10 CFR 73.20 - General performance objective and requirements.

Code of Federal Regulations, 2010 CFR

2010-01-01

... availability of the physical protection system, including a demonstration that any defects of such activities... Section 73.20 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PHYSICAL PROTECTION OF PLANTS AND MATERIALS... arrangements for a physical protection system which will have as its objective to provide high assurance that...

Connecting Neuronal Cell Protective Pathways and Drug Combinations in a Huntington's Disease Model through the Application of Quantitative Systems Pharmacology.

PubMed

Pei, Fen; Li, Hongchun; Henderson, Mark J; Titus, Steven A; Jadhav, Ajit; Simeonov, Anton; Cobanoglu, Murat Can; Mousavi, Seyed H; Shun, Tongying; McDermott, Lee; Iyer, Prema; Fioravanti, Michael; Carlisle, Diane; Friedlander, Robert M; Bahar, Ivet; Taylor, D Lansing; Lezon, Timothy R; Stern, Andrew M; Schurdak, Mark E

2017-12-19

Quantitative Systems Pharmacology (QSP) is a drug discovery approach that integrates computational and experimental methods in an iterative way to gain a comprehensive, unbiased understanding of disease processes to inform effective therapeutic strategies. We report the implementation of QSP to Huntington's Disease, with the application of a chemogenomics platform to identify strategies to protect neuronal cells from mutant huntingtin induced death. Using the STHdh Q111 cell model, we investigated the protective effects of small molecule probes having diverse canonical modes-of-action to infer pathways of neuronal cell protection connected to drug mechanism. Several mechanistically diverse protective probes were identified, most of which showed less than 50% efficacy. Specific combinations of these probes were synergistic in enhancing efficacy. Computational analysis of these probes revealed a convergence of pathways indicating activation of PKA. Analysis of phospho-PKA levels showed lower cytoplasmic levels in STHdh Q111 cells compared to wild type STHdh Q7 cells, and these levels were increased by several of the protective compounds. Pharmacological inhibition of PKA activity reduced protection supporting the hypothesis that protection may be working, in part, through activation of the PKA network. The systems-level studies described here can be broadly applied to any discovery strategy involving small molecule modulation of disease phenotype.

5 CFR 1207.103 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Administrative Personnel MERIT SYSTEMS PROTECTION BOARD ORGANIZATION AND PROCEDURES ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF DISABILITY IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE MERIT SYSTEMS PROTECTION... anatomical loss affecting one or more of the following body systems: Neurological; musculoskeletal; special...

5 CFR 1207.103 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-01-01

... Administrative Personnel MERIT SYSTEMS PROTECTION BOARD ORGANIZATION AND PROCEDURES ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF DISABILITY IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE MERIT SYSTEMS PROTECTION... anatomical loss affecting one or more of the following body systems: Neurological; musculoskeletal; special...

Protection of the wilderness and aesthetic values of Antarctica: Geographical Information Systems (GIS) as a tool

Treesearch

Rupert Summerson; Tina Tin

2011-01-01

Antarctica is designated by the Antarctic Treaty System as a "natural reserve devoted to peace and science" (http://www.ats.aq/index_e.htm). Multiple, and sometimes conflicting, values are protected. In a place where wilderness protection and certain forms of human activity are both prized, a discussion of the protection of the Antarctic wilderness...

Mammalian Toxicology Testing: Problem Definition Study, Global Army Toxicology Requirements.

DTIC Science & Technology

1981-03-01

Electronic Warfare Equipment (D251) Tactical ECK System (64750A) Protective Electronic Warfare Equipment (D540) High Energy Electromagnetic Radiation...Fighting Portable Weapon (for IFV) Smoke Grenade Launcher Staff Smart, Target-Activated Fire-and-Forget Tactical ECK System (63755A) Protective Electronic...Warfare Equipment (D251) Tactical ECK System (64750A) Protective Electronic Warfare Equipment (D540) High Energy Electromagnetic Radiation Weapons (e.g

42 CFR 51.31 - Conduct of protection and advocacy activities.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 1 2011-10-01 2011-10-01 false Conduct of protection and advocacy activities. 51.31 Section 51.31 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS... shall establish policies and procedures to guide and coordinate advocacy activities. The P&A system...

Resveratrol as a potential therapeutic drug for respiratory system diseases.

PubMed

Zhu, Xiao-Dan; Lei, Xiao-Ping; Dong, Wen-Bin

2017-01-01

Respiratory system diseases are common and major ailments that seriously endanger human health. Resveratrol, a polyphenolic phytoalexin, is considered an anti-inflammatory, antioxidant, and anticancer agent. Thanks to its wide range of biological activities, resveratrol has become a hotspot in many fields, including respiratory system diseases. Indeed, research has demonstrated that resveratrol is helpful to relieve pulmonary function in the general population. Meanwhile, growing evidence indicates that resveratrol plays a protective role in respiratory system diseases. This review aimed to summarize the main protective effects of resveratrol in respiratory system diseases, including its anti-inflammatory, antiapoptotic, antioxidant, antifibrotic, antihypertensive, and anticancer activities. We found that resveratrol plays a protective role in the respiratory system through a variety of mechanisms, and so it may become a new drug for the treatment of respiratory system diseases.

40 CFR 141.806 - Reporting requirements.

Code of Federal Regulations, 2012 CFR

2012-07-01

... fleet; (ii) Change in status (active or inactive) of any aircraft as an aircraft water system as defined... to or removed from the water system. (iv) Change to whether the aircraft water system can be... Section 141.806 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS...

40 CFR 141.806 - Reporting requirements.

Code of Federal Regulations, 2011 CFR

2011-07-01

... fleet; (ii) Change in status (active or inactive) of any aircraft as an aircraft water system as defined... to or removed from the water system. (iv) Change to whether the aircraft water system can be... Section 141.806 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS...

Protective effect of extract of Crataegus pinnatifida pollen on DNA damage response to oxidative stress.

PubMed

Cheng, Ni; Wang, Yuan; Gao, Hui; Yuan, Jialing; Feng, Fan; Cao, Wei; Zheng, Jianbin

2013-09-01

The protective effect of extract of Crataegus pinnatifida (Rosaceae) pollen (ECPP) on the DNA damage response to oxidative stress was investigated and assessed with an alkaline single-cell gel electrophoresis (SCGE) assay and pBR322 plasmid DNA breaks in site-specific and non-site-specific systems. Total phenolic content, total flavonoid content, individual phenolic compounds, antioxidant activities (1,1-diphenyl-2-picrylhydrazyl (DPPH), radical scavenging activity, FRAP, and chelating activity) were also determined. The results showed that ECPP possessed a strong ability to protect DNA from being damaged by hydroxyl radicals in both the site-specific system and the non-site-specific system. It also exhibited a cytoprotection effect in mouse lymphocytes against H₂O₂-induced DNA damage. These protective effects may be related to its high total phenolic content (17.65±0.97 mg GAE/g), total flavonoid content (8.04±0.97 mg rutin/g), strong free radical scavenging activity and considerable ferrous ion chelating ability (14.48±0.21 mg Na₂EDTA/g). Copyright © 2013 Elsevier Ltd. All rights reserved.

Operability of Space Station Freedom's meteoroid/debris protection system

NASA Technical Reports Server (NTRS)

Kahl, Maggie S.; Stokes, Jack W.

1992-01-01

The design of Space Station Freedom's external structure must not only protect the spacecraft from the hazardous environment, but also must be compatible with the extra vehicular activity system for assembly and maintenance. The external procedures for module support are utility connections, external orbital replaceable unit changeout, and maintenance of the meteoroid/debris shields and multilayer insulation. All of these interfaces require proper man-machine engineering to be compatible with the extra vehicular activity and manipulator systems. This paper discusses design solutions, including those provided for human interface, to the Space Station Freedom meteoroid/debris protection system. The system advantages and current access capabilities are illustrated through analysis of its configuration over the Space Station Freedom resource nodes and common modules, with emphasis on the cylindrical sections and endcones.

Current Technology for Thermal Protection Systems

NASA Technical Reports Server (NTRS)

Scotti, Stephen J. (Compiler)

1992-01-01

Interest in thermal protection systems for high-speed vehicles is increasing because of the stringent requirements of such new projects as the Space Exploration Initiative, the National Aero-Space Plane, and the High-Speed Civil Transport, as well as the needs for improved capabilities in existing thermal protection systems in the Space Shuttle and in turbojet engines. This selection of 13 papers from NASA and industry summarizes the history and operational experience of thermal protection systems utilized in the national space program to date, and also covers recent development efforts in thermal insulation, refractory materials and coatings, actively cooled structures, and two-phase thermal control systems.

76 FR 6782 - Agency Information Collection Activities; Proposed Collection; Comment Request; Information...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-08

... ENVIRONMENTAL PROTECTION AGENCY [EPA-HQ-SFUND-2011-0052; FRL-9263-6] Agency Information Collection Activities; Proposed Collection; Comment Request; Information Collection Request for Superfund Site Evaluation and Hazard Ranking System AGENCY: Environmental Protection Agency (EPA). ACTION: Notice. SUMMARY...

Active Wireless Temperature Sensors for Aerospace Thermal Protection Systems

NASA Technical Reports Server (NTRS)

Milos, Frank S.; Karunaratne, K.; Arnold, Jim (Technical Monitor)

2002-01-01

Health diagnostics is an area where major improvements have been identified for potential implementation into the design of new reusable launch vehicles in order to reduce life-cycle costs, to increase safety margins, and to improve mission reliability. NASA Ames is leading the effort to advance inspection and health management technologies for thermal protection systems. This paper summarizes a joint project between NASA Ames and Korteks to develop active wireless sensors that can be embedded in the thermal protection system to monitor sub-surface temperature histories. These devices are thermocouples integrated with radio-frequency identification circuitry to enable acquisition and non-contact communication of temperature data through aerospace thermal protection materials. Two generations of prototype sensors are discussed. The advanced prototype collects data from three type-k thermocouples attached to a 2.54-cm square integrated circuit.

Thienopyrimidine-type compounds protect Arabidopsis plants against the hemibiotrophic fungal pathogen Colletotrichum higginsianum and bacterial pathogen Pseudomonas syringae pv. maculicola.

PubMed

Narusaka, Mari; Narusaka, Yoshihiro

2017-03-04

Plant activators activate systemic acquired resistance-like defense responses or induced systemic resistance, and thus protect plants from pathogens. We screened a chemical library composed of structurally diverse small molecules. We isolated six plant immune-inducing thienopyrimidine-type compounds and their analogous compounds. It was observed that the core structure of thienopyrimidine plays a role in induced resistance in plants. Furthermore, we highlight the protective effect of thienopyrimidine-type compounds against both hemibiotrophic fungal pathogen, Colletotrichum higginsianum, and bacterial pathogen, Pseudomonas syringae pv. maculicola, in Arabidopsis thaliana. We suggest that thienopyrimidine-type compounds could be potential lead compounds as novel plant activators, and can be useful and effective agrochemicals against various plant diseases.

European Directions for Hypersonic Thermal Protection Systems and Hot Structures

NASA Technical Reports Server (NTRS)

Glass, David E.

2007-01-01

This presentation will overview European Thermal Protection Systems (TPS) and Hot Structures activities in Europe. The Europeans have a lot of very good work going on in the area. The presentation will discuss their emphasis on focused technology development for their flight vehicles.

42 CFR 51.31 - Conduct of protection and advocacy activities.

Code of Federal Regulations, 2010 CFR

2010-10-01

... to mental health system improvement. Decisions concerning the selection of individuals to receive... 42 Public Health 1 2010-10-01 2010-10-01 false Conduct of protection and advocacy activities. 51.31 Section 51.31 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS...

Wireless system for explosion detection in underground structures

NASA Astrophysics Data System (ADS)

Chikhradze, M.; Bochorishvili, N.; Akhvlediani, I.; Kukhalashvili, D.; Kalichava, I.; Mataradze, E.

2009-06-01

Considering the growing threat of terrorist or accidental explosions in underground stations, underground highway and railway sections improvement of system for protecting people from explosions appears urgent. Current automatic protective devices with blast identification module and blast damping absorbers of various designs as their basic elements cannot be considered effective. Analysis revealed that low reliability of blast detection and delayed generation of start signal for the activation of an absorber are the major disadvantages of protective devices. Besides the transmission of trigger signal to an energy absorber through cable communication reduces the reliability of the operation of protective device due to a possible damage of electric wiring under blast or mechanical attack. This paper presents the outcomes of the studies conducted to select accurate criteria for blast identification and to design wireless system of activation of defensive device. The results of testing of blast detection methods (seismic, EMP, optical, on overpressure) showed that the proposed method, which implies constant monitoring of overpressure in terms of its reliability and response speed, best meets the requirements. Proposed wireless system for explosions identification and activation of protective device consists of transmitter and receiver modules. Transmitter module contains sensor and microprocessor equipped with blast identification software. Receiver module produces activation signal for operation of absorber. Tests were performed in the underground experimental base of Mining Institute. The time between the moment of receiving signal by the sensor and activation of absorber - 640 microsecond; distance between transmitter and receiver in direct tunnel - at least 150m; in tunnel with 900 bending - 50m. This research is sponsored by NATO's Public Diplomacy Division in the framework of "Science for Peace".

Heat Exchange in “Human body - Thermal protection - Environment” System

NASA Astrophysics Data System (ADS)

Khromova, I. V.

2017-11-01

This article is devoted to the issues of simulation and calculation of thermal processes in the system called “Human body - Thermal protection - Environment” under low temperature conditions. It considers internal heat sources and convective heat transfer between calculated elements. Overall this is important for the Heat Transfer Theory. The article introduces complex heat transfer calculation method and local thermophysical parameters calculation method in the system called «Human body - Thermal protection - Environment», considering passive and active thermal protections, thermophysical and geometric properties of calculated elements in a wide range of environmental parameters (water, air). It also includes research on the influence that thermal resistance of modern materials, used in special protective clothes development, has on heat transfer in the system “Human body - Thermal protection - Environment”. Analysis of the obtained results allows adding of the computer research data to experiments and optimizing of individual life-support system elements, which are intended to protect human body from exposure to external factors.

CJ2 Icing Effects Simulator. Delivery Order 0019: Development of an Icing Effects Simulation for a Typical Business Jet Configuration

DTIC Science & Technology

2007-08-01

considered were: - Icing protection system failure ice - Inter-cycle (roughness) ice - Run-back ice. The study entailed wind tunnel tests of different...jet that incorporates the effects of various forms of ice. The ice conditions considered were:  Icing protection system failure ice  Inter-cycle...accretions. These were pre-activation roughness, runback shapes that form downstream of the thermal wing ice protection system , and a wing ice

Structural Analysis of Lightning Protection System for New Launch Vehicle

NASA Technical Reports Server (NTRS)

Cope, Anne; Moore, Steve; Pruss, Richard

2008-01-01

This project includes the design and specification of a lightning protection system for Launch Complex 39 B (LC39B) at Kennedy Space Center, FL in support of the Constellation Program. The purpose of the lightning protection system is to protect the Crew Launch Vehicle (CLV) or Cargo Launch Vehicle (CaLV) and associated launch equipment from direct lightning strikes during launch processing and other activities prior to flight. The design includes a three-tower, overhead catenary wire system to protect the vehicle and equipment on LC39B as described in the study that preceded this design effort: KSC-DX-8234 "Study: Construct Lightning Protection System LC3 9B". The study was a collaborative effort between Reynolds, Smith, and Hills (RS&H) and ASRC Aerospace (ASRC), where ASRC was responsible for the theoretical design and risk analysis of the lightning protection system and RS&H was responsible for the development of the civil and structural components; the mechanical systems; the electrical and grounding systems; and the siting of the lightning protection system. The study determined that a triangular network of overhead catenary cables and down conductors supported by three triangular free-standing towers approximately 594 ft tall (each equipped with a man lift, ladder, electrical systems, and communications systems) would provide a level of lightning protection for the Constellation Program CLV and CaLV on Launch Pad 39B that exceeds the design requirements.

Thermal protection system flight repair kit

NASA Technical Reports Server (NTRS)

1979-01-01

A thermal protection system (TPS) flight repair kit required for use on a flight of the Space Transportation System is defined. A means of making TPS repairs in orbit by the crew via extravehicular activity is discussed. A cure in place ablator, a precured ablator (large area application), and packaging design (containers for mixing and dispensing) for the TPS are investigated.

Integral isolation valve systems for loss of coolant accident protection

DOEpatents

Kanuch, David J.; DiFilipo, Paul P.

2018-03-20

A nuclear reactor includes a nuclear reactor core comprising fissile material disposed in a reactor pressure vessel having vessel penetrations that exclusively carry flow into the nuclear reactor and at least one vessel penetration that carries flow out of the nuclear reactor. An integral isolation valve (IIV) system includes passive IIVs each comprising a check valve built into a forged flange and not including an actuator, and one or more active IIVs each comprising an active valve built into a forged flange and including an actuator. Each vessel penetration exclusively carrying flow into the nuclear reactor is protected by a passive IIV whose forged flange is directly connected to the vessel penetration. Each vessel penetration carrying flow out of the nuclear reactor is protected by an active IIV whose forged flange is directly connected to the vessel penetration. Each active valve may be a normally closed valve.

Exercise protects the cardiovascular system: effects beyond traditional risk factors

PubMed Central

Joyner, Michael J; Green, Daniel J

2009-01-01

In humans, exercise training and moderate to high levels of physical activity are protective against cardiovascular disease. In fact they are ∼40% more protective than predicted based on the changes in traditional risk factors (blood lipids, hypertension, diabetes etc.) that they cause. In this review, we highlight the positive effects of exercise on endothelial function and the autonomic nervous system. We also ask if these effects alone, or in combination, might explain the protective effects of exercise against cardiovascular disease that appear to be independent of traditional risk factor modification. Our goal is to use selected data from our own work and that of others to stimulate debate on the nature and cause of the ‘risk factor gap’ associated with exercise and physical activity. PMID:19736305

10 CFR 73.55 - Requirements for physical protection of licensed activities in nuclear power reactors against...

Code of Federal Regulations, 2011 CFR

2011-01-01

... integration of systems, technologies, programs, equipment, supporting processes, and implementing procedures...-in-depth methodologies to minimize the potential for an insider to adversely affect, either directly... protection of digital computer and communication systems and networks. (ii) Site-specific conditions that...

Protective effects of broadly neutralizing immunoglobulin against homologous and heterologous equine infectious anemia virus infection in horses with severe combined immunodeficiency.

PubMed

Taylor, Sandra D; Leib, Steven R; Wu, Wuwei; Nelson, Robert; Carpenter, Susan; Mealey, Robert H

2011-07-01

Using the equine infectious anemia virus (EIAV) lentivirus model system, we previously demonstrated protective effects of broadly neutralizing immune plasma in young horses (foals) with severe combined immunodeficiency (SCID). However, in vivo selection of a neutralization-resistant envelope variant occurred. Here, we determined the protective effects of purified immunoglobulin with more potent broadly neutralizing activity. Overall, protection correlated with the breadth and potency of neutralizing activity in vitro. Four of five SCID foals were completely protected against homologous challenge, while partial protection occurred following heterologous challenge. These results support the inclusion of broadly neutralizing antibodies in lentivirus control strategies.

40 CFR 141.521 - What updated watershed control requirements must my unfiltered system implement to continue to...

Code of Federal Regulations, 2011 CFR

2011-07-01

...) Identify watershed characteristics and activities which may have an adverse effect on source water quality; and (b) Monitor the occurrence of activities which may have an adverse effect on source water quality. ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) NATIONAL...

A Federal Response: The President's Critical Infrastructure Protection Board.

ERIC Educational Resources Information Center

Schmidt, Howard

2002-01-01

Outlines the U.S. Critical Infrastructure Protection Board's purpose, budget, principles, and priorities. Describes the board's role in coordinating all federal activities related to protection of information systems and networks supporting critical infrastructures. Also discusses its responsibility in creating a policy and road map for government…

Factors that deregulate the protective immune response in tuberculosis.

PubMed

Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana

2009-01-01

Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.

Is lipid signaling through cannabinoid 2 receptors part of a protective system?

PubMed Central

Pacher, P.; Mechoulam, R.

2011-01-01

The mammalian body has a highly developed immune system which guards against continuous invading protein attacks and aims at preventing, attenuating or repairing the inflicted damage. It is conceivable that through evolution analogous biological protective systems have been evolved against non-protein attacks. There is emerging evidence that lipid endocannabinoid signaling through cannabinoid 2 (CB2) receptors may represent an example/part of such a protective system/armamentarium. Inflammation/tissue injury triggers rapid elevations in local endocannabinoid levels, which in turn regulate signaling responses in immune and other cells modulating their critical functions. Changes in endocannabinoid levels and/or CB2 receptor expressions have been reported in almost all diseases affecting humans, ranging from cardiovascular, gastrointestinal, liver, kidney, neurodegenerative, psychiatric, bone, skin, auto-immune, lung disorders to pain and cancer, and modulating CB2 receptor activity holds tremendous therapeutic potential in these pathologies. While CB2 receptor activation in general mediates immunosuppressive effects, which limit inflammation and associated tissue injury in large number of pathological conditions, in some disease states activation of the CB2 receptor may enhance or even trigger tissue damage, which will also be discussed alongside the protective actions of the CB2 receptor stimulation with endocannabinoids or synthetic agonists, and the possible biological mechanisms involved in these effects. PMID:21295074

Is lipid signaling through cannabinoid 2 receptors part of a protective system?

PubMed

Pacher, P; Mechoulam, R

2011-04-01

The mammalian body has a highly developed immune system which guards against continuous invading protein attacks and aims at preventing, attenuating or repairing the inflicted damage. It is conceivable that through evolution analogous biological protective systems have been evolved against non-protein attacks. There is emerging evidence that lipid endocannabinoid signaling through cannabinoid 2 (CB₂) receptors may represent an example/part of such a protective system/armamentarium. Inflammation/tissue injury triggers rapid elevations in local endocannabinoid levels, which in turn regulate signaling responses in immune and other cells modulating their critical functions. Changes in endocannabinoid levels and/or CB₂ receptor expressions have been reported in almost all diseases affecting humans, ranging from cardiovascular, gastrointestinal, liver, kidney, neurodegenerative, psychiatric, bone, skin, autoimmune, lung disorders to pain and cancer, and modulating CB₂ receptor activity holds tremendous therapeutic potential in these pathologies. While CB₂ receptor activation in general mediates immunosuppressive effects, which limit inflammation and associated tissue injury in large number of pathological conditions, in some disease states activation of the CB₂ receptor may enhance or even trigger tissue damage, which will also be discussed alongside the protective actions of the CB₂ receptor stimulation with endocannabinoids or synthetic agonists, and the possible biological mechanisms involved in these effects. Published by Elsevier Ltd.

Liquid and Gaseous Waste Operations Department annual operating report CY 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maddox, J.J.; Scott, C.B.

1997-03-01

This annual report summarizes operating activities dealing with the process waste system, the liquid low-level waste system, and the gaseous waste system. It also describes upgrade activities dealing with the process and liquid low-level waste systems, the cathodic protection system, a stack ventilation system, and configuration control. Maintenance activities are described dealing with nonradiological wastewater treatment plant, process waste treatment plant and collection system, liquid low-level waste system, and gaseous waste system. Miscellaneous activities include training, audits/reviews/tours, and environmental restoration support.

Methane Explosion Mitigation in Coal Mines by Water Mist

NASA Astrophysics Data System (ADS)

Chikhradze, Nikoloz; Mataradze, Edgar; Chikhradze, Mikheil; Krauthammer, Ted; Mansurov, Zulkhair; Alyiev, Erhan

2017-12-01

Statistics shows that the majority of accidents with fatal outcome are caused by methane and/or coal dust explosion. This leads to assume that contemporary counter-explosion systems of various designs cannot be considered effective. Considering the growing threat of methane explosion in the coming years along with the development of deeper levels, the improvement of a system for protecting people in underground opening appears urgent. This paper focuses on technical solutions to be used in designing a protective system for minimizing the consequences of methane explosions in coalmines. The new protective system consists of three main modules: i) a high-speed shock wave suppression section; ii) a suppression section with a long-term action and iii) a system activating device. The shock wave suppressor contains a 200 litre volume water tank with a built-in gas generator and nozzles. It is activated after 12ms from the blast moment, the duration of discharge is 40 s. The suppression section with a long-term action contains a 2000 litre volume water tank, a high-pressure pump, a hydraulic accumulator, solenoid valves, and a system of pipes with built-in nozzles. It is activated after 4 s from the blast moment, the duration of discharge is 8 min. The activation device includes a detection block containing sensors, an emergency signal generation module, a signal transmission module, a signal receiving module and a power supply module. The system operates in a waiting mode and activates immediately upon the receipt of the start signal generated by the detector. The paper also addresses the preliminary results of the system prototype testing in the tunnel.

Stimulation of TLRs by LMW-HA induces self-defense mechanisms in vaginal epithelium.

PubMed

Dusio, Giuseppina F; Cardani, Diego; Zanobbio, Laura; Mantovani, Martina; Luchini, Patrizia; Battini, Lorenzo; Galli, Valentina; Diana, Angela; Balsari, Andrea; Rumio, Cristiano

2011-07-01

The innate immune system is present throughout the female reproductive tract and functions in synchrony with the adaptive immune system to provide protection in a way that enhances the chances for fetal survival, while protecting against potential pathogens. Recent data show that activation of Toll-like receptor (TLR)2 and 4 by low-molecular weight hyaluronic acid (LMW-HA) in the epidermis induces secretion of the antimicrobial peptide β-defensin 2. In the present work, we show that LMW-HA induces vaginal epithelial cells to release different antimicrobial peptides, via activation of TLR2 and TLR4. Further, we found that LMW-HA favors repair of vaginal epithelial injury, involving TLR2 and TLR4, and independently from its classical receptor CD44. This wound-healing activity of LMW-HA is dependent from an Akt/phosphatidylinositol 3 kinase pathway. Therefore, these findings suggest that the vaginal epithelium is more than a simple physical barrier to protect against invading pathogens: on the contrary, this surface acts as efficient player of innate host defense, which may modulate its antimicrobial properties and injury restitution activity, following LMW-HA stimulation; this activity may furnish an additional protective activity to this body compartment, highly and constantly exposed to microbiota, ameliorating the self-defense of the vaginal epithelium in both basal and pathological conditions.

45 CFR 1386.23 - Periodic reports: Protection and Advocacy System.

Code of Federal Regulations, 2014 CFR

2014-10-01

... advocacy work and training activities, and the outcomes which it strives to accomplish. (2) Where applicable, the SOP must include a description of how the Protection and Advocacy System operates and how it... for assistance when it is outside the scope of the SOP but they must inform individuals that this is...

45 CFR 1386.23 - Periodic reports: Protection and Advocacy System.

Code of Federal Regulations, 2011 CFR

2011-10-01

... advocacy work and training activities, and the outcomes which it strives to accomplish. (2) Where applicable, the SOP must include a description of how the Protection and Advocacy System operates and how it... for assistance when it is outside the scope of the SOP but they must inform individuals that this is...

45 CFR 1386.23 - Periodic reports: Protection and Advocacy System.

Code of Federal Regulations, 2013 CFR

2013-10-01

... advocacy work and training activities, and the outcomes which it strives to accomplish. (2) Where applicable, the SOP must include a description of how the Protection and Advocacy System operates and how it... for assistance when it is outside the scope of the SOP but they must inform individuals that this is...

45 CFR 1386.23 - Periodic reports: Protection and Advocacy System.

Code of Federal Regulations, 2012 CFR

2012-10-01

... advocacy work and training activities, and the outcomes which it strives to accomplish. (2) Where applicable, the SOP must include a description of how the Protection and Advocacy System operates and how it... for assistance when it is outside the scope of the SOP but they must inform individuals that this is...

Make an Alarm! Grades 3-5.

ERIC Educational Resources Information Center

Rushton, Erik; Ryan, Emily; Swift, Charles

After reading the story "Dear Mr. Henshaw" by Beverly Cleary, students build an alarm system for something in the classroom as the main character, Leigh, does to protect his lunchbox from thieves. Students learn about alarms and use their creativity to create an alarm system to protect their lockers, desk, or classroom door. This activity uses a…

Advanced extravehicular protective systems

NASA Technical Reports Server (NTRS)

Sutton, J. G.; Heimlich, P. F.; Tepper, E. H.

1972-01-01

New technologies are identified and recommended for developing a regenerative portable life support system that provides protection for extravehicular human activities during long duration missions on orbiting space stations, potential lunar bases, and possible Mars landings. Parametric subsystems analyses consider: thermal control, carbon dioxide control, oxygen supply, power supply, contaminant control, humidity control, prime movers, and automatic temperature control.

Effects of pituitary adenylate cyclase activating polypeptide in the urinary system, with special emphasis on its protective effects in the kidney.

PubMed

Reglodi, Dora; Kiss, Peter; Horvath, Gabriella; Lubics, Andrea; Laszlo, Eszter; Tamas, Andrea; Racz, Boglarka; Szakaly, Peter

2012-04-01

Pituitary adenylate cyclase activating polypeptide (PACAP) is a widespread neuropeptide with diverse effects in the nervous system and peripheral organs. One of the most well-studied effects of PACAP is its cytoprotective action, against different harmful stimuli in a wide variety of cells and tissues. PACAP occurs in the urinary system, from the kidney to the lower urinary tract. The present review focuses on the nephroprotective effects of PACAP and summarizes data obtained regarding the protective effects of PACAP in different models of kidney pathologies. In vitro data show that PACAP protects tubular cells against oxidative stress, myeloma light chain, cisplatin, cyclosporine-A and hypoxia. In vivo data provide evidence for its protective effects in ischemia/reperfusion, cisplatin, cyclosporine-A, myeloma kidney injury, diabetic nephropathy and gentamicin-induced kidney damage. Results accumulated on the renoprotective effects of PACAP suggest that PACAP is an emerging candidate for treatment of human kidney pathologies. Copyright © 2011 Elsevier Ltd. All rights reserved.

23 CFR 750.104 - Signs that may not be permitted in protected areas.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Advertising Adjacent to the Interstate System Under the 1958 Bonus Program § 750.104 Signs that may not be... protected areas: (a) Signs advertising activities that are illegal under State or Federal laws or regulations in effect at the location of such signs or at the location of such activities. (b) Obsolete signs...

78 FR 23811 - Privacy Act of 1974; Proposed New Routine Uses and System of Records Alterations

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-22

..., and local law enforcement agencies and private security contractors to protect the safety of SSA... respect to activities that affect such safety and security, or activities that disrupt the operation of.... B. To Federal, State, and Local Law Enforcement To Protect the Safety of SSA Employees and Customers...

40 CFR 260.40 - Additional regulation of certain hazardous waste recycling activities on a case-by-case basis.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 26 2011-07-01 2011-07-01 false Additional regulation of certain hazardous waste recycling activities on a case-by-case basis. 260.40 Section 260.40 Protection of... SYSTEM: GENERAL Rulemaking Petitions § 260.40 Additional regulation of certain hazardous waste recycling...

40 CFR 260.40 - Additional regulation of certain hazardous waste recycling activities on a case-by-case basis.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Additional regulation of certain hazardous waste recycling activities on a case-by-case basis. 260.40 Section 260.40 Protection of... SYSTEM: GENERAL Rulemaking Petitions § 260.40 Additional regulation of certain hazardous waste recycling...

40 CFR 260.40 - Additional regulation of certain hazardous waste recycling activities on a case-by-case basis.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 27 2013-07-01 2013-07-01 false Additional regulation of certain hazardous waste recycling activities on a case-by-case basis. 260.40 Section 260.40 Protection of... SYSTEM: GENERAL Rulemaking Petitions § 260.40 Additional regulation of certain hazardous waste recycling...

40 CFR 260.40 - Additional regulation of certain hazardous waste recycling activities on a case-by-case basis.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 26 2014-07-01 2014-07-01 false Additional regulation of certain hazardous waste recycling activities on a case-by-case basis. 260.40 Section 260.40 Protection of... SYSTEM: GENERAL Rulemaking Petitions § 260.40 Additional regulation of certain hazardous waste recycling...

40 CFR 260.40 - Additional regulation of certain hazardous waste recycling activities on a case-by-case basis.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 27 2012-07-01 2012-07-01 false Additional regulation of certain hazardous waste recycling activities on a case-by-case basis. 260.40 Section 260.40 Protection of... SYSTEM: GENERAL Rulemaking Petitions § 260.40 Additional regulation of certain hazardous waste recycling...

Day, night and all-weather security surveillance automation synergy from combining two powerful technologies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morellas, Vassilios; Johnson, Andrew; Johnston, Chris

2006-07-01

Thermal imaging is rightfully a real-world technology proven to bring confidence to daytime, night-time and all weather security surveillance. Automatic image processing intrusion detection algorithms are also a real world technology proven to bring confidence to system surveillance security solutions. Together, day, night and all weather video imagery sensors and automated intrusion detection software systems create the real power to protect early against crime, providing real-time global homeland protection, rather than simply being able to monitor and record activities for post event analysis. These solutions, whether providing automatic security system surveillance at airports (to automatically detect unauthorized aircraft takeoff andmore » landing activities) or at high risk private, public or government facilities (to automatically detect unauthorized people or vehicle intrusion activities) are on the move to provide end users the power to protect people, capital equipment and intellectual property against acts of vandalism and terrorism. As with any technology, infrared sensors and automatic image intrusion detection systems for global homeland security protection have clear technological strengths and limitations compared to other more common day and night vision technologies or more traditional manual man-in-the-loop intrusion detection security systems. This paper addresses these strength and limitation capabilities. False Alarm (FAR) and False Positive Rate (FPR) is an example of some of the key customer system acceptability metrics and Noise Equivalent Temperature Difference (NETD) and Minimum Resolvable Temperature are examples of some of the sensor level performance acceptability metrics. (authors)« less

Economic Shocks and Public Health Protections in US Metropolitan Areas

PubMed Central

Hogg, Rachel A.

2015-01-01

Objectives. We examined public health system responses to economic shocks using longitudinal observations of public health activities implemented in US metropolitan areas from 1998 to 2012. Methods. The National Longitudinal Survey of Public Health Systems collected data on the implementation of 20 core public health activities in a nationally representative cohort of 280 metropolitan areas in 1998, 2006, and 2012. We used generalized estimating equations to estimate how local economic shocks relate to the scope of activities implemented in communities, the mix of organizations performing them, and perceptions of the effectiveness of activities. Results. Public health activities fell by nearly 5% in the average community between 2006 and 2012, with the bottom quintile of communities losing nearly 25% of their activities. Local public health delivery fell most sharply among communities experiencing the largest increases in unemployment and the largest reductions in governmental public health spending. Conclusions. Federal resources and private sector contributions failed to avert reductions in local public health protections during the recession. New financing mechanisms may be necessary to ensure equitable public health protections during economic downturns. PMID:25689201

Traceability of radiation protection instruments

NASA Astrophysics Data System (ADS)

Hino, Y.; Kurosawa, T.

2007-08-01

Radiation protection instruments are used in daily measurement of dose and activities in workplaces and environments for safety management. The requirements for calibration certificates with traceability are increasing for these instruments to ensure the consistency and reliabilities of the measurement results. The present traceability scheme of radiation protection instruments for dose and activity measurements is described with related IEC/ISO requirements. Some examples of desirable future calibration systems with recent new technologies are also discussed to establish the traceability with reasonable costs and reliabilities.

Protective-antigen (PA) based anthrax vaccines confer protection against inhalation anthrax by precluding the establishment of a systemic infection

PubMed Central

Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P

2013-01-01

An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response. PMID:23787486

Protective-antigen (PA) based anthrax vaccines confer protection against inhalation anthrax by precluding the establishment of a systemic infection.

PubMed

Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P

2013-09-01

An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response.

Assessment of anti-oxidant activity of plant extracts using microbial test systems.

PubMed

Oktyabrsky, O; Vysochina, G; Muzyka, N; Samoilova, Z; Kukushkina, T; Smirnova, G

2009-04-01

To evaluate the anti-oxidant properties of extracts from 20 medicinal herbs growing in western Siberia using microbial test systems and different in vitro methods. In vivo anti-oxidant activity of extracts was evaluated for their capacity to protect bacteria, Escherichia coli, against bacteriostatic and bactericidal effects of H(2)O(2) and menadione, and action on anti-oxidant gene expression. In vitro anti-oxidant activity has been examined by a number of methods including: the 1,1-diphenyl-2-picrylhydrazyl radical (DPPH(*))-scavenging assay, chelating activity and capacity to protect plasmid DNA against oxidative damage. In addition, total polyphenol content was determined. The extracts of Fragaria vesca, Rosa majalis, Pentaphylloides fruticosa, Alchemilla vulgaris and Pulmonaria mollis possessed the highest levels of anti-oxidant activity in vivo and in vitro. The protective properties were more closely related to the DPPH(*) radical-scavenging activity, tannin content and action on anti-oxidant gene expression than to other parameters. The extracts of medicinal plants may have anti-oxidant effects on bacteria simultaneously through several different pathways, including direct inhibition of reactive oxygen species, iron chelation and anti-oxidant genes induction. Using microbial test systems, we revealed herbs that may be used as potential sources of natural anti-oxidants.

Deprenyl and Protection Against Mammary Tumors

DTIC Science & Technology

2000-09-01

16 A ppendices ...and augmenting central catecholaminergic activity. Acute peripheral nervous systems by deprenyl may not be the sole administration of deprenyl to...cytotoxic T lymphocyte and natural killer cell oimmunology: interaction between the nervous system and activity, and enhancement of acute pathogenesis

WASTE TREATMENT BUILDING SYSTEM DESCRIPTION DOCUMENT

DOE Office of Scientific and Technical Information (OSTI.GOV)

F. Habashi

2000-06-22

The Waste Treatment Building System provides the space, layout, structures, and embedded subsystems that support the processing of low-level liquid and solid radioactive waste generated within the Monitored Geologic Repository (MGR). The activities conducted in the Waste Treatment Building include sorting, volume reduction, and packaging of dry waste, and collecting, processing, solidification, and packaging of liquid waste. The Waste Treatment Building System is located on the surface within the protected area of the MGR. The Waste Treatment Building System helps maintain a suitable environment for the waste processing and protects the systems within the Waste Treatment Building (WTB) from mostmore » of the natural and induced environments. The WTB also confines contaminants and provides radiological protection to personnel. In addition to the waste processing operations, the Waste Treatment Building System provides space and layout for staging of packaged waste for shipment, industrial and radiological safety systems, control and monitoring of operations, safeguards and security systems, and fire protection, ventilation and utilities systems. The Waste Treatment Building System also provides the required space and layout for maintenance activities, tool storage, and administrative facilities. The Waste Treatment Building System integrates waste processing systems within its protective structure to support the throughput rates established for the MGR. The Waste Treatment Building System also provides shielding, layout, and other design features to help limit personnel radiation exposures to levels which are as low as is reasonably achievable (ALARA). The Waste Treatment Building System interfaces with the Site Generated Radiological Waste Handling System, and with other MGR systems that support the waste processing operations. The Waste Treatment Building System interfaces with the General Site Transportation System, Site Communications System, Site Water System, MGR Site Layout, Safeguards and Security System, Site Radiological Monitoring System, Site Electrical Power System, Site Compressed Air System, and Waste Treatment Building Ventilation System.« less

A Proteinaceous Elicitor Sm1 from the Beneficial Fungus Trichoderma virens Is Required for Induced Systemic Resistance in Maize1[W

PubMed Central

Djonović, Slavica; Vargas, Walter A.; Kolomiets, Michael V.; Horndeski, Michelle; Wiest, Aric; Kenerley, Charles M.

2007-01-01

We have previously shown that the beneficial filamentous fungus Trichoderma virens secretes the highly effective hydrophobin-like elicitor Sm1 that induces systemic disease resistance in the dicot cotton (Gossypium hirsutum). In this study we tested whether colonization of roots by T. virens can induce systemic protection against a foliar pathogen in the monocot maize (Zea mays), and we further demonstrated the importance of Sm1 during maize-fungal interactions using a functional genomics approach. Maize seedlings were inoculated with T. virens Gv29-8 wild type and transformants in which SM1 was disrupted or constitutively overexpressed in a hydroponic system or in soil-grown maize seedlings challenged with the pathogen Colletotrichum graminicola. We show that similar to dicot plants, colonization of maize roots by T. virens induces systemic protection of the leaves inoculated with C. graminicola. This protection was associated with notable induction of jasmonic acid- and green leaf volatile-biosynthetic genes. Neither deletion nor overexpression of SM1 affected normal growth or development of T. virens, conidial germination, production of gliotoxin, hyphal coiling, hydrophobicity, or the ability to colonize maize roots. Plant bioassays showed that maize grown with SM1-deletion strains exhibited the same levels of systemic protection as non-Trichoderma-treated plants. Moreover, deletion and overexpression of SM1 resulted in significantly reduced and enhanced levels of disease protection, respectively, compared to the wild type. These data together indicate that T. virens is able to effectively activate systemic disease protection in maize and that the functional Sm1 elicitor is required for this activity. PMID:17885089

Lactoferrin from Milk: Nutraceutical and Pharmacological Properties

PubMed Central

Giansanti, Francesco; Panella, Gloria; Leboffe, Loris; Antonini, Giovanni

2016-01-01

Lactoferrin is an iron-binding protein present in large quantities in colostrum and in breast milk, in external secretions and in polymorphonuclear leukocytes. Lactoferrin’s main function is non-immune protection. Among several protective activities shown by lactoferrin, those displayed by orally administered lactoferrin are: (i) antimicrobial activity, which has been presumed due to iron deprivation, but more recently attributed also to a specific interaction with the bacterial cell wall and extended to viruses and parasites; (ii) immunomodulatory activity, with a direct effect on the development of the immune system in the newborn, together with a specific antinflammatory effects; (iii) a more recently discovered anticancer activity. It is worth noting that most of the protective activities of lactoferrin have been found, sometimes to a greater extent, also in peptides derived from limited proteolysis of lactoferrin that could be generated after lactoferrin ingestion. Lactoferrin could therefore be considered an ideal nutraceutic product because of its relatively cheap production from bovine milk and of its widely recognized tolerance after ingestion, along with its well demonstrated protective activities. The most important protective activities shown by orally administered bovine lactoferrin are reviewed in this article. PMID:27690059

Early infections by myxoma virus of young rabbits (Oryctolagus cuniculus) protected by maternal antibodies activate their immune system and enhance herd immunity in wild populations.

PubMed

Marchandeau, Stéphane; Pontier, Dominique; Guitton, Jean-Sébastien; Letty, Jérôme; Fouchet, David; Aubineau, Jacky; Berger, Francis; Léonard, Yves; Roobrouck, Alain; Gelfi, Jacqueline; Peralta, Brigitte; Bertagnoli, Stéphane

2014-03-04

The role of maternal antibodies is to protect newborns against acute early infection by pathogens. This can be achieved either by preventing any infection or by allowing attenuated infections associated with activation of the immune system, the two strategies being based on different cost/benefit ratios. We carried out an epidemiological survey of myxomatosis, which is a highly lethal infectious disease, in two distant wild populations of rabbits to describe the epidemiological pattern of the disease. Detection of specific IgM and IgG enabled us to describe the pattern of immunity. We show that maternal immunity attenuates early infection of juveniles and enables activation of their immune system. This mechanism associated with steady circulation of the myxoma virus in both populations, which induces frequent reinfections of immune rabbits, leads to the maintenance of high immunity levels within populations. Thus, myxomatosis has a low impact, with most infections being asymptomatic. This work shows that infection of young rabbits protected by maternal antibodies induces attenuated disease and activates their immune system. This may play a major role in reducing the impact of a highly lethal disease when ecological conditions enable permanent circulation of the pathogen.

Early infections by myxoma virus of young rabbits (Oryctolagus cuniculus) protected by maternal antibodies activate their immune system and enhance herd immunity in wild populations

PubMed Central

2014-01-01

The role of maternal antibodies is to protect newborns against acute early infection by pathogens. This can be achieved either by preventing any infection or by allowing attenuated infections associated with activation of the immune system, the two strategies being based on different cost/benefit ratios. We carried out an epidemiological survey of myxomatosis, which is a highly lethal infectious disease, in two distant wild populations of rabbits to describe the epidemiological pattern of the disease. Detection of specific IgM and IgG enabled us to describe the pattern of immunity. We show that maternal immunity attenuates early infection of juveniles and enables activation of their immune system. This mechanism associated with steady circulation of the myxoma virus in both populations, which induces frequent reinfections of immune rabbits, leads to the maintenance of high immunity levels within populations. Thus, myxomatosis has a low impact, with most infections being asymptomatic. This work shows that infection of young rabbits protected by maternal antibodies induces attenuated disease and activates their immune system. This may play a major role in reducing the impact of a highly lethal disease when ecological conditions enable permanent circulation of the pathogen. PMID:24589193

MER Surface Phase; Blurring the Line Between Fault Protection and What is Supposed to Happen

NASA Technical Reports Server (NTRS)

Reeves, Glenn E.

2008-01-01

An assessment on the limitations of communication with MER rovers and how such constraints drove the system design, flight software and fault protection architecture, blurring the line between traditional fault protection and expected nominal behavior, and requiring the most novel autonomous and semi-autonomous elements of the vehicle software including communication, surface mobility, attitude knowledge acquisition, fault protection, and the activity arbitration service.

Infection in systemic lupus erythematosus, similarities, and differences with lupus flare

PubMed Central

Jung, Ju-Yang; Suh, Chang-Hee

2017-01-01

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease with diverse manifestations, and its pathogenesis is unclear and complicated. Infection and SLE are similar in that they both cause inf lammatory reactions in the immune system; however, one functions to protect the body, whereas the other is activated to damage the body. Infection is known as one of the common trigger factors for SLE; there are a number of reports on infectious agents that provoke autoimmune response. Several viruses, bacteria, and protozoa were revealed to cause immune dysfunction by molecular mimicry, epitope spreading, and bystander activation. In contrast, certain pathogens were revealed to protect from immune dysregulation. Infection can be threatening to patients with SLE who have a compromised immune system, and it is regarded as one of the common causes of mortality in SLE. A clinical distinction between infection and lupus f lare up is required when patients with SLE present fevers. With a close-up assessment of symptoms and physical examination, C-reactive protein and disease activity markers play a major role in differentiating the different disease conditions. Vaccination is necessary because protection against infection is important in patients with SLE. PMID:28490724

Resveratrol protects primary rat hepatocytes against oxidative stress damage: activation of the Nrf2 transcription factor and augmented activities of antioxidant enzymes.

PubMed

Rubiolo, Juan Andrés; Mithieux, Gilles; Vega, Félix Victor

2008-09-04

Oxidative stress is recognized as an important factor in the development of liver pathologies. The reactive oxygen species endogenously generated or as a consequence of xenobiotic metabolism are eliminated by enzymatic and nonenzymatic cellular systems. Besides endogen defences, the antioxidant consumption in the diet has an important role in the protection against the development of diseases product of oxidative damage. Resveratrol is a naturally occurring compound which is part of the human diet. This molecule has been shown to have many biological properties, including antioxidant activity. We decided to test if resveratrol could protect primary hepatocytes in culture from oxidative stress damage and if so, to determine if this compound affects the cellular detoxifying systems and their regulation through the Nrf2 transcription factor that regulates the expression of antioxidant and phase II detoxifying enzymes. Cell death by necrosis was detected by measuring the activity of lactate dehydrogenase liberated to the medium. The activities of antioxidant and phase II enzymes were measured using previously described methods. Activation of the Nrf2 transcription factor was studied by confocal microscopy and the Nrf2 and its coding mRNA levels were determined by western blot and quantitative PCR respectively. Resveratrol pre-treatment effectively protected hepatocytes in culture exposed to oxidative stress, increasing the activities of catalase, superoxide dismutase, glutathione peroxidase, NADPH quinone oxidoreductase and glutathione-S-transferase. Resveratrol increases the level of Nrf2 and induces its translocation to the nucleus. Also, it increases the concentration of the coding mRNA for Nrf2. In this work we show that resveratrol could be a useful drug for the protection of liver cells from oxidative stress induced damage.

Reducing Disease Activity in Animal Models of MS by Activation of the Protective Arm of the Renin-Angiotensin System

DTIC Science & Technology

2015-10-01

patients, there is little evidence for a role of ACE2/A( 1 -7)/Mas axis, only a solitary assessment showing decreased ACE2 levels in the CSF of MS...project? Major Goals (Year 1 ): 1 : Measure levels of RAS components in the spinal cord of mice with EAE (animal model of MS) prior to, and at multiple...AWARD NUMBER: W81XWH-14- 1 -0523 TITLE: Reducing Disease Activity in Animal Models of MS by Activation of the Protective Arm of the Renin

A Nitric Oxide Storage and Transport System That Protects Activated Macrophages from Endogenous Nitric Oxide Cytotoxicity*

PubMed Central

Lok, Hiu Chuen; Sahni, Sumit; Jansson, Patric J.; Kovacevic, Zaklina; Hawkins, Clare L.; Richardson, Des R.

2016-01-01

Nitric oxide (NO) is integral to macrophage cytotoxicity against tumors due to its ability to induce iron release from cancer cells. However, the mechanism for how activated macrophages protect themselves from endogenous NO remains unknown. We previously demonstrated by using tumor cells that glutathione S-transferase P1 (GSTP1) sequesters NO as dinitrosyl-dithiol iron complexes (DNICs) and inhibits NO-mediated iron release from cells via the transporter multidrug resistance protein 1 (MRP1/ABCC1). These prior studies also showed that MRP1 and GSTP1 protect tumor cells against NO cytotoxicity, which parallels their roles in defending cancer cells from cytotoxic drugs. Considering this, and because GSTP1 and MRP1 are up-regulated during macrophage activation, this investigation examined whether this NO storage/transport system protects macrophages against endogenous NO cytotoxicity in two well characterized macrophage cell types (J774 and RAW 264.7). MRP1 expression markedly increased upon macrophage activation, and the role of MRP1 in NO-induced 59Fe release was demonstrated by Mrp1 siRNA and the MRP1 inhibitor, MK571, which inhibited NO-mediated iron efflux. Furthermore, Mrp1 silencing increased DNIC accumulation in macrophages, indicating a role for MRP1 in transporting DNICs out of cells. In addition, macrophage 59Fe release was enhanced by silencing Gstp1, suggesting GSTP1 was responsible for DNIC binding/storage. Viability studies demonstrated that GSTP1 and MRP1 protect activated macrophages from NO cytotoxicity. This was confirmed by silencing nuclear factor-erythroid 2-related factor 2 (Nrf2), which decreased MRP1 and GSTP1 expression, concomitant with reduced 59Fe release and macrophage survival. Together, these results demonstrate a mechanism by which macrophages protect themselves against NO cytotoxicity. PMID:27866158

In vitro studies on chemoprotective effect of Purnark against benzo(a)pyrene-induced chromosomal damage in human lymphocytes.

PubMed

Ghaisas, S D; Bhide, S V

1994-01-01

Human lymphocytes were used as an assay system to test chemopreventive activity of natural products. Purnark, a mixture of extracts of turmeric, betel leaf and catechu, was tested for its chemoprotective activity against BP induced DNA damage. Sister chromatid exchange and micronuclei were used as markers to assess the protective activity of Purnark. Purnark gave 50-60% protection against BP induced SCEs and micronuclei. Purnark at 100 micrograms dose did not show any genotoxicity.

EPA MOBILE INCINERATION SYSTEM MODIFICATIONS, TESTING AND OPERATIONS - FEBRUARY 1986 TO JUNE 1989

EPA Science Inventory

The report covers the field demonstration activities of the U.S. Environmental Protection Agency's Mobile Incineration System (MIS) from February 1986 to June 1989 at the Denney Farm Site, Missouri. The activities discussed in the current report include: modifications made to the...

Data surveillance in child protection systems development: an Indonesian case study.

PubMed

Boothby, Neil; Stark, Lindsay

2011-12-01

Successful implementation of child protection program interventions and child and family welfare services is contingent upon the availability and use of good quality information, as emphasized by the recent Convention on the Rights of the Child's General Comment 13. Yet, the role of information within child protection is not well understood, and ongoing efforts to strengthen child protection systems have not systematically examined this critical function. Recognizing these shortcomings, the Government of Indonesia and UNICEF commissioned a study to identify a "road map" for a national child protection information system. The used desk review, semi-structured interviews, focus groups and site visits to identify existing data collection practices, and analyze the appropriateness and efficiency of information management mechanisms from the national down to the community level. The results show that the prevailing situation in Indonesia is characterized by a lack of accurate information on all necessary aspects of child care and protection including magnitude of problems, causality analysis and impact of programmatic responses. There is no lead actor for child protection at the national level, and there are no agreed upon data collection priorities, procedures or methods for a shared data collection system. The study suggests a need to reframe the dominant language from a "child protection information management system" to a "child protection surveillance system" to promote clearer data collection objectives and activities. Identifying a government ministry to lead child protection efforts and to forge closer partnerships among relevant actors will be required to support a national surveillance system. Additionally, addressing obstacles that limit child protection incident detection at the community level is critical. In addition to strengthening Indonesia's system, this study's approach and findings have the potential to help to inform ongoing child protection system development initiatives in other countries as well. Copyright © 2011 Elsevier Ltd. All rights reserved.

Defense Infrastructure: DOD Should Improve Reporting and Communication on Its Corrosion Prevention and Control Activities

DTIC Science & Technology

2013-05-01

Cycle Prediction for Equipment and Facilities 33.1 33.1 12 FAR16 Corrosion Prevention of Rebar in Concrete in Critical Facilities Located in Coastal...through 2007. 16 N-F-229 Integrated Concrete Pier Piling Repair and Corrosion Protection System 1.9 1.9 2006 17 FNV01 Corrosion Protection...Protection System 3.4 3.0 2007 21 F07NV03 Corrosion Inhibitor Evaluation for Concrete Repairs 16.8 16.8 22 F07NV04 Satellite Based Remote Monitoring

76 FR 39092 - Agency Information Collection Activities; Proposed Collection; Comment Request; Disinfectants...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-05

...; Disinfectants/Disinfection Byproducts, Chemical and Radionuclides; Microbial; and Public Water System...://www.epa.gov/epahome/dockets.htm . FOR FURTHER INFORMATION CONTACT: Matthew Reed, Drinking Water Protection Division, Office of Ground Water and Drinking Water, (4606M), Environmental Protection Agency...

40 CFR 60.2170 - Is there a minimum amount of monitoring data I must obtain?

Code of Federal Regulations, 2014 CFR

2014-07-01

... monitoring system quality assurance or quality control activities (including, as applicable, calibration... required monitoring system quality assurance or quality control activities including, as applicable... 40 Protection of Environment 7 2014-07-01 2014-07-01 false Is there a minimum amount of monitoring...

76 FR 22891 - Modification to 2008 National Pollutant Discharge Elimination System (NPDES) General Permit for...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-25

... Construction Activities AGENCY: Environmental Protection Agency (EPA). ACTION: Notice. SUMMARY: EPA Regions 1... System (NPDES) general permits for stormwater discharges associated with construction activity in order... permits will be referred to as ``permit'' or ``2008 construction general permit'' or ``2008 CGP.'' This...

75 FR 4554 - Modification to 2008 National Pollutant Discharge Elimination System (NPDES) General Permit for...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-28

... Construction Activities AGENCY: Environmental Protection Agency (EPA). ACTION: Notice. SUMMARY: EPA Regions 1... System (NPDES) general permits for stormwater discharges associated with construction activity in order... will be referred to as ``permit'' or ``2008 construction general permit'' or ``2008 CGP.'' The 2008 CGP...

Formal Validation of Fault Management Design Solutions

NASA Technical Reports Server (NTRS)

Gibson, Corrina; Karban, Robert; Andolfato, Luigi; Day, John

2013-01-01

The work presented in this paper describes an approach used to develop SysML modeling patterns to express the behavior of fault protection, test the model's logic by performing fault injection simulations, and verify the fault protection system's logical design via model checking. A representative example, using a subset of the fault protection design for the Soil Moisture Active-Passive (SMAP) system, was modeled with SysML State Machines and JavaScript as Action Language. The SysML model captures interactions between relevant system components and system behavior abstractions (mode managers, error monitors, fault protection engine, and devices/switches). Development of a method to implement verifiable and lightweight executable fault protection models enables future missions to have access to larger fault test domains and verifiable design patterns. A tool-chain to transform the SysML model to jpf-Statechart compliant Java code and then verify the generated code via model checking was established. Conclusions and lessons learned from this work are also described, as well as potential avenues for further research and development.

Microbial ecology of terrestrial Antarctica: Are microbial systems at risk from human activities?

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, G.J.

1996-08-01

Many of the ecological systems found in continental Antarctica are comprised entirely of microbial species. Concerns have arisen that these microbial systems might be at risk either directly through the actions of humans or indirectly through increased competition from introduced species. Although protection of native biota is covered by the Protocol on Environmental Protection to the Antarctic Treaty, strict measures for preventing the introduction on non-native species or for protecting microbial habitats may be impractical. This report summarizes the research conducted to date on microbial ecosystems in continental Antarctica and discusses the need for protecting these ecosystems. The focus ismore » on communities inhabiting soil and rock surfaces in non-coastal areas of continental Antarctica. Although current polices regarding waste management and other operations in Antarctic research stations serve to reduce the introduction on non- native microbial species, importation cannot be eliminated entirely. Increased awareness of microbial habitats by field personnel and protection of certain unique habitats from physical destruction by humans may be necessary. At present, small-scale impacts from human activities are occurring in certain areas both in terms of introduced species and destruction of habitat. On a large scale, however, it is questionable whether the introduction of non-native microbial species to terrestrial Antarctica merits concern.« less

Effects of high pressure processing on activity and structure of soluble acid invertase in mango pulp, crude extract, purified form and model systems.

PubMed

Li, Renjie; Wang, Yongtao; Ling, Jiangang; Liao, Xiaojun

2017-09-15

The effects of high pressure processing (HPP) on the activity of soluble acid invertase (SAI) in mango pulp, crude extract, purified SAI and purified SAI in model systems (pectin, bovine serum albumin (BSA), sugars and pH 3-7) were investigated. The activity of SAI in mango pulp was increased after HPP, and that in crude extract stayed unchanged. The activity of purified SAI was decreased after HPP at 45 and 50°C. Pectin exhibited a concentration-dependent protection for purified SAI against HPP at 50°C/600MPa for 30min. Pectin that had an esterification degree (DE) of 85% exhibited a greater protection than pectin that had a DE of 20-34%. BSA, acidic pH (3-6) and sucrose also exhibited protection for purified SAI against HPP. HPP at 50°C/600MPa for 30min disrupted the secondary structure and tertiary structure of purified SAI, but no aggregation of purified SAI was observed after HPP. Copyright © 2017 Elsevier Ltd. All rights reserved.

Antarctica’s Protected Areas Are Inadequate, Unrepresentative, and at Risk

PubMed Central

Shaw, Justine D.; Terauds, Aleks; Riddle, Martin J.; Possingham, Hugh P.; Chown, Steven L.

2014-01-01

Antarctica is widely regarded as one of the planet's last true wildernesses, insulated from threat by its remoteness and declaration as a natural reserve dedicated to peace and science. However, rapidly growing human activity is accelerating threats to biodiversity. We determined how well the existing protected-area system represents terrestrial biodiversity and assessed the risk to protected areas from biological invasions, the region's most significant conservation threat. We found that Antarctica is one of the planet's least protected regions, with only 1.5% of its ice-free area formally designated as specially protected areas. Five of the distinct ice-free ecoregions have no specially designated areas for the protection of biodiversity. Every one of the 55 designated areas that protect Antarctica's biodiversity lies closer to sites of high human activity than expected by chance, and seven lie in high-risk areas for biological invasions. By any measure, including Aichi Target 11 under the Convention on Biological Diversity, Antarctic biodiversity is poorly protected by reserves, and those reserves are threatened. PMID:24936869

Space Debris Protection: A Standard Procedure in Future?

NASA Astrophysics Data System (ADS)

Yasaka, Tetsuo

2002-01-01

The near earth orbital environment is getting hazardous due to increasing space debris accumulated as a result of human space activities. Man tended facility is being designed so that the main structure may be protected from a collision with a limited size debris.Other space systems are generally found inadequate to possess protection shields because of functional requirement of space-viewing faces and cost burden in terms of added mass. In the future, where the debris hazard is expected to become severer, the situation is not expected to change and most space systems will be left un-protected. The present situation and future projection of the orbital debris environment will be first reviewed. The possible hazard to space systems will be described in terms of colliding debris size at various orbits. Some of the measures to secure safety of the system will be then proposed for future application.

Wireless device for activation of an underground shock wave absorber

NASA Astrophysics Data System (ADS)

Chikhradze, M.; Akhvlediani, I.; Bochorishvili, N.; Mataradze, E.

2011-10-01

The paper describes the mechanism and design of the wireless device for activation of energy absorber for localization of blast energy in underground openings. The statistics shows that the greatest share of accidents with fatal results associate with explosions in coal mines due to aero-methane and/or air-coal media explosion. The other significant problem is terrorist or accidental explosions in underground structures. At present there are different protective systems to reduce the blast energy. One of the main parts of protective Systems is blast Identification and Registration Module. The works conducted at G. Tsulukidze Mining Institute of Georgia enabled to construct the wireless system of explosion detection and mitigation of shock waves. The system is based on the constant control on overpressure. The experimental research continues to fulfill the system based on both threats, on the constant control on overpressure and flame parameters, especially in underground structures and coal mines. Reaching the threshold value of any of those parameters, the system immediately starts the activation. The absorber contains a pyrotechnic device ensuring the discharge of dispersed water. The operational parameters of wireless device and activation mechanisms of pyrotechnic element of shock wave absorber are discussed in the paper.

Planetary Protection Considerations for Life Support and Habitation Systems

NASA Technical Reports Server (NTRS)

Barta, Daniel J.; Hogan, John A.

2010-01-01

Life support systems for future human missions beyond low Earth orbit may include a combination of existing hardware components and advanced technologies. Discipline areas for technology development include atmosphere revitalization, water recovery, solid waste management, crew accommodations, food production, thermal systems, environmental monitoring, fire protection and radiation protection. Life support systems will be influenced by in situ resource utilization (ISRU), crew mobility and the degree of extravehicular activity. Planetary protection represents an additional set of requirements that technology developers have generally not considered. Planetary protection guidelines will affect the kind of operations, processes, and functions that can take place during future exploration missions, including venting and discharge of liquids and solids, ejection of wastes, use of ISRU, requirements for cabin atmospheric trace contaminant concentrations, cabin leakage and restrictions on what materials, organisms, and technologies that may be brought on missions. Compliance with planetary protection requirements may drive development of new capabilities or processes (e.g. in situ sterilization, waste containment, contaminant measurement) and limit or prohibit certain kinds of operations or processes (e.g. unfiltered venting). Ultimately, there will be an effect on mission costs, including the mission trade space. Planetary protection requirements need to be considered early in technology development programs. It is expected that planetary protection will have a major impact on technology selection for future missions.

Limited Investigation of Active Feel Control Stick System (Active Stick)

DTIC Science & Technology

2009-06-01

contained no limit protection and was the baseline system. The second system was “F-16 like” and contained angle -of-attack and load factor limiting...system. The second system was “F-16 like” and contained angle of attack (AOA) and load factor limiting features built into the flight control system...Force PTI at VLO .......................... 13 Figure 9: Pitch Angle Response to 1.5 g Commanded Force PTI at VLO ........................ 14 Figure 10

[Study on protective effect of Tianji soft capsule on blood lipids, internal antioxidant system and vascular endothelial system in hyperlipidemia rats].

PubMed

Ma, Hai-ying; Chen, Jin-yao; Zhang, Li-shi

2011-11-01

To study the protective effects of Tianji soft capsule (TJSC) on blood lipids, internal antioxidant system and vascular endothelial system in hyperlipidemia rats. Seventy two healthy male rats were divided into six groups. The rats in control group were administered with ordinary diet. The rats in model group were fed with high cholesterol/lipid diet to induce hyperlipidemia. The rats in TJSC and CoQ10 groups were fed with high cholesterol/lipid diet, and treated with TJSC at different doses of 83 (low-dose group, L), 250 (middle-dose group, M), 750 (high-dose group, H) mg/kg, and CoQ10 at the dose of 83 mg/kg, respectively. All animals were put to death after four weeks, effects on lipid level; antioxidant system and endothelial system were evaluated through detection of total cholesterol (TC), triglyceride (TG), very low density lipoprotein (VLDL), atherogenic index (AI), malondidehyde (MDA) and plasma endothelin (ET), HDL/TC ratio, activities of superoxide dismutase (SOD) and nitric oxide (NO). Compared with model group, serum TC, TG, VLDL, AI, MDA and ET reduced and the HDL/TC ratio increased, meanwhile activities of SOD and NO were enhanced. TJSC can regulate the lipid metabolism, enhance antioxidant system and protect the vascular endothelia system in hyperlipiemic rats.

Passive intrusion detection system

NASA Technical Reports Server (NTRS)

Laue, E. G. (Inventor)

1980-01-01

An intrusion detection system is described in which crystal oscillators are used to provide a frequency which varies as a function of fluctuations of a particular environmental property of the atmosphere, e.g., humidity, in the protected volume. The system is based on the discovery that the frequency of an oscillator whose crystal is humidity sensitive, varies at a frequency or rate which is within a known frequency band, due to the entry of an intruder into the protected volume. The variable frequency is converted into a voltage which is then filtered by a filtering arrangement which permits only voltage variations at frequencies within the known frequency band to activate an alarm, while inhibiting the alarm activation when the voltage frequency is below or above the known frequency band.

76 FR 9032 - Agency Information Collection Activities: Proposed Collection; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-16

...: Protection and Advocacy for Individuals With Mental Illness (PAIMI) Annual Program Performance Report (OMB No. 0930-0169)-- Revision The Protection and Advocacy for Individuals with Mental Illness (PAIMI) Act at 42... individual and systemic advocacy services to individuals with significant (severe) mental illness (adults...

78 FR 77139 - Agency Information Collection Activities: Small Vessel Reporting System

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-20

... DEPARTMENT OF HOMELAND SECURITY U.S. Customs and Border Protection Agency Information Collection... Security. ACTION: 30-Day notice and request for comments; Extension of an existing information collection: 1651-0137. SUMMARY: U.S. Customs and Border Protection (CBP) of the Department of Homeland Security...

40 CFR 60.2735 - Is there a minimum amount of monitoring data I must obtain?

Code of Federal Regulations, 2011 CFR

2011-07-01

....2770(o) of this part), and required monitoring system quality assurance or quality control activities... periods, and required monitoring system quality assurance or quality control activities including, as... 40 Protection of Environment 6 2011-07-01 2011-07-01 false Is there a minimum amount of monitoring...

12 CFR 208.85 - Where insurance activities may take place.

Code of Federal Regulations, 2010 CFR

2010-01-01

... SYSTEM MEMBERSHIP OF STATE BANKING INSTITUTIONS IN THE FEDERAL RESERVE SYSTEM (REGULATION H) Consumer Protection in Sales of Insurance § 208.85 Where insurance activities may take place. (a) General rule. A bank... transactions are routinely conducted in the bank may refer a consumer who seeks to purchase an insurance...

The role of ATP-sensitive potassium channels in cellular function and protection in the cardiovascular system.

PubMed

Tinker, Andrew; Aziz, Qadeer; Thomas, Alison

2014-01-01

ATP-sensitive potassium channels (K(ATP)) are widely distributed and present in a number of tissues including muscle, pancreatic beta cells and the brain. Their activity is regulated by adenine nucleotides, characteristically being activated by falling ATP and rising ADP levels. Thus, they link cellular metabolism with membrane excitability. Recent studies using genetically modified mice and genomic studies in patients have implicated K(ATP) channels in a number of physiological and pathological processes. In this review, we focus on their role in cellular function and protection particularly in the cardiovascular system. © 2013 The British Pharmacological Society.

Improving radioactive waste management: an overview of the Environmental Protection Agency's low-activity waste effort.

PubMed

Schultheisz, Daniel J; Czyscinski, Kenneth S; Klinger, Adam D

2006-11-01

Radioactive waste disposal in the United States is marked by a fragmented regulatory system, with requirements that often focus on the origin or statutory definition of the waste, rather than the hazard of the material in question. It may be possible to enhance public protection by moving toward a system that provides disposal options appropriate for the hazard presented by the waste in question. This paper summarizes aspects of an approach focusing on the potential use, with appropriate conditions, of Resource Conservation and Recovery Act Subtitle-C hazardous waste landfills for disposal of "low-activity" wastes and public comments on the suggested approach.

Identifying and assessing ecotourism visitor impacts at selected protected areas in Costa Rica and Belize

USGS Publications Warehouse

Farrell, T.A.; Marion, J.L.

2001-01-01

Protected area visitation is an important component of ecotourism, and as such, must be sustainable. However, protected area visitation may degrade natural resources, particularly in areas of concentrated visitor activities like trails and recreation sites. This is an important concern in ecotourism destinations such as Belize and Costa Rica, because they actively promote ecotourism and emphasize the pristine qualities of their natural resources. Research on visitor impacts to protected areas has many potential applications in protected area management, though it has not been widely applied in Central and South America. This study targeted this deficiency through manager interviews and evaluations of alternative impact assessment procedures at eight protected areas in Belize and Costa Rica. Impact assessment procedures included qualitative condition class systems, ratings systems, and measurement-based systems applied to trails and recreation sites. The resulting data characterize manager perceptions of impact problems, document trail and recreation site impacts, and provide examples of inexpensive, efficient and effective rapid impact assessment procedures. Interview subjects reported a variety of impacts affecting trails, recreation sites, wildlife, water, attraction features and other resources. Standardized assessment procedures were developed and applied to record trail and recreation site impacts. Impacts affecting the study areas included trail proliferation, erosion and widening, muddiness on trails, vegetation cover loss, soil and root exposure, and tree damage on recreation sites. The findings also illustrate the types of assessment data yielded by several alternative methods and demonstrate their utility to protected area managers. The need for additional rapid assessment procedures for wildlife, water, attraction feature and other resource impacts was also identified.

Managing Analysis Models in the Design Process

NASA Technical Reports Server (NTRS)

Briggs, Clark

2006-01-01

Design of large, complex space systems depends on significant model-based support for exploration of the design space. Integrated models predict system performance in mission-relevant terms given design descriptions and multiple physics-based numerical models. Both the design activities and the modeling activities warrant explicit process definitions and active process management to protect the project from excessive risk. Software and systems engineering processes have been formalized and similar formal process activities are under development for design engineering and integrated modeling. JPL is establishing a modeling process to define development and application of such system-level models.

A Protective Mechanism of Visible Red Light in Normal Human Dermal Fibroblasts: Enhancement of GADD45A-Mediated DNA Repair Activity.

PubMed

Kim, Yeo Jin; Kim, Hyoung-June; Kim, Hye Lim; Kim, Hyo Jeong; Kim, Hyun Soo; Lee, Tae Ryong; Shin, Dong Wook; Seo, Young Rok

2017-02-01

The phototherapeutic effects of visible red light on skin have been extensively investigated, but the underlying biological mechanisms remain poorly understood. We aimed to elucidate the protective mechanism of visible red light in terms of DNA repair of UV-induced oxidative damage in normal human dermal fibroblasts. The protective effect of visible red light on UV-induced DNA damage was identified by several assays in both two-dimensional and three-dimensional cell culture systems. With regard to the protective mechanism of visible red light, our data showed alterations in base excision repair mediated by growth arrest and DNA damage inducible, alpha (GADD45A). We also observed an enhancement of the physical activity of GADD45A and apurinic/apyrimidinic endonuclease 1 (APE1) by visible red light. Moreover, UV-induced DNA damages were diminished by visible red light in an APE1-dependent manner. On the basis of the decrease in GADD45A-APE1 interaction in the activating transcription factor-2 (ATF2)-knockdown system, we suggest a role for ATF2 modulation in GADD45A-mediated DNA repair upon visible red light exposure. Thus, the enhancement of GADD45A-mediated base excision repair modulated by ATF2 might be a potential protective mechanism of visible red light. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Recommendation system to determine suitable and viable hiking routes: a prototype application in Sierra de las Nieves Nature Reserve (southern Spain)

NASA Astrophysics Data System (ADS)

Vías, Jesús; Rolland, José; Gómez, María Luisa; Ocaña, Carmen; Luque, Ana

2018-05-01

This paper describes a system for recommending hiking routes to help manage hiking activities in a protected area. The system proposes various routes, based on five criteria that maximize some aspects of hikers' requirements (by analyzing the viability and difficulty of the trails) and also those of protected areas managers (by proposals to relieve congestion in areas already used for hiking and to promote awareness of new ones, as a contribution to environmental education). The recommendation system uses network analysis, multi-criteria decision analysis and geographic information system by free software tools: PgRouting, PostgreSQL and PostGIS. This system has been tested in Sierra de las Nieves Nature Reserve (Andalusia, Spain). Of the 182 routes obtained by the system, 62 (34%) are considered viable for hikers in Sierra de las Nieves, taking into account the type of user most likely to visit this protected area. Most routes have a high difficulty level, which is coherent with the mountainous character of the protected area.

Protection from the toxicity of diisopropylfluorophosphate by adeno-associated virus expressing acetylcholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Bin; Duysen, Ellen G.; Poluektova, Larisa Y.

2006-07-15

Organophosphorus esters (OP) are highly toxic chemicals used as pesticides and nerve agents. Their acute toxicity is attributed to inhibition of acetylcholinesterase (AChE, EC 3.1.1.7) in nerve synapses. Our goal was to find a new therapeutic for protection against OP toxicity. We used a gene therapy vector, adeno-associated virus serotype 2 (AAV-2), to deliver murine AChE to AChE-/- mice that have no endogenous AChE activity. The vector encoded the most abundant form of AChE: exons 2, 3, 4, and 6. Two-day old animals, with an immature immune system, were injected. AChE delivered intravenously was expressed up to 5 months inmore » plasma, liver, heart, and lung, at 5-15% of the level in untreated wild-type mice. A few mice formed antibodies, but antibodies did not block AChE activity. The plasma AChE was a mixture of dimers and tetramers. AChE delivered intramuscularly had 40-fold higher activity levels than in wild-type muscle. None of the AChE was collagen-tailed. No retrograde transport through the motor neurons to the central nervous system was detected. AChE delivered intrastriatally assembled into tetramers. In brain, the AAV-2 vector transduced neurons, but not astrocytes and microglia. Vector-treated AChE-/- mice lived longer than saline-treated controls. AChE-/- mice were protected from diisopropylfluorophosphate-induced respiratory failure when the vector was delivered intravenously, but not intrastriatally. Since vector-treated animals had no AChE activity in diaphragm muscle, protection from respiratory failure came from AChE in other tissues. We conclude that AChE scavenged OP and in this way protected the activity of butyrylcholinesterase (BChE, EC 3.1.1.8) in motor endplates.« less

Life Support and Habitation and Planetary Protection Workshop

NASA Technical Reports Server (NTRS)

Hogan, John A. (Editor); Race, Margaret S. (Editor); Fisher, John W. (Editor); Joshi, Jitendra A. (Editor); Rummel, John D. (Editor)

2006-01-01

A workshop entitled "Life Support and Habitation and Planetary Protection Workshop" was held in Houston, Texas on April 27-29, 2005 to facilitate the development of planetary protection guidelines for future human Mars exploration missions and to identify the potential effects of these guidelines on the design and selection of related human life support, extravehicular activity and monitoring and control systems. This report provides a summary of the workshop organization, starting assumptions, working group results and recommendations. Specific result topics include the identification of research and technology development gaps, potential forward and back contaminants and pathways, mitigation alternatives, and planetary protection requirements definition needs. Participants concluded that planetary protection and science-based requirements potentially affect system design, technology trade options, development costs and mission architecture. Therefore early and regular coordination between the planetary protection, scientific, planning, engineering, operations and medical communities is needed to develop workable and effective designs for human exploration of Mars.

Dissecting polyclonal vaccine-induced humoral immunity against HIV using Systems Serology

PubMed Central

Chung, Amy W.; Kumar, Manu P.; Arnold, Kelly B.; Yu, Wen Han; Schoen, Matthew K.; Dunphy, Laura J.; Suscovich, Todd J.; Frahm, Nicole; Linde, Caitlyn; Mahan, Alison E.; Hoffner, Michelle; Streeck, Hendrik; Ackerman, Margaret E.; McElrath, M. Juliana; Schuitemaker, Hanneke; Pau, Maria G.; Baden, Lindsey R.; Kim, Jerome H.; Michael, Nelson L.; Barouch, Dan H.; Lauffenburger, Douglas A.; Alter, Galit

2017-01-01

While antibody titers and neutralization are considered the gold standard for the selection of successful vaccines, these parameters are often inadequate predictors of protective immunity. As antibodies mediate an array of extra-neutralizing Fc-functions, when neutralization fails to predict protection, investigating Fc-mediated activity may help identify immunological correlates and mechanism(s) of humoral protection. Here, we used an integrative approach termed Systems Serology to analyze relationships among humoral responses elicited in four HIV vaccine-trials. Each vaccine regimen induced a unique humoral “Fc-fingerprint”. Moreover, analysis of case:control data from the first moderately protective HIV vaccine trial, RV144, pointed to mechanistic insights into immune complex composition that may underlie protective immunity to HIV. Thus, multi-dimensional relational comparisons of vaccine humoral fingerprints offer a unique approach for the evaluation and design of novel vaccines against pathogens for which correlates of protection remain elusive. PMID:26544943

29 CFR 1926.500 - Scope, application, and definitions applicable to this subpart.

Code of Federal Regulations, 2012 CFR

2012-07-01

... protection requirements for employees performing steel erection work (except for towers and tanks) are... protection systems, except in relation to steel erection activities and the use of equipment covered by... refusal, breakage, or separation of component parts. Load refusal is the point where the ultimate strength...

29 CFR 1926.500 - Scope, application, and definitions applicable to this subpart.

Code of Federal Regulations, 2011 CFR

2011-07-01

... protection requirements for employees performing steel erection work (except for towers and tanks) are... protection systems, except in relation to steel erection activities and the use of equipment covered by... refusal, breakage, or separation of component parts. Load refusal is the point where the ultimate strength...

29 CFR 1926.500 - Scope, application, and definitions applicable to this subpart.

Code of Federal Regulations, 2010 CFR

2010-07-01

...) Fall protection requirements for employees performing steel erection work (except for towers and tanks... protection systems, except in relation to steel erection activities. (b) Definitions. Anchorage means a... component parts. Load refusal is the point where the ultimate strength is exceeded. Free fall means the act...

29 CFR 1926.500 - Scope, application, and definitions applicable to this subpart.

Code of Federal Regulations, 2013 CFR

2013-07-01

... protection requirements for employees performing steel erection work (except for towers and tanks) are... protection systems, except in relation to steel erection activities and the use of equipment covered by... refusal, breakage, or separation of component parts. Load refusal is the point where the ultimate strength...

76 FR 82314 - Agency Information Collection Activities: Small Vessel Reporting System

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-30

... DEPARTMENT OF HOMELAND SECURITY U.S. Customs and Border Protection Agency Information Collection... Security. ACTION: 30-Day notice and request for comments; Establishment of a new collection of information. SUMMARY: U.S. Customs and Border Protection (CBP) of the Department of Homeland Security will be...

12 CFR 208.81 - Purpose and scope.

Code of Federal Regulations, 2010 CFR

2010-01-01

... STATE BANKING INSTITUTIONS IN THE FEDERAL RESERVE SYSTEM (REGULATION H) Consumer Protection in Sales of Insurance § 208.81 Purpose and scope. This subpart establishes consumer protections in connection with... consumer by: (a) Any state member bank; or (b) Any other person that is engaged in such activities at an...

40 CFR 60.1885 - What must I include in my annual report?

Code of Federal Regulations, 2013 CFR

2013-07-01

... monitoring system (§ 60.1850(a)(1)). (d) For municipal waste combustion units that use activated carbon for... diluent gas, documentation of the relationship between oxygen and carbon dioxide, as specified in § 60...? 60.1885 Section 60.1885 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR...

40 CFR 60.1885 - What must I include in my annual report?

Code of Federal Regulations, 2014 CFR

2014-07-01

... monitoring system (§ 60.1850(a)(1)). (d) For municipal waste combustion units that use activated carbon for... diluent gas, documentation of the relationship between oxygen and carbon dioxide, as specified in § 60...? 60.1885 Section 60.1885 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR...

40 CFR 60.1885 - What must I include in my annual report?

Code of Federal Regulations, 2012 CFR

2012-07-01

... monitoring system (§ 60.1850(a)(1)). (d) For municipal waste combustion units that use activated carbon for... diluent gas, documentation of the relationship between oxygen and carbon dioxide, as specified in § 60...? 60.1885 Section 60.1885 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR...

Protective garment ventilation system

NASA Technical Reports Server (NTRS)

Lang, R. (Inventor)

1970-01-01

A method and apparatus for ventilating a protective garment, space suit system, and/or pressure suits to maintain a comfortable and nontoxic atmosphere within is described. The direction of flow of a ventilating and purging gas in portions of the garment may be reversed in order to compensate for changes in environment and activity of the wearer. The entire flow of the ventilating gas can also be directed first to the helmet associated with the garment.

Under-Body Blast Mitigation: Stand-Alone Seat Safety Activation System

DTIC Science & Technology

2014-04-01

Restraints, Airbags or other protection systems) to mitigate injury to the occupant during the onset of the event. Injuries may occur as soon as 2.5 ms...cost-effective sensor to accurately and consistently deploy airbags and other pyrotechnic restraint systems based on accelerometers and other...Circuitry are critically important in order to activate the initiators of air bags and pyrotechnic restraint system such as airbags at the very first

5 CFR 1207.103 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-01-01

... mental or physical impairment that substantially limits one or more major life activities. (4) Is... physical or mental impairment that substantially limits major life activities only as a result of the... NONDISCRIMINATION ON THE BASIS OF DISABILITY IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE MERIT SYSTEMS PROTECTION...

Influence of Bacterial Biofilm Polysaccharide Structure on Interactions with Antimicrobial Peptides: A Study on Klebsiella pneumoniae.

PubMed

Bellich, Barbara; Lagatolla, Cristina; Tossi, Alessandro; Benincasa, Monica; Cescutti, Paola; Rizzo, Roberto

2018-06-06

Biofilms are complex systems produced by bacteria and constituted by macromolecular matrix embedding cells. They provide advantages to bacteria including protection against antimicrobials. The protection given by biofilms produced by Klebsiella pneumoniae strains towards antimicrobial peptides of the innate immune system was investigated. In particular, the role of matrix bacterial exopolysaccharides was explored. Three clinical strains producing exopolysaccharides with different chemistry were selected and the interaction of purified biofilm polysaccharides with two bovine cathelicidins was studied by circular dichroism spectroscopy and microbiological assays to establish their influence on the peptide’s antimicrobial activity. The spectroscopic data indicated a different extent of interaction with the two peptides, in a manner dependent on their sugar composition, and in particular the presence of rhamnose residues correlated with a lower interaction. The extent of interaction was then related to the protection towards antimicrobial peptides, conferred by the addition of the different exopolysaccharides, in minimum inhibitory concentration (MIC) assays against a reference Escherichia coli strain. Microbiological results were in very good agreement with spectroscopic data, confirming the active role of matrix polysaccharides in determining a biofilm’s protective capacity and indicating lower protection levels afforded by rhamnose containing exopolysaccharides.

Real World Data Driven Evolution of Volvo Cars’ Side Impact Protection Systems and their Effectiveness

PubMed Central

Jakobsson, Lotta; Lindman, Magdalena; Svanberg, Bo; Carlsson, Henrik

2010-01-01

This study analyses the outcome of the continuous improved occupant protection over the last two decades for front seat near side occupants in side impacts based on a real world driven working process. The effectiveness of four generations of improved side impact protection are calculated based on data from Volvo’s statistical accident database of Volvo Cars in Sweden. Generation I includes vehicles with a new structural and interior concept (SIPS). Generation II includes vehicles with structural improvements and a new chest airbag (SIPSbag). Generation III includes vehicles with further improved SIPS and SIPSbag as well as the new concept with a head protecting Inflatable Curtain (IC). Generation IV includes the most recent vehicles with further improvements of all the systems plus advanced sensors and seat belt pretensioner activation. Compared to baseline vehicles, vehicles of generation I reduce MAIS2+ injuries by 54%, generation II by 61% and generation III by 72%. For generation IV effectiveness figures cannot be calculated because of the lack of MAIS2+ injuries. A continuous improved performance is also seen when studying the AIS2+ pelvis, abdomen, chest and head injuries separately. By using the same real world driven working process, future improvements and possibly new passive as well as active safety systems, will be developed with the aim of further improved protection to near side occupants in side impacts. PMID:21050597

L-3 Com AVISYS civil aviation self-protection system

NASA Astrophysics Data System (ADS)

Carey, Jim

2006-05-01

In early 2004, L-3 Com AVISYS Corporation (hereinafter referred to as L-3 AVISYS or AVISYS) completed a contract for the integration and deployment of an advanced Infrared Countermeasures self-protection suite for a Head of State Airbus A340 aircraft. This initial L-3 AVISYS IRCM Suite was named WIPPS (Widebody Integrated Platform Protection System). The A340 WIPPS installation provisions were FAA certified with the initial deployment of the modified aircraft. WIPPS is unique in that it utilizes a dual integrated missile warning subsystem to produce a robust, multi-spectral, ultra-low false alarm rate threat warning capability. WIPPS utilizes the Thales MWS-20 Pulsed Doppler Radar Active MWS and the EADS AN/AAR-60 Ultraviolet Passive MWS. These MWS subsystems are integrated through an L-3 AVISYS Electronic Warfare Control Set (EWCS). The EWCS also integrates the WIPPS MWS threat warning information with the A340 flight computer data to optimize ALE-47 Countermeasure Dispensing System IR decoy dispensing commands, program selection and timing. WIPPS utilizes standard and advanced IR Decoys produced by ARMTEC Defense and Alloy Surfaces. WIPPS demonstrated that when IR decoy dispensing is controlled by threat range and time-to-go information provided by an Active MWS, unsurpassed self protection levels are achievable. Recognizing the need for high volume civil aviation protection, L-3 AVISYS configured a variant of WIPPS optimized for commercial airline reliability requirements, safety requirements, supportability and most importantly, affordability. L-3 AVISYS refers to this IRCM suite as CAPS (Commercial Airliner Protection System). CAPS has been configured for applications to all civil aircraft ranging from the small Regional Jets to the largest Wide-bodies. This presentation and paper will provide an overview of the initial WIPPS IRCM Suite and the important factors that were considered in defining the CAPS configuration.

Actively Controlled Magnetic Vibration-Isolation System

NASA Technical Reports Server (NTRS)

Grodsinky, Carlos M.; Logsdon, Kirk A.; Wbomski, Joseph F.; Brown, Gerald V.

1993-01-01

Prototype magnetic suspension system with active control isolates object from vibrations in all six degrees of freedom at frequencies as low as 0.01 Hz. Designed specifically to protect instruments aboard spacecraft by suppressing vibrations to microgravity levels; basic control approach used for such terrestrial uses as suppression of shocks and other vibrations in trucks and railroad cars.

Sun Protection Preferences and Behaviors among Young Adult Males during Maximum Ultraviolet Radiation Exposure Activities

PubMed Central

Wickenheiser, Marilyn; Baker, Mary Kate; Gaber, Rikki; Blatt, Hanz; Robinson, June K.

2013-01-01

This study explores sun protection attitudes, preferences, and behaviors among young adult males participating in an open-field activity with extreme ultraviolet radiation exposure. Male drum corps members (n = 137) responded to survey questions regarding their behavior and willingness to engage in sun protection and barriers to sunscreen usage. A subset of members (n = 31) participated in cognitive interviews exploring various sunscreen products and intervention techniques. Participants were knowledgeable about health risks and protection benefits regarding sun exposure. Generally, males had positive attitudes and normative beliefs about using sunscreen. A barrier to sunscreen re-application was lack of adequate time to reapply sunscreen during the open field activity. Males preferred a towelette application method, but were unfamiliar with its efficacy and proper use. Thus, they were more likely to use the more familiar sunscreen spray. To increase sun protection behaviors and lower skin cancer risk for males participating in open-field activities, breaks must be allotted every 2 h and have sufficient time to allow sunscreen application. Future development and research into delivery systems that rapidly and evenly apply sunscreen may help lower exposure in this population. PMID:23912201

[STUDY OF PROTECTIVE ACTIVITY OF PROTEIN-CONTAINING ANTIGENS OF STREPTOCOCCUS PNEUMONIAE IN A HETEROLOGOUS SYSTEM].

PubMed

Vorobiev, D S; Semenova, I B; Volokh, Yu V; Romanenko, E E; Baturo, A P; Mikhailova, N A

2015-01-01

Study protective activity of protein-containing antigens of pneumococcus, obtained from serotypes 6B, 10A, 14, 19F, 23F and 36R, against infection with heterologous strains of S. pneumoniae. S. pneumoniae strains of serotypes 3, 6B, 10A, 14, 19F, 23F and 36R, obtained from the collection of pneumococcus strains of Mechnikov RIVS, were used in the study. Protein-containing antigens of S. pneumoniae were isolated by acetone precipitations of supernatant fraction of culture medium. Protective activity of preparations of protein-containing antigens of pneumococcus as studied in experiments of active protection of BALb/c line mice. The data obtained give evidence, that protein-containing antigens of pneumococcus, isolated from serotypes 6B, 10A, 14, 19F and 23F, effectively protect animals from subsequent infection with a heterologous S. pneumoniae strain of serotype 3 No. 11/56. Protection was noted at a level from 80 to 100% (p ≤ 0.05). Similar protective effect was detected in another experiment in a group of mice, immunized with preparations of protein-containing antigens of pneumococcus, obtained from serotypes 6B and 36R, against infection with a heterologous S. pneumoniae strain of serotype 3 No. 11/56. Protection was noted at a level of 90% (p ≤ 0.05). The results of the experiments carried out allow to assume, that the main role in formation of cross-protection in experiments in animals is played by pneumococcus, proteins, that are a part of the studied preparations, and not polysaccharide antigens.

[The development and introduction of a rational system for the protection of the personnel in a large enterprise against attack by blood-sucking arthropods in western Siberia].

PubMed

Ermishev, Iu V; Dremova, V P; Stepnov, A P; Semenov, V E

2000-01-01

In the middle Ob River Valley (north and moderate taiga), a large number of bloodsucking dipterans (mosquitoes, blackflies, biting midges, horseflies) are recorded during 90-100 days; the activity of Ixodes persulcatus and their attack on humans are notified during 90-115 days. A package of measures that protect petroleum industrial workers from the attacks of bloodsucking insects and ticks includes the use of protective suits, the treatment of premises with insecticides, the use of repellents, and health education. Protective means for workers should be the items included into the list of expenses on safety measures. Work is done on a cost-accounting principle. The introduced system annually shows a high efficiency (95-98%) in protecting large groups of workers in their working places.

Molecular mechanisms of liver preconditioning

PubMed Central

Alchera, Elisa; Dal Ponte, Caterina; Imarisio, Chiara; Albano, Emanuele; Carini, Rita

2010-01-01

Ischemia/reperfusion (I/R) injury still represents an important cause of morbidity following hepatic surgery and limits the use of marginal livers in hepatic transplantation. Transient blood flow interruption followed by reperfusion protects tissues against damage induced by subsequent I/R. This process known as ischemic preconditioning (IP) depends upon intrinsic cytoprotective systems whose activation can inhibit the progression of irreversible tissue damage. Compared to other organs, liver IP has additional features as it reduces inflammation and promotes hepatic regeneration. Our present understanding of the molecular mechanisms involved in liver IP is still largely incomplete. Experimental studies have shown that the protective effects of liver IP are triggered by the release of adenosine and nitric oxide and the subsequent activation of signal networks involving protein kinases such as phosphatidylinositol 3-kinase, protein kinase C δ/ε and p38 MAP kinase, and transcription factors such as signal transducer and activator of transcription 3, nuclear factor-κB and hypoxia-inducible factor 1. This article offers an overview of the molecular events underlying the preconditioning effects in the liver and points to the possibility of developing pharmacological approaches aimed at activating the intrinsic protective systems in patients undergoing liver surgery. PMID:21182220

5 CFR 1215.24 - Claims involving criminal activity or misconduct.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 5 Administrative Personnel 3 2011-01-01 2011-01-01 false Claims involving criminal activity or misconduct. 1215.24 Section 1215.24 Administrative Personnel MERIT SYSTEMS PROTECTION BOARD ORGANIZATION AND PROCEDURES DEBT MANAGEMENT Claims Collection § 1215.24 Claims involving criminal activity or misconduct. (a...

5 CFR 1215.24 - Claims involving criminal activity or misconduct.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 5 Administrative Personnel 3 2013-01-01 2013-01-01 false Claims involving criminal activity or misconduct. 1215.24 Section 1215.24 Administrative Personnel MERIT SYSTEMS PROTECTION BOARD ORGANIZATION AND PROCEDURES DEBT MANAGEMENT Claims Collection § 1215.24 Claims involving criminal activity or misconduct. (a...

5 CFR 1215.24 - Claims involving criminal activity or misconduct.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 5 Administrative Personnel 3 2012-01-01 2012-01-01 false Claims involving criminal activity or misconduct. 1215.24 Section 1215.24 Administrative Personnel MERIT SYSTEMS PROTECTION BOARD ORGANIZATION AND PROCEDURES DEBT MANAGEMENT Claims Collection § 1215.24 Claims involving criminal activity or misconduct. (a...

5 CFR 1215.24 - Claims involving criminal activity or misconduct.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Claims involving criminal activity or misconduct. 1215.24 Section 1215.24 Administrative Personnel MERIT SYSTEMS PROTECTION BOARD ORGANIZATION AND PROCEDURES DEBT MANAGEMENT Claims Collection § 1215.24 Claims involving criminal activity or misconduct. (a...

5 CFR 1215.24 - Claims involving criminal activity or misconduct.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 5 Administrative Personnel 3 2014-01-01 2014-01-01 false Claims involving criminal activity or misconduct. 1215.24 Section 1215.24 Administrative Personnel MERIT SYSTEMS PROTECTION BOARD ORGANIZATION AND PROCEDURES DEBT MANAGEMENT Claims Collection § 1215.24 Claims involving criminal activity or misconduct. (a...

Scientific evaluation of the ArmorGuard mobile barrier system.

DOT National Transportation Integrated Search

2011-06-17

"Accidents and injuries occur during maintenance activities that could be protected by the ArmorGuard or BalsiBeam mobile barrier systems. The main purpose of this study is to perform a scientific evaluation of the utility of the ArmorGuard system in...

The framework for simulation of bioinspired security mechanisms against network infrastructure attacks.

PubMed

Shorov, Andrey; Kotenko, Igor

2014-01-01

The paper outlines a bioinspired approach named "network nervous system" and methods of simulation of infrastructure attacks and protection mechanisms based on this approach. The protection mechanisms based on this approach consist of distributed procedures of information collection and processing, which coordinate the activities of the main devices of a computer network, identify attacks, and determine necessary countermeasures. Attacks and protection mechanisms are specified as structural models using a set-theoretic approach. An environment for simulation of protection mechanisms based on the biological metaphor is considered; the experiments demonstrating the effectiveness of the protection mechanisms are described.

Seaweed Polysaccharides and Derived Oligosaccharides Stimulate Defense Responses and Protection Against Pathogens in Plants

PubMed Central

Vera, Jeannette; Castro, Jorge; Gonzalez, Alberto; Moenne, Alejandra

2011-01-01

Plants interact with the environment by sensing “non-self” molecules called elicitors derived from pathogens or other sources. These molecules bind to specific receptors located in the plasma membrane and trigger defense responses leading to protection against pathogens. In particular, it has been shown that cell wall and storage polysaccharides from green, brown and red seaweeds (marine macroalgae) corresponding to ulvans, alginates, fucans, laminarin and carrageenans can trigger defense responses in plants enhancing protection against pathogens. In addition, oligosaccharides obtained by depolymerization of seaweed polysaccharides also induce protection against viral, fungal and bacterial infections in plants. In particular, most seaweed polysaccharides and derived oligosaccharides trigger an initial oxidative burst at local level and the activation of salicylic (SA), jasmonic acid (JA) and/or ethylene signaling pathways at systemic level. The activation of these signaling pathways leads to an increased expression of genes encoding: (i) Pathogenesis-Related (PR) proteins with antifungal and antibacterial activities; (ii) defense enzymes such as pheylalanine ammonia lyase (PAL) and lipoxygenase (LOX) which determine accumulation of phenylpropanoid compounds (PPCs) and oxylipins with antiviral, antifugal and antibacterial activities and iii) enzymes involved in synthesis of terpenes, terpenoids and/or alkaloids having antimicrobial activities. Thus, seaweed polysaccharides and their derived oligosaccharides induced the accumulation of proteins and compounds with antimicrobial activities that determine, at least in part, the enhanced protection against pathogens in plants. PMID:22363237

Seaweed polysaccharides and derived oligosaccharides stimulate defense responses and protection against pathogens in plants.

PubMed

Vera, Jeannette; Castro, Jorge; Gonzalez, Alberto; Moenne, Alejandra

2011-12-01

Plants interact with the environment by sensing "non-self" molecules called elicitors derived from pathogens or other sources. These molecules bind to specific receptors located in the plasma membrane and trigger defense responses leading to protection against pathogens. In particular, it has been shown that cell wall and storage polysaccharides from green, brown and red seaweeds (marine macroalgae) corresponding to ulvans, alginates, fucans, laminarin and carrageenans can trigger defense responses in plants enhancing protection against pathogens. In addition, oligosaccharides obtained by depolymerization of seaweed polysaccharides also induce protection against viral, fungal and bacterial infections in plants. In particular, most seaweed polysaccharides and derived oligosaccharides trigger an initial oxidative burst at local level and the activation of salicylic (SA), jasmonic acid (JA) and/or ethylene signaling pathways at systemic level. The activation of these signaling pathways leads to an increased expression of genes encoding: (i) Pathogenesis-Related (PR) proteins with antifungal and antibacterial activities; (ii) defense enzymes such as pheylalanine ammonia lyase (PAL) and lipoxygenase (LOX) which determine accumulation of phenylpropanoid compounds (PPCs) and oxylipins with antiviral, antifugal and antibacterial activities and iii) enzymes involved in synthesis of terpenes, terpenoids and/or alkaloids having antimicrobial activities. Thus, seaweed polysaccharides and their derived oligosaccharides induced the accumulation of proteins and compounds with antimicrobial activities that determine, at least in part, the enhanced protection against pathogens in plants.

Mast cell activators as novel immune regulators.

PubMed

Johnson-Weaver, Brandi; Choi, Hae Woong; Abraham, Soman N; Staats, Herman F

2018-05-26

Mast cells are an important cell type of the innate immune system that when activated, play a crucial role in generating protective innate host responses after bacterial and viral infection. Additionally, activated mast cells influence lymph node composition to regulate the induction of adaptive immune responses. The recognition that mast cells play a beneficial role in host responses to microbial infection and induction of adaptive immunity has provided the rationale to evaluate mast cell activators for use as antimicrobials or vaccine adjuvants. This review summarizes the role of mast cell activators in antimicrobial responses while also discussing the use of different classes of mast cell activators as potent vaccine adjuvants that enhance the induction of protective immune responses. Copyright © 2018 Elsevier Ltd. All rights reserved.

Advanced ceramic matrix composites for TPS

NASA Technical Reports Server (NTRS)

Rasky, Daniel J.

1992-01-01

Recent advances in ceramic matrix composite (CMC) technology provide considerable opportunity for application to future aircraft thermal protection system (TPS), providing materials with higher temperature capability, lower weight, and higher strength and stiffness than traditional materials. The Thermal Protection Material Branch at NASA Ames Research Center has been making significant progress in the development, characterization, and entry simulation (arc-jet) testing of new CMC's. This protection gives a general overview of the Ames Thermal Protection Materials Branch research activities, followed by more detailed descriptions of recent advances in very-high temperature Zr and Hf based ceramics, high temperature, high strength SiC matrix composites, and some activities in polymer precursors and ceramic coating processing. The presentation closes with a brief comparison of maximum heat flux capabilities of advanced TPS materials.

The influence of the environmental management system on the environmental impact of seaport companies during an economic crisis: Lithuanian case study.

PubMed

Anne, Olga; Burskyte, Vilma; Stasiskiene, Zaneta; Balciunas, Arunas

2015-01-01

Freight handling in EU ports fell by more than 12 % during the global economic crisis in 2008-2009 after almost a decade of continuous growth. The decrease of freight handling in the Klaipeda seaport, the only port in Lithuania, was 6.7 % and happened due to the dominant outward movement of goods (mainly oil products). The Klaipeda seaport, due to its peculiarity, is the only ice-free port in the northern part of Baltic Sea. The present study explores the environmental impact of Klaipeda seaport activities from 2001 to 2011. Moreover, it compares the environmental effectiveness of environmental protection strategies used in the four biggest companies that, in fact, cover about 88 % of total activities (except general cargo) of the seaport. The first group of targeted companies used an environmental protection strategy to implement an ISO 14001-based environmental management system, and the second group selected to follow environmental management practices without certification. The paper analyses the development of the companies' activities in regard to the change of environmental effectiveness. The paper evaluates the pressure of the economic crisis on the companies' activities and its influence on environmental decisions, with particular interest in the ability of different environmental protection systems to resist and handle the expected performance. The study identified a significant decrease in companies' activities during the crisis period. However, the economic activities and environmental effectiveness demonstrated similar short-term tendencies in regard to the environmental strategy selection but differed in long-term perspective.

The endocannabinoid system in normal and pathological brain ageing

PubMed Central

Bilkei-Gorzo, Andras

2012-01-01

The role of endocannabinoids as inhibitory retrograde transmitters is now widely known and intensively studied. However, endocannabinoids also influence neuronal activity by exerting neuroprotective effects and regulating glial responses. This review centres around this less-studied area, focusing on the cellular and molecular mechanisms underlying the protective effect of the cannabinoid system in brain ageing. The progression of ageing is largely determined by the balance between detrimental, pro-ageing, largely stochastic processes, and the activity of the homeostatic defence system. Experimental evidence suggests that the cannabinoid system is part of the latter system. Cannabinoids as regulators of mitochondrial activity, as anti-oxidants and as modulators of clearance processes protect neurons on the molecular level. On the cellular level, the cannabinoid system regulates the expression of brain-derived neurotrophic factor and neurogenesis. Neuroinflammatory processes contributing to the progression of normal brain ageing and to the pathogenesis of neurodegenerative diseases are suppressed by cannabinoids, suggesting that they may also influence the ageing process on the system level. In good agreement with the hypothesized beneficial role of cannabinoid system activity against brain ageing, it was shown that animals lacking CB1 receptors show early onset of learning deficits associated with age-related histological and molecular changes. In preclinical models of neurodegenerative disorders, cannabinoids show beneficial effects, but the clinical evidence regarding their efficacy as therapeutic tools is either inconclusive or still missing. PMID:23108550

The endocannabinoid system in normal and pathological brain ageing.

PubMed

Bilkei-Gorzo, Andras

2012-12-05

The role of endocannabinoids as inhibitory retrograde transmitters is now widely known and intensively studied. However, endocannabinoids also influence neuronal activity by exerting neuroprotective effects and regulating glial responses. This review centres around this less-studied area, focusing on the cellular and molecular mechanisms underlying the protective effect of the cannabinoid system in brain ageing. The progression of ageing is largely determined by the balance between detrimental, pro-ageing, largely stochastic processes, and the activity of the homeostatic defence system. Experimental evidence suggests that the cannabinoid system is part of the latter system. Cannabinoids as regulators of mitochondrial activity, as anti-oxidants and as modulators of clearance processes protect neurons on the molecular level. On the cellular level, the cannabinoid system regulates the expression of brain-derived neurotrophic factor and neurogenesis. Neuroinflammatory processes contributing to the progression of normal brain ageing and to the pathogenesis of neurodegenerative diseases are suppressed by cannabinoids, suggesting that they may also influence the ageing process on the system level. In good agreement with the hypothesized beneficial role of cannabinoid system activity against brain ageing, it was shown that animals lacking CB1 receptors show early onset of learning deficits associated with age-related histological and molecular changes. In preclinical models of neurodegenerative disorders, cannabinoids show beneficial effects, but the clinical evidence regarding their efficacy as therapeutic tools is either inconclusive or still missing.

17Beta-estradiol protects against oxidative stress-induced cell death through the glutathione/glutaredoxin-dependent redox regulation of Akt in myocardiac H9c2 cells.

PubMed

Urata, Yoshishige; Ihara, Yoshito; Murata, Hiroaki; Goto, Shinji; Koji, Takehiko; Yodoi, Junji; Inoue, Satoshi; Kondo, Takahito

2006-05-12

The GSH/glutaredoxin (GRX) system is involved in the redox regulation of certain enzyme activities, and this system protects cells from H2O2-induced apoptosis by regulating the redox state of Akt (Murata, H., Ihara, Y., Nakamura, H., Yodoi, J., Sumikawa, K., and Kondo, T. (2003) J. Biol. Chem. 278, 50226-50233). Estrogens, such as 17beta-estradiol (E2), play an important role in development, growth, and differentiation and appear to have protective effects on oxidative stress mediated by estrogen receptor alpha (ERalpha). However, the role of the ERbeta-mediated pathway in this cytoprotection and the involvement of E2 in the redox regulation are not well understood. In the present study, we demonstrated that E2 protected cardiac H9c2 cells, expressing ERbeta from H2O2-induced apoptosis concomitant with an increase in the activity of Akt. E2 induced the expression of glutaredoxin (GRX) as well as gamma-glutamylcysteine synthetase, a rate-limiting enzyme for the synthesis of GSH. Inhibitors for both gamma-glutamylcysteine synthetase and GRX and ICI182,780, a specific inhibitor of ERs, abolished the protective effect of E2 on cell survival as well as the activity of Akt, suggesting that ERbeta is involved in the cytoprotection and redox regulation by E2. Transcription of the GRX gene was enhanced by E2. The promoter activity of GRX was up-regulated by an ERbeta-dependent element. These results suggest that the GRX/GSH system is involved in the cytoprotective and genomic effects of E2 on the redox state of Akt, a pathway that is mediated, at least in part, by ERbeta. This mechanism may also play an antiapoptotic role in cancer cells during carcinogenesis or chemotherapy.

Antioxidant activity and protective effect of Clitoria ternatea flower extract on testicular damage induced by ketoconazole in rats.

PubMed

Iamsaard, Sitthichai; Burawat, Jaturon; Kanla, Pipatpong; Arun, Supatcharee; Sukhorum, Wannisa; Sripanidkulchai, Bungorn; Uabundit, Nongnut; Wattathorn, Jintanaporn; Hipkaeo, Wiphawi; Fongmoon, Duriya; Kondo, Hisatake

2014-06-01

Ketoconazole (KET), an antifungal drug, has adverse effects on the male reproductive system. Pre-treatments with antioxidant plant against testicular damage induced by KET are required. The flowers of Clitoria ternatea (CT) are proven to have hepatoprotective potential. However, the protective effect on KET-induced testicular damage has not been reported. To investigate the protective effect of CT flower extracts with antioxidant activity on male reproductive parameters including sperm concentration, serum testosterone level, histopathology of the testis, and testicular tyrosine phosphorylation levels in rats induced with KET. The antioxidant activity of CT flower extracts was determined using 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power (FRAP) assays. Male rats were treated with CT flower extracts (10, 50, or 100 mg/kg BW) or distilled water via a gastric tube for 28 d (preventive period: Days 1-21) and induced by KET (100 mg/kg BW) via intraperitoneal injection for 7 d (induction period: Days 22-28). After the experiment, all animals were examined for the weights of the testis, epididymis plus vas deferens and seminal vesicle, serum testosterone levels, sperm concentration, histological structures and diameter of testis, and testicular tyrosine phosphorylation levels by immunoblotting. The CT flower extracts had capabilities for DPPH scavenging and high reducing power. At 100 mg/kg BW, the extract had no toxic effects on the male reproductive system. Significantly, in CT+KET groups, CT flower extracts (50 and 100 mg/kg BW) alleviated the reduction of reproductive organ weight parameters, testosterone levels, and sperm concentration. In addition, CT flower extracts gave protection from testicular damage in KET-induced rats. Moreover, in the CT100+KET group, CT flower extracts significantly enhanced the expression of a testicular 50-kDa tyrosine phosphorylated protein compared with that of other groups. C. ternatea flower extracts possessing antioxidant activity are not harmful to the male reproductive system and can protect against testicular damage in KET-induced rats.

[THE OPTIMIZATION OF THE ACTIVITY OF ORGANS OF FEDERAL SERVICE FOR SUPERVISION OF CONSUMER RIGHTS PROTECTION AND HUMAN WELFARE IN THE SVERDLOVSK REGION].

PubMed

Kuz'min, S V; Gurvich, V B; Romanov, S V; Dikonskaia, O V; Iarushin, S V; Malykh, O L

2015-01-01

In the Sverdlovsk region there have developed and implemented methodological approaches to the optimization oj the activity of the Directorate and the Centre directed to the improvement of the sanitary and epidemiological surveillance and in the sphere of the protection of the rights of consumers in the framework of the development of an comprehensive regional system of risk management for the population's health in the Sverdlovsk region.

75 FR 48325 - Agency Information Collection Activities: Proposed Collection; Comment Request; Underground...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-10

... statute. Do not submit information that you consider to be CBI or otherwise protected through www... businesses affected by this collection. What should I consider when I prepare my comments for EPA? You may... standards for UST systems, as may be necessary, to protect human health and the environment, and procedures...

ENVIRONMENTAL RESEARCH BRIEF: WASTE REDUCTION ACTIVITIES AND OPTIONS FOR A MANUFACTURER OF SYSTEMS TO PRODUCE SEMICONDUCTORS.

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) funded a project with the New Jersey Department of Environmental Protection and Energy (NJDEPE) to assist in conducting waste minimization assessments at thirty small- to medium-sized businesses in the state of New Jersey. ne of the ...

ENVIRONMENTAL RESEARCH BRIEF: WASTE REDUCTION ACTIVITIES AND OPTIONS FOR AN ELECTRICAL UTILITY TRANSMISSION SYSTEM MONITORING AND MAINTENANCE FACILITY

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) funded a project with the New Jersey Department of Environmental Protection and Energy (NJDEPE) to assist in conducting waste minimization assessments at thirty small- to medium-sized businesses in the state of New Jersey. ne of the ...

ENVIRONMENTAL RESEARCH BRIEF: WASTE REDUCTION ACTIVITIES AND OPTIONS FOR AN ELECTRICAL UTILITY TRANSMISSION SYSTEM MONITORING AND MAINTENANCE FACILITY.

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) funded a project with the New Jersey Department of Environmental Protection and Energy (NJDEPE) to assist in conducting waste minimization assessments at thirty small- to medium-sized businesses in the state of New Jersey. ne of the ...

STATUS OF ENDOCRINE DISRUPTOR SCREENING AND TESTING ACTIVITIES IN THE US: IMPLEMENTATION OF THE EDSTAC RECOMMENDATIONS

EPA Science Inventory

The last two decades have witnessed a growing concern for chemicals that have the potential to adversely affect the normal functioning of the endocrine system. In 1996, the US Congress passed the Food Quality Protection Act (FQPA) that mandated the US Environmental Protection Ag...

KSC-07pd2610

NASA Image and Video Library

2007-09-28

KENNEDY SPACE CENTER, FLA. -- In the Orbiter Processing Facility, members of the STS-122 crew get information about the thermal protection system on space shuttle Atlantis (overhead). From left are Pilot Alan Poindexter, Mission Specialists Rex Walheim, Commander Stephen Frick, and Mission Specialists Hans Schlegel, Leland Melvin and Stanley Love. Schlegel represents the European Space Agency. The crew is at Kennedy to take part in a crew equipment interface test, or CEIT, which helps familiarize them with equipment and payloads for the mission. Among the activities standard to a CEIT are harness training, inspection of the thermal protection system and camera operation for planned extravehicular activities, or EVAs. STS-122 is targeted for launch in December. Photo credit: NASA/Kim Shiflett

Systems analysis of protective immune responses to RTS,S malaria vaccination in humans

PubMed Central

Kazmin, Dmitri; Nakaya, Helder I.; Lee, Eva K.; Johnson, Matthew J.; van der Most, Robbert; van den Berg, Robert A.; Ballou, W. Ripley; Jongert, Erik; Wille-Reece, Ulrike; Ockenhouse, Christian; Aderem, Alan; Zak, Daniel E.; Sadoff, Jerald; Hendriks, Jenny; Wrammert, Jens; Ahmed, Rafi; Pulendran, Bali

2017-01-01

RTS,S is an advanced malaria vaccine candidate and confers significant protection against Plasmodium falciparum infection in humans. Little is known about the molecular mechanisms driving vaccine immunity. Here, we applied a systems biology approach to study immune responses in subjects receiving three consecutive immunizations with RTS,S (RRR), or in those receiving two immunizations of RTS,S/AS01 following a primary immunization with adenovirus 35 (Ad35) (ARR) vector expressing circumsporozoite protein. Subsequent controlled human malaria challenge (CHMI) of the vaccinees with Plasmodium-infected mosquitoes, 3 wk after the final immunization, resulted in ∼50% protection in both groups of vaccinees. Circumsporozoite protein (CSP)-specific antibody titers, prechallenge, were associated with protection in the RRR group. In contrast, ARR-induced lower antibody responses, and protection was associated with polyfunctional CD4+ T-cell responses 2 wk after priming with Ad35. Molecular signatures of B and plasma cells detected in PBMCs were highly correlated with antibody titers prechallenge and protection in the RRR cohort. In contrast, early signatures of innate immunity and dendritic cell activation were highly associated with protection in the ARR cohort. For both vaccine regimens, natural killer (NK) cell signatures negatively correlated with and predicted protection. These results suggest that protective immunity against P. falciparum can be achieved via multiple mechanisms and highlight the utility of systems approaches in defining molecular correlates of protection to vaccination. PMID:28193898

48 CFR 1552.237-74 - Publicity.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Section 1552.237-74 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY CLAUSES AND... removal or remedial activities under the Comprehensive Environmental Response, Compensation and Liability... any information to the news media regarding the removal or remedial activities being conducted under...

48 CFR 1552.237-74 - Publicity.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Section 1552.237-74 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY CLAUSES AND... removal or remedial activities under the Comprehensive Environmental Response, Compensation and Liability... any information to the news media regarding the removal or remedial activities being conducted under...

Protecting terrestrial ecosystems and the climate through a global carbon market.

PubMed

Bonnie, Robert; Carey, Melissa; Petsonk, Annie

2002-08-15

Protecting terrestrial ecosystems through international environmental laws requires the development of economic mechanisms that value the Earth's natural systems. The major international treaties to address ecosystem protection lack meaningful binding obligations and the requisite financial instruments to affect large-scale conservation. The Kyoto Protocol's emissions-trading framework creates economic incentives for nations to reduce greenhouse-gas (GHG) emissions cost effectively. Incorporating GHG impacts from land-use activities into this system would create a market for an important ecosystem service provided by forests and agricultural lands: sequestration of atmospheric carbon. This would spur conservation efforts while reducing the 20% of anthropogenic CO(2) emissions produced by land-use change, particularly tropical deforestation. The Kyoto negotiations surrounding land-use activities have been hampered by a lack of robust carbon inventory data. Moreover, the Protocol's provisions agreed to in Kyoto made it difficult to incorporate carbon-sequestering land-use activities into the emissions-trading framework without undermining the atmospheric GHG reductions contemplated in the treaty. Subsequent negotiations since 1997 failed to produce a crediting system that provides meaningful incentives for enhanced carbon sequestration. Notably, credit for reducing rates of tropical deforestation was explicitly excluded from the Protocol. Ultimately, an effective GHG emissions-trading framework will require full carbon accounting for all emissions and sequestration from terrestrial ecosystems. Improved inventory systems and capacity building for developing nations will, therefore, be necessary.

Protecting peroxidase activity of multilayer enzyme-polyion films using outer catalase layers.

PubMed

Lu, Haiyun; Rusling, James F; Hu, Naifei

2007-12-27

Films constructed layer-by-layer on electrodes with architecture {protein/hyaluronic acid (HA)}n containing myoglobin (Mb) or horseradish peroxidase (HRP) were protected against protein damage by H2O2 by using outer catalase layers. Peroxidase activity for substrate oxidation requires activation by H2O2, but {protein/HA}n films without outer catalase layers are damaged slowly and irreversibly by H2O2. The rate and extent of damage were decreased dramatically by adding outer catalase layers to decompose H2O2. Comparative studies suggest that protection results from catalase decomposing a fraction of the H2O2 as it enters the film, rather than by an in-film diffusion barrier. The outer catalase layers controlled the rate of H2O2 entry into inner regions of the film, and they biased the system to favor electrocatalytic peroxide reduction over enzyme damage. Catalase-protected {protein/HA}n films had an increased linear concentration range for H2O2 detection. This approach offers an effective way to protect biosensors from damage by H2O2.

Protection of ATP-Depleted Cells by Impermeant Strychnine Derivatives

PubMed Central

Dong, Zheng; Venkatachalam, Manjeri A.; Weinberg, Joel M.; Saikumar, Pothana; Patel, Yogendra

2001-01-01

Glycine and structurally related amino acids with activities at chloride channel receptors in the central nervous system also have robust protective effects against cell injury by ATP depletion. The glycine receptor antagonist strychnine shares this protective activity. An essential step toward identification of the molecular targets for these compounds is to determine whether they protect cells through interactions with intracellular targets or with molecules on the outer surface of plasma membranes. Here we report cytoprotection by a cell-impermeant derivative of strychnine. A strychnine-fluorescein conjugate (SF) was synthesized, and impermeability of plasma membranes to this compound was verified by fluorescence confocal microscopy. In an injury model of Madin-Darby canine kidney cells, ATP depletion led to lactate dehydrogenase release. SF prevented lactate dehydrogenase leakage without ameliorating ATP depletion. This was accompanied by preservation of cellular ultrastructure and exclusion of vital dyes. SF protection was also shown for ATP-depleted rat hepatocytes. On the other hand, when a key structural motif in the active site of strychnine was chemically blocked, the SF lost its protective effect, establishing strychnine-related specificity for SF protection. Cytoprotective effects of the cell-impermeant strychnine derivative provide compelling evidence suggesting that molecular targets on the outer surface of plasma membranes may mediate cytoprotection by strychnine and glycine. PMID:11238050

Protection of ATP-depleted cells by impermeant strychnine derivatives: implications for glycine cytoprotection.

PubMed

Dong, Z; Venkatachalam, M A; Weinberg, J M; Saikumar, P; Patel, Y

2001-03-01

Glycine and structurally related amino acids with activities at chloride channel receptors in the central nervous system also have robust protective effects against cell injury by ATP depletion. The glycine receptor antagonist strychnine shares this protective activity. An essential step toward identification of the molecular targets for these compounds is to determine whether they protect cells through interactions with intracellular targets or with molecules on the outer surface of plasma membranes. Here we report cytoprotection by a cell-impermeant derivative of strychnine. A strychnine-fluorescein conjugate (SF) was synthesized, and impermeability of plasma membranes to this compound was verified by fluorescence confocal microscopy. In an injury model of Madin-Darby canine kidney cells, ATP depletion led to lactate dehydrogenase release. SF prevented lactate dehydrogenase leakage without ameliorating ATP depletion. This was accompanied by preservation of cellular ultrastructure and exclusion of vital dyes. SF protection was also shown for ATP-depleted rat hepatocytes. On the other hand, when a key structural motif in the active site of strychnine was chemically blocked, the SF lost its protective effect, establishing strychnine-related specificity for SF protection. Cytoprotective effects of the cell-impermeant strychnine derivative provide compelling evidence suggesting that molecular targets on the outer surface of plasma membranes may mediate cytoprotection by strychnine and glycine.

Involvement of endogenous antioxidant systems in the protective activity of pituitary adenylate cyclase-activating polypeptide against hydrogen peroxide-induced oxidative damages in cultured rat astrocytes.

PubMed

Douiri, Salma; Bahdoudi, Seyma; Hamdi, Yosra; Cubì, Roger; Basille, Magali; Fournier, Alain; Vaudry, Hubert; Tonon, Marie-Christine; Amri, Mohamed; Vaudry, David; Masmoudi-Kouki, Olfa

2016-06-01

Astroglial cells possess an array of cellular defense mechanisms, including superoxide dismutase (SOD) and catalase antioxidant enzymes, to prevent damages caused by oxidative stress. Nevertheless, astroglial cell viability and functionality can be affected by significant oxidative stress. We have previously shown that pituitary adenylate cyclase-activating polypeptide (PACAP) is a potent glioprotective agent that prevents hydrogen peroxide (H2 O2 )-induced apoptosis in cultured astrocytes. The purpose of this study was to investigate the potential protective effect of PACAP against oxidative-generated alteration of astrocytic antioxidant systems. Incubation of cells with subnanomolar concentrations of PACAP inhibited H2 O2 -evoked reactive oxygen species accumulation, mitochondrial respiratory burst, and caspase-3 mRNA level increase. PACAP also stimulated SOD and catalase activities in a concentration-dependent manner, and counteracted the inhibitory effect of H2 O2 on the activity of these two antioxidant enzymes. The protective action of PACAP against H2 O2 -evoked inhibition of antioxidant systems in astrocytes was protein kinase A, PKC, and MAP-kinase dependent. In the presence of H2 O2 , the SOD blocker NaCN and the catalase inhibitor 3-aminotriazole, both suppressed the protective effects of PACAP on SOD and catalase activities, mitochondrial function, and cell survival. Taken together, these results indicate that the anti-apoptotic effect of PACAP on astroglial cells can account for the activation of endogenous antioxidant enzymes and reduction in respiration rate, thus preserving mitochondrial integrity and preventing caspase-3 expression provoked by oxidative stress. Considering its powerful anti-apoptotic and anti-oxidative properties, the PACAPergic signaling system should thus be considered for the development of new therapeutical approaches to cure various pathologies involving oxidative neurodegeneration. We propose the following cascade for the glioprotective action of Pituitary adenylate cyclase-activating polypeptide (PACAP) against H2 O2 -induced astrocyte damages and cell apoptosis in cultured rat astrocytes. PACAP, through activation of its receptor, PAC1-R, and the protein kinase A (PKA), protein kinase C (PKC), and MAP-kinases signaling pathways, prevents accumulation of ROS and inhibition of SOD and catalase activities. This allows the preservation of mitochondrial membrane integrity and the reduction in caspase-3 activation induced by H2 O2 . These data may lead to the development of new strategies for cerebral injury treatment. Cat, catalase; Cyt. C, cytochrome C; SOD, superoxide dismutase. © 2016 International Society for Neurochemistry.

Protective effects of buckwheat honey on DNA damage induced by hydroxyl radicals.

PubMed

Zhou, Juan; Li, Peng; Cheng, Ni; Gao, Hui; Wang, Bini; Wei, Yahui; Cao, Wei

2012-08-01

To understand the antioxidant properties of buckwheat honeys, we investigated their antioxidant effects on hydroxyl radical-induced DNA breaks in the non-site-specific and site-specific systems, the physicochemical properties, antioxidant activities (1,1-diphenyl-2-picrylhydrazyl (DPPH), hydroxyl radical scavenging activity, chelating, and reducing power assays), total phenolic content and individual phenolic acids were also determined. Total phenolic content of buckwheat honeys ranged from 774 to 1694 mg PA/kg, and p-hydroxybenzoic and p-coumaric acids proved to be the main components in buckwheat honeys. All the buckwheat honey samples possess stronger capability to protect DNA in the non-site-specific systems than in the site-specific systems from being damaged by hydroxyl radicals. In the non-site-specific and site-specific system, buckwheat honeys samples prevented ()OH-induced DNA breaks by 21-78% and 5-31% over control value, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

INcreasing Security and Protection through Infrastructure REsilience: The INSPIRE Project

NASA Astrophysics Data System (ADS)

D'Antonio, Salvatore; Romano, Luigi; Khelil, Abdelmajid; Suri, Neeraj

The INSPIRE project aims at enhancing the European potential in the field of security by ensuring the protection of critical information infrastructures through (a) the identification of their vulnerabilities and (b) the development of innovative techniques for securing networked process control systems. To increase the resilience of such systems INSPIRE will develop traffic engineering algorithms, diagnostic processes and self-reconfigurable architectures along with recovery techniques. Hence, the core idea of the INSPIRE project is to protect critical information infrastructures by appropriately configuring, managing, and securing the communication network which interconnects the distributed control systems. A working prototype will be implemented as a final demonstrator of selected scenarios. Controls/Communication Experts will support project partners in the validation and demonstration activities. INSPIRE will also contribute to standardization process in order to foster multi-operator interoperability and coordinated strategies for securing lifeline systems.

Prevention of SHIV transmission by topical IFN-β treatment.

PubMed

Veazey, R S; Pilch-Cooper, H A; Hope, T J; Alter, G; Carias, A M; Sips, M; Wang, X; Rodriguez, B; Sieg, S F; Reich, A; Wilkinson, P; Cameron, M J; Lederman, M M

2016-11-01

Understanding vaginal and rectal HIV transmission and protective cellular and molecular mechanisms is critical for designing new prevention strategies, including those required for an effective vaccine. The determinants of protection against HIV infection are, however, poorly understood. Increasing evidence suggest that innate immune defenses may help protect mucosal surfaces from HIV transmission in highly exposed, uninfected subjects. More recent studies suggest that systemically administered type 1 interferon protects against simian immunodeficiency virus infection of macaques. Here we hypothesized that topically applied type 1 interferons might stimulate vaginal innate responses that could protect against HIV transmission. We therefore applied a recombinant human type 1 interferon (IFN-β) to the vagina of rhesus macaques and vaginally challenged them with pathogenic simian/human immunodeficiency virus (SHIV). Vaginal administration of IFN-β resulted in marked local changes in immune cell phenotype, increasing immune activation and HIV co-receptor expression, yet provided significant protection from SHIV acquisition as interferon response genes were also upregulated. These data suggest that protection from vaginal HIV acquisition may be achieved by activating innate mucosal defenses.

Plant-derived phenolic compounds prevent the DNA single-strand breakage and cytotoxicity induced by tert-butylhydroperoxide via an iron-chelating mechanism.

PubMed Central

Sestili, Piero; Diamantini, Giuseppe; Bedini, Annalida; Cerioni, Liana; Tommasini, Ilaria; Tarzia, Giorgio; Cantoni, Orazio

2002-01-01

The protective effects of selected members from a series of caffeic acid esters and flavonoids were tested in various toxicity paradigms using U937 cells, previously shown to be sensitive to either iron chelators or bona fide radical scavengers or to both classes of compounds. It was found that all the protective polyphenols were active at very low concentrations and that their effects were observed only under those conditions in which iron chelators also afforded protection. Consistently, active polyphenolic compounds, unlike the inactive ones, effectively chelated iron in an in vitro system. It follows that, at least under the experimental conditions utilized in the present study, the most prominent activity of these polyphenolic compounds resides in their ability to chelate iron. Further studies revealed that the protective effects afforded by the caffeic acid esters and flavonoids were largely mediated by the catechol moiety and that the relative biological potency of these compounds was a direct function of their lipophilicity. PMID:11988084

Effects of a caffeine-free Cola nitida nuts extract on elastase/alpha-1-proteinase inhibitor balance.

PubMed

Daels-Rakotoarison, Dominique A; Kouakou, Gisèle; Gressier, Bernard; Dine, Thierry; Brunet, Claude; Luyckx, Michel; Bailleul, François; Trotin, Francis

2003-11-01

In an infection, polymorphonuclear neutrophils (PMN) become activated and they produce oxidizing compounds and elastase in the extracellular medium. Alpha-1-proteinase inhibitor (alpha1PI), a protease inhibitor which is inactivated by oxidants, is the main endogenous inhibitor of elastase helping to limit excessive elastase activity. This study evaluates the ability of a plant extract, Cola nitida nuts, to protect alpha1PI from inactivation by oxidizing compounds as reactive oxygen species. On the one hand, we have evaluated the direct effect of cola nut extract on neutrophil elastase, and on the H(2)O(2) and myeloperoxidase (MPO)-H(2)O(2) system via cell-free systems. Results showed that cola nut extract scavenges H(2)O(2) and therefore protects alpha1PI from HOCl which is produced from the MPO-H(2)O(2) system. Experiments also showed that cola extract has the capacity to limit elastase activity. On the other hand, we have worked on cellular systems including isolated PMN with the aim to study the effect of cola extract on PMN metabolism. PMN were stimulated with PMA, calcium ionophore or fMLP. Each stimulant possesses its own stimulation pathway. According to the inhibitory concentration obtained at 50%, the results on cellular systems led to the conclusion that cola extract can reduce elastase liberation from PMN. It can then be concluded that cola nut extract can protect alpha1PI from inactivation, and has an effect both on elastase liberation and elastase activity. The cola nut extract effect is rather biased towards a reduction in elastase release, thus limiting the injurious effects caused by this enzyme.

Protection of methamphetamine nigrostriatal toxicity by dietary selenium.

PubMed

Kim, H C; Jhoo, W K; Choi, D Y; Im, D H; Shin, E J; Suh, J H; Floyd, R A; Bing, G

1999-12-18

Multiple dose administration of methamphetamine (MA) results in long-lasting toxic effects in the nigrostriatal dopaminergic system. These effects are considered to be primarily due to oxidative damage mediated by increased production of hydrogen peroxide or other reactive oxygen species in the dopaminergic system. The present study was designed to determine the protective effects of dietary antioxidant selenium on MA-induced neurotoxicity in the nigrostriatal dopaminergic system. Male C57BL/6J mice were fed either selenium-deficient (< 0.01 ppm Se) or selenium-replete (0.2 ppm Se) diets for 90 days. MA treatment decreased the dopamine (DA) levels in the striatum and substantia nigra (SN) of both Se-replete and Se-deficient animals. However, in Se-replete animals, this DA depletion was significantly attenuated in both the striatum and SN. A novel observation is that MA administration resulted in increased activity of Cu,Zn-SOD in the brains of both Se-deficient and Se-replete animals. However, MA administration to Se-deficient animals exhibited a higher Cu,Zn-SOD activity in the nigrostriatal system than the control animals. Elevated malondialdehyde (MDA) levels in the striatum and SN were also observed in Se-deficient MA-treated animals. Se repletion significantly increased the glutathione peroxidase (GPx) activity and the ratio of reduced glutathione (GSH)/oxidized glutathione (GSSG) in the MA-treated animals. In conclusion, we have shown that dietary Se attenuated methamphetamine neurotoxicity and that this protection involves GPx-mediated antioxidant mechanisms. Even though Cu,Zn-SOD activity was significantly elevated by MA treatment, the role of this enzyme in MA-mediated neurotoxicity is not yet clear.

[Effect of population density on enzymatic activity of antioxidative and phenol oxidase systems of imagoes and nymphs of the marble cockroach Nauphoeta cinerea].

PubMed

Murzagulov, G S; Saltykova, E S; Gaĭfullina, L R; Nikolenko, A G

2013-01-01

The work deals with effect of density of population on functional activity of components pf protective system of adult individuals and nymphs of the marble cockroach. The resistance of individuals has been noted to decrease both at individual maintenance and under conditions of overpopulation. Changes in activities of enzymes of antioxidative and phenoloxidase systems are studied ion the insect hemolymph and intestine. Possible consequences of isolation and overpopulation are discussed both for stability and for individual development.

Mitochondria in the middle: exercise preconditioning protection of striated muscle

PubMed Central

Rodriguez, Dinah A.; Hord, Jeffrey M.

2016-01-01

Abstract Cellular and physiological adaptations to an atmosphere which became enriched in molecular oxygen spurred the development of a layered system of stress protection, including antioxidant and stress response proteins. At physiological levels reactive oxygen and nitrogen species regulate cell signalling as well as intracellular and intercellular communication. Exercise and physical activity confer a variety of stressors on skeletal muscle and the cardiovascular system: mechanical, metabolic, oxidative. Transient increases of stressors during acute bouts of exercise or exercise training stimulate enhancement of cellular stress protection against future insults of oxidative, metabolic and mechanical stressors that could induce injury or disease. This phenomenon has been termed both hormesis and exercise preconditioning (EPC). EPC stimulates transcription factors such as Nrf‐1 and heat shock factor‐1 and up‐regulates gene expression of a cadre of cytosolic (e.g. glutathione peroxidase and heat shock proteins) and mitochondrial adaptive or stress proteins (e.g. manganese superoxide dismutase, mitochondrial KATP channels and peroxisome proliferator activated receptor γ coactivator‐1 (PGC‐1)). Stress response and antioxidant enzyme inducibility with exercise lead to protection against striated muscle damage, oxidative stress and injury. EPC may indeed provide significant clinical protection against ischaemia–reperfusion injury, Type II diabetes and ageing. New molecular mechanisms of protection, such as δ‐opioid receptor regulation and mitophagy, reinforce the notion that mitochondrial adaptations (e.g. heat shock proteins, antioxidant enzymes and sirtuin‐1/PGC‐1 signalling) are central to the protective effects of exercise preconditioning. PMID:27060608

Sulforaphane prevents microcystin-LR-induced oxidative damage and apoptosis in BALB/c mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun Xiaoyun; Mi Lixin; Liu Jin

2011-08-15

Microcystins (MCs), the products of blooming algae Microcystis, are waterborne environmental toxins that have been implicated in the development of liver cancer, necrosis, and even fatal intrahepatic bleeding. Alternative protective approaches in addition to complete removal of MCs in drinking water are urgently needed. In our previous work, we found that sulforaphane (SFN) protects against microcystin-LR (MC-LR)-induced cytotoxicity by activating the NF-E2-related factor 2 (Nrf2)-mediated defensive response in human hepatoma (HepG2) and NIH 3T3 cells. The purpose of this study was to investigate and confirm efficacy the SFN-induced multi-mechanistic defense system against MC-induced hepatotoxicity in an animal model. We reportmore » that SFN protected against MC-LR-induced liver damage and animal death at a nontoxic and physiologically relevant dose in BALB/c mice. The protection by SFN included activities of anti-cytochrome P450 induction, anti-oxidation, anti-inflammation, and anti-apoptosis. Our results suggest that SFN may protect mice against MC-induced hepatotoxicity. This raises the possibility of a similar protective effect in human populations, particularly in developing countries where freshwaters are polluted by blooming algae. - Graphical abstract: Display Omitted Research Highlights: > SFN protected against MC-LR-induced liver damage and animal death in BALB/c mice. > The dose of SFN is at a nontoxic and physiologically relevant dose. > The protection included activities of anti-oxidation, anti-inflammation, and anti-apoptosis. > SFN may protect mice against MC-induced hepatotoxicity.« less

An Intrusion Detection System for the Protection of Railway Assets Using Fiber Bragg Grating Sensors

PubMed Central

Catalano, Angelo; Bruno, Francesco Antonio; Pisco, Marco; Cutolo, Antonello; Cusano, Andrea

2014-01-01

We demonstrate the ability of Fiber Bragg Gratings (FBGs) sensors to protect large areas from unauthorized activities in railway scenarios such as stations or tunnels. We report on the technological strategy adopted to protect a specific depot, representative of a common scenario for security applications in the railway environment. One of the concerns in the protection of a railway area centers on the presence of rail-tracks, which cannot be obstructed with physical barriers. We propose an integrated optical fiber system composed of FBG strain sensors that can detect human intrusion for protection of the perimeter combined with FBG accelerometer sensors for protection of rail-track access. Several trials were carried out in indoor and outdoor environments. The results demonstrate that FBG strain sensors bonded under a ribbed rubber mat enable the detection of intruder break-in via the pressure induced on the mat, whereas the FBG accelerometers installed under the rails enable the detection of intruders walking close to the railroad tracks via the acoustic surface waves generated by footsteps. Based on a single enabling technology, this integrated system represents a valuable intrusion detection system for railway security and could be integrated with other sensing functionalities in the railway field using fiber optic technology. PMID:25268920

Lack of an Efficient Endoplasmic Reticulum-localized Recycling System Protects Peroxiredoxin IV from Hyperoxidation*

PubMed Central

Cao, Zhenbo; Subramaniam, Suraj; Bulleid, Neil J.

2014-01-01

Typical 2-Cys peroxiredoxins are required to remove hydrogen peroxide from several different cellular compartments. Their activity can be regulated by hyperoxidation and consequent inactivation of the active-site peroxidatic cysteine. Here we developed a simple assay to quantify the hyperoxidation of peroxiredoxins. Hyperoxidation of peroxiredoxins can only occur efficiently in the presence of a recycling system, usually involving thioredoxin and thioredoxin reductase. We demonstrate that there is a marked difference in the sensitivity of the endoplasmic reticulum-localized peroxiredoxin to hyperoxidation compared with either the cytosolic or mitochondrial enzymes. Each enzyme is equally sensitive to hyperoxidation in the presence of a robust recycling system. Our results demonstrate that peroxiredoxin IV recycling in the endoplasmic reticulum is much less efficient than in the cytosol or mitochondria, leading to the protection of peroxiredoxin IV from hyperoxidation. PMID:24403061

Lightning Instrumentation at KSC

NASA Technical Reports Server (NTRS)

Colon, Jose L.; Eng, D.

2003-01-01

This report summarizes lightning phenomena with a brief explanation of lightning generation and lightning activity as related to KSC. An analysis of the instrumentation used at launching Pads 39 A&B for measurements of lightning effects is included with alternatives and recommendations to improve the protection system and upgrade the actual instrumentation system. An architecture for a new data collection system to replace the present one is also included. A novel architecture to obtain lightning current information from several sensors using only one high speed recording channel while monitoring all sensors to replace the actual manual lightning current recorders and a novel device for the protection system are described.

The Framework for Simulation of Bioinspired Security Mechanisms against Network Infrastructure Attacks

PubMed Central

Kotenko, Igor

2014-01-01

The paper outlines a bioinspired approach named “network nervous system" and methods of simulation of infrastructure attacks and protection mechanisms based on this approach. The protection mechanisms based on this approach consist of distributed prosedures of information collection and processing, which coordinate the activities of the main devices of a computer network, identify attacks, and determine nessesary countermeasures. Attacks and protection mechanisms are specified as structural models using a set-theoretic approach. An environment for simulation of protection mechanisms based on the biological metaphor is considered; the experiments demonstrating the effectiveness of the protection mechanisms are described. PMID:25254229

A NASA/University/Industry Consortium for Research on Aircraft Ice Protection

NASA Technical Reports Server (NTRS)

Zumwalt, Glen W.

1989-01-01

From 1982 through 1987, an unique consortium was functioning which involved government (NASA), academia (Wichita State Univ.) and twelve industries. The purpose was the development of a better ice protection systems for aircraft. The circumstances which brought about this activity are described, the formation and operation recounted, and the effectiveness of the ventue evaluated.

Fire Pumps: Time to Change NFPA 25 Weekly Churn Testing

ERIC Educational Resources Information Center

Saidi, John F.; Davis, Richard J.

2010-01-01

APPA, through its Code Advocacy Task Force (CATF), is active with code organizations such as the National Fire Protection Association (NFPA). This article reviews some of the recent work on NFPA 25, Standard for the Inspection, Testing, and Maintenance of Water-Based Fire Protection Systems, by the CATF and some members of the NFPA 25 Technical…

75 FR 36652 - Agency Information Collection Activities; Proposed Collection; Comment Request; Notification of...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-28

... restricted by statute. Do not submit information that you consider to be CBI or otherwise protected through... any are being taken to protect public health and welfare and the environment. ERNS fact sheets, which...'' system, which means EPA will not know your identity or contact information unless you provide it in the...

Systems approach to walk-off problems for dish-type solar thermal power systems

NASA Technical Reports Server (NTRS)

Jaffe, L. D.; Levin, R. R.; Moynihan, P. I.; Nesmith, B. J.; Owen, W. A.; Roschke, E. J.; Starkey, D. J.; Thostesen, T. O.

1983-01-01

'Walk-off' in a dish-type solar thermal power system is a failure situation in which the concentrator remains fixed while the spot of concentrated sunlight slowly moves across the face of the receiver. The intense local heating may damage the receiver and nearby equipment. Passive protection has advantages in minimizing damage, but in a fully passive design the receiver must be able to withstand full solar input with no forced fluid circulation during the walk-off. An active walk-off emergency subsystem may include an emergency detrack or defocus mechanism or sun-blocking device, emergency power, sensors and logic to detect the emergency and initiate protective action, and cooling or passive protection of emergency and non-emergency components. Each of these elements is discussed and evaluated in the paper.

Lightning Protection and Instrumentation at Kennedy Space Center

NASA Technical Reports Server (NTRS)

Colon, Jose L.

2005-01-01

Lightning is a natural phenomenon, but can be dangerous. Prevention of lightning is a physical impossibility and total protection requires compromises on costs and effects, therefore prediction and measurements of the effects that might be produced by iightn:ing is a most at locat:ions where people or sensitive systems and equipment are exposed. This is the case of the launching pads for the Space Shuttle at Kennedy Space Center (KSC) of the National Aeronautics and Space Administration. This report summarizes lightring phenomena with a brief explanation of lightning generation and lightning activity as related to KSC. An analysis of the instrumentation used at the launching pads for measurements of lightning effects with alternatives to improve the protection system and up-grade the actual instrumentation system is indicated.

Floods n' Dams: A Watershed Model.

ERIC Educational Resources Information Center

Milne, Andrew; Etches, John

1996-01-01

Describes an activity meant to illustrate flooding in a watershed as it impinges on human activities. Shows how flood protection can be provided using the natural holding capacity of basins elsewhere in the water system to reduce the impact on the settled flood plain. The activity works well with intermediate and senior level students but can be…

What's Under Your Feet? Activity Book. Earth Science for Everyone.

ERIC Educational Resources Information Center

Rubin, Penni; Robbins, Eleanora I.

This profusely illustrated activity book helps students understand systems and cycles, how years change the look of the Earth, and how students can protect resources. The sections (and activities) in this book are: (1) The Earth (Introduction--View, Soil & Dirt); (2) Forces (Plate Tectonics, Earthquakes, Mountain Building, Erosion, Volcanoes,…

77 FR 76097 - Agency Information Collection Activities: Renewal of Currently Approved Collection; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2012-12-26

... Recovery.gov . The FederalReporting.gov Recipient Registration System (FRRS) was developed to protect the... RECOVERY ACCOUNTABILITY AND TRANSPARENCY BOARD Agency Information Collection Activities: Renewal of Currently Approved Collection; Comment Request AGENCY: Recovery Accountability and Transparency...

Flexible Foam Protection Materials for Portable Life Support System Packaging Study

NASA Technical Reports Server (NTRS)

Tang,Henry H.; Dillon, Paul A.; Thomas, Gretchen A.

2009-01-01

This paper discusses the phase I effort in evaluating and selecting a light weight impact protection material for the Constellation Space Suit Element (CSSE) Portable Life Support System (PLSS) conceptual packaging study. A light weight material capable of holding and protecting the components inside the PLSS is required to demonstrate the viability of the flexible PLSS packaging concept. The material needs to distribute, dissipate, and absorb the impact energy of the PLSS falling on the lunar surface. It must also be robust to consistently perform over several Extravehicular Activity (EVA) missions in the extreme lunar thermal vacuum environment. This paper documents the performance requirements for selecting a foam protection material, and the methodologies for evaluating some commercial off-the-shelf (COTS) foam material candidates. It also presents the mechanical properties and impact drop tests results of the foam material candidates. The results of this study suggest that a foam based flexible protection system is a viable solution for PLSS packaging. However, additional works are needed to optimize COTS foam or to develop a composite foam system that will meet all the performance requirements for the CSSE PLSS flexible packaging.

40 CFR 35.3535 - Authorized set-aside activities.

Code of Federal Regulations, 2011 CFR

2011-07-01

... demonstrate how the purchase of land or easements will protect the source water of the system from... ASSISTANCE STATE AND LOCAL ASSISTANCE Drinking Water State Revolving Funds § 35.3535 Authorized set-aside... DWSRF program and to provide technical assistance to public water systems. (c) Small systems technical...

40 CFR 35.3535 - Authorized set-aside activities.

Code of Federal Regulations, 2010 CFR

2010-07-01

... demonstrate how the purchase of land or easements will protect the source water of the system from... ASSISTANCE STATE AND LOCAL ASSISTANCE Drinking Water State Revolving Funds § 35.3535 Authorized set-aside... DWSRF program and to provide technical assistance to public water systems. (c) Small systems technical...

76 FR 7189 - Agency Information Collection Activities; Submission to OMB for Review and Approval; Comment...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-09

... Refinery Wastewater Systems (Renewal) AGENCY: Environmental Protection Agency (EPA). ACTION: Notice... Wastewater Systems (Renewal) ICR Numbers: EPA ICR Number 1136.10, OMB Control Number 2060-0172. ICR Status... (NSPS) for Volatile Organic Compound (VOC) Emissions from Petroleum Refinery Wastewater Systems were...

Overview of ICRP Committee 5: protection of the environment.

PubMed

Larsson, C-M

2016-06-01

Protection of the environment is integral to the system of radiological protection, as outlined in the 2007 Recommendations of the International Commission on Radiological Protection (ICRP, Publication 103). The Commission's activities in this area are mainly pursued by Committee 5 and its associated Task Groups. Publication 91 broadly outlines the approach to radiological protection of the environment, and its alignment with approaches to environmental protection from hazardous substances in general. Publications 108 and 114 provide the cornerstones of the environmental protection system and relevant databases. Publication 124 considers its application in planned, existing, and emergency exposure situations. The system centres on 12 Reference Animals and Plants (RAPs) with broad relevance for environmental protection based on their ubiquity and significance as well as other criteria, as described in Publication 108 The databases comprise general biology of the RAPs, transfer parameters, dose conversion coefficients, and effects data. Derived Consideration Reference Levels (DCRLs) were established for each RAP; a DCRL represents a band of dose rates that might result in some deleterious effects in individuals of that type of RAP. Newly established Task Group 99 will compile the RAP-specific reference information into monographs, with the view of updating information and improving the applicability of the system in different exposure situations. For certain scenarios, more precise and ecosystem-specific protection benchmarks may be justified, which would have to be informed by consideration of representative organisms (i.e. representative of a particular ecosystem and relevant to the specific scenario; Publication 124). Committee 5 will explore this further, making use of a limited number of case studies. © The International Society for Prosthetics and Orthotics.

47 CFR 74.634 - Remote control operation.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES EXPERIMENTAL RADIO... control system must be designed, installed, and protected so that the transmitter can only be activated or... ensure proper operation. (3) The remote control system must be designed to prevent inadvertent...

47 CFR 74.634 - Remote control operation.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES EXPERIMENTAL RADIO... control system must be designed, installed, and protected so that the transmitter can only be activated or... ensure proper operation. (3) The remote control system must be designed to prevent inadvertent...

47 CFR 74.634 - Remote control operation.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES EXPERIMENTAL RADIO... control system must be designed, installed, and protected so that the transmitter can only be activated or... ensure proper operation. (3) The remote control system must be designed to prevent inadvertent...

47 CFR 74.634 - Remote control operation.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES EXPERIMENTAL RADIO... control system must be designed, installed, and protected so that the transmitter can only be activated or... ensure proper operation. (3) The remote control system must be designed to prevent inadvertent...

47 CFR 74.634 - Remote control operation.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES EXPERIMENTAL RADIO... control system must be designed, installed, and protected so that the transmitter can only be activated or... ensure proper operation. (3) The remote control system must be designed to prevent inadvertent...

Report: Improvements Needed in EPA’s Network Traffic Management Practices

EPA Pesticide Factsheets

Report #11-P-0159, March 14, 2011. OEI does not have consistent, repeatable intrusion detection system monitoring practices in place, which inhibits EPA’s ability to monitor unusual network activity and thus protect Agency systems and associated data.

Mars transit vehicle thermal protection system: Issues, options, and trades

NASA Technical Reports Server (NTRS)

Brown, Norman

1986-01-01

A Mars mission is characterized by different mission phases. The thermal control of cryogenic propellant in a propulsive vehicle must withstand the different mission environments. Long term cryogenic storage may be achieved by passive or active systems. Passive cryo boiloff management features will include multilayer insulation, vapor cooled shield, and low conductance structural supports and penetrations. Active boiloff management incorporates the use of a refrigeration system. Key system trade areas include active verses passive system boiloff management (with respect to safety, reliability, and cost) and propellant tank insulation optimizations. Technology requirements include refrigeration technology advancements, insulation performance during long exposure, and cryogenic fluid transfer system for mission vehicle propellant tanking during vehicle buildip in LEO.

Tuberculosis and systemic lupus erythematosus: a case-control study in Mexico City.

PubMed

Torres-González, Pedro; Romero-Díaz, Juanita; Cervera-Hernández, Miguel Enrique; Ocampo-Torres, Mario; Chaires-Garza, Luis Gerardo; Lastiri-González, Ernesto Alejandro; Atisha-Fregoso, Yemil; Bobadilla-Del-Valle, Miriam; Ponce-de-León, Alfredo; Sifuentes-Osornio, José

2018-04-20

To determine, among systemic lupus erythematosus patients, factors associated with active tuberculosis. We performed a case-control study, in a tertiary-care center in Mexico City. We defined cases as systemic lupus erythematosus patients with active tuberculosis and matched them 1:1 with systemic lupus erythematosus patients without tuberculosis (controls) by age, date of systemic lupus erythematosus diagnosis, and disease duration. We analyzed clinical variables, lupus disease activity (SLEDAI-2K), and accumulated damage (SLICC/ARC-DI). We performed a nonconditional logistic regression to determine factors associated with tuberculosis. We identified 72 tuberculosis cases among systemic lupus erythematosus patients, 58% were culture confirmed. Thirty-three percent (24/72) were pulmonary only, 47.2% (34/72) extrapulmonary only, and 19.4% both. After adjustment for age, gender, and socioeconomic status, SLEDAI-2K and SLICC/ARC-DI, a 1-year cumulative dose of prednisone ≥ 3 g (odds ratios (OR), 18.85; 95% confidence interval (95% CI), 6.91-51.45) was associated with tuberculosis, and the antimalarial treatment was protective (OR, 0.13; 95% CI, 0.04-0.36). Among systemic lupus erythematosus patients, cumulative dose of prednisone is associated with tuberculosis. Further research is required to elucidate the protective effect of antimalarial drugs for tuberculosis. Preventive strategies must be implemented in patients at risk.

Polymer Composite Wrapping and Cathodic Protection System for Reinforced Concrete Piles in Marine Applications

DTIC Science & Technology

2013-06-01

vicinity of new patches. Fiber -reinforced polymer (FRP) composite wrapping systems have been evolving over the last 20 years and are now a viable...material is a woven glass fiber pre-impregnated with moisture-activated resins that cure underwater after being put in place. Figure 4. ICPW...wrap system The FRP composite wrap material that was selected is Aqua Wrap Type G- 05, a woven glass fiber pre-impregnated with moisture-activated

Revitalizing the Space Shuttle's Thermal Protection System with Reverse Engineering and 3D Vision Technology

NASA Technical Reports Server (NTRS)

Wilson, Brad; Galatzer, Yishai

2008-01-01

The Space Shuttle is protected by a Thermal Protection System (TPS) made of tens of thousands of individually shaped heat protection tile. With every flight, tiles are damaged on take-off and return to earth. After each mission, the heat tiles must be fixed or replaced depending on the level of damage. As part of the return to flight mission, the TPS requirements are more stringent, leading to a significant increase in heat tile replacements. The replacement operation requires scanning tile cavities, and in some cases the actual tiles. The 3D scan data is used to reverse engineer each tile into a precise CAD model, which in turn, is exported to a CAM system for the manufacture of the heat protection tile. Scanning is performed while other activities are going on in the shuttle processing facility. Many technicians work simultaneously on the space shuttle structure, which results in structural movements and vibrations. This paper will cover a portable, ultra-fast data acquisition approach used to scan surfaces in this unstable environment.

Space debris protection: A standard procedure in future?

NASA Astrophysics Data System (ADS)

Yasaka, Tetsuo

2003-08-01

The near earth orbital environment is getting hazardous due to increasing space debris accumulated as a result of human space activities. Man tended facility is being designed so that the main structure may be protected from a collision with a limited size debris. Other space systems are generally found inadequate to possess protection shields because of functional requirement of space-viewing faces and cost burden in terms of added mass. In the future, where the debris hazard is expected to become severer, the situation is not expected to change and most space systems will be left unprotected. The present situation and future projection of the orbital debris environment will be first reviewed. The possible hazard to space systems will be described in terms of colliding debris size at various orbits. Some of the measures to secure safety of the system will be then proposed for future application.

Public-private provision of protection measures against natural hazards

NASA Astrophysics Data System (ADS)

Gruber, M.

2009-04-01

Natural hazards threaten human lives as well as economic values of a society. Due to an increasing population density, augmenting property holdings in congested areas as well as higher frequencies of catastrophic events, the damage potential associated with natural hazards is growing. In order to safeguard societal assets against this threat, active and passive protection measures can be established. While passive protection measures provide for this type of risk by means of thorough land use planning, active protection measures aim at improving safety through technical or biological protective systems and structures. However, these provisions are costly and need to be handled prudentially. In most European countries protection measures against natural hazards are provided by the public. Specific governmental funds have been set up for the establishment of preventive systems as well as for damage compensation payments after the occurrence of catastrophic events. Though, additional capital is urgently needed in order to facilitate the realisation of all necessary projects in this field and to provide for maximal safety. One potential solution for such financial deficiencies can be found in Public Private Partnerships (PPP). PPPs have been implemented as attractive concepts for the funding of diverse projects in the fields of e.g. road construction, municipal, health and social services. In principle, they could also provide alternative funding solutions for the establishment of crucial protective infrastructure in respect of natural hazards, adding private financial means to the currently available public funds. Thereby, the entire capacities for catastrophe funding could be enhanced. Beside PPPs, also alternative funding mechanisms such as the emission of catastrophe bonds, contingent credit lines or leasing arrangements may enhance available capacities for the financing of protection measures. This contribution discusses innovative solutions for the funding of protection measures against natural hazards along with potential positive and negative implications. In particular, the suitability of various forms of Public Private Partnerships will be considered, as several issues need to be declared in order to render such partnerships successful and to avoid undesirable drawbacks. Finally, the author intends to suggest appropriate alternatives to the current system of (almost) exclusive public funding of protection measures against natural hazards.

Hazardous waste management system--Environmental Protection Agency. Notice of regulatory reform actions; request for comments.

PubMed

1982-12-13

In response to Executive Order 12291 and the President's Task Force on Regulatory Relief, the Environmental Protection Agency is reviewing and reassessing the hazardous waste regulations developed under the Resource Conservation and Recovery Act (RCRA). A variety of activities are underway that will simplify procedures and reduce paperwork, modify existing regulations to make them more workable and cost effective, and control new wastes and new processes. The purpose of this notice is to inform the public of these activities and invite comments on the general approaches being taken.

Erythropoietin Employs Cell Longevity Pathways of SIRT1 to Foster Endothelial Vascular Integrity During Oxidant Stress

PubMed Central

Hou, Jinling; Wang, Shaohui; Shang, Yan Chen; Chong, Zhao Zhong; Maiese, Kenneth

2011-01-01

Given the cytoprotective ability of erythropoietin (EPO) in cerebral microvascular endothelial cells (ECs) and the invaluable role of ECs in the central nervous system, it is imperative to elucidate the cellular pathways for EPO to protect ECs against brain injury. Here we illustrate that EPO relies upon the modulation of SIRT1 (silent mating type information regulator 2 homolog 1) in cerebral microvascular ECs to foster cytoprotection during oxygen-glucose deprivation (OGD). SIRT1 activation which results in the inhibition of apoptotic early membrane phosphatidylserine (PS) externalization and subsequent DNA degradation during OGD becomes a necessary component for EPO protection in ECs, since inhibition of SIRT1 activity or diminishing its expression by gene silencing abrogates cell survival supported by EPO during OGD. Furthermore, EPO promotes the subcellular trafficking of SIRT1 to the nucleus which is necessary for EPO to foster vascular protection. EPO through SIRT1 averts apoptosis through activation of protein kinase B (Akt1) and the phosphorylation and cytoplasmic retention of the forkhead transcription factor FoxO3a. SIRT1 through EPO activation also utilizes mitochondrial pathways to prevent mitochondrial depolarization, cytochrome c release, and Bad, caspase 1, and caspase 3 activation. Our work identifies novel pathways for EPO in the vascular system that can govern the activity of SIRT1 to prevent apoptotic injury through Akt1, FoxO3a phosphorylation and trafficking, mitochondrial membrane permeability, Bad activation, and caspase 1 and 3 activities in ECs during oxidant stress. PMID:21722091

[METHODICAL APPROACHES, EXPERIENCE AND PERSPECTIVES OF THE IMPLEMENTATION OF THE RISK MODEL OF SURVEILLANCE ACTIVITIES IN THE SPHERE OF THE ASSURANCE OF SANITARY AND EPIDEMIOLOGICAL WELFARE OF POPULATION, POPULATION'S HEALTH RISK MANAGEMENT AND THE CONSUMER RIGHTS PROTECTION].

PubMed

Gurvich, V B; Kuz'min, S V; Dikonskaia, O V; Gileva, M A; Boiarskiĭ, A P

2015-01-01

Control and supervision measures--one of the main technologies of Federal Service for Supervision of Consumer Rights protection and Human Welfare in the overall system of risk management for public health and damage to property consumers, aimed at the solution of the prior tasks in the field of assurance of the sanitary and epidemiological welfare of the population and consumer rights protection. The effectiveness of this technology depends on the correct choice of priority objects of supervision, which form the main problems in the sanitary and epidemiological situation and in the consumer market. The application of is approach has led to more effective oversight activity and the improvement of a number of indices characterizing the achievement of the objectives in the common system of risk management for public health and property of consumers.

Numerical simulation of quench protection for a 1.5 T persistent mode MgB2 conduction-cooled MRI magnet

NASA Astrophysics Data System (ADS)

Deissler, Robert J.; Baig, Tanvir; Poole, Charles; Amin, Abdullah; Doll, David; Tomsic, Michael; Martens, Michael

2017-02-01

The active quench protection of a 1.5 T MgB2 conduction-cooled MRI magnet operating in persistent current mode is considered. An active quench protection system relies on the detection of the resistive voltage developed in the magnet, which is used to trigger the external energizing of quench heaters located on the surfaces of all ten coil bundles. A numerical integration of the heat equation is used to determine the development of the temperature profile and the maximum temperature in the coil at the origin, or ‘hot spot’, of the quench. Both n-value of the superconductor and magnetoresistance of the wire are included in the simulations. An MgB2 wire manufactured by Hyper Tech Research, Inc. was used as the basis to model the wire for the simulations. With the proposed active quench protection system, the maximum temperature was limited to 200 K or less, which is considered low enough to prevent damage to the magnet. By substituting Glidcop for the Monel in the wire sheath or by increasing the thermal conductivity of the insulation, the margin for safe operation was further increased, the maximum temperature decreasing by more than 40 K. The strain on the MgB2 filaments is calculated using ANSYS, verifying that the stress and strain limits in the MgB2 superconductor and epoxy insulation are not exceeded.

42 CFR 84.89 - Weight requirement.

Code of Federal Regulations, 2014 CFR

2014-10-01

... RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Self-Contained Breathing... which contributes materially to the wearer's comfort, e.g., a cooling system, the completely assembled...

77 FR 46527 - Agency Information Collection Activities; Proposed Collection

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-03

... MERIT SYSTEMS PROTECTION BOARD Agency Information Collection Activities; Proposed Collection... extension of an Information Collection Request (ICR) to the Office of Management and Budget (OMB) for review and approval. This ICR describes the nature of the information collection and its estimated burden and...

Antimicrobial resistance surveillance in the AFHSC-GEIS network

PubMed Central

2011-01-01

International infectious disease surveillance has been conducted by the United States (U.S.) Department of Defense (DoD) for many years and has been consolidated within the Armed Forces Health Surveillance Center, Division of Global Emerging Infections Surveillance and Response System (AFHSC-GEIS) since 1998. This includes activities that monitor the presence of antimicrobial resistance among pathogens. AFHSC-GEIS partners work within DoD military treatment facilities and collaborate with host-nation civilian and military clinics, hospitals and university systems. The goals of these activities are to foster military force health protection and medical diplomacy. Surveillance activities include both community-acquired and health care-associated infections and have promoted the development of surveillance networks, centers of excellence and referral laboratories. Information technology applications have been utilized increasingly to aid in DoD-wide global surveillance for diseases significant to force health protection and global public health. This section documents the accomplishments and activities of the network through AFHSC-GEIS partners in 2009. PMID:21388568

Antimicrobial resistance surveillance in the AFHSC-GEIS network.

PubMed

Meyer, William G; Pavlin, Julie A; Hospenthal, Duane; Murray, Clinton K; Jerke, Kurt; Hawksworth, Anthony; Metzgar, David; Myers, Todd; Walsh, Douglas; Wu, Max; Ergas, Rosa; Chukwuma, Uzo; Tobias, Steven; Klena, John; Nakhla, Isabelle; Talaat, Maha; Maves, Ryan; Ellis, Michael; Wortmann, Glenn; Blazes, David L; Lindler, Luther

2011-03-04

International infectious disease surveillance has been conducted by the United States (U.S.) Department of Defense (DoD) for many years and has been consolidated within the Armed Forces Health Surveillance Center, Division of Global Emerging Infections Surveillance and Response System (AFHSC-GEIS) since 1998. This includes activities that monitor the presence of antimicrobial resistance among pathogens. AFHSC-GEIS partners work within DoD military treatment facilities and collaborate with host-nation civilian and military clinics, hospitals and university systems. The goals of these activities are to foster military force health protection and medical diplomacy. Surveillance activities include both community-acquired and health care-associated infections and have promoted the development of surveillance networks, centers of excellence and referral laboratories. Information technology applications have been utilized increasingly to aid in DoD-wide global surveillance for diseases significant to force health protection and global public health. This section documents the accomplishments and activities of the network through AFHSC-GEIS partners in 2009.

Install active/passive neutron examination and assay (APNEA)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1996-04-01

This document describes activities pertinent to the installation of the prototype Active/Passive Neutron Examination and Assay (APNEA) system built in Area 336 into its specially designed trailer. It also documents the basic theory of operation, design and protective features, basic personnel training, and the proposed characterization site location at Lockheed Martin Specialty Components, Inc., (Specialty Components) with the estimated 10 mrem/year boundary. Additionally, the document includes the Preventive Change Analysis (PCA) form, and a checklist of items for verification prior to unrestricted system use.

Integrated Passive Biological Treatment System/ Mine Waste Technology Program Report #16

EPA Science Inventory

This report summarizes the results of the Mine Waste Technology Program (MWTP) Activity III, Project 16, Integrated, Passive Biological Treatment System, funded by the United States Environmental Protection Agency (EPA) and jointly administered by EPA and the United States Depar...

Cyanidin-3-O-Glucoside Modulates the In Vitro Inflammatory Crosstalk between Intestinal Epithelial and Endothelial Cells.

PubMed

Ferrari, Daniela; Cimino, Francesco; Fratantonio, Deborah; Molonia, Maria Sofia; Bashllari, Romina; Busà, Rossana; Saija, Antonella; Speciale, Antonio

2017-01-01

Intestinal epithelium represents a protective physical barrier and actively contributes to the mucosal immune system. Polarized basolateral intestinal secretion of inflammatory mediators, followed by activation of NF- κ B signaling and inflammatory pathways in endothelial cells, efficiently triggers extravasation of neutrophils from the vasculature, therefore contributing to the development and maintenance of intestinal inflammation. Proper regulation of NF- κ B activation at the epithelial interface is crucial for the maintenance of physiological tissue homeostasis. Many papers reported that anthocyanins, a group of compounds belonging to flavonoids, possess anti-inflammatory effects and modulate NF- κ B activity. In this study, by using a coculture in vitro system, we aimed to evaluate the effects of TNF- α -stimulated intestinal cells on endothelial cells activation, as well as the protective effects of cyanidin-3-glucoside (C3G). In this model, TNF- α induced nuclear translocation of NF- κ B and TNF- α and IL-8 gene expression in Caco-2 cells, whereas C3G pretreatment dose-dependently reduced these effects. Furthermore, TNF- α -stimulated Caco-2 cells induced endothelial cells activation with increased E-selectin and VCAM-1 mRNA, leukocyte adhesion, and NF- κ B levels in HUVECs, which were inhibited by C3G. We demonstrated that selective inhibition of the NF- κ B pathway in epithelial cells represents the main mechanism by which C3G exerts these protective effects. Thus, anthocyanins could contribute to the management of chronic gut inflammatory diseases.

Protective system for civil buildings and industrial structures subjected to the seismic risk

NASA Astrophysics Data System (ADS)

Ghica, D.; Grigore, A.; Ionescu, C.

2009-04-01

Romania is a European country with significant seismicity. The most active seismic zone is represented by the Vrancea area, located within the arch of the Carpathians Mountains. Vrancea seismicity is characterized by intermediate depth earthquakes which occur in a narrow epicentral and hypocentral region. During the last 70 years, Romania experienced four strong Vrancea earthquakes: 10 November 1940 (Mw =7.7, 160 km depth), 4 March 1977 (Mw =7.5, 100 km depth), 30 August 1986 (Mw =7.2, 140 km depth), 30 May 30 1990 (Mw =6.9, 80 km depth). The 1977 event was characterized by catastrophic consequences: 1500 casualties and collapsing of 35 high-risk buildings, mostly occurring in Bucharest. The purpose of this paper is to present a protective system designed to be installed in the civil buildings and industrial structures placed in the high seismic regions, and therefore to contribute to the mitigation of the strong earthquake effects on human society. This system proposes an efficient antiseismic protection, respectively shutting down the installations and equipments mounted in the building's infrastructure, which can become extremely dangerous in case of a major earthquake by appearing the possibility of explosions, deflagration, fires, toxic and polluting fluids leakage. The damages are strongly amplified by the fact that, simultaneously, water and electric energy lines distributions are damaged too, making impossible an efficient firemen intervention, for localizing the fire sources. Moreover, the installations of the individual heating stations which operate with open flame increase the risk of explosions inside the buildings during an earthquake. The protective system consists of a seismic switch used for activating through weak-electric-currents of the building's safety systems in case of strong earthquake, especially designed for building's elevators, as well as for moving parts of installations, which require positioning in safety place areas. The originality of this device is based of a network of minimum three seismic sensors (accelerometers), which, through a coincidence circuit, endorses the presence of a seismic shock, excluding the accidental triggers caused by local noises and mechanical shocks from neighboring area. When is activated, the system allows to automatically place in safe position the most dangerous installations located in buildings, such as elevators, heating systems using natural gas or high pressure liquid, water pipes, thermal stations, electrical power line etc. Presently, in Romania, such protective systems installed in the buildings and structures subjected to seismic risk are not available. The only possibility of protection against the potential disastrous effects of earthquakes (wounded, lost of human lives, important material losses, explosions, fires, damages of the water and electricity lines) is to adopt clear solutions for preventing and reducing as much as it is possible the dimensions of material damages and casualties.

The intracellular angiotensin system buffers deleterious effects of the extracellular paracrine system

PubMed Central

Villar-Cheda, Begoña; Costa-Besada, Maria A; Valenzuela, Rita; Perez-Costas, Emma; Melendez-Ferro, Miguel; Labandeira-Garcia, Jose L

2017-01-01

The ‘classical’ renin–angiotensin system (RAS) is a circulating system that controls blood pressure. Local/paracrine RAS, identified in a variety of tissues, including the brain, is involved in different functions and diseases, and RAS blockers are commonly used in clinical practice. A third type of RAS (intracellular/intracrine RAS) has been observed in some types of cells, including neurons. However, its role is still unknown. The present results indicate that in brain cells the intracellular RAS counteracts the intracellular superoxide/H2O2 and oxidative stress induced by the extracellular/paracrine angiotensin II acting on plasma membrane receptors. Activation of nuclear receptors by intracellular or internalized angiotensin triggers a number of mechanisms that protect the cell, such as an increase in the levels of protective angiotensin type 2 receptors, intracellular angiotensin, PGC-1α and IGF-1/SIRT1. Interestingly, this protective mechanism is altered in isolated nuclei from brains of aged animals. The present results indicate that at least in the brain, AT1 receptor blockers acting only on the extracellular or paracrine RAS may offer better protection of cells. PMID:28880266

NASA SSA for Robotic Missions

NASA Technical Reports Server (NTRS)

Newman, Lauri K.

2009-01-01

This viewgraph presentation reviews NASA's Space Situational Awareness (SSA) activities as preparation for robotic missions and Goddard's role in this work. The presentation includes the preparations that Goddard Space Flight Center (GSFC) has made to provide consolidated space systems protection indluding consolidating GSFC support for Orbit Debris analysis, conjunction assessment and collision avoidance, commercial and foreign support, and protection of GSFC managed missions.

76 FR 28771 - Agency Information Collection Activities; Submission to OMB for Review and Approval; Comment...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-18

... with the Paperwork Reduction Act (PRA) (44 U.S.C. 3501 et seq.), this document announces that an... method), by e-mail to a-and-r[email protected] , or by mail to: EPA Docket Center, Environmental Protection...-566-1742. Use EPA's electronic docket and comment system at http://www.regulations.gov , to submit or...

Nrf2 protects human bladder urothelial cells from arsenite and monomethylarsonous acid toxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Xiaojun; Sun Zheng; Chen Weimin

2007-12-01

Arsenic is widely spread in our living environment and imposes a big challenge on human health worldwide. Arsenic damages biological systems through multiple mechanisms including the generation of reactive oxygen species. The transcription factor Nrf2 regulates the cellular antioxidant response that protects cells from various insults. In this study, the protective role of Nrf2 in arsenic toxicity was investigated in a human bladder urothelial cell line, UROtsa. Using a UROtsa cell line stably infected with Nrf2-siRNA, we clearly demonstrate that compromised Nrf2 expression sensitized the cells to As(III)- and MMA(III)-induced toxicity. On the other hand, the activation of the Nrf2more » pathway by tert-butylhydroquinone (tBHQ) and sulforaphane (SF), the known Nrf2-inducers, rendered UROtsa cells more resistant to As(III) and MMA(III). Furthermore, the wild-type mouse embryo fibroblast (WT-MEF) cells were protected from As(III)- and MMA(III)-induced toxicity following Nrf2 activation by tBHQ or SF, whereas neither tBHQ nor SF conferred protection in the Nrf2{sup -/-}MEF cells, demonstrating that tBHQ- or SF-mediated protection against As(III)- and MMA(III)-induced toxicity depends on Nrf2 activation. These results, obtained by both loss of function and gain of function analyses, clearly demonstrate the protective role of Nrf2 in arsenic-induced toxicity. The current work lays the groundwork for using Nrf2 activators for therapeutic and dietary interventions against adverse effects of arsenic.« less

Evaluation of Thermal Protection Tile Transmissibility for Ground Vibration Test

NASA Technical Reports Server (NTRS)

Chung, Y. T.; Fowler, Samuel B.; Lo, Wenso; Towner, Robert

2005-01-01

Transmissibility analyses and tests were conducted on a composite panel with thermal protection system foams to evaluate the quality of the measured frequency response functions. Both the analysis and the test results indicate that the vehicle dynamic responses are fully transmitted to the accelerometers mounted on the thermal protection system in the normal direction below a certain frequency. In addition, the in-plane motions of the accelerometer mounted on the top surface of the thermal protection system behave more actively than those on the composite panel due to the geometric offset of the accelerometer from the panel in the test set-up. The transmissibility tests and analyses show that the frequency response functions measured from the accelerometers mounted on the TPS will provide accurate vehicle responses below 120 Hz for frequency and mode shape identification. By confirming that accurate dynamic responses below a given frequency can be obtained, this study increases the confidence needed for conducting the modal testing, model correlation, and model updating for a vehicle installed with TPS. '

Groundwater protection of minimal water supply systems integrating simple hydrogeological information

NASA Astrophysics Data System (ADS)

Rodrigo-Ilarri, Javier; Rodrigo-Clavero, María Elena

2016-04-01

According to the current EU environmental legislation, groundwater protection is one of the key issues to be addressed when new industrial activities have to be authorised. This work shows a simple methodology that could be used by local and environmental authorities in order to analyse the potential risk caused by an industrial spill on a natural environment. The methodology leads to the determination of the protection area around an extraction well system using the information given by: i) a set of local piezometers, ii) the chemical nature of the industrial spill and iii) the hydrogeological parameters of the local aquifer. The exact location of the contaminant source is not needed for the analysis. The flow equation is afterwards solved using a finite-difference approximation scheme under stationary conditions. Finally, the capture zones for different times are computed by a simple upstream advective transport model. Results on the determination of the perimeter protection area definition of a water supply system in the municipality of L'Alcora (Castellón) in Spain are shown.

εPKC confers acute tolerance to cerebral ischemic reperfusion injury

PubMed Central

Bright, Rachel; Sun, Guo-Hua; Yenari, Midori A.; Steinberg, Gary K.; Mochly-Rosen, Daria

2008-01-01

In response to mild ischemic stress, the brain elicits endogenous survival mechanisms to protect cells against a subsequent lethal ischemic stress, referred to as ischemic tolerance. The molecular signals that mediate this protection are thought to involve the expression and activation of multiple kinases, including protein kinase C (PKC). Here we demonstrate that εPKC mediates cerebral ischemic tolerance in vivo. Systemic delivery of ψεRACK, an εPKC-selective peptide activator, confers neuroprotection against a subsequent cerebral ischemic event when delivered immediately prior to stroke. In addition, activation of εPKC by ψεRACK treatment decreases vascular tone in vivo, as demonstrated by a reduction in microvascular cerebral blood flow. Here we demonstrate the role of acute and transient εPKC in early cerebral tolerance in vivo and suggest that extra-parenchymal mechanisms, such as vasoconstriction, may contribute to the conferred protection. PMID:18586397

Previous encapsulation response enhances within individual protection against fungal parasite in the mealworm beetle Tenebrio molitor.

PubMed

Krams, Indrikis; Daukste, Janina; Kivleniece, Inese; Krama, Tatjana; Rantala, Markus J

2013-12-01

Immune defenses of insects show either broad reactions or specificity and durability of induced protection against attacking parasites and pathogens. In this study, we tested whether encapsulation response against nylon monofilament increases between two attempts of activation of immune system in mealworm beetles Tenebrio molitor, and whether previous exposure to nylon monofilament may also increase protection against an entomopathogenic fungus. We found that survival of beetles subjected to immune activation by nylon implant and subsequent fungal exposure a week later was significantly higher than survival of beetles which had been subjected to fungal infection only. This result suggests that previous immune activation by the nylon implant may be considered as broad spectrum "immune priming" which helps to fight not only the same intruder but also other parasites. © 2012 Institute of Zoology, Chinese Academy of Sciences.

An Assessment of Alternate Thermal Protection Systems for the Space Shuttle Orbiter. Volume 1; Executive Summary

NASA Technical Reports Server (NTRS)

Hays, D.

1982-01-01

Alternate thermal protection system (TPS) concepts to the Space Shuttle Orbiter were assessed. Metallic, ablator, and carbon-carbon concepts which are the result of some previous design, manufacturing and testing effort were considered. Emphasis was placed on improved TPS durability, which could potentially reduce life cycle costs and improve Orbiter operational characteristics. Integrated concept/orbiter point designs were generated and analyzed on the basis of Shuttle design environments and criteria. A merit function evaluation methodology based on mission impact, life cycle costs, and risk was developed to compare the candidate concepts and to identify the best alternate. Voids and deficiencies in the technology were identified, along with recommended activities to overcome them. Finally, programmatic plans, including ROM costs and schedules, were developed for all activities required to bring the selected alternate system up to operational readiness.

Adolescents and Social Media: Privacy, Brain Development, and the Law.

PubMed

Costello, Caitlin R; McNiel, Dale E; Binder, Renée L

2016-09-01

Adolescents under the age of 18 are not recognized in the law as adults, nor do they have the fully developed capacity of adults. Yet teens regularly enter into contractual arrangements with operators of websites to send and post information about themselves. Their level of development limits their capacity to understand the implications of online communications, yet the risks are real to adolescents' privacy and reputations. This article explores an apparent contradiction in the law: that in areas other than online communications, U.S. legal systems seek to protect minors from the limitations of youth. The Children's Online Privacy Protection Act provides some protection to the privacy of young people, but applies only to children under age 13, leaving minors of ages 13 to 17 with little legal protection in their online activities. In this article, we discuss several strategies to mitigate the risks of adolescent online activity. © 2016 American Academy of Psychiatry and the Law.

Wireless Subsurface Sensors for Health Monitoring of Thermal Protection Systems on Hypersonic Vehicles

NASA Technical Reports Server (NTRS)

Milos, Frank S.; Arnold, Jim (Technical Monitor)

2001-01-01

Health diagnostics is an area where major improvements have been identified for potential implementation into the design of new reusable launch vehicles (RLVs) in order to reduce life cycle costs, to increase safety margins, and to improve mission reliability. NASA Ames is leading the effort to develop inspection and health management technologies for thermal protection systems. This paper summarizes a joint project between NASA Ames and industry partners to develop "wireless" devices that can be embedded in the thermal protection system to monitor temperature or other quantities of interest. These devices are sensors integrated with radio-frequency identification (RFID) microchips to enable non-contact communication of sensor data to an external reader that may be a hand-held scanner or a large portal. Both passive and active prototype devices have been developed. The passive device uses a thermal fuse to indicate the occurrence of excessive temperature. This device has a diameter under 0.13 cm. (suitable for placement in gaps between ceramic TPS tiles on an RLV) and can withstand 370 C for 15 minutes. The active device contains a small battery to provide power to a thermocouple for recording a temperature history during flight. The bulk of the device must be placed beneath the TPS for protection from high temperature, but the thermocouple can be placed in a hot location such as near the external surface.

Transient Ureteral Obstruction Prevents against Kidney Ischemia/Reperfusion Injury via Hypoxia-Inducible Factor (HIF)-2α Activation

PubMed Central

Chen, Xiao-Song; Zhang, Ming; Xu, Long-Mei; Zhang, Jian-Jun; Xia, Qiang

2012-01-01

Although the protective effect of transient ureteral obstruction (UO) prior to ischemia on subsequent renal ischemia/reperfusion (I/R) injury has been documented, the underlying molecular mechanism remains to be understood. We showed in the current study that 24 h of UO led to renal tubular hypoxia in the ipsilateral kidney in mice, with the accumulation of hypoxia-inducible factor (HIF)-2α, which lasted for a week after the release of UO. To address the functions of HIF-2α in UO-mediated protection of renal IRI, we utilized the Mx-Cre/loxP recombination system to knock out target genes. Inactivation of HIF-2α, but not HIF-1α blunted the renal protective effects of UO, as demonstrated by much higher serum creatinine level and severer histological damage. UO failed to prevent postischemic neutrophil infiltration and apoptosis induction in HIF-2α knockout mice, which also diminished the postobstructive up-regulation of the protective molecule, heat shock protein (HSP)-27. The renal protective effects of UO were associated with the improvement of the postischemic recovery of intra-renal microvascular blood flow, which was also dependent on the activation of HIF-2α. Our results demonstrated that UO protected the kidney via activation of HIF-2α, which reduced tubular damages via preservation of adequate renal microvascular perfusion after ischemia. Thus, preconditional HIF-2α activation might serve as a novel therapeutic strategy for the treatment of ischemic acute renal failure. PMID:22295069

Functional Safety of Hybrid Laser Safety Systems - How can a Combination between Passive and Active Components Prevent Accidents?

NASA Astrophysics Data System (ADS)

Lugauer, F. P.; Stiehl, T. H.; Zaeh, M. F.

Modern laser systems are widely used in industry due to their excellent flexibility and high beam intensities. This leads to an increased hazard potential, because conventional laser safety barriers only offer a short protection time when illuminated with high laser powers. For that reason active systems are used more and more to prevent accidents with laser machines. These systems must fulfil the requirements of functional safety, e.g. according to IEC 61508, which causes high costs. The safety provided by common passive barriers is usually unconsidered in this context. In the presented approach, active and passive systems are evaluated from a holistic perspective. To assess the functional safety of hybrid safety systems, the failure probability of passive barriers is analysed and added to the failure probability of the active system.

Beneficial effect of the bioflavonoid quercetin on cholecystokinin-induced mitochondrial dysfunction in isolated rat pancreatic acinar cells.

PubMed

Weber, Heike; Jonas, Ludwig; Wakileh, Michael; Krüger, Burkhard

2014-03-01

The pathogenesis of acute pancreatitis (AP) is still poorly understood. Thus, a reliable pharmacological therapy is currently lacking. In recent years, an impairment of the energy metabolism of pancreatic acinar cells, caused by Ca(2+)-mediated depolarization of the inner mitochondrial membrane and a decreased ATP supply, has been implicated as an important pathological event. In this study, we investigated whether quercetin exerts protection against mitochondrial dysfunction. Following treatment with or without quercetin, rat pancreatic acinar cells were stimulated with supramaximal cholecystokinin-8 (CCK). CCK caused a decrease in the mitochondrial membrane potential (MMP) and ATP concentration, whereas the mitochondrial dehydrogenase activity was significantly increased. Quercetin treatment before CCK application exerted no protection on MMP but increased ATP to a normal level, leading to a continuous decrease in the dehydrogenase activity. The protective effect of quercetin on mitochondrial function was accompanied by a reduction in CCK-induced changes to the cell membrane. Concerning the molecular mechanism underlying the protective effect of quercetin, an increased AMP/ATP ratio suggests that the AMP-activated protein kinase system may be activated. In addition, quercetin strongly inhibited CCK-induced trypsin activity. The results indicate that the use of quercetin may be a therapeutic strategy for reducing the severity of AP.

At the Ready: Planning for Business Continuity

ERIC Educational Resources Information Center

Sharp, Linda

2011-01-01

School system leaders never know when disaster may strike. Having a plan in place to protect vital data and systems is crucial. School system leaders need to be actively involved in crisis preparedness, planned response, and recovery to ensure student and staff safety and to make certain that all important operations, services, processes, and…

33 CFR 154.2203 - Facility requirements for barge vapor overpressure and vacuum protection.

Code of Federal Regulations, 2014 CFR

2014-07-01

... displacement system must provide a pressure-sensing device that activates an alarm that satisfies the... located in the fluid displacement system's piping downstream of any devices that could potentially isolate... to inject the fluid. (d) A fluid displacement system must provide a pressure-sensing device that is...

42 CFR 51.21 - Contracts for program operations.

Code of Federal Regulations, 2011 CFR

2011-10-01

... and Priorities § 51.21 Contracts for program operations. (a) An eligible P&A system should work... individuals. (b) An eligible P&A system may contract for the operation of all or part of its program with... capacity to perform protection and advocacy activities throughout the State; (2) The eligible P&A system...

Antiinflammatory activity of lymphomyosot during chronic deseases.

PubMed

Ratiani, L; Terunashvili, G; Sanikidze, T

2012-04-01

Every pathology generally refers to an inadequate response to the influence brought by endo- and exotoxins, which is carried out via natural compensative and protective pathways of the body. Scientific conception of bioregulative therapy and homotoxicology implies treatment by modulation of own protective mechanisms and neutralization of already existing toxins. This endo- and exogenic homotoxins influence on the development of various immune responses of immunocompetent cells. Lymphomyosot, a complex nutural detoxifier drug, providing the effective detoxication of extracellular matrix via lymphatic system. As a huge amount of immunocompetent cells are located in the lymphatic system are, regulation of their immune responses by Lymphomyosot is very the essence of the treatment applicable to different chronic pathologies. determining of dose-dependent immunomodulating activity of Lymphomyosot on T lymphocytes modelled system of Jurkat cells. The modelled systems of Jurkat cells, incubated under moderate oxidative stress conditions inherent chronic inflammatory processes, and stimulated with mytogene Phytohemaglutinine (PHA) was used. Effectiveness of Lypmhomyosot was studied by regulatory capacity of the cells bioviability (MTT test) immunological activity (cytokine expression, respiratory burst) and of mytogene-induced apoptosis intensity of Jurkat cells. Lymphomyosot shows antioxidant effect and dose-dependent immunomodulatory activity. Lymphomyosot, as anti-inflammatory, recovering agent is effective for profilactic aims. Low (therapeutic) doses of lymphomyosot are effective for the treatment of.

Protection of host cells by complement regulators.

PubMed

Schmidt, Christoph Q; Lambris, John D; Ricklin, Daniel

2016-11-01

The complement cascade is an ancient immune-surveillance system that not only provides protection from pathogen invasion but has also evolved to participate in physiological processes to maintain tissue homeostasis. The alternative pathway (AP) of complement activation is the evolutionarily oldest part of this innate immune cascade. It is unique in that it is continuously activated at a low level and arbitrarily probes foreign, modified-self, and also unaltered self-structures. This indiscriminate activation necessitates the presence of preformed regulators on autologous surfaces to spare self-cells from the undirected nature of AP activation. Although the other two canonical complement activation routes, the classical and lectin pathways, initiate the cascade more specifically through pattern recognition, their activity still needs to be tightly controlled to avoid excessive reactivity. It is the perpetual duty of complement regulators to protect the self from damage inflicted by inadequate complement activation. Here, we review the role of complement regulators as preformed mediators of defense, explain their common and specialized functions, and discuss selected cases in which alterations in complement regulators lead to disease. Finally, rational engineering approaches using natural complement inhibitors as potential therapeutics are highlighted. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Ammonia impairs glutamatergic communication in astroglial cells: protective role of resveratrol.

PubMed

Bobermin, Larissa Daniele; Hansel, Gisele; Scherer, Emilene B S; Wyse, Angela T S; Souza, Diogo Onofre; Quincozes-Santos, André; Gonçalves, Carlos-Alberto

2015-12-01

Ammonia is a key toxin in the precipitation of hepatic encephalopathy (HE), a neuropsychiatric disorder associated with liver failure. In response to ammonia, various toxic events are triggered in astroglial cells, and alterations in brain glutamate communication are common. Resveratrol is a polyphenolic compound that has been extensively studied in pathological events because it presents several beneficial effects, including some in the central nervous system (CNS). We previously described that resveratrol is able to significantly modulate glial functioning and has a protective effect during ammonia challenge in vitro. In this study, we addressed the mechanisms by which resveratrol can protect C6 astroglial cells from glutamatergic alterations induced by ammonia. Resveratrol was able to prevent all the effects triggered by ammonia: (i) decrease in glutamate uptake activity and expression of the EAAC1 glutamate transporter, the main glutamate transporter present in C6 cells; (ii) increase of glutamate release, which was also dependent on the activation of the Na(+)-K(+)-Cl(-) co-transporter NKCC1; (iii) reduction in GS activity and intracellular GSH content; and (iv) impairment of Na(+)K(+)-ATPase activity. Interestingly, resveratrol, per se, also positively modulated the astroglial functions evaluated. Moreover, we demonstrated that heme oxygenase 1 (HO1), an enzyme that is part of the cellular defense system, mediated some of the effects of resveratrol. In conclusion, the mechanisms of the putative protective role of resveratrol against ammonia toxicity involve the modulation of pathways and molecules related to glutamate communication in astroglial cells. Copyright © 2015 Elsevier B.V. All rights reserved.

EVA 4 activity on Flight Day 7 to service the Hubble Space Telescope

NASA Image and Video Library

1997-02-17

S82-E-5606 (17 Feb. 1997) --- Astronaut Gregory J. Harbaugh at work on Hubble Space Telescope (HST), with the assistance of astronaut Joseph R. Tanner (out of frame) on Remote Manipulator System (RMS). After replacing the HST's Solar Array Drive Electronics (SADE), Harbaugh and Tanner replaced the Magnetic Sensing System (MSS) protective lids with new, permanent covers; and they installed pre-cut insulation pieces to correct tears in the HST's protective covering caused by temperature changes in space. This view was taken with an Electronic Still Camera (ESC).

Fault Analysis in a Grid Integrated DFIG Based Wind Energy System with NA CB_P Circuit for Ridethrough Capability and Power Quality Improvement

NASA Astrophysics Data System (ADS)

Swain, Snehaprava; Ray, Pravat Kumar

2016-12-01

In this paper a three phase fault analysis is done on a DFIG based grid integrated wind energy system. A Novel Active Crowbar Protection (NACB_P) system is proposed to enhance the Fault-ride through (FRT) capability of DFIG both for symmetrical as well as unsymmetrical grid faults. Hence improves the power quality of the system. The protection scheme proposed here is designed with a capacitor in series with the resistor unlike the conventional Crowbar (CB) having only resistors. The major function of the capacitor in the protection circuit is to eliminate the ripples generated in the rotor current and to protect the converter as well as the DC-link capacitor. It also compensates reactive power required by the DFIG during fault. Due to these advantages the proposed scheme enhances the FRT capability of the DFIG and also improves the power quality of the whole system. Experimentally the fault analysis is done on a 3hp slip ring induction generator and simulation results are carried out on a 1.7 MVA DFIG based WECS under different types of grid faults in MATLAB/Simulation and functionality of the proposed scheme is verified.

Monitoring Design for Source Identification in Water Distribution Systems

EPA Science Inventory

The design of sensor networks for the purpose of monitoring for contaminants in water distribution systems is currently an active area of research. Much of the effort has been directed at the contamination detection problem and the expression of public health protection objective...

Countering MANPADS: study of new concepts and applications

NASA Astrophysics Data System (ADS)

Maltese, Dominique; Robineau, Jacques; Audren, Jean-Thierry; Aragones, Julien; Sailliot, Christophe

2006-05-01

The latest events of ground-to-air Man Portable Air Defense (MANPAD) attacks against aircraft have revealed a new threat both for military and civilian aircraft. Consequently, the implementation of Protecting systems (i.e. Directed InfraRed Counter Measure - DIRCM) in order to face IR guided missiles turns out to be now inevitable. In a near future, aircraft will have to possess detection, tracking, targeting and jamming capabilities to face single and multiple MANPAD threats fired in short-range scenarios from various environments (urban sites, landscape...). In this paper, a practical example of a DIRCM system under study at SAGEM DEFENSE & SECURITY company is presented. The self-protection solution includes built-in and automatic locking-on, tracking, identification and laser jamming capabilities, including defeat assessment. Target Designations are provided by a Missile Warning System. Multiple Target scenarios have been considered to design the system architecture. The article deals with current and future threats (IR seekers of different generations...), scenarios and platforms for system definition. Plus, it stresses on self-protection solutions based on laser jamming capability. Different strategies including target identification, multi band laser, active imagery are described. The self-protection system under study at SAGEM DEFENSE & SECURITY company is also a part of this chapter. Eventually, results of self-protection scenarios are provided for different MANPAD scenarios. Data have been obtained from a simulation software. The results highlight how the system reacts to incoming IR-guided missiles in short time scenarios.

Infection in systemic lupus erythematosus: friend or foe?

PubMed Central

Francis, Lisa; Perl, Andras

2010-01-01

Infectious agents have long been implicated in the pathogenesis of systemic lupus erythematosus. Common viruses, such as the Epstein-Barr virus, transfusion transmitted virus, parvovirus and cytomegalovirus, have an increased prevalence in patients with systemic lupus erythematosus. They may contribute to disease pathogenesis through triggering autoimmunity via structural or functional molecular mimicry, encoding proteins that induce cross-reactive immune responses to self antigens or modulate antigen processing, activation, or apoptosis of B and T cells, macrophages or dendritic cells. Alternatively, some infectious agents, such as malaria, Toxoplasma gondii and Helicobacter pylori, may have a protective effect. Vaccinations may play dual roles by protecting against friend and foe alike. PMID:20209114

Prevalence of type III secretion system in effective biocontrol pseudomonads.

PubMed

Almario, Juliana; Gobbin, Davide; Défago, Geneviève; Moënne-Loccoz, Yvan; Rezzonico, Fabio

2014-05-01

Functional type III secretion system (T3SS) genes are needed for effective biocontrol of Pythium damping-off of cucumber by Pseudomonas fluorescens KD, but whether biocontrol Pseudomonas strains with T3SS genes display overall a higher plant-protecting activity is unknown. The assessment of 198 biocontrol fluorescent pseudomonads originating from 60 soils worldwide indicated that 32% harbour the ATPase-encoding T3SS gene hrcN, which was most often found in tomato isolates. The hrcN(+) biocontrol strains (and especially those also producing 2,4-diacetylphloroglucinol and displaying 1-aminocyclopropane-1-carboxylate deaminase activity) displayed higher plant-protecting ability in comparison with hrcN(-) biocontrol strains, both in the Pythium/cucumber and Fusarium/cucumber pathosystems. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Effect of Antiviral Agents in Equine Abortion Virus-Infected Hamsters1

PubMed Central

Lieberman, Melvin; Pascale, Andrea; Schafer, Thomas W.; Came, Paul E.

1972-01-01

Equine abortion virus, a member of the herpesvirus group, produces a lethal infection in hamsters. With this system, the protective effect of certain inhibitors of deoxyribonucleic acid viruses, inducers of interferon and exogenous interferon, was evaluated. Of the various agents studied, 9-β-d-arabinofuranosyladenine markedly suppressed mortality, and 5-iodo-2′-deoxyuridine, distamycin A, and N-ethylisatin β-thiosemicarbazone were inactive. Of the inducers tested, statolon, ultraviolet-irradiated Newcastle disease virus, and polyriboinosinic:polyribocytidylic acid (poly I:C) were protective, and endotoxin, polyacrylic acid, and polymethacrylic acid did not protect. Administration of exogenous interferon did not afford protection. Statolon and ultraviolet-irradiated Newcastle disease virus induced circulating interferon in hamsters, whereas poly I:C, endotoxin, and polyacrylic acid did not produce interferon. Because of the severity of the disease produced in hamsters by equine abortion virus, lack of protective activity by an agent in this system should not preclude possible efficacy against other members of the herpesvirus group. PMID:4376907

76 FR 77823 - Agency Information Collection Activities; Submission to OMB for Review and Approval; Comment...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-14

... technology and systems for the purposes of collecting, validating, and verifying information, processing and... ENVIRONMENTAL PROTECTION AGENCY [EPA-HQ-OECA-2011-0218; FRL-9501-2] Agency Information Collection Activities; Submission to OMB for Review and Approval; Comment Request; NSPS for Metallic Mineral Processing...

77 FR 25718 - Proposed Information Collection Activity; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-01

... Protection and Advocacy Systems Program Performance Report. OMB No.: 0980-0160. Description: This information... a program Performance Report for the preceding fiscal year of activities and accomplishments and of conditions in the State. The information in the Annual Report will be aggregated into a national profile of...

76 FR 4705 - Proposed Information Collection Activity; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-26

... Protection and Advocacy Systems Program Performance Report. OMB No. 0980-0160. Description: This information... a program Performance Report for the preceding fiscal year of activities and accomplishments and of conditions in the State. The information in the Annual Report will be aggregated into a national profile of...

39 CFR 447.43 - Investigation and enforcement.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 39 Postal Service 1 2010-07-01 2010-07-01 false Investigation and enforcement. 447.43 Section 447... Political Activities § 447.43 Investigation and enforcement. The Office of the Special Counsel and the Merit Systems Protection Board investigate and adjudicate allegations of political activity in violation of the...

75 FR 55324 - Agency Information Collection Activities: Proposed Collection; Comment Request; 2011 Drinking...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-10

... water systems serving more than 3,300 persons and from American Indian and Alaskan Native Village... Activities: Proposed Collection; Comment Request; 2011 Drinking Water Infrastructure Needs Survey and... submitting comments. E-mail: [email protected] . Fax: 202-564-3757. Mail: Water Docket, EPA Docket Center...

76 FR 40355 - Modification to 2008 National Pollutant Discharge Elimination System (NPDES) General Permit for...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-08

... Construction Activities AGENCY: Environmental Protection Agency (EPA). ACTION: Notice. SUMMARY: EPA Regions 1... (NPDES) general permits for stormwater discharges associated with construction activity in order to... permits will be referred to as ``permit'' or ``2008 construction general permit'' or ``2008 CGP.'' This...

A rapid method for identifying and characterizing structural impacts using distributed sensors: An application for automotive pedestrian protection

NASA Astrophysics Data System (ADS)

Kim, Andrew C.

This research is motivated by recent activity to improve automotive safety, especially for pedestrians. In many parts of the world today, injuries and fatalities from road accidents are a significant problem. Safety features such as seat restraints and air bags provide considerable levels of protection for car occupants; however, no such protective measures currently exist for pedestrians. Drawing upon the success and effectiveness of occupant air bag systems, current research aims to develop similar devices for pedestrians. These active pedestrian protection systems deploy a safety feature such as an external air bag when a pedestrian is hit by a vehicle. Contact with the front bumper induces a body rotation that may result in a violent head collision. The deployable safety device provides a cushioning surface for the vulnerable pedestrian during impact. The challenge of such a system is an effective sensory unit that can rapidly and correctly discriminate pedestrian impacts from non-pedestrian ones. The fast kinematics of the automobile-pedestrian impact leaves a minimal amount of time for signal processing and computation. This research study focuses on a discrimination scheme that satisfies both the time and accuracy requirements for a proposed sensory system for pedestrian protection. A unique methodology was developed to identify structural impacts using dominant frequency features extracted from sensory data. Contact sensors mounted on the front bumper of an automobile measure the strain response from an impact event. The dominant frequencies obtained from these sensor signals are greatly influenced by the impact object's properties and can be used to discriminate between different objects. Extensive tests were conducted to gather sensor data and validate the proposed methodology and impact discrimination algorithm. Results of the impact tests indicate that the approach is sound, and the sensory system effectively identifies "pedestrian" impacts within a short period of time.

Moricandia arvensis extracts protect against DNA damage, mutagenesis in bacteria system and scavenge the superoxide anion.

PubMed

Skandrani, Ines; Bouhlel, Ines; Limem, Ilef; Boubaker, Jihed; Bhouri, Wissem; Neffati, Aicha; Ben Sghaier, Mohamed; Kilani, Soumaya; Ghedira, Kamel; Ghedira-Chekir, Leila

2009-02-01

The mutagenic potential of total aqueous, total oligomers flavonoids (TOF), ethyl acetate (EA), chloroform (Chl), petroleum ether (PE) and methanol (MeOH) extracts from aerial parts of Moricandia arvensis was assessed using Ames Salmonella tester strains TA100 and TA1535 with and without metabolic activation (S9), and using plasmid pBluescript DNA assay. None of the different extracts produced a mutagenic effect, except aqueous extract when incubated with Salmonella typhimurium TA100 after metabolic activation. Likewise, the antimutagenicity of the same extracts was tested using the "Ames test". Our results showed that M. arvensis extracts possess antimutagenic effects against sodium azide (SA) in the two tested Salmonella assay systems, except metabolized aqueous and PE extracts when tested with S. typhimurium TA100 assay system. Different extracts were also found to be effective in protecting plasmid DNA against the strand breakage induced by hydroxyl radicals, except PE and aqueous extracts. Antioxidant capacity of the tested extracts was evaluated using the enzymatic (xanthine/xanthine oxidase assay) (X/XOD) and the non enzymatic (NBT/Riboflavine assay) systems. TOF extract was the more effective one in inhibiting both xanthine oxidase activity and NBT reduction.

A protection system for the JET ITER-like wall based on imaging diagnostics.

PubMed

Arnoux, G; Devaux, S; Alves, D; Balboa, I; Balorin, C; Balshaw, N; Beldishevski, M; Carvalho, P; Clever, M; Cramp, S; de Pablos, J-L; de la Cal, E; Falie, D; Garcia-Sanchez, P; Felton, R; Gervaise, V; Goodyear, A; Horton, A; Jachmich, S; Huber, A; Jouve, M; Kinna, D; Kruezi, U; Manzanares, A; Martin, V; McCullen, P; Moncada, V; Obrejan, K; Patel, K; Lomas, P J; Neto, A; Rimini, F; Ruset, C; Schweer, B; Sergienko, G; Sieglin, B; Soleto, A; Stamp, M; Stephen, A; Thomas, P D; Valcárcel, D F; Williams, J; Wilson, J; Zastrow, K-D

2012-10-01

The new JET ITER-like wall (made of beryllium and tungsten) is more fragile than the former carbon fiber composite wall and requires active protection to prevent excessive heat loads on the plasma facing components (PFC). Analog CCD cameras operating in the near infrared wavelength are used to measure surface temperature of the PFCs. Region of interest (ROI) analysis is performed in real time and the maximum temperature measured in each ROI is sent to the vessel thermal map. The protection of the ITER-like wall system started in October 2011 and has already successfully led to a safe landing of the plasma when hot spots were observed on the Be main chamber PFCs. Divertor protection is more of a challenge due to dust deposits that often generate false hot spots. In this contribution we describe the camera, data capture and real time processing systems. We discuss the calibration strategy for the temperature measurements with cross validation with thermal IR cameras and bi-color pyrometers. Most importantly, we demonstrate that a protection system based on CCD cameras can work and show examples of hot spot detections that stop the plasma pulse. The limits of such a design and the associated constraints on the operations are also presented.

Local Melatoninergic System as the Protector of Skin Integrity

PubMed Central

Slominski, Andrzej T.; Kleszczyński, Konrad; Semak, Igor; Janjetovic, Zorica; Żmijewski, Michał A.; Kim, Tae-Kang; Slominski, Radomir M.; Reiter, Russel J.; Fischer, Tobias W.

2014-01-01

The human skin is not only a target for the protective actions of melatonin, but also a site of melatonin synthesis and metabolism, suggesting an important role for a local melatoninergic system in protection against ultraviolet radiation (UVR) induced damages. While melatonin exerts many effects on cell physiology and tissue homeostasis via membrane bound melatonin receptors, the strong protective effects of melatonin against the UVR-induced skin damage including DNA repair/protection seen at its high (pharmocological) concentrations indicate that these are mainly mediated through receptor-independent mechanisms or perhaps through activation of putative melatonin nuclear receptors. The destructive effects of the UVR are significantly counteracted or modulated by melatonin in the context of a complex intracutaneous melatoninergic anti-oxidative system with UVR-enhanced or UVR-independent melatonin metabolites. Therefore, endogenous intracutaneous melatonin production, together with topically-applied exogenous melatonin or metabolites would be expected to represent one of the most potent anti-oxidative defense systems against the UV-induced damage to the skin. In summary, we propose that melatonin can be exploited therapeutically as a protective agent or as a survival factor with anti-genotoxic properties or as a “guardian” of the genome and cellular integrity with clinical applications in UVR-induced pathology that includes carcinogenesis and skin aging. PMID:25272227

A protection system for the JET ITER-like wall based on imaging diagnosticsa)

NASA Astrophysics Data System (ADS)

Arnoux, G.; Devaux, S.; Alves, D.; Balboa, I.; Balorin, C.; Balshaw, N.; Beldishevski, M.; Carvalho, P.; Clever, M.; Cramp, S.; de Pablos, J.-L.; de la Cal, E.; Falie, D.; Garcia-Sanchez, P.; Felton, R.; Gervaise, V.; Goodyear, A.; Horton, A.; Jachmich, S.; Huber, A.; Jouve, M.; Kinna, D.; Kruezi, U.; Manzanares, A.; Martin, V.; McCullen, P.; Moncada, V.; Obrejan, K.; Patel, K.; Lomas, P. J.; Neto, A.; Rimini, F.; Ruset, C.; Schweer, B.; Sergienko, G.; Sieglin, B.; Soleto, A.; Stamp, M.; Stephen, A.; Thomas, P. D.; Valcárcel, D. F.; Williams, J.; Wilson, J.; Zastrow, K.-D.; JET-EFDA Contributors

2012-10-01

The new JET ITER-like wall (made of beryllium and tungsten) is more fragile than the former carbon fiber composite wall and requires active protection to prevent excessive heat loads on the plasma facing components (PFC). Analog CCD cameras operating in the near infrared wavelength are used to measure surface temperature of the PFCs. Region of interest (ROI) analysis is performed in real time and the maximum temperature measured in each ROI is sent to the vessel thermal map. The protection of the ITER-like wall system started in October 2011 and has already successfully led to a safe landing of the plasma when hot spots were observed on the Be main chamber PFCs. Divertor protection is more of a challenge due to dust deposits that often generate false hot spots. In this contribution we describe the camera, data capture and real time processing systems. We discuss the calibration strategy for the temperature measurements with cross validation with thermal IR cameras and bi-color pyrometers. Most importantly, we demonstrate that a protection system based on CCD cameras can work and show examples of hot spot detections that stop the plasma pulse. The limits of such a design and the associated constraints on the operations are also presented.

Collaborative Point Paper on Active Protection Systems

DTIC Science & Technology

2006-10-01

for the Hunter VHP CIED Program. Also, General Dynamics Armament and Technical Products (GDATP), Burlington, VT is contracted by the Marine Corps...the incoming threat at a relatively long distance. Specific details about the composition and mechanism of this explosive interceptor device are...relatively thin shell of ballistic steel and composite armor, also known as hybrid armor, designed to provide optimal protection from specific threats

Safinamide and flecainide protect axons and reduce microglial activation in models of multiple sclerosis.

PubMed

Morsali, Damineh; Bechtold, David; Lee, Woojin; Chauhdry, Summen; Palchaudhuri, Upayan; Hassoon, Paula; Snell, Daniel M; Malpass, Katy; Piers, Thomas; Pocock, Jennifer; Roach, Arthur; Smith, Kenneth J

2013-04-01

Axonal degeneration is a major cause of permanent disability in the inflammatory demyelinating disease multiple sclerosis, but no therapies are known to be effective in axonal protection. Sodium channel blocking agents can provide effective protection of axons in the white matter in experimental models of multiple sclerosis, but the mechanism of action (directly on axons or indirectly via immune modulation) remains uncertain. Here we have examined the efficacy of two sodium channel blocking agents to protect white matter axons in two forms of experimental autoimmune encephalomyelitis, a common model of multiple sclerosis. Safinamide is currently in phase III development for use in Parkinson's disease based on its inhibition of monoamine oxidase B, but the drug is also a potent state-dependent inhibitor of sodium channels. Safinamide provided significant protection against neurological deficit and axonal degeneration in experimental autoimmune encephalomyelitis, even when administration was delayed until after the onset of neurological deficit. Protection of axons was associated with a significant reduction in the activation of microglia/macrophages within the central nervous system. To clarify which property of safinamide was likely to be involved in the suppression of the innate immune cells, the action of safinamide on microglia/macrophages was compared with that of the classical sodium channel blocking agent, flecainide, which has no recognized monoamine oxidase B activity, and which has previously been shown to protect the white matter in experimental autoimmune encephalomyelitis. Flecainide was also potent in suppressing microglial activation in experimental autoimmune encephalomyelitis. To distinguish whether the suppression of microglia was an indirect consequence of the reduction in axonal damage, or possibly instrumental in the axonal protection, the action of safinamide was examined in separate experiments in vitro. In cultured primary rat microglial cells activated by lipopolysaccharide, safinamide potently suppressed microglial superoxide production and enhanced the production of the anti-oxidant glutathione. The findings show that safinamide is effective in protecting axons from degeneration in experimental autoimmune encephalomyelitis, and that this effect is likely to involve a direct effect on microglia that can result in a less activated phenotype. Together, this work highlights the potential of safinamide as an effective neuroprotective agent in multiple sclerosis, and implicates microglia in the protective mechanism.

Glossary | STORET Legacy Data Center | US EPA

EPA Pesticide Factsheets

2014-06-06

The U.S. Environmental Protection Agency (EPA) maintains two data management systems containing water quality information for the nation's waters: the Legacy Data Center (LDC), and STORET. The LDC is a static, archived database and STORET is an operational system actively being populated with water quality data.

76 FR 5612 - Agency Information Collection Activities; Submission for OMB Review; Comment Request; YouthBuild...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-01

... for OMB Review; Comment Request; YouthBuild Reporting System ACTION: Notice. SUMMARY: The Department... Administration (ETA) sponsored information collection request (ICR) titled, ``YouthBuild Reporting System,'' to... at [email protected] . SUPPLEMENTARY INFORMATION: YouthBuild grantees collect and report...

77 FR 27540 - Information Collection Activities

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-10

... information or copies of the information collection(s) send your request to accounting[email protected]; and converting the data from the carrier's individual accounting system to the Board's Uniform System... (URCS), which is a cost measurement methodology. URCS, which was developed by the Board pursuant to 49 U...

Organizations - I | STORET Legacy Data Center | US EPA

EPA Pesticide Factsheets

2007-05-16

The U.S. Environmental Protection Agency (EPA) maintains two data management systems containing water quality information for the nation's waters: the Legacy Data Center (LDC), and STORET. The LDC is a static, archived database and STORET is an operational system actively being populated with water quality data.

Glossary | STORET Legacy Data Center | US EPA

EPA Pesticide Factsheets

2011-02-14

The U.S. Environmental Protection Agency (EPA) maintains two data management systems containing water quality information for the nation's waters: the Legacy Data Center (LDC), and STORET. The LDC is a static, archived database and STORET is an operational system actively being populated with water quality data.

Contacts | STORET Legacy Data Center | US EPA

EPA Pesticide Factsheets

2007-05-16

The U.S. Environmental Protection Agency (EPA) maintains two data management systems containing water quality information for the nation's waters: the Legacy Data Center (LDC), and STORET. The LDC is a static, archived database and STORET is an operational system actively being populated with water quality data.

Vitamin D3 contributes to enhanced osteogenic differentiation of MSCs under oxidative stress condition via activating the endogenous antioxidant system.

PubMed

Zhou, J; Wang, F; Ma, Y; Wei, F

2018-06-02

The anti-oxidative effects of vitamin D3 (Vd3) on mesenchymal stem cells (MSCs) have not been studied before. The present study suggested that Vd3 could not only promote the osteogenic differentiation of MSCs under normal condition but also partly protect it from oxidative stress damage by activating the endogenous antioxidant system. Evolving evidence proved that oxidative stress caused by reactive oxygen species (ROS) overproduction might lead to bone loss. Vd3, a commonly used osteogenic induction drug, was proved to exhibit potent anti-oxidative effects on other cell types. The present study aims to investigate the protective effects of Vd3 on oxidative stress-induced dysfunctions of MSCs, as well as its underlying mechanisms. The H 2 O 2 was used as exogenous reactive oxygen species (ROS). The influence of ROS and anti-oxidative protection of Vd3 on MSCs were analyzed too. Multi-techniques were used to assess the beneficial effects of Vd3 on MSCs under oxidative stress condition. The results demonstrated that Vd3 could significantly attenuate the H 2 O 2 -induced cell injury of MSCs via Sirt1/FoxO1 signaling pathway, and reduced the H 2 O 2 exposure-induced intracellular oxidative stress status of MSCs. What's more, the H 2 O 2 exposure resulted in the decreased osteogenic differentiation of MSCs, as evidenced by decreased alkaline phosphatase activity, calcium deposition level, and osteogenic differentiation gene mRNA levels, but the injury was restored via Vd3 administration. The results suggested that Vd3 could not only promote the osteogenic differentiation of osteoblastic cells under normal condition but also partly protect the cell from oxidative stress damage by activating endogenous antioxidant system. The study shed light on the new roles of Vd3 in bone modeling and remodeling regulation.

Detoxified pneumolysin derivative Plym2 directly protects against pneumococcal infection via induction of inflammatory cytokines.

PubMed

Lu, Jingcai; Sun, Tianxu; Hou, Hongjia; Xu, Man; Gu, Tiejun; Dong, Yunliang; Wang, Dandan; Chen, Pinxu; Wu, Chunlai; Liang, Chunshu; Sun, Shiyang; Jiang, Chunlai; Kong, Wei; Wu, Yongge

2014-01-01

Streptococcus pneumoniae is a major cause of infectious disease and complications worldwide, such as pneumonia, otitis media, bacteremia and meningitis. New generation protein-based pneumococcal vaccines are recognized as alternative vaccine candidates. Pneumolysin (Ply) is a cholesterol-dependent cytolysin produced by all clinical isolates of S. pneumoniae. Our research group previously developed a highly detoxified Ply mutant designated Plym2 by replacement of two animo acids (C428G and W433F). Exhibiting undetectable levels of cytotoxicity, Plym2 could still elicit high titer neutralizing antibodies against the native toxin. However, evaluation of the active immunoprotective effects of Plym2 by subcutaneous immunization and lethal challenge with S. pneumoniae in mice did not yield favorable results. In the present work, we confirmed the previous observations by using passive immunization and systemic challenge. Results of the passive immunization were consistent with those of active immunization. Further experiments were conducted to explain the inability of high titer neutralizing antibodies against Ply to protect mice from S. pneumoniae challenge. Pneumococcal Ply is known to be the major factor responsible for the induction of inflammation that benefits the host. Proinflammatory cytokines facilitate the clearance of invaders by the recruitment and activation of leukocytes at the early infection stage. We demonstrated that Plym2 could induce proinflammatory cytokines similarly to wild-type Ply. A systemic infection model was used to clarify that Plym2 lacking cytolytic activity could protect mice from intraperitoneal challenge directly, while antibodies to the mutant had no effect. Therefore, the protective function of Plym2 may be due to its induction of proinflammatory cytokines. When used in the systemic infection model, Plym2 antibodies may block the induction of proinflammatory cytokines by Ply. These findings demonstrate that a Ply-based vaccine would not be an effective primary vaccine component, but it may be beneficial as an adjuvant to stimulate cytokine production.

Biocidal quaternary ammonium resin

NASA Technical Reports Server (NTRS)

Janauer, G. E.

1983-01-01

Activated carbon (charcoal) and polymeric resin sorbents are widely used in the filtration and treatment of drinking water, mainly to remove dissolved organic and inorganic impurities and to improve the taste. Earlier hopes that activated carbon might "disinfect' water proved to be unfounded. The feasibility of protecting against microbial infestation in charcoal and resin beds such as those to be incorporated into total water reuse systems in spacecraft was investigated. The biocidal effect of IPCD (insoluable polymeric contact disinfectants) in combination with a representative charcoal was assessed. The ion exchange resins (IPCD) were shown to adequately protect charcoal and ion exchange beds.

Tiger Team Assessment of the Los Alamos National Laboratory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1991-11-01

The purpose of the safety and health assessment was to determine the effectiveness of representative safety and health programs at the Los Alamos National Laboratory (LANL). Within the safety and health programs at LANL, performance was assessed in the following technical areas: Organization and Administration, Quality Verification, Operations, Maintenance, Training and Certification, Auxiliary Systems, Emergency Preparedness, Technical Support, Packaging and Transportation, Nuclear Criticality Safety, Security/Safety Interface, Experimental Activities, Site/Facility Safety Review, Radiological Protection, Personnel Protection, Worker Safety and Health (OSHA) Compliance, Fire Protection, Aviation Safety, Explosives Safety, Natural Phenomena, and Medical Services.

Neurotensin protects pancreatic beta cells from apoptosis.

PubMed

Coppola, Thierry; Béraud-Dufour, Sophie; Antoine, Aurélie; Vincent, Jean-Pierre; Mazella, Jean

2008-01-01

The survival of pancreatic beta cells depends on the balance between external cytotoxic and protective molecular systems. The neuropeptide neurotensin (NT) has been shown to regulate certain functions of the endocrine pancreas including insulin and glucagon release. However, the mechanism of action of NT as well as the identification of receptors involved in the pancreatic functions of the peptide remained to be studied. We demonstrate here that NT is an efficient protective agent of pancreatic beta cells against cytotoxic agents. Both beta-TC3 and INS-1E cell lines and the mouse pancreatic islet cells express the three known NT receptors. The incubation of beta cells with NT protects cells from apoptosis induced either by staurosporine or by IL-1beta. In beta-TC3 cells, NT activates both MAP and PI-3 kinases pathways and strongly reduces the staurosporine or the Il-1beta-induced caspase-3 activity by a mechanism involving Akt activation. The NTSR2 agonist levocabastine displays the same protective effect than NT whereas the NTSR1 antagonist is unable to block the effect of NT suggesting the predominant involvement of the NTSR2 in the action of NT on beta cells. These results clearly indicate for the first time that NT is able to protect endocrine beta cells from external cytotoxic agents, a role well correlated with its release in the circulation after a meal.

75 FR 71346 - Special Conditions: Boeing Model 787-8 Airplane; Lightning Protection of Fuel Tank Structure To...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-23

... Boeing Model 787-8 airplane will incorporate a fuel tank nitrogen generation system (NGS) that actively... ignition source in the fuel tank system could not result from any single failure, from any single failure... of fuel systems. We do not intend to apply the alternative standards used under these special...

33 CFR 154.812 - Facility requirements for vessel liquid overfill protection.

Code of Federal Regulations, 2011 CFR

2011-07-01

... intrinsically safe cargo tank level sensor system complying with 46 CFR 39.20-9(b) as its only means of overfill... shutdown signal from the cargo tank level sensor system that: (1) Closes the remotely operated cargo vapor...) Electrical continuity of the cargo tank level sensor system is lost; (2) Activates an alarm which is audible...

33 CFR 154.812 - Facility requirements for vessel liquid overfill protection.

Code of Federal Regulations, 2012 CFR

2012-07-01

... intrinsically safe cargo tank level sensor system complying with 46 CFR 39.20-9(b) as its only means of overfill... shutdown signal from the cargo tank level sensor system that: (1) Closes the remotely operated cargo vapor...) Electrical continuity of the cargo tank level sensor system is lost; (2) Activates an alarm which is audible...

33 CFR 154.812 - Facility requirements for vessel liquid overfill protection.

Code of Federal Regulations, 2013 CFR

2013-07-01

... intrinsically safe cargo tank level sensor system complying with 46 CFR 39.20-9(b) as its only means of overfill... shutdown signal from the cargo tank level sensor system that: (1) Closes the remotely operated cargo vapor...) Electrical continuity of the cargo tank level sensor system is lost; (2) Activates an alarm which is audible...

The Insider Threat Security Architecture: An Integrated, Inseparable, and Uninterrupted Self-Protection Autonomic Framework

ERIC Educational Resources Information Center

Jabbour, Ghassan

2010-01-01

The increasing proliferation of globally interconnected complex information systems has elevated the magnitude of attacks and the level of damage that they inflict on such systems. This open environment of intertwined financial, medical, defense, and other systems has attracted hackers to increase their malicious activities to cause harm or to…

Plasmon-organic fiber interactions in diamond-like carbon coated nanostructured gold films

NASA Astrophysics Data System (ADS)

Cielecki, Paweł Piotr; Sobolewska, Elżbieta Karolina; Kostiuočenko, Oksana; Leißner, Till; Tamulevičius, Tomas; Tamulevičius, Sigitas; Rubahn, Horst-Günter; Adam, Jost; Fiutowski, Jacek

2017-11-01

Gold is the most commonly used plasmonic material, however soft and prone to mechanical deformations. It has been shown that the durability of gold plasmonic substrates can be improved by applying a protective diamond-like carbon (DLC) coating. In this work, we investigate the influence of such protective layers on plasmonic interactions in organic-plasmonic hybrid systems. We consider systems, consisting of 1-Cyano-quaterphenylene nanofibers on top of gold nano-square plasmonic arrays, coated with protective layers of varying thickness. We numerically investigate the spectral position of surface plasmon polariton resonances and electric field intensity, as a function of protective layer thickness, using the finite-difference time-domain method. To confirm the numerically indicated field enhancement preservation on top of protective layers, we experimentally map the second harmonic response of organic nanofibers. Subsequently, we characterize the plasmonic coupling between organic nanofibers and underlying substrates, considered as one of the main loss channels for photoluminescence from nanofibers, by time-resolved photoluminescence spectroscopy. Our findings reveal that, for the investigated system, plasmonic interactions are preserved for DLC coatings up to 55 nm. This is relevant for the fabrication of new passive and active plasmonic components with increased durability and hence prolonged lifetime.

Advanced worker protection system. Topical report, Phase I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myers, J.

1995-07-01

The Department of Energy (DOE) is in the process of defining the magnitude and diversity of Decontamination and Decommissioning (D&D) obligations at its numerous sites. The DOE believes that existing technologies are inadequate to solve many challenging problems such as how to decontaminate structures and equipment cost effectively, what to do with materials and wastes generated, and how to adequately protect workers and the environment. Preliminary estimates show a tremendous need for effective use of resources over a relatively long period (over 30 years). Several technologies are being investigated which can potentially reduce D&D costs while providing appropriate protection tomore » DOE workers. The DOE recognizes that traditional methods used by the EPA in hazardous waste site clean up activities are insufficient to provide the needed protection and worker productivity demanded by DOE D&D programs. As a consequence, new clothing and equipment which can adequately protect workers while providing increases in worker productivity are being sought for implementation at DOE sites. This project will result in the development of an Advanced Worker Protection System (AWPS). The AWPS will be built around a life support backpack that uses liquid air to provide cooling as well as breathing gas to the worker. The backpack will be combined with advanced protective garments, advanced liquid cooling garment, respirator, communications, and support equipment to provide improved worker protection, simplified system, maintenance, and dramatically improve worker productivity through longer duration work cycles.« less

Developing a new syndromic surveillance system for the London 2012 Olympic and Paralympic Games.

PubMed

Harcourt, S E; Fletcher, J; Loveridge, P; Bains, A; Morbey, R; Yeates, A; McCloskey, B; Smyth, B; Ibbotson, S; Smith, G E; Elliot, A J

2012-12-01

Syndromic surveillance is vital for monitoring public health during mass gatherings. The London 2012 Olympic and Paralympic Games represents a major challenge to health protection services and community surveillance. In response to this challenge the Health Protection Agency has developed a new syndromic surveillance system that monitors daily general practitioner out-of-hours and unscheduled care attendances. This new national system will fill a gap identified in the existing general practice-based syndromic surveillance systems by providing surveillance capability of general practice activity during evenings/nights, over weekends and public holidays. The system will complement and supplement the existing tele-health phone line, general practitioner and emergency department syndromic surveillance systems. This new national system will contribute to improving public health reassurance, especially to meet the challenges of the London 2012 Olympic and Paralympic Games.

Application of Hybrid Real-Time Power System Simulator for Designing and Researching of Relay Protection and Automation

NASA Astrophysics Data System (ADS)

Borovikov, Yu S.; Sulaymanov, A. O.; Andreev, M. V.

2015-10-01

Development, research and operation of smart grids (SG) with active-adaptive networks (AAS) are actual tasks for today. Planned integration of high-speed FACTS devices greatly complicates complex dynamic properties of power systems. As a result the operating conditions of equipment of power systems are significantly changing. Such situation creates the new actual problem of development and research of relay protection and automation (RPA) which will be able to adequately operate in the SGs and adapt to its regimes. Effectiveness of solution of the problem depends on using tools - different simulators of electric power systems. Analysis of the most famous and widely exploited simulators led to the conclusion about the impossibility of using them for solution of the mentioned problem. In Tomsk Polytechnic University developed the prototype of hybrid multiprocessor software and hardware system - Hybrid Real-Time Power System Simulator (HRTSim). Because of its unique features this simulator can be used for solution of mentioned tasks. This article introduces the concept of development and research of relay protection and automation with usage of HRTSim.

Study of structural active cooling and heat sink systems for space shuttle

NASA Technical Reports Server (NTRS)

1972-01-01

This technology investigation was conducted to evaluate the feasibility of a number of thermal protection systems (TPS) concepts which are alternate candidates to the space shuttle baseline TPS. Four independent tasks were performed. Task 1 consisted of an in-depth evaluation of active structural cooling of the space shuttle orbiter. In Task 2, heat sink concepts for the booster were studied to identify and postulate solutions for design problems unique to heat sink TPS. Task 3 consisted of a feasibility demonstration test of a phase change material (PCM) incorporated into a reusable surface insulation (RSI) thermal protection system for the shuttle orbiter. In Task 4 the feasibility of heat pipes for stagnation region cooling was studied for the booster and the orbiter. Designs were developed for the orbiter leading edge and used in trade studies of leading edge concepts. At the time this program was initiated, a 2-stage fully reusable shuttle system was envisioned; therefore, the majority of the tasks were focused on the fully reusable system environments. Subsequently, a number of alternate shuttle system approaches, with potential for reduced shuttle system development funding requirements, were proposed. Where practicable, appropriate shifts in emphasis and task scoping were made to reflect these changes.

Integration of planetary protection activities

NASA Technical Reports Server (NTRS)

Race, Margaret S.

1995-01-01

For decades, NASA has been concerned about the protection of planets and other solar system bodies from biological contamination. Its policies regarding biological contamination control for outbound and inbound planetary spacecraft have evolved to focus on three important areas: (1) the preservation of celestial objects and the space environment; (2) protection of Earth from extraterrestrial hazards; and (3) ensuring the integrity of its scientific investigations. Over the years as new information has been obtained from planetary exploration and research, planetary protection parameters and policies have been modified accordingly. The overall focus of research under this cooperative agreement has been to provide information about non-scientific and societal factors related to planetary protection and use it in the planning and implementation phases of future Mars sample return missions.

76 FR 48184 - Notice of Permit Applications Received Under the Antarctic Conservation Act of 1978

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-08

... developed regulations for the establishment of a permit system for various activities in Antarctica and... establish such a permit system to designate Antarctic Specially Protected Areas. The applications received... established in 1986 studying the foraging ecology, population dynamics, census and reproductive success and...

Legacy STORET Level 5 | STORET Legacy Data Center | US ...

EPA Pesticide Factsheets

2007-05-16

The U.S. Environmental Protection Agency (EPA) maintains two data management systems containing water quality information for the nation's waters: the Legacy Data Center (LDC), and STORET. The LDC is a static, archived database and STORET is an operational system actively being populated with water quality data.

76 FR 78673 - New Agency Information Collection Activity Under OMB Review: Exercise Information System (EXIS)

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-19

...- accessible knowledge-management system developed by TSA serving stakeholders--industry, port authorities... Management and Budget (OMB) for review and approval under the Paperwork Reduction Act (PRA). The ICR... comments. The first comment was from a contractor in the Infrastructure Protection Disaster Management...

76 FR 19333 - Commission Information Collection Activities (FERC-725B); Comment Request; Submitted for OMB Review

Federal Register 2010, 2011, 2012, 2013, 2014

2011-04-07

... the Bulk-Power System to comply with specific requirements to safeguard critical cyber assets.\\2\\ These standards help protect the nation's Bulk-Power System against potential disruptions from cyber... recordkeeping requirements. Specifically, CIP- 008-1 requires responsible entities to report cyber security...

42 CFR 84.300 - Closed-circuit escape respirator; description.

Code of Federal Regulations, 2012 CFR

2012-10-01

... OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES... the size of a water canteen, that employ either compressed oxygen with a chemical system for removing...

42 CFR 84.300 - Closed-circuit escape respirator; description.

Code of Federal Regulations, 2014 CFR

2014-10-01

... OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES... the size of a water canteen, that employ either compressed oxygen with a chemical system for removing...

42 CFR 84.300 - Closed-circuit escape respirator; description.

Code of Federal Regulations, 2013 CFR

2013-10-01

... OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES... the size of a water canteen, that employ either compressed oxygen with a chemical system for removing...

Food protection activities of the Pan American Health Organization.

PubMed

1994-03-01

One of the most widespread health problems in the Caribbean and Latin America is contaminated food and foodborne illness. The Pan American Health Organization (PAHO) has been a major force in activities to strengthen food protection. The program within the regional Program of Technical Cooperation is administered by the Veterinary Public Health program and under the guidance of the Pan American Institute for Food protection and Zoonoses in Buenos Aires, Argentina. A food action plan for 1986-90 was established at the 1986 Pan American Sanitary Conference, and extended to cover 1991-95. Program activities during the 1990s covered cholera, epidemiologic surveillance, street food vendors, shellfish poisoning, meat, national programs, information systems, air catering, food irradiation, and tourism. The action plan for 1991-95 promoted greater political support and cooperation within and between related sectors and institutions, management, and education. The aims were to organize national integrated programs, to strengthen laboratory services, to strengthen inspection services, to establish epidemiologic surveillance systems, and to promote food protection through community participation. Program activities included the initiatives of the Veterinary Public Health Program in 1991 to distribute literature on the transmission of cholera by foods. Studies were conducted in Bolivia, Colombia, and Peru on food contamination. Microbiologists received training on standard methods for detecting Vibrio cholerae in foods. A working group of experts from 10 countries examined the issues and produced a guide for investigating the incidence of foodborne disease. PAHO has contributed to the formation of an Inter-American Network for Epidemiologic Surveillance of Foodborne Diseases. PAHO has worked to improve hygienic practices among street food vendors. Seminars on paralytic shellfish poisoning were conducted in 1990; the outcome was a network working to strengthen national surveillance programs. The safety and quality of meat products was strengthened through the 3-week training course in 1992 on detection of residues of anabolic agents in meat and poultry. Mexico has received technical assistance in strengthening their food protection program. Caribbean conferences were held on strengthening training and surveillance.

Protection of tokamak plasma facing components by a capillary porous system with lithium

NASA Astrophysics Data System (ADS)

Lyublinski, I.; Vertkov, A.; Mirnov, S.; Lazarev, V.

2015-08-01

Development of plasma facing material (PFM) based on the Capillary-Porous System (CPS) with lithium and activity on realization of lithium application strategy are addressed to meet the challenges under the creation of steady-state tokamak fusion reactor and fusion neutron source. Presented overview of experimental study of lithium CPS in plasma devices demonstrates the progress in protection of tokamak plasma facing components (PFC) from damage, stabilization and self-renewal of liquid lithium surface, elimination of plasma pollution and lithium accumulation in tokamak chamber. The possibility of PFC protection from the high power load related to cooling of the tokamak boundary plasma by radiation of non-fully stripped lithium ions supported by experimental results. This approach demonstrated in scheme of closed loops of Li circulation in the tokamak vacuum chamber and realized in a series of design of tokamak in-vessel elements.

Data fusion concept in multispectral system for perimeter protection of stationary and moving objects

NASA Astrophysics Data System (ADS)

Ciurapiński, Wieslaw; Dulski, Rafal; Kastek, Mariusz; Szustakowski, Mieczyslaw; Bieszczad, Grzegorz; Życzkowski, Marek; Trzaskawka, Piotr; Piszczek, Marek

2009-09-01

The paper presents the concept of multispectral protection system for perimeter protection for stationary and moving objects. The system consists of active ground radar, thermal and visible cameras. The radar allows the system to locate potential intruders and to control an observation area for system cameras. The multisensor construction of the system ensures significant improvement of detection probability of intruder and reduction of false alarms. A final decision from system is worked out using image data. The method of data fusion used in the system has been presented. The system is working under control of FLIR Nexus system. The Nexus offers complete technology and components to create network-based, high-end integrated systems for security and surveillance applications. Based on unique "plug and play" architecture, system provides unmatched flexibility and simplistic integration of sensors and devices in TCP/IP networks. Using a graphical user interface it is possible to control sensors and monitor streaming video and other data over the network, visualize the results of data fusion process and obtain detailed information about detected intruders over a digital map. System provides high-level applications and operator workload reduction with features such as sensor to sensor cueing from detection devices, automatic e-mail notification and alarm triggering.

Economic efficiency of countries' clinical review processes and competitiveness on the market of human experimentation.

PubMed

Ippoliti, Roberto

2013-01-01

Clinical research is a specific phase of pharmaceutical industry's production process in which companies test candidate drugs on patients to collect clinical evidence about safety and effectiveness. Information is essential to obtain manufacturing authorization from the national drug agency and, in this way, make profits on the market. Considering this activity, however, the public stakeholder has to face a conflict of interests. On the one side, there is society's necessity to make advances in medicine and, of course, to promote pharmaceutical companies' investments in this specific phase (new generation). On the other side, there is the duty to protect patients involved in these experimental treatments (old generation). To abide by this moral duty, a protection system was developed through the years, based on two legal institutions: informed consent and institutional review board. How should an efficient protection system that would take human experimentation into account be shaped? Would it be possible for the national protection system of patients' rights to affect the choice of whether to develop a clinical trial in a given country or not? Looking at Europe and considering a protection system that is shaped around institutional review boards, this article is an empirical work that tries to give answers to these open questions. It shows how a protection system that can minimize the time necessary to start a trial can positively affect pharmaceutical clinical research, that is, the choice of pharmaceutical companies to start innovative medical treatments in a given country. Copyright © 2013 International Society for Pharmacoeconomics and Outcomes Research (ISPOR). Published by Elsevier Inc. All rights reserved.

Bee venom phospholipase A2 induces a primary type 2 response that is dependent on the receptor ST2 and confers protective immunity

PubMed Central

Palm, Noah W.; Rosenstein, Rachel K.; Yu, Shuang; Schenten, Dominik; Florsheim, Esther; Medzhitov, Ruslan

2013-01-01

SUMMARY Venoms consist of toxic components that are delivered to their victims via bites or stings. Venoms also represent a major class of allergens in humans. Phospholipase A2 (PLA2) is a conserved component of venoms from multiple species and is the major allergen in bee venom. Here we examined how bee venom PLA2 is sensed by the innate immune system and induces a type 2 immune response in mice. We found that bee venom PLA2 induced a T helper type 2 (Th2) cell-type response and group 2 innate lymphoid cell activation via the enzymatic cleavage of membrane phospholipids and release of interleukin-33. Furthermore, we showed that the IgE response to PLA2 could protect mice from future challenge with a near-lethal dose of PLA2. These data suggest that the innate immune system can detect the activity of a conserved component of venoms and induce a protective immune response against a venom toxin. PMID:24210353

Sulforaphane prevents microcystin-LR-induced oxidative damage and apoptosis in BALB/c mice.

PubMed

Sun, Xiaoyun; Mi, Lixin; Liu, Jin; Song, Lirong; Chung, Fung-Lung; Gan, Nanqin

2011-08-15

Microcystins (MCs), the products of blooming algae Microcystis, are waterborne environmental toxins that have been implicated in the development of liver cancer, necrosis, and even fatal intrahepatic bleeding. Alternative protective approaches in addition to complete removal of MCs in drinking water are urgently needed. In our previous work, we found that sulforaphane (SFN) protects against microcystin-LR (MC-LR)-induced cytotoxicity by activating the NF-E2-related factor 2 (Nrf2)-mediated defensive response in human hepatoma (HepG2) and NIH 3T3 cells. The purpose of this study was to investigate and confirm efficacy the SFN-induced multi-mechanistic defense system against MC-induced hepatotoxicity in an animal model. We report that SFN protected against MC-LR-induced liver damage and animal death at a nontoxic and physiologically relevant dose in BALB/c mice. The protection by SFN included activities of anti-cytochrome P450 induction, anti-oxidation, anti-inflammation, and anti-apoptosis. Our results suggest that SFN may protect mice against MC-induced hepatotoxicity. This raises the possibility of a similar protective effect in human populations, particularly in developing countries where freshwaters are polluted by blooming algae. Copyright © 2011 Elsevier Inc. All rights reserved.

Activation of the Nrf2-ARE pathway by siRNA knockdown of Keap1 reduces oxidative stress and provides partial protection from MPTP-mediated neurotoxicity.

PubMed

Williamson, Tracy P; Johnson, Delinda A; Johnson, Jeffrey A

2012-06-01

Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that binds to the antioxidant response element, a cis-acting regulatory element that increases expression of detoxifying enzymes and antioxidant proteins. Kelch-like ECH associating protein 1 (Keap1) protein is a negative regulator of Nrf2. Previous work has shown that genetic overexpression of Nrf2 is protective in vitro and in vivo. To modulate the Nrf2-ARE system without overexpressing Nrf2, we used short interfering RNA (siRNA) directed against Keap1. Keap1 siRNA administration in primary astrocytes increased the levels of Nrf2-ARE driven genes and protected against oxidative stress. Moreover, Keap1 siRNA resulted in a persistent upregulation of the Nrf2-ARE pathway and protection against oxidative stress in primary astrocytes. Keap1 siRNA injected into the striatum was also modestly protective against MPTP-induced dopaminergic terminal damage. These data indicate that activation of endogenous intracellular levels of Nrf2 is sufficient to protect in models of oxidative stress and Parkinson's disease. Copyright © 2012 Elsevier Inc. All rights reserved.

The protective effects of ginsenosides on human erythrocytes against hemin-induced hemolysis.

PubMed

Li, Guo-Xiang; Liu, Zai-Qun

2008-03-01

Panax ginseng has been used in traditional Chinese medicine to enhance stamina and capacity to deal with fatigue and physical stress. Many reports have been devoted to the effects of ginsenosides on many in vitro or in vivo experimental systems. The major aim of this work is to investigate the protective effects of 12 individual ginsenosides including Rb1, Rb3, Rc, Rd, Re, Rg1, Rg2, Rg3, Rh1, Rh2, R1 and pseudoginsenoside F11, together with the central structures of aforementioned ginsenosides, 20(S)-protopanaxadiol (PD) and 20(S)-protopanaxatriol (PT), on hemin-induced hemolysis of human erythrocytes. This is because hemin can induce hemolysis by accelerating the potassium leakage, dissociating skeletal proteins and prohibiting some enzymes in the membrane of erythrocyte. Thus, the structure-activity-relationship (SAR) between ginsenosides and protective effects has been screened in this in vitro experimental system. It is found that Rh2 and Rg3 intensify hemolysis in the presence of hemin, and initiate hemolysis even in the absence of hemin. All the other ginsenosides protect human erythrocytes against hemin-induced hemolysis more or less. The overall sequence is Rc>Rd>Re approximately Rb1>Rg1 approximately Rh1>Rb3 approximately Rg2 approximately R1 approximately F11 approximately PT. In addition, the protective effects of PD and PT have been detected, and found that PD promotes hemolysis appreciably, whereas PT protects erythrocytes efficiently. Moreover, the protective effects of PT ginsenosides are similar to PT itself, and the protective effects of PD ginsenosides vary remarkably, demonstrating that the positions of the sugar moieties make the protective activities of ginsenosides complicated. Especially, sugar moiety at 20-position is critical for PD ginsenosides to inhibit hemolysis, whereas hydroxyl group at 3-position is important for PT ginsenosides. The present result may be useful for understanding the SAR of ginsenosides.

Capacity and principles of participation of the provincial fund of environmental protection and water management in Cracow in Cracow program of elimination of low emission sources

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolek, K.; Sarzynski, H.

1995-12-31

In general, the principles of environmental protection was determined by Law issued January 31, 1980. Certain detailed solutions have been included in several amendments in subsequent years and the uniformed text of the Law on Environmental Protection and Creation was published in 1994. The Provincial Fund of Environmental Protection and Water Management was established in 1989 but until 1993 the Fund has no legal status. The main purpose of the creation of such fund was to assign certain financial means to the defined tasks related to environmental protection. This way the fund accumulates financial means from the fees paid formore » the usage of the natural environmental for business purposes and from penalties becoming due in the case of non-observance of the environmental protection standards. On the other hand, the Fund spends money for tasks in the field of environmental protection requiring urgent implementation. It should be added that - after few amendments brought into force - the Provincial Funds are able to assign a greater amount of money to the implementation of these tasks. The basic purposes of Provincial Fund activity, defined by Law, determine the policy and criteria of the selection of undertaking. This is also a base for making programs of activity and for creation of the list of priorities. The environmental protection problems in the individual provinces are different. Therefore, the scope of works partly financed by the Fund is very differentiated both in essence and in the method of financing. The former system of subsidies is now being replaced with a wide range of partial financing of undertakings in the field of environmental protection. The system of selection of these undertakings has been changed essentially. The selection of tasks and methods of their financing is based on economic criteria.« less

Secure Database Management Study.

DTIC Science & Technology

1978-12-01

covers cases Involving indus- trial economics (e.g., Industrial spies) and commercial finances (e.g., fraud). Priv¢j--Protection of date about people...California, Berke - lay [STONM76aI. * The approach to protection taken in INGRE (STOM74| has attracted a lot of Interest* Queries, in a high level query...Material Command Support Activity (NMCSA), and another DoD agency, Cullinane Corporation developed a prototype version of the IDS database system on a

Fulfilling the pedestrian protection directive using a long-wavelength infrared camera designed to meet both performance and cost targets

NASA Astrophysics Data System (ADS)

Källhammer, Jan-Erik; Pettersson, Håkan; Eriksson, Dick; Junique, Stéphane; Savage, Susan; Vieider, Christian; Andersson, Jan Y.; Franks, John; Van Nylen, Jan; Vercammen, Hans; Kvisterøy, Terje; Niklaus, Frank; Stemme, Göran

2006-04-01

Pedestrian fatalities are around 15% of the traffic fatalities in Europe. A proposed EU regulation requires the automotive industry to develop technologies that will substantially decrease the risk for Vulnerable Road Users when hit by a vehicle. Automatic Brake Assist systems, activated by a suitable sensor, will reduce the speed of the vehicle before the impact, independent of any driver interaction. Long Wavelength Infrared technology is an ideal candidate for such sensors, but requires a significant cost reduction. The target necessary for automotive serial applications are well below the cost of systems available today. Uncooled bolometer arrays are the most mature technology for Long Wave Infrared with low-cost potential. Analyses show that sensor size and production yield along with vacuum packaging and the optical components are the main cost drivers. A project has been started to design a new Long Wave Infrared system with a ten times cost reduction potential, optimized for the pedestrian protection requirement. It will take advantage of the progress in Micro Electro-Mechanical Systems and Long Wave Infrared optics to keep the cost down. Deployable and pre-impact braking systems can become effective alternatives to passive impact protection systems solutions fulfilling the EU pedestrian protection regulation. Low-cost Long Wave Infrared sensors will be an important enabler to make such systems cost competitive, allowing high market penetration.

Quench Detection and Protection for High Temperature Superconducting Transformers by Using the Active Power Method

NASA Astrophysics Data System (ADS)

Nanato, N.; Kobayashi, Y.

AC high temperature superconducting (HTS) coils have been developed for transformers, motors and so on. Quench detection and protection system are essential for safety operations of the AC HTS facilities. The balance voltage method is universally used for the quench detection and protection, however especially for AC operations, the method has risks in terms of high voltage sparks. Because the method needs a voltage tap soldered to a midpoint of the coil winding and the AC HTS facilities generally operate at high voltages and therefore high voltage sparks may occur at the midpoint with no insulation. We have proposed the active power method for the quench detection and protection. The method requires no voltage tap on the midpoint of the coil winding and therefore it has in-built effectiveness for the AC HTS facilities. In this paper, we show that the method can detect the quench in an HTS transformer and moreover our proposed quench protection circuits which consist of thyristors are simple and useful for the AC HTS facilities.

40 CFR 60.2735 - Is there a minimum amount of monitoring data I must obtain?

Code of Federal Regulations, 2012 CFR

2012-07-01

... monitoring malfunctions, associated repairs, and required quality assurance or quality control activities for... periods, or required monitoring system quality assurance or control activities in calculations used to... 40 Protection of Environment 7 2012-07-01 2012-07-01 false Is there a minimum amount of monitoring...

75 FR 76979 - Agency Information Collection Activities: Submission to OMB for Review and Approval; Comment...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-12-10

... persons and from American Indian and Alaskan Native Village community water systems and not-for-profit non... Activities: Submission to OMB for Review and Approval; Comment Request; 2011 Drinking Water Infrastructure...: Robert Barles, Drinking Water Protection Division (Mail Code 4606M), Office of Ground Water and Drinking...

Protecting Small Communities Through Domestic Policing: Adopting an Early Warning System to Recognize Potential Terrorist Activity

DTIC Science & Technology

2009-09-01

product of program activities or services used. For example, police officers have the authority to use force against the public such as their power......estimate or any other aspect of this collection of information, including suggestions for reducing this burden, to Washington Headquarters Services

Coenzyme Q{sub 10} and alpha-tocopherol protect against amitriptyline toxicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cordero, Mario D.; Dpto. Citologia e Histologia Normal y Patologica, Facultad de Medicina. Universidad de Sevilla. 41009 Sevilla; Moreno-Fernandez, Ana Maria

Since amitriptyline is a very frequently prescribed antidepressant drug, it is not surprising that amitriptyline toxicity is relatively common. Amitriptyline toxic systemic effects include cardiovascular, autonomous nervous, and central nervous systems. To understand the mechanisms of amitriptyline toxicity we studied the cytotoxic effects of amitriptyline treatment on cultured primary human fibroblasts and zebrafish embryos, and the protective role of coenzyme Q{sub 10} and alpha-tocopherol, two membrane antioxidants. We found that amitriptyline treatment induced oxidative stress and mitochondrial dysfunction in primary human fibroblasts. Mitochondrial dysfunction in amitriptyline treatment was characterized by reduced expression levels of mitochondrial proteins and coenzyme Q{sub 10},more » decreased NADH:cytochrome c reductase activity, and a drop in mitochondrial membrane potential. Moreover, and as a consequence of these toxic effects, amitriptyline treatment induced a significant increase in apoptotic cell death activating mitochondrial permeability transition. Coenzyme Q{sub 10} and alpha-tocopherol supplementation attenuated ROS production, lipid peroxidation, mitochondrial dysfunction, and cell death, suggesting that oxidative stress affecting cell membrane components is involved in amitriptyline cytotoxicity. Furthermore, amitriptyline-dependent toxicity and antioxidant protection were also evaluated in zebrafish embryos, a well established vertebrate model to study developmental toxicity. Amitriptyline significantly increased embryonic cell death and apoptosis rate, and both antioxidants provided a significant protection against amitriptyline embryotoxicity.« less

Pharmacological actions and therapeutic applications of Salvia miltiorrhiza depside salt and its active components.

PubMed

Wu, Wen-yu; Wang, Yi-ping

2012-09-01

Salvia miltiorrhiza, a traditional medical herb known as danshen, has been widely used in China to improve blood circulation, relieve blood stasis, and treat coronary heart disease. S miltiorrhiza depside salt is a novel drug recently developed at the Shanghai Institute of Materia Medica; it contains magnesium lithospermate B (MLB) and its analogs, rosmarinic acid (RA) and lithospermic acid (LA), as active components. The drug has been used in the clinic to improve blood circulation and treat coronary heart disease. The pharmacological effects of the depside salt from S miltiorrhiza and its components have been extensively investigated. Experimental studies have demonstrated that magnesium lithospermate B possesses a variety of biological activities, especially protective effects in the cardiovascular system such as attenuation of atherosclerosis and protection against myocardial ischemia-reperfusion injury. Rosmarinic acid and lithospermic acid also show beneficial effects on the cardiovascular system. This paper reviews the recent findings regarding the mechanisms underlying the pharmacological actions of the active components of S miltiorrhiza depside salt, based on published works and our own observations.

Graphdiyne Nanoparticles with High Free Radical Scavenging Activity for Radiation Protection.

PubMed

Xie, Jiani; Wang, Ning; Dong, Xinghua; Wang, Chengyan; Du, Zhen; Mei, Linqiang; Yong, Yuan; Huang, Changshui; Li, Yuliang; Gu, Zhanjun; Zhao, Yuliang

2018-03-06

Numerous carbon networks materials comprised of benzene moieties, such as graphene and fullerene, have held great fascination for radioprotection because of their acknowledged good biocompatibility and strong free radical scavenging activity derived from their delocalized π-conjugated structure. Recently, graphdiyne, a new emerging carbon network material consisting of a unique chemical structure of benzene and acetylenic moieties, has gradually attracted attention in many research fields. Encouraged by its unique structure with strong conjugated π-system and highly reactive diacetylenic linkages, graphdiyne might have free radical activity and can thus be used as a radioprotector, which has not been investigated so far. Herein, for the first time, we synthesized bovine serum albumin (BSA)-modified graphdiyne nanoparticles (graphdiyne-BSA NPs) to evaluate their free radical scavenging ability and investigate their application for radioprotection both in cell and animal models. In vitro studies indicated that the graphdiyne-BSA NPs could effectively eliminate the free-radicals, decrease radiation-induced DNA damage in cells, and improve the viability of cells under ionizing radiation. In vivo experiments showed that the graphdiyne-BSA NPs could protect the bone marrow DNA of mice from radiation-induced damage and make the superoxide dismutase (SOD) and malondialdehyde (MDA) (two kinds of vital indicators of radiation-induced injury) recover back to normal levels. Furthermore, the good biocompatibility and negligible systemically toxicity responses of the graphdiyne-BSA NPs to mice were verified. All these results manifest the good biosafety and radioprotection activity of graphdiyne-BSA NPs to normal tissues. Therefore, our studies not only provide a new radiation protection platform based on graphdiyne for protecting normal tissues from radiation-caused injury but also provide a promising direction for the application of graphdiyne in the biomedicine field.

Evaluation of Antioxidant and DNA Damage Protection Activity of the Hydroalcoholic Extract of Desmostachya bipinnata L. Stapf

PubMed Central

Bhimathati, Solomon Sunder Raj

2014-01-01

Desmostachya bipinnata Stapf (Poaceae/Gramineae) is an official drug of ayurvedic pharmacopoeia. Various parts of this plant were used extensively in traditional and folklore medicine to cure various human ailments. The present study was aimed to evaluate the antioxidant and DNA damage protection activity of hydroalcoholic extract of Desmostachya bipinnata both in vitro and in vivo, to provide scientific basis for traditional usage of this plant. The extract showed significant antioxidant activity in a dose-dependent manner with an IC50 value of 264.18 ± 3.47 μg/mL in H2O2 scavenging assay and prevented the oxidative damage to DNA in presence of DNA damaging agent (Fenton's reagent) at a concentration of 50 μg/mL. Also, the presence of extract protected yeast cells in a dose-dependent manner against DNA damaging agent (Hydroxyurea) in spot assay. Moreover, the presence of extract exhibited significant antioxidant activity in vivo by protecting yeast cells against oxidative stressing agent (H2O2). Altogether, the results of current study revealed that Desmostachya bipinnata is a potential source of antioxidants and lends pharmacological credence to the ethnomedical use of this plant in traditional system of medicine, justifying its therapeutic application for free-radical-induced diseases. PMID:24574873

Evaluation of antioxidant and DNA damage protection activity of the hydroalcoholic extract of Desmostachya bipinnata L. Stapf.

PubMed

Golla, Upendarrao; Bhimathati, Solomon Sunder Raj

2014-01-01

Desmostachya bipinnata Stapf (Poaceae/Gramineae) is an official drug of ayurvedic pharmacopoeia. Various parts of this plant were used extensively in traditional and folklore medicine to cure various human ailments. The present study was aimed to evaluate the antioxidant and DNA damage protection activity of hydroalcoholic extract of Desmostachya bipinnata both in vitro and in vivo, to provide scientific basis for traditional usage of this plant. The extract showed significant antioxidant activity in a dose-dependent manner with an IC50 value of 264.18±3.47  μg/mL in H2O2 scavenging assay and prevented the oxidative damage to DNA in presence of DNA damaging agent (Fenton's reagent) at a concentration of 50  μg/mL. Also, the presence of extract protected yeast cells in a dose-dependent manner against DNA damaging agent (Hydroxyurea) in spot assay. Moreover, the presence of extract exhibited significant antioxidant activity in vivo by protecting yeast cells against oxidative stressing agent (H2O2). Altogether, the results of current study revealed that Desmostachya bipinnata is a potential source of antioxidants and lends pharmacological credence to the ethnomedical use of this plant in traditional system of medicine, justifying its therapeutic application for free-radical-induced diseases.

FAK/Src family of kinases: protective or aggravating factor for ischemia reperfusion injury in nervous system?

PubMed

Bikis, Christos; Moris, Demetrios; Vasileiou, Ioanna; Patsouris, Eustratios; Theocharis, Stamatios

2015-04-01

The focal adhesion kinase (FAK) and the Src families of kinases are subfamilies of the non-receptor protein tyrosine kinases. FAK activity is regulated by gene amplification, alternative splicing and phosporylation/dephosphorylation. FAK/Src complex has been found to participate through various pathways in neuronal models of ischemia-reperfusion injury (IRI) with conflicting results. The aim of the present review is to summarize the currently available data on this subject. The MEDLINE/PubMed database was searched for publications with the medical subject heading IRI and FAK and/or Src, nervous system. We restricted our search till 2014. We identified 93 articles that were available in English as abstracts or/and full-text articles that were deemed appropriate for our review. FAK has been found to have a beneficial preconditioning effect on IRI through activation via the protein kinase C (PKC) pathway by anesthetic agents. Of great importance are the interactions between FAK/Src and VEGF that has been already detected as a protective mean for IRI. The effect of VEGF administration might depend on dose as well as on time of administration. A Ca(2+)/calmodulin-dependent protein kinase II or PKC inhibitors seem to have protective effects on IRI by inhibiting ion channels activation.

Long-term antibody memory induced by synthetic peptide vaccination is protective against Streptococcus pyogenes infection and is independent of memory T-cell help

PubMed Central

Pandey, Manisha; Wykes, Michelle N; Hartas, Jon; Good, Michael F; Batzloff, Michael R

2013-01-01

Streptococcus pyogenes (group A streptococcus; GAS) is a leading human pathogen associated with a diverse array of mucosal and systemic infections. Vaccination with J8, a conserved region synthetic peptide derived from the M-protein of GAS and containing only 12 amino acids from GAS, when conjugated to DT, has been shown to protect mice against a lethal GAS challenge. Protection has been previously shown to be antibody-mediated. J8 does not contain a dominant GAS-specific T-cell epitope. The current study examined long-term antibody memory and dissected the role of B and T-cells. Our results demonstrated that vaccination generates specific memory B-cells and long-lasting antibody responses. The memory B-cell response can be activated following boost with antigen or limiting numbers of whole bacteria. We further show that these memory responses protect against systemic infection with GAS. T-cell help is required for activation of memory B-cells but can be provided by naïve T-cells responding directly to GAS at the time of infection. Thus, individuals whose T-cells do not recognize the short synthetic peptide in the vaccine will be able to generate a protective and rapid memory antibody response at the time of infection. These studies significantly strengthen previous findings, which showed that protection by the J8-DT vaccine is antibody-mediated and suggest that in vaccine design for other organisms the source of T-cell help for antibody responses need not be limited to sequences from the organism itself. PMID:23401589

The gnotobiotic brine shrimp (Artemia franciscana) model system reveals that the phenolic compound pyrogallol protects against infection through its prooxidant activity.

PubMed

Baruah, Kartik; Duy Phong, Ho Phuong Pham; Norouzitallab, Parisa; Defoirdt, Tom; Bossier, Peter

2015-12-01

The phenolic compound pyrogallol is the functional unit of many polyphenols and currently there has been a growing interest in using this compound in human and animal health owing to its health-promoting effects. The biological actions of pyrogallol moiety (and polyphenols) in inducing health benefitting effects have been studied; however, the mechanisms of action remain unclear yet. Here, we aimed at unravelling the underlying mechanism of action behind the protective effects of pyrogallol against bacterial infection by using the gnotobiotically-cultured brine shrimp Artemia franciscana and pathogenic bacteria Vibrio harveyi as host-pathogen model system. The gnotobiotic test system represents an exceptional system for carrying out such studies because it eliminates any possible interference of microbial communities (naturally present in the experimental system) in mechanistic studies and furthermore facilitates the interpretation of the results in terms of a cause effect relationship. We provided clear evidences suggesting that pyrogallol pretreament, at an optimum concentration, induced protective effects in the brine shrimp against V. harveyi infection. By pretreating brine shrimp with pyrogallol in the presence or absence of an antioxidant enzyme mixture (catalase and superoxide dismutase), we showed that the Vibrio-protective effect of the compound was caused by its prooxidant action (e.g. generation of hydrogen peroxide, H2O2). We showed further that generation of prooxidant is linked to the induction of heat shock protein Hsp70, which is involved in eliciting the prophenoloxidase and transglutaminase immune responses. The ability of pyrogallol to induce protective immunity makes it a potential natural protective agent that might be a potential preventive modality for different host-pathogen systems. Copyright © 2015 Elsevier Inc. All rights reserved.

Innate control of adaptive immunity: Beyond the three-signal paradigm

PubMed Central

Jain, Aakanksha; Pasare, Chandrashekhar

2017-01-01

Activation of cells in the adaptive immune system is a highly orchestrated process dictated by multiples cues from the innate immune system. Although the fundamental principles of innate control of adaptive immunity are well established, it is not fully understood how innate cells integrate qualitative pathogenic information in order to generate tailored protective adaptive immune responses. In this review, we discuss complexities involved in the innate control of adaptive immunity that extend beyond T cell receptor engagement, co-stimulation and priming cytokine production but are critical for generation of protective T cell immunity. PMID:28483987

Green Remediation Best Management Practices: Landfill Cover Systems & Energy Production

EPA Pesticide Factsheets

The U.S. Environmental Protection Agency (EPA) Principles for Greener Cleanups outline the Agency's policy for evaluating and minimizing the environmental 'footprint' of activities undertaken when cleaning up a contaminated site.

Environmental Enterprise Risk Management Benefits for a Government Contractor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linda Guinn

An often overlooked advantage that an Environmental Enterprise Risk Management System (ERMS) has to organizations is the added protection from the Civil False Claims Act (FCA) for activities under a government contract.

The platelet-activating factor acetylhydrolase gene derived from Trichoderma harzianum induces maize resistance to Curvularia lunata through the jasmonic acid signaling pathway.

PubMed

Yu, Chuanjin; Fan, Lili; Gao, Jinxin; Wang, Meng; Wu, Qiong; Tang, Jun; Li, Yaqian; Chen, Jie

2015-01-01

Platelet-activating factor acetylhydrolase (PAF-AH) derived from Trichoderma harzianum was upregulated by the interaction of T. harzianum with maize roots or the foliar pathogen Curvularia lunata. PAF-AH was associated with chitinase and cellulase expressions, but especially with chitinase, because its activity in the KO40 transformant (PAF-AH disruption transformant) was lower, compared with the wild-type strain T28. The result demonstrated that the colonization of maize roots by T. harzianum induced systemic protection of leaves inoculated with C. lunata. Such protection was associated with the expression of inducible jasmonic acid pathway-related genes. Moreover, the data from liquid chromatography-mass spectrometry confirmed that the concentration of jasmonic acid in maize leaves was associated with the expression level of defense-related genes, suggesting that PAF-AH induced resistance to the foliar pathogen. Our findings showed that PAF-AH had an important function in inducing systemic resistance to maize leaf spot pathogen.

Considerations for NSLS-II Synchrotron Radiation Protection When Operating Damping Wigglers at Low Machine Energy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seletskiy, S.; Podobedov, B.

2015-12-30

The NSLS-II storage ring vacuum chamber, including frontends (FE) and beamlines (BL), is protected from possible damage from synchrotron radiation (SR) emitted from insertion devices (IDs) by a dedicated active interlock system (AIS). The system monitors electron beam position and angle and triggers a beam dump if the beam orbit is outside of the active interlock envelope (AIE). The AIE was calculated under the assumptions of 3 GeV beam energy and ID gaps set to their minimum operating values (i.e. “fully closed”). Recently it was proposed to perform machine studies that would ramp the stored beam energy significantly below themore » nominal operational value of 3 GeV. These studies may potentially include the use of NSLS-II damping wigglers (DWs) for electron beam emittance reduction and control.« less

[The activity of prooxidant-antioxidant system in loach embryos under the action of microwave radiation].

PubMed

Iaremchuk, M M; Dyka, M V; Sanahurs'kyĭ, D I

2014-01-01

Electromagnetic radiation (EMR) affects biological organisms, primarily on the cellular level. However, the effects of EMR at low-intensity exposure on animals and state of metabolic systems are not fully defined yet. Thus, research of microwave radiation influence on the processes of lipid peroxidation and antioxidant protection system is important for understanding the mechanisms of EMR action on the cell, in particular, and organism development on the whole. The content of lipid peroxidation products--lipid hydroperoxides, thiobarbituric acid reactive substances and the activity of antioxidant enzymes--superoxide dismutase, glutathione peroxidase and catalase in loach embryos under the action of microwave radiation (GSM-900 MHz, SAR = 1.1 Vt/kg) lasting 1; 5; 10 and 20 min during early embryogenesis were studied. It has been found that content of lipid peroxidation products in germ cells undergoes significant changes under the action of low-intensity EMR. The effect of microwave radiation (1, 5, 10 min) leads to the increase of superoxide dismutase activity, nevertheless, 20 min exposure decreased this index to the level of control values as it is shown. It has been established that EMR at frequencies used for mobile communications reduce the activity of antioxidant protection system components, especially catalase and glutathione peroxidase. The growth of catalase activity at the 10-cell stage of blastomere division (P < 0.05) is an exception. The results of two-way analysis of variance attest that microwave radiation factor causes the large part of all observable modifications.

The Protective Effects of IGF-I against β-Amyloid-related Downregulation of Hippocampal Somatostatinergic System Involve Activation of Akt and Protein Kinase A.

PubMed

Aguado-Llera, David; Canelles, Sandra; Frago, Laura M; Chowen, Julie A; Argente, Jesús; Arilla, Eduardo; Barrios, Vicente

2018-03-15

Somatostatin (SRIF), a neuropeptide highly distributed in the hippocampus and involved in learning and memory, is markedly reduced in the brain of Alzheimer's disease patients. The effects of insulin-like growth factor-I (IGF-I) against β amyloid (Aβ)-induced neuronal death and associated cognitive disorders have been extensively reported in experimental models of this disease. Here, we examined the effect of IGF-I on the hippocampal somatostatinergic system in Aβ-treated rats and the molecular mechanisms associated with changes in this peptidergic system. Intracerebroventricular Aβ25-35 administration during 14 days (300 pmol/day) to male rats increased Aβ25-35 levels and cell death and markedly reduced SRIF and SRIF receptor 2 levels in the hippocampus. These deleterious effects were associated with reduced Akt and cAMP response element-binding protein (CREB) phosphorylation and activation of c-Jun N-terminal kinase (JNK). Subcutaneous IGF-I co-administration (50 µg/kg/day) reduced hippocampal Aβ25-35 levels, cell death and JNK activation. In addition, IGF-I prevented the reduction in the components of the somatostatinergic system affected by Aβ infusion. Its co-administration also augmented protein kinase A (PKA) activity, as well as Akt and CREB phosphorylation. These results suggest that IGF-I co-administration may have protective effects on the hippocampal somatostatinergic system against Aβ insult through up-regulation of PKA activity and Akt and CREB phosphorylation. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

Failsafe automation of Phase II clinical trial interim monitoring for stopping rules.

PubMed

Day, Roger S

2010-02-01

In Phase II clinical trials in cancer, preventing the treatment of patients on a study when current data demonstrate that the treatment is insufficiently active or too toxic has obvious benefits, both in protecting patients and in reducing sponsor costs. Considerable efforts have gone into experimental designs for Phase II clinical trials with flexible sample size, usually implemented by early stopping rules. The intended benefits will not ensue, however, if the design is not followed. Despite the best intentions, failures can occur for many reasons. The main goal is to develop an automated system for interim monitoring, as a backup system supplementing the protocol team, to ensure that patients are protected. A secondary goal is to stimulate timely recording of patient assessments. We developed key concepts and performance needs, then designed, implemented, and deployed a software solution embedded in the clinical trials database system. The system has been in place since October 2007. One clinical trial tripped the automated monitor, resulting in e-mails that initiated statistician/investigator review in timely fashion. Several essential contributing activities still require human intervention, institutional policy decisions, and institutional commitment of resources. We believe that implementing the concepts presented here will provide greater assurance that interim monitoring plans are followed and that patients are protected from inadequate response or excessive toxicity. This approach may also facilitate wider acceptance and quicker implementation of new interim monitoring algorithms.

Superoxide Dismutase

PubMed Central

Lee, Edward H.; Bennett, Jesse H.

1982-01-01

An experimental chemical N-[2-(2-oxo-1-imidazolidinyl)ethyl]-N′-phenylurea (EDU), is an effective protectant against acute and chronic foliar injury due to ozone (03) when sprayed on intact leaves or supplied to the plants through soil application. An 03-sensitive snap bean cultivar (Phaseolus vulgaris L. `Bush Blue Lake 290') was systemically treated with EDU (0, 25, 50, and 100 milligrams per 15-centimeter diameter pot) to determine if EDU-induced or activated protective oxyradical and peroxyl scavenging enzymes. EDU-enhanced tolerance to O3 injury always correlated with increases in superoxide dismutase (SOD) and catalase activities in the leaves. Peroxidase levels correlated more closely with foliar injury. Greater SOD levels in young leves compared to older leaves were associated with lower ozone sensitivities in these tissues. Polyacrylamide slab gel electrophoresis separations and specific determinations of SOD activity showed that EDU-treated plants possessed markedly greater SOD activity than non-treated plants. Tolerant plant tissues may have enhanced enzyme scavenging capabilities for the protection against toxic oxyradicals. Experimental confirmation for the oxyradical theory for O3 phytotoxicity and SOD involvement in the detoxification process are presented. Images PMID:16662420

Explosion safety in industrial electrostatics

NASA Astrophysics Data System (ADS)

Szabó, S. V.; Kiss, I.; Berta, I.

2011-01-01

Complicated industrial systems are often endangered by electrostatic hazards, both from atmospheric (lightning phenomenon, primary and secondary lightning protection) and industrial (technological problems caused by static charging and fire and explosion hazards.) According to the classical approach protective methods have to be used in order to remove electrostatic charging and to avoid damages, however no attempt to compute the risk before and after applying the protective method is made, relying instead on well-educated and practiced expertise. The Budapest School of Electrostatics - in close cooperation with industrial partners - develops new suitable solutions for probability based decision support (Static Control Up-to-date Technology, SCOUT) using soft computing methods. This new approach can be used to assess and audit existing systems and - using the predictive power of the models - to design and plan activities in industrial electrostatics.

Administration of the antitumor drug mitoguazone protects normal thymocytes against spontaneous and etoposide-induced apoptosis.

PubMed

Ferioli, M E; Bottone, M G; Soldani, C; Pellicciari, C

2004-11-01

The suggestion has been made that polyamines may be involved in the control of cell death, since exceedingly high or low levels induce apoptosis in different cell systems. For a deeper insight into the relationship between apoptosis and polyamine metabolism, we investigated in vitro the effect on rat thymocytes of mitoguazone (MGBG, which inhibits S-adenosylmethionine decarboxylase, i.e. a key enzyme in the polyamine biosynthetic pathway). Thymocytes were selected as an especially suitable model system, since they undergo spontaneous apoptosis in vivo and can be easily induced to apoptose in vitro by etoposide, used here as an apoptogenic agent. MGBG protected thymocytes from both spontaneous and drug-induced apoptosis, and this protective effect was associated with a decrease in polyamine oxidase activity and total polyamine levels.

How can the auditory efferent system protect our ears from noise-induced hearing loss? Let us count the ways

NASA Astrophysics Data System (ADS)

Marshall, Lynne; Miller, Judi A. Lapsley

2015-12-01

It is a cause for some debate as to how the auditory olivocochlear (OC) efferent system could protect hearing from noise trauma. In this review, we examined physiological research to find mechanisms that could effectively attenuate the response to sound. For each purported mechanism, we indicate which part of the OC-efferent system is responsible for the function and the site of action. These mechanisms include basilar-membrane phase shifts at high stimulus levels; changes in outer-hair-cell stiffness and phase lag associated with efferent slow effects; small decreases in endocochlear potentials causing small decreases in outer- and inner-hair-cell output; low-spontaneous-rate and medium-spontaneous-rate fibers showing OC-induced decrements at high levels; auditory-nerve initial-peak reduction; OC effect increasing over minutes; cholinergic activation of anti-apoptotic pathways; and anti-excitotoxicity. There are clearly multiple opportunities for the OC-efferent system to protect the inner ear from noise trauma. From further exploration into the mechanisms outlined here, as well as to-be-discovered mechanisms, we will gain a greater understanding of the protective nature of the OC-efferent system. These findings could aid our ability to design better predictive tests for people at risk for noise-induced hearing loss.

Protective activity of green tea against free radical- and glucose-mediated protein damage.

PubMed

Nakagawa, Takako; Yokozawa, Takako; Terasawa, Katsutoshi; Shu, Seiji; Juneja, Lekh Raj

2002-04-10

Protein oxidation and glycation are posttranslational modifications that are implicated in the pathological development of many age-related disease processes. This study investigated the effects of green tea extract, and a green tea tannin mixture and its components, on protein damage induced by 2,2'-azobis(2-amidinopropane) dihydrochloride (a free radical generator) and glucose in in vitro assay systems. We found that green tea extract can effectively protect against protein damage, and showed that its action is mainly due to tannin. In addition, it was shown that the chemical structures of tannin components are also involved in this activity, suggesting that the presence of the gallate group at the 3 position plays the most important role in the protective activity against protein oxidation and glycation, and that there is also a contribution by the hydroxyl group at the 5' position in the B ring and the sterical structure. These findings demonstrate the mechanisms of the usefulness of green tea in protein oxidation- and glycation-associated diseases.

[Ecological demonstration activity and eco-civilization construction mode: review and prospects].

PubMed

Mao, Hui-ping; He, Xuan; He, Jia; Niu, Dong-jie; Bao, Cun-kuan

2013-04-01

Ecological civilization is to normalize human development behaviors to harmonize the relationships between social and ecological development and eco-environment protection. In this paper, a comparative analysis was made on the ecological demonstration activities of ecological demonstration areas led by the Ministry of Environmental Protection, exemplar cities of national environmental protection, and ecological provinces, cities, and counties. It was considered that all the ecological demonstration activities had the problems of lacking pertinence of construction goals, disordered construction subjects, inefficient construction processes, and lacking continuous incentive mechanisms of assessment. In the meantime, through the analysis of the connotations of eco-civilization, the relationships between eco-civilization and eco-demonstration constructions were approached, and the eco-civilization construction mode was put forward in terms of construction goal, construction subject, and construction processes and assessment. The construction mode included the construction goal based on regional characteristics; the synergistic cooperation of construction subjects, the expanding ways of public participation, and the establishment of evaluation system for comprehensively measuring the 'actions and results'.

Protective immune responses against West Nile virus are primed by distinct complement activation pathways.

PubMed

Mehlhop, Erin; Diamond, Michael S

2006-05-15

West Nile virus (WNV) causes a severe infection of the central nervous system in several vertebrate animals including humans. Prior studies have shown that complement plays a critical role in controlling WNV infection in complement (C) 3(-/-) and complement receptor 1/2(-/-) mice. Here, we dissect the contributions of the individual complement activation pathways to the protection from WNV disease. Genetic deficiencies in C1q, C4, factor B, or factor D all resulted in increased mortality in mice, suggesting that all activation pathways function together to limit WNV spread. In the absence of alternative pathway complement activation, WNV disseminated into the central nervous system at earlier times and was associated with reduced CD8+ T cell responses yet near normal anti-WNV antibody profiles. Animals lacking the classical and lectin pathways had deficits in both B and T cell responses to WNV. Finally, and somewhat surprisingly, C1q was required for productive infection in the spleen but not for development of adaptive immune responses after WNV infection. Our results suggest that individual pathways of complement activation control WNV infection by priming adaptive immune responses through distinct mechanisms.

Protection of germline gene expression by the C. elegans Argonaute CSR-1.

PubMed

Wedeles, Christopher J; Wu, Monica Z; Claycomb, Julie M

2013-12-23

In Caenorhabditis elegans, the Piwi-interacting small RNA (piRNA)-mediated germline surveillance system encodes more than 30,000 unique 21-nucleotide piRNAs, which silence a variety of foreign nucleic acids. What mechanisms allow endogenous germline-expressed transcripts to evade silencing by the piRNA pathway? One likely candidate in a protective mechanism is the Argonaute CSR-1, which interacts with 22G-small RNAs that are antisense to nearly all germline-expressed genes. Here, we use an in vivo RNA tethering assay to demonstrate that the recruitment of CSR-1 to a transcript licenses expression of the transcript, protecting it from piRNA-mediated silencing. Licensing occurs mainly at the level of transcription, as we observe changes in pre-mRNA levels consistent with transcriptional activation when CSR-1 is tethered. Furthermore, the recruitment of CSR-1 to a previously silenced locus transcriptionally activates its expression. Together, these results demonstrate a rare positive role for an endogenous Argonaute pathway in heritably licensing and protecting germline transcripts.

Water Environment Assessment as an Ecological Red Line Management Tool for Marine Wetland Protection.

PubMed

Zhang, Yinan; Chu, Chunli; Liu, Lei; Xu, Shengguo; Ruan, Xiaoxue; Ju, Meiting

2017-08-02

A 'red line' was established, identifying an area requiring for ecological protection in Tianjin, China. Within the protected area of the red line area, the Qilihai wetland is an important ecotope with complex ecological functions, although the ecosystem is seriously disturbed due to anthropogenic activities in the surrounding areas. This study assesses the water quality status of the Qilihai wetlands to identify the pollution sources and potential improvements based on the ecological red line policy, to improve and protect the waters of the Qilihai wetlands. An indicator system was established to assess water quality status using single factor evaluation and a comprehensive evaluation method, supported by data from 2010 to 2013. Assessment results show that not all indicators met the requirement of the Environmental Quality Standards for Surface Water (GB3838-2002) and that overall, waters in the Qilihai wetland were seriously polluted. Based on these findings we propose restrictions on all polluting anthropogenic activities in the red line area and implementation of restoration projects to improve water quality.

Sildenafil protects against 3-nitropropionic acid neurotoxicity through the modulation of calpain, CREB, and BDNF.

PubMed

Puerta, Elena; Hervias, Isabel; Barros-Miñones, Lucía; Jordan, Joaquin; Ricobaraza, Ana; Cuadrado-Tejedor, Mar; García-Osta, Ana; Aguirre, Norberto

2010-05-01

In this study we tested whether phosphodiesterase 5 (PDE5) inhibitors, sildenafil and vardenafil, would afford protection against 3-nitropropionic acid (3NP), which produces striatal lesions that closely mimic some of the neuropathological features of Huntington's Disease (HD). The neurotoxin was given over 5 days by constant systemic infusion using osmotic minipumps. Animals treated with PDE5 inhibitors (sildenafil or vardenafil) showed improved neurologic scores, reduced the loss of striatal DARPP-32 protein levels and lesion volumes, and decreased calpain activation produced by 3NP. This protective effect was independent of changes in 3NP-induced succinate dehydrogenase inhibition. Furthermore, striatal p-CREB levels along with the expression of BDNF were significantly increased in sildenafil-treated rats. In summary, PDE5 inhibitors protected against 3NP-induced striatal degeneration by reducing calpain activation and by promoting survival pathways. These data encourage further evaluation of PDE5 inhibitors in transgenic mouse models of HD. Copyright 2010 Elsevier Inc. All rights reserved.

Protection method for an optical information carrier

NASA Astrophysics Data System (ADS)

Pitsyuga, Vitaly V.; Kolesnikov, Michael Y.; Kosyak, Igor V.

1997-02-01

Now information protection on personal carriers (for example, cards) from an unauthorized access (UA) is a very important problem in connection with wide introduction of proper automatic systems for information processing in different spheres of human activity. These are financial, medical and information services, an access to restricted units and so on. There is proposed to use physical parameters of the special coating part (so-called restricted zone) to information protection on optical carriers (laser cards). There is formed restricted zone on the surface of the recording coating of a laser card. The unique information about every laser card to creating a protective passport from UA is obtained by readout of defects parameters.

Accelerator Vacuum Protection System

NASA Astrophysics Data System (ADS)

Barua, Pradip; Kothari, Ashok; Archunan, M.; Joshi, Rajan

2012-11-01

A new and elaborate automatic vacuum protection system using fast acting valve has been installed to avoid accidental venting of accelerator from experimental chamber side. To cover all the beam lines and to reduce the system cost, it has been installed at a common point from where all the seven beam lines originate. The signals are obtained by placing fast response pressure sensing gauges (HV SENSOR) near all the experimental stations. The closing time of the fast valve is 10 milli-second. The fast closing system protects only one vacuum line at a time. At IUAC, we have seven beam lines so one sensor was placed in each of the beam lines near experimental chamber and a multiplexer was incorporated into the fast closing system. At the time of experiment, the sensor of the active beam line is selected through the multiplexer and the Fast closing valve is interlocked with the selected sensor. As soon as the pressure sensor senses the pressure rise beyond a selected pressure, the signal is transferred and the fast valve closes within 10 to 12 millisecond.

Sestrin2 Protects Dopaminergic Cells against Rotenone Toxicity through AMPK-Dependent Autophagy Activation

PubMed Central

Hou, Yi-Sheng; Guan, Jun-Jie; Xu, Hai-Dong; Wu, Feng; Sheng, Rui

2015-01-01

Dysfunction of the autophagy-lysosomal pathway (ALP) and the ubiquitin-proteasome system (UPS) was thought to be an important pathogenic mechanism in synuclein pathology and Parkinson's disease (PD). In the present study, we investigated the role of sestrin2 in autophagic degradation of α-synuclein and preservation of cell viability in a rotenone-induced cellular model of PD. We speculated that AMP-activated protein kinase (AMPK) was involved in regulation of autophagy and protection of dopaminergic cells against rotenone toxicity by sestrin2. The results showed that both the mRNA and protein levels of sestrin2 were increased in a TP53-dependent manner in Mes 23.5 cells after treatment with rotenone. Genetic knockdown of sestrin2 compromised the autophagy induction in response to rotenone, while overexpression of sestrin2 increased the basal autophagy activity. Sestrin2 presumably enhanced autophagy in an AMPK-dependent fashion, as sestrin2 overexpression activated AMPK, and genetic knockdown of AMPK abrogated autophagy induction by rotenone. Restoration of AMPK activity by metformin after sestrin2 knockdown recovered the autophagy activity. Sestrin2 overexpression ameliorated α-synuclein accumulation, inhibited caspase 3 activation, and reduced the cytotoxicity of rotenone. These results suggest that sestrin2 upregulation attempts to maintain autophagy activity and suppress rotenone cytotoxicity through activation of AMPK, and that sestrin2 exerts a protective effect on dopaminergic cells. PMID:26031332

Active site electrostatics protect genome integrity by blocking abortive hydrolysis during DNA recombination

PubMed Central

Ma, Chien-Hui; Rowley, Paul A; Macieszak, Anna; Guga, Piotr; Jayaram, Makkuni

2009-01-01

Water, acting as a rogue nucleophile, can disrupt transesterification steps of important phosphoryl transfer reactions in DNA and RNA. We have unveiled this risk, and identified safeguards instituted against it, during strand cleavage and joining by the tyrosine site-specific recombinase Flp. Strand joining is threatened by a latent Flp endonuclease activity (type I) towards the 3′-phosphotyrosyl intermediate resulting from strand cleavage. This risk is not alleviated by phosphate electrostatics; neutralizing the negative charge on the scissile phosphate through methylphosphonate (MeP) substitution does not stimulate type I endonuclease. Rather, protection derives from the architecture of the recombination synapse and conformational dynamics within it. Strand cleavage is protected against water by active site electrostatics. Replacement of the catalytic Arg-308 of Flp by alanine, along with MeP substitution, elicits a second Flp endonuclease activity (type II) that directly targets the scissile phosphodiester bond in DNA. MeP substitution, combined with appropriate active site mutations, will be useful in revealing anti-hydrolytic mechanisms engendered by systems that mediate DNA relaxation, DNA transposition, site-specific recombination, telomere resolution, RNA splicing and retrohoming of mobile introns. PMID:19440204

Fragrant unsaturated aldehydes elicit activation of the Keap1/Nrf2 system leading to the upregulation of thioredoxin expression and protection against oxidative stress.

PubMed

Masutani, Hiroshi; Otsuki, Ryoko; Yamaguchi, Yoshimi; Takenaka, Masahiro; Kanoh, Nobue; Takatera, Koji; Kunimoto, Yuji; Yodoi, Junji

2009-05-01

Thioredoxin, a key molecule in redox regulation, and many redox enzymes are regulated through the antioxidant responsive element (ARE). To search for antioxidative constituents, we screened extracts from vegetables and found that the extracts of Perilla frutescens and Artemisia princeps have potent thioredoxin-inducing activities. By activity-guided purification of Perilla frutescens extracts, we identified perillaldehyde as a novel thioredoxin inducer. Fragrant unsaturated aldehydes, such as trans-cinnamaldehyde, safranal, 2,4-octadienal, citral, trans-2, cis-6-nonadienal, and trans-2-hexenal showed the ability to activate ARE. Perillaldehyde-induced activation through the ARE was suppressed by the overexpression of wild-type Keap1, whereas sulforaphane-induced activation seemed to be partially suppressed. Mutant Keap1 (R272A/K287A or C273A/C288A) did not suppress this activation. Pretreatment with perillaldehyde reduced the H(2)O(2)-induced cytotoxicity. Thus, we show that fragrant unsaturated aldehydes from edible plants are novel thioredoxin inducers and ARE activators and may be beneficial for protection against oxidative stress-induced cellular damage. These results also suggest that perillaldehyde activates the Nrf2-Keap1 system and that the lysine and arginine residues juxtaposed to the critical cysteine residues of Keap1 are required for signal sensing.

HIF1α-dependent glycolysis promotes macrophage functional activities in protecting against bacterial and fungal infection.

PubMed

Li, Chunxiao; Wang, Yu; Li, Yan; Yu, Qing; Jin, Xi; Wang, Xiao; Jia, Anna; Hu, Ying; Han, Linian; Wang, Jian; Yang, Hui; Yan, Dapeng; Bi, Yujing; Liu, Guangwei

2018-02-26

Macrophages are important innate immune defense system cells in the fight against bacterial and fungal pathogenic infections. They exhibit significant plasticity, particularly with their ability to undergo functional differentiation. Additionally, HIF1α is critically involved in the functional differentiation of macrophages during inflammation. However, the role of macrophage HIF1α in protecting against different pathogenic infections remains unclear. In this study, we investigated and compared the roles of HIF1α in different macrophage functional effects of bacterial and fungal infections in vitro and in vivo. We found that bacterial and fungal infections produced similar effects on macrophage functional differentiation. HIF1α deficiency inhibited pro-inflammatory macrophage functional activities when cells were stimulated with LPS or curdlan in vitro or when mice were infected with L. monocytogenes or C. albicans in vivo, thus decreasing pro-inflammatory TNFα and IL-6 secretion associated with pathogenic microorganism survival. Alteration of glycolytic pathway activation was required for the functional differentiation of pro-inflammatory macrophages in protecting against bacterial and fungal infections. Thus, the HIF1α-dependent glycolytic pathway is essential for pro-inflammatory macrophage functional differentiation in protecting against bacterial and fungal infections.

Nondestructive reactivation of chemical protective garments. Final report, June 1985-July 1989

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, K.W.; Chang, S.Y.; Klemperer, E.

In the near future, chemical protective combat uniforms may be worn by Army personnel on a continuous basis. Activated carbon, the operative component, has diminished capacity for sorbing chemical agents after it has been exposed to dirt, sweat, cigarette smoke, engine exhaust, petroleum products and numerous other elements routinely present in the battlefield environment. This report summarizes the development of two nondestructive methods for cleaning and reactivating soiled chemical protective garments. Complete reactivation was achieved when the aqueous i-propanol iodine displacement method of Manes, which removed all but pure hydrocarbon oil soils from the current overgarment Type III foam ormore » Kynol activated carbon fiber material, was applied in nonaqueous solvent. Subsequently, a nonaqueous solvent method that requires less handling was chosen in designing a truck-mounted system. It features non-agitative flow of methylene chloride and methanol around the chemical-protective garments suspended between ultrasonic transducers. Both methods restore full sorptivity to the Type III foam liner. There is a one-time 10% loss of activated carbon without any loss of sorptivity. The volatile solvents are more easily removed, and can be economically recovered. Overall features of a mobile unit have been sketched.« less

Research on the laser angle deception jamming technology of laser countermeasure

NASA Astrophysics Data System (ADS)

Ma, Shi-wei; Chen, Wen-jian; Gao, Wei; Duan, Yuan-yuan

2015-10-01

In recent years , laser guided weapons behave very well at destroying the military goals in the local wars, the single-shot probability, effective range and hitting precision getting better. And the semi-active laser guided weapons are the most widely used laser guided weapons. In order to improve the viability and protect important military goals, it's necessary to study the technology to against the semi-active guided weapons. This paper studies the working principle, the advantages and disadvantages of the semi-active guided weapons at first, and analyze the possibility of laser angle deception jamming system working. Then it analyzes the working principle and process of laser angle deception jamming technology. Finally it designs a half-real simulation system of laser angle deception jamming, which consists of semi-active laser guided weapons simulation system and laser angle deception jamming system. The simulation system demonstrates the working process of the laser angle deception jamming system. This paper provides fundamental base for the research on the countermeasure technology of semi-active laser guided weapons.

Overview of current capabilities and research and technology developments for planetary protection

NASA Astrophysics Data System (ADS)

Frick, Andreas; Mogul, Rakesh; Stabekis, Pericles; Conley, Catharine A.; Ehrenfreund, Pascale

2014-07-01

The pace of scientific exploration of our solar system provides ever-increasing insights into potentially habitable environments, and associated concerns for their contamination by Earth organisms. Biological and organic-chemical contamination has been extensively considered by the COSPAR Panel on Planetary Protection (PPP) and has resulted in the internationally recognized regulations to which spacefaring nations adhere, and which have been in place for 40 years. The only successful Mars lander missions with system-level “sterilization” were the Viking landers in the 1970s. Since then different cleanliness requirements have been applied to spacecraft based on their destination, mission type, and scientific objectives. The Planetary Protection Subcommittee of the NASA Advisory Council has noted that a strategic Research & Technology Development (R&TD) roadmap would be very beneficial to encourage the timely availability of effective tools and methodologies to implement planetary protection requirements. New research avenues in planetary protection for ambitious future exploration missions can best be served by developing an over-arching program that integrates capability-driven developments with mission-driven implementation efforts. This paper analyzes the current status concerning microbial reduction and cleaning methods, recontamination control and bio-barriers, operational analysis methods, and addresses concepts for human exploration. Crosscutting research and support activities are discussed and a rationale for a Strategic Planetary Protection R&TD Roadmap is outlined. Such a roadmap for planetary protection provides a forum for strategic planning and will help to enable the next phases of solar system exploration.

Green Remediation Best Management Practices: Sites with Leaking Underground Storage Tank Systems

EPA Pesticide Factsheets

The U.S. Environmental Protection Agency (EPA) Principles for Greener Cleanups outline the Agency's policy for evaluating and minimizing the environmental 'footprint' of activities undertaken when cleaning up a contaminated site.

29 CFR 1915.506 - Hazards of fixed extinguishing systems on board vessels and vessel sections.

Code of Federal Regulations, 2010 CFR

2010-07-01

... operational. (d) Doors and hatches. The employer must: (1) Take protective measures to ensure that all doors, hatches, scuttles, and other exit openings remain working and accessible for escape in the event the systems are activated; and (2) Ensure that all inward opening doors, hatches, scuttles, and other...

33 CFR 154.2102 - Facility requirements for vessel liquid overfill protection.

Code of Federal Regulations, 2014 CFR

2014-07-01

... receives cargo vapor from a tank barge that is fitted with an intrinsically safe cargo tank level sensor... tank level sensor system that— (1) Closes the remotely operated cargo vapor shutoff valve required by... sensor system is interrupted; (2) Activates an audible and visible alarm that warns barge and facility...

78 FR 3920 - Notice of Permit Applications Received; Under the Antarctic Conservation Act of 1978 (Pub. L. 95...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-17

... system for various activities in Antarctica and designation of certain animals and certain geographic areas a requiring special protection. The regulations establish such a permit system to designate... be shed on the evolution, faunal dynamics, and/or paleobiogeography of such important vertebrate...

78 FR 70075 - Notice of Permit Applications Received Under the Antarctic Conservation Act of 1978 (Public Law...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-22

... establishment of a permit system for various activities in Antarctica and designation of certain animals and certain geographic areas a requiring special protection. The regulations establish such a permit system to..., stable isotope analysis, and DNA extraction. Data would be used to reconstruct seal population dynamics...

78 FR 76709 - Proposed Agency Information Collection Activities; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-18

... of Emergency Order No. 28, which requires railroads operating on the general system of transportation... in Lac-M[eacute]gantic, Quebec, Canada, on July 6, 2013. See 78 FR 48218. Emergency Order No. 28 is... secured in order to protect the general public and communities near the general system of rail...

Insulin-like Growth Factor 1 Rescues R28 Retinal Neurons from Apoptotic Death through ERK-mediated BimEL Phosphorylation Independent of Akt

PubMed Central

Kong, Dejuan; Gong, Lijie; Arnold, Edith; Shanmugam, Sumathi; Fort, Patrice E.; Gardner, Thomas W.; Abcouwer, Steven F.

2016-01-01

Insulin-like growth factor 1 (IGF-1) can provide long-term neurotrophic support by activation of Akt, inhibition of FoxO nuclear localization and suppression of Bim gene transcription in multiple neuronal systems. However, MEK/ERK activation can also promote neuron survival through phosphorylation of BimEL. We explored the contribution of the PI3K/Akt/FoxO and MEK/ERK/BimEL pathways in IGF-1 stimulated survival after serum deprivation (SD) of R28 cells differentiated to model retinal neurons. IGF-1 caused rapid activation of Akt leading to FoxO1/3-T32/T24 phosphorylation, and prevented FoxO1/3 nuclear translocation and Bim mRNA upregulation in response to SD. IGF-1 also caused MAPK/MEK pathway activation as indicated by ERK1/2-T202/Y204 and Bim-S65 phosphorylation. Overexpression of FoxO1 increased Bim mRNA expression and amplified the apoptotic response to SD without shifting the serum response curve. Inhibition of Akt activation with LY294002 or by Rictor knockdown did not block the protective effect of IGF-1, while inhibition of MEK activity with PD98059 prevented Bim phosphorylation and blocked IGF-1 protection. In addition, knockdown of Bim expression was protective during SD, while co-silencing of FoxO1 and Fox03 expression had little effect. Thus, the PI3K/Akt/FoxO pathway was not essential for protection from SD-induced apoptosis by IGF-1 in R28 cells. Instead, IGF-1 protection was dependent on activation of the MEK/ERK pathway leading to BimEL phosphorylation, which is known to prevent Bax/Bak oligomerization and activation of the intrinsic mitochondrial apoptosis pathway. These studies demonstrate the requirement of the MEK/ERK pathway in a model of retinal neuron cell survival and highlight the cell specificity for IGF-1 signaling in this response. PMID:27511131

Development of a new categorization system for pesticides exposure to support harmonized reporting between EU Member States.

PubMed

Settimi, Laura; Orford, Rob; Davanzo, Franca; Hague, Charlotte; Desel, Herbert; Pelclova, Daniela; Dragelyte, Gabija; Mathieu-Nolf, Monique; Adams, Richard; Duarte-Davidson, Raquel

2016-05-01

European legislation requires reporting from Member States on acute poisoning incidents involving pesticides. However, standard rules for data collection and reporting have not yet been set out. The new categorization system presented in this paper is aimed at enabling Member States to gather comparable data and provide standard reporting on pesticide poisoning exposures. European Regulations providing separate official categorization of biocidal and plant protection pesticides, were used as a basis to build up a unified pesticide categorization and coding system. Data on selected pesticide exposures collected by Poison Control Centres in six EU countries were reviewed, categorized and reported according to the proposed system. The resulting pesticide categorization system has two dimensions. The first part identifies the main category of use, i.e. biocide/plant protection pesticide/unknown, and the secondary category of use, e.g. Rodenticides, Insecticides and acaricides. The second part of the system is organized into two levels: level one identifies chemical grouping, e.g. Coumarins, Pyrethrins/pyrethroids, while level two identifies the active compound by using its Chemical Abstract Service Registry Number. The system was used to provide a unified categorization to compare exposures to plant protection and biocidal Rodenticides and Pyrethrins/pyrethroids Insecticides and acaricides identified by six EU member states. The developed pesticide categorization system was successfully applied to data extracted from different databases and was able to make the required information comparable. The data reported filling in common templates containing a pre-ordinate list of active compounds categorized according the proposed system, highlighted different capabilities in data collection and recording, showing that some of the collaborating centres were not able to distinguish between main categories of pesticide products or provide information on active compounds. The results indicate that a special effort should be dedicated to support detailed data recording at national level. Providing common tools to systematically report to the EU Commission hazardous exposures to pesticides, as well as to other selected categories of products, could allow for data comparability between Member States and greatly improve post marketing surveillance and alerting systems in Europe. Copyright © 2016 Elsevier Ltd. All rights reserved.

Countering MANPADS: study of new concepts and applications: part two

NASA Astrophysics Data System (ADS)

Maltese, Dominique; Vergnolle, Jean-François; Aragones, Julien; Renaudat, Mathieu

2007-04-01

The latest events of ground-to-air Man Portable Air Defense (MANPAD) attacks against aircraft have revealed a new threat both for military and civilian aircraft. Consequently, the implementation of protecting systems (i.e. Directed Infra Red Counter Measure - DIRCM) in order to face IR guided missiles turns out to be now inevitable. In a near future, aircraft will have to possess detection, tracking, identification, targeting and jamming capabilities to face MANPAD threats. Besides, Multiple Missiles attacks become more and more current scenarios to deal with. In this paper, a practical example of DIRCM systems under study at SAGEM DEFENSE & SECURITY Company is presented. The article is the continuation of a previous SPIE one. Self-protection solutions include built-in and automatic locking-on, tracking, identification and laser jamming capabilities, including defeat assessment. Target Designations are provided by a Missile Warning System. Targets scenarios including multiple threats are considered to design systems architectures. In a first step, the article reminds the context, current and future threats (IR seekers of different generations...), and scenarios for system definition. Then, it focuses on potential self-protection systems under study at SAGEM DEFENSE & SECURITY Company. Different strategies including target identification, multi band laser and active imagery have been previously studied in order to design DIRCM System solutions. Thus, results of self-protection scenarios are provided for different MANPAD scenarios to highlight key problems to solve. Data have been obtained from simulation software modeling full DIRCM systems architectures on technical and operational scenarios (parametric studies).

A manned lunar outpost. Design considerations for three key elements in an initial manned lunar outpost

NASA Technical Reports Server (NTRS)

Bell, Larry; Trotti, Guillermo; Brown, Jeff; Bhattacharya, Nilajan; Moore, Nathan; Polette, Tom; Toups, Larry

1988-01-01

The Initial Manned Lunar Outpost (IMLO) is proposed as the initial permanent base for manned activities on the Moon. The study concentrated on identifying the equipment, support systems, and initial base configuration necessary to accomplish the various science, industrial and exploration activities planned. The primary concepts of the MLO were the use of hard modules for habitation areas creating a flexible, modular transportation system; designing a multi-functional vehicle; and using an overhead radiation protection system. The transportation system, dubbed the Lunar Mobile Surface Transport System (LMSTS), carries the hard modules to the surface of the moon and provides a method to move them to the desired location through the use of interchangeable pallets. The avionics pallets are changed-out with wheel and hitch pallets, transforming the LMSTS into a "tractor trailer" used with the Multi-Functional Vehicle (MFV). The modules are placed under the Regolith Support Structure (RSS) which provides a stable environment and radiation protection for the entire base. The overhead structure was chosen over simply burying the modules to provide a study on the advantages and disadvantages of this type of system. The advantages include easy access to the exterior of the modules, providing a protected area for vehicles and equipment used in EVA, and creating an area of constant temperature. Disadvantages include a need for prefabrication of structural components, including the preconstruction and construction phases of the initial MLO. The design approach taken considered existing and near-term materials and technology only, without the consideration of possible future building technologies.

Flexible Foam Protection Materials for Constellation Space Suit Element Portable Life Support Subsystem Packaging Study

NASA Technical Reports Server (NTRS)

Tang, Henry H.; Orndoff, Evelyne S.; Thomas, Gretchen A.

2009-01-01

This paper discusses the effort in evaluating and selecting a light weight impact protection material for the Constellation Space Suit Element (CSSE) Portable Life Support Subsystem (PLSS) conceptual packaging study. A light weight material capable of holding and protecting the components inside the PLSS is required to demonstrate the viability of the flexible PLSS packaging concept. The material needs to distribute, dissipate, and absorb the impact energy of the PLSS falling on the lunar surface. It must also be very robust and function in the extreme lunar thermal vacuum environment for up to one hundred Extravehicular Activity (EVA) missions. This paper documents the performance requirements for selecting a foam protection material, and the methodologies for evaluating commercial off-the-shelf (COTS) foam protection materials. It also presents the materials properties test results and impact drop test results of the various foam materials evaluated in the study. The findings from this study suggest that a foam based flexible protection system is a viable solution for PLSS packaging. However, additional works are needed to optimize COTS foam properties or to develop a composite foam system that will meet all the performance requirements for the CSSE PLSS flexible packaging.

Effects of ventilation strategy on distribution of lung inflammatory cell activity

PubMed Central

2013-01-01

Introduction Leukocyte infiltration is central to the development of acute lung injury, but it is not known how mechanical ventilation strategy alters the distribution or activation of inflammatory cells. We explored how protective (vs. injurious) ventilation alters the magnitude and distribution of lung leukocyte activation following systemic endotoxin administration. Methods Anesthetized sheep received intravenous endotoxin (10 ng/kg/min) followed by 2 h of either injurious or protective mechanical ventilation (n = 6 per group). We used positron emission tomography to obtain images of regional perfusion and shunting with infused 13N[nitrogen]-saline and images of neutrophilic inflammation with 18F-fluorodeoxyglucose (18F-FDG). The Sokoloff model was used to quantify 18F-FDG uptake (Ki), as well as its components: the phosphorylation rate (k3, a surrogate of hexokinase activity) and the distribution volume of 18F-FDG (Fe) as a fraction of lung volume (Ki = Fe × k3). Regional gas fractions (fgas) were assessed by examining transmission scans. Results Before endotoxin administration, protective (vs. injurious) ventilation was associated with a higher ratio of partial pressure of oxygen in arterial blood to fraction of inspired oxygen (PaO2/FiO2) (351 ± 117 vs. 255 ± 74 mmHg; P < 0.01) and higher whole-lung fgas (0.71 ± 0.12 vs. 0.48 ± 0.08; P = 0.004), as well as, in dependent regions, lower shunt fractions. Following 2 h of endotoxemia, PaO2/FiO2 ratios decreased in both groups, but more so with injurious ventilation, which also increased the shunt fraction in dependent lung. Protective ventilation resulted in less nonaerated lung (20-fold; P < 0.01) and more normally aerated lung (14-fold; P < 0.01). Ki was lower during protective (vs. injurious) ventilation, especially in dependent lung regions (0.0075 ± 0.0043/min vs. 0.0157 ± 0.0072/min; P < 0.01). 18F-FDG phosphorylation rate (k3) was twofold higher with injurious ventilation and accounted for most of the between-group difference in Ki. Dependent regions of the protective ventilation group exhibited lower k3 values per neutrophil than those in the injurious ventilation group (P = 0.01). In contrast, Fe was not affected by ventilation strategy (P = 0.52). Lung neutrophil counts were not different between groups, even when regional inflation was accounted for. Conclusions During systemic endotoxemia, protective ventilation may reduce the magnitude and heterogeneity of pulmonary inflammatory cell metabolic activity in early lung injury and may improve gas exchange through its effects predominantly in dependent lung regions. Such effects are likely related to a reduction in the metabolic activity, but not in the number, of lung-infiltrating neutrophils. PMID:23947920

21 CFR 346.14 - Protectant active ingredients.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 5 2011-04-01 2011-04-01 false Protectant active ingredients. 346.14 Section 346...) DRUGS FOR HUMAN USE ANORECTAL DRUG PRODUCTS FOR OVER-THE-COUNTER HUMAN USE Active Ingredients § 346.14 Protectant active ingredients. (a) The following active ingredients may be used as the sole protectant active...

21 CFR 346.14 - Protectant active ingredients.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 5 2014-04-01 2014-04-01 false Protectant active ingredients. 346.14 Section 346...) DRUGS FOR HUMAN USE ANORECTAL DRUG PRODUCTS FOR OVER-THE-COUNTER HUMAN USE Active Ingredients § 346.14 Protectant active ingredients. (a) The following active ingredients may be used as the sole protectant active...

21 CFR 346.14 - Protectant active ingredients.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 5 2013-04-01 2013-04-01 false Protectant active ingredients. 346.14 Section 346...) DRUGS FOR HUMAN USE ANORECTAL DRUG PRODUCTS FOR OVER-THE-COUNTER HUMAN USE Active Ingredients § 346.14 Protectant active ingredients. (a) The following active ingredients may be used as the sole protectant active...

21 CFR 346.14 - Protectant active ingredients.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 5 2012-04-01 2012-04-01 false Protectant active ingredients. 346.14 Section 346...) DRUGS FOR HUMAN USE ANORECTAL DRUG PRODUCTS FOR OVER-THE-COUNTER HUMAN USE Active Ingredients § 346.14 Protectant active ingredients. (a) The following active ingredients may be used as the sole protectant active...

The NASA Firefighter's Breathing System Program: A Status Report

NASA Technical Reports Server (NTRS)

McLaughlan, Pat B.

1973-01-01

The National Aeronautics and Space Administration (NASA), through its Technology Utilization Program, has been making its advanced technology developments available to the public. This has coincided in recent years with a growing demand within the fire service for improved protective equipment. A better breathing system for firefighters was one of the more immediate needs identified by the firefighting organizations. The Johnson Space Center (JSC), based upon their experience in providing life support systems for space flight, was subsequently requested to determine the feasibility of providing an improved breathing system for firefighters. Such a system was determined to be well within the current state of the art, and the Center is well into a development program to provide design verification of this improved protective' equipment. This report - outlines the overall objectives of this program, progress to date, and future planned activities.

Modulating kidney transplant interstitial fibrosis and tubular atrophy: is the RAAS an important target?

PubMed

Amer, Hatem; Griffin, Matthew D

2014-02-01

In follow-up to a recently published randomized controlled clinical trial, Issa et al. provide evidence that systemic activity and physiological responsiveness of the renin aldosterone angiotensin system (RAAS) are well within normal limits in most kidney recipients during the first 5 years post-transplant. Implications of the results include the need to better understand intra-renal RAAS activity in transplanted kidneys and to identify patients in which the graft-protective effects of RAAS blockade are most relevant.

NF-κB and enhancer-binding CREB protein scaffolded by CREB-binding protein (CBP)/p300 proteins regulate CD59 protein expression to protect cells from complement attack.

PubMed

Du, Yiqun; Teng, Xiaoyan; Wang, Na; Zhang, Xin; Chen, Jianfeng; Ding, Peipei; Qiao, Qian; Wang, Qingkai; Zhang, Long; Yang, Chaoqun; Yang, Zhangmin; Chu, Yiwei; Du, Xiang; Zhou, Xuhui; Hu, Weiguo

2014-01-31

The complement system can be activated spontaneously for immune surveillance or induced to clear invading pathogens, in which the membrane attack complex (MAC, C5b-9) plays a critical role. CD59 is the sole membrane complement regulatory protein (mCRP) that restricts MAC assembly. CD59, therefore, protects innocent host cells from attacks by the complement system, and host cells require the constitutive and inducible expression of CD59 to protect themselves from deleterious destruction by complement. However, the mechanisms that underlie CD59 regulation remain largely unknown. In this study we demonstrate that the widely expressed transcription factor Sp1 may regulate the constitutive expression of CD59, whereas CREB-binding protein (CBP)/p300 bridge NF-κB and CREB, which surprisingly functions as an enhancer-binding protein to induce the up-regulation of CD59 during in lipopolysaccharide (LPS)-triggered complement activation, thus conferring host defense against further MAC-mediated destruction. Moreover, individual treatment with LPS, TNF-α, and the complement activation products (sublytic MAC (SC5b-9) and C5a) could increase the expression of CD59 mainly by activating NF-κB and CREB signaling pathways. Together, our findings identify a novel gene regulation mechanism involving CBP/p300, NF-κB, and CREB; this mechanism suggests potential drug targets for controlling various complement-related human diseases.

Hepatoprotective activity of bacoside A against N-nitrosodiethylamine-induced liver toxicity in adult rats.

PubMed

Janani, Panneerselvam; Sivakumari, Kanakarajan; Parthasarathy, Chandrakesan

2009-10-01

N-Nitrosodiethylamine (DEN) is a notorious carcinogen, present in many environmental factors. DEN induces oxidative stress and cellular injury due to enhanced generation of reactive oxygen species; free radical scavengers protect the membranes from DEN-induced damage. The present study was designed to evaluate the protective effect of bacoside A (the active principle isolated from Bacopa monniera Linn.) on carcinogen-induced damage in rat liver. Adult male albino rats were pretreated with 15 mg/kg body weight/day of bacoside A orally (for 14 days) and then intoxicated with single necrogenic dose of N-nitrosodiethylamine (200 mg/kg bodyweight, intraperitonially) and maintained for 7 days. The liver weight, lipid peroxidation (LPO), and activity of serum marker enzymes (aspartate transaminases, alanine transaminases, lactate dehydrogenase, alkaline phosphatase, and gamma-glutamyl transpeptidase) were markedly increased in carcinogen-administered rats, whereas the activities of marker enzymes were near normal in bacoside A-pretreated rats. Activities of antioxidant enzymes (superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase, glutatione-S-transferase, and reduced glutathione) in liver also decreased in carcinogen-administered rats, which were significantly elevated in bacoside A-pretreated rats. It is concluded that pretreatment of bacoside A prevents the elevation of LPO and activity of serum marker enzymes and maintains the antioxidant system and thus protects the rats from DEN-induced hepatotoxicity.

Opposing effects of two osmolytes--trehalose and glycerol--on thermal inactivation of rabbit muscle 6-phosphofructo-1-kinase.

PubMed

Faber-Barata, Joana; Sola-Penna, Mauro

2005-01-01

Trehalose and glycerol are known as good stabilizers of function and structure of several macromolecules against stress conditions. We previously reported that they have comparable effectiveness on protecting two yeast cytosolic enzymes against thermal inactivation. However, enzyme protection has always been associated to a decrease in catalytic activity at the stabilizing conditions i.e., the presence of the protective molecule. In the present study we tested trehalose and glycerol on thermal protection of the mammalian cytosolic enzyme phosphofructokinase. Here we found that trehalose was able to protect phosphofructokinase against thermal inactivation as well as to promote an activation of its catalytic activity. The enzyme incubated in the presence of 1 M trehalose did not present any significant inactivation within 2 h of incubation at 50 degrees C, contrasting to control experiments where the enzyme was fully inactivated during the same period exhibiting a t0.5 for thermal inactivation of 56+/-5 min. On the other hand, enzyme incubated in the presence of 37.5% (v/v) glycerol was not protected against incubation at 50 degrees C. Indeed, when phosphofructokinase was incubated for 45 min at 50 degrees C in the presence of lower concentrations of glycerol (7.5-25%, v/v), the remaining activity was 2-4 times lower than control. These data show that the compatibility of effects previously shown for trehalose and glycerol with some yeast cytosolic enzymes can not be extended to all globular enzyme system. In the case of phosphofructokinase, we believe that its property of shifting between several different complex oligomers configurations can be influenced by the physicochemical properties of the stabilizing molecules.

Improving the viability and versatility of the E × B probe with an active cooling system.

PubMed

Liu, Lihui; Cai, Guobiao; You, Fengyi; Ren, Xiang; Zheng, Hongru; He, Bijiao

2018-04-01

A thermostatic E × B probe is designed to protect the probe body from the thermal effect of the plasma plume that has a significant influence on the resolution of the probe for high-power electric thrusters. An active cooling system, which consists of a cooling panel and carbon fiber felts combined with a recycling system of liquid coolants or an open-type system of gas coolants, is employed to realize the protection of the probe. The threshold for the design parameters for the active cooling system is estimated by deriving the energy transfer of the plasma plume-probe body interaction and the energy taken away by the coolants, and the design details are explained. The diagnostics of the LIPS-300 ion thruster with a power of 3 kW and a screen-grid voltage of 1450 V was implemented by the designed thermostatic E × B probe. The measured spectra illustrate that the thermostatic E × B probe can distinguish the fractions of Xe + ions and Xe 2+ ions without areas of overlap. In addition, the temperature of the probe body was less than 306 K in the beam region of the plasma plume during the 200-min-long continuous test. A thermostatic E × B probe is useful for enhancing the viability and versatility of equipment and for reducing uneconomical and complex test procedures.

Improving the viability and versatility of the E × B probe with an active cooling system

NASA Astrophysics Data System (ADS)

Liu, Lihui; Cai, Guobiao; You, Fengyi; Ren, Xiang; Zheng, Hongru; He, Bijiao

2018-04-01

A thermostatic E × B probe is designed to protect the probe body from the thermal effect of the plasma plume that has a significant influence on the resolution of the probe for high-power electric thrusters. An active cooling system, which consists of a cooling panel and carbon fiber felts combined with a recycling system of liquid coolants or an open-type system of gas coolants, is employed to realize the protection of the probe. The threshold for the design parameters for the active cooling system is estimated by deriving the energy transfer of the plasma plume-probe body interaction and the energy taken away by the coolants, and the design details are explained. The diagnostics of the LIPS-300 ion thruster with a power of 3 kW and a screen-grid voltage of 1450 V was implemented by the designed thermostatic E × B probe. The measured spectra illustrate that the thermostatic E × B probe can distinguish the fractions of Xe+ ions and Xe2+ ions without areas of overlap. In addition, the temperature of the probe body was less than 306 K in the beam region of the plasma plume during the 200-min-long continuous test. A thermostatic E × B probe is useful for enhancing the viability and versatility of equipment and for reducing uneconomical and complex test procedures.

Estrogen, aging and the cardiovascular system

PubMed Central

Stice, James P.; Lee, Jennifer S.; Pechenino, Angela S.; Knowlton, Anne A.

2014-01-01

Estrogen is a powerful hormone with pleiotropic effects. Estrogens have potent antioxidant effects and are able to reduce inflammation, induce vasorelaxation and alter gene expression in both the vasculature and the heart. Estrogen treatment of cultured cardiac myocytes and endothelial cells rapidly activates NFκB, induces heat-shock protein (HSP)-72, a potent intracellular protective protein, and protects cells from simulated ischemia. In in vivo models, estrogens protect against ischemia and trauma/hemorrhage. Estrogens may decrease the expression of soluble epoxide hydrolase, which has deleterious effects on the cardiovascular system through metabolism of epoxyeicosatrienoic acids. Natural (endogenous) estrogens in premenopausal women appear to protect against cardiovascular disease and yet controlled clinical trials have not indicated a benefit from estrogen replacement postmenopause. Much remains to be understood in regards to the many properties of this powerful hormone and how changes in this hormone interact with aging-associated changes. The unexpected negative results of trials of estrogen replacement postmenopause probably arise from our lack of understanding of the many effects of this hormone. PMID:19371207

SERVING EPA'S MISSION: POTENTIAL ROLES OF ENGERETIC TOOLS

EPA Science Inventory

Effective environmental protection requires an understanding of environmental systems dynamics that includes socioeconomic activity along with its interactions with environmental processes. Some forms of scientific analysis, such as emergy analysis, do seek to account for the ...

KENNEDY SPACE CENTER, FLA. -- United Space Alliance (USA) Manager of the Thermal Protection System (TPS) Facility Martin Wilson (right) briefs NASA Deputy Associate Administrator for Space Station and Shuttle Programs Michael Kostelnik (left) on the properties of a thermal blanket used in the Shuttle's TPS. NASA and USA Space Shuttle program management are participating in a leadership workday. The day is intended to provide management with an in-depth, hands-on look at Shuttle processing activities at KSC.

NASA Image and Video Library

2003-12-19

KENNEDY SPACE CENTER, FLA. -- United Space Alliance (USA) Manager of the Thermal Protection System (TPS) Facility Martin Wilson (right) briefs NASA Deputy Associate Administrator for Space Station and Shuttle Programs Michael Kostelnik (left) on the properties of a thermal blanket used in the Shuttle's TPS. NASA and USA Space Shuttle program management are participating in a leadership workday. The day is intended to provide management with an in-depth, hands-on look at Shuttle processing activities at KSC.

Collaborative Approaches in Developing Environmental and Safety Management Systems for Commercial Space Transportation

NASA Technical Reports Server (NTRS)

Zee, Stacey; Murray, D.

2009-01-01

The Federal Aviation Administration (FAA), Office of Commercial Space Transportation (AST) licenses and permits U.S. commercial space launch and reentry activities, and licenses the operation of non-federal launch and reentry sites. ASTs mission is to ensure the protection of the public, property, and the national security and foreign policy interests of the United States during commercial space transportation activities and to encourage, facilitate, and promote U.S. commercial space transportation. AST faces unique challenges of ensuring the protection of public health and safety while facilitating and promoting U.S. commercial space transportation. AST has developed an Environmental Management System (EMS) and a Safety Management System (SMS) to help meet its mission. Although the EMS and SMS were developed independently, the systems share similar elements. Both systems follow a Plan-Do-Act-Check model in identifying potential environmental aspects or public safety hazards, assessing significance in terms of severity and likelihood of occurrence, developing approaches to reduce risk, and verifying that the risk is reduced. This paper will describe the similarities between ASTs EMS and SMS elements and how AST is building a collaborative approach in environmental and safety management to reduce impacts to the environment and risks to the public.

Advanced emergency braking controller design for pedestrian protection oriented automotive collision avoidance system.

PubMed

Lie, Guo; Zejian, Ren; Pingshu, Ge; Jing, Chang

2014-01-01

Automotive collision avoidance system, which aims to enhance the active safety of the vehicle, has become a hot research topic in recent years. However, most of the current systems ignore the active protection of pedestrian and other vulnerable groups in the transportation system. An advanced emergency braking control system is studied by taking into account the pedestrians and the vehicles. Three typical braking scenarios are defined and the safety situations are assessed by comparing the current distance between the host vehicle and the obstacle with the critical braking distance. To reflect the nonlinear time-varying characteristics and control effect of the longitudinal dynamics, the vehicle longitudinal dynamics model is established in CarSim. Then the braking controller with the structure of upper and lower layers is designed based on sliding mode control and the single neuron PID control when confronting deceleration or emergency braking conditions. Cosimulations utilizing CarSim and Simulink are finally carried out on a CarSim intelligent vehicle model to explore the effectiveness of the proposed controller. Results display that the designed controller has a good response in preventing colliding with the front vehicle or pedestrian.

Advanced Emergency Braking Controller Design for Pedestrian Protection Oriented Automotive Collision Avoidance System

PubMed Central

Lie, Guo; Zejian, Ren; Pingshu, Ge; Jing, Chang

2014-01-01

Automotive collision avoidance system, which aims to enhance the active safety of the vehicle, has become a hot research topic in recent years. However, most of the current systems ignore the active protection of pedestrian and other vulnerable groups in the transportation system. An advanced emergency braking control system is studied by taking into account the pedestrians and the vehicles. Three typical braking scenarios are defined and the safety situations are assessed by comparing the current distance between the host vehicle and the obstacle with the critical braking distance. To reflect the nonlinear time-varying characteristics and control effect of the longitudinal dynamics, the vehicle longitudinal dynamics model is established in CarSim. Then the braking controller with the structure of upper and lower layers is designed based on sliding mode control and the single neuron PID control when confronting deceleration or emergency braking conditions. Cosimulations utilizing CarSim and Simulink are finally carried out on a CarSim intelligent vehicle model to explore the effectiveness of the proposed controller. Results display that the designed controller has a good response in preventing colliding with the front vehicle or pedestrian. PMID:25097870

Gender difference in cytoprotection induced by estrogen on female and male bovine aortic endothelial cells.

PubMed

Si, M L; Al-Sharafi, B; Lai, C C; Khardori, R; Chang, C; Su, C Y

2001-08-01

Before menopause, women have a lower risk of cardiovascular diseases than men. Studies attribute this gender difference to estrogenic protection in the female cardiovascular system. We have demonstrated that 17beta-estradiol (E2) protects female bovine aortic endothelial cells against oxidative injury, probably through the induction of antioxidant enzyme activities. In this study, we examined whether E2 confers a differential protection on male and female cells. Bovine aortic endothelial cells from both genders were preconditioned for 24 h with E2 (1 nM to 10 microM), and their resistance to paraquat (1 mM, 3 h), a superoxide generator, was measured using an MTT assay. In contrast to the protection observed in female bovine aortic endothelial cells, there was no protective effect by E2 on male bovine aortic endothelial cells at physiologic concentrations. However, E2 at 1-10 microM attenuated paraquat's toxicity in both male and female cells, probably through its direct antioxidant activity. E2 at 1 nM increased in female, but not in male, cells the activities of superoxide dismutase, catalase, glutathione peroxidase, and glutathione reductase, which was associated with decreased levels of reactive oxygen species during subsequent paraquat exposure. This suggests that antioxidant enzyme induction plays some role in E2-augmented oxidative resistance in female endothelial cells.

REWSET: A prototype seismic and tsunami early warning system in Rhodes island, Greece

NASA Astrophysics Data System (ADS)

Papadopoulos, Gerasimos; Argyris, Ilias; Aggelou, Savvas; Karastathis, Vasilis

2014-05-01

Tsunami warning in near-field conditions is a critical issue in the Mediterranean Sea since the most important tsunami sources are situated within tsunami wave travel times starting from about five minutes. The project NEARTOWARN (2012-2013) supported by the EU-DG ECHO contributed substantially to the development of new tools for the near-field tsunami early warning in the Mediterranean. One of the main achievements is the development of a local warning system in the test-site of Rhodes island (Rhodes Early Warning System for Earthquakes and Tsunamis - REWSET). The system is composed by three main subsystems: (1) a network of eight seismic early warning devices installed in four different localities of the island, one in the civil protection, another in the Fire Brigade and another two in municipality buildings; (2) two radar-type (ultrasonic) tide-gauges installed in the eastern coastal zine of the island which was selected since research on the historical earthquake and tsunami activity has indicated that the most important, near-field tsunami sources are situated offshore to the east of Rhodes; (3) a crisis Geographic Management System (GMS), which is a web-based and GIS-based application incorporating a variety of thematic maps and other information types. The seismic early warning devices activate by strong (magnitude around 6 or more) earthquakes occurring at distances up to about 100 km from Rhodes, thus providing immediate mobilization of the civil protection. The tide-gauges transmit sea level data, while during the crisis the GMS supports decisions to be made by civil protection. In the near future it is planned the REWSET system to be integrated with national and international systems. REWSET is a prototype which certainly could be developed in other coastal areas of the Mediterranean and beyond.

Towards an autonomous sensor architecture for persistent area protection

NASA Astrophysics Data System (ADS)

Thomas, Paul A.; Marshall, Gillian F.; Stubbins, Daniel J.; Faulkner, David A.

2016-10-01

The majority of sensor installations for area protection (e.g. critical national infrastructure, military forward operating bases, etc.) make use of banks of screens each containing one or more sensor feeds, such that the burden of combining data from the various sources, understanding the situation, and controlling the sensors all lies with the human operator. Any automation in the system is generally heavily bespoke for the particular installation, leading to an inflexible system which is difficult to change or upgrade. We have developed a modular system architecture consisting of intelligent autonomous sensor modules, a high level decision making module, a middleware integration layer and an end-user GUI. The modules are all effectively "plug and play", and we have demonstrated that it is relatively simple to incorporate legacy sensors into the architecture. We have extended our previously-reported SAPIENT demonstration system to operate with a larger number and variety of sensor modules, over an extended area, detecting and classifying a wider variety of "threat activities", both vehicular and pedestrian. We report the results of a demonstration of the SAPIENT system containing multiple autonomous sensor modules with a range of modalities including laser scanners, radar, TI, EO, acoustic and seismic sensors. They operate from a combination of mains, generator and battery power, and communicate with the central "hub" over Ethernet, point-to-point wireless links and Wi-Fi. The system has been configured to protect an extended area in a complex semi-urban environment. We discuss the operation of the SAPIENT system in a realistic demonstration environment (which included significant activity not under trial control), showing sensor cueing, multi-modal sensor fusion, threat prioritisation and target hand-off.

Modified mosquito landing boxes dispensing transfluthrin provide effective protection against Anopheles arabiensis mosquitoes under simulated outdoor conditions in a semi-field system.

PubMed

Andrés, Marta; Lorenz, Lena M; Mbeleya, Edgar; Moore, Sarah J

2015-06-24

Efforts to control malaria vectors have primarily focused on scaling-up of long-lasting insecticidal nets (LLINs) and indoor residual spraying. Although highly efficient against indoor-biting and indoor-resting vectors, these interventions have lower impact on outdoor-biting mosquitoes. Innovative vector control tools are required to prevent outdoor human-mosquito contacts. In this work, the potential of spatial repellents, delivered in an active system that requires minimal user compliance, to provide personal protection against exophagic mosquitoes active in the early evening was explored. A device previously used as an odour-baited lure and kill apparatus, the mosquito landing box (MLB), was modified to dispense the volatile synthetic pyrethroid, transfluthrin, as a spatial repellent. The MLB has an active odour-dispensing mechanism that uses a solar-powered fan and switches on at dusk to provide long duration dispensing of volatile compounds without the need for the user to remember to employ it. Two MLBs were located 5 m from a human volunteer to investigate the repellent effects of a transfluthrin 'bubble' created between the MLBs. Transfluthrin was emanated from polyester strips, hanging inside the MLB odour-dispensing unit. A fully randomized cross-over design was performed in a large, semi-field, screened cage to assess the effect of the repellent against laboratory-reared Anopheles arabiensis mosquitoes under ambient outdoor conditions. The knock-down capacity of the transfluthrin-treated strips was also evaluated at different time points up to 3 weeks after being impregnated to measure duration of efficacy. The protective transfluthrin bubble provided 68.9% protection against An. arabiensis bites under these simulated outdoor conditions. Volatile transfluthrin caused low mortality among mosquitoes in the semi-field system. Transfluthrin-treated strips continued to knock down mosquitoes in laboratory tests, 3 weeks after impregnation, although this effect diminished with time. Modified MLBs can be used as efficient and long-lasting dispensers of volatile spatial repellents such as transfluthrin, thereby providing high levels of protection against outdoor-biting mosquitoes in the peri-domestic space. They have a potential role in combatting outdoor malaria transmission without interfering with effective indoor interventions such as LLINs.

Legal considerations and cooperative opportunities for space commercial activities

NASA Technical Reports Server (NTRS)

Hosenball, S. N.

1984-01-01

It is a national policy to make the capabilities of the Space Transportation System available to a wide range of potential users. This includes its availability as a space manufacturing facility for commercial activities, which may be carried out on a reimbursable basis or as a joint endeavor with NASA, but with substantial private investment. In any high risk, long lead-time research and development activity directed towards commercialization, the protection afforded the results of the research and development under the laws relating to intellectual property rights may provide an important incentive for private investment. The policies and practices of NASA directed towards the protection of privately-established intellectual property rights involved in STS use are reviewed with particular emphasis on reimbursable launch agreements and joint endeavor agreements.

Long-term change of protective forest during the past four decades at Dongshan Island, southeastern China

NASA Astrophysics Data System (ADS)

Zhang, Caiyun; Yan, Jing; Shang, Shaoling

2017-02-01

The Dongshan Island is a typical protective forest area of the southeastern coastal region of China. In this work, we extract the variation of the Dongshan Island’s protective forest area since the 1970s from the remote sensing data of the LandSAT and the Chinese HJ 1A/B satellites, and we examined the possible reasons for the variation. The results showed that the maximum likelihood classification of the extracted remote sensing data of the Dongshan Island coastal protective forest had a total accuracy of 92.6%. In the last 40 years, the area of the Dongshan Island coastal protective forest experienced a waving variation of decrease (1973-1984), increase (1984-1999) and decrease (1999-2008), in which human activity was the predominant impact factor for this fluctuation pattern. Since the early 1960s to the 1980s, due to the Cultural Revolution and the later deforestation and land reclamation activities, the protective forest of Dongshan Island was severely damaged. The total area declined sharply from 2134.4 ha in 1964 to 1515.74 ha in 1984, and the northern area of the island had the most significant decrease. After 1988, the Fujian Province began to aggressively establish the coastal protective forest system, and the protective forest acreage increased significantly to 3370.22 ha in 1999, an increase of nearly 1.2 times based on the figure of 1984. In the past five years, the area of protective forest declined slightly again, mainly because of the natural aging of the protective forest ecosystem, tourism development and the booming aquaculture industry.

Effect of Genetic Variant in BICC1 on Functional and Structural Brain Changes in Depression

PubMed Central

Bermingham, Rachel; Carballedo, Angela; Lisiecka, Danuta; Fagan, Andrew; Morris, Derek; Fahey, Ciara; Donohoe, Gary; Meaney, James; Gill, Michael; Frodl, Thomas

2012-01-01

Genes and early-life adversity (ELA) interactively increase the risk of developing major depressive disorder (MDD). A recent genome-wide association study suggests that the minor T-allele of single-nucleotide polymorphisms in the bicaudal C homolog 1 gene (BICC1) has a protective role against MDD. The aims of the study were to investigate whether the minor T-allele of BICC1 is protective against hippocampal structural brain changes, whether it is associated with increased functional brain activity in the emotion regulation system, and how ELA would modify this association. Forty-four patients with MDD and 44 healthy controls were investigated using structural magnetic resonance imaging (MRI) and functional MRI with an emotion inhibition task. Analysis of a single-nucleotide polymorphism in the BICC1-1 (rs999845) gene was performed. Right hippocampal bodies of patients and controls without a history of ELA and who carry the protective T-allele of BICC1 were significantly larger compared with those participants homozygous for the major C-allele of BICC1. However, MDD patients with ELA, who carry the T-allele, had smaller hippocampal head volumes compared with MDD patients without ELA. FMRI showed that patients and controls carrying the protective T-allele of BICC1 activate the emotion regulation system significantly more compared with those participants homozygous for the major C-allele (p<0.05, family wise error corrected). These results are suggestive that the minor T-allele of BICC1 has a protective role against MDD and its known structural and functional brain changes. However, this protective effect seems to be lost in the case of co-occurrence of ELA. PMID:22910460

Protective effect of zinc supplementation against cadmium-induced oxidative stress and the RANK/RANKL/OPG system imbalance in the bone tissue of rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzóska, Malgorzata M., E-mail: Malgorzata.Brzoska@umb.edu.pl; Rogalska, Joanna

It was investigated whether protective influence of zinc (Zn) against cadmium (Cd)-induced disorders in bone metabolism may be related to its antioxidative properties and impact on the receptor activator of nuclear factor (NF)-κΒ (RANK)/RANK ligand (RANKL)/osteoprotegerin (OPG) system. Numerous indices of oxidative/antioxidative status, and Cd and Zn were determined in the distal femur of the rats administered Zn (30 and 60 mg/l) or/and Cd (5 and 50 mg/l) for 6 months. Soluble RANKL (sRANKL) and OPG were measured in the bone and serum. Zn supplementation importantly protected from Cd-induced oxidative stress preventing protein, DNA, and lipid oxidation in the bone.more » Moreover, Zn protected from the Cd-induced increase in sRANKL concentration and the sRANKL/OPG ratio, and decrease in OPG concentration in the bone and serum. Numerous correlations were noted between indices of the oxidative/antioxidative bone status, concentrations of sRANKL and OPG in the bone and serum, as well as the bone concentrations of Zn and Cd, and previously reported by us in these animals (Brzóska et al., 2007) indices of bone turnover and bone mineral density. The results allow us to conclude that the ability of Zn to prevent from oxidative stress and the RANK/RANKL/OPG system imbalance may be implicated in the mechanisms of its protective impact against Cd-induced bone damage. This paper is the first report from an in vivo study providing evidence that beneficial Zn impact on the skeleton under exposure to Cd is related to the improvement of the bone tissue oxidative/antioxidative status and mediating the RANK/RANKL/OPG system. - Highlights: • Cd induces oxidative stress in the bone tissue. • Cd disturbs bone metabolism via disorder of the RANK/RANKL/OPG system balance. • Zn supplementation protects from Cd-induced oxidative stress in the bone tissue. • Zn protects from the RANK/RANKL/OPG system imbalance caused by Cd in the bone tissue. • Enhanced Zn intake protects from Cd-induced disorders in bone metabolism.« less

Fail-safe system for activity cooled supersonic and hypersonic aircraft. [using liquid hydrogen fuel

NASA Technical Reports Server (NTRS)

Jones, R. A.; Braswell, D. O.; Richie, C. B.

1975-01-01

A fail-safe-system concept was studied as an alternative to a redundant active cooling system for supersonic and hypersonic aircraft which use the heat sink of liquid-hydrogen fuel for cooling the aircraft structure. This concept consists of an abort maneuver by the aircraft and a passive thermal protection system (TPS) for the aircraft skin. The abort manuever provides a low-heat-load descent from normal cruise speed to a lower speed at which cooling is unnecessary, and the passive TPS allows the aircraft skin to absorb the abort heat load without exceeding critical skin temperature. On the basis of results obtained, it appears that this fail-safe-system concept warrants further consideration, inasmuch as a fail-safe system could possibly replace a redundant active cooling system with no increase in weight and would offer other potential advantages.

Myricetin: A Dietary Molecule with Diverse Biological Activities

PubMed Central

Semwal, Deepak Kumar; Semwal, Ruchi Badoni; Combrinck, Sandra; Viljoen, Alvaro

2016-01-01

Myricetin is a common plant-derived flavonoid and is well recognised for its nutraceuticals value. It is one of the key ingredients of various foods and beverages. The compound exhibits a wide range of activities that include strong anti-oxidant, anticancer, antidiabetic and anti-inflammatory activities. It displays several activities that are related to the central nervous system and numerous studies have suggested that the compound may be beneficial to protect against diseases such as Parkinson’s and Alzheimer’s. The use of myricetin as a preserving agent to extend the shelf life of foods containing oils and fats is attributed to the compound’s ability to protect lipids against oxidation. A detailed search of existing literature revealed that there is currently no comprehensive review available on this important molecule. Hence, the present work includes the history, synthesis, pharmaceutical applications and toxicity studies of myricetin. This report also highlights structure-activity relationships and mechanisms of action for various biological activities. PMID:26891321

ADVANCED WORKER PROTECTION SYSTEM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Judson Hedgehock

2001-03-16

From 1993 to 2000, OSS worked under a cost share contract from the Department of Energy (DOE) to develop an Advanced Worker Protection System (AWPS). The AWPS is a protective ensemble that provides the user with both breathing air and cooling for a NIOSH-rated duration of two hours. The ensemble consists of a liquid air based backpack, a Liquid Cooling Garment (LCG), and an outer protective garment. The AWPS project was divided into two phases. During Phase 1, OSS developed and tested a full-scale prototype AWPS. The testing showed that workers using the AWPS could work twice as long asmore » workers using a standard SCBA. The testing also provided performance data on the AWPS in different environments that was used during Phase 2 to optimize the design. During Phase 1, OSS also performed a life-cycle cost analysis on a representative clean up effort. The analysis indicated that the AWPS could save the DOE millions of dollars on D and D activities and improve the health and safety of their workers. During Phase 2, OSS worked to optimize the AWPS design to increase system reliability, to improve system performance and comfort, and to reduce the backpack weight and manufacturing costs. To support this design effort, OSS developed and tested several different generations of prototype units. Two separate successful evaluations of the ensemble were performed by the International Union of Operation Engineers (IUOE). The results of these evaluations were used to drive the design. During Phase 2, OSS also pursued certifying the AWPS with the applicable government agencies. The initial intent during Phase 2 was to finalize the design and then to certify the system. OSS and Scott Health and Safety Products teamed to optimize the AWPS design and then certify the system with the National Institute of Occupational Health and Safety (NIOSH). Unfortunately, technical and programmatic difficulties prevented us from obtaining NIOSH certification. Despite the inability of NIOSH to certify the design, OSS was able to develop and successfully test, in both the lab and in the field, a prototype AWPS. They clearly demonstrated that a system which provides cooling can significantly increase worker productivity by extending the time they can function in a protective garment. They were also able to develop mature outer garment and LCG designs that provide considerable benefits over current protective equipment, such as self donning and doffing, better visibility, and machine washable. A thorough discussion of the activities performed during Phase 1 and Phase 2 is presented in the AWPS Final Report. The report also describes the current system design, outlines the steps needed to certify the AWPS, discusses the technical and programmatic issues that prevented the system from being certified, and presents conclusions and recommendations based upon the seven year effort.« less

Natural Killer T Cell Activation Protects Mice Against Experimental Autoimmune Encephalomyelitis

PubMed Central

Singh, Avneesh K.; Wilson, Michael T.; Hong, Seokmann; Olivares-Villagómez, Danyvid; Du, Caigan; Stanic, Aleksandar K.; Joyce, Sebastian; Sriram, Subramaniam; Koezuka, Yasuhiko; Van Kaer, Luc

2001-01-01

Experimental autoimmune encephalomyelitis (EAE) serves as a prototypic model for T cell–mediated autoimmunity. Vα14 natural killer T (NKT) cells are a subset of T lymphocytes that recognize glycolipid antigens presented by the nonpolymorphic major histocompatibility complex (MHC) class I–like protein CD1d. Here, we show that activation of Vα14 NKT cells by the glycosphingolipid α-galactosylceramide (α-GalCer) protects susceptible mice against EAE. β-GalCer, which binds CD1d but is not recognized by NKT cells, failed to protect mice against EAE. Furthermore, α-GalCer was unable to protect CD1d knockout (KO) mice against EAE, indicating the requirement for an intact CD1d antigen presentation pathway. Protection of disease conferred by α-GalCer correlated with its ability to suppress myelin antigen-specific Th1 responses and/or to promote myelin antigen-specific Th2 cell responses. α-GalCer was unable to protect IL-4 KO and IL-10 KO mice against EAE, indicating a critical role for both of these cytokines. Because recognition of α-GalCer by NKT cells is phylogenetically conserved, our findings have identified NKT cells as novel target cells for treatment of inflammatory diseases of the central nervous system. PMID:11748281

Pragmatic ethical basis for radiation protection in diagnostic radiology.

PubMed

Malone, Jim; Zölzer, Friedo

2016-01-01

Medical ethics has a tried and tested literature and a global active research community. Even among health professionals, literate and fluent in medical ethics, there is low recognition of radiation protection principles such as justification and optimization. On the other hand, many in healthcare environments misunderstand dose limitation obligations and incorrectly believe patients are protected by norms including a dose limit. Implementation problems for radiation protection in medicine possibly flow from apparent inadequacies of the International Commission on Radiological Protection (ICRP) principles taken on their own, coupled with their failure to transfer successfully to the medical world. Medical ethics, on the other hand, is essentially global, is acceptable in most cultures, is intuitively understood in hospitals, and its expectations are monitored, even by managements. This article presents an approach to ethics in diagnostic imaging rooted in the medical tradition, and alert to contemporary social expectations. ICRP and the International Radiation Protection Association (IRPA), both alert to growing ethical concerns, organized a series of consultations on ethics for general radiation protection in the last few years. The literature on medical ethics and implicit ICRP ethical values were reviewed qualitatively, with a view to identifying a system that will help guide contemporary behaviour in radiation protection of patients. Application of the system is illustrated in six clinical scenarios. The proposed system is designed, as far as is possible, so as not to be in conflict with the conclusions emerging from the ICRP/IRPA consultations. A widely recognized and well-respected system of medical ethics was identified that has global reach and claims acceptance in all cultures. Three values based on this system are grouped with two additional values to provide an ethical framework for application in diagnostic imaging. This system has the potential to be robust and to reach conclusions that are in accord with contemporary medical, social and ethical thinking. The system is not intended to replace the ICRP principles. Rather, it is intended as a well-informed interim approach that will help judge and analyse situations that arouse ethical concerns in radiology. Six scenarios illustrate the practicality of the value system in alerting one to possible deficits in practice. Five widely recognized values and the basis for them are identified to support the contemporary practice of diagnostic radiology. These are essential to complement the widely used ICRP principles pending further development in the area.

Barrier protective effects of withaferin A in HMGB1-induced inflammatory responses in both cellular and animal models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Wonhwa; Department of Biochemistry and Cell Biology, School of Medicine, Kyungpook National University; Kim, Tae Hoon

2012-07-01

Withaferin A (WFA), an active compound from Withania somnifera, is widely researched for its anti-inflammatory, cardioactive and central nervous system effects. In this study, we first investigated the possible barrier protective effects of WFA against pro-inflammatory responses in human umbilical vein endothelial cells (HUVECs) and in mice induced by high mobility group box 1 protein (HMGB1) and the associated signaling pathways. The barrier protective activities of WFA were determined by measuring permeability, leukocytes adhesion and migration, and activation of pro-inflammatory proteins in HMGB1-activated HUVECs. We found that WFA inhibited lipopolysaccharide (LPS)-induced HMGB1 release and HMGB1-mediated barrier disruption, expression of cellmore » adhesion molecules (CAMs) and adhesion/transendothelial migration of leukocytes to human endothelial cells. WFA also suppressed acetic acid-induced hyperpermeability and carboxymethylcellulose-induced leukocytes migration in vivo. Further studies revealed that WFA suppressed the production of interleukin 6, tumor necrosis factor-α (TNF-α) and activation of nuclear factor-κB (NF-κB) by HMGB1. Collectively, these results suggest that WFA protects vascular barrier integrity by inhibiting hyperpermeability, expression of CAMs, adhesion and migration of leukocytes, thereby endorsing its usefulness as a therapy for vascular inflammatory diseases. -- Highlights: ► Withaferin A inhibited LPS induced HMGB1 release. ► Withaferin A reduced HMGB1-mediated hyperpermeability. ► Withaferin A inhibited HMGB1-mediated adhesion and migration of leukocytes. ► Withaferin A inhibited HMGB1-mediated activation of NF-κB, IL-6 and TNF-α.« less

A feasibility study of cell phone and landline phone interviews for monitoring of risk and protection factors for chronic diseases in Brazil.

PubMed

Moura, Erly Catarina; Claro, Rafael Moreira; Bernal, Regina; Ribeiro, Juliano; Malta, Deborah Carvalho; Morais Neto, Otaliba

2011-02-01

The study objective was to evaluate the feasibility of interviews by cell phone as a complement to interviews by landline to estimate risk and protection factors for chronic non-communicable diseases. Adult cell phone users were evaluated by random digit dialing. Questions asked were: age, sex, education, race, marital status, ownership of landline and cell phones, health condition, weight and height, medical diagnosis of hypertension and diabetes, physical activity, diet, binge drinking and smoking. The estimates were calculated using post-stratification weights. The cell phone interview system showed a reduced capacity to reach elderly and low educated populations. The estimates of the risk and protection factors for chronic non-communicable diseases in cell phone interviews were equal to the estimates obtained by landline phone. Eligibility, success and refusal rates using the cell phone system were lower than those of the landline system, but loss and cost were much higher, suggesting it is unsatisfactory as a complementary method in such a context.

Protecting against vascular disease in brain

PubMed Central

2011-01-01

Endothelial cells exert an enormous influence on blood vessels throughout the circulation, but their impact is particularly pronounced in the brain. New concepts have emerged recently regarding the role of this cell type and mechanisms that contribute to endothelial dysfunction and vascular disease. Activation of the renin-angiotensin system plays a prominent role in producing these abnormalities. Both oxidative stress and local inflammation are key mechanisms that underlie vascular disease of diverse etiology. Endogenous mechanisms of vascular protection are also present, including antioxidants, anti-inflammatory molecules, and peroxisome proliferator-activated receptor-γ. Despite their clear importance, studies of mechanisms that underlie cerebrovascular disease continue to lag behind studies of vascular biology in general. Identification of endogenous molecules and pathways that protect the vasculature may result in targeted approaches to prevent or slow the progression of vascular disease that causes stroke and contributes to the vascular component of dementia and Alzheimer's disease. PMID:21335467

Waste Technology Engineering Laboratory (324 building)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kammenzind, D.E.

The 324 Facility Standards/Requirements Identification Document (S/RID) is comprised of twenty functional areas. Two of the twenty functional areas (Decontamination and Decommissioning and Environmental Restoration) were determined as nonapplicable functional areas and one functional area (Research and Development and Experimental Activities) was determined applicable, however, requirements are found in other functional areas and will not be duplicated. Each functional area follows as a separate chapter, either containing the S/RID or a justification for nonapplicability. The twenty functional areas listed below follow as chapters: 1. Management Systems; 2. Quality Assurance; 3. Configuration Management; 4. Training and Qualification; 5. Emergency Management; 6.more » Safeguards and Security; 7. Engineering Program; 8. Construction; 9. Operations; 10. Maintenance; 11. Radiation Protection; 12. Fire Protection; 13. Packaging and Transportation; 14. Environmental Restoration; 15. Decontamination and Decommissioning; 16. Waste Management; 17. Research and Development and Experimental Activities; 18. Nuclear Safety; 19. Occupational Safety and Health; 20. Environmental Protection.« less

Protecting Networks Via Automated Defense of Cyber Systems

DTIC Science & Technology

2016-09-01

autonomics, and artificial intelligence . Our conclusion is that automation is the future of cyber defense, and that advances are being made in each of...SUBJECT TERMS Internet of Things, autonomics, sensors, artificial intelligence , cyber defense, active cyber defense, automated indicator sharing...called Automated Defense of Cyber Systems, built upon three core technological components: sensors, autonomics, and artificial intelligence . Our

78 FR 52786 - Notice of Lodging of Proposed Consent Decree Under the Park System Resource Protection Act

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-26

... access to Defendants' property to plant, water, and monitor replacement trees, and conduct other appropriate activities. Defendants will also supply water and equipment to water the trees. The publication of....C. 19jj et seq., for destruction of, loss of, or injury to park system resources of the Saint Croix...

Neuroscience. Stout guards of the central nervous system.

PubMed

Mechoulam, R; Lichtman, A H

2003-10-03

Endocannabinoids have paradoxical effects on the mammalian nervous system: Sometimes they block neuronal excitability and other times they augment it. In their Perspective, Mechoulam and Lichtman discuss new work (Marsicano et al.) showing that activation of the cannabinoid receptor CB1 by the endocannabinoid anandamide protects against excitotoxic damage in a mouse model of kainic acid-induced epilepsy.

SPME determination of volatile aldehydes for evaluation of in-vitro antioxidant activity.

PubMed

Stashenko, Elena E; Puertas, Miguel A; Martínez, Jairo R

2002-05-01

The in-vitro antioxidant activity of natural (essential oils, vitamin E) or synthetic substances ( tert-butyl hydroxy anisole (BHA), Trolox) has been evaluated by monitoring volatile carbonyl compounds released in model lipid systems subjected to peroxidation. The procedure employed methodology previously developed for the determination of carbonyl compounds as their pentafluorophenylhydrazine derivatives which were quantified, with high sensitivity, by means of capillary gas chromatography with electron-capture detection. Linoleic acid and sunflower oil were used as model lipid systems. Lipid peroxidation was induced in linoleic acid by the Fe2+ ion (1 mmol L-1, 37 degrees C, 12 h) and in sunflower oil by heating in the presence of O2 (220 degrees C, 2 h). The change in hexanal (the main lipoxidation product) concentration found in the lipid matrix subjected to oxidation with and without the substance being tested was used to calculate the antioxidant protection effect. These procedures were employed to evaluate the antioxidant activity of the essential oils of cilantro ( Coriander sativum L.), fennel ( Foeniculum vulgare Mill.), rosemary ( Rosmarinus officinalis L.), "salvia negra" ( Lepechinia schiedeana), and oregano ( Origanum vulgare L.), and the well-known antioxidants BHA, vitamin E, and Trolox, its water-soluble analog. In the sunflower oil system, the essential oils had a stronger protective effect against lipid peroxidation than BHA, vitamin E, and Trolox within the range of concentrations examined (1-20 g L-1). The highest protecting effect, corresponding to a 90% drop in hexanal release, was observed for cilantro oil at 10 g L-1.

Suppressing active replication of a live attenuated simian immunodeficiency virus vaccine does not abrogate protection from challenge

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gabriel, Benjamin; Fiebig, Uwe; Hohn, Oliver

Although safety concerns preclude the use of live attenuated HIV vaccines in humans, they provide a useful system for identifying the elusive correlates of protective immunity in the SIV/macaque animal model. However, a number of pieces of evidence suggest that protection may result from prior occupancy of susceptible target cells by the vaccine virus rather than the immune response. To address this, we developed a Nef-deletion variant of an RT-SHIV whose active replication could be shut off by treatment with RT-inhibitors. Groups of macaques were inoculated with the ∆Nef-RT-SHIV and immune responses allowed to develop before antiretroviral treatment and subsequentmore » challenge with wild-type SIVmac239. Vaccinated animals either resisted infection fully or significantly controlled the subsequent viremia. However, there was no difference between animals undergoing replication of the vaccine virus and those without. This strongly suggests that competition for available target cells does not play a role in protection. - Highlights: • A Nef-deleted RT-SHIV was used as a live attenuated vaccine in macaques. • Vaccine virus replication was shut down to investigate its role in protection. • Ongoing vaccine virus replication did not appear to be necessary for protection. • An analysis of T- and B-cell responses failed to identify a correlate of protection.« less

A recombinant 63-kDa form of Bacillus anthracis protective antigen produced in the yeast Saccharomyces cerevisiae provides protection in rabbit and primate inhalational challenge models of anthrax infection.

PubMed

Hepler, Robert W; Kelly, Rosemarie; McNeely, Tessie B; Fan, Hongxia; Losada, Maria C; George, Hugh A; Woods, Andrea; Cope, Leslie D; Bansal, Alka; Cook, James C; Zang, Gina; Cohen, Steven L; Wei, Xiaorong; Keller, Paul M; Leffel, Elizabeth; Joyce, Joseph G; Pitt, Louise; Schultz, Loren D; Jansen, Kathrin U; Kurtz, Myra

2006-03-06

Infection by Bacillus anthracis is preventable by prophylactic vaccination with several naturally derived and recombinant vaccine preparations. Existing data suggests that protection is mediated by antibodies directed against the protective antigen (PA) component of the anthrax toxin complex. PA is an 83-kDa protein cleaved in vivo to yield a biologically active 63-kDa protein. In an effort to evaluate the potential of yeast as an expression system for the production of recombinant PA, and to determine if the yeast-purified rPA63 can protect from a lethal inhalational challenge, the sequence of the 63-kDa form of PA was codon-optimized and expressed in the yeast Saccharomyces cerevisiae. Highly purified rPA63 isolated from Saccharomyces under denaturing conditions demonstrated reduced biological activity in a macrophage-killing assay compared to non-denatured rPA83 purified from Escherichia coli. Rabbits and non-human primates (NHP) immunized with rPA63 and later challenged with a lethal dose of B. anthracis spores were generally protected from infection. These results indicate that epitopes present in the 63-kDa from of PA can protect rabbits and non-human primates from a lethal spore challenge, and further suggest that a fully functional rPA63 is not required in order to provide these epitopes.

The dectin-1/inflammasome pathway is responsible for the induction of protective T-helper 17 responses that discriminate between yeasts and hyphae of Candida albicans.

PubMed

Cheng, Shih-Chin; van de Veerdonk, Frank L; Lenardon, Megan; Stoffels, Monique; Plantinga, Theo; Smeekens, Sanne; Rizzetto, Lisa; Mukaremera, Liliane; Preechasuth, Kanya; Cavalieri, Duccio; Kanneganti, Thirumala Devi; van der Meer, Jos W M; Kullberg, Bart Jan; Joosten, Leo A B; Gow, Neil A R; Netea, Mihai G

2011-08-01

In the mucosa, the immune pathways discriminating between colonizing and invasive Candida, thus inducing tolerance or inflammation, are poorly understood. Th17 responses induced by Candida albicans hyphae are central for the activation of mucosal antifungal immunity. An essential step for the discrimination between yeasts and hyphae and induction of Th17 responses is the activation of the inflammasome by C. albicans hyphae and the subsequent release of active IL-1β in macrophages. Inflammasome activation in macrophages results from differences in cell-wall architecture between yeasts and hyphae and is partly mediated by the dectin-1/Syk pathway. These results define the dectin-1/inflammasome pathway as the mechanism that enables the host immune system to mount a protective Th17 response and distinguish between colonization and tissue invasion by C. albicans.

NEU3 Sialidase Is Activated under Hypoxia and Protects Skeletal Muscle Cells from Apoptosis through the Activation of the Epidermal Growth Factor Receptor Signaling Pathway and the Hypoxia-inducible Factor (HIF)-1α

PubMed Central

Scaringi, Raffaella; Piccoli, Marco; Papini, Nadia; Cirillo, Federica; Conforti, Erika; Bergante, Sonia; Tringali, Cristina; Garatti, Andrea; Gelfi, Cecilia; Venerando, Bruno; Menicanti, Lorenzo; Tettamanti, Guido; Anastasia, Luigi

2013-01-01

NEU3 sialidase, a key enzyme in ganglioside metabolism, is activated under hypoxic conditions in cultured skeletal muscle cells (C2C12). NEU3 up-regulation stimulates the EGF receptor signaling pathway, which in turn activates the hypoxia-inducible factor (HIF-1α), resulting in a final increase of cell survival and proliferation. In the same cells, stable overexpression of sialidase NEU3 significantly enhances cell resistance to hypoxia, whereas stable silencing of the enzyme renders cells more susceptible to apoptosis. These data support the working hypothesis of a physiological role played by NEU3 sialidase in protecting cells from hypoxic stress and may suggest new directions in the development of therapeutic strategies against ischemic diseases, particularly of the cerebro-cardiovascular system. PMID:23209287

NEU3 sialidase is activated under hypoxia and protects skeletal muscle cells from apoptosis through the activation of the epidermal growth factor receptor signaling pathway and the hypoxia-inducible factor (HIF)-1α.

PubMed

Scaringi, Raffaella; Piccoli, Marco; Papini, Nadia; Cirillo, Federica; Conforti, Erika; Bergante, Sonia; Tringali, Cristina; Garatti, Andrea; Gelfi, Cecilia; Venerando, Bruno; Menicanti, Lorenzo; Tettamanti, Guido; Anastasia, Luigi

2013-02-01

NEU3 sialidase, a key enzyme in ganglioside metabolism, is activated under hypoxic conditions in cultured skeletal muscle cells (C2C12). NEU3 up-regulation stimulates the EGF receptor signaling pathway, which in turn activates the hypoxia-inducible factor (HIF-1α), resulting in a final increase of cell survival and proliferation. In the same cells, stable overexpression of sialidase NEU3 significantly enhances cell resistance to hypoxia, whereas stable silencing of the enzyme renders cells more susceptible to apoptosis. These data support the working hypothesis of a physiological role played by NEU3 sialidase in protecting cells from hypoxic stress and may suggest new directions in the development of therapeutic strategies against ischemic diseases, particularly of the cerebro-cardiovascular system.

Sex matters: Systemic complement activity of female C57BL/6J and BALB/cJ mice is limited by serum terminal pathway components.

PubMed

Kotimaa, Juha; Klar-Mohammad, Ngaisah; Gueler, Faikah; Schilders, Geurt; Jansen, Aswin; Rutjes, Helma; Daha, Mohamed R; van Kooten, Cees

2016-08-01

Experimental mouse models have been extensively used to elucidate the role of the complement system in different diseases and injuries. Contribution of gender has revealed an intriguing gender specific difference; female mice often show protection against most complement driven injuries such as ischemia/reperfusion injury, graft rejection and sepsis. Interestingly, early studies to the mouse complement system revealed that female mice have very low total complement activity (CH50), which is related to androgen regulation of hepatic complement synthesis. Here, our aim was to understand at which level the female specific differences in mouse complement resides. We have used recently developed complement assays to study the functional activities of female and male mice at the level of C3 and C9 activation, and furthermore assayed key complement factor levels in serum of age-matched female and male C57BL/6 mice. Our results show that the female mice have normal complement cascade functionality at the level of C3 activation, which was supported by determinations of early complement factors. However, all pathways are strongly reduced at the level of C9 activation, suggesting a terminal pathway specific difference. This was in line with C6 and C9 measurements, showing strongly decreased levels in females. Furthermore, similar gender differences were also found in BALB/cJ mice, but not in CD-1 mice. Our results clearly demonstrate that the complement system in females of frequently used mouse strains is restricted by the terminal pathway components and that the perceived female specific protection against experimental disease and injury might be in part explained by the inability promote inflammation through C5b-9. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Acute Cerebrovascular Radiation Syndrome: Radiation Neurotoxicity , mechanisms of CNS radiation injury, advanced countermeasures for Radiation Protection of Central Nervous System.

NASA Astrophysics Data System (ADS)

Popov, Dmitri; Jones, Jeffrey; Maliev, Slava

Key words: Cerebrovascular Acute Radiation Syndrome (Cv ARS), Radiation Neurotoxins (RNT), Neurotransmitters, Radiation Countermeasures, Antiradiation Vaccine (ArV), Antiradiation Blocking Antibodies, Antiradiation Antidote. Psychoneuroimmunology, Neurotoxicity. ABSTRACT: To review the role of Radiation Neurotoxins in triggering, developing of radiation induced central nervous system injury. Radiation Neurotoxins - rapidly acting blood toxic lethal agent, which activated after irradiation and concentrated, circulated in interstitial fluid, lymph, blood with interactions with cell membranes, receptors and cell compartments. Radiation Neurotoxins - biological molecules with high enzymatic activity and/or specific lipids and activated or modified after irradiation. The Radiation Neurotoxins induce increased permeability of blood vessels, disruption of the blood-brain barrier, blood-cerebrospinal fluid (CSF) barrier and developing severe disorder of blood macro- and micro-circulation. Principles of Radiation Psychoneuro-immunology and Psychoneuro-allergology were applied for determination of pathological processes developed after irradiation or selective administration of Radiation Neurotoxins to radiation naïve mammals. Effects of radiation and exposure to radiation can develop severe irreversible abnormalities of Central Nervous System, brain structures and functions. Antiradiation Vaccine - most effective, advanced methods of protection, prevention, mitigation and treatment and was used for of Acute Radiation Syndromes and elaboration of new technology for immune-prophylaxis and immune-protection against ϒ, Heavy Ion, Neutron irradiation. Results of experiments suggested that blocking, antitoxic, antiradiation antibodies can significantly reduce toxicity of Radiation Toxins. New advanced technology include active immune-prophylaxis with Antiradiation Vaccine and Antiradiation therapy that included specific blocking antibodies to Radiation Neurotoxins. Antiradiation Vaccine and Antiradiation IgG preparations - prospective effective antidote/countermeasure for ϒ-irradiation, heavy ions irradiation, neutron irradiation. Recommendations for treatment and immune-prophylaxis of CNS injury, induced by radiation, were proposed. Specific immune therapy and specific immune prophylaxis reduce symptoms of ACvRS. This manuscript summarizes the results of experiments and considering possibility for blocking toxicological mechanisms of action of Radiation and Radiation Neurotoxins and prevention or diminishing clinical signs of injury of CNS. Experimental data suggest that Antiradiation vaccine and Antiradiation IgG with specific antibodies to Radiation Neurotoxins, Cytotoxins protect CNS against high doses of radiation.

Pharmacological and Nutritional Effects of Natural Coumarins and Their Structure-Activity Relationships.

PubMed

Zhu, Jing-Jing; Jiang, Jian-Guo

2018-05-11

Coumarins are fused benzene and pyrone ring systems with a wide spectrum of bioactivities including anti-tumor, anti-inflammation, antiviral and antibacterial effects. In this paper, the current development of coumarins-based drugs is introduced, and their structure-activity relationship is discussed by reviewing the relevant literatures published in the past twenty years. Coumarin molecules can be customized by the target site to prevent systemic side effects by virtue of structural modification. The ortho-phenolic hydroxyl on the benzene ring had remarkable antioxidant and anti-tumor activities. Coumarins with aryl groups at the C-4 position have good activities in anti-HIV, anti-tumor, anti-inflammation and analgesia. C-3 phenylcoumarins have strong anti-HIV and antioxidant effects. Tetracycline pyranocoumarins can significantly inhibit the HIV, osthol structural analogues have antimicrobial activity. Praeruptorin C and its derivatives play an important role in lowering blood pressure and dilating coronary arteries, and khellactone derivatives have significant inhibitory effects on AIDS, cancer and cardiovascular diseases. It is concluded that the specific site on the core structure of coumarin exhibits one or more activities due to the electronic or steric effects of the substituents. This review is designed to be conducive to rational design and development of more active and less toxic agents with a coumarin scaffold. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Sulforaphane pretreatment prevents systemic inflammation and renal injury in response to cardiopulmonary bypass.

PubMed

Nguyen, Bao; Luong, Le; Naase, Hatam; Vives, Marc; Jakaj, Gentjan; Finch, Jonathan; Boyle, Joseph; Mulholland, John W; Kwak, Jong-hwan; Pyo, Suhkneung; de Luca, Amalia; Athanasiou, Thanos; Angelini, Gianni; Anderson, Jon; Haskard, Dorian O; Evans, Paul C

2014-08-01

Systemic inflammatory responses are a major cause of morbidity and mortality in patients undergoing cardiac surgery with cardiopulmonary bypass. However, the underlying molecular mechanisms for systemic inflammation in response to cardiopulmonary bypass are poorly understood. A porcine model was established to study the signaling pathways that promote systemic inflammation in response to cardiac surgery with cardiopulmonary bypass under well-controlled experimental conditions. The influence of sulforaphane, an anti-inflammatory compound derived from green vegetables, on inflammation and injury in response to cardiopulmonary bypass was also studied. Intracellular staining and flow cytometry were performed to measure phosphorylation of p38 mitogen-activated protein kinase and the transcription factor nuclear factor-κB in granulocytes and mononuclear cells. Surgery with cardiopulmonary bypass for 1 to 2 hours enhanced phosphorylation of p38 (2.5-fold) and nuclear factor-κB (1.6-fold) in circulating mononuclear cells. Cardiopulmonary bypass also modified granulocytes by activating nuclear factor-κB (1.6-fold), whereas p38 was not altered. Histologic analyses revealed that cardiopulmonary bypass promoted acute tubular necrosis. Pretreatment of animals with sulforaphane reduced p38 (90% reduction) and nuclear factor-κB (50% reduction) phosphorylation in leukocytes and protected kidneys from injury. Systemic inflammatory responses after cardiopulmonary bypass were associated with activation of p38 and nuclear factor-κB pathways in circulating leukocytes. Inflammatory responses to cardiopulmonary bypass can be reduced by sulforaphane, which reduced leukocyte activation and protected against renal injury. Copyright © 2014 The American Association for Thoracic Surgery. Published by Mosby, Inc. All rights reserved.

U.S. EPA's Watershed Management Research Activities

EPA Science Inventory

Watershed and stormwater managers need modeling tools to evaluate alternative plans for environmental quality restoration and protection needs in urban and developing areas. A watershed-scale decision-support system, based on cost optimization, provides an essential tool to suppo...

Hormesis and adaptive cellular control systems

EPA Science Inventory

Hormetic dose response occurs for many endpoints associated with exposures of biological organisms to environmental stressors. Cell-based U- or inverted U-shaped responses may derive from common processes involved in activation of adaptive responses required to protect cells from...

48 CFR 1552.237-74 - Publicity.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Section 1552.237-74 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY CLAUSES AND... removal or remedial activities under the Comprehensive Environmental Response, Compensation and Liability... on-scene coordinator (or Project Officer) prior to releasing any information to the news media...

48 CFR 1552.237-74 - Publicity.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Section 1552.237-74 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY CLAUSES AND... removal or remedial activities under the Comprehensive Environmental Response, Compensation and Liability... on-scene coordinator (or Project Officer) prior to releasing any information to the news media...

48 CFR 1552.237-74 - Publicity.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Section 1552.237-74 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY CLAUSES AND... removal or remedial activities under the Comprehensive Environmental Response, Compensation and Liability... on-scene coordinator (or Project Officer) prior to releasing any information to the news media...

Zein Nanoparticles as Eco-Friendly Carrier Systems for Botanical Repellents Aiming Sustainable Agriculture.

PubMed

Oliveira, Jhones L de; Campos, Estefânia V R; Pereira, Anderson E S; Pasquoto, Tatiane; Lima, Renata; Grillo, Renato; Andrade, Daniel Junior de; Santos, Fabiano Aparecido Dos; Fraceto, Leonardo Fernandes

2018-02-14

Botanical repellents represent one of the main ways of reducing the use of synthetic pesticides and the contamination of soil and hydric resources. However, the poor stability and rapid degradation of these compounds in the environment hinder their effective application in the field. Zein nanoparticles can be used as eco-friendly carrier systems to protect these substances against premature degradation, provide desirable release characteristics, and reduce toxicity in the environment and to humans. In this study, we describe the preparation and characterization of zein nanoparticles loaded with the main constituents of the essential oil of citronella (geraniol and R-citronellal). The phytotoxicity, cytotoxicity, and insect activity of the nanoparticles toward target and nontarget organisms were also evaluated. The botanical formulations showed high encapsulation efficiency (>90%) in the nanoparticles, good physicochemical stability, and effective protection of the repellents against UV degradation. Cytotoxicity and phytotoxicity assays showed that encapsulation of the botanical repellents decreased their toxicity. Repellent activity tests showed that nanoparticles containing the botanical repellents were highly repellent against the Tetranychus urticae Koch mite. This nanotechnological formulation offers a new option for the effective use of botanical repellents in agriculture, reducing toxicity, protecting against premature degradation, and providing effective pest control.

Nanocomposites coated with xyloglucan for drug delivery: In vitro studies.

PubMed

Ribeiro, C; Arizaga, G G C; Wypych, F; Sierakowski, M-R

2009-02-09

Enalaprilate (Enal), an active pharmaceutical component, was intercalated into a layered double hydroxide (Mg/Al-LDH) by an ion exchange reaction. The use of a layered double hydroxide (LDH) to release active drugs is limited by the low pH of the stomach (pH approximately 1.2), in whose condition it is readily dissolved. To overcome this limitation, xyloglucan (XG) extracted from Hymenaea courbaril (jatobá) seeds, Brazilian species, was used to protect the LDH and allow the drug to pass through the gastrointestinal tract. All the materials were characterized by X-ray diffraction, Fourier transform infrared spectroscopy, elemental analyses, transmission electronic microscopy, thermal analyses, and a kinetic study of the in vitro release was monitored by ultraviolet spectroscopy. The resulting hybrid system containing HDL-Enal-XG(3) slowly released the Enal. In an 8-h of test, the system protected 40% (w/v) of the drug. The kinetic profile showed that the drug release was a co-effect behavior, involving dissolution of inorganic material and ion exchange between the intercalated anions in the lamella and those of phosphate in the buffer solution. The nanocomposite coated protection with XG was therefore efficient in obtaining a slow release of Enal.

Mesoporous silica nanoparticles for active corrosion protection.

PubMed

Borisova, Dimitriya; Möhwald, Helmuth; Shchukin, Dmitry G

2011-03-22

This work presents the synthesis of monodisperse, mesoporous silica nanoparticles and their application as nanocontainers loaded with corrosion inhibitor (1H-benzotriazole (BTA)) and embedded in hybrid SiOx/ZrOx sol-gel coating for the corrosion protection of aluminum alloy. The developed porous system of mechanically stable silica nanoparticles exhibits high surface area (∼1000 m2·g(-1)), narrow pore size distribution (d∼3 nm), and large pore volume (∼1 mL·g(-1)). As a result, a sufficiently high uptake and storage of the corrosion inhibitor in the mesoporous nanocontainers was achieved. The successful embedding and homogeneous distribution of the BTA-loaded monodisperse silica nanocontainers in the passive anticorrosive SiOx/ZrOx film improve the wet corrosion resistance of the aluminum alloy AA2024 in 0.1 M sodium chloride solution. The enhanced corrosion protection of this newly developed active system in comparison to the passive sol-gel coating was observed during a simulated corrosion process by the scanning vibrating electrode technique (SVET). These results, as well as the controlled pH-dependent release of BTA from the mesoporous silica nanocontainers without additional polyelectrolyte shell, suggest an inhibitor release triggered by the corrosion process leading to a self-healing effect.

Protective Effects of Hydroxychloroquine against Accelerated Atherosclerosis in Systemic Lupus Erythematosus

PubMed Central

Cauli, Alberto

2018-01-01

Cardiovascular (CV) morbidity and mortality are a challenge in management of patients with systemic lupus erythematosus (SLE). Higher risk of CV disease in SLE patients is mostly related to accelerated atherosclerosis. Nevertheless, high prevalence of traditional cardiovascular risk factors in SLE patients does not fully explain the increased CV risk. Despite the pathological bases of accelerated atherosclerosis are not fully understood, it is thought that this process is driven by the complex interplay between SLE and atherosclerosis pathogenesis. Hydroxychloroquine (HCQ) is a cornerstone in treatment of SLE patients and has been thought to exert a broad spectrum of beneficial effects on disease activity, prevention of damage accrual, and mortality. Furthermore, HCQ is thought to protect against accelerated atherosclerosis targeting toll-like receptor signaling, cytokine production, T-cell and monocyte activation, oxidative stress, and endothelial dysfunction. HCQ was also described to have beneficial effects on traditional CV risk factors, such as dyslipidemia and diabetes. In conclusion, despite lacking randomized controlled trials unambiguously proving the protection of HCQ against accelerated atherosclerosis and incidence of CV events in SLE patients, evidence analyzed in this review is in favor of its beneficial effect. PMID:29670462

30 CFR 865.11 - Protected activity.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 30 Mineral Resources 3 2013-07-01 2013-07-01 false Protected activity. 865.11 Section 865.11 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR PROTECTION OF EMPLOYEES PROTECTION OF EMPLOYEES § 865.11 Protected activity. (a) No person shall discharge or...

30 CFR 865.11 - Protected activity.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 30 Mineral Resources 3 2011-07-01 2011-07-01 false Protected activity. 865.11 Section 865.11 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR PROTECTION OF EMPLOYEES PROTECTION OF EMPLOYEES § 865.11 Protected activity. (a) No person shall discharge or...

30 CFR 865.11 - Protected activity.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 30 Mineral Resources 3 2012-07-01 2012-07-01 false Protected activity. 865.11 Section 865.11 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR PROTECTION OF EMPLOYEES PROTECTION OF EMPLOYEES § 865.11 Protected activity. (a) No person shall discharge or...

30 CFR 865.11 - Protected activity.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 30 Mineral Resources 3 2014-07-01 2014-07-01 false Protected activity. 865.11 Section 865.11 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR PROTECTION OF EMPLOYEES PROTECTION OF EMPLOYEES § 865.11 Protected activity. (a) No person shall discharge or...

30 CFR 865.11 - Protected activity.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Protected activity. 865.11 Section 865.11 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT OF THE INTERIOR PROTECTION OF EMPLOYEES PROTECTION OF EMPLOYEES § 865.11 Protected activity. (a) No person shall discharge or...

Protective effects of quercetin on nicotine induced oxidative stress in 'HepG2 cells'.

PubMed

Yarahmadi, Amir; Zal, Fatemeh; Bolouki, Ayeh

2017-10-01

Nicotine is a natural component of tobacco plants and is responsible for the addictive properties of tobacco. Nicotine has been recognized to result in oxidative stress by inducing the generation of reactive oxygen species (ROS). The purpose of this work was to estimate the hepatotoxicity effect of nicotine on viability and on antioxidant defense system in cultures of HepG2 cell line and the other hand, ameliorative effect of quercetin (Q) as an antioxidant was analyzed. Nicotine induced concentration dependent loss in HepG2 cell line viability. The results indicated that nicotine decreased activity of superoxide dismutase (SOD) and glutathione reductase (GR) and increased activities of catalase (CAT) and glutathione peroxidase (GPx) and glutathione (GSH) content in the HepG2 cells. Q significantly increased activity of SOD, GR and GSH content and decreased activity of GPX in nicotine + Q groups. Our data demonstrate that Q plays a protective role against the imbalance elicited by nicotine between the production of free radicals and antioxidant defense systems, and suggest that administration of this antioxidant may find clinical application where cellular damage is a consequence of ROS.

Nanocontainer-based corrosion sensing coating.

PubMed

Maia, F; Tedim, J; Bastos, A C; Ferreira, M G S; Zheludkevich, M L

2013-10-18

The present paper reports on the development of new sensing active coating on the basis of nanocontainers containing pH-indicating agent. The coating is able to detect active corrosion processes on different metallic substrates. The corrosion detection functionality based on the local colour change in active cathodic zones results from the interaction of hydroxide ions with phenolphthalein encapsulated in mesoporous nanocontainers which function as sensing nanoreactors. The mesoporous silica nanocontainers are synthesized and loaded with pH indicator phenolphthalein in a one-stage process. The resulting system is mesoporous, which together with bulkiness of the indicator molecules limits their leaching. At the same time, penetration of water molecules and ions inside the container is still possible, allowing encapsulated phenolphthalein to be sensitive to the pH in the surrounding environment and outperforming systems when an indicator is directly dispersed in the coating layer.The performed tests demonstrate the pH sensitivity of the developed nanocontainers being dispersed in aqueous solutions. The corrosion sensing functionality of the protective coatings with nanocontainers are proven for aluminium- and magnesium-based metallic substrates. As a result, the developed nanocontainers show high potential to be used in a new generation of active protective coatings with corrosion-sensing coatings.

Effects of Adaptogens on the Central Nervous System and the Molecular Mechanisms Associated with Their Stress—Protective Activity

PubMed Central

Panossian, Alexander; Wikman, Georg

2010-01-01

Adaptogens were initially defined as substances that enhance the “state of non-specific resistance” in stress, a physiological condition that is linked with various disorders of the neuroendocrine-immune system. Studies on animals and isolated neuronal cells have revealed that adaptogens exhibit neuroprotective, anti-fatigue, antidepressive, anxiolytic, nootropic and CNS stimulating activity. In addition, a number of clinical trials demonstrate that adaptogens exert an anti-fatigue effect that increases mental work capacity against a background of stress and fatigue, particularly in tolerance to mental exhaustion and enhanced attention. Indeed, recent pharmacological studies of a number of adaptogens have provided a rationale for these effects also at the molecular level. It was discovered that the stress—protective activity of adaptogens was associated with regulation of homeostasis via several mechanisms of action, which was linked with the hypothalamic-pituitary-adrenal axis and the regulation of key mediators of stress response, such as molecular chaperons (e.g., HSP70), stress-activated c-Jun N-terminal protein kinase 1 (JNK1), Forkhead box O (FOXO) transcription factor DAF-16, cortisol and nitric oxide. PMID:27713248

EUROBLOCv2: Methodology for the Study of Rockfalls

NASA Astrophysics Data System (ADS)

Torrebadella, Joan; Altimir, Joan; Lopez, Carles; Amigó, Jordi; Ferrer, Pau

2014-05-01

For studies of falling rocks, Euroconsult (Andorra) and Eurogeotecnica (Catalonia) developed in 1998 the methodology known as EUROBLOC. Having worked with it for over 10 years, and having done numerous studies both in the Principality of Andorra and Spain, it was considered appropriate to undertake an enhanced version of the methodology (EUROBLOCv2), in order to adapt it to the technological advances carried out in recent years on passive protection techniques, (it should be remembered that in 2000 there was only dynamic barriers with a retaining capacity of 1.000 kJ and nowadays there are already approved barriers up to 8.000 kJ and it is expected to reach10.000 kJ in the near future, embankments, reinforced earth walls, etc.) and also in active protection systems (direct stabilization of the slope in base of wire mesh or wire mesh combined with high strength anchors). The EUROBLOCv2 methodology (which was first used in 2012 in order to incorporate all the improvements in the field of protection) consists of two distinct parts, which are firstly, the analysis of rock falls and secondly determining the degree of protection afforded by the protection. So today, we can use a pioneering technique in the field of rocky landslides in which we consider all possible kinds of protection that are on the market, based on both passive protection and active protection. The new methodology also allows work with the simulation of 20m3 rock fall volume, instead on 10m3, maximum considered to date.

Protection Enhances Community and Habitat Stability: Evidence from a Mediterranean Marine Protected Area

PubMed Central

Fraschetti, Simonetta; Guarnieri, Giuseppe; Bevilacqua, Stanislao; Terlizzi, Antonio; Boero, Ferdinando

2013-01-01

Rare evidences support that Marine Protected Areas (MPAs) enhance the stability of marine habitats and assemblages. Based on nine years of observation (2001–2009) inside and outside a well managed MPA, we assessed the potential of conservation and management actions to modify patterns of spatial and/or temporal variability of Posidonia oceanica meadows, the lower midlittoral and the shallow infralittoral rock assemblages. Significant differences in both temporal variations and spatial patterns were observed between protected and unprotected locations. A lower temporal variability in the protected vs. unprotected assemblages was found in the shallow infralittoral, demonstrating that, at least at local scale, protection can enhance community stability. Macrobenthos with long-lived and relatively slow-growing invertebrates and structurally complex algal forms were homogeneously distributed in space and went through little fluctuations in time. In contrast, a mosaic of disturbed patches featured unprotected locations, with small-scale shifts from macroalgal stands to barrens, and harsh temporal variations between the two states. Opposite patterns of spatial and temporal variability were found for the midlittoral assemblages. Despite an overall clear pattern of seagrass regression through time, protected meadows showed a significantly higher shoot density than unprotected ones, suggesting a higher resistance to local human activities. Our results support the assumption that the exclusion/management of human activities within MPAs enhance the stability of the structural components of protected marine systems, reverting or arresting threat-induced trajectories of change. PMID:24349135

29 CFR 1978.104 - Investigation.

Code of Federal Regulations, 2011 CFR

2011-07-01

... covered by the Act, a perception of protected activity was a contributing factor in the adverse action... circumstances covered by the Act, the perception of protected activity, was a contributing factor in the adverse... employee to have engaged in protected activity) and that the protected activity (or the perception thereof...

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Overload protection: avoidance response to heavy plantar surface loading.

PubMed

Robbins, S E; Hanna, A M; Gouw, G J

1988-02-01

Current footwear which are designed for use in running are examples of intentional biomechanical model integration into device design. The inadequacy of this footwear in protecting against injury is postulated to be due to fixation on inadequate models of locomotory biomechanics that do not provide for feedback control; in particular, an hypothesized plantar surface sensory-mediated feedback control system, which imparts overload protection during locomotion. A heuristic approach was used to identify the hypothesized system. A random series of loads (0 to 164 kg) was applied to the knee flexed at 90 degrees. In this testing system, plantar surface avoidance behavior was the difference between the sum of the leg weight and the load applied to the knee, and the load measured at the plantar surface; this was produced by activation of hip flexors. Significant avoidance behavior was found in all of the subjects (P less than 0.001). On all surfaces tested, including modern athletic footwear (P less than 0.001), its magnitude increased directly in relation to the load applied to the knee (P less than 0.001). There were significant differences in avoidance behavior in relation to the weight-bearing surfaces tested (P less than 0.05). With the identification of a feedback control system which would serve to moderate loading during locomotion, an explanation is provided as to why current athletic footwear do not protect and may be injurious; thus allowing the design of footwear which may be truly protective.

A Shifting Shield Provides Protection Against Cosmic Rays

NASA Astrophysics Data System (ADS)

Kohler, Susanna

2017-12-01

The Sun plays an important role in protecting us from cosmic rays, energetic particles that pelt us from outside our solar system. But can we predict when and how it will provide the most protection, and use this to minimize the damage to both pilotedand roboticspace missions?The Challenge of Cosmic RaysSpacecraft outside of Earths atmosphere and magnetic field are at risk of damage from cosmic rays. [ESA]Galactic cosmic rays are high-energy, charged particles that originate from astrophysical processes like supernovae or even distant active galactic nuclei outside of our solar system.One reason to care about the cosmic rays arriving near Earth is because these particles can provide a significant challenge for space missions traveling above Earths protective atmosphere and magnetic field. Since impacts from cosmic rays can damage human DNA, this risk poses a major barrier to plans for interplanetary travel by crewed spacecraft. And roboticmissions arent safe either: cosmic rays can flip bits, wreaking havoc on spacecraft electronics as well.The magnetic field carried by the solar wind provides a protective shield, deflecting galactic cosmic rays from our solar system. [Walt Feimer/NASA GSFCs Conceptual Image Lab]Shielded by the SunConveniently, we do have some broader protection against galactic cosmic rays: a built-in shield provided by the Sun. The interplanetary magnetic field, which is embedded in the solar wind, deflects low-energy cosmic rays from us at the outer reaches of our solar system, decreasing the flux of these cosmic rays that reach us at Earth.This shield, however, isnt stationary; instead, it moves and changes as the strength and direction of the solar wind moves and changes. This results in a much lower cosmic-ray flux at Earth when solar activity is high i.e., at the peak of the 11-year solar cycle than when solar activity is low. This visible change in local cosmic-ray flux with solar activity is known as solar modulation of the cosmic ray flux at Earth.In a new study, a team of scientists led by Nicola Tomassetti (University of Perugia, Italy) has modeled this solar modulation to better understand the process by which the Suns changing activity influences the cosmic ray flux that reaches us at Earth.Modeling a LagTomassetti and collaborators model uses two solar-activity observables as inputs: the number of sunspots and the tilt angle of the heliospheric current sheet. By modeling basic transport processes in the heliosphere, the authors then track the impact that the changing solar properties have on incoming galactic cosmic rays. In particular, the team explores the time lag between when solar activity changes and when we see the responding change in the cosmic-ray flux.Cosmic-ray flux observations are best fit by the authors model when an 8-month lag is included (red bold line). A comparison model with no lag (black dashed line) is included. [Tomassetti et al. 2017]By comparing their model outputs to the large collection of time-dependent observations of cosmic-ray fluxes, Tomassetti and collaborators show that the best fit to data occurs with an 8-month lag between changing solar activity and local cosmic-ray flux modulation.This is an important outcome for studying the processes that affect the cosmic-ray flux that reaches Earth. But theres an additional intriguing consequence of this result: knowledge of the current solar activity could allow us to predict the modulation that will occur for cosmic rays near Earth an entire 8 months from now! If this model is correct, it brings us one step closer to being able to plan safer space missions for the future.CitationNicola Tomassetti et al 2017 ApJL 849 L32. doi:10.3847/2041-8213/aa9373

32 CFR 228.2 - Control of activities on protected property.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 32 National Defense 2 2010-07-01 2010-07-01 false Control of activities on protected property. 228... DEFENSE (CONTINUED) MISCELLANEOUS SECURITY PROTECTIVE FORCE § 228.2 Control of activities on protected property. Persons in and on protected property shall at all times comply with official signs of a...

32 CFR 228.2 - Control of activities on protected property.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 32 National Defense 2 2013-07-01 2013-07-01 false Control of activities on protected property. 228... DEFENSE (CONTINUED) MISCELLANEOUS SECURITY PROTECTIVE FORCE § 228.2 Control of activities on protected property. Persons in and on protected property shall at all times comply with official signs of a...

32 CFR 228.2 - Control of activities on protected property.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 32 National Defense 2 2011-07-01 2011-07-01 false Control of activities on protected property. 228... DEFENSE (CONTINUED) MISCELLANEOUS SECURITY PROTECTIVE FORCE § 228.2 Control of activities on protected property. Persons in and on protected property shall at all times comply with official signs of a...

32 CFR 228.2 - Control of activities on protected property.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 32 National Defense 2 2012-07-01 2012-07-01 false Control of activities on protected property. 228... DEFENSE (CONTINUED) MISCELLANEOUS SECURITY PROTECTIVE FORCE § 228.2 Control of activities on protected property. Persons in and on protected property shall at all times comply with official signs of a...

Marginalization of end-use technologies in energy innovation for climate protection

NASA Astrophysics Data System (ADS)

Wilson, Charlie; Grubler, Arnulf; Gallagher, Kelly S.; Nemet, Gregory F.

2012-11-01

Mitigating climate change requires directed innovation efforts to develop and deploy energy technologies. Innovation activities are directed towards the outcome of climate protection by public institutions, policies and resources that in turn shape market behaviour. We analyse diverse indicators of activity throughout the innovation system to assess these efforts. We find efficient end-use technologies contribute large potential emission reductions and provide higher social returns on investment than energy-supply technologies. Yet public institutions, policies and financial resources pervasively privilege energy-supply technologies. Directed innovation efforts are strikingly misaligned with the needs of an emissions-constrained world. Significantly greater effort is needed to develop the full potential of efficient end-use technologies.

Therapeutic vaccines for substance dependence.

PubMed

Kosten, Thomas R; Biegel, Diane

2002-10-01

Several immunotherapies are under development for nicotine, cocaine and phencyclidine and a cocaine vaccine has started human trials. These therapies promise a new approach to diseases that have had limited treatment success and tremendous morbidity. Both the cocaine and nicotine addiction immunotherapies have reduced 'relapse' to drug use in animal model systems. To date, the active cocaine vaccine has few side effects and induces considerable antibody titers after active immunization in humans. Studies with the monoclonal phencyclidine immunotherapy provide intriguing evidence of sustained protection for months after single-dose administration. Other immunotherapy may include treatment of drug overdose, prevention of brain or cardiac toxicity and protection of a fetus during pregnancy in a drug abuser.

[Effectiveness of the Federal Inspectorate for the Protection of Consumer Rights and Human Welfare in the Novosibirsk Region in 2007 to 2009].

PubMed

Mikheev, V N; Ivanova, L K; Iagudin, B I; Turbinskiĭ, V V

2010-01-01

A system for monitoring and analyzing the effectiveness and efficiency of the performance of the Board of the Federal Inspectorate for the Protection of Consumer Rights and Human Welfare in the Novosibirsk Region was introduced into its activities to estimate the provision of the Novosibirsk Region's population with sanitary epidemiological wellbeing in 2007-2009. The introduction of monitoring was ascertained to increase the effectiveness of budgetary fund surveillance and spending, by predicting the effectiveness and choice of priority lines of activities, by increasing the quality of budgetary services rendered in the provision of sanitary and epidemiological well-being to the population.

Topical Resiquimod Protects against Visceral Infection with Leishmania infantum chagasi in Mice

PubMed Central

Craft, Noah; Birnbaum, Ron; Quanquin, Natalie; Erfe, Marie Crisel B.; Quant, Cara; Haskell, Jacquelyn

2014-01-01

New prevention and treatment strategies are needed for visceral leishmaniasis, particularly ones that can be deployed simply and inexpensively in areas where leishmaniasis is endemic. Synthetic molecules that activate Toll-like receptor 7 and 8 (TLR7/8) pathways have previously been demonstrated to enhance protection against cutaneous leishmaniasis. We initially sought to determine whether the TLR7/8-activating molecule resiquimod might serve as an effective vaccine adjuvant targeting visceral leishmaniasis caused by infection with Leishmania infantum chagasi. Resiquimod was topically applied to the skin of mice either prior to or after systemic infection with L. infantum chagasi, and parasite burdens were assessed. Surprisingly, topical resiquimod application alone, in the absence of vaccination, conferred robust resistance to mice against future intravenous challenge with virulent L. infantum chagasi. This protection against L. infantum chagasi infection persisted as long as 8 weeks after the final topical resiquimod treatment. In addition, in mice with existing infections, therapeutic treatment with topical resiquimod led to significantly lower visceral parasite loads. Resiquimod increased trafficking of leukocytes, including B cells, CD4+ and CD8+ T cells, dendritic cells, macrophages, and granulocytes, in livers and spleens, which are the key target organs of visceralizing infection. We conclude that topical resiquimod leads to systemic immune modulation and confers durable protection against visceralizing L. infantum chagasi infection, in both prophylactic and therapeutic settings. These studies support continued studies of TLR-modulating agents to determine mechanisms of protection and also provide a rationale for translational development of a critically needed, novel class of topical, preventative, and therapeutic agents for these lethal infections. PMID:25030052

Five-Year Research and Development Plan, Fiscal Years 2008-2013

DTIC Science & Technology

2008-08-01

protect our interior 1.l.1 Deploy a mix of infrastructure, technology, and personnel on the Southwest border to ensure all illegal activity along...requirements into a systems model. FY 2009: • Review the System of Systems model and ensure it correctly addresses SBI requirements. FY 2010... on a ship). This security architecture provides the framework within which DHS will incorporate their near-term CSD and future container security

Pharmacological effects of Chinese herb aconite (fuzi) on cardiovascular system.

PubMed

Zhao, Dandan; Wang, Jie; Cui, Yanjing; Wu, Xinfang

2012-09-01

Fuzi (aconite, Radix Aconiti praeparata), a widely used Chinese herb, plays a significant role in the cardiovascular system. This is mainly reflected by Fuzi's cardiotonic effect, its protective effect on myocardial cells, and its effect on heart rate and rhythm, blood pressure, and hemodynamics. In this article, the pharmacological effects and the corresponding mechanisms of Fuzi (aconite) and its active components on cardiovascular system are reviewed.

[The action of bemitil on the self-regulation systems during short-term immobilization].

PubMed

Kirichek, L T; Bobkov, Iu G

1991-01-01

In the immobilized rats bemithyl (50 mg/kg in a single dose) was shown to normalize the state of the musculomotor and cardiovascular systems exerting the positive influence on the key links of the process of autoregulation in the form of the sedative (the central nervous system), stress-protective (hormonal regulation) and antihypoxic (metabolism) effects that characterizes it as the drug with the distinct antistress activity.

Cellular self-defense: how cell-autonomous immunity protects against pathogens.

PubMed

Randow, Felix; MacMicking, John D; James, Leo C

2013-05-10

Our prevailing view of vertebrate host defense is strongly shaped by the notion of a specialized set of immune cells as sole guardians of antimicrobial resistance. Yet this view greatly underestimates a capacity for most cell lineages-the majority of which fall outside the traditional province of the immune system-to defend themselves against infection. This ancient and ubiquitous form of host protection is termed cell-autonomous immunity and operates across all three domains of life. Here, we discuss the organizing principles that govern cellular self-defense and how intracellular compartmentalization has shaped its activities to provide effective protection against a wide variety of microbial pathogens.

Security in Full-Force

NASA Technical Reports Server (NTRS)

2002-01-01

When fully developed for NASA, Vanguard Enforcer(TM) software-which emulates the activities of highly technical security system programmers, auditors, and administrators-was among the first intrusion detection programs to restrict human errors from affecting security, and to ensure the integrity of a computer's operating systems, as well as the protection of mission critical resources. Vanguard Enforcer was delivered in 1991 to Johnson Space Center and has been protecting systems and critical data there ever since. In August of 1999, NASA granted Vanguard exclusive rights to commercialize the Enforcer system for the private sector. In return, Vanguard continues to supply NASA with ongoing research, development, and support of Enforcer. The Vanguard Enforcer 4.2 is one of several surveillance technologies that make up the Vanguard Security Solutions line of products. Using a mainframe environment, Enforcer 4.2 achieves previously unattainable levels of automated security management.

rhEPO Enhances Cellular Anti-oxidant Capacity to Protect Long-Term Cultured Aging Primary Nerve Cells.

PubMed

Wang, Huqing; Fan, Jiaxin; Chen, Mengyi; Yao, Qingling; Gao, Zhen; Zhang, Guilian; Wu, Haiqin; Yu, Xiaorui

2017-08-01

Erythropoietin (EPO) may protect the nervous system of animals against aging damage, making it a potential anti-aging drug for the nervous system. However, experimental evidence from natural aging nerve cell models is lacking, and the efficacy of EPO and underlying mechanism of this effect warrant further study. Thus, the present study used long-term cultured primary nerve cells to successfully mimic the natural aging process of nerve cells. Starting on the 11th day of culture, cells were treated with different concentrations of recombinant human erythropoietin (rhEPO). Using double immunofluorescence labeling, we found that rhEPO significantly improved the morphology of long-term cultured primary nerve cells and increased the total number of long-term cultured primary cells. However, rhEPO did not improve the ratio of nerve cells. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to measure nerve cell activity and showed that rhEPO significantly improved the activity of long-term cultured primary nerve cells. Moreover, Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) double immunofluorescence labeling flow cytometry revealed that rhEPO reduced the apoptotic rate of long-term cultured primary nerve cells. Senescence-associated β-galactosidase (SA-β-gal) immunohistochemistry staining showed that rhEPO significantly reduced the aging rate of long-term cultured primary nerve cells. Immunochemistry revealed that rhEPO enhanced intracellular superoxide dismutase (SOD) activity and glutathione (GSH) abundance and reduced the intracellular malondialdehyde (MDA) level. In addition, this effect depended on the dose, was maximized at a dose of 100 U/ml and was more pronounced than that of vitamin E. In summary, this study finds that rhEPO protects long-term cultured primary nerve cells from aging in a dose-dependent manner. The mechanism of this effect may be associated with the enhancement of the intracellular anti-oxidant capacity. These findings provide a theoretical basis to further the anti-aging mechanism of EPO in the nervous system, and they provide experimental evidence at the cellular level for the clinical application of EPO to protect the nervous system from aging.

Heme oxygenase/carbon monoxide signaling pathways: regulation and functional significance.

PubMed

Ryter, Stefan W; Otterbein, Leo E; Morse, Danielle; Choi, Augustine M K

2002-01-01

Carbon monoxide (CO), a gaseous second messenger, arises in biological systems during the oxidative catabolism of heme by the heme oxygenase (HO) enzymes. HO exists as constitutive (HO-2, HO-3) and inducible isoforms (HO-1), the latter which responds to regulation by multiple stress-stimuli. HO-1 confers protection in vitro and in vivo against oxidative cellular stress. Although the redox active compounds that are generated from HO activity (i.e. iron, biliverdin-IXalpha, and bilirubin-IXa) potentially modulate oxidative stress resistance, increasing evidence points to cytoprotective roles for CO. Though not reactive, CO regulates vascular processes such as vessel tone, smooth muscle proliferation, and platelet aggregation, and possibly functions as a neurotransmitter. The latter effects of CO depend on the activation of guanylate cyclase activity by direct binding to the heme moiety of the enzyme, stimulating the production of cyclic 3':5'-guanosine monophosphate. CO potentially interacts with other intracellular hemoprotein targets, though little is known about the functional significance of such interactions. Recent progress indicates that CO exerts novel anti-inflammatory and anti-apoptotic effects dependent on the modulation of the p38 mitogen activated protein kinase (MAPK)-signaling pathway. By virtue of these effects, CO confers protection in oxidative lung injury models, and likely plays a role in HO-1 mediated tissue protection.

Marine Web Portal as an Interface between Users and Marine Data and Information Sources

NASA Astrophysics Data System (ADS)

Palazov, A.; Stefanov, A.; Marinova, V.; Slabakova, V.

2012-04-01

Fundamental elements of the success of marine data and information management system and an effective support of marine and maritime economic activities are the speed and the ease with which users can identify, locate, get access, exchange and use oceanographic and marine data and information. There are a lot of activities and bodies have been identified as marine data and information users, such as: science, government and local authorities, port authorities, shipping, marine industry, fishery and aquaculture, tourist industry, environmental protection, coast protection, oil spills combat, Search and Rescue, national security, civil protection, and general public. On other hand diverse sources of real-time and historical marine data and information exist and generally they are fragmented, distributed in different places and sometimes unknown for the users. The marine web portal concept is to build common web based interface which will provide users fast and easy access to all available marine data and information sources, both historical and real-time such as: marine data bases, observing systems, forecasting systems, atlases etc. The service is regionally oriented to meet user needs. The main advantage of the portal is that it provides general look "at glance" on all available marine data and information as well as direct user to easy discover data and information in interest. It is planned to provide personalization ability, which will give the user instrument to tailor visualization according its personal needs.

Peculiarities of antioxidant system and iron metabolism in organism during development of tumor resistance to cisplatin.

PubMed

Chekhun, V F; Lozovska, Y V; Burlaka, A P; Lukyanova, N Y; Todor, I N; Naleskina, L A

2014-09-01

To study in vivo the peculiarities of changes of iron metabolism and antioxidant system in dynamics of growth of Guerin carcinoma with different sensitivity to cisplatin. In order to evaluate the content of metallothionein-1 (MT-1) in tumor homogenates and blood serum of rats with cisplatin-sensitive and cisplatin-resistant Guerin carcinoma the immunoenzyme method was used. The evaluation of ceruloplasmin activity, content of "free iron" complexes, superoxide and NO-generating acti-vity of NADPH-oxidase and iNOS activity in neutrophils, blood serum and tumor homogenates was measured by EPR-spectro-scopy. Maximal accumulation of MT-1 in blood serum and tumor, more pronounced in resistant strain, at the border of latent and exponential phase of growth has been shown that is the evidence of protective role of this protein in the respect to the generation of free radical compounds. It has been determined that in animals with cisplatin-resistant strain of Guerin carcinoma, increase of "free iron" complexes is more apparent both on the level of tumor and organism on the background on increase of CP/TR ratio that is the consequence of organism antioxidant protection system disorder. Mentioned changes in metabolism of iron with its accumulation in tumor and further reprogramming of mitochondria metabolism and activity of NADPH-oxidase for non-transformed cells are favorable conditions for the formation of oxidative phenotype of tumor.

Radiation safety requirements for radioactive waste management in the framework of a quality management system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salgado, M.M.; Benitez, J.C.; Pernas, R.

2007-07-01

The Center for Radiation Protection and Hygiene (CPHR) is the institution responsible for the management of radioactive wastes generated from nuclear applications in medicine, industry and research in Cuba. Radioactive Waste Management Service is provided at a national level and it includes the collection and transportation of radioactive wastes to the Centralized Waste Management Facilities, where they are characterized, segregated, treated, conditioned and stored. A Quality Management System, according to the ISO 9001 Standard has been implemented for the RWM Service at CPHR. The Management System includes the radiation safety requirements established for RWM in national regulations and in themore » Licence's conditions. The role of the Regulatory Body and the Radiation Protection Officer in the Quality Management System, the authorization of practices, training and personal qualification, record keeping, inspections of the Regulatory Body and internal inspection of the Radiation Protection Officer, among other aspects, are described in this paper. The Quality Management System has shown to be an efficient tool to demonstrate that adequate measures are in place to ensure the safety in radioactive waste management activities and their continual improvement. (authors)« less

A prototype expert/information system for examining environmental risks of KSC activities

NASA Technical Reports Server (NTRS)

Engel, Bernard A.

1993-01-01

Protection of the environment and natural resources at the Kennedy Space Center (KSC) is of great concern. An expert/information system to replace the paper-based KSC Environmental Checklist was developed. The computer-based system requests information only as a required and supplies assistance as needed. The most comprehensive portion of the system provides information about endangered species habitat at KSC. This module uses geographic information system (GIS) data and tools, expert rules, color graphics, computer-based video, and hypertext to provide information.

Audit of the management and cost of the Department of Energy`s protective forces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1994-07-01

The Department of Energy`s safeguards and security program is designed to provide appropriate, efficient, and effective protection of the Department`s nuclear weapons, nuclear materials, facilities, and classified information. These items must be protected against theft, sabotage, espionage, and terrorist activity, with continuing emphasis on protection against the insider threat. The purpose of the audit was to determine if protective forces were efficiently managed and appropriately sized in light of the changing missions and current budget constraints. The authors found that the cost of physical security at some sites had grown beyond those costs incurred when the site was in fullmore » production. This increase was due to a combination of factors, including concerns about the adequacy of physical security, reactions to the increase in terrorism in the early 1980s with the possibility of hostile attacks, and the selection of security system upgrades without adequate consideration of cost effectiveness. Ongoing projects to upgrade security systems were not promptly reassessed when missions changed and levels of protection were not determined in a way which considered the attractiveness of the material being protected. The authors also noted several opportunities for the Department to improve the operational efficiency of its protective force operations, including, eluminating overtime paid to officers prior to completion of the basic 40-hour workweek, paying hourly wages of unarmed guards which are commensurate with their duties, consolidating protective force units, transferring law enforcement duties to local law agencies, eliminating or reducing paid time to exercise, and standardizing supplies and equipment used by protective force members.« less

[Child protection system: Knowledge and role of the general practitioners in Ille-et-Vilaine].

PubMed

Balençon, M; Arrieta, A; You, C A; Brun, J-F; Federico-Desgranges, M; Roussey, M

2016-01-01

On 5 March 2007 the law concerning the child protection system was reformed. Since this date, child protection services are responsible for child abuse and neglect. Child protection services are now attempting to determine the rightful place for parents. Asking for child protection is now easier for the general practitioner (GP), who can submit a "preoccupying information (PI)" form. The aim of this study was to review GPs' knowledge on this issue 6 years after the passage of this new law. Prospective postal investigation between 04/01/2013 and 06/01/2013. A total of 298 (113 women) of the 899 GPs of the Ille-et-Vilaine area in Brittany answered a few questions about their activity and their knowledge on child abuse and neglect. The sample's mean age, sex, and practice was representative of the GPs in this area. Only 25.5% of the GPs had any knowledge of this new law. The term "preoccupying information" was unfamiliar to 70.1% of the GPs and what to do with the PI was unknown to 77.2%. The GPs did not know which type of letter to send nor where to send it between legal child protection and social protection services. Only 5% of the GPs had child protection training on PI. The main problem informing the child protection services was the lack of training. Consequently, 91.9% of the GPs would like training. The GPs in the Ille-et-Vilaine area in Brittany are unfamiliar with the child protection updates and need special training. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Neonatal Fc receptor expression in dendritic cells mediates protective immunity against colorectal cancer.

PubMed

Baker, Kristi; Rath, Timo; Flak, Magdalena B; Arthur, Janelle C; Chen, Zhangguo; Glickman, Jonathan N; Zlobec, Inti; Karamitopoulou, Eva; Stachler, Matthew D; Odze, Robert D; Lencer, Wayne I; Jobin, Christian; Blumberg, Richard S

2013-12-12

Cancers arising in mucosal tissues account for a disproportionately large fraction of malignancies. Immunoglobulin G (IgG) and the neonatal Fc receptor for IgG (FcRn) have an important function in the mucosal immune system that we have now shown extends to the induction of CD8(+) T cell-mediated antitumor immunity. We demonstrate that FcRn within dendritic cells (DCs) was critical for homeostatic activation of mucosal CD8(+) T cells that drove protection against the development of colorectal cancers and lung metastases. FcRn-mediated tumor protection was driven by DCs activation of endogenous tumor-reactive CD8(+) T cells via the cross-presentation of IgG complexed antigens (IgG IC), as well as the induction of cytotoxicity-promoting cytokine secretion, particularly interleukin-12, both of which were independently triggered by the FcRn-IgG IC interaction in murine and human DCs. FcRn thus has a primary role within mucosal tissues in activating local immune responses that are critical for priming efficient anti-tumor immunosurveillance. Copyright © 2013 Elsevier Inc. All rights reserved.

Cytosolic NADP(+)-dependent isocitrate dehydrogenase protects macrophages from LPS-induced nitric oxide and reactive oxygen species.

PubMed

Maeng, Oky; Kim, Yong Chan; Shin, Han-Jae; Lee, Jie-Oh; Huh, Tae-Lin; Kang, Kwang-il; Kim, Young Sang; Paik, Sang-Gi; Lee, Hayyoung

2004-04-30

Macrophages activated by microbial lipopolysaccharides (LPS) produce bursts of nitric oxide and reactive oxygen species (ROS). Redox protection systems are essential for the survival of the macrophages since the nitric oxide and ROS can be toxic to them as well as to pathogens. Using suppression subtractive hybridization (SSH) we found that cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) is strongly upregulated by nitric oxide in macrophages. The levels of IDPc mRNA and of the corresponding enzymatic activity were markedly increased by treatment of RAW264.7 cells or peritoneal macrophages with LPS or SNAP (a nitric oxide donor). Over-expression of IDPc reduced intracellular peroxide levels and enhanced the survival of H2O2- and SNAP-treated RAW264.7 macrophages. IDPc is known to generate NADPH, a cellular reducing agent, via oxidative decarboxylation of isocitrate. The expression of enzymes implicated in redox protection, superoxide dismutase (SOD) and catalase, was relatively unaffected by LPS and SNAP. We propose that the induction of IDPc is one of the main self-protection mechanisms of macrophages against LPS-induced oxidative stress.

Water Environment Assessment as an Ecological Red Line Management Tool for Marine Wetland Protection

PubMed Central

Zhang, Yinan; Chu, Chunli; Liu, Lei; Xu, Shengguo; Ruan, Xiaoxue; Ju, Meiting

2017-01-01

A ‘red line’ was established, identifying an area requiring for ecological protection in Tianjin, China. Within the protected area of the red line area, the Qilihai wetland is an important ecotope with complex ecological functions, although the ecosystem is seriously disturbed due to anthropogenic activities in the surrounding areas. This study assesses the water quality status of the Qilihai wetlands to identify the pollution sources and potential improvements based on the ecological red line policy, to improve and protect the waters of the Qilihai wetlands. An indicator system was established to assess water quality status using single factor evaluation and a comprehensive evaluation method, supported by data from 2010 to 2013. Assessment results show that not all indicators met the requirement of the Environmental Quality Standards for Surface Water (GB3838-2002) and that overall, waters in the Qilihai wetland were seriously polluted. Based on these findings we propose restrictions on all polluting anthropogenic activities in the red line area and implementation of restoration projects to improve water quality. PMID:28767096

Protective role of catechin and quercetin in sodium benzoate-induced lipid peroxidation and the antioxidant system in human erythrocytes in vitro.

PubMed

Yetuk, Gamze; Pandir, Dilek; Bas, Hatice

2014-01-01

The aim of this study was to evaluate the protective effect of catechin and quercetin in sodium benzoate- (SB-) induced oxidative stress in human erythrocytes in vitro. For this, the effects of SB (6.25, 12.5, 25, 50, and 100 μg/mL), catechin (10 μM), and quercetin (10 μM) on lipid peroxidation (LPO) and the activities of SOD, CAT, GPx, and GST were studied. Significantly higher LPO and lower activities of antioxidant enzymes were observed with the increasing concentrations of SB. Catechin or quercetin protected the erythrocytes against SB-induced toxicity only at low concentrations of SB. The presence of catechin or quercetin at 10 μM have no effect on SB-induced toxicity at high concentrations of SB (50 and 100 μg/mL). In conclusion, SB may cause oxidative stress as food additive in human erythrocytes in vitro. So, it appears that our findings provide evidence for the protection of erythrocytes from SB that could be considered for further studies.

Low dose radiation adaptive protection to control neurodegenerative diseases.

PubMed

Doss, Mohan

2014-05-01

Concerns have been expressed recently regarding the observed increased DNA damage from activities such as thinking and exercise. Such concerns have arisen from an incomplete accounting of the full effects of the increased oxidative damage. When the effects of the induced adaptive protective responses such as increased antioxidants and DNA repair enzymes are taken into consideration, there would be less endogenous DNA damage during the subsequent period of enhanced defenses, resulting in improved health from the thinking and exercise activities. Low dose radiation (LDR), which causes oxidative stress and increased DNA damage, upregulates adaptive protection systems that may decrease diseases in an analogous manner. Though there are ongoing debates regarding LDR's carcinogenicity, with two recent advisory committee reports coming to opposite conclusions, data published since the time of the reports have overwhelmingly ruled out its carcinogenicity, paving the way for consideration of its potential use for disease reduction. LDR adaptive protection is a promising approach to control neurodegenerative diseases, for which there are no methods of prevention or cure. Preparation of a compelling ethics case would pave the way for LDR clinical studies and progress in dealing with neurodegenerative diseases.

Peptidergic Agonists of Activity-Dependent Neurotrophic Factor Protect Against Prenatal Alcohol-Induced Neural Tube Defects and Serotonin Neuron Loss

PubMed Central

Zhou, Feng C.; Fang, Yuan; Goodlett, Charles

2009-01-01

Introduction Prenatal alcohol exposure via maternal liquid diet consumption by C57BL/6 (B6) mice causes conspicuous midline neural tube deficit (dysraphia) and disruption of genesis and development of serotonin (5-HT) neurons in the raphe nuclei, together with brain growth retardation. The current study tested the hypothesis that concurrent treatment with either an activity-dependent neurotrophic factor (ADNF) agonist peptide [SALLRSIPA, (SAL)] or an activity-dependent neurotrophic protein (ADNP) agonist peptide [NAPVSIPQ, (NAP)] would protect against these alcohol-induced deficits in brain development. Methods Timed-pregnant B6 dams consumed alcohol from embryonic day 7 (E7, before the onset of neurulation) until E15. Fetuses were obtained on E15 and brain sections processed for 5-HT immunocytochemistry, for evaluation of morphologic development of the brainstem raphe and its 5-HT neurons. Additional groups were treated either with SAL or NAP daily from E7 to E15 to assess the potential protective effects of these peptides. Measures of incomplete occlusion of the ventral canal and the frequency and extent of the openings in the rhombencephalon were obtained to assess fetal dysraphia. Counts of 5-HT-immunostained neurons were also obtained in the rostral and caudal raphe. Results Prenatal alcohol exposure resulted in abnormal openings along the midline and delayed closure of ventral canal in the brainstem. This dysraphia was associated with reductions in the number of 5-HT neurons both in the rostral raphe nuclei (that gives rise to ascending 5-HT projections) and in the caudal raphe (that gives rise to the descending 5-HT projections). Concurrent treatment of the alcohol-consuming dams with SAL prevented dysraphia and protected against the alcohol-induced reductions in 5-HT neurons in both the rostral and caudal raphe. NAP was less effective in protecting against dysraphia and did not protect against 5-HT loss in the rostral raphe, but did protect against loss in the caudal raphe. Conclusions These findings further support the potential usefulness of these peptides for therapeutic interventions in pregnancies at risk for alcohol-induced developmental deficits. Notably, the ascending 5-HT projections of the rostral raphe have profound effects in regulating forebrain development and function, and the descending 5-HT projections of the caudal raphe are critical for regulating respiration. Protection of the rostral 5-HT-system may help prevent structural and functional deficits linked to abnormal forebrain development, and protection of the caudal systems may also reduce the increased risk for sudden infant death syndrome associated with prenatal alcohol exposure. PMID:18565153

Port resilience: overcoming threats to maritime infrastructure and operations from climate change : final report.

DOT National Transportation Integrated Search

2015-12-01

In the coastal zone, seaports and their intermodal connectors are key types of infrastructure that support the global : supply chain, provide regional economic activity, local transportation system services, and community jobs. The : protection of co...

Protecting Surface Transportation Systems and Patrons from Terrorist Activities

DOT National Transportation Integrated Search

1997-11-01

This report documents the first phase of a continuing research effort carried out by the Norman Y. Mineta International Institute for Surface Transportation Policy Studies (IISTPS) on behalf of the U.S. Department of Transportation. It comprises a ch...

5 CFR 1207.103 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-01-01

... NONDISCRIMINATION ON THE BASIS OF DISABILITY IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE MERIT SYSTEMS PROTECTION... a disability means any person who has a physical or mental impairment that substantially limits one... mental retardation, organic brain syndrome, emotional or mental illness, and specific learning...

Making evolutionary history count: biodiversity planning for coral reef fishes and the conservation of evolutionary processes

NASA Astrophysics Data System (ADS)

von der Heyden, Sophie

2017-03-01

Anthropogenic activities are having devastating impacts on marine systems with numerous knock-on effects on trophic functioning, species interactions and an accelerated loss of biodiversity. Establishing conservation areas can not only protect biodiversity, but also confer resilience against changes to coral reefs and their inhabitants. Planning for protection and conservation in marine systems is complex, but usually focuses on maintaining levels of biodiversity and protecting special and unique landscape features while avoiding negative impacts to socio-economic benefits. Conversely, the integration of evolutionary processes that have shaped extant species assemblages is rarely taken into account. However, it is as important to protect processes as it is to protect patterns for maintaining the evolutionary trajectories of populations and species. This review focuses on different approaches for integrating genetic analyses, such as phylogenetic diversity, phylogeography and the delineation of management units, temporal and spatial monitoring of genetic diversity and quantification of adaptive variation for protecting evolutionary resilience, into marine spatial planning, specifically for coral reef fishes. Many of these concepts are not yet readily applied to coral reef fish studies, but this synthesis highlights their potential and the importance of including historical processes into systematic biodiversity planning for conserving not only extant, but also future, biodiversity and its evolutionary potential.

Leishmania Surveillance and Diagnostic Capability in Support of the Joint Biological Agent Identification and Diagnostic System (JBAIDS) and Leishmania Vector Surveillance

DTIC Science & Technology

2013-02-07

specific biosurveillance activities as well as clinical applications and alternative versions preformatted and categorized as ‘high-tech’ and ‘low-tech’ and...methodologies. Application for patent protection of this DoD intellectual property is underway. 1::1 . :::.u~~l-1 I ~111VI:::O Leishmaniasis...LHL assay and the need to develop novel and unique sample preparation methodologies. Application for patent protection of this DoD intellectual

Tile survey seen during EVA 3

NASA Image and Video Library

2005-08-03

S114-E-6388 (3 August 2005) --- A close-up view of a portion of the thermal protection tiles on Space Shuttle Discovery’s underside is featured in this image photographed by astronaut Stephen K. Robinson, STS-114 mission specialist, during the mission’s third session of extravehicular activities (EVA). Robinson’s shadow is visible on the thermal protection tiles and a portion of the Canadian-built remote manipulator system (RMS) robotic arm and the Nile River is visible at bottom.

Full Body Loading for Small Exercise Devices Project

NASA Technical Reports Server (NTRS)

Downs, Meghan; Hanson, Andrea; Newby, Nathaniel

2015-01-01

Protecting astronauts' spine, hip, and lower body musculoskeletal strength will be critical to safely and efficiently perform physically demanding vehicle egress, exploration, and habitat building activities necessary to expand human presence in the solar system. Functionally limiting decrements in musculoskeletal health are likely during Mars proving-ground and Earth-independent missions given extended transit times and the vehicle limitations for exercise devices (low-mass, small volume). Most small exercise device concepts are designed with single-cable loading, which inhibits the ability to perform full body exercises requiring two-point loading at the shoulders. Shoulder loading is critical to protect spine, hip, and lower body musculoskeletal strength. We propose a novel low-mass, low-maintenance, and rapid deploy pulley-based system that can attach to a single-cable small exercise device to enable two-point loading at the shoulders. This attachment could protect astronauts' health and save cost, space, and energy during all phases of the Journey to Mars.

Gas pipeline relief valves

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bright, G.F.

1974-01-01

A discussion of the increasing activity of natural gas pipeline companies in the analysis of the overpressure protection methods for complying with the provisions of Part 192, Title 49, Code of Federal Regulations ''Transportation of Natural and Other Gas by Pipelines; Minimum Federal Safety Standards'' and with the USAS B31.8 Code covers the basic requirements for protection against accidental overpressure as being essentially the same in both documents, i.e., at the maximum allowable operating overpressure in a gas system can be exceeded either at a compressor station or downstream of a pressure control valve; mandatory use of overpressure protection devicesmore » in these situations, except for those cases which exempt some service regulators because the distribution system pressure is less than 60 psig and six other requirements of design, performance, and size are met; and basic design requirements of a pressure relief or limiting station and the components used.« less

Structural and biochemical analysis of nuclease domain of clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein 3 (Cas3).

PubMed

Mulepati, Sabin; Bailey, Scott

2011-09-09

RNA transcribed from clustered regularly interspaced short palindromic repeats (CRISPRs) protects many prokaryotes from invasion by foreign DNA such as viruses, conjugative plasmids, and transposable elements. Cas3 (CRISPR-associated protein 3) is essential for this CRISPR protection and is thought to mediate cleavage of the foreign DNA through its N-terminal histidine-aspartate (HD) domain. We report here the 1.8 Å crystal structure of the HD domain of Cas3 from Thermus thermophilus HB8. Structural and biochemical studies predict that this enzyme binds two metal ions at its active site. We also demonstrate that the single-stranded DNA endonuclease activity of this T. thermophilus domain is activated not by magnesium but by transition metal ions such as manganese and nickel. Structure-guided mutagenesis confirms the importance of the metal-binding residues for the nuclease activity and identifies other active site residues. Overall, these results provide a framework for understanding the role of Cas3 in the CRISPR system.

Antiviral Type I and Type III Interferon Responses in the Central Nervous System

PubMed Central

Sorgeloos, Frédéric; Kreit, Marguerite; Hermant, Pascale; Lardinois, Cécile; Michiels, Thomas

2013-01-01

The central nervous system (CNS) harbors highly differentiated cells, such as neurons that are essential to coordinate the functions of complex organisms. This organ is partly protected by the blood-brain barrier (BBB) from toxic substances and pathogens carried in the bloodstream. Yet, neurotropic viruses can reach the CNS either by crossing the BBB after viremia, or by exploiting motile infected cells as Trojan horses, or by using axonal transport. Type I and type III interferons (IFNs) are cytokines that are critical to control early steps of viral infections. Deficiencies in the IFN pathway have been associated with fatal viral encephalitis both in humans and mice. Therefore, the IFN system provides an essential protection of the CNS against viral infections. Yet, basal activity of the IFN system appears to be low within the CNS, likely owing to the toxicity of IFN to this organ. Moreover, after viral infection, neurons and oligodendrocytes were reported to be relatively poor IFN producers and appear to keep some susceptibility to neurotropic viruses, even in the presence of IFN. This review addresses some trends and recent developments concerning the role of type I and type III IFNs in: i) preventing neuroinvasion and infection of CNS cells; ii) the identity of IFN-producing cells in the CNS; iii) the antiviral activity of ISGs; and iv) the activity of viral proteins of neurotropic viruses that target the IFN pathway. PMID:23503326

Antiviral type I and type III interferon responses in the central nervous system.

PubMed

Sorgeloos, Frédéric; Kreit, Marguerite; Hermant, Pascale; Lardinois, Cécile; Michiels, Thomas

2013-03-15

The central nervous system (CNS) harbors highly differentiated cells, such as neurons that are essential to coordinate the functions of complex organisms. This organ is partly protected by the blood-brain barrier (BBB) from toxic substances and pathogens carried in the bloodstream. Yet, neurotropic viruses can reach the CNS either by crossing the BBB after viremia, or by exploiting motile infected cells as Trojan horses, or by using axonal transport. Type I and type III interferons (IFNs) are cytokines that are critical to control early steps of viral infections. Deficiencies in the IFN pathway have been associated with fatal viral encephalitis both in humans and mice. Therefore, the IFN system provides an essential protection of the CNS against viral infections. Yet, basal activity of the IFN system appears to be low within the CNS, likely owing to the toxicity of IFN to this organ. Moreover, after viral infection, neurons and oligodendrocytes were reported to be relatively poor IFN producers and appear to keep some susceptibility to neurotropic viruses, even in the presence of IFN. This review addresses some trends and recent developments concerning the role of type I and type III IFNs in: i) preventing neuroinvasion and infection of CNS cells; ii) the identity of IFN-producing cells in the CNS; iii) the antiviral activity of ISGs; and iv) the activity of viral proteins of neurotropic viruses that target the IFN pathway.

Avoiding fraud risks associated with EHRs.

PubMed

Helton, Jeffrey R

2010-07-01

Fraud associated with electronic health records (EHRs) generally falls into two categories: inappropriate billing by healthcare providers and inappropriate access by a system's users. A provider's EHR system requires controls to be of any significant help in detecting such fraudulent activity, or in gathering transactional evidence should such activity be identified. To protect against potential EHR-related healthcare fraud, providers should follow the recommendations established in 2007 by RTI International for the Office of the National Coordinator for Health Information Technology of the U.S. Department of Health and Human Services.

Neuroprotective Effects and Mechanisms of Curcumin-Cu(II) and -Zn(II) Complexes Systems and Their Pharmacological Implications.

PubMed

Yan, Fa-Shun; Sun, Jian-Long; Xie, Wen-Hai; Shen, Liang; Ji, Hong-Fang

2017-12-28

Alzheimer's disease (AD) is the main form of dementia and has a steadily increasing prevalence. As both oxidative stress and metal homeostasis are involved in the pathogenesis of AD, it would be interesting to develop a dual function agent, targeting the two factors. Curcumin, a natural compound isolated from the rhizome of Curcuma longa , is an antioxidant and can also chelate metal ions. Whether the complexes of curcumin with metal ions possess neuroprotective effects has not been evaluated. Therefore, the present study was designed to investigate the protective effects of the complexes of curcumin with Cu(II) or Zn(II) on hydrogen peroxide (H₂O₂)-induced injury and the underlying molecular mechanisms. The use of rat pheochromocytoma (PC12) cells, a widely used neuronal cell model system, was adopted. It was revealed that curcumin-Cu(II) complexes systems possessed enhanced O₂ ·- -scavenging activities compared to unchelated curcumin. In comparison with unchelated curcumin, the protective effects of curcumin-Cu(II) complexes systems were stronger than curcumin-Zn(II) system. Curcumin-Cu(II) or -Zn(II) complexes systems significantly enhanced the superoxide dismutase, catalase, and glutathione peroxidase activities and attenuated the increase of malondialdehyde levels and caspase-3 and caspase-9 activities, in a dose-dependent manner. The curcumin-Cu(II) complex system with a 2:1 ratio exhibited the most significant effect. Further mechanistic study demonstrated that curcumin-Cu(II) or -Zn(II) complexes systems inhibited cell apoptosis via downregulating the nuclear factor κB (NF-κB) pathway and upregulating Bcl-2/Bax pathway. In summary, the present study found that curcumin-Cu(II) or -Zn(II) complexes systems, especially the former, possess significant neuroprotective effects, which indicates the potential advantage of curcumin as a promising agent against AD and deserves further study.

Traditional ecological knowledge trends in the transition to a market economy: empirical study in the Doñana natural areas.

PubMed

Gómez-Baggethun, Erik; Mingorría, Sara; Reyes-García, Victoria; Calvet, Laura; Montes, Carlos

2010-06-01

Researchers and conservation managers largely agree on the relevance of traditional ecological knowledge for natural resource management in indigenous communities, but its prevalence and role as societies modernize are contested. We analyzed the transmission of traditional knowledge among rural local people in communities linked to protected areas in Doñana, southwestern Spain. We studied changes in knowledge related to local practices in agriculture and livestock farming among 198 informants from three generations that cover the period in which the area transited from an economy strongly dependent on local ecosystem services to a market economy with intensified production systems. Our results suggest an abrupt loss of traditional agricultural knowledge related to rapid transformations and intensification of agricultural systems, but maintenance of knowledge of traditional livestock farming, an activity allowed in the protected areas that maintains strong links with local cultural identity. Our results demonstrate the potential of protected areas in protecting remaining bodies of traditional ecological knowledge in developed country settings. Nevertheless, we note that strict protection in cultural-landscape-dominated areas can disrupt transmission of traditional knowledge if local resource users and related practices are excluded from ecosystem management.

Efficient Method of Achieving Agreements between Individuals and Organizations about RFID Privacy

NASA Astrophysics Data System (ADS)

Cha, Shi-Cho

This work presents novel technical and legal approaches that address privacy concerns for personal data in RFID systems. In recent years, to minimize the conflict between convenience and the privacy risk of RFID systems, organizations have been requested to disclose their policies regarding RFID activities, obtain customer consent, and adopt appropriate mechanisms to enforce these policies. However, current research on RFID typically focuses on enforcement mechanisms to protect personal data stored in RFID tags and prevent organizations from tracking user activity through information emitted by specific RFID tags. A missing piece is how organizations can obtain customers' consent efficiently and flexibly. This study recommends that organizations obtain licenses automatically or semi-automatically before collecting personal data via RFID technologies rather than deal with written consents. Such digitalized and standard licenses can be checked automatically to ensure that collection and use of personal data is based on user consent. While individuals can easily control who has licenses and license content, the proposed framework provides an efficient and flexible way to overcome the deficiencies in current privacy protection technologies for RFID systems.

Micro-Fabricated Solid-State Radiation Detectors for Active Personal Dosimetry

NASA Technical Reports Server (NTRS)

Wrbanek, John D.; Wrbanek, Susan Y.; Fralick, Gustave C.; Chen, Liang-Yu

2007-01-01

Active radiation dosimetry is important to human health and equipment functionality for space applications outside the protective environment of a space station or vehicle. This is especially true for long duration missions to the moon, where the lack of a magnetic field offers no protection from space radiation to those on extravehicular activities. In order to improve functionality, durability and reliability of radiation dosimeters for future NASA lunar missions, single crystal silicon carbide devices and scintillating fiber detectors are currently being investigated for applications in advanced extravehicular systems. For many years, NASA Glenn Research Center has led significant efforts in silicon carbide semiconductor technology research and instrumentation research for sensor applications under extreme conditions. This report summarizes the technical progress and accomplishments toward characterization of radiation-sensing components for the recommendation of their fitness for advanced dosimetry development.

Protective effect of dextrans on glucose oxidase denaturation and inactivation.

PubMed

Altikatoglu, Melda; Basaran-Elalmis, Yeliz

2012-08-01

In the present study, the stabilizing effect of dextrans as additives on the denaturation and inactivation of glucose oxidase (GOD) was investigated. Three different molecular weighted dextrans (M(w) 17.5, 75, 188 kD) were used with different concentrations. Dramatically increased enzyme activities were measured after one hour of incubation of enzyme with additives between 25-40°C in water bath. Highest activity value was measured with 75 kDa molecular weighted dextran (in concentration 30% w/v) at pH 5. Dextran as an additive supplied a long shelf-life to the enzyme at 4°C. In the presence of the 75 kDa dextran, the enzyme was more stable and its activity was increased 2.7-fold at 30°C. In addition, dextran protected GOD against inactivation by a n-heptane/aqueous buffer-stirred system.

Pharmacological actions of Uncaria alkaloids, rhynchophylline and isorhynchophylline.

PubMed

Shi, Jing-Shan; Yu, Jun-Xian; Chen, Xiu-Ping; Xu, Rui-Xia

2003-02-01

The pharmacological actions of Uncaria alkaloids, rhynchophylline and isorhynchophylline extracted from Uncaria rhynchophylla Miq Jacks were reviewed. The alkaloids mainly act on cardiovascular system and central nervous system including the hypotension, brachycardia, antiarrhythmia, and protection of cerebral ischemia and sedation. The active mechanisms were related to blocking of calcium channel, opening of potassium channel, and regulating of nerve transmitters transport and metabolism, etc.

Intermediate Experimental Vehicle (IXV): Avionics and Software of the ESA Reentry Demonstrator

NASA Astrophysics Data System (ADS)

Malucchi, Giovanni; Dussy, Stephane; Camuffo, Fabrizio

2012-08-01

The IXV project is conceived as a technology platform that would perform the step forward with respect to the Atmospheric Reentry Demonstrator (ARD), by increasing the system maneuverability and verifying the critical technology performances against a wider re- entry corridor.The main objective is to design, develop and to perform an in-flight verification of an autonomous lifting and aerodynamically controlled (by a combined use of thrusters and aerodynamic surfaces) reentry system.The project also includes the verification and experimentation of a set of critical reentry technologies and disciplines:Thermal Protection System (TPS), for verification and characterization of thermal protection technologies in representative operational environment;Aerodynamics - Aerthermodynamics (AED-A TD), for understanding and validation of aerodynamics and aerothermodyamics phenomena with improvement of design tools;Guidance, Navigation and Control (GNC), for verification of guidance, navigation and control techniques in representative operational environment (i.e. reentry from Low Earth Orbit);Flight dynamics, to update and validate the vehicle model during actual flight, focused on stability and control derivatives.The above activities are being performed through the implementation of a strict system design-to-cost approach with a proto-flight model development philosophy.In 2008 and 2009, the IXV project activities reached the successful completion of the project Phase-B, including the System PDR, and early project Phase-C.In 2010, following a re-organization of the industrial consortium, the IXV project successfully completed a design consolidation leading to an optimization of the technical baseline including the GNC, avionics (i.e. power, data handling, radio frequency and telemetry), measurement sensors, hot and cold composite structures, thermal protections and control, with significant improvements of the main system budgets.The project has successfully closed the System CDR during 2011 and it is currently running the Phase-D with the target to be launched with Vega from Kourou in 2014The paper will provide an overview of the IXV design and mission objectives in the frame of the atmospheric reentry overall activities, focusing on the avionics and software architecture and design.

Planetary Protection Concerns During Pre-Launch Radioisotope Power System Final Integration Activities

NASA Technical Reports Server (NTRS)

Chen, Fei; McKay, Terri; Spry, James A.; Colozza, Anthony J.; DiStefano, Salvador

2012-01-01

The Advanced Stirling Radioisotope Generator (ASRG) is a next-generation radioisotope-based power system that is currently being developed as an alternative to the Multi-Mission Radioisotope Thermoelectric Generator (MMRTG). Power sources such as these may be needed for proposed missions to solar system planets and bodies that have challenging Planetary Protection (PP) requirements (e.g. Mars, Europa, Enceladus) that may support NASA s search for life, remnants of past life, and the precursors of life. One concern is that the heat from the ASRG could potentially create a region in which liquid water may occur. As advised by the NASA Planetary Protection Officer, when deploying an ASRG to Mars, the current COSPAR/NASA PP policy should be followed for Category IVc mission. Thus, sterilization processing of the ASRG to achieve bioburden reduction would be essential to meet the Planetary Protection requirements. Due to thermal constraints and associated low temperature limits of elements of the ASRG, vapor hydrogen peroxide (VHP) was suggested as a candidate alternative sterilization process to complement dry heat microbial reduction (DHMR) for the assembled ASRG. The following proposed sterilization plan for the ASRG anticipates a mission Category IVc level of cleanliness. This plan provides a scenario in which VHP is used as the final sterilization process. Keywords: Advanced Stirling Radioisotope Generator (ASRG), Planetary Protection (PP), Vapor hydrogen peroxide (VHP) sterilization.

Chitosan nanoparticle based delivery systems for sustainable agriculture.

PubMed

Kashyap, Prem Lal; Xiang, Xu; Heiden, Patricia

2015-01-01

Development of technologies that improve food productivity without any adverse impact on the ecosystem is the need of hour. In this context, development of controlled delivery systems for slow and sustained release of agrochemicals or genetic materials is crucial. Chitosan has emerged as a valuable carrier for controlled delivery of agrochemicals and genetic materials because of its proven biocompatibility, biodegradability, non-toxicity, and adsorption abilities. The major advantages of encapsulating agrochemicals and genetic material in a chitosan matrix include its ability to function as a protective reservoir for the active ingredients, protecting the ingredients from the surrounding environment while they are in the chitosan domain, and then controlling their release, allowing them to serve as efficient gene delivery systems for plant transformation or controlled release of pesticides. Despite the great progress in the use of chitosan in the area of medical and pharmaceutical sciences, there is still a wide knowledge gap regarding the potential application of chitosan for encapsulation of active ingredients in agriculture. Hence, the present article describes the current status of chitosan nanoparticle-based delivery systems in agriculture, and to highlight challenges that need to be overcome. Copyright © 2015 Elsevier B.V. All rights reserved.

A Thermal Physiological Comparison of Two HazMat Protective Ensembles With and Without Active Convective Cooling

NASA Technical Reports Server (NTRS)

Williamson, Rebecca; Carbo, Jorge; Luna, Bernadette; Webbon, Bruce W.

1998-01-01

Wearing impermeable garments for hazardous materials clean up can often present a health and safety problem for the wearer. Even short duration clean up activities can produce heat stress injuries in hazardous materials workers. It was hypothesized that an internal cooling system might increase worker productivity and decrease likelihood of heat stress injuries in typical HazMat operations. Two HazMat protective ensembles were compared during treadmill exercise. The different ensembles were created using two different suits: a Trelleborg VPS suit representative of current HazMat suits and a prototype suit developed by NASA engineers. The two life support systems used were a current technology Interspiro Spirolite breathing apparatus and a liquid air breathing system that also provided convective cooling. Twelve local members of a HazMat team served as test subjects. They were fully instrumented to allow a complete physiological comparison of their thermal responses to the different ensembles. Results showed that cooling from the liquid air system significantly decreased thermal stress. The results of the subjective evaluations of new design features in the prototype suit were also highly favorable. Incorporation of these new design features could lead to significant operational advantages in the future.

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

PubMed Central

Fusaro, Adriana F.; Barton, Deborah A.; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L.; Kawchuk, Lawrence M.; Vaslin, Maite F. S.; Waterhouse, Peter M.

2017-01-01

The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense. PMID:28994713

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

PubMed

Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

2017-10-10

The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

STUDY ON THE CHEMICAL PROTECTION AGAINST RADIATION INJURIES. II. EFFECT OF VITAMINS B$sub 2$, B$sub 6$, H, C AND PANTOTHENIC ACID

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hashimoto, T.

Pure-bred mice were irradiated with a single exposure of 800 r (lethal dose) and 680 r (LD/sub 5//sub 0/) of x rays. No protective effect of vit. B/ sub 2/, B/sub 6/, or pantothenic acid against radiation injury was recognized. Only vit. B/sub 1/ was effective. These 2 results indicate that the protective effect of vit. B/sub 1/ is due to activation of SH base. Neither pantothenic acid nor pantothein had any radiation-protective effect, but the combined use of pantothenic acid with beta -mercaptoethylamine was effective. Probably the protection is due to some mechanism other than the SH group. Vit.more » H gave no protection, and there was some relationship between the dosage of vit. H and its toxity. Vit. C gave some protection against radiation injury, believed to be due to cooperation with glutathione in the oxidation-reduction system. This mechanism seems to be different from that of other types of radiation-protective agents. (Abstr. Japan Med., 1: No. 8, 1961)« less

Simultaneous approach using systemic, mucosal and transcutaneous routes of immunization for development of protective HIV-1 vaccines.

PubMed

Belyakov, I M; Ahlers, J D

2011-01-01

Mucosal tissues are major sites of HIV entry and initial infection. Induction of a local mucosal cytotoxic T lymphocyte response is considered an important goal in developing an effective HIV vaccine. In addition, activation and recruitment of memory CD4(+) and CD8(+) T cells in systemic lymphoid circulation to mucosal effector sites might provide the firewall needed to prevent virus spread. Therefore a vaccine that generates CD4(+) and CD8(+) responses in both mucosal and systemic tissues might be required for protection against HIV. However, optimal routes and number of vaccinations required for the generation of long lasting CD4(+) and CD8(+) CTL effector and memory responses are not well understood especially for mucosal T cells. A number of studies looking at protective immune responses against diverse mucosal pathogens have shown that mucosal vaccination is necessary to induce a compartmentalized immune response including maximum levels of mucosal high-avidity CD8(+) CTL, antigen specific mucosal antibodies titers (especially sIgA), as well as induction of innate anti-viral factors in mucosa tissue. Immune responses are detectable at mucosal sites after systemic delivery of vaccine, and prime boost regimens can amplify the magnitude of immune responses in mucosal sites and in systemic lymphoid tissues. We believe that the most optimal mucosal and systemic HIV/SIV specific protective immune responses and innate factors might best be achieved by simultaneous mucosal and systemic prime and boost vaccinations. Similar principals of vaccination may be applied for vaccine development against cancer and highly invasive pathogens that lead to chronic infection.

Prophylactic immunization against experimental leishmaniasis. III. Protection against fatal Leishmania tropica infection induced by irradiated promastigotes involves Lyt-1/sup +/2/sup -/ T cells that do not mediate cutaneous DTH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liew, F.Y.; Howard, J.G.; Hale, C.

1984-01-01

Protective immunity against fatal L. tropica infection in genetically vulnerable BALB/c mice can be induced by prophylactic immunization with irradiated promastigotes even when heat-killed. Such immunity is adoptively transferable transiently into intact or durably into sub-lethally irradiated (200 or 550 rad) syngeneic recipients by splenic T but not B cells. The effector T cells are of the Lyt-1/sup +/2/sup -/ phenotype, devoid of demonstrable cytotoxic activity. The immune splenic T cell population expresses specific helper activity for antibody synthesis. A causal role for helper T cells in this capacity, however, seems unlikely, because it was shown that antibody does notmore » determine the protective immunity against L. tropica. The immunized donors show no detectable cutaneous DTH or its early memory recall in response to live or killed promastigotes or a soluble L. tropica antigen preparation. Spleen, lymph node, and peritoneal exudate cells from protectively immunized donors similarly fail to transfer DTH locally or systemically. These cells also lack demonstrable suppressive activity against the expression or induction of DTH to L. tropica. Thus, protection against L. tropica induced by prophylactic i.v. immunization with irradiated promastigotes appears to be conferred by Lyt-1/sup +/2/sup -/ T cells that are distinguishable from T cells mediating either both DTH and T help, or cytotoxicity.« less

The effects and mechanisms of mitochondrial nutrient alpha-lipoic acid on improving age-associated mitochondrial and cognitive dysfunction: an overview.

PubMed

Liu, Jiankang

2008-01-01

We have identified a group of nutrients that can directly or indirectly protect mitochondria from oxidative damage and improve mitochondrial function and named them "mitochondrial nutrients". The direct protection includes preventing the generation of oxidants, scavenging free radicals or inhibiting oxidant reactivity, and elevating cofactors of defective mitochondrial enzymes with increased Michaelis-Menten constant to stimulate enzyme activity, and also protect enzymes from further oxidation, and the indirect protection includes repairing oxidative damage by enhancing antioxidant defense systems either through activation of phase 2 enzymes or through increase in mitochondrial biogenesis. In this review, we take alpha-lipoic acid (LA) as an example of mitochondrial nutrients by summarizing the protective effects and possible mechanisms of LA and its derivatives on age-associated cognitive and mitochondrial dysfunction of the brain. LA and its derivatives improve the age-associated decline of memory, improve mitochondrial structure and function, inhibit the age-associated increase of oxidative damage, elevate the levels of antioxidants, and restore the activity of key enzymes. In addition, co-administration of LA with other mitochondrial nutrients, such as acetyl-L: -carnitine and coenzyme Q10, appears more effective in improving cognitive dysfunction and reducing oxidative mitochondrial dysfunction. Therefore, administrating mitochondrial nutrients, such as LA and its derivatives in combination with other mitochondrial nutrients to aged people and patients suffering from neurodegenerative diseases, may be an effective strategy for improving mitochondrial and cognitive dysfunction.

Corrosion Activities at the NASA Kennedy Space Center

NASA Technical Reports Server (NTRS)

Heidersbach, Robert H.

2002-01-01

This report documents summer faculty fellow efforts in the corrosion test bed at the NASA Kennedy Space Center. During the summer of 2002 efforts were concentrated on three activities: a short course on corrosion control for KSC personnel, evaluation of commercial wash additives used for corrosion control on Army aircraft, and improvements in the testing of a new cathodic protection system under development at KSC.

Aircraft icing research at NASA

NASA Technical Reports Server (NTRS)

Reinmann, J. J.; Shaw, R. J.; Olsen, W. A., Jr.

1982-01-01

Research activity is described for: ice protection systems, icing instrumentation, experimental methods, analytical modeling for the above, and in flight research. The renewed interest in aircraft icing has come about because of the new need for All-Weather Helicopters and General Aviation aircraft. Because of increased fuel costs, tomorrow's Commercial Transport aircraft will also require new types of ice protection systems and better estimates of the aeropenalties caused by ice on unprotected surfaces. The physics of aircraft icing is very similar to the icing that occurs on ground structures and structures at sea; all involve droplets that freeze on the surfaces because of the cold air. Therefore all icing research groups will benefit greatly by sharing their research information.

Gut-Associated Lymphoid Tissue: A Key Tissue Inside the Mucosal Immune System of Hens Immunized with Escherichia coli F4.

PubMed

Peralta, Maria F; Magnoli, Alejandra; Alustiza, Fabrisio; Nilson, Armando; Miazzo, Raúl; Vivas, Adriana

2017-01-01

Immunoglobulin Y (IgY) is the predominant antibody found in hen's ( Gallus domesticus ) egg yolk. This antibody, developed against several microorganisms in hen egg yolk, has been successfully used as an alternative to immunoglobulins from mammals for use in immunodiagnostics and immunotherapy. Enteropathogenic Escherichia coli (E.coli) F 4 is the main etiological agent associated with swine neonatal diarrhea, and it causes notable economic losses in swine production. The aim of the present study was to evaluate the relationship between humoral immune response and the activation of gut-associated lymphoid tissue (GALT) in laying hens intramuscularly immunized with E. coli F 4 . Adult laying Shaver hens were immunized with a bacterin based on an inactivated lysate E. coli F 4 strain that was originally isolated from neonatal piglet diarrhea, following a recommended schedule. The percentage of B lymphocytes in blood and spleen homogenates was determined by flow cytometry. Villi histomorphometry and the size of germinal centers (GC) activated in GALT and the spleen were measured in histological samples either stained with hematoxylin/eosin or through immunofluorescence. Antibody and isotype-specific antibodies in serum and egg yolk were measured using indirect enzyme-linked immunosorbent assay (ELISA). Secretory and serum immunoglobulin A (IgA) were measured by ELISA tests. Laying hen with intramuscular immunization with E. coli F 4 lysate, activated both mucosal and systemic protection. Mucosal protection was provided through B lymphocytes, and most of them were activated on Peyer's patches and esophageal tonsils, in GALT. Furthermore, increased B lymphocyte number in the lamina propria of the gut, and increased intraepithelial plasmatic cell number, produced high levels of mucosal IgA. Activated B lymphocytes interacted with absorptive cells, immune cells, and microbiota in the gut, producing signals that were translated into a powerful physical defense by producing a greater volume of mucin from an increased number of goblet cells. Systemic protection was provided through B lymphocyte activation of spleen GC, which produced hugely specific IgY serum levels. One week later, this specific IgY was deposited in the yolk. This suggests that GALT is a key immunologic tissue inside the mucosal immune system, acting as the "command center" for humoral reaction.

Gut-Associated Lymphoid Tissue: A Key Tissue Inside the Mucosal Immune System of Hens Immunized with Escherichia coli F4

PubMed Central

Peralta, Maria F.; Magnoli, Alejandra; Alustiza, Fabrisio; Nilson, Armando; Miazzo, Raúl; Vivas, Adriana

2017-01-01

Immunoglobulin Y (IgY) is the predominant antibody found in hen’s (Gallus domesticus) egg yolk. This antibody, developed against several microorganisms in hen egg yolk, has been successfully used as an alternative to immunoglobulins from mammals for use in immunodiagnostics and immunotherapy. Enteropathogenic Escherichia coli (E.coli) F4 is the main etiological agent associated with swine neonatal diarrhea, and it causes notable economic losses in swine production. The aim of the present study was to evaluate the relationship between humoral immune response and the activation of gut-associated lymphoid tissue (GALT) in laying hens intramuscularly immunized with E. coli F4. Adult laying Shaver hens were immunized with a bacterin based on an inactivated lysate E. coli F4 strain that was originally isolated from neonatal piglet diarrhea, following a recommended schedule. The percentage of B lymphocytes in blood and spleen homogenates was determined by flow cytometry. Villi histomorphometry and the size of germinal centers (GC) activated in GALT and the spleen were measured in histological samples either stained with hematoxylin/eosin or through immunofluorescence. Antibody and isotype-specific antibodies in serum and egg yolk were measured using indirect enzyme-linked immunosorbent assay (ELISA). Secretory and serum immunoglobulin A (IgA) were measured by ELISA tests. Laying hen with intramuscular immunization with E. coli F4 lysate, activated both mucosal and systemic protection. Mucosal protection was provided through B lymphocytes, and most of them were activated on Peyer’s patches and esophageal tonsils, in GALT. Furthermore, increased B lymphocyte number in the lamina propria of the gut, and increased intraepithelial plasmatic cell number, produced high levels of mucosal IgA. Activated B lymphocytes interacted with absorptive cells, immune cells, and microbiota in the gut, producing signals that were translated into a powerful physical defense by producing a greater volume of mucin from an increased number of goblet cells. Systemic protection was provided through B lymphocyte activation of spleen GC, which produced hugely specific IgY serum levels. One week later, this specific IgY was deposited in the yolk. This suggests that GALT is a key immunologic tissue inside the mucosal immune system, acting as the “command center” for humoral reaction. PMID:28588575

Insulin-like growth factor 1 rescues R28 retinal neurons from apoptotic death through ERK-mediated BimEL phosphorylation independent of Akt.

PubMed

Kong, Dejuan; Gong, Lijie; Arnold, Edith; Shanmugam, Sumathi; Fort, Patrice E; Gardner, Thomas W; Abcouwer, Steven F

2016-10-01

Insulin-like growth factor 1 (IGF-1) can provide long-term neurotrophic support by activation of Akt, inhibition of FoxO nuclear localization and suppression of Bim gene transcription in multiple neuronal systems. However, MEK/ERK activation can also promote neuron survival through phosphorylation of BimEL. We explored the contribution of the PI3K/Akt/FoxO and MEK/ERK/BimEL pathways in IGF-1 stimulated survival after serum deprivation (SD) of R28 cells differentiated to model retinal neurons. IGF-1 caused rapid activation of Akt leading to FoxO1/3-T32/T24 phosphorylation, and prevented FoxO1/3 nuclear translocation and Bim mRNA upregulation in response to SD. IGF-1 also caused MAPK/MEK pathway activation as indicated by ERK1/2-T202/Y204 and Bim-S65 phosphorylation. Overexpression of FoxO1 increased Bim mRNA expression and amplified the apoptotic response to SD without shifting the serum response curve. Inhibition of Akt activation with LY294002 or by Rictor knockdown did not block the protective effect of IGF-1, while inhibition of MEK activity with PD98059 prevented Bim phosphorylation and blocked IGF-1 protection. In addition, knockdown of Bim expression was protective during SD, while co-silencing of FoxO1 and Fox03 expression had little effect. Thus, the PI3K/Akt/FoxO pathway was not essential for protection from SD-induced apoptosis by IGF-1 in R28 cells. Instead, IGF-1 protection was dependent on activation of the MEK/ERK pathway leading to BimEL phosphorylation, which is known to prevent Bax/Bak oligomerization and activation of the intrinsic mitochondrial apoptosis pathway. These studies demonstrate the requirement of the MEK/ERK pathway in a model of retinal neuron cell survival and highlight the cell specificity for IGF-1 signaling in this response. Copyright © 2016 Elsevier Ltd. All rights reserved.

Annual report to the NASA Administrator by the Aerospace Safety Advisory Panel on the space shuttle program. Part 2: Summary of information developed in the panel's fact-finding activities

NASA Technical Reports Server (NTRS)

1976-01-01

Safety management areas of concern include the space shuttle main engine, shuttle avionics, orbiter thermal protection system, the external tank program, and the solid rocket booster program. The ground test program and ground support equipment system were reviewed. Systems integration and technical 'conscience' were of major priorities for the investigating teams.

Radiological Health Protection Issues Associated with Use of Active Detection Technology Systems for Detection of Radioactive Threat Materials

DTIC Science & Technology

2013-07-01

detection system available will simply register events resulting from natural background radiation if a suitable source emission is not employed. The...random fluctuations in the natural background radiation level. Noise within the detection system can result from any of the various components that...Uritani et al., 1994). Nothing can generally be done to reduce or stabilize the amount of natural background radiation present for nonstationary

42 CFR 84.142 - Air supply source; hand-operated or motor driven air blowers; Type A supplied-air respirators...

Code of Federal Regulations, 2014 CFR

2014-10-01

... RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84... multiple systems, whereby more than one user is supplied by one blower, will be approved, unless each hose...

42 CFR 84.142 - Air supply source; hand-operated or motor driven air blowers; Type A supplied-air respirators...

Code of Federal Regulations, 2013 CFR

2013-10-01

... RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84... multiple systems, whereby more than one user is supplied by one blower, will be approved, unless each hose...

42 CFR 84.142 - Air supply source; hand-operated or motor driven air blowers; Type A supplied-air respirators...

Code of Federal Regulations, 2010 CFR

2010-10-01

... RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84... multiple systems, whereby more than one user is supplied by one blower, will be approved, unless each hose...

42 CFR 84.142 - Air supply source; hand-operated or motor driven air blowers; Type A supplied-air respirators...

Code of Federal Regulations, 2012 CFR

2012-10-01

... RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84... multiple systems, whereby more than one user is supplied by one blower, will be approved, unless each hose...

42 CFR 84.142 - Air supply source; hand-operated or motor driven air blowers; Type A supplied-air respirators...

Code of Federal Regulations, 2011 CFR

2011-10-01

... RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84... multiple systems, whereby more than one user is supplied by one blower, will be approved, unless each hose...

ENVIRONMENTALLY COMPLIANT CORROSION-ACTIVATED INHIBITOR SYSTEM FOR ALUMINUM ALLOYS - PHASE I

EPA Science Inventory

The federal government is estimated to spend $1 billion on painting/repainting aircraft annually. Aircraft have surfaces composed of aluminum alloys that are highly susceptible to corrosion and must be protected with corrosion-preventative treatments that typically conta...

77 FR 38608 - Privacy Act of 1974; System of Records

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-28

..., professional qualifications and skills, training courses completed, certifications received, level of education... Activity Unit Identification Code (UIC).'' Safeguards: Delete entry and replace with ``The NTMPS servers.... All data transferred is encrypted. The interface server is protected from attempts to penetrate the...

42 CFR 51.24 - Program priorities.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS REQUIREMENTS APPLICABLE TO... obtaining protection of their rights. Systemic and legislative activities shall also be addressed in the... representatives of such individuals and to other individuals with disabilities. Procedures for public comment must...

Trends in Public Library Buildings.

ERIC Educational Resources Information Center

Holt, Raymond M.

1987-01-01

Review of trends in public library buildings covers cycles in building activity; financial support; site selection; expansion, remodeling, or conversion of existing buildings; size of buildings; and such architectural concerns as flexible space, lighting, power, accommodation of computer systems, heat and ventilation, fire protection, security,…

Kestrel: force protection and Intelligence, Surveillance, and Reconnaissance (ISR) persistent surveillance on aerostats

NASA Astrophysics Data System (ADS)

Luber, David R.; Marion, John E.; Fields, David

2012-05-01

Logos Technologies has developed and fielded the Kestrel system, an aerostat-based, wide area persistent surveillance system dedicated to force protection and ISR mission execution operating over forward operating bases. Its development included novel imaging and stabilization capability for day/night operations on military aerostat systems. The Kestrel system's contribution is a substantial enhancement to aerostat-based, force protection systems which to date have relied on narrow field of view ball gimbal sensors to identify targets of interest. This inefficient mechanism to conduct wide area field of view surveillance is greatly enhanced by Kestrel's ability to maintain a constant motion imagery stare of the entire forward operating base (FOB) area. The Kestrel airborne sensor enables 360° coverage out to extended ranges which covers a city sized area at moderate resolution, while cueing a narrow field of view sensor to provide high resolution imagery of targets of interest. The ground station exploitation system enables operators to autonomously monitor multiple regions of interest in real time, and allows for backtracking through the recorded imagery, while continuing to monitor ongoing activity. Backtracking capability allows operators to detect threat networks, their CONOPS, and locations of interest. Kestrel's unique advancement has already been utilized successfully in OEF operations.

Mitochondrial Protection and Anti-aging Activity of Astragalus Polysaccharides and Their Potential Mechanism

PubMed Central

Li, Xing-Tai; Zhang, Ya-Kui; Kuang, Hai-Xue; Jin, Feng-Xin; Liu, De-Wen; Gao, Ming-Bo; Liu, Ze; Xin, Xiao-Juan

2012-01-01

The current study was performed to investigate mitochondrial protection and anti-aging activity of Astragalus polysaccharides (APS) and the potential underlying mechanism. Lipid peroxidation of liver and brain mitochondria was induced by Fe2+–Vit C in vitro. Thiobarbituric acid (TBA) colorimetry was used to measure the content of thiobarbituric acid reactive substances (TBARS). Mouse liver mitochondrial permeability transition (PT) was induced by calcium overload in vitro and spectrophotometry was used to measure it. The scavenging activities of APS on superoxide anion (O2•−) and hydroxyl radical (•OH), which were produced by reduced nicotinamide adenine dinucleotide (NADH)—N-Methylphenazonium methyl sulfate (PMS) and hydrogen peroxide (H2O2)–Fe2+ system respectively, were measured by 4-nitrobluetetrazolium chloride (NBT) reduction and Fenton reaction colorimetry respectively. The Na2S2O3 titration method was used to measure the scavenging activities of APS on H2O2. APS could inhibit TBARS production, protect mitochondria from PT, and scavenge O2•−, •OH and H2O2 significantly in a concentration-dependent manner respectively. The back of the neck of mice was injected subcutaneously with D-galactose to induce aging at a dose of 100 mg/kg/d for seven weeks. Moreover, the activities of catalase (CAT), surperoxide dismutase (SOD) and glutathione peroxidase (GPx) and anti-hydroxyl radical which were assayed by using commercial monitoring kits were increased significantly in vivo by APS. According to this research, APS protects mitochondria by scavenging reactive oxygen species (ROS), inhibiting mitochondrial PT and increasing the activities of antioxidases. Therefore, APS has the effect of promoting health. PMID:22408421

Melatonin-mediated upregulation of Sirt3 attenuates sodium fluoride-induced hepatotoxicity by activating the MT1-PI3K/AKT-PGC-1α signaling pathway.

PubMed

Song, Chao; Zhao, Jiamin; Fu, Beibei; Li, Dan; Mao, Tingchao; Peng, Wei; Wu, Haibo; Zhang, Yong

2017-11-01

Mitochondrial reactive oxygen species (ROS) production has been implicated in the pathogenesis of fluoride toxicity in liver. Melatonin, an indolamine synthesized in the pineal gland, was previously shown to protect against sodium fluoride (NaF)-induced hepatotoxicity. This study investigated the protective effects of melatonin pretreatment on NaF-induced hepatotoxicity and elucidates the potential mechanism of melatonin-mediated protection. Reducing mitochondrial ROS by melatonin substantially attenuated NaF-induced NADPH oxidase 4 (Nox4) upregulation and cytotoxicity in L-02 cells. Melatonin exerted its hepatoprotective effects by upregulating Sirtuin 3 (Sirt3) expression level and its activity. Melatonin increased the activity of manganese superoxide dismutase (SOD2) by promoting Sirt3-mediated deacetylation and promoted SOD2 expression through Sirt3-regulated DNA-binding activity of forkhead box O3 (FoxO3a), thus inhibiting the production of mitochondrial ROS induced by NaF. Notably, increased peroxisome proliferator-activated receptor gamma coactivator 1α (PGC-1α) by melatonin activated the Sirt3 expression, which was regulated by an estrogen-related receptor (ERR) binding element (ERRE) mapped to Sirt3 promoter region. Analysis of the cell signaling pathway profiling systems and specific pathway inhibition indicated that melatonin enhances PGC-1α expression by activating the PI3K/AKT signaling pathway. Importantly, inhibition of melatonin receptor (MT)-1 blocked the melatonin-activated PI3K/AKT-PGC-1α-Sirt3 signaling. Mechanistic study revealed that the protective effects of melatonin were associated with down-regulation of JNK1/2 phosphorylation. Our findings provided a theoretical basis that melatonin mitigated NaF-induced hepatotoxicity, which, in part, was mediated through the activation of the Sirt3 pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

Towards an Active Hearing Protection Device for Musicians =

NASA Astrophysics Data System (ADS)

Bernier, Antoine

Professional musicians are oftentimes exposed to high levels of sound. Prolonged or severe exposure to high sound levels could lead to permanent hearing loss and compromise their career. The logical solution would be to wear hearing protection devices (HPDs) when appropriate. However, perceptual discomfort associated with wearing HPD can discourage their use by musicians. The perceptual discomfort is caused by two detrimental effects: the occlusion effect and the isolation effect. The occlusion effect is often reported as an augmented, unnatural and annoying perception of one's own voice or instrument mechanically coupled to the head when wearing HPDs. The isolation effect is the unnatural sensation of being isolated from a given sound environment and can be caused by wearing HPDs that do not compensate for psychoacoustical factors and therefore alter the wearer's auditory perception. Both effects are highly unfavorable to the musicians' auditory perception and compromise their capacity to perform to the best of their abilities for their audience. They are among the reasons most often reported by musicians to decide not to wear HPDs. This master's project presents the concept and first prototype of an active HPD for musicians that aims at solving the detrimental effects while protecting the musician's hearing. A solution for the occlusion effect is presented in the form of an earplug complemented with in-ear active noise control. Practical design issues and required trade-off are analyzed through a literature review and the implementation and characterization of an active occlusion effect reduction system, allowing reduction of the occlusion effect between 8.5 and 12 dB at 250 Hz. A solution for the isolation effect is presented in the form of an earplug complemented with digital signal processing capabilities. Factors that may cause the isolation effect are identified through a literature review and corresponding algorithms that aim at re-establishing the naturalness of the auditory perception while wearing HPDs are presented through the design and implementation of an isolation effect compensation system, allowing up to 15 dB of variable uniform attenuation when used by itself. Both systems working simultaneously in the same device would result in an active HPD for musicians that reduces the occlusion effect and offers uniform variable attenuation up to 25 dB and perceived uniform attenuation up to 25 phons. The aim of this active HPD for musicians is to cause the least perceptual discomfort while protecting a musician's most precious tool: his hearing.

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 18 Conservation of Power and Water Resources 2 2014-04-01 2014-04-01 false Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 18 Conservation of Power and Water Resources 2 2013-04-01 2012-04-01 true Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 18 Conservation of Power and Water Resources 2 2012-04-01 2012-04-01 false Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

18 CFR 1316.8 - Employee protected activities.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 18 Conservation of Power and Water Resources 2 2011-04-01 2011-04-01 false Employee protected... Conditions and Certifications § 1316.8 Employee protected activities. When so indicated in TVA contract... Protected Activities (Applicable to contracts for goods or services delivered to nuclear facilities or...

In vitro study on antioxidant potential of various drugs used in the perioperative period.

PubMed

Kang, M Y; Tsuchiya, M; Packer, L; Manabe, M

1998-01-01

Since surgical trauma not only intensifies the oxidative stress by generating reactive oxygen species (ROS), but also weakens the biological defense system against ROS attack, the antioxidant activity of drugs used during the perioperative period, which possibly normalizes the impaired redox state in the patient, is of fundamental importance and great clinical interest. We have applied the phycoerythrin fluorescence-based assay, in which 2,2'-azobis (2-amidinopropane) dihydrochloride (AAPH)-generated peroxyl radical attacks B-phycoerythrin (B-PE) to lead to a sensitive decrease in its fluorescence intensity linearly, to evaluate the antioxidant activity of major drugs in anesthetic practice. By the protective effect on B-PE fluorescence decay, the antioxidant activities of the drugs were classified into three groups: Group I drugs, which only slowed B-PE fluorescence decay (nicardipine, verapamil, diltiazem, ephedrine, aminophylline, vecuronium, lidocaine, mepivacaine, midazolam, thiamylal, droperidol, ketamine, hydroxyzine, butorphanol, prednisolone, hydrocortisone, betamethasone, dexamethasone, methylprednisolone, and furosemide); Group II drugs, which protected B-PE oxidation completely and stopped fluorescence decay in a certain duration (dopamine, epinephrine, norepinephrine, dobutamine, isoproterenol, and buprenorphine); and Group III drugs, which had no protective effect on B-PE oxidation (nitroglycerin, prostaglandin E1, neostigmine, pancuronium, suxamethonium, atropine, bupivacaine, pentazocine, and heparin). These results indicate that Group I and II drugs exert some antioxidant activity in vitro, as measured by their protection of fluorescence decay of B-PE. Careful consideration of these properties might, then, serve to facilitate more efficient drug application.