers3

    1Human Studies Division, National Health and Environmental Effects Research Laborato...

  3. Field-induced activation of metal oxide semiconductor for low temperature flexible transparent electronic device applications

    NASA Astrophysics Data System (ADS)

    Pudasaini, Pushpa Raj; Noh, Joo Hyon; Wong, Anthony; Haglund, Amada; Ward, Thomas Zac; Mandrus, David; Rack, Philip

    Amorphous metal-oxide semiconductors have been extensively studied as an active channel material in thin film transistors due to their high carrier mobility, and excellent large-area uniformity. Here, we report the athermal activation of amorphous indium gallium zinc oxide semiconductor channels by an electric field-induced oxygen migration via gating through an ionic liquid. Using field-induced activation, a transparent flexible thin film transistor is demonstrated on a polyamide substrate with transistor characteristics having a current ON-OFF ratio exceeding 108, and saturation field effect mobility of 8.32 cm2/(V.s) without a post-deposition thermal treatment. This study demonstrates the potential of field-induced activation as an athermal alternative to traditional post-deposition thermal annealing for metal oxide electronic devices suitable for transparent and flexible polymer substrates. Materials Science and Technology Division, ORBL, Oak Ridge, TN 37831, USA.

  4. The inhibitory effect of metals and other ions on acid phosphatase activity from Vigna aconitifolia seeds.

    PubMed

    Srivastava, Pramod Kumar; Anand, Asha

    2015-01-01

    Sensitivity of acid phosphatase from Vigna aconitifolia seeds to metal ions, fluoride, and phosphate was examined. All the effectors had different degree of inhibitory effect on the enzyme. Among metal ions, molybdate and ferric ion were observed to be most potent inhibitors and both exhibited mixed type of inhibition. Acid phosphatase activity was inhibited by Cu2+ in a noncompetitive manner. Zn and Mn showed mild inhibition on the enzyme activity. Inhibition kinetics analysis explored molybdate as a potent inhibitor for acid phosphatase in comparison with other effectors used in this study. Fluoride was the next most strong inhibitor for the enzyme activity, and caused a mixed type of inhibition. Phosphate inhibited the enzyme competitively, which demonstrates that inhibition due to phosphate is one of the regulatory factors for enzyme activity.

  5. Abundance, composition and activity of denitrifier communities in metal polluted paddy soils

    NASA Astrophysics Data System (ADS)

    Liu, Yuan; Liu, Yongzhuo; Zhou, Huimin; Li, Lianqing; Zheng, Jinwei; Zhang, Xuhui; Zheng, Jufeng; Pan, Genxing

    2016-01-01

    Denitrification is one of the most important soil microbial processes leading to the production of nitrous oxide (N2O). The potential changes with metal pollution in soil microbial community for N2O production and reduction are not well addressed. In this study, topsoil samples were collected both from polluted and non-polluted rice paddy fields and denitrifier communities were characterized with molecular fingerprinting procedures. All the retrieved nirK sequences could be grouped into neither α- nor β- proteobacteria, while most of the nosZ sequences were affiliated with α-proteobacteria. The abundances of the nirK and nosZ genes were reduced significantly in the two polluted soils. Thus, metal pollution markedly affected composition of both nirK and nosZ denitrifiers. While the total denitrifying activity and N2O production rate were both reduced under heavy metal pollution of the two sites, the N2O reduction rate showed no significant change. These findings suggest that N2O production activity could be sensitive to heavy metal pollution, which could potentially lead to a decrease in N2O emission in polluted paddies. Therefore, metal pollution could have potential impacts on soil N transformation and thus on N2O emission from paddy soils.

  6. Active Adoption of Void Formation in Metal-Oxide for All Transparent Super-Performing Photodetectors

    PubMed Central

    Patel, Malkeshkumar; Kim, Hong-Sik; Park, Hyeong-Ho; Kim, Joondong

    2016-01-01

    Could ‘defect-considered’ void formation in metal-oxide be actively used? Is it possible to realize stable void formation in a metal-oxide layer, beyond unexpected observations, for functional utilization? Herein we demonstrate the effective tailoring of void formation of NiO for ultra-sensitive UV photodetection. NiO was formed onto pre-sputtered ZnO for a large size and spontaneously formed abrupt p-NiO/n-ZnO heterojunction device. To form voids at an interface, rapid thermal process was performed, resulting in highly visible light transparency (85–95%). This heterojunction provides extremely low saturation current (<0.1 nA) with an extraordinary rectifying ratio value of over 3000 and works well without any additional metal electrodes. Under UV illumination, we can observe the fast photoresponse time (10 ms) along with the highest possible responsivity (1.8 A W−1) and excellent detectivity (2 × 1013 Jones) due to the existence of an intrinsic-void layer at the interface. We consider this as the first report on metal-oxide-based void formation (Kirkendall effect) for effective photoelectric device applications. We propose that the active adoption of ‘defect-considered’ Kirkendall-voids will open up a new era for metal-oxide based photoelectric devices. PMID:27151288

  7. Active Adoption of Void Formation in Metal-Oxide for All Transparent Super-Performing Photodetectors

    NASA Astrophysics Data System (ADS)

    Patel, Malkeshkumar; Kim, Hong-Sik; Park, Hyeong-Ho; Kim, Joondong

    2016-05-01

    Could ‘defect-considered’ void formation in metal-oxide be actively used? Is it possible to realize stable void formation in a metal-oxide layer, beyond unexpected observations, for functional utilization? Herein we demonstrate the effective tailoring of void formation of NiO for ultra-sensitive UV photodetection. NiO was formed onto pre-sputtered ZnO for a large size and spontaneously formed abrupt p-NiO/n-ZnO heterojunction device. To form voids at an interface, rapid thermal process was performed, resulting in highly visible light transparency (85–95%). This heterojunction provides extremely low saturation current (<0.1 nA) with an extraordinary rectifying ratio value of over 3000 and works well without any additional metal electrodes. Under UV illumination, we can observe the fast photoresponse time (10 ms) along with the highest possible responsivity (1.8 A W‑1) and excellent detectivity (2 × 1013 Jones) due to the existence of an intrinsic-void layer at the interface. We consider this as the first report on metal-oxide-based void formation (Kirkendall effect) for effective photoelectric device applications. We propose that the active adoption of ‘defect-considered’ Kirkendall-voids will open up a new era for metal-oxide based photoelectric devices.

  8. Mycorrhizal fungi modulate phytochemical production and antioxidant activity of Cichorium intybus L. (Asteraceae) under metal toxicity.

    PubMed

    Rozpądek, P; Wężowicz, K; Stojakowska, A; Malarz, J; Surówka, E; Sobczyk, Ł; Anielska, T; Ważny, R; Miszalski, Z; Turnau, K

    2014-10-01

    Cichorium intybus (common chicory), a perennial plant, common in anthropogenic sites, has been the object of a multitude of studies in recent years due to its high content of antioxidants utilized in pharmacy and food industry. Here, the role of arbuscular mycorrhizal fungi (AMF) in the biosynthesis of plant secondary metabolites and the activity of enzymatic antioxidants under toxic metal stress was studied. Plants inoculated with Rhizophagus irregularis and non-inoculated were grown on non-polluted and toxic metal enriched substrata. The results presented here indicate that AMF improves chicory fitness. Fresh and dry weight was found to be severely affected by the fungi and heavy metals. The concentration of hydroxycinnamates was increased in the shoots of mycorrhizal plants cultivated on non-polluted substrata, but no differences were found in plants cultivated on metal enriched substrata. The activity of SOD and H2O2 removing enzymes CAT and POX was elevated in the shoots of mycorrhizal plants regardless of the cultivation environment. Photochemical efficiency of inoculated chicory was significantly improved. Our results indicate that R. irregularis inoculation had a beneficial role in sustaining the plants ability to cope with the deleterious effects of metal toxicity.

  9. Active Adoption of Void Formation in Metal-Oxide for All Transparent Super-Performing Photodetectors.

    PubMed

    Patel, Malkeshkumar; Kim, Hong-Sik; Park, Hyeong-Ho; Kim, Joondong

    2016-05-06

    Could 'defect-considered' void formation in metal-oxide be actively used? Is it possible to realize stable void formation in a metal-oxide layer, beyond unexpected observations, for functional utilization? Herein we demonstrate the effective tailoring of void formation of NiO for ultra-sensitive UV photodetection. NiO was formed onto pre-sputtered ZnO for a large size and spontaneously formed abrupt p-NiO/n-ZnO heterojunction device. To form voids at an interface, rapid thermal process was performed, resulting in highly visible light transparency (85-95%). This heterojunction provides extremely low saturation current (<0.1 nA) with an extraordinary rectifying ratio value of over 3000 and works well without any additional metal electrodes. Under UV illumination, we can observe the fast photoresponse time (10 ms) along with the highest possible responsivity (1.8 A W(-1)) and excellent detectivity (2 × 10(13) Jones) due to the existence of an intrinsic-void layer at the interface. We consider this as the first report on metal-oxide-based void formation (Kirkendall effect) for effective photoelectric device applications. We propose that the active adoption of 'defect-considered' Kirkendall-voids will open up a new era for metal-oxide based photoelectric devices.

  10. Redox-activated MRI contrast agents based on lanthanide and transition metal ions.

    PubMed

    Tsitovich, Pavel B; Burns, Patrick J; McKay, Adam M; Morrow, Janet R

    2014-04-01

    The reduction/oxidation (redox) potential of tissue is tightly regulated in order to maintain normal physiological processes, but is disrupted in disease states. Thus, the development of new tools to map tissue redox potential may be clinically important for the diagnosis of diseases that lead to redox imbalances. One promising area of chemical research is the development of redox-activated probes for mapping tissue through magnetic resonance imaging (MRI). In this review, we summarize several strategies for the design of redox-responsive MRI contrast agents. Our emphasis is on both lanthanide(III) and transition metal(II/III) ion complexes that provide contrast either as T1 relaxivity MRI contrast agents or as paramagnetic chemical exchange saturation transfer (PARACEST) contrast agents. These agents are redox-triggered by a variety of chemical reactions or switches including redox-activated thiol groups, and heterocyclic groups that interact with the metal ion or influence properties of other ancillary ligands. Metal ion centered redox is an approach which is ripe for development by coordination chemists. Redox-triggered metal ion approaches have great potential for creating large differences in magnetic properties that lead to changes in contrast. An attractive feature of these agents is the ease of fine-tuning the metal ion redox potential over a biologically relevant range.

  11. Active Adoption of Void Formation in Metal-Oxide for All Transparent Super-Performing Photodetectors.

    PubMed

    Patel, Malkeshkumar; Kim, Hong-Sik; Park, Hyeong-Ho; Kim, Joondong

    2016-01-01

    Could 'defect-considered' void formation in metal-oxide be actively used? Is it possible to realize stable void formation in a metal-oxide layer, beyond unexpected observations, for functional utilization? Herein we demonstrate the effective tailoring of void formation of NiO for ultra-sensitive UV photodetection. NiO was formed onto pre-sputtered ZnO for a large size and spontaneously formed abrupt p-NiO/n-ZnO heterojunction device. To form voids at an interface, rapid thermal process was performed, resulting in highly visible light transparency (85-95%). This heterojunction provides extremely low saturation current (<0.1 nA) with an extraordinary rectifying ratio value of over 3000 and works well without any additional metal electrodes. Under UV illumination, we can observe the fast photoresponse time (10 ms) along with the highest possible responsivity (1.8 A W(-1)) and excellent detectivity (2 × 10(13) Jones) due to the existence of an intrinsic-void layer at the interface. We consider this as the first report on metal-oxide-based void formation (Kirkendall effect) for effective photoelectric device applications. We propose that the active adoption of 'defect-considered' Kirkendall-voids will open up a new era for metal-oxide based photoelectric devices. PMID:27151288

  12. Abundance, composition and activity of denitrifier communities in metal polluted paddy soils

    PubMed Central

    Liu, Yuan; Liu, Yongzhuo; Zhou, Huimin; Li, Lianqing; Zheng, Jinwei; Zhang, Xuhui; Zheng, Jufeng; Pan, Genxing

    2016-01-01

    Denitrification is one of the most important soil microbial processes leading to the production of nitrous oxide (N2O). The potential changes with metal pollution in soil microbial community for N2O production and reduction are not well addressed. In this study, topsoil samples were collected both from polluted and non-polluted rice paddy fields and denitrifier communities were characterized with molecular fingerprinting procedures. All the retrieved nirK sequences could be grouped into neither α- nor β- proteobacteria, while most of the nosZ sequences were affiliated with α-proteobacteria. The abundances of the nirK and nosZ genes were reduced significantly in the two polluted soils. Thus, metal pollution markedly affected composition of both nirK and nosZ denitrifiers. While the total denitrifying activity and N2O production rate were both reduced under heavy metal pollution of the two sites, the N2O reduction rate showed no significant change. These findings suggest that N2O production activity could be sensitive to heavy metal pollution, which could potentially lead to a decrease in N2O emission in polluted paddies. Therefore, metal pollution could have potential impacts on soil N transformation and thus on N2O emission from paddy soils. PMID:26739424

  13. Merging Photoredox and Nickel Catalysis: The Direct Synthesis of Ketones by the Decarboxylative Arylation of α-Oxo Acids.

    PubMed

    Chu, Lingling; Lipshultz, Jeffrey M; MacMillan, David W C

    2015-06-26

    The direct decarboxylative arylation of α-oxo acids has been achieved by synergistic visible-light-mediated photoredox and nickel catalysis. This method offers rapid entry to aryl and alkyl ketone architectures from simple α-oxo acid precursors via an acyl radical intermediate. Significant substrate scope is observed with respect to both the oxo acid and arene coupling partners. This mild decarboxylative arylation can also be utilized to efficiently access medicinal agents, as demonstrated by the rapid synthesis of fenofibrate.

  14. Extended Hartree-Fock theory of chemical reactions. IX. Diradical and perepoxide mechanisms for oxygenations of ethylene with molecular oxygen and iron-oxo species are revisited

    NASA Astrophysics Data System (ADS)

    Yamaguchi, Kizashi; Yamanaka, Syusuke; Shimada, Jiro; Isobe, Hiroshi; Saito, Toru; Shoji, Mitsuo; Kitagawa, Yasutaka; Okumura, Mitsutaka

    Symmetry and broken symmetry (BS) in molecular orbital description of transition structures and intermediates in oxygenation reactions have been revisited to elucidate states correlation diagrams and mechanisms for addition reactions of molecular oxygen and metal-oxo M=O (M = Mn(II) and Fe(II)) species to C=C double bonds. Relative stabilities between diradical (DR) and perepoxide (PE) intermediates were thoroughly investigated by several BS hybrid DFT (HDFT) methods and BS CCSD(T) method with and without spin projection. It has been found that recovery of spin symmetry, namely eliminating spin contamination error from the BS solutions, is crucial for the elucidation of reasonable state correlation diagrams and energy differences of the key structures in the oxygenation reactions because the singlet-triplet energy gap for molecular oxygen is large (22 kcal/mol). The BS HDFT followed by spin correction reproduced activation barriers for transition structures along both PE and DR reaction pathways by the use of the CASPT2 method. Basis set dependence on the relative stability between PE and DR intermediates were also examined thoroughly. Solvation effect for DR and PE intermediates was further examined with self-consistent reaction field (SCRF) and SCIPCM methods. Both BS HDFT and CASPT2 have concluded that the DR mechanism is favorable for the addition reaction of singlet oxygen to ethylene, supporting our previous conclusions. The BS HDFT with spin correction was concluded to be useful enough for theoretical investigations of mechanisms of oxygenation reactions. Implications of the computational results were discussed in relation to the theoretical framework (four configuration model) for elucidation of possible mechanisms of epoxidation reactions with Fe(IV)=O cores in metalloenzymes on the basis of isolobal analogies among O, O=O, and Fe(IV)=O. Correspondence between magnetic coupling mode and radical pathway in oxygenations with these species was clarified based

  15. Structural and Mechanistic Studies on Klebsiella pneumoniae 2-Oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline Decarboxylase

    SciTech Connect

    French, Jarrod B.; Ealick, Steven E.

    2010-11-12

    The stereospecific oxidative degradation of uric acid to (S)-allantoin was recently shown to proceed via three enzymatic steps. The final conversion is a decarboxylation of the unstable intermediate 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU) and is catalyzed by OHCU decarboxylase. Here we present the structures of Klebsiella pneumoniae OHCU decarboxylase in unliganded form and with bound allantoin. These structures provide evidence that ligand binding organizes the active site residues for catalysis. Modeling of the substrate and intermediates provides additional support for this hypothesis. In addition we characterize the steady state kinetics of this enzyme and report the first OHCU decarboxylase inhibitor, allopurinol, a structural isomer of hypoxanthine. This molecule is a competitive inhibitor of K. pneumoniae OHCU decarboxylase with a K{sub i} of 30 {+-} 2 {micro}m. Circular dichroism measurements confirm structural observations that this inhibitor disrupts the necessary organization of the active site. Our structural and biochemical studies also provide further insights into the mechanism of catalysis of OHCU decarboxylation.

  16. hSSB1 (NABP2/ OBFC2B) is required for the repair of 8-oxo-guanine by the hOGG1-mediated base excision repair pathway

    PubMed Central

    Paquet, Nicolas; Adams, Mark N.; Leong, Vincent; Ashton, Nicholas W.; Touma, Christine; Gamsjaeger, Roland; Cubeddu, Liza; Beard, Sam; Burgess, Joshua T.; Bolderson, Emma; O'Byrne, Ken J.; Richard, Derek J.

    2015-01-01

    The maintenance of genome stability is essential to prevent loss of genetic information and the development of diseases such as cancer. One of the most common forms of damage to the genetic code is the oxidation of DNA by reactive oxygen species (ROS), of which 8-oxo-7,8-dihydro-guanine (8-oxoG) is the most frequent modification. Previous studies have established that human single-stranded DNA-binding protein 1 (hSSB1) is essential for the repair of double-stranded DNA breaks by the process of homologous recombination. Here we show that hSSB1 is also required following oxidative damage. Cells lacking hSSB1 are sensitive to oxidizing agents, have deficient ATM and p53 activation and cannot effectively repair 8-oxoGs. Furthermore, we demonstrate that hSSB1 forms a complex with the human oxo-guanine glycosylase 1 (hOGG1) and is important for hOGG1 localization to the damaged chromatin. In vitro, hSSB1 binds directly to DNA containing 8-oxoguanines and enhances hOGG1 activity. These results underpin the crucial role hSSB1 plays as a guardian of the genome. PMID:26261212

  17. Bivalent transition metal complexes of cetirizine: spectroscopic, equilibrium studies and biological activity.

    PubMed

    El-Sherif, Ahmed A; Shoukry, Mohamed M; Abobakr, Lamis O

    2013-08-01

    Metal complexes of cetirizine·2HCl (CTZ=2-[2-[4-[(4-chlorophenyl)phenyl methyl]piperazine-1-yl]-ethoxy]acetic acid, dihydrochloride have been prepared and characterized by elemental analyses, IR, solid reflectance, magnetic moment, molar conductance, and UV-Vis spectra. The analytical data of the complexes show the formation of 1:2 [M:L] ratio, where M represents Ni(II), Co(II) and Cu(II) ions, while L represents the deprotonated CTZ ligand. IR spectra show that CTZ is coordinated to the metal ions in a monodentate manner through carboxylate-O atom. Protonation equilibria of CTZ and its metal complexation by some divalent metal ions were determined in aqueous solution at constant ionic strength (0.1 M NaCl) using an automatic potentiometric technique. Thermodynamic parameters for the protonation equilibria of CTZ were calculated and discussed. The stability order of M(II)-CTZ complexes were found to obey Mn(2+)metal complexes were screened for their biological activity against bacterial species (Bacillus subtillis RCMB 010067, Staphylococcus aureus RCMB 010028, Pseudomonas aeuroginosa RCMB 010043, and Escherichia coli RCMB 010052) and fungi as (Aspergillus flavus RCMB 02568, Pencicillium italicum RCMB 03924, Candida albicans RCMB 05031 and Geotricum candidum RCMB 05097). The activity data show that the metal complexes have antibacterial and antifungal activity more than the parent CTZ ligand against one or more bacterial or fungi species. MIC was evaluated for the isolated complexes. PMID:23685158

  18. Bivalent transition metal complexes of cetirizine: Spectroscopic, equilibrium studies and biological activity

    NASA Astrophysics Data System (ADS)

    El-Sherif, Ahmed A.; Shoukry, Mohamed M.; Abobakr, Lamis O.

    2013-08-01

    Metal complexes of cetirizineṡ2HCl (CTZ = 2-[2-[4-[(4-chlorophenyl)phenyl methyl]piperazine-1-yl]-ethoxy]acetic acid, dihydrochloride have been prepared and characterized by elemental analyses, IR, solid reflectance, magnetic moment, molar conductance, and UV-Vis spectra. The analytical data of the complexes show the formation of 1:2 [M:L] ratio, where M represents Ni(II), Co(II) and Cu(II) ions, while L represents the deprotonated CTZ ligand. IR spectra show that CTZ is coordinated to the metal ions in a monodentate manner through carboxylate-O atom. Protonation equilibria of CTZ and its metal complexation by some divalent metal ions were determined in aqueous solution at constant ionic strength (0.1 M NaCl) using an automatic potentiometric technique. Thermodynamic parameters for the protonation equilibria of CTZ were calculated and discussed. The stability order of M(II)-CTZ complexes were found to obey Mn2+ < Co2+ < Ni2+ < Cu2+, in accordance with the Irving-Williams order. The concentration distribution of the complexes in solution is evaluated as a function of pH. The CTZ ligand and its metal complexes were screened for their biological activity against bacterial species (Bacillus subtillis RCMB 010067, Staphylococcus aureus RCMB 010028, Pseudomonas aeuroginosa RCMB 010043, and Escherichia coli RCMB 010052) and fungi as (Aspergillus flavus RCMB 02568, Pencicillium italicum RCMB 03924, Candida albicans RCMB 05031 and Geotricum candidum RCMB 05097). The activity data show that the metal complexes have antibacterial and antifungal activity more than the parent CTZ ligand against one or more bacterial or fungi species. MIC was evaluated for the isolated complexes.

  19. Thermal stability of water ice in Ceres' crater Oxo

    NASA Astrophysics Data System (ADS)

    Formisano, Michelangelo; Federico, Costanzo; De Sanctis, Maria Cristina; Frigeri, Alessandro; Magni, Gianfranco; Tosi, Federico

    2016-10-01

    Dwarf planet Ceres, target of the NASA Dawn mission, exhibits evidences of ammoniated phyllosilicates on its surface [1], compatible with a likely outer Solar System origin. Considerable amounts of water ice have recently been detected in some craters by the Visible InfraRed mapping spectrometer (VIR) onboard Dawn in some small fresh crater, such as Oxo, located at about 40° N. The exposure mechanism of water ice is unknown: cryovolcanism, cometary type sublimation/recondensation [2]or impacts with other bodies are likely mechanisms. The evaluation of the time stability of the water ice is crucial to understand the plausible mechanism for its existence. For this purpose, we developed a 3D finite-elements model (FEM) by using the topography given by the shape model of Ceres derived on the basis of images acquired by the Framing Camera in the Survey mission phase. The illumination conditions are provided by the SPICE toolkit. We performed several simulations by analyzing the effect of thermal inertia and albedo on the temperature and rate of ice sublimation. The results of the simulations about the stability of water ice will be presented.[1] De Sanctis et al. NATURE, doi:10.1038/nature16172[2] Formisano et al. MNRAS, doi: 10.1093/mnras/stv2344

  20. Heavy metal impurities impair the spectrophotometric assay of ribulose bisphosphate carboxylase activity.

    PubMed

    Walbot, V

    1977-01-01

    An inverse relationship between the concentration of ribose 5-phosphate and apparent ribulose bisphosphate carboxylase activity was observed. The Lilley-Walker assay spectrophotometric assay, in which the 3-phosphoglyceric acid-dependent oxidation of reduced pyridine nucleotide is measured, is shown to be highly sensitive to inhibition by heavy metals. Analysis of the purity of reagents showed that ribose 5-phosphate is often contaminated with lead in sufficient quantity to impair the assay. This noncompetitive inhibition by ribose 5-phosphate is independent of the competitive inhibition of this substrate as an ATP sink as described by Slabas and Walker. A method for checking reagent purity and removing heavy metal contaminants is described.

  1. The influence of soil heavy metals pollution on soil microbial biomass, enzyme activity, and community composition near a copper smelter.

    PubMed

    Wang, YuanPeng; Shi, JiYan; Wang, Hui; Lin, Qi; Chen, XinCai; Chen, YingXu

    2007-05-01

    The environmental risk of heavy metal pollution is pronounced in soils adjacent to large industrial complexes. It is important to investigate the functioning of soil microorganisms in ecosystems exposed to long-term contamination by heavy metals. We studied the potential effects of heavy metals on microbial biomass, activity, and community composition in soil near a copper smelter in China. The results showed that microbial biomass C was negatively affected by the elevated metal levels and was closely correlated with heavy metal stress. Enzyme activity was greatly depressed by conditions in the heavy metal-contaminated sites. Good correlation was observed between enzyme activity and the distance from the smelter. Elevated metal loadings resulted in changes in the activity of the soil microbe, as indicated by changes in their metabolic profiles from correlation analysis. Significant decrease of soil phosphatase activities was found in the soils 200 m away from the smelter. Polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis demonstrated that heavy metals pollution had a significant impact on bacterial and actinomycetic community structure. There were negative correlations between soil microbial biomass, phosphatase activity, and NH(4)NO(3) extractable heavy metals. The soil microorganism activity and community composition could be predicted significantly using the availability of Cu and Zn. By combining different monitoring approaches from different viewpoints, the set of methods applied in this study were sensitive to site differences and contributed to a better understanding of heavy metals effects on the structure, size and activity of microbial communities in soils. The data presented demonstrate the role of heavy metals pollution in understanding the heavy metal toxicity to soil microorganism near a copper smelter in China. PMID:16828162

  2. Redox activation of metal-based prodrugs as a strategy for drug delivery

    PubMed Central

    Graf, Nora

    2012-01-01

    This review provides an overview of metal-based anticancer drugs and drug candidates. In particular, we focus on metal complexes that can be activated in the reducing environment of cancer cells, thus serving as prodrugs. There are many reports of Pt and Ru complexes as redox-activatable drug candidates, but other d-block elements with variable oxidation states have a similar potential to serve as prodrugs in this manner. In this context are compounds based on Fe, Co, or Cu chemistry, which are also covered. A trend in the field of medicinal inorganic chemistry has been toward molecularly targeted, metal-based drugs obtained by functionalizing complexes with biologically active ligands. Another recent activity is the use of nanomaterials for drug delivery, exploiting passive targeting of tumors with nanosized constructs made from Au, Fe, carbon, or organic polymers. Although complexes of all of the above mentioned metals will be described, this review focuses primarily on Pt compounds, including constructs containing nanomaterials. PMID:22289471

  3. Biphasic catalysis using amphiphilic polyphenols-chelated noble metals as highly active and selective catalysts

    PubMed Central

    Mao, Hui; Yu, Hong; Chen, Jing; Liao, Xuepin

    2013-01-01

    In the field of catalysis, it is highly desired to develop novel catalysts that combine the advantages of both homogeneous and heterogeneous catalysts. Here we disclose that the use of plant pholyphenol as amphiphilic large molecule ligand/stabilizer allows for the preparation of noble metal complex and noble metal nanoparticle catalysts. These catalysts are found to be highly selective and active in aqueous-organic biphasic catalysis of cinnamaldehyde and quinoline, and can be reused at least 3 times without significant loss of activity. Moreover, the catalytic activity and reusability of the catalysts can be rationally controlled by simply adjusting the content of polyphenols in the catalysts. Our strategy may be extended to design a wide range of aqueous-organic biphasic catalysis system. PMID:23863916

  4. Effect of metal ions on structure and activity of papain from Carica papaya.

    PubMed

    Kaul, P; Sathish, H A; Prakash, V

    2002-02-01

    Papain, a powerful proteolytic enzyme, is an endoprotease belonging to cysteine endopeptidase family. It is used extensively in food processing especially in tenderization of meat. In this study, we have made an attempt to show the structure activity relationship of this enzyme and the role of calcium and magnesium ions in the activity and stability of the enzyme. Results of activation and stabilization of the enzyme by these cations showed concentration dependent effect. The enzymatic activity of papain increases to a maximum of 18% and 24% in presence of calcium and magnesium ions at 1 x 10(-3) M concentration, respectively. Thermal denaturation studies showed that the binding of calcium and magnesium ions bring about change in the thermal stability of papain at various concentrations of these metal ions. Far ultraviolet circular dichroic studies showed no significant change in the alpha-helix and beta-sheet structure of the papain upon binding of these metal ions. The mechanism underlying the structure activity relationship of papain in presence of these metal ions have been discussed here with reference to the ionic radii, ligand binding preference, coordination numbers and the electrostatic forces between the protein molecule and cations present in the microenvironment of the enzyme. PMID:11890048

  5. Impacts of human activity modes and climate on heavy metal "spread" in groundwater are biased.

    PubMed

    Chen, Ming; Qin, Xiaosheng; Zeng, Guangming; Li, Jian

    2016-06-01

    Groundwater quality deterioration has attracted world-wide concerns due to its importance for human water supply. Although more and more studies have shown that human activities and climate are changing the groundwater status, an investigation on how different groundwater heavy metals respond to human activity modes (e.g. mining, waste disposal, agriculture, sewage effluent and complex activity) in a varying climate has been lacking. Here, for each of six heavy metals (i.e. Fe, Zn, Mn, Pb, Cd and Cu) in groundwater, we use >330 data points together with mixed-effect models to indicate that (i) human activity modes significantly influence the Cu and Mn but not Zn, Fe, Pb and Cd levels, and (ii) annual mean temperature (AMT) only significantly influences Cu and Pb levels, while annual precipitation (AP) only significantly affects Fe, Cu and Mn levels. Given these differences, we suggest that the impacts of human activity modes and climate on heavy metal "spread" in groundwater are biased. PMID:27003366

  6. Impacts of human activity modes and climate on heavy metal "spread" in groundwater are biased.

    PubMed

    Chen, Ming; Qin, Xiaosheng; Zeng, Guangming; Li, Jian

    2016-06-01

    Groundwater quality deterioration has attracted world-wide concerns due to its importance for human water supply. Although more and more studies have shown that human activities and climate are changing the groundwater status, an investigation on how different groundwater heavy metals respond to human activity modes (e.g. mining, waste disposal, agriculture, sewage effluent and complex activity) in a varying climate has been lacking. Here, for each of six heavy metals (i.e. Fe, Zn, Mn, Pb, Cd and Cu) in groundwater, we use >330 data points together with mixed-effect models to indicate that (i) human activity modes significantly influence the Cu and Mn but not Zn, Fe, Pb and Cd levels, and (ii) annual mean temperature (AMT) only significantly influences Cu and Pb levels, while annual precipitation (AP) only significantly affects Fe, Cu and Mn levels. Given these differences, we suggest that the impacts of human activity modes and climate on heavy metal "spread" in groundwater are biased.

  7. Tunable catalytic activity of solid solution metal-organic frameworks in one-pot multicomponent reactions.

    PubMed

    Aguirre-Díaz, Lina María; Gándara, Felipe; Iglesias, Marta; Snejko, Natalia; Gutiérrez-Puebla, Enrique; Monge, M Ángeles

    2015-05-20

    The aim of this research is to establish how metal-organic frameworks (MOFs) composed of more than one metal in equivalent crystallographic sites (solid solution MOFs) exhibit catalytic activity, which is tunable by virtue of the metal ions ratio. New MOFs with general formula [InxGa1-x(O2C2H4)0.5(hfipbb)] were prepared by the combination of Ga and In. They are isostructural with their monometal counterparts, synthesized with Al, Ga, and In. Differences in their behavior as heterogeneous catalysts in the three-component, one pot Strecker reaction illustrate the potential of solid solution MOFs to provide the ability to address the various stages involved in the reaction mechanism.

  8. Metal-activated histidine carbon donor hydrogen bonds contribute to metalloprotein folding and function.

    PubMed

    Schmiedekamp, Ann; Nanda, Vikas

    2009-07-01

    Carbon donor hydrogen bonds are typically weak interactions that contribute less than 2 kcal/mol, and provide only modest stabilization in proteins. One exception is the class of hydrogen bonds donated by heterocyclic side chain carbons. Histidine is capable of particularly strong interactions through the Cepsilon(1) and Cdelta(2) carbons when the imidazole is protonated or bound to metal. Given the frequent occurrence of metal-bound histidines in metalloproteins, we characterized the energies of these interactions through DFT calculations on model compounds. Imidazole-water hydrogen bonding could vary from -11.0 to -17.0 kcal/mol, depending on the metal identity and oxidation state. A geometric search of metalloprotein structures in the PDB identified a number of candidate His C-H...O hydrogen bonds which may be important for folding or function. DFT calculations on model complexes of superoxide reductase show a carbon donor hydrogen bond positioning a water molecule above the active site.

  9. Synthesis, characterization, antibacterial and anti-inflammatory activities of enoxacin metal complexes.

    PubMed

    Arayne, Saeed; Sultana, Najma; Haroon, Urooj; Mesaik, M Ahmed

    2009-01-01

    The present work comprises the synthesis of enoxacin (Heno) complexes with various transition metals. Two types of complexes [M(eno)(2)(H(2)O)(2)]3H(2)O(M = Cu(II), Ni(II) or Mn(II)) and [M(eno)(H(2)O)(2)]Cl . 4H(2)O (M = Fe(III)) were obtained. The complexes were characterized by different physicochemical, spectroscopic, and elemental analysis. Results suggest that enoxacin interacts with the metals as a monoanionic bidentate ligand. These complexes were also tested for their antibacterial activity against eleven (11) different microorganisms, and the results were compared with the parent drug. Moreover all the metal complexes were also tested for their ability to scavenge reactive oxygen species where by Mn(II) and Cu(II) complexes exhibited potential to mediate anti-inflammatory response.

  10. Active and Durable Hydrogen Evolution Reaction Catalyst Derived from Pd-Doped Metal-Organic Frameworks.

    PubMed

    Chen, Jitang; Xia, Guoliang; Jiang, Peng; Yang, Yang; Li, Ren; Shi, Ruohong; Su, Jianwei; Chen, Qianwang

    2016-06-01

    The water electrolysis is of critical importance for sustainable hydrogen production. In this work, a highly efficient and stable PdCo alloy catalyst (PdCo@CN) was synthesized by direct annealing of Pd-doped metal-organic frameworks (MOFs) under N2 atmosphere. In 0.5 M H2SO4 solution, PdCo@CN displays remarkable electrocatalytic performance with overpotential of 80 mV, a Tafel slope of 31 mV dec(-1), and excellent stability of 10 000 cycles. Our studies reveal that noble metal doped MOFs are ideal precursors for preparing highly active alloy electrocatalysts with low content of noble metal. PMID:27112733

  11. Metals

    ERIC Educational Resources Information Center

    Kirkemo, Harold; Goudarzi, Gus H.

    1978-01-01

    There has been a general lag in minerals-exploration activity in the past few years. Government concern is reviewed in this article, along with significant developments that included the discovery of additional bauxite, copper, and molybdenum deposits and the reopening of different mining operations. (MA)

  12. Artificial sweeteners and salts producing a metallic taste sensation activate TRPV1 receptors.

    PubMed

    Riera, Céline E; Vogel, Horst; Simon, Sidney A; le Coutre, Johannes

    2007-08-01

    Throughout the world many people use artificial sweeteners (AS) for the purpose of reducing caloric intake. The most prominently used of these molecules include saccharin, aspartame (Nutrasweet), acesulfame-K, and cyclamate. Despite the caloric advantage they provide, one key concern in their use is their aversive aftertaste that has been characterized on a sensory level as bitter and/or metallic. Recently, it has been shown that the activation of particular T2R bitter taste receptors is partially involved with the bitter aftertaste sensation of saccharin and acesulfame-K. To more fully understand the biology behind these phenomena we have addressed the question of whether AS could stimulate transient receptor potential vanilloid-1 (TRPV1) receptors, as these receptors are activated by a large range of structurally different chemicals. Moreover, TRPV1 receptors and/or their variants are found in taste receptor cells and in nerve terminals throughout the oral cavity. Hence, TRPV1 activation could be involved in the AS aftertaste or even contribute to the poorly understood metallic taste sensation. Using Ca(2+) imaging on TRPV1 receptors heterologously expressed in the human embryonic kidney (HEK) 293 cells and on dissociated primary sensory neurons, we find that in both systems, AS activate TRPV1 receptors, and, moreover, they sensitize these channels to acid and heat. We also found that TRPV1 receptors are activated by CuSO(4), ZnSO(4), and FeSO(4), three salts known to produce a metallic taste sensation. In summary, our results identify a novel group of compounds that activate TRPV1 and, consequently, provide a molecular mechanism that may account for off tastes of sweeteners and metallic tasting salts.

  13. Curcumin derivatives as metal-chelating agents with potential multifunctional activity for pharmaceutical applications.

    PubMed

    Ferrari, Erika; Benassi, Rois; Sacchi, Stefania; Pignedoli, Francesca; Asti, Mattia; Saladini, Monica

    2014-10-01

    Curcuminoids represent new perspectives for the development of novel therapeutics for Alzheimer's disease (AD), one probable mechanism of action is related to their metal complexing ability. In this work we examined the metal complexing ability of substituted curcuminoids to propose new chelating molecules with biological properties comparable with curcumin but with improved stability as new potential AD therapeutic agents. The K2T derivatives originate from the insertion of a -CH2COOC(CH3)3 group on the central atom of the diketonic moiety of curcumin. They retain the diketo-ketoenol tautomerism which is solvent dependent. In aqueous solution the prevalent form is the diketo one but the addition of metal ion (Ga(3+), Cu(2+)) causes the dissociation of the enolic proton creating chelate complexes and shifting the tautomeric equilibrium towards the keto-enol form. The formation of metal complexes is followed by both NMR and UV-vis spectroscopy. The density functional theory (DFT) calculations on K2T21 complexes with Ga(3+) and Cu(2+) are performed and compared with those on curcumin complexes. [Ga(K2T21)2(H2O)2](+) was found more stable than curcumin one. Good agreement is detected between calculated and experimental (1)H and (13)C NMR data. The calculated OH bond dissociation energy (BDE) and the OH proton dissociation enthalpy (PDE), allowed to predict the radical scavenging ability of the metal ion complexed with K2T21, while the calculated electronic affinity (EA) and ionization potential (IP) represent yardsticks of antioxidant properties. Eventually theoretical calculations suggest that the proton-transfer-associated superoxide-scavenging activity is enhanced after binding metal ions, and that Ga(3+) complexes display possible superoxide dismutase (SOD)-like activity.

  14. Gill ATPase activity in Procambarus clarkii as an indicator of heavy metal pollution

    SciTech Connect

    Torreblanca, A.; Del Ramo, J.; Diaz-Mayans, J. )

    1989-06-01

    Lake Albufera and the surrounding rice field waters are subjected to very heavy loads of sewage and toxic industrial residues, including heavy metals, from the many urban and waste waters of this area. The American red crayfish, Procambarus clarkii have a high resistance to toxic effects of heavy metals. The sublethal effects of heavy metals on gills of fish and aquatic invertebrates have been extensively studied. Some metabolic disturbances and histologic damages have been reported, as well as osmoregulation alterations. However, little work has been done about the effect of heavy metals on Na,K and Mg-ATPases of freshwater invertebrate gills. Na,K-ATPase is the prime mediator of ion transport across cellular membranes and plays a central role in whole body ion regulation in marine and estuarine animals. Na,K-ATPase has been reviewed and assessed as a potentially useful indicator of pollution stress in aquatic animals. The purpose of this study is look for the relation, if any, between crayfish gill ATP-ase activity changes and metal exposure in laboratory. This find would allow the authors to assay this potential indicator in the field.

  15. Screening of catalytic oxygen reduction reaction activity of metal-doped graphene by density functional theory

    NASA Astrophysics Data System (ADS)

    Chen, Xin; Chen, Shuangjing; Wang, Jinyu

    2016-08-01

    Graphene doping is a promising direction for developing effective oxygen reduction reaction (ORR) catalysts. In this paper, we computationally investigated the ORR performance of 10 kinds of metal-doped graphene (M-G) catalysts, namely, Al-, Si-, Mn-, Fe-, Co-, Ni-, Pd-, Ag-, Pt-, and Au-G. The results shown that the binding energies of the metal atoms incorporated into the graphene vacancy are higher than their bulk cohesive energies, indicating the formed M-G catalysts are even more stable than the corresponding bulk metal surfaces, and thus avoid the metals dissolution in the reaction environment. We demonstrated that the linear relation among the binding energies of the ORR intermediates that found on metal-based materials does not hold for the M-G catalysts, therefore a single binding energy of intermediate alone is not sufficient to evaluate the ORR activity of an arbitrary catalyst. By analysis of the detailed ORR processes, we predicted that the Au-, Co-, and Ag-G materials can be used as the ORR catalysts.

  16. Influence of Humic Acid Complexation with Metal Ions on Extracellular Electron Transfer Activity.

    PubMed

    Zhou, Shungui; Chen, Shanshan; Yuan, Yong; Lu, Qin

    2015-01-01

    Humic acids (HAs) can act as electron shuttles and mediate biogeochemical cycles, thereby influencing the transformation of nutrients and environmental pollutants. HAs commonly complex with metals in the environment, but few studies have focused on how these metals affect the roles of HAs in extracellular electron transfer (EET). In this study, HA-metal (HA-M) complexes (HA-Fe, HA-Cu, and HA-Al) were prepared and characterized. The electron shuttle capacities of HA-M complexes were experimentally evaluated through microbial Fe(III) reduction, biocurrent generation, and microbial azoreduction. The results show that the electron shuttle capacities of HAs were enhanced after complexation with Fe but were weakened when using Cu or Al. Density functional theory calculations were performed to explore the structural geometry of the HA-M complexes and revealed the best binding sites of the HAs to metals and the varied charge transfer rate constants (k). The EET activity of the HA-M complexes were in the order HA-Fe > HA-Cu > HA-Al. These findings have important implications for biogeochemical redox processes given the ubiquitous nature of both HAs and various metals in the environment. PMID:26593782

  17. Influence of Humic Acid Complexation with Metal Ions on Extracellular Electron Transfer Activity

    PubMed Central

    Zhou, Shungui; Chen, Shanshan; Yuan, Yong; Lu, Qin

    2015-01-01

    Humic acids (HAs) can act as electron shuttles and mediate biogeochemical cycles, thereby influencing the transformation of nutrients and environmental pollutants. HAs commonly complex with metals in the environment, but few studies have focused on how these metals affect the roles of HAs in extracellular electron transfer (EET). In this study, HA-metal (HA-M) complexes (HA-Fe, HA-Cu, and HA-Al) were prepared and characterized. The electron shuttle capacities of HA-M complexes were experimentally evaluated through microbial Fe(III) reduction, biocurrent generation, and microbial azoreduction. The results show that the electron shuttle capacities of HAs were enhanced after complexation with Fe but were weakened when using Cu or Al. Density functional theory calculations were performed to explore the structural geometry of the HA-M complexes and revealed the best binding sites of the HAs to metals and the varied charge transfer rate constants (k). The EET activity of the HA-M complexes were in the order HA-Fe > HA-Cu > HA-Al. These findings have important implications for biogeochemical redox processes given the ubiquitous nature of both HAs and various metals in the environment. PMID:26593782

  18. Effect of the chelation of metal cation on the antioxidant activity of chondroitin sulfates.

    PubMed

    Ajisaka, Katsumi; Oyanagi, Yutaka; Miyazaki, Tatsuo; Suzuki, Yasuhiro

    2016-06-01

    The antioxidant potencies of chondroitin sulfates (CSs) from shark cartilage, salmon cartilage, bovine trachea, and porcine intestinal mucosa were compared by three representative methods for the measurement of the antioxidant activity; DPPH radical scavenging activity, superoxide radical scavenging activity, and hydroxyl radical scavenging activity. CSs from salmon cartilage and bovine trachea showed higher potency in comparison with CSs from shark cartilage and porcine intestinal mucosa. Next, CS from salmon cartilage chelating with Ca(2+), Mg(2+), Mn(2+), or Zn(2+) were prepared, and their antioxidant potencies were compared. CS chelating with Ca(2+) or Mg(2+) ions showed rather decreased DPPH radical scavenging activity in comparison with CS of H(+) form. In contrast, CS chelating with Ca(2+) or Mg(2+) ion showed remarkably enhanced superoxide radical scavenging activity than CS of H(+) or Na(+) form. Moreover, CS chelating with divalent metal ions, Ca(2+), Mg(2+), Mn(2+), or Zn(2+), showed noticeably higher hydroxyl radical scavenging activity than CS of H(+) or Na(+) form. The present results revealed that the scavenging activities of, at least, superoxide radical and hydroxyl radical were enhanced by the chelation with divalent metal ions.

  19. Effect of the chelation of metal cation on the antioxidant activity of chondroitin sulfates.

    PubMed

    Ajisaka, Katsumi; Oyanagi, Yutaka; Miyazaki, Tatsuo; Suzuki, Yasuhiro

    2016-06-01

    The antioxidant potencies of chondroitin sulfates (CSs) from shark cartilage, salmon cartilage, bovine trachea, and porcine intestinal mucosa were compared by three representative methods for the measurement of the antioxidant activity; DPPH radical scavenging activity, superoxide radical scavenging activity, and hydroxyl radical scavenging activity. CSs from salmon cartilage and bovine trachea showed higher potency in comparison with CSs from shark cartilage and porcine intestinal mucosa. Next, CS from salmon cartilage chelating with Ca(2+), Mg(2+), Mn(2+), or Zn(2+) were prepared, and their antioxidant potencies were compared. CS chelating with Ca(2+) or Mg(2+) ions showed rather decreased DPPH radical scavenging activity in comparison with CS of H(+) form. In contrast, CS chelating with Ca(2+) or Mg(2+) ion showed remarkably enhanced superoxide radical scavenging activity than CS of H(+) or Na(+) form. Moreover, CS chelating with divalent metal ions, Ca(2+), Mg(2+), Mn(2+), or Zn(2+), showed noticeably higher hydroxyl radical scavenging activity than CS of H(+) or Na(+) form. The present results revealed that the scavenging activities of, at least, superoxide radical and hydroxyl radical were enhanced by the chelation with divalent metal ions. PMID:26856546

  20. Effect of heavy metal cations on the activity of cathepsin D (in vitro study).

    PubMed

    Karwowska, Alicja; Łapiński, Radosław; Gacko, Marek; Grzegorczyk, Ewa; Żurawska, Joanna; Karczewski, Jan K

    2012-10-08

    We studied the effect of heavy metal cations: Fe²⁺, Cu²⁺, Zn²⁺, Cd²⁺, Hg²⁺, Pb²⁺ on the activity of cathepsin D in human aorta homogenate and blood serum. The concentration of cations was 1 mmol/l. Hemoglobin was the cathepsin D substrate. The activity of cathepsin D was determined at pH 3.5. Only Hg²⁺ cations inhibit the activity of cathepsin D. Cations Hg²⁺ damage lysosomes and release cathepsin D from these organelles.

  1. Tuning the redox activity of encapsulated metal clusters via the metallic and semiconducting character of carbon nanotubes

    PubMed Central

    Zhang, Fan; Pan, Xiulian; Hu, Yongfeng; Yu, Liang; Chen, Xiaoqi; Jiang, Peng; Zhang, Hongbo; Deng, Shibin; Zhang, Jin; Bolin, Trudy B.; Zhang, Shuo; Huang, Yuying; Bao, Xinhe

    2013-01-01

    We demonstrate that reactions confined within single-walled carbon nanotube (SWCNT) channels are modulated by the metallic and semiconducting character of the hosts. In situ Raman and X-ray absorption near-edge structure spectroscopies provide complementary information about the electronic state of carbon nanotubes and the encapsulated rhenium species, which reveal electronic interactions between encapsulated species and nanotubes. More electrons are transferred from metallic tubes (m-SWCNTs) to oxidic rhenium clusters, leading to a lower valence state rhenium oxide than that in semiconducting tubes (s-SWCNTs). Reduction in 3.5% (vol/vol) H2/Ar leads to weakened host–guest electronic interaction. The high valence state Re within s-SWCNTs is more readily reduced when raising the temperature, whereas only a sluggish change is observed for Re within m-SWCNTs. Only at 400 °C does Re reach a similar electronic state (mixture of Re0 and Re4+) in both types of tubes. Subsequent oxidation in 1% O2/Ar does not show changes for Re in s-SWCNTs up to 200 °C. In comparison, m-SWCNTs facilitate the oxidation of reduced rhenium (160 °C). This can be exploited for rational design of active catalysts with stable species as a desired valence state can be obtained by selecting specific-type SWCNTs and a controlled thermal treatment. These results also provide a chemical approach to modulate reversibly the electronic structure of SWCNTs without damaging the sidewalls of SWCNTs. PMID:23980145

  2. Enhanced electron-transfer reactivity of nonheme manganese(IV)-oxo complexes by binding scandium ions.

    PubMed

    Yoon, Heejung; Lee, Yong-Min; Wu, Xiujuan; Cho, Kyung-Bin; Sarangi, Ritimukta; Nam, Wonwoo; Fukuzumi, Shunichi; Fuhkuzumi, Shunichi

    2013-06-19

    One and two scandium ions (Sc(3+)) are bound strongly to nonheme manganese(IV)-oxo complexes, [(N4Py)Mn(IV)(O)](2+) (N4Py = N,N-bis(2-pyridylmethyl)-N-bis(2-pyridyl)methylamine) and [(Bn-TPEN)Mn(IV)(O)](2+) (Bn-TPEN = N-benzyl-N,N',N'-tris(2-pyridylmethyl)-1,2-diaminoethane), to form Mn(IV)(O)-(Sc(3+))1 and Mn(IV)(O)-(Sc(3+))2 complexes, respectively. The binding of Sc(3+) ions to the Mn(IV)(O) complexes was examined by spectroscopic methods as well as by DFT calculations. The one-electron reduction potentials of the Mn(IV)(O) complexes were markedly shifted to a positive direction by binding of Sc(3+) ions. Accordingly, rates of the electron transfer reactions of the Mn(IV)(O) complexes were enhanced as much as 10(7)-fold by binding of two Sc(3+) ions. The driving force dependence of electron transfer from various electron donors to the Mn(IV)(O) and Mn(IV)(O)-(Sc(3+))2 complexes was examined and analyzed in light of the Marcus theory of electron transfer to determine the reorganization energies of electron transfer. The smaller reorganization energies and much more positive reduction potentials of the Mn(IV)(O)-(Sc(3+))2 complexes resulted in remarkable enhancement of the electron-transfer reactivity of the Mn(IV)(O) complexes. Such a dramatic enhancement of the electron-transfer reactivity of the Mn(IV)(O) complexes by binding of Sc(3+) ions resulted in the change of mechanism in the sulfoxidation of thioanisoles by Mn(IV)(O) complexes from a direct oxygen atom transfer pathway without metal ion binding to an electron-transfer pathway with binding of Sc(3+) ions.

  3. Chiral magnetic effect and natural optical activity in metals with or without Weyl points

    NASA Astrophysics Data System (ADS)

    Ma, Jing; Pesin, D. A.

    2015-12-01

    We consider the phenomenon of natural optical activity, and related chiral magnetic effect in metals with low carrier concentration. To reveal the correspondence between the two phenomena, we compute the optical conductivity of a noncentrosymmetric metal to linear order in the wave vector of the light wave, specializing to the low-frequency regime. We show that it is the orbital magnetic moment of quasiparticles that is responsible for the natural optical activity, and thus the chiral magnetic effect. While for purely static magnetic fields the chiral magnetic effect is known to have a topological origin and to be related to the presence of Berry curvature monopoles (Weyl points) in the band structure, we show that the existence of Berry monopoles is not required for the dynamic chiral magnetic effect to appear; the latter is thus not unique to Weyl metals. The magnitude of the dynamic chiral magnetic effect in a material is related to the trace of its gyrotropic tensor. We discuss the conditions under which this trace is nonzero; in noncentrosymmetric Weyl metals it is found to be proportional to the energy-space dipole moment of Berry curvature monopoles. The calculations are done within both the semiclassical kinetic equation, and Kubo linear-response formalisms, with coincident results.

  4. Effects of activated carbon fibre-supported metal oxide characteristics on toluene removal.

    PubMed

    Liu, Zhen-Shu; Peng, Yu-Hui; Li, Wen-Kai

    2014-01-01

    Few studies have investigated the use of activated carbon fibres (ACFs) impregnated with metal oxides for the catalytic oxidation of volatile organic compounds (VOCs). Thus, the effects of the ACF-supported metal oxides on toluene removal are determined in this study. Three catalysts, namely, Ce, Mn, and Cu, two pretreatment solutions NaOH and H2O2, and three reaction temperatures of 250 degrees C, 300 degrees C, and 350 degrees C, were employed to determine toluene removal. The composition and morphology of the catalysts were analysed using Brunauer-Emmett-Teller (BET), transmission electron microscope (TEM), inductively coupled plasma (ICP), X-ray photoelectron spectroscopy (XPS), Fourier-transform infrared spectrometer (FTIR), and thermo-gravimetric analyser (TGA) to study the effects of the catalyst's characteristics on toluene removal. The results demonstrated that the metal catalysts supported on the ACFs could significantly increase toluene removal. The Mn/ACFs and Cu/ACFs were observed to be most active in toluene removal at a reaction temperature of 250 degrees C with 10% oxygen content. Moreover, the data also indicated that toluene removal was slightly improved after pretreating the ACFs with NaOH and H2O2. The results suggested that surface-metal loading and the surface characteristics of the ACFs were the determinant parameters for toluene removal. Furthermore, the removal of toluene over Mn/ACFs-H202 decreased when the reaction temperature considered was > 300 degrees C.

  5. 8-oxo-7,8-dihydroguanine: Link to gene expression, aging and defense against oxidative stress

    PubMed Central

    Radak, Zsolt; Boldogh, Istvan

    2010-01-01

    The one-electron oxidation product of guanine 8-oxo-7,8-dihydroguanine (8-oxoG) is an abundant lesion in genomic, mitochondrial and telomeric DNA and RNA. It is considered to be a marker of oxidative stress that preferentially accumulates at the 5’ end of guanine strings in the DNA helix, guanine quadruplexes and in RNA molecules. 8-oxoG has a lower oxidation potential compared to guanine, thus it is susceptible to oxidation/reduction and along with its redox products, is traditionally considered to be a major genotoxic/mutagenic DNA base lesion. It does not change the architecture of the DNA double helix and it is specifically recognized and excised by 8-oxoguanine DNA glycosylase (OGG1) during the DNA base excision repair pathway. OGG1 null animals accumulate excess levels of 8-oxoG in their genome, while they do not have shorter lifespan, nor exhibit severe pathological symptoms including tumor formation. In fact they are increasingly resistant to inflammation. Here we address rarely considered significance of 8-oxoG such as its optimal level in the DNA and RNA in a given condition, essentiality for normal cellular physiology, evolutionary role, ability to soften the effects of oxidative stress in DNA, harmful consequences of its repair, as well as its importance in transcriptional initiation and chromatin relaxation. PMID:20483371

  6. Metal based isatin-derived sulfonamides: their synthesis, characterization, coordination behavior and biological activity.

    PubMed

    Chohan, Zahid H; Supuran, Claudiu T; Ben Hadda, Taibi; Nasim, Faiz-Ul-Hassan; Khan, Khalid M

    2009-06-01

    Some isatin derived sulfonamides and their transition metal [Co(II), Cu(II), Ni(II), Zn(II)] complexes have been synthesized and characterized. The structure of synthesized compounds and their nature of bonding have been inferred on the basis of their physical (magnetic susceptibility and conductivity measurements), analytical (elemental analyses) and spectral (IR, (1)H NMR and (13)C NMR) properties. An octahedral geometry has been suggested for Co(II), Ni(II) and Zn(II) and square-planar for Cu(II) complexes. In order to assess the antibacterial and antifungal behavior, the ligands and their metal(II) complexes were screened for their in vitro antibacterial activity against four Gram-negative species, Escherichia coli, Shigella flexneri, Pseudomonas aeruginosa and Salmonella typhi and two Gram-positive species, Staphylococcus aureus and Bacillus subtilis and, for in vitro antifungal activity against Trichophyton longifusus, Candida albicans, Aspergillus flavus, Microsporum canis, Fusarium solani and Candida glaberata. In vitro cytotoxic properties of all the compounds were also studied against Artemia salina by brine shrimp bioassay. The results of average antibacterial/antifungal activity showed that zinc(II) complexes were found to be the most active against one or more bacterial/fungal strains as compared to the other metal complexes. PMID:18825557

  7. Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB

    PubMed Central

    Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria

    2016-01-01

    Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site

  8. Tuning the reactivity of an actor ligand for tandem CO2 and C-H activations: from spectator metals to metal-free.

    PubMed

    Annibale, Vincent T; Dalessandro, Daniel A; Song, Datong

    2013-10-30

    The 4,5-diazafluorenide ligand (L(-)) serves as an actor ligand in the formal insertion of CO2 into a C-H bond remote from the metal center. With the Ru(II) complex of L(-) as the starting point, Rh(III), Rh(I), and Cu(I) were used as spectator metal centers to tune the reactivity of the actor ligand toward CO2. In the case of Rh(III)-diazafluorenide a room temperature reversible activation of CO2 was observed, similar to the isoelectronic Ru(II) analogue. In the case of Rh(I)- and Cu(I)-diazafluorenide CO2 is trapped by the formation of dinuclear carboxylate complexes and diazafluorene (LH). The spectator metal center could even be replaced entirely with an organic group allowing for the first metal-free reversible tandem CO2 and C-H activation.

  9. Synthesis of new microbial pesticide metal complexes derived from coumarin-imine ligand.

    PubMed

    Elhusseiny, Amel F; Aazam, Elham S; Al-Amri, Huda M

    2014-07-15

    A series of metal complexes of zinc(II), cadmium(II), copper(II), nickel(II) and palladium(II) have been synthesized from coumarin-imine ligand, 8-[(1E)-1-(2-aminophenyliminio)ethyl]-2-oxo-2H-chromen-7-olate, [HL]. The structures of the complexes were proposed in the light of their spectroscopic, molar conductance, magnetic and thermal studies. The ligand coordinated in a tridentate manner through the azomethine nitrogen, the phenolic oxygen and the amine nitrogen and all complexes were non-electrolytes with different geometrical arrangements around the central metal ion. Photoluminescence data unambiguously showed remarkable fluorescence enhancement to Zn(2+) over other cations. The antimicrobial screening tests revealed that copper(II) complex exhibited the highest potency and its minimum inhibitory concentration on the enzymatic activities of the tested microbial species was determined. No toxin productivity was detected for all tested toxigenic species upon the exposure of copper complex. PMID:24704603

  10. Synthesis of new microbial pesticide metal complexes derived from coumarin-imine ligand

    NASA Astrophysics Data System (ADS)

    Elhusseiny, Amel F.; Aazam, Elham S.; Al-Amri, Huda M.

    2014-07-01

    A series of metal complexes of zinc(II), cadmium(II), copper(II), nickel(II) and palladium(II) have been synthesized from coumarin-imine ligand, 8-[(1E)-1-(2-aminophenyliminio)ethyl]-2-oxo-2H-chromen-7-olate, [HL]. The structures of the complexes were proposed in the light of their spectroscopic, molar conductance, magnetic and thermal studies. The ligand coordinated in a tridentate manner through the azomethine nitrogen, the phenolic oxygen and the amine nitrogen and all complexes were non-electrolytes with different geometrical arrangements around the central metal ion. Photoluminescence data unambiguously showed remarkable fluorescence enhancement to Zn2+ over other cations. The antimicrobial screening tests revealed that copper(II) complex exhibited the highest potency and its minimum inhibitory concentration on the enzymatic activities of the tested microbial species was determined. No toxin productivity was detected for all tested toxigenic species upon the exposure of copper complex.

  11. Nitrogen Oxide Atom-Transfer Redox Chemistry; Mechanism of NO(g) to Nitrite Conversion Utilizing µ-oxo Heme-FeIII−O−CuII(L) Constructs

    PubMed Central

    Hematian, Shabnam; Kenkel, Isabell; Shubina, Tatyana E.; Dürr, Maximilian; Liu, Jeffrey J.; Siegler, Maxime A.; Ivanovic-Burmazovic, Ivana; Karlin, Kenneth D.

    2015-01-01

    While nitric oxide (NO, nitrogen monoxide) is a critically important signaling agent, its cellular concentrations must be tightly controlled, generally through its oxidative conversion to nitrite (NO2−) where it is held in reserve to be reconverted as needed. In part, this reaction is mediated by the binuclear heme a3/CuB active site of cytochrome c oxidase. In this report, the oxidation of NO(g) to nitrite is shown to occur efficiently in new synthetic µ-oxo heme-FeIII−O−CuII(L) constructs (L being a tridentate or tetradentate pyridyl/alkylamino ligand), and spectroscopic and kinetic investigations provide detailed mechanistic insights. Two new X-ray structures of µ-oxo complexes have been determined and compared to literature analogs. All µ-oxo complexes react with 2 mol equiv NO(g) to give 1:1 mixtures of discrete [(L)CuII(NO2−)]+ plus ferrous heme-nitrosyl compounds; when the first NO(g) equiv reduces the heme center and itself is oxidized to nitrite, the second equiv of NO(g) traps the ferrous heme thus formed. For one µ-oxo heme-FeIII−O−CuII(L) compound, the reaction with NO(g) reveals an intermediate species (“intermediate”), formally a bis-NO adduct, [(NO)(porphyrinate)FeII-(NO2−)−CuII(L)]+ (λmax = 433 nm), confirmed by cryo-spray ionization mass spectrometry and EPR spectroscopy, along with the observation that cooling a 1:1 mixture of [(L)CuII(NO2−)]+ and heme-FeII(NO) to −125 °C leads to association and generation of the key 433 nm UV–vis feature. Kinetic-thermodynamic parameters obtained from low-temperature stopped-flow measurements are in excellent agreement with DFT calculations carried out which describe the sequential addition of NO(g) to the µ-oxo complex. PMID:25974136

  12. Synthesis of New N,N'-Bis(5-arylidene-4-oxo-4,5-dihydrothiazolin-2-yl)piperazine Derivatives Under Microwave Irradiation and Preliminary Biological Evaluation.

    PubMed

    Coulibaly, Wacothon Karime; Paquin, Ludovic; Bénié, Anoubilé; Bekro, Yves-Alain; Durieux, Emilie; Meijer, Laurent; Le Guével, Rémy; Corlu, Anne; Bazureau, Jean-Pierre

    2012-12-01

    New N,N'-bis(5-arylidene-4-oxo-4,5-dihydrothiazoline-2-yl)diamine derivatives 5 were prepared in two steps from rhodanine and piperazine, or 1,4-bis(3-amino-propyl)piperazine, under microwave reaction conditions with retention of configuration. Some of these compounds were tested for in vitro antiproliferative activities and for their kinase inhibitory potencies towards six kinases (CDK5/p25, GSK3α/β, DYRK1A, DYRK2, CLK1, and CLK2). The compound 5d showed nanomolar activity towards DYRK1A kinase (IC(50) = 0.041 μM). PMID:23264934

  13. μ-Oxo-Dinuclear-Iron(III)-Catalyzed O-Selective Acylation of Aliphatic and Aromatic Amino Alcohols and Transesterification of Tertiary Alcohols.

    PubMed

    Horikawa, Rikiya; Fujimoto, Chika; Yazaki, Ryo; Ohshima, Takashi

    2016-08-22

    A highly chemoselective and reactive μ-oxo-dinuclear iron(III) salen catalyst for transesterification was developed. The developed iron complex catalyzed acylation of aliphatic amino alcohols with nearly perfect O-selectivity, even when using activated esters, for which chemoselectivity is more difficult to control. In addition, O-selective transesterification of aromatic amino alcohols was achieved for the first time. The high activity of the iron complex enabled the use of sterically congested tertiary alcohols, including unprecedented tert-butanol. PMID:27309126

  14. Reactive oxygen species-related activities of nano-iron metal and nano-iron oxides.

    PubMed

    Wu, Haohao; Yin, Jun-Jie; Wamer, Wayne G; Zeng, Mingyong; Lo, Y Martin

    2014-03-01

    Nano-iron metal and nano-iron oxides are among the most widely used engineered and naturally occurring nanostructures, and the increasing incidence of biological exposure to these nanostructures has raised concerns about their biotoxicity. Reactive oxygen species (ROS)-induced oxidative stress is one of the most accepted toxic mechanisms and, in the past decades, considerable efforts have been made to investigate the ROS-related activities of iron nanostructures. In this review, we summarize activities of nano-iron metal and nano-iron oxides in ROS-related redox processes, addressing in detail the known homogeneous and heterogeneous redox mechanisms involved in these processes, intrinsic ROS-related properties of iron nanostructures (chemical composition, particle size, and crystalline phase), and ROS-related bio-microenvironmental factors, including physiological pH and buffers, biogenic reducing agents, and other organic substances.

  15. Metal ion-mediated polymer superquenching for highly sensitive detection of kinase and phosphatase activities.

    PubMed

    Rininsland, Frauke; Xia, Wensheng; Wittenburg, Shannon; Shi, Xiaobo; Stankewicz, Casey; Achyuthan, Komandoor; McBranch, Duncan; Whitten, David

    2004-10-26

    An assay technology for high-throughput screening of kinase and phosphatase activities is introduced. The format is based upon superquenching of fluorescent-conjugated polymers by dye-labeled kinase/phosphatase peptide substrates. The sensor platform is composed of highly fluorescent-conjugated polyelectrolytes colocated with the phosphate coordinating metal ion gallium on microspheres. Phosphorylated peptide substrates containing a quencher bind specifically to the metal ions by means of phosphate groups, resulting in quench of polymer fluorescence. The modulation of fluorescence signal is proportional to kinase or phosphatase activity and is monitored as a turn-off or turn-on signal, respectively. The assay is homogeneous and simple and can be run either as an endpoint measurement or in a kinetic mode. The assay meets the sensitivity required for high-throughput screening of kinase or phosphatase inhibitors and is a valuable tool for drug discovery. A modified version of the assay allows for the detection of protein phosphorylation.

  16. Local atomic structure modulations activate metal oxide as electrocatalyst for hydrogen evolution in acidic water.

    PubMed

    Li, Yu Hang; Liu, Peng Fei; Pan, Lin Feng; Wang, Hai Feng; Yang, Zhen Zhong; Zheng, Li Rong; Hu, P; Zhao, Hui Jun; Gu, Lin; Yang, Hua Gui

    2015-08-19

    Modifications of local structure at atomic level could precisely and effectively tune the capacity of materials, enabling enhancement in the catalytic activity. Here we modulate the local atomic structure of a classical but inert transition metal oxide, tungsten trioxide, to be an efficient electrocatalyst for hydrogen evolution in acidic water, which has shown promise as an alternative to platinum. Structural analyses and theoretical calculations together indicate that the origin of the enhanced activity could be attributed to the tailored electronic structure by means of the local atomic structure modulations. We anticipate that suitable structure modulations might be applied on other transition metal oxides to meet the optimal thermodynamic and kinetic requirements, which may pave the way to unlock the potential of other promising candidates as cost-effective electrocatalysts for hydrogen evolution in industry.

  17. Local atomic structure modulations activate metal oxide as electrocatalyst for hydrogen evolution in acidic water

    PubMed Central

    Li, Yu Hang; Liu, Peng Fei; Pan, Lin Feng; Wang, Hai Feng; Yang, Zhen Zhong; Zheng, Li Rong; Hu, P.; Zhao, Hui Jun; Gu, Lin; Yang, Hua Gui

    2015-01-01

    Modifications of local structure at atomic level could precisely and effectively tune the capacity of materials, enabling enhancement in the catalytic activity. Here we modulate the local atomic structure of a classical but inert transition metal oxide, tungsten trioxide, to be an efficient electrocatalyst for hydrogen evolution in acidic water, which has shown promise as an alternative to platinum. Structural analyses and theoretical calculations together indicate that the origin of the enhanced activity could be attributed to the tailored electronic structure by means of the local atomic structure modulations. We anticipate that suitable structure modulations might be applied on other transition metal oxides to meet the optimal thermodynamic and kinetic requirements, which may pave the way to unlock the potential of other promising candidates as cost-effective electrocatalysts for hydrogen evolution in industry. PMID:26286479

  18. Determination of reactions between free radicals and selected Chilean wines and transition metals by ESR and UV-vis technique

    NASA Astrophysics Data System (ADS)

    Espinoza, Mónica; Olea-Azar, Claudio; Speisky, Hernán; Rodríguez, Jorge

    2009-01-01

    Four different types of Chilean wines (Cabernet Sauvignon, Merlot, Carmenere and Syrah) were selected and examined in their free radical scavenging capacities by electron spin resonance (ESR) and spectrophotometric methods. The free radical scavenging properties were evaluated against 2,2-diphenyl-1-picrylhydrazyl (DPPH rad ) radical, 2,6-di- tert-butyl-alpha-(3,5-di- tert-butyl-4-oxo-2,5-cyclohexadien-1-ylidene)- p-tolyloxy (Galvinoxyl) radical and hydroxyl radical (HO rad ). The possible effect on these scavenging properties of added transition metals to these wines was evaluated. Among the wines evaluated, Cabernet Sauvignon was the one with the highest activity against all radicals tested. The presence of added copper or iron to wines resulted in a reduced free radical scavenging capacity for all type of wines studied. The formation of redox inactive complexes between polyphenols of wine and transition metals is the possible cause of this reduction in antioxidant activity.

  19. Determination of reactions between free radicals and selected Chilean wines and transition metals by ESR and UV-vis technique.

    PubMed

    Espinoza, Mónica; Olea-Azar, Claudio; Speisky, Hernán; Rodríguez, Jorge

    2009-01-01

    Four different types of Chilean wines (Cabernet Sauvignon, Merlot, Carmenere and Syrah) were selected and examined in their free radical scavenging capacities by electron spin resonance (ESR) and spectrophotometric methods. The free radical scavenging properties were evaluated against 2,2-diphenyl-1-picrylhydrazyl (DPPH*) radical, 2,6-di-tert-butyl-alpha-(3,5-di-tert-butyl-4-oxo-2,5-cyclohexadien-1-ylidene)-p-tolyloxy (Galvinoxyl) radical and hydroxyl radical (HO*). The possible effect on these scavenging properties of added transition metals to these wines was evaluated. Among the wines evaluated, Cabernet Sauvignon was the one with the highest activity against all radicals tested. The presence of added copper or iron to wines resulted in a reduced free radical scavenging capacity for all type of wines studied. The formation of redox inactive complexes between polyphenols of wine and transition metals is the possible cause of this reduction in antioxidant activity.

  20. Structure, bonding, and catalytic activity of monodisperse, transition-metal-substituted CeO2 nanoparticles.

    PubMed

    Elias, Joseph S; Risch, Marcel; Giordano, Livia; Mansour, Azzam N; Shao-Horn, Yang

    2014-12-10

    We present a simple and generalizable synthetic route toward phase-pure, monodisperse transition-metal-substituted ceria nanoparticles (M0.1Ce0.9O2-x, M = Mn, Fe, Co, Ni, Cu). The solution-based pyrolysis of a series of heterobimetallic Schiff base complexes ensures a rigorous control of the size, morphology and composition of 3 nm M0.1Ce0.9O2-x crystallites for CO oxidation catalysis and other applications. X-ray absorption spectroscopy confirms the dispersion of aliovalent (M(3+) and M(2+)) transition metal ions into the ceria matrix without the formation of any bulk transition metal oxide phases, while steady-state CO oxidation catalysis reveals an order of magnitude increase in catalytic activity with copper substitution. Density functional calculations of model slabs of these compounds confirm the stabilization of M(3+) and M(2+) in the lattice of CeO2. These results highlight the role of the host CeO2 lattice in stabilizing high oxidation states of aliovalent transition metal dopants that ordinarily would be intractable, such as Cu(3+), as well as demonstrating a rational approach to catalyst design. The current work demonstrates, for the first time, a generalizable approach for the preparation of transition-metal-substituted CeO2 for a broad range of transition metals with unparalleled synthetic control and illustrates that Cu(3+) is implicated in the mechanism for CO oxidation on CuO-CeO2 catalysts. PMID:25406101

  1. Metal-Mediated Modulation of Streptococcal Cysteine Protease Activity and Its Biological Implications

    PubMed Central

    Chella Krishnan, Karthickeyan; Mukundan, Santhosh; Landero Figueroa, Julio A.; Caruso, Joseph A.

    2014-01-01

    Streptococcal cysteine protease (SpeB), the major secreted protease produced by group A streptococcus (GAS), cleaves both host and bacterial proteins and contributes importantly to the pathogenesis of invasive GAS infections. Modulation of SpeB expression and/or its activity during invasive GAS infections has been shown to affect bacterial virulence and infection severity. Expression of SpeB is regulated by the GAS CovR-CovS two-component regulatory system, and we demonstrated that bacteria with mutations in the CovR-CovS two-component regulatory system are selected for during localized GAS infections and that these bacteria lack SpeB expression and exhibit a hypervirulent phenotype. Additionally, in a separate study, we showed that expression of SpeB can also be modulated by human transferrin- and/or lactoferrin-mediated iron chelation. Accordingly, the goal of this study was to investigate the possible roles of iron and other metals in modulating SpeB expression and/or activity in a manner that would potentiate bacterial virulence. Here, we report that the divalent metals zinc and copper inhibit SpeB activity at the posttranslational level. Utilizing online metal-binding site prediction servers, we identified two putative metal-binding sites in SpeB, one of which involves the catalytic-dyad residues 47Cys and 195His. Based on our findings, we propose that zinc and/or copper availability in the bacterial microenvironment can modulate the proteolytic activity of SpeB in a manner that preserves the integrity of several other virulence factors essential for bacterial survival and dissemination within the host and thereby may exacerbate the severity of invasive GAS infections. PMID:24799625

  2. Logical regulation of the enzyme-like activity of gold nanoparticles by using heavy metal ions

    NASA Astrophysics Data System (ADS)

    Lien, Chia-Wen; Chen, Ying-Chieh; Chang, Huan-Tsung; Huang, Chih-Ching

    2013-08-01

    In this study we employed self-deposition and competitive or synergistic interactions between metal ions and gold nanoparticles (Au NPs) to develop OR, AND, INHIBIT, and XOR logic gates through regulation of the enzyme-like activity of Au NPs. In the presence of various metal ions (Ag+, Bi3+, Pb2+, Pt4+, and Hg2+), we found that Au NPs (13 nm) exhibited peroxidase-, oxidase-, or catalase-like activity. After Ag+, Bi3+, or Pb2+ ions had been deposited on the Au NPs, the particles displayed strong peroxidase-like activity; on the other hand, they exhibited strong oxidase- and catalase-like activities after reactions with Ag+/Hg2+ and Hg2+/Bi3+ ions, respectively. The catalytic activities of these Au NPs arose mainly from the various oxidation states of the surface metal atoms/ions. Taking advantage of this behavior, we constructed multiplex logic operations--OR, AND, INHIBIT, and XOR logic gates--through regulation of the enzyme-like activity after the introduction of metal ions into the Au NP solution. When we deposited Hg2+ and/or Bi3+ ions onto the Au NPs, the catalase-like activities of the Au NPs were strongly enhanced (>100-fold). Therefore, we could construct an OR logic gate by using Hg2+/Bi3+ as inputs and the catalase-like activity of the Au NPs as the output. Likewise, we constructed an AND logic gate by using Pt4+ and Hg2+ as inputs and the oxidase-like activity of the Au NPs as the output; the co-deposition of Pt and Hg atoms/ions on the Au NPs was responsible for this oxidase-like activity. Competition between Pb2+ and Hg2+ ions for the Au NPs allowed us to develop an INHIBIT logic gate--using Pb2+ and Hg2+ as inputs and the peroxidase-like activity of the Au NPs as the output. Finally, regulation of the peroxidase-like activity of the Au NPs through the two inputs Ag+ and Bi3+ enabled us to construct an XOR logic gate.In this study we employed self-deposition and competitive or synergistic interactions between metal ions and gold nanoparticles (Au NPs

  3. A Frontier Molecular Orbital determination of the active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.

    1992-11-01

    An angular overlap calculation has been used to determine the s, p and d orbital energy levels of the different types of surface sites present on a dispersed metal catalysts. The basis for these calculations is the reported finding that a large number of catalyzed reactions take place on single atom active sites on the metal surface. Thus, these sites can be considered as surface complexes made up of the central active atom surrounded by near-neighbor metal atom ``ligands`` with localized surface orbitals perturbed only by these ``ligands``. These ``complexes`` are based on a twelve coordinate species with the ``ligands`` attached to the t{sub 2g} orbitals and the coordinate axes coincident with the direction of the e{sub g} orbitals on the central atom. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  4. A Frontier Molecular Orbital determination of the active sites on dispersed metal catalysts

    SciTech Connect

    Augustine, R.L.; Lahanas, K.M.

    1992-01-01

    An angular overlap calculation has been used to determine the s, p and d orbital energy levels of the different types of surface sites present on a dispersed metal catalysts. The basis for these calculations is the reported finding that a large number of catalyzed reactions take place on single atom active sites on the metal surface. Thus, these sites can be considered as surface complexes made up of the central active atom surrounded by near-neighbor metal atom ligands'' with localized surface orbitals perturbed only by these ligands''. These complexes'' are based on a twelve coordinate species with the ligands'' attached to the t{sub 2g} orbitals and the coordinate axes coincident with the direction of the e{sub g} orbitals on the central atom. These data can permit a Frontier Molecular Orbital treatment of specific site activities as long as the surface orbital availability for overlap with adsorbed substrates is considered along with its energy value and symmetry.

  5. Active-matrix organic light-emitting diode displays on flexible metal foil substrates

    NASA Astrophysics Data System (ADS)

    Chuang, Ta-Ko

    This dissertation presents the research efforts that deal with the development of polysilicon thin film transistors (TFTs) on stainless-steel-foil substrates, the implementation of high-resolution flexible active-matrix backplanes, and the integration of the flexible polysilicon TFT backplanes with polymer light-emitting diodes. This research investigated the preparation of the steel foil substrates, the fabrication of flexible polysilicon TFT backplanes and polymer light emitting diodes (PLEDs), and the encapsulation of the flexible Active Matrix Polymer Light Emitting Diode displays. The first successful integration of polysilicon TFT backplane with PLEDs onto light-weight, robust, and flexible stainless-steel-foil substrates is presented. A top-emitting, monochrome active-matrix polymer light-emitting diode (AM-PLED) display, having the VGA (640x480) format and a 230 dpi resolution, is demonstrated for the first time on flexible stainless-steel-foil substrates. This work validates the compatibility of the polysilicon technology for high-resolution flexible AM-PLED displays. Furthermore, this work shows that a variety of other large-area microelectronics could also be implemented onto flexible metal foils, benefiting by the metal oil dimensional stability and ability to withstand high process temperature. In conclusion, the polysilicon TFT technology combining with metal-foil substrates opens up a new road for flexible displays as well as large-area flexible electronic applications.

  6. Isolated metal active site concentration and stability control catalytic CO2 reduction selectivity.

    PubMed

    Matsubu, John C; Yang, Vanessa N; Christopher, Phillip

    2015-03-01

    CO2 reduction by H2 on heterogeneous catalysts is an important class of reactions that has been studied for decades. However, atomic scale details of structure-function relationships are still poorly understood. Particularly, it has been suggested that metal particle size plays a unique role in controlling the stability of CO2 hydrogenation catalysts and the distribution of active sites, which dictates reactivity and selectivity. These studies often have not considered the possible role of isolated metal active sites in the observed dependences. Here, we utilize probe molecule diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) with known site-specific extinction coefficients to quantify the fraction of Rh sites residing as atomically dispersed isolated sites (Rhiso), as well as Rh sites on the surface of Rh nanoparticles (RhNP) for a series of TiO2 supported Rh catalysts. Strong correlations were observed between the catalytic reverse water gas shift turn over frequency (TOF) and the fraction of Rhiso sites and between catalytic methanation TOF and the fraction of RhNP sites. Furthermore, it was observed that reaction condition-induced disintegration of Rh nanoparticles, forming Rhiso active sites, controls the changing reactivity with time on stream. This work demonstrates that isolated atoms and nanoparticles of the same metal on the same support can exhibit uniquely different catalytic selectivity in competing parallel reaction pathways and that disintegration of nanoparticles under reaction conditions can play a significant role in controlling stability.

  7. Metal clad active fibres for power scaling and thermal management at kW power levels.

    PubMed

    Daniel, Jae M O; Simakov, Nikita; Hemming, Alexander; Clarkson, W Andrew; Haub, John

    2016-08-01

    We present a new approach to high power fibre laser design, consisting of a polymer-free all-glass optical fibre waveguide directly overclad with a high thermal conductivity metal coating. This metal clad active fibre allows a significant reduction in thermal resistance between the active fibre and the laser heat-sink as well as a significant increase in the operating temperature range. In this paper we show the results of a detailed thermal analysis of both polymer and metal coated active fibres under thermal loads typical of kW fibre laser systems. Through several different experiments we present the first demonstration of a cladding pumped aluminium-coated fibre laser and the first demonstration of efficient operation of a cladding-pumped fibre laser at temperatures of greater than 400 °C. Finally, we highlight the versatility of this approach through operation of a passively (radiatively) cooled ytterbium fibre laser head at an output power of 405 W in a compact and ultralight package weighing less than 100 g. PMID:27505822

  8. Nitrogen-doped carbon nanotubes as a highly active metal-free catalyst for selective oxidation.

    PubMed

    Chizari, Kambiz; Deneuve, Adrien; Ersen, Ovidiu; Florea, Ileana; Liu, Yu; Edouard, David; Janowska, Izabela; Begin, Dominique; Pham-Huu, Cuong

    2012-01-01

    Catalytic reactions are generally carried out on supported metals or oxides, which act as an active phase and require impregnation and thermal treatment steps. During tests, the metal or oxide nanoparticles could be further sintered, which would induces deactivation. Direct incorporation of the active phase into the matrix of a support could be an elegant alternative to prevent catalyst deactivation. Here, we report that nitrogen-doped carbon nanotubes (N-CNTs) can be efficiently employed as a metal-free catalyst for oxidative reactions that allow the selective transformation of the harmful, gaseous H(2)S into solid sulfur. The catalyst exhibits a high stability during the test at high space velocity. The macroscopic shaping of the catalyst on the silicon carbide foam also increases its catalytic activity by improving the contact between the reactants and the catalyst. Such macroscopic shaping allows the avoidance of problems linked with transport and handling of nanoscopic materials and also reduces the pressure drop across the catalyst bed to a large extent.

  9. Isolated metal active site concentration and stability control catalytic CO2 reduction selectivity.

    PubMed

    Matsubu, John C; Yang, Vanessa N; Christopher, Phillip

    2015-03-01

    CO2 reduction by H2 on heterogeneous catalysts is an important class of reactions that has been studied for decades. However, atomic scale details of structure-function relationships are still poorly understood. Particularly, it has been suggested that metal particle size plays a unique role in controlling the stability of CO2 hydrogenation catalysts and the distribution of active sites, which dictates reactivity and selectivity. These studies often have not considered the possible role of isolated metal active sites in the observed dependences. Here, we utilize probe molecule diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) with known site-specific extinction coefficients to quantify the fraction of Rh sites residing as atomically dispersed isolated sites (Rhiso), as well as Rh sites on the surface of Rh nanoparticles (RhNP) for a series of TiO2 supported Rh catalysts. Strong correlations were observed between the catalytic reverse water gas shift turn over frequency (TOF) and the fraction of Rhiso sites and between catalytic methanation TOF and the fraction of RhNP sites. Furthermore, it was observed that reaction condition-induced disintegration of Rh nanoparticles, forming Rhiso active sites, controls the changing reactivity with time on stream. This work demonstrates that isolated atoms and nanoparticles of the same metal on the same support can exhibit uniquely different catalytic selectivity in competing parallel reaction pathways and that disintegration of nanoparticles under reaction conditions can play a significant role in controlling stability. PMID:25671686

  10. Origin of photogenerated carrier recombination at the metal-active layer interface in polymer solar cells.

    PubMed

    Kumar, Mukesh; Dubey, Ashish; Reza, Khan Mamun; Adhikari, Nirmal; Qiao, Qiquan; Bommisetty, Venkat

    2015-11-01

    The role of the metal-active layer interface in photogenerated recombination has been investigated using nanoscale current sensing atomic force microscopy (CS-AFM) and intensity modulated photocurrent spectroscopy (IMPS) in as-deposited, pre-annealed and post-annealed bulk heterojunction (BHJ) solar cells. Aluminum (Al) confined post-annealed BHJ solar cells exhibited a significantly improved device efficiency compared to pre-annealed BHJ solar cells having similar photocarrier harvesting ability in the active layer. The nanoscale topography and CS-AFM results indicate a uniform PCBM rich phase at the metal-active layer interface in the post-annealed cells, but PCBM segregation in the pre-annealed cells. These two different annealing processes showed different carrier dynamics revealed using IMPS under various light intensities. The IMPS results suggest reduced photo generated carrier recombination in uniform PCBM rich post-annealed BHJ solar cells. This study reveals the importance of the metal-bend interface in BHJ solar cells in order to obtain efficient charge carrier extraction for high efficiency. PMID:26431263

  11. Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

    PubMed Central

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

  12. Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

    PubMed

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

    2014-01-01

    In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

  13. A trinuclear oxo-chromium(III) complex containing the natural flavonoid primuletin: Synthesis, characterization, and antiradical properties

    DOE PAGES

    Rocha, Reginaldo C.; Alexiou, Anamaria D.P.; Decandio, Carla C.; Almeida, Sabrina da N.; Ferreira, Marcelo J.P.; Romoff, Paulete

    2015-04-10

    A new trinuclear oxo-centered chromium(III) complex with formula [Cr₃O(CH₃CO₂)₆(L)(H₂O)₂] (L = 5-hydroxyflavone, known as primuletin) was synthetized and characterized by ESI mass spectrometry, thermogravimetry, and ¹H-NMR, UV-Vis, and FTIR spectroscopies. In agreement with the experimental results, DFT calculations indicated that the flavonoid ligand is coordinated to one of the three Cr(III) centers in an O,O-bidentate mode through the 5-hydroxy/4-keto groups. In a comparative study involving the uncoordinated primuletin and its corresponding complex, systematic reactions with the free radical 2,2-diphenyl-1-picrylhydrazyl (DPPH) showed that antiradical activity increases upon complexation.

  14. Influence of Traffic Activity on Heavy Metal Concentrations of Roadside Farmland Soil in Mountainous Areas

    PubMed Central

    Zhang, Fan; Yan, Xuedong; Zeng, Chen; Zhang, Man; Shrestha, Suraj; Devkota, Lochan Prasad; Yao, Tandong

    2012-01-01

    Emission of heavy metals from traffic activities is an important pollution source to roadside farmland ecosystems. However, little previous research has been conducted to investigate heavy metal concentrations of roadside farmland soil in mountainous areas. Owing to more complex roadside environments and more intense driving conditions on mountainous highways, heavy metal accumulation and distribution patterns in farmland soil due to traffic activity could be different from those on plain highways. In this study, design factors including altitude, roadside distance, terrain, and tree protection were considered to analyze their influences on Cu, Zn, Cd, and Pb concentrations in farmland soils along a mountain highway around Kathmandu, Nepal. On average, the concentrations of Cu, Zn, Cd, and Pb at the sampling sites are lower than the tolerable levels. Correspondingly, pollution index analysis does not show serious roadside pollution owing to traffic emissions either. However, some maximum Zn, Cd, and Pb concentrations are close to or higher than the tolerable level, indicating that although average accumulations of heavy metals pose no hazard in the region, some spots with peak concentrations may be severely polluted. The correlation analysis indicates that either Cu or Cd content is found to be significantly correlated with Zn and Pb content while there is no significant correlation between Cu and Cd. The pattern can be reasonably explained by the vehicular heavy metal emission mechanisms, which proves the heavy metals’ homology of the traffic pollution source. Furthermore, the independent factors show complex interaction effects on heavy metal concentrations in the mountainous roadside soil, which indicate quite a different distribution pattern from previous studies focusing on urban roadside environments. It is found that the Pb concentration in the downgrade roadside soil is significantly lower than that in the upgrade soil while the Zn concentration in the

  15. Accumulation of fossil fuels and metallic minerals in active and ancient rift lakes

    USGS Publications Warehouse

    Robbins, E.I.

    1983-01-01

    A study of active and ancient rift systems around the world suggests that accumulations of fossil fuels and metallic minerals are related to the interactions of processes that form rift valleys with those that take place in and around rift lakes. The deposition of the precursors of petroleum, gas, oil shale, coal, phosphate, barite, Cu-Pb-Zn sulfides, and uranium begins with erosion of uplifted areas, and the consequent input of abundant nutrients and solute loads into swamps and tectonic lakes. Hot springs and volcanism add other nutrients and solutes. The resulting high biological productivity creates oxidized/reduced interfaces, and anoxic and H2S-rich bottom waters which preserves metal-bearing organic tissues and horizons. In the depositional phases, the fine-grained lake deposits are in contact with coarse-grained beach, delta, river, talus, and alluvial fan deposits. Earthquake-induced turbidites also are common coarse-grained deposits of rift lakes. Postdepositional processes in rifts include high heat flow and a resulting concentration of the organic and metallic components that were dispersed throughout the lakebeds. Postdepositional faulting brings organic- and metal-rich sourcebeds in contact with coarse-grained host and reservoir rocks. A suite of potentially economic deposits is therefore a characteristic of rift valleys. ?? 1983.

  16. THE CHROMOSPHERIC ACTIVITY, AGE, METALLICITY, AND SPACE MOTIONS OF 36 WIDE BINARIES

    SciTech Connect

    Zhao, J. K.; Oswalt, T. D.; Rudkin, M.; Zhao, G.; Chen, Y. Q. E-mail: toswalt@fit.edu E-mail: gzhao@bao.ac.cn

    2011-04-15

    We present the chromospheric activity (CA) levels, metallicities, and full space motions for 41 F, G, K, and M dwarf stars in 36 wide binary systems. Thirty-one of the binaries contain a white dwarf (WD) component. In such binaries, the total age can be estimated by adding the cooling age of the WD to an estimate of the progenitor's main-sequence lifetime. To better understand how CA correlates to stellar age, 14 cluster member stars were also observed. Our observations demonstrate for the first time that, in general, CA decays with age from 50 Myr to at least 8 Gyr for stars with 1.0 {<=} V - I {<=} 2.4. However, little change occurs in the CA level for stars with V - I < 1.0 between 1 Gyr and 5 Gyr, consistent with the results of Pace et al. Our sample also exhibits a negative correlation between the stellar age and metallicity, a positive correlation between the stellar age and W space velocity component, and the W velocity dispersion increases with age. Finally, the population membership of these wide binaries is examined based upon their U, V, W kinematics, metallicity, and CA. We conclude that wide binaries are similar to field and cluster stars in these respects. More importantly, they span a much more continuous range in age and metallicity than is afforded by nearby clusters.

  17. Is interaction of amyloid β-peptides with metals involved in cognitive activity?

    PubMed

    Tamano, Haruna; Takeda, Atsushi

    2015-08-01

    Metal ions, i.e., Zn(2+) and Cu(2+), are released from neuron terminals in the hippocampus, which plays important roles in spatial and declarative memory, and may serve as a signal factor. Synaptic homeostasis of metal ions is critical for cognitive activity in the hippocampus. Amyloid-β (Aβ) is a causative candidate for the pathogenesis of Alzheimer's disease (AD) and Aβ-induced synapse dysfunction is easy to emerge along with normal aging and leads to the cognitive decline and memory loss in the pre-dementia stage of AD. Because Aβ interacts with Zn(2+) and Cu(2+), it is likely that these metal ions are involved in the Aβ-induced modification of the synaptic function. There is evidence to indicate that the inhibition of the interaction of Aβ with Zn(2+) and Cu(2+) may ameliorate the pathophysiology of AD. Interaction of extracellular Zn(2+) with Aβ in the hippocampus is involved in transiently Aβ-induced cognition deficits, while the interaction of extracellular Cu(2+) reduces bioavailability of intracellular Cu(2+), followed by an increase in oxidative stress, which may lead to cognitive deficits. It is likely that Zn(2+) and Cu(2+) play as a key-mediating factor in pathophysiology of the synaptic dysfunction in which Aβ is involved. Based on the idea that understating Aβ-induced changes in synaptic plasticity is important to prevent AD, the present paper summarizes the interaction of Aβ with metal ions in cognition. PMID:25959547

  18. CHEMICAL ACTIVATION OF MOLECULES BY METALS: EXPERIMENTAL STUDIES OF ELECTRON DISTRIBUTIONS AND BONDING

    SciTech Connect

    LICHTENBERGER, DENNIS L.

    2002-03-26

    This research program is directed at obtaining detailed experimental information on the electronic interactions between metals and organic molecules. These interactions provide low energy pathways for many important chemical and catalytic processes. A major feature of the program is the continued development and application of our special high-resolution valence photoelectron spectroscopy (UPS), and high-precision X-ray core photoelectron spectroscopy (XPS) instrumentation for study of organometallic molecules in the gas phase. The study involves a systematic approach towards understanding the interactions and activation of bound carbonyls, C-H bonds, methylenes, vinylidenes, acetylides, alkenes, alkynes, carbenes, carbynes, alkylidenes, alkylidynes, and others with various monometal, dimetal, and cluster metal species. Supporting ligands include -aryls, alkoxides, oxides, and phosphines. We are expanding our studies of both early and late transition metal species and electron-rich and electron-poor environments in order to more completely understand the electronic factors that serve to stabilize particular organic fragments and intermediates on metals. Additional new directions for this program are being taken in ultra-high vacuum surface UPS, XPS, scanning tunneling microscopy (STM) and atomic force microscopy (AFM) experiments on both physisorbed and chemisorbed organometallic thin films. The combination of these methods provides additional electronic structure information on surface-molecule and molecule-molecule interactions. A very important general result emerging from this program is the identification of a close relationship between the ionization energies of the species and the thermodynamics of the chemical and catalytic reactions of these systems.

  19. Synthesis and antimicrobial activity of polysaccharide alginate derived cationic surfactant-metal(II) complexes.

    PubMed

    Tawfik, Salah M; Hefni, Hassan H

    2016-01-01

    New natural polysaccharide carbohydrate derivatives of sodium alginate surfactant and its cobalt, copper and zinc complexes were synthesized. Structures of the synthesized compounds are reported using FTIR, (1)H NMR and UV-vis. The critical micelle concentration (CMC) value of the alginate surfactant and its metal complexes in aqueous solution was found out from surface tension measurements. Surface tension data at different temperatures served for the evaluation of the temperature-dependent CMC and the thermodynamics of micellization (ΔGmic, ΔHmic, ΔSmic) and adsorption (ΔGads, ΔGads, ΔSads). The surface activities of the synthesized polymeric surfactant and its metal complexes were influenced by their chemical structures and the type of the transition metals. These compounds were evaluated against Gram-positive bacteria (Bacillus subtilis and Staphylococcus aureus), Gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa) and fungi (Candida albicans and Asperigllus niger). The antibacterial and antifungal screening tests of the alginate surfactant metal complexes have shown good results compared to its precursor alginate surfactant.

  20. Mobility of heavy metals from tailings to stream waters in a mining activity contaminated site.

    PubMed

    Concas, A; Ardau, C; Cristini, A; Zuddas, P; Cao, G

    2006-04-01

    In this paper the results of a recent characterization of Rio Piscinas (SW of Sardinia, Italy) hydrological basin are reported. In such area (about 50 km2), previous mining activities caused a serious heavy metal contamination of surface waters, groundwater, soils and biota. Acid mine drainage phenomena were observed in the area. The main sources of contamination are the tailings stored in mine tunnels and abandoned along fluvial banks. A methodological approach was adopted in order to identify relations between tailings and water contamination. Representative samples of tailings and stream sediments samples were collected. XRD analyses were performed for mineralogical characterization, while acid digestion was carried out for determining metal contents. Batch sequential leaching tests were performed in order to assess metal mobility. Also groundwater and stream water were sampled in specific locations and suitably characterized. All information collected allowed the understanding of the effect of tailings on water contamination, thus contributing to the qualitative prediction of pollution evolution on the basis of metal mobility. Finally, a potential remediation strategy of stream water is proposed.

  1. Steric and Electronic Control over the Reactivity of a Thiolate-Ligated Fe(II) Complex with Dioxygen and Superoxide: Reversible μ-Oxo Dimer Formation

    PubMed Central

    Theisen, Roslyn M.; Shearer, Jason; Kaminsky, Werner; Kovacs, Julie A.

    2015-01-01

    The reactivity between a thiolate-ligated five-coordinate complex [FeII(SMe2N4(tren))]+ (1) and dioxygen is examined in order to determine if O2 activation, resembling that of the metalloenzyme cytochrome P450, can be promoted even when O2 binds cis, as opposed to trans, to a thiolate. Previous work in our group showed that [FeII(SMe2N4-(tren))]+ (1) reacts readily with superoxide (O2−) in the presence of a proton source to afford H2O2 via an FeIII–OOH intermediate, thus providing a biomimetic model for the metalloenzyme superoxide reductase (SOR). Addition of O2 to 1 affords binuclear μ-oxo-bridged [FeIII(SMe2N4(tren))]2(μ2-O)(PF6)2•3MeCN (3). At low temperatures, in protic solvents, an intermediate is detected, the details of which will be the subject of a separate paper. Although the thiolate ligand does not appear to perturb the metrical parameters of the unsupported μ-oxo bridge (Fe–O=1.807(8) Å, and Fe–O–Fe= 155.3(5)° fall in the usual range), it decreases the magnetic coupling between the irons (J = −28 cm−1) and creates a rather basic oxo site. Protonation of this oxo using strong (HBF4, HCl) or weak (HOAc, NH4PF6, LutNHCl) acids results in bridge cleavage to cleanly afford the corresponding monomeric anion-ligated (OAc− (6), or Cl− (7)) or solvent-ligated (MeCN (4)) derivatives. Addition of OH− converts [FeIII(SMe2N4-(tren))(MeCN)]2+ (4) back to μ-oxo 3. Thus, μ-oxo bridge cleavage is reversible. The protonated μ-hydroxo-bridged intermediate is not observed. In an attempt to prevent μ-oxo dimer formation, and facilitate the observation of O2-bound intermediates, a bulkier tertiary amine ligand, tren-Et4= N-(2-amino-ethyl)-N-(2-diethylamino-ethyl)-N′,N′-diethyl-ethane-1,2-diamine, and the corresponding [FeII(SMe2N4(tren-Et4))]+ (5) complex was synthesized and structurally characterized. Steric repulsive interactions create unusually long FeII-N(3,4) amine bonds in 5 (mean distance = 2.219(1) Å). The [(tren-Et4)N4SMe2]1

  2. 40 CFR 721.10019 - Benzoic acid, 2-chloro-5-nitro-, 1,1-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester. 721.10019 Section 721.10019 Protection of Environment...-, 1,1-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester. (a) Chemical substance and significant new uses...-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester (PMN P-01-563; CAS No. 174489-76-0) is subject to...

  3. 40 CFR 721.10019 - Benzoic acid, 2-chloro-5-nitro-, 1,1-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester. 721.10019 Section 721.10019 Protection of Environment...-, 1,1-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester. (a) Chemical substance and significant new uses...-dimethyl-2-oxo-2-(2-propenyloxy) ethyl ester (PMN P-01-563; CAS No. 174489-76-0) is subject to...

  4. A novel chemical oxo-precipitation (COP) process for efficient remediation of boron wastewater at room temperature.

    PubMed

    Shih, Yu-Jen; Liu, Chia-Hsun; Lan, Wei-Cheng; Huang, Yao-Hui

    2014-09-01

    Chemical oxo-precipitation (COP), which combines treatment with an oxidant and precipitation using metal salts, was developed for treating boron-containing water under milder conditions (room temperature, pH 10) than those of conventional coagulation processes. The concentration of boron compounds was 1000mg-BL(-1). They included boric acid (H3BO3) and perborate (NaBO3). Precipitation using calcium chloride eliminated 80% of the boron from the perborate solution, but was unable to treat boric acid. COP uses hydrogen peroxide (H2O2) to pretreat boric acid, substantially increasing the removal of boron from boric acid solution by chemical precipitation from less than 5% to 80%. Furthermore, of alkaline earth metals, barium ions are the most efficient precipitant, and can increase the 80% boron removal to 98.5% at [H2O2]/[B] and [Ba]/[B] molar ratios of 2 and 1, respectively. The residual boron in the end water of COP contained 15ppm-B: this value cannot be achieved using conventional coagulation processes.

  5. Redox-inactive metal ions promoted the catalytic reactivity of non-heme manganese complexes towards oxygen atom transfer.

    PubMed

    Choe, Cholho; Yang, Ling; Lv, Zhanao; Mo, Wanling; Chen, Zhuqi; Li, Guangxin; Yin, Guochuan

    2015-05-21

    Redox-inactive metal ions can modulate the reactivity of redox-active metal ions in a variety of biological and chemical oxidations. Many synthetic models have been developed to help address the elusive roles of these redox-inactive metal ions. Using a non-heme manganese(II) complex as the model, the influence of redox-inactive metal ions as a Lewis acid on its catalytic efficiency in oxygen atom transfer was investigated. In the absence of redox-inactive metal ions, the manganese(II) catalyst is very sluggish, for example, in cyclooctene epoxidation, providing only 9.9% conversion with 4.1% yield of epoxide. However, addition of 2 equiv. of Al(3+) to the manganese(II) catalyst sharply improves the epoxidation, providing up to 97.8% conversion with 91.4% yield of epoxide. EPR studies of the manganese(II) catalyst in the presence of an oxidant reveal a 16-line hyperfine structure centered at g = 2.0, clearly indicating the formation of a mixed valent di-μ-oxo-bridged diamond core, Mn(III)-(μ-O)2-Mn(IV). The presence of a Lewis acid like Al(3+) causes the dissociation of this diamond Mn(III)-(μ-O)2-Mn(IV) core to form monomeric manganese(iv) species which is responsible for improved epoxidation efficiency. This promotional effect has also been observed in other manganese complexes bearing various non-heme ligands. The findings presented here have provided a promising strategy to explore the catalytic reactivity of some di-μ-oxo-bridged complexes by adding non-redox metal ions to in situ dissociate those dimeric cores and may also provide clues to understand the mechanism of methane monooxygenase which has a similar diiron diamond core as the intermediate.

  6. Using metal-ligand binding characteristics to predict metal toxicity: quantitative ion character-activity relationships (QICARs).

    PubMed Central

    Newman, M C; McCloskey, J T; Tatara, C P

    1998-01-01

    Ecological risk assessment can be enhanced with predictive models for metal toxicity. Modelings of published data were done under the simplifying assumption that intermetal trends in toxicity reflect relative metal-ligand complex stabilities. This idea has been invoked successfully since 1904 but has yet to be applied widely in quantitative ecotoxicology. Intermetal trends in toxicity were successfully modeled with ion characteristics reflecting metal binding to ligands for a wide range of effects. Most models were useful for predictive purposes based on an F-ratio criterion and cross-validation, but anomalous predictions did occur if speciation was ignored. In general, models for metals with the same valence (i.e., divalent metals) were better than those combining mono-, di-, and trivalent metals. The softness parameter (sigma p) and the absolute value of the log of the first hydrolysis constant ([symbol: see text] log KOH [symbol: see text]) were especially useful in model construction. Also, delta E0 contributed substantially to several of the two-variable models. In contrast, quantitative attempts to predict metal interactions in binary mixtures based on metal-ligand complex stabilities were not successful. PMID:9860900

  7. First structural characterization of a protactinium(V) single oxo bond in aqueous media.

    PubMed

    Le Naour, Claire; Trubert, Didier; Di Giandomenico, Maria V; Fillaux, Clara; Den Auwer, Christophe; Moisy, Philippe; Hennig, Christoph

    2005-12-12

    The present work describes the first structural studies of protactinium(V) in sulfuric and hydrofluoric acid media using X-ray absorption spectroscopy. The results show unambiguously the absence of the trans-dioxo bond that characterizes the other early actinide elements such as U and Np. In concentrated sulfuric acid (13 M), Pa(V) is proved to exhibit a single oxo bond as postulated in the literature for species in more dilute media. In a 0.5 M HF medium, XANES and EXAFS spectra indicate the absence of any oxo bond: Pa(V) exists in the form of a pure fluoro complex.

  8. First structural characterization of a protactinium(V) single oxo bond in aqueous media.

    PubMed

    Le Naour, Claire; Trubert, Didier; Di Giandomenico, Maria V; Fillaux, Clara; Den Auwer, Christophe; Moisy, Philippe; Hennig, Christoph

    2005-12-12

    The present work describes the first structural studies of protactinium(V) in sulfuric and hydrofluoric acid media using X-ray absorption spectroscopy. The results show unambiguously the absence of the trans-dioxo bond that characterizes the other early actinide elements such as U and Np. In concentrated sulfuric acid (13 M), Pa(V) is proved to exhibit a single oxo bond as postulated in the literature for species in more dilute media. In a 0.5 M HF medium, XANES and EXAFS spectra indicate the absence of any oxo bond: Pa(V) exists in the form of a pure fluoro complex. PMID:16323942

  9. On the Correlation between the Magnetic Activity Levels, Metallicities, and Radii of Low-Mass Stars

    NASA Astrophysics Data System (ADS)

    López-Morales, Mercedes

    2007-05-01

    The recent increase in the number of radius measurements of very low mass stars from eclipsing binaries and interferometry of single stars has raised more questions about what could be causing the discrepancy between the observed radii and those predicted by models. The two main explanations being proposed are a correlation between the radii of the stars and either their activity levels or their metallicities. This paper presents a study of such correlations using all the data published to date. The study also investigates correlations between the radius deviations from the models and the masses of the stars. There is no clear correlation between activity level and radius for the single stars in the sample. These single stars are slow rotators, with typical velocities vrotsini<3.0 km s-1. A clear correlation however exists in the case of the faster rotating members of binaries. This result is based on the X-ray emission levels of the stars. There also appears to be an increase in the deviation of the radii of single stars from the models as a function of metallicity, as previously indicated by Berger et al. The stars in binaries do not seem to follow the same trend. Finally, the Baraffe et al. models reproduce well the radius observations below 0.30-0.35 Msolar, where the stars become fully convective, although this result is preliminary since almost all the sample stars in that mass range are slow rotators and metallicities have not been measured for most of them. The results indicate that stellar activity and metallicity play an important role in determining the radius of very low mass stars, at least above 0.35 Msolar.

  10. Ionic Liquid Activation of Amorphous Metal-Oxide Semiconductors for Flexible Transparent Electronic Devices

    DOE PAGES

    Pudasaini, Pushpa Raj; Noh, Joo Hyon; Wong, Anthony T.; Ovchinnikova, Olga S.; Haglund, Amanda V.; Dai, Sheng; Ward, Thomas Zac; Mandrus, David; Rack, Philip D.

    2016-02-09

    To begin this abstract, amorphous metal-oxide semiconductors offer the high carrier mobilities and excellent large-area uniformity required for high performance, transparent, flexible electronic devices; however, a critical bottleneck to their widespread implementation is the need to activate these materials at high temperatures which are not compatible with flexible polymer substrates. The highly controllable activation of amorphous indium gallium zinc oxide semiconductor channels using ionic liquid gating at room temperature is reported. Activation is controlled by electric field-induced oxygen migration across the ionic liquid-semiconductor interface. In addition to activation of unannealed devices, it is shown that threshold voltages of a transistormore » can be linearly tuned between the enhancement and depletion modes. Finally, the first ever example of transparent flexible thin film metal oxide transistor on a polyamide substrate created using this simple technique is demonstrated. Finally, this study demonstrates the potential of field-induced activation as a promising alternative to traditional postdeposition thermal annealing which opens the door to wide scale implementation into flexible electronic applications.« less

  11. The impact of metal pollution on soil faunal and microbial activity in two grassland ecosystems.

    PubMed

    Boshoff, Magdalena; De Jonge, Maarten; Dardenne, Freddy; Blust, Ronny; Bervoets, Lieven

    2014-10-01

    In this study the influence of metal pollution on soil functional activity was evaluated by means of Bait lamina and BIOLOG(®) EcoPlates™ assays. The in situ bait lamina assay investigates the feeding activity of macrofauna, mesofauna and microarthropods while the BIOLOG(®) EcoPlate™ assay measures the metabolic fingerprint of a selectively extracted microbial community. Both assays proved sensitive enough to reveal changes in the soil community between the plots nearest to and further away from a metal pollution source. Feeding activity (FA) at the less polluted plots reached percentages of 90% while plots nearer to the source of pollution reached percentages as low as 10%. After 2 and 6 days of incubation average well color development (AWCD) and functional richness (R') were significantly lower at the plots closest to the source of pollution. While the Shannon Wiener diversity index (H') decreased significantly at sites nearer to the source of pollution after 2 days but not after 6 days of incubation. Arsenic, Cu and Pb correlated significantly and negatively with feeding activity and functional indices while the role of changing environmental factors such as moisture percentage could not be ruled out completely. Compared to the Bait lamina method that is used in situ and which is therefore more affected by site specific variation, the BIOLOG assay, which excludes confounding factors such as low moisture percentage, may be a more reliable assay to measure soil functional activity.

  12. Highly active non-PGM catalysts prepared from metal organic frameworks

    SciTech Connect

    Barkholtz, Heather M.; Chong, Lina; Kaiser, Zachary B.; Xu, Tao; Liu, Di -Jia

    2015-06-11

    Finding inexpensive alternatives to platinum group metals (PGMs) is essential for reducing the cost of proton exchange membrane fuel cells (PEMFCs). Numerous materials have been investigated as potential replacements of Pt, of which the transition metal and nitrogen-doped carbon composites (TM/Nx/C) prepared from iron doped zeolitic imidazolate frameworks (ZIFs) are among the most active ones in catalyzing the oxygen reduction reaction based on recent studies. In this report, we demonstrate that the catalytic activity of ZIF-based TM/Nx/C composites can be substantially improved through optimization of synthesis and post-treatment processing conditions. Ultimately, oxygen reduction reaction (ORR) electrocatalytic activity must be demonstrated in membrane-electrode assemblies (MEAs) of fuel cells. The process of preparing MEAs using ZIF-based non-PGM electrocatalysts involves many additional factors which may influence the overall catalytic activity at the fuel cell level. Evaluation of parameters such as catalyst loading and perfluorosulfonic acid ionomer to catalyst ratio were optimized. Our overall efforts to optimize both the catalyst and MEA construction process have yielded impressive ORR activity when tested in a fuel cell system.

  13. Highly active non-PGM catalysts prepared from metal organic frameworks

    DOE PAGES

    Barkholtz, Heather M.; Chong, Lina; Kaiser, Zachary B.; Xu, Tao; Liu, Di -Jia

    2015-06-11

    Finding inexpensive alternatives to platinum group metals (PGMs) is essential for reducing the cost of proton exchange membrane fuel cells (PEMFCs). Numerous materials have been investigated as potential replacements of Pt, of which the transition metal and nitrogen-doped carbon composites (TM/Nx/C) prepared from iron doped zeolitic imidazolate frameworks (ZIFs) are among the most active ones in catalyzing the oxygen reduction reaction based on recent studies. In this report, we demonstrate that the catalytic activity of ZIF-based TM/Nx/C composites can be substantially improved through optimization of synthesis and post-treatment processing conditions. Ultimately, oxygen reduction reaction (ORR) electrocatalytic activity must be demonstratedmore » in membrane-electrode assemblies (MEAs) of fuel cells. The process of preparing MEAs using ZIF-based non-PGM electrocatalysts involves many additional factors which may influence the overall catalytic activity at the fuel cell level. Evaluation of parameters such as catalyst loading and perfluorosulfonic acid ionomer to catalyst ratio were optimized. Our overall efforts to optimize both the catalyst and MEA construction process have yielded impressive ORR activity when tested in a fuel cell system.« less

  14. Antioxidant, Metal Chelating, Anti-glucosidase Activities and Phytochemical Analysis of Selected Tropical Medicinal Plants

    PubMed Central

    Wong, Fai-Chu; Yong, Ann-Li; Ting, Evon Peir-Shan; Khoo, Sim-Chyi; Ong, Hean-Chooi; Chai, Tsun-Thai

    2014-01-01

    The purpose of this investigation was to determine the antioxidant potentials and anti-glucosidase activities of six tropical medicinal plants. The levels of phenolic constituents in these medicinal plants were also quantified and compared. Antioxidation potentials were determined colorimetrically for scavenging activities against DPPH and NO radicals. Metal chelating assay was based on the measurement of iron-ferrozine absorbance at 562 nm. Anti-diabetic potentials were measured by using α-glucosidase as target enzyme. Medicinal plants’ total phenolic, total flavonoid and hydroxycinnamic acid contents were determined using spectrophotometric methods, by comparison to standard plots prepared using gallic acid, quercetin and caffeic acid standards, respectively. Radical scavenging and metal chelating activities were detected in all medicinal plants, in concentration-dependent manners. Among the six plants tested, C. nutans, C. formosana and H. diffusa were found to possess α-glucosidase inhibitory activities. Spectrophotometric analysis indicated that the total phenolic, total flavonoid and hydroxycinnamic acid contents ranged from 12.13-21.39 mg GAE per g of dry sample, 1.83-9.86 mg QE per g of dry sample, and 0.91-2.74 mg CAE per g of dry sample, respectively. Our results suggested that C. nutans and C. formosana could potentially be used for the isolation of potent antioxidants and anti-diabetic compounds. To the best of our knowledge, this study represents the first time that C. nutans (Acanthaceae family) was reported in literature with glucosidase inhibition activity. PMID:25587331

  15. Soluble porous coordination polymers by mechanochemistry: from metal-containing films/membranes to active catalysts for aerobic oxidation.

    PubMed

    Zhang, Pengfei; Li, Haiying; Veith, Gabriel M; Dai, Sheng

    2015-01-14

    Soluble porous coordination polymers from mechanochemical synthesis are presented through a coordination polymerization between highly contorted, rigid tetraphenol and a broad variety of transition metal ions. These polymers can be easily cast as metal-containing films or freestanding membranes. Importantly, as-made coordination polymers are highly active and stable in the aerobic oxidation of allylic C-H bonds. PMID:25389070

  16. Hydrogen Sulfide Induced Carbon Dioxide Activation by Metal-Free Dual Catalysis.

    PubMed

    Kumar, Manoj; Francisco, Joseph S

    2016-03-18

    The role of metal free dual catalysis in the hydrogen sulfide (H2S)-induced activation of carbon dioxide (CO2) and subsequent decomposition of resulting monothiolcarbonic acid in the gas phase has been explored. The results suggest that substituted amines and monocarboxylic type organic or inorganic acids via dual activation mechanisms promote both activation and decomposition reactions, implying that the judicious selection of a dual catalyst is crucial to the efficient C-S bond formation via CO2 activation. Considering that our results also suggest a new mechanism for the formation of carbonyl sulfide from CO2 and H2S, these new insights may help in better understanding the coupling between the carbon and sulfur cycles in the atmospheres of Earth and Venus.

  17. Platinum nanoparticles encapsulated metal-organic frameworks for the electrochemical detection of telomerase activity.

    PubMed

    Ling, Pinghua; Lei, Jianping; Jia, Li; Ju, Huangxian

    2016-01-21

    A simple and rapid electrochemical sensor is constructed for the detection of telomerase activity based on the electrocatalysis of platinum nanoparticle (Pt NP) encapsulated metal-organic frameworks (MOFs), which are synthesized by one-pot encapsulation of Pt NPs into prototypal MOFs, UiO-66-NH2. Integrating with the efficient electrocatalysis of Pt@MOFs towards NaBH4 oxidation, this biosensor shows the wide dynamic correlation of telomerase activity from 5 × 10(2) to 10(7) HeLa cells mL(-1) and the telomerase activity in a single HeLa cell was calculated to be 2.0 × 10(-11) IU, providing a powerful platform for detecting telomerase activity.

  18. ANISOTROPIC METAL-ENRICHED OUTFLOWS DRIVEN BY ACTIVE GALACTIC NUCLEI IN CLUSTERS OF GALAXIES

    SciTech Connect

    Kirkpatrick, C. C.; McNamara, B. R.; Cavagnolo, K. W.

    2011-04-20

    We present an analysis of the spatial distribution of metal-rich gas in 10 galaxy clusters using deep observations from the Chandra X-ray Observatory. The brightest cluster galaxies (BCGs) have experienced recent active galactic nucleus activity in the forms of bright radio emission, cavities, and shock fronts embedded in the hot atmospheres. The heavy elements are distributed anisotropically and are aligned with the large-scale radio and cavity axes. They are apparently being transported from the halo of the BCG into the intracluster medium along large-scale outflows driven by the radio jets. The radial ranges of the metal-enriched outflows are found to scale with jet power as R{sub Fe} {proportional_to} P {sup 0.42}{sub jet}, with a scatter of only 0.5 dex. The heavy elements are transported beyond the extent of the inner cavities in all clusters, suggesting that this is a long-lasting effect sustained over multiple generations of outbursts. Black holes in BCGs will likely have difficulty ejecting metal-enriched gas beyond 1 Mpc unless their masses substantially exceed 10{sup 9} M{sub sun}.

  19. Exploring the DNA binding mode of transition metal based biologically active compounds

    NASA Astrophysics Data System (ADS)

    Raman, N.; Sobha, S.

    2012-01-01

    Few novel 4-aminoantipyrine derived Schiff bases and their metal complexes were synthesized and characterized. Their structural features and other properties were deduced from the elemental analysis, magnetic susceptibility and molar conductivity as well as from mass, IR, UV-vis, 1H NMR and EPR spectral studies. The binding of the complexes with CT-DNA was analyzed by electronic absorption spectroscopy, viscosity measurement, and cyclic voltammetry. The interaction of the metal complexes with DNA was also studied by molecular modeling with special reference to docking. The experimental and docking results revealed that the complexes have the ability of interaction with DNA of minor groove binding mode. The intrinsic binding constants ( Kb) of the complexes with CT-DNA were found out which show that they are minor groove binders. Gel electrophoresis assay demonstrated the ability of the complexes to cleave the pUC19 DNA in the presence of AH 2 (ascorbic acid). Moreover, the oxidative cleavage studies using distamycin revealed the minor groove binding for the newly synthesized 4-aminoantipyrine derived Schiff bases and their metal complexes. Evaluation of antibacterial activity of the complexes against Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Staphylococcus epidermidis, and Klebsiella pneumoniae exhibited that the complexes have potent biocidal activity than the free ligands.

  20. Electron-Transfer Reduction of Dinuclear Copper Peroxo and Bis-μ-oxo Complexes Leading to the Catalytic Four-Electron Reduction of Dioxygen to Water

    PubMed Central

    Tahsini, Laleh; Kotani, Hiroaki; Lee, Yong-Min; Cho, Jaeheung

    2012-01-01

    The four-electron reduction of dioxygen by decamethylferrocene (Fc*) to water is efficiently catalyzed by a binuclear copper(II) complex (1) and a mononuclear copper(II) complex (2) in the presence of trifluoroacetic acid in acetone at 298 K. Fast electron transfer from Fc* to 1 and 2 affords the corresponding CuI complexes, which react at low temperature (193 K) with dioxygen to afford the η2:η2-peroxo dicopper(II) (3) and bis-μ-oxo dicopper(III) (4) intermediates, respectively. The rate constants for electron transfer from Fc* and octamethylferrocene (Me8Fc) to 1 as well as electron transfer from Fc* and Me8Fc to 3 were determined at various temperatures, leading to activation enthalpies and entropies. The activation entropies of electron transfer from Fc* and Me8Fc to 1 were determined to be close to zero, as expected for outer-sphere electron-transfer reactions without formation of any intermediates. For electron transfer from Fc* and Me8Fc to 3, the activation entropies were also found to be close to zero. Such agreement indicates that the η2:η2-peroxo complex (3) is directly reduced by Fc* rather than via the conversion to the corresponding bis-μ-oxo complex, followed by the electron-transfer reduction by Fc* leading to the four-electron reduction of dioxygen to water. The bis-μ-oxo species (4) is reduced by Fc* with a much faster rate than the η2:η2-peroxo complex (3), but this also leads to the four-electron reduction of dioxygen to water. PMID:22237962

  1. Electrical conductivity of activated carbon-metal oxide nanocomposites under compression: a comparison study.

    PubMed

    Barroso-Bogeat, A; Alexandre-Franco, M; Fernández-González, C; Macías-García, A; Gómez-Serrano, V

    2014-12-01

    From a granular commercial activated carbon (AC) and six metal oxide (Al2O3, Fe2O3, SnO2, TiO2, WO3 and ZnO) precursors, two series of AC-metal oxide nanocomposites were prepared by wet impregnation, oven-drying at 120 °C, and subsequent heat treatment at 200 or 850 °C in an inert atmosphere. Here, the electrical conductivity of the resulting products was studied under moderate compression. The influence of the applied pressure, sample volume, mechanical work, and density of the hybrid materials was thoroughly investigated. The DC electrical conductivity of the compressed samples was measured at room temperature by the four-probe method. Compaction assays suggest that the mechanical properties of the nanocomposites are largely determined by the carbon matrix. Both the decrease in volume and the increase in density were relatively small and only significant at pressures lower than 100 kPa for AC and most nanocomposites. In contrast, the bulk electrical conductivity of the hybrid materials was strongly influenced by the intrinsic conductivity, mean crystallite size, content and chemical nature of the supported phases, which ultimately depend on the metal oxide precursor and heat treatment temperature. The supported nanoparticles may be considered to act as electrical switches either hindering or favouring the effective electron transport between the AC cores of neighbouring composite particles in contact under compression. Conductivity values as a rule were lower for the nanocomposites than for the raw AC, all of them falling in the range of semiconductor materials. With the increase in heat treatment temperature, the trend is toward the improvement of conductivity due to the increase in the crystallite size and, in some cases, to the formation of metals in the elemental state and even metal carbides. The patterns of variation of the electrical conductivity with pressure and mechanical work were slightly similar, thus suggesting the predominance of the pressure

  2. Active Interrogation Observables for Enrichment Determination of DU Shielded HEU Metal Assemblies with Limited Geometrical Information

    SciTech Connect

    Pena, Kirsten E; McConchie, Seth M; Crye, Jason Michael; Mihalczo, John T

    2011-01-01

    Determining the enrichment of highly enriched uranium (HEU) metal assemblies shielded by depleted uranium (DU) proves a unique challenge to currently employed measurement techniques. Efforts to match time-correlated neutron distributions obtained through active interrogation to Monte Carlo simulations of the assemblies have shown promising results, given that the exact geometries of both the HEU metal assemblies and DU shields are known from imaging and fission site mapping. In certain situations, however, it is desirable to obtain enrichment with limited or no geometrical information of the assemblies being measured. This paper explores the possibility that the utilization of observables in the interrogation of assemblies by time-tagged D-T neutrons, including time-correlated distribution of neutrons and gammas using liquid scintillators operating on the fission chain time scale, can lead to enrichment determination without a complete set of geometrical information.

  3. Instrumental neutron activation analysis of mass fractions of toxic metals in plastic.

    PubMed

    Park, Kwangwon; Kang, Namgoo

    2007-10-15

    It is very challenging to decompose a plastic product for the purpose of analysis of hazardous elements contained. To circumvent such technical problem, it is imperative that an analyst employ a nondestructive analytical method free of any pretreatments. The analytical results of the concentrations of toxic metals such as Cd and Cr in polypropylene for seven samples at two different levels were obtained using the instrumental neutron activation analysis. This work was intended ultimately to establish certified reference materials (CRMs) of these metals in the polypropylene, traceable to the SI. The uncertainties associated with the analytical procedures were estimated in accordance with the ISO guideline. The results were subsequently validated by a comparison with those for CRM-680 and -681 of the Bureau Communautaire de Reference (BCR), which demonstrated acceptable agreement within their uncertainty ranges.

  4. Synthesis, spectral, thermal and antimicrobial studies of some new tri metallic biologically active ceftriaxone complexes

    NASA Astrophysics Data System (ADS)

    Ali, Alaa E.

    2011-01-01

    Iron, cobalt, nickel and copper complexes of ceftriaxone were prepared in 1:3 ligand:metal ratio to examine the ligating properties of the different moieties of the drug. The complexes were found to have high percentages of coordinated water molecules. The modes of bonding were discussed depending on the infrared spectral absorption peaks of the different allowed vibrations. The Nujol mull electronic absorption spectra and the magnetic moment values indicated the Oh geometry of the metal ions in the complexes. The ESR spectra of the iron, cobalt, and copper complexes were determined and discussed. The thermal behaviors of the complexes were studied by TG and DTA techniques. The antimicrobial activities of the complexes were examined and compared to that of the ceftriaxone itself.

  5. An approach to preparing porous and hollow metal phosphides with higher hydrodesulfurization activity

    NASA Astrophysics Data System (ADS)

    Song, Limin; Zhang, Shujuan; Wei, Qingwu

    2011-06-01

    This paper describes an effective method for the synthesis of metal phosphides. Bulk and supported Ni 2P, Cu 3P, and CoP were prepared by thermal treatment of metal and the amorphous red phosphorus mixtures. Porous and hollow Ni 2P particles were also synthesized successfully using this method. The structural properties of these products are investigated using X-ray powder diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), inductively coupled plasma (ICP-AES) and X-ray photoemission spectroscopy (XPS). A rational mechanism was proposed for the selective formation of Ni 2P particles. In experimental conditions, the Ni 2P/SiO 2 catalyst exhibits excellent hydrodesulfurization (HDS) activity for dibenzothiophene (DBT).

  6. Role of cis-12-oxo-phytodienoic acid in tomato embryo development.

    PubMed

    Goetz, Stephan; Hellwege, Anja; Stenzel, Irene; Kutter, Claudia; Hauptmann, Valeska; Forner, Susanne; McCaig, Bonnie; Hause, Gerd; Miersch, Otto; Wasternack, Claus; Hause, Bettina

    2012-04-01

    Oxylipins including jasmonates are signaling compounds in plant growth, development, and responses to biotic and abiotic stresses. In Arabidopsis (Arabidopsis thaliana) most mutants affected in jasmonic acid (JA) biosynthesis and signaling are male sterile, whereas the JA-insensitive tomato (Solanum lycopersicum) mutant jai1 is female sterile. The diminished seed formation in jai1 together with the ovule-specific accumulation of the JA biosynthesis enzyme allene oxide cyclase (AOC), which correlates with elevated levels of JAs, suggest a role of oxylipins in tomato flower/seed development. Here, we show that 35S::SlAOC-RNAi lines with strongly reduced AOC in ovules exhibited reduced seed set similarly to the jai1 plants. Investigation of embryo development of wild-type tomato plants showed preferential occurrence of AOC promoter activity and AOC protein accumulation in the developing seed coat and the embryo, whereas 12-oxo-phytodienoic acid (OPDA) was the dominant oxylipin occurring nearly exclusively in the seed coat tissues. The OPDA- and JA-deficient mutant spr2 was delayed in embryo development and showed an increased programmed cell death in the developing seed coat and endosperm. In contrast, the mutant acx1a, which accumulates preferentially OPDA and residual amount of JA, developed embryos similar to the wild type, suggesting a role of OPDA in embryo development. Activity of the residual amount of JA in the acx1a mutant is highly improbable since the known reproductive phenotype of the JA-insensitive mutant jai1 could be rescued by wound-induced formation of OPDA. These data suggest a role of OPDA or an OPDA-related compound for proper embryo development possibly by regulating carbohydrate supply and detoxification. PMID:22337921

  7. Activation of amide N-H bonds by organotransition metal complexes

    SciTech Connect

    Schaad, D.R.

    1992-01-01

    This research was aimed at developing new homogeneous transition metal hydroamination catalysts, specifically for hydroamination reactions involving the addition of amides to olefins. New iron-, ruthenium-, palladium- and platinum-amido complexes were formed via amide N-H bond activation reactions to zerovalent and divalent organotransition metal complexes. Complexes of the general formula trans-MW(amido) (diphosphine)[sub 2] were synthesized by reaction of amides with FeH(C[sub 6]H[sub 4]PPhCH[sub 2]CH[sub 2]PPh[sub 2]) (dppe) and cis-RuHNp(dmpe)[sub 2]. Photolysis of cis-FeH[sub 2](dmpe)[sub 2] or Pt(C[sub 2]O[sub 4] (PEt[sub 3])[sub 2] in the presence of amides yielded trans-FeH(amido)(dmple)[sub 2] and trans-PtH (amido) IPEt[sub 3]) products. Reactions of amides with cis-M(PEtt[sub 3])[sub 2]Me[sub 2] yielded compounds with the general formula M(amido)Me(PEt[sub 3])[sub 2] (M = Pd, Pt). The reaction of M(diphosphine)Me[sub 2] complexes with amides produced compounds with the general formula M(amido)Me(diphosphine) (M = Pd, Pt). Reaction of amides with PtMe[sub 2](COD) yielded complexes with the general formula PtMe(amido)(COD). The compounds were characterized by multinuclear NMR spectroscopy. The reactions were proposed to occur by two routes: oxidative addition of the amid eN-H bond to the metal complex or direct protonation of the metal complex by the N-H bond of the amide. The rate of formation and the stability of the metal-amido products depended on the nature of the metal complex and the amide employed. Only acidic amides reacted with the iron complexes. For the thermal reactions of amides with the metal complexes, the reactions proceeded to completion faster as the acidity of the amide was increased. The new iron-, ruthenium-, palladium- and platinum-amido complexes were inert to further reaction.

  8. Expression of CYP107Z13 in Streptomyces lividans TK54 catalyzes the oxidation of avermectin to 4″-oxo-avermectin.

    PubMed

    Jiang, Xiliang; Liu, Weide; Ji, Ying; Niu, Jing; Li, Mei

    2012-03-01

    Streptomyces ahygroscopicus ZB01 has strong catalytic activity for the regiospecific oxidation of 4″-OH of avermectin to form 4″-oxo-avermectin. A cytochrome P450 gene from S. ahygroscopicus ZB01, cyp107z13, was cloned into pKC1139 to generate pKCZ1 and was transformed into Streptomyces lividans TK54, which does not have the ability to catalyze the conversion of avermectin. CYP107Z13, under the control of an ermE* promoter, was actively expressed in the TK54 recombinant strain as determined by a reduced CO difference spectrum analysis of the crude protein. Analysis of whole-cell biocatalytic activity by high-performance liquid chromatography revealed the recombinant to be able to oxidize avermectin regiospecifically to 4″-oxo-avermectin and CYP107Z13 to be a regioselective oxidase of avermectin. In addition, the whole-cell reaction conditions of the recombinant were optimized. Growth on medium ISP-2 at pH 6 was more conducive for the expression of CYP107Z13 than on medium PYG1 or at pH 7, and active cells of the recombinant strain had higher biocatalytic activity than resting cells.

  9. Antioxidant activities, metal contents, total phenolics and flavonoids of seven Morchella species.

    PubMed

    Gursoy, Nevcihan; Sarikurkcu, Cengiz; Cengiz, Mustafa; Solak, M Halil

    2009-09-01

    Seven Morchella species were analyzed for their antioxidant activities in different test systems namely beta-carotene/linoleic acid, DPPH, reducing power, chelating effect and scavenging effect (%) on the stable ABTS*(+), in addition to their heavy metals, total phenolic and flavonoid contents. In beta-carotene/linoleic acid system, the most active mushrooms were M. esculenta var. umbrina and M.angusticeps. In the case of DPPH, methanol extract of M. conica showed high antioxidant activity. The reducing power of the methanol extracts of mushrooms increased with concentration. Chelating capacity of the extracts was also increased with the concentration. On the other hand, in 40 microg ml(-1) concentration, methanol extract of M. conica, exhibited the highest radical scavenging activity (78.66+/-2.07%) when reacted with the ABTS*(+) radical. Amounts of seven elements (Cu, Mn, Co, Zn, Fe, Ca, and Mg) and five heavy metals (Ni, Pb, Cd, Cr, and Al) were also determined in all species. M. conica was found to have the highest phenolic content among the samples. Flavonoid content of M. rotunda was also found superior (0.59+/-0.01 microg QEs/mg extract). PMID:19563856

  10. Metal Nanoparticles Catalyzed Selective Carbon-Carbon Bond Activation in the Liquid Phase.

    PubMed

    Ye, Rong; Yuan, Bing; Zhao, Jie; Ralston, Walter T; Wu, Chung-Yeh; Unel Barin, Ebru; Toste, F Dean; Somorjai, Gabor A

    2016-07-13

    Understanding the C-C bond activation mechanism is essential for developing the selective production of hydrocarbons in the petroleum industry and for selective polymer decomposition. In this work, ring-opening reactions of cyclopropane derivatives under hydrogen catalyzed by metal nanoparticles (NPs) in the liquid phase were studied. 40-atom rhodium (Rh) NPs, encapsulated by dendrimer molecules and supported in mesoporous silica, catalyzed the ring opening of cyclopropylbenzene at room temperature under hydrogen in benzene, and the turnover frequency (TOF) was higher than other metals or the Rh homogeneous catalyst counterparts. Comparison of reactants with various substitution groups showed that electron donation on the three-membered ring boosted the TOF of ring opening. The linear products formed with 100% selectivity for ring opening of all reactants catalyzed by the Rh NP. Surface Rh(0) acted as the active site in the NP. The capping agent played an important role in the ring-opening reaction kinetics. Larger particle size tended to show higher TOF and smaller reaction activation energy for Rh NPs encapsulated in either dendrimer or poly(vinylpyrrolidone). The generation/size of dendrimer and surface group also affected the reaction rate and activation energy. PMID:27322570

  11. Transition from stress-driven to thermally activated stress relaxation in metallic glasses

    NASA Astrophysics Data System (ADS)

    Qiao, J. C.; Wang, Yun-Jiang; Zhao, L. Z.; Dai, L. H.; Crespo, D.; Pelletier, J. M.; Keer, L. M.; Yao, Y.

    2016-09-01

    The short-range ordered but long-range disordered structure of metallic glasses yields strong structural and dynamic heterogeneities. Stress relaxation is a technique to trace the evolution of stress in response to a fixed strain, which reflects the dynamic features phenomenologically described by the Kohlrausch-Williams-Watts (KWW) equation. The KWW equation describes a broad distribution of relaxation times with a small number of empirical parameters, but it does not arise from a particular physically motivated mechanistic picture. Here we report an anomalous two-stage stress relaxation behavior in a Cu46Zr46Al8 metallic glass over a wide temperature range and generalize the findings in other compositions. Thermodynamic analysis identifies two categories of processes: a fast stress-driven event with large activation volume and a slow thermally activated event with small activation volume, which synthetically dominates the stress relaxation dynamics. Discrete analyses rationalize the transition mechanism induced by stress and explain the anomalous variation of the KWW characteristic time with temperature. Atomistic simulations reveal that the stress-driven event involves virtually instantaneous short-range atomic rearrangement, while the thermally activated event is the percolation of the fast event accommodated by the long-range atomic diffusion. The insights may clarify the underlying physical mechanisms behind the phenomenological description and shed light on correlating the hierarchical dynamics and structural heterogeneity of amorphous solids.

  12. Free radical scavenging activity, metal chelation and antioxidant power of some of the Indian spices.

    PubMed

    Yadav, Amit Singh; Bhatnagar, Deepak

    2007-01-01

    Food constituents are the major source of various phytochemicals and micronutrients. The importance of these dietary constituents has been stressed in recent years due to their antioxidant and anticarcinogenic potential. Spices used in Indian foods such as cloves (Syzygium aromaticum), licorice (Glycyrrhiza glabra), mace (aril of Myristica fragans), and greater cardamom (Amomum subulatum) were tested for their antioxidant properties in vitro. The metal chelating activity, bleomycin dependent DNA oxidation, diphenyl-p-picryl hydrazyl (DPPH) radical scavenging activity and the ferric reducing /antioxidant power (FRAP) were measured in rat liver homogenate in presence of spices. Metal chelating activity was significantly high with all the spice extracts except mace. The spices due to higher reducing potential (in presence of bleomycin-FeCl_{3}) showed increased DNA oxidation. Cloves showed the highest DPPH radical scavenging activity, followed by licorice, mace and cardamom. FRAP values for cloves were also the highest, while other spices showed comparatively lesser FRAP values. The results show that the spices tested are strong antioxidants and may have beneficial effects on human health.

  13. Antimicrobial activity of metal based nanoparticles against microbes associated with diseases in aquaculture.

    PubMed

    Swain, P; Nayak, S K; Sasmal, A; Behera, T; Barik, S K; Swain, S K; Mishra, S S; Sen, A K; Das, J K; Jayasankar, P

    2014-09-01

    The emergence of diseases and mortalities in aquaculture and development of antibiotics resistance in aquatic microbes, has renewed a great interest towards alternative methods of prevention and control of diseases. Nanoparticles have enormous potential in controlling human and animal pathogens and have scope of application in aquaculture. The present investigation was carried out to find out suitable nanoparticles having antimicrobial effect against aquatic microbes. Different commercial as well as laboratory synthesized metal and metal oxide nanoparticles were screened for their antimicrobial activities against a wide range of bacterial and fungal agents including certain freshwater cyanobacteria. Among different nanoparticles, synthesized copper oxide (CuO), zinc oxide (ZnO), silver (Ag) and silver doped titanium dioxide (Ag-TiO2) showed broad spectrum antibacterial activity. On the contrary, nanoparticles like Zn and ZnO showed antifungal activity against fungi like Penicillium and Mucor species. Since CuO, ZnO and Ag nanoparticles showed higher antimicrobial activity, they may be explored for aquaculture use.

  14. In vitro antiplasmodial activity of PDDS-coated metal oxide nanoparticles against Plasmodium falciparum

    NASA Astrophysics Data System (ADS)

    Jacob Inbaneson, Samuel; Ravikumar, Sundaram

    2013-06-01

    Malaria is the most important parasitic disease, leading to annual death of about one million people and the Plasmodium falciparum develops resistant to well-established antimalarial drugs. The newest antiplasmodial drug from metal oxide nanoparticles helps in addressing this problem. Commercial nanoparticles such as Fe3O4, MgO, ZrO2, Al2O3 and CeO2 coated with PDDS and all the coated and non-coated nanoparticles were screened for antiplasmodial activity against P. falciparum. The Al2O3 nanoparticles (71.42 ± 0.49 μg ml-1) showed minimum level of IC50 value and followed by MgO (72.33 ± 0.37 μg ml-1) and Fe3O4 nanoparticles (77.23 ± 0.42 μg ml-1). The PDDS-Fe3O4 showed minimum level of IC50 value (48.66 ± 0.45 μg ml-1), followed by PDDS-MgO (60.28 ± 0.42 μg ml-1) and PDDS-CeO2 (67.06 ± 0.61 μg ml-1). The PDDS-coated metal oxide nanoparticles showed superior antiplasmodial activity than the non-PDDS-coated metal oxide nanoparticles. Statistical analysis reveals that, significant in vitro antiplasmodial activity ( P < 0.05) was observed between the concentrations and time of exposure. The chemical injury to erythrocytes showed no morphological changes in erythrocytes by the nanoparticles after 48 h of incubation. It is concluded from the present study that, the PDDS-Fe3O4 showed good antiplasmodial activity and it might be used for the development of antiplasmodial drugs.

  15. A Two-Metal-Ion-Mediated Conformational Switching Pathway for HDV Ribozyme Activation

    PubMed Central

    Lee, Tai-Sung; Radak, Brian K.; Harris, Michael E.; York, Darrin M.

    2016-01-01

    RNA enzymes serve as a potentially powerful platform from which to design catalysts and engineer new biotechnology. A fundamental understanding of these systems provides insight to guide design. The hepatitis delta virus ribozyme (HDVr) is a small, self-cleaving RNA motif widely distributed in nature, that has served as a paradigm for understanding basic principles of RNA catalysis. Nevertheless, questions remain regarding the precise roles of divalent metal ions and key nucleotides in catalysis. In an effort to establish a reaction mechanism model consistent with available experimental data, we utilize molecular dynamics simulations to explore different conformations and metal ion binding modes along the HDVr reaction path. Building upon recent crystallographic data, our results provide a dynamic model of the HDVr reaction mechanism involving a conformational switch between multiple non-canonical G25:U20 base pair conformations in the active site. These local nucleobase dynamics play an important role in catalysis by modulating the metal binding environments of two Mg2+ ions that support catalysis at different steps of the reaction pathway. The first ion plays a structural role by inducing a base pair flip necessary to obtain the catalytic fold in which C75 moves towards to the scissile phosphate in the active site. Ejection of this ion then permits a second ion to bind elsewhere in the active site and facilitate nucleophile activation. The simulations collectively describe a mechanistic scenario that is consistent with currently available experimental data from crystallography, phosphorothioate substitutions, and chemical probing studies. Avenues for further experimental verification are suggested. PMID:27774349

  16. Metal active site elasticity linked to activation of homocysteine in methionine synthases

    SciTech Connect

    Koutmos, Markos; Pejchal, Robert; Bomer, Theresa M.; Matthews, Rowena G.; Smith, Janet L.; Ludwig, Martha L.

    2008-04-02

    Enzymes possessing catalytic zinc centers perform a variety of fundamental processes in nature, including methyl transfer to thiols. Cobalamin-independent (MetE) and cobalamin-dependent (MetH) methionine synthases are two such enzyme families. Although they perform the same net reaction, transfer of a methyl group from methyltetrahydrofolate to homocysteine (Hcy) to form methionine, they display markedly different catalytic strategies, modular organization, and active site zinc centers. Here we report crystal structures of zinc-replete MetE and MetH, both in the presence and absence of Hcy. Structural investigation of the catalytic zinc sites of these two methyltransferases reveals an unexpected inversion of zinc geometry upon binding of Hcy and displacement of an endogenous ligand in both enzymes. In both cases a significant movement of the zinc relative to the protein scaffold accompanies inversion. These structures provide new information on the activation of thiols by zinc-containing enzymes and have led us to propose a paradigm for the mechanism of action of the catalytic zinc sites in these and related methyltransferases. Specifically, zinc is mobile in the active sites of MetE and MetH, and its dynamic nature helps facilitate the active site conformational changes necessary for thiol activation and methyl transfer.

  17. Identification of the structural determinants for anticancer activity of a ruthenium arene peptide conjugate.

    PubMed

    Meier, Samuel M; Novak, Maria; Kandioller, Wolfgang; Jakupec, Michael A; Arion, Vladimir B; Metzler-Nolte, Nils; Keppler, Bernhard K; Hartinger, Christian G

    2013-07-01

    Organometallic Ru(arene)-peptide bioconjugates with potent in vitro anticancer activity are rare. We have prepared a conjugate of a Ru(arene) complex with the neuropeptide [Leu(5)]-enkephalin. [Chlorido(η(6)-p-cymene)(5-oxo-κO-2-{(4-[(N-tyrosinyl-glycinyl-glycinyl-phenylalanyl-leucinyl-NH2)propanamido]-1H-1,2,3-triazol-1-yl)methyl}-4H-pyronato-κO)ruthenium(II)] (8) shows antiproliferative activity in human ovarian carcinoma cells with an IC50 value as low as 13 μM, whereas the peptide or the Ru moiety alone are hardly cytotoxic. The conjugation strategy for linking the Ru(cym) (cym=η(6)-p-cymene) moiety to the peptide involved N-terminal modification of an alkyne-[Leu(5)]-enkephalin with a 2-(azidomethyl)-5-hydroxy-4H-pyran-4-one linker, using Cu(I)-catalyzed alkyne-azide cycloaddition (CuAAC), and subsequent metallation with the Ru(cym) moiety. The ruthenium-bioconjugate was characterized by high resolution top-down electrospray ionization mass spectrometry (ESI-MS) with regard to peptide sequence, linker modification and metallation site. Notably, complete sequence coverage was obtained and the Ru(cym) moiety was confirmed to be coordinated to the pyronato linker. The ruthenium-bioconjugate was analyzed with respect to cytotoxicity-determining constituents, and through the bioconjugate models [{2-(azidomethyl)-5-oxo-κO-4H-pyronato-κO}chloride (η(6)-p-cymene)ruthenium(II)] (5) and [chlorido(η(6)-p-cymene){5-oxo-κO-2-([(4-(phenoxymethyl)-1H-1,2,3-triazol-1-yl]methyl)-4H-pyronato-κO}ruthenium(II)] (6) the Ru(cym) fragment with a triazole-carrying pyronato ligand was identified as the minimal unit required to achieve in vitro anticancer activity.

  18. Oxidative stress in the mollusk Echinolittorina peruviana (Gasteropoda: Littorinidae, Lamarck, 1822) and trace metals in coastal sectors with mining activity.

    PubMed

    Jara, C; Gaete, H; Lobos, G; Hidalgo, M E

    2014-08-01

    The aim of the study was to evaluate the effect of coastal waters of sites with mining activity in Echinolittorina peruviana, through oxidative stress biomarkers and heavy metals determination both in water and in tissue. Organisms were collected in the intertidal zone in areas with and without mining activity. Metal concentrations in the water and tissues, and also, the following biomarkers of oxidative stress: antioxidant enzyme activity, superoxide dismutase and catalase, non-enzymatic oxidative capacity (TRAP), oxidative damage to proteins (carbonyls) and TBARS, were measured The concentrations of accumulated metals had the following order Fe > Cu > Cd > Zn > Cr > Mo > As; the highest concentrations of metals in water and tissues were found in Caleta Palito and Chañaral. Results suggest that the coastal waters with mining activity and greatest concentrations of copper and iron induced the greater antioxidant response and oxidative damage to lipids in E. peruviana. PMID:24829115

  19. Method of synthesizing a plurality of reactants and producing thin films of electro-optically active transition metal oxides

    DOEpatents

    Tracy, C.E.; Benson, D.K.; Ruth, M.R.

    1985-08-16

    A method of synthesizing a plurality of reactants by inducing a reaction by plasma deposition among the reactants. The plasma reaction is effective for consolidating the reactants and producing thin films of electro-optically active transition metal oxides.

  20. Development of novel catalytically active polymer-metal-nanocomposites based on activated foams and textile fibers

    NASA Astrophysics Data System (ADS)

    Domènech, Berta; Ziegler, Kharla K.; Carrillo, Fernando; Muñoz, Maria; Muraviev, Dimitri N.; Macanás, Jorge

    2013-05-01

    In this paper, we report the intermatrix synthesis of Ag nanoparticles in different polymeric matrices such as polyurethane foams and polyacrylonitrile or polyamide fibers. To apply this technique, the polymer must bear functional groups able to bind and retain the nanoparticle ion precursors while ions should diffuse through the matrix. Taking into account the nature of some of the chosen matrices, it was essential to try to activate the support material to obtain an acceptable value of ion exchange capacity. To evaluate the catalytic activity of the developed nanocomposites, a model catalytic reaction was carried out in batch experiments: the reduction of p-nitrophenol by sodium borohydride.