Science.gov

Sample records for active region formed

  1. Determination of GMPE functional form for an active region with limited strong motion data: application to the Himalayan region

    NASA Astrophysics Data System (ADS)

    Bajaj, Ketan; Anbazhagan, P.

    2018-01-01

    Advancement in the seismic networks results in formulation of different functional forms for developing any new ground motion prediction equation (GMPE) for a region. Till date, various guidelines and tools are available for selecting a suitable GMPE for any seismic study area. However, these methods are efficient in quantifying the GMPE but not for determining a proper functional form and capturing the epistemic uncertainty associated with selection of GMPE. In this study, the compatibility of the recent available functional forms for the active region is tested for distance and magnitude scaling. Analysis is carried out by determining the residuals using the recorded and the predicted spectral acceleration values at different periods. Mixed effect regressions are performed on the calculated residuals for determining the intra- and interevent residuals. Additionally, spatial correlation is used in mixed effect regression by changing its likelihood function. Distance scaling and magnitude scaling are respectively examined by studying the trends of intraevent residuals with distance and the trend of the event term with magnitude. Further, these trends are statistically studied for a respective functional form of a ground motion. Additionally, genetic algorithm and Monte Carlo method are used respectively for calculating the hinge point and standard error for magnitude and distance scaling for a newly determined functional form. The whole procedure is applied and tested for the available strong motion data for the Himalayan region. The functional form used for testing are five Himalayan GMPEs, five GMPEs developed under NGA-West 2 project, two from Pan-European, and one from Japan region. It is observed that bilinear functional form with magnitude and distance hinged at 6.5 M w and 300 km respectively is suitable for the Himalayan region. Finally, a new regression coefficient for peak ground acceleration for a suitable functional form that governs the attenuation

  2. Interaction between Ionized and Molecular Gas in the Active Star-forming Region W31

    NASA Astrophysics Data System (ADS)

    Kim, Kee-Tae; Koo, Bon-Chul

    2002-08-01

    We have carried out 21 cm radio continuum, H76α radio recombination line, and various (12CO, 13CO, CS, and C34S) molecular line observations of the W31 complex. Our radio continuum data show that W31 is composed of two extended H II regions, G10.2-0.3 and G10.3-0.1, each of which comprises an ultracompact H II region, two or more compact components, and a diffuse envelope. The W31 cloud appears as an incomplete shell on the whole and consists of southern spherical and northern flat components, which are associated with G10.2-0.3 and G10.3-0.1, respectively. For an assumed distance of 6 kpc, the molecular cloud has a size of 48 pc and a mass of 6.2×105 Msolar. The IR luminosity-to-mass ratio and the star formation efficiency are derived to be 9 Lsolar/Msolar and 3%, respectively. These estimates are greater than average values of the inner Galactic plane. We detect two large (16 and 11 pc) and massive (2.1×105 and 8.2×104 Msolar) CS-emitting regions in the northern and southern cloud components. The large amount (48% in mass and 16% in area) of dense gas may suggest that the W31 cloud has the ability to form rich stellar clusters and that star formation has only recently begun. The extended envelopes of both G10.2-0.3 and G10.3-0.1 are likely to be results of the champagne flows, based on the distributions of ionized and molecular gas and the velocity gradient of H76α line emission. According to the champagne model, the dynamical ages of the two H II regions would be (4-12)×105 yr. We find strong evidence of bipolar molecular outflows associated with the two ultracompact H II regions. In the vicinity of the ultracompact and compact H II regions in G10.3-0.1, the 12CO J=2-1/J=1-0 intensity ratio is high (1.4), and a small but prominent molecular gas hollow exists. Together, these observations strongly indicate that the H II regions and their ionizing stars are interacting with the molecular cloud. Therefore, it is most likely that recently formed massive stars

  3. Star Formation Activity Beyond the Outer Arm. I. WISE -selected Candidate Star-forming Regions

    SciTech Connect

    Izumi, Natsuko; Yasui, Chikako; Saito, Masao

    2017-10-01

    The outer Galaxy beyond the Outer Arm provides a good opportunity to study star formation in an environment significantly different from that in the solar neighborhood. However, star-forming regions in the outer Galaxy have never been comprehensively studied or cataloged because of the difficulties in detecting them at such large distances. We studied 33 known young star-forming regions associated with 13 molecular clouds at R {sub G} ≥ 13.5 kpc in the outer Galaxy with data from the Wide-field Infrared Survey Explorer ( WISE ) mid-infrared all-sky survey. From their color distribution, we developed a simple identification criterion of star-forming regions inmore » the outer Galaxy with the WISE color. We applied the criterion to all the WISE sources in the molecular clouds in the outer Galaxy at R {sub G} ≥ 13.5 kpc detected with the Five College Radio Astronomy Observatory (FCRAO) {sup 12}CO survey of the outer Galaxy, of which the survey region is 102.°49 ≤  l  ≤ 141.°54, −3.°03 ≤  b  ≤ 5.°41, and successfully identified 711 new candidate star-forming regions in 240 molecular clouds. The large number of samples enables us to perform the statistical study of star formation properties in the outer Galaxy for the first time. This study is crucial to investigate the fundamental star formation properties, including star formation rate, star formation efficiency, and initial mass function, in a primordial environment such as the early phase of the Galaxy formation.« less

  4. Active Regions Blossoming

    NASA Image and Video Library

    2015-10-28

    As a pair of active regions began to rotate into view, their towering magnetic field lines above them bloomed into a dazzling display of twisting arches (Oct. 27-28, 2015). Some of the lines reached over and connected with the neighboring active region. Active regions are usually the source of solar storms. The images were taken in a wavelength of extreme ultraviolet light. http://photojournal.jpl.nasa.gov/catalog/PIA20048

  5. Gyrating Active Region

    NASA Image and Video Library

    2017-01-26

    On Jan. 20, 2017, NASA Solar Dynamics Observatory captured a small area of the sun highlighted three active region. Over half a day this active region sent dark swirls of plasma and bright magnetic arches twisting and turning above it. All the activity in the three areas was driven by competing magnetic forces. The dynamic action was observed in a wavelength of extreme ultraviolet light. Movies are available at http://photojournal.jpl.nasa.gov/catalog/PIA11703

  6. Active Regions' Magnetic Connection

    NASA Image and Video Library

    2017-05-22

    Several bright bands of plasma connect from one active region to another, even though they are tens of thousands of miles away from each other (May 17-18, 2017). Active regions are, by their nature, strong magnetic areas with north and south poles. The plasma consists of charged particles that stream along the magnetic field lines between these two regions. These connecting lines are clearly visible in this wavelength of extreme ultraviolet light. Other loops and strands of bright plasma can be seen rising up and out of smaller active regions as well. The video covers about one day's worth of activity. Movies are available at https://photojournal.jpl.nasa.gov/catalog/PIA21638

  7. Active superconducting devices formed of thin films

    DOEpatents

    Martens, Jon S.; Beyer, James B.; Nordman, James E.; Hohenwarter, Gert K. G.

    1991-05-28

    Active superconducting devices are formed of thin films of superconductor which include a main conduction channel which has an active weak link region. The weak link region is composed of an array of links of thin film superconductor spaced from one another by voids and selected in size and thickness such that magnetic flux can propagate across the weak link region when it is superconducting. Magnetic flux applied to the weak link region will propagate across the array of links causing localized loss of superconductivity in the links and changing the effective resistance across the links. The magnetic flux can be applied from a control line formed of a superconducting film deposited coplanar with the main conduction channel and weak link region on a substrate. The devices can be formed of any type to superconductor but are particularly well suited to the high temperature superconductors since the devices can be entirely formed from coplanar films with no overlying regions. The devices can be utilized for a variety of electrical components, including switching circuits, amplifiers, oscillators and modulators, and are well suited to microwave frequency applications.

  8. Energized Active Regions

    NASA Image and Video Library

    2017-06-02

    A pair of relatively small (but frenetic) active regions rotated into view, spouting off numerous small flares and sweeping loops of plasma (May 31-June 2, 2017). At first, only the one active region was observed, but mid-way though the video clip a second one behind the first can be picked out. The dynamic regions were easily the most remarkable areas on the sun during this 42-hour period. The images were taken in a wavelength of extreme ultraviolet light. Movies are available at https://photojournal.jpl.nasa.gov/catalog/PIA21756

  9. Agitated Active Region

    NASA Image and Video Library

    2016-10-11

    An active region just rotating into view gave us a perfect view of the tussle of magnetic field lines above it (Oct. 10-11, 2016). The particles spiraling along the magnetic field lines become visible in extreme ultraviolet light, helping us to see the struggle going on. There were no eruptions during this period, although active regions are usually the source for solar storms. The video clip covers just one day's worth of activity. Movies are available at http://photojournal.jpl.nasa.gov/catalog/PIA21109

  10. Jumpy Active Region

    NASA Image and Video Library

    2017-01-03

    A close-up view of one day in the life of a rather small active region shows the agitation and dynamism of its magnetic field (Dec. 21, 2016). This wavelength of extreme ultraviolet light reveals particles as they spin along the cascading arches of magnetic field lines above the active region. Some darker plasma rises up and spins around at the edge of the sun near the end of the video clip also being pulled by unseen magnetic forces. Movies are available at http://photojournal.jpl.nasa.gov/catalog/PIA15032

  11. Disk Evaporation in Star Forming Regions

    NASA Technical Reports Server (NTRS)

    Hollenbach, David; DeVincenzi, Donald L. (Technical Monitor)

    2000-01-01

    Young stars produce sufficient ultraviolet photon luminosity and mechanical luminosity in their winds to significantly affect the structure and evolution of the accretion disks surrounding them. The Lyman continuum photons create a nearly static, ionized, isothermal 10(exp 4) K atmosphere forms above the neutral disk at small distances from the star. Further out, they create a photoevaporative flow which relatively rapidly destroys the disk. The resulting slow (10-50 km/s) ionized outflow, which persists for approx. greater than 10(exp 5) years for disk masses M(sub d) approx. 0.3M(sub *), may explain the observational characteristics of many ultracompact HII regions. We compare model results to the observed radio free-free spectra and luminosities of ultracompact HII regions and to the interesting source MWC349, which is observed to produce hydrogen masers. We apply the results to Ae and Be stars in order to determine the lifetimes of disks around such stars. We also apply the results to the early solar nebula to explain the the dispersal of the solar nebula and the differences in hydrogen content in the giant planets. Finally, we model the small bright objects ("proplyds") observed in the Orion Nebula as disks around young, low mass stars which are externally illuminated by the UV photons from the nearby massive star Theta(sup 1) C.

  12. The S106 star-forming region

    NASA Astrophysics Data System (ADS)

    Hodapp, Klaus-Werner; Rayner, John

    1991-09-01

    A K-band image, near-infrared photometry, and I-band polarization data on the bipolar H II region S106 are presented. When a distance of 600 pc is assumed, S106 is found to be associated with an 0.3-pc radius protocluster of about 160 stars embedded in the molecular cloud surrounding S106. Only a few of the stars in the present cluster show reflection nebulosity surrounding them, which is interpreted as a sign of very young age. An age estimate of 1 x 10 to the 6th - 2 x 10 to the 6th yr is derived for the cluster. The K-band brightness function in this cluster rises smoothly to the completeness limit of 14.0 mag. Only within the last 100,000 yr has a star formed that is sufficiently massive to remove significant amounts of gas from the protocluster and end further star formation there. Polarization data on embedded and background stars near S106 confirm earlier results about the magnetic field orientation in its parent molecular cloud.

  13. Extreme Variables in Star Forming Regions

    NASA Astrophysics Data System (ADS)

    Contreras Peña, Carlos Eduardo

    2015-01-01

    in two multi-epoch infrared surveys: the UKIDSS Galactic Plane Survey (GPS) and the Vista Variables in the Via Lactea (VVV). In order to further investigate the nature of the selected variable stars, we use photometric information arising from public surveys at near- to far-infrared wavelengths. In addition we have performed spectroscopic and photometric follow-up for a large subset of the samples arising from GPS and VVV. We analyse the widely separated two-epoch K-band photometry in the 5th, 7th and 8th data releases of the UKIDSS Galactic Plane Survey. We find 71 stars with ΔK > 1 mag, including 2 previously known OH/IR stars and a Nova. Even though the mid-plane is mostly excluded from the dataset, we find the majority (66%) of our sample to be within known star forming regions (SFRs), with two large concentrations in the Serpens OB2 association (11 stars) and the Cygnus-X complex (27 stars). The analysis of the multi-epoch K-band photometry of 2010-2012 data from VVV covering the Galactic disc at |b| < 1° yields 816 high amplitude variables, which include known variables of different classes such as high mass X-ray binaries, Novae and eclipsing binaries among others. Remarkably, 65% of the sample are found concentrated towards areas of star formation, similar to the results from GPS. In both surveys, sources in SFRs show spectral energy distributions (SEDs) that support classification as YSOs. This indicates that YSOs dominate the Galactic population of high amplitude infrared variable stars at low luminosities and therefore likely dominate the total high amplitude population. Spectroscopic follow-up allows us to confirm the pre-main sequence nature of several GPS and VVV Objects. Most objects in both samples show spectroscopic signatures that can be attributed to YSOs undergoing high states of accretion, such as veiling of photospheric features and CO emission, or show FUor-like spectra. We also find a large fraction of objects with 2.12 μm H2 emission that

  14. Ab Initio Active Region Formation

    NASA Astrophysics Data System (ADS)

    Stein, Robert F.; Nordlund, A.

    2013-01-01

    The tachocline is not necessary to produce active regions with their global properties. Dynamo action within the convection zone can produce large scale reversing polarity magnetic fields as shown by ASH code and Charboneau et al simulations. Magneto-convection acting on this large scale field produces Omega-loops which emerge through the surface to produce active regions. The field first emerges as small bipoles with horizontal field over granules anchored in vertical fields in the intergranular lanes. The fields are quickly swept into the intergranular lanes and produce a mixed polarity "pepper and salt" pattern. The opposite polarities then migrate toward separate unipolar regions due to the underlying large scale loop structure. When sufficient flux concentrates, pores and sunspots form. We will show movies of magneto-convection simulations of the emerging flux, its migration, and concentration to form pores and spots, as well as the underlying magnetic field evolution. In addition, the same atmospheric data has been used as input to the LILIA Stokes Inversion code to calculate Stokes spectra for the Fe I 630 nm lines and then invert them to determine the magnetic field. Comparisons of the inverted field with the simulation field shows that small-scale, weak fields, less than 100 G, can not be accurately determined because of vertical gradients that are difficult to match in fitting the line profiles. Horizontal smoothing by telescope diffraction further degrades the inversion accuracy.

  15. Radio observations of massive star forming regions

    NASA Astrophysics Data System (ADS)

    Linz, H.; Stecklum, B.; Henning, Th.; Norris, R.; Nyman, L.-A.

    We report on first results of molecular line observations of a sample of methanol maser sources conducted at the SEST. The sources were selected according to the presence of linear or arc-like chains of maser spots which are thought to occur in circumstellar disks or outflows. The primary aim of our investigation was to look for evidence of molecular flows by detecting broad line wings and their subsequent mapping. This should, in principle, enable us to decide whether the masers occur in a circumstellar disk (flow orientation perpendicular to maser chain) or reside in the outflow (parallel orientation of outflow and maser axes). Several molecules prove to be good tracers for the conditions and the kinematics of the outflow as well as the parent molecular core. Thus, most of the regions were mapped in different molecular lines, e.g. CO(2--1), CS(2--1), HCO+(1--0), CH3OH and other species. The large average distance (several kpc) and the occasional presence of other molecular clouds along the line of sight rendered the mapping of possibly detected flows difficult. Nevertheless, the spectra can be used to constrain the properties of the cores by comparing the line profiles of different molecules/transitions with results of radiative line transfer calculations. In combination with our near- and mid-infrared imaging data, we will be able to draw conclusions on the conditions for the formation of massive stars and the presence of hot cores associated with the maser sources.

  16. Regional Activities Division. Papers.

    ERIC Educational Resources Information Center

    International Federation of Library Associations, The Hague (Netherlands).

    Papers on library network activities in Canada, the Third World, Japan, Malaysia, Brazil, and Sweden which were presented at the 1982 International Federation of Library Associations (IFLA) conference include: (1) "Canada: A Voluntary and Flexible Network," a review by Guy Sylvestre of the political, social, and economic structures…

  17. Silicon on insulator with active buried regions

    DOEpatents

    McCarthy, A.M.

    1996-01-30

    A method is disclosed for forming patterned buried components, such as collectors, sources and drains, in silicon-on-insulator (SOI) devices. The method is carried out by epitaxially growing a suitable sequence of single or multiple etch stop layers ending with a thin silicon layer on a silicon substrate, masking the silicon such that the desired pattern is exposed, introducing dopant and activating in the thin silicon layer to form doped regions. Then, bonding the silicon layer to an insulator substrate, and removing the silicon substrate. The method additionally involves forming electrical contact regions in the thin silicon layer for the buried collectors. 10 figs.

  18. Spatial and kinematic structure of Monoceros star-forming region

    NASA Astrophysics Data System (ADS)

    Costado, M. T.; Alfaro, E. J.

    2018-05-01

    The principal aim of this work is to study the velocity field in the Monoceros star-forming region using the radial velocity data available in the literature, as well as astrometric data from the Gaia first release. This region is a large star-forming complex formed by two associations named Monoceros OB1 and OB2. We have collected radial velocity data for more than 400 stars in the area of 8 × 12 deg2 and distance for more than 200 objects. We apply a clustering analysis in the subspace of the phase space formed by angular coordinates and radial velocity or distance data using the Spectrum of Kinematic Grouping methodology. We found four and three spatial groupings in radial velocity and distance variables, respectively, corresponding to the Local arm, the central clusters forming the associations and the Perseus arm, respectively.

  19. The formation of prebiotic molecules in star-forming regions

    NASA Astrophysics Data System (ADS)

    Rivilla, V. M.

    New sensitive observations using the current generation of (sub)millimeter telescopes have revealed in several star-forming regions molecular species of different chemical families (e.g. sugars, esters, isocyanates, phosphorus-bearing species) that may play an important role in prebiotic chemistry, and eventually in the origin of life. The observed molecular abundances of complex organic molecules (glycolaldehyde, ethylene glycol and ethyl formate) are better explained by surface-phase chemistry on dust grains, although gas-phase reactions can also play an important role, as in the case of methyl isocyanate. The PO molecule - a basic chemical bond to build-up the backbone of the DNA - has been detected for the first time in star-forming regions. These new observations indicate that phosphorus, a key element for the development of life, is much more abundant in star-forming regions than previously thought.

  20. New Molecular Views of Southern Star Forming Regions

    NASA Astrophysics Data System (ADS)

    Fukui, Y.

    1999-10-01

    I will present new molecular views of southern sky based on the CO survey for star forming regions conducted by Nagoya University with the NANTEN 4-m millimeter wave telescope. The NANTEN telescope is installed at the Las Campanas Observatory in Chile under a mutual agreement between Nagoya University and the Carnegie Institution of Washington. Through the survey, molecular gas distribution and the physical properties of cluster forming regions in the Magellanic Clouds, Galactic star forming GMCs, dark clouds, high latitude clouds, and interacting clouds with HII regions and/or SNRs are studied at a beam size of 2.'7 in the 12CO, 13CO, and C18O (J=1-0) molecular emission. I will review the expected contribution of the southern CO survey to the ALMA project, and discuss the scientific targets related with star formation at the time the ALMA becomes available.

  1. Small but Dynamic Active Region

    NASA Image and Video Library

    2018-04-20

    The sun featured just one, rather small active region over the past few days, but it developed rapidly and sported a lot of magnetic activity in just one day (Apr. 11-12, 2018). The activity was observed in a wavelength of extreme ultraviolet light. The loops and twisting arches above it are evidence of magnetic forces tangling with each other. The video clip was produced using Helioviewer software. Movies are available at https://photojournal.jpl.nasa.gov/catalog/PIA06676

  2. Astronomers Discover New Star-Forming Regions in Milky Way

    NASA Astrophysics Data System (ADS)

    2010-05-01

    Astronomers studying the Milky Way have discovered a large number of previously-unknown regions where massive stars are being formed. Their discovery provides important new information about the structure of our home Galaxy and promises to yield new clues about the chemical composition of the Galaxy. "We can clearly relate the locations of these star-forming sites to the overall structure of the Galaxy. Further studies will allow us to better understand the process of star formation and to compare the chemical composition of such sites at widely different distances from the Galaxy's center," said Thomas Bania, of Boston University. Bania worked with Loren Anderson of the Astrophysical Laboratory of Marseille in France, Dana Balser of the National Radio Astronomy Observatory (NRAO), and Robert Rood of the University of Virginia. The scientists presented their findings to the American Astronomical Society's meeting in Miami, Florida. The star-forming regions the astronomers sought, called H II regions, are sites where hydrogen atoms are ionized, or stripped of their electrons, by the intense radiation of the massive, young stars. To find these regions hidden from visible-light detection by the Milky Way's gas and dust, the researchers used infrared and radio telescopes. "We found our targets by using the results of infrared surveys done with NASA's Spitzer Space Telescope and of surveys done with the National Science Foundation's (NSF) Very Large Array (VLA) radio telescope," Anderson said. "Objects that appear bright in both the Spitzer and VLA images we studied are good candidates for H II regions," he explained. The astronomers then used the NSF's giant Robert C. Byrd Green Bank Telescope (GBT) in West Virginia, an extremely sensitive radio telescope. With the GBT, they were able to detect specific radio frequencies emitted by electrons as they recombined with protons to form hydrogen. This evidence of recombination confirmed that the regions contained ionized

  3. Attention to form or surface properties modulates different regions of human occipitotemporal cortex.

    PubMed

    Cant, Jonathan S; Goodale, Melvyn A

    2007-03-01

    We carried out 2 functional magnetic resonance imaging experiments to investigate the cortical mechanisms underlying the contribution of form and surface properties to object recognition. In experiment 1, participants performed same-different judgments in separate blocks of trials on pairs of unfamiliar "nonsense" objects on the basis of their form, surface properties (i.e., both color and texture), or orientation. Attention to form activated the lateral occipital (LO) area, whereas attention to surface properties activated the collateral sulcus (CoS) and the inferior occipital gyrus (IOG). In experiment 2, participants were required to make same-different judgments on the basis of texture, color, or form. Again attention to form activated area LO, whereas attention to texture activated regions in the IOG and the CoS, as well as regions in the lingual sulcus and the inferior temporal sulcus. Within these last 4 regions, activation associated with texture was higher than activation associated with color. No color-specific cortical areas were identified in these regions, although parts of V1 and the cuneus yielded higher activation for color as opposed to texture. These results suggest that there are separate form and surface-property pathways in extrastriate cortex. The extraction of information about an object's color seems to occur relatively early in visual analysis as compared with the extraction of surface texture, perhaps because the latter requires more complex computations.

  4. Silk Microgels Formed by Proteolytic Enzyme Activity

    PubMed Central

    Samal, Sangram K.; Dash, Mamoni; Chiellini, Federica; Kaplan, David L.; Chiellini, Emo

    2013-01-01

    The proteolytic enzyme α-chymotrypsin selectively cleaves the amorphous regions of silk fibroin protein (SFP) and allows the crystalline regions to self-assemble into silk microgels (SMG) at physiological temperature. These microgels consist of lamellar crystals in the micrometer scale, in contrast to the nanometer scaled crystals in native silkworm fibers. SDS-PAGE and zeta potential results demonstrated that α-chymotrypsin utilized only the nonamorphous domains or segments of the heavy chain of SFP to form negatively charged SMGs. The SMGs were characterized in terms of size, charge, structure, morphology, crystallinity, swelling kinetics, water content and thermal properties. The results suggest that the present technique of preparing SMGs by α-chymotrypsin is simple and efficient potential and that the prepared SMGS have useful features for studies related to biomaterials and pharmaceutical needs. This process is also an easy approach to obtain the amorphous peptide chains for further study. PMID:23756227

  5. The IRAS 08589-4714 star-forming region

    NASA Astrophysics Data System (ADS)

    Saldaño, H. P.; Vasquez, J.; Cappa, C. E.; Gómez, M.; Duronea, N.; Rubio, M.

    2017-04-01

    We present an analysis of the IRAS 08589-4714 star-forming region. This region harbors candidate young stellar objects identified in the WISE and Herschel images using color index criteria and spectral energy distributions (SEDs). The SEDs of some of the infrared sources and the 70 μm radial intensity profile of the brightest source are modeled using the DUSTY code. For these objects, we estimate the main parameters, which suggest that they are very young, massive and luminous objects at early stages of the formation process. We use the emission distribution in the infrared at 70 and 160 μm to estimate the dust temperature gradient. This suggests that the nearby massive starforming region RCW 38, located at ≈10 pc from the IRAS source position, may be contributing to the photodissociation of the molecular gas and to the heating of the interstellar dust in the environs of the IRAS source.

  6. Intense active region brightenings observed by IRIS

    NASA Astrophysics Data System (ADS)

    Young, Peter R.

    2014-06-01

    Active region raster scans obtained with the Interface Region Imaging Spectrometer (IRIS) typically reveal a few extremely intense brightenings in the Si IV emission lines (formed around 80,000 K) that are not related to flares. The brightenings are around 0.5-1.0 arcsec (0.4-0.8 Mm) in size, and the line profiles can be very broad (up to 300 km/s), showing multiple emission components. Similar brightenings were reported from the Coronal Diagnostic Spectrometer (CDS) on board the Solar and Heliospheric Observatory (SOHO) and were termed active region blinkers. The much higher spatial and spectral resolution of IRIS together with high cadence coronal and photospheric imaging from the Solar Dynamics Observatory allows the brightenings to be identified with magnetic field and coronal signatures. Example events will be shown and statistics given.

  7. ASTE Surveys of Galactic Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    Kohno, Kotaro

    2008-05-01

    We report some recent highlights on the observational studies of Galactic star formation based on surveys using the Atacama Submillimeter Telescope Experiment (ASTE), a new 10 m telescope in the Atacama desert in northern Chile (Kohno et al., 2008, ApSS, 313, 279). The highlights will include (1) a large scale CO(3-2) imaging survey of the Galactic Center, unveiling the presence of numerous compact high velocity clouds with high CO(3-2)/CO(1-0) ratios as a "fossil” of the recent burst of star formation in the Galactic Center region (Oka et al., 2007, PASJ, 59, 15; Nagai et al., 2007, PASJ, 59, 25; Tanaka et al., 2007, PASJ, 59, 323), (2) a large scale CO(3-2) imaging survey of the Sgr arm and inter-am regions, revealing the distinct difference on the morphology and physical property of molecular gas between the arm and inter-arm regions for the first time (Sawada, Koda, et al., in prep.), and (3) a wide area 1.1 mm imaging survey of Southern low mass star-forming regions such as Chamaeleon and Lupus molecular clouds using the bolometer camera AzTEC (Wilson et al., 2008, MNRAS, in press) mounted on ASTE, yielding detections of starless cores with a very low mass detection limist down to 0.1 solar masses (Hiramatsu, Tsukagoshi, Kawabe et al., in prep.). Related topics on the massive star-forming regions in very nearby galaxies such as LMC (Minamidani et al., 2008, ApJS, in press) and M 33 (Tosaki et al., 2007, ApJ, 664, L27; Onodera et al., in prep.; Komugi et al., in prep.) will also be reviewed.

  8. VLBA Helps Build New Picture of Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    2007-01-01

    New, high-precision distance measurements by the National Science Foundation's Very Long Baseline Array (VLBA) radio telescope are providing a major advance for astronomers trying to understand how stars form. "A large improvement in measuring the distance to a young, still-forming star means a large improvement in measuring characteristics such as its mass and intrinsic brightness," said Laurent Loinard, of the National University of Mexico (UNAM). Loinard, Amy Mioduszewski of the National Radio Astronomy Observatory, UNAM graduate student Rosa Torres and UNAM professor Luis Rodriguez presented their findings to the American Astronomical Society's meeting in Seattle, Washington. Parallax Diagram Trigonometric Parallax method determines distance to star by measuring its slight shift in apparent position as seen from opposite ends of Earth's orbit. CREDIT: Bill Saxton, NRAO/AUI/NSF Image and Animation Files Parallax Diagram (above image, JPEG, 153K) Animation of apparant motion on sky of young star T Tauri S (MPEG, 891K) Still Frame from above animation (JPEG, 14K) B&W Plot of T Tauri S Parallax motion (JPEG, 51K) "Most of what we know about the processes of star formation has come from studying young stars in a few, relatively nearby regions," Loinard said. "However, estimates of the distance to these regions have been imprecise. That imprecision has limited the ability of real-world observations to improve theoretical models for star formation," he added. The new VLBA distance measurements are great improvements over earlier estimates. For example, earlier work placed a famous young stellar system in the constellation Taurus between 423 and 489 light-years from Earth. The new VLBA measurements narrow the range to 418-422 light-years. "Our observations brought the error in this measurement down from 66 light-years to four," Mioduszewski said. The new VLBA observations also refined the distance estimate to another star-forming region in the constellation Ophiuchus

  9. Collapse scenarios in magnetized star-forming regions

    NASA Astrophysics Data System (ADS)

    Juarez, Carmen

    2017-04-01

    Turbulence, magnetic fields and gravity driven flows are important for the formation of new stars. Although magnetic fields have been proven to be important in the formation of stars, only a few works have been done combining magnetic field and kinematic information. Such studies are important to analyze both gravity and gas dynamics and be able to compare them with the magnetic field. In this thesis we will combine dust polarization studies with kinematic analysis towards different star-forming regions. We aim to study the physical properties at core scales (<0.1 pc) from molecular line and dust emission, and study the role of the magnetic field in their dynamic evolution. For this, we will use millimeter and submillimeter observational data taken towards low- and high- mass star-forming regions in different environments and evolutionary states. The first project is the study of the physical, chemical and magnetic properties of the pre-stellar core FeSt1-457 in the Pipe nebula. We studied the emission of the molecular line N2H+(1-0) which is a good tracer of dense gas and therefore describes well the structure of the core. In addition, we detected more than 15 molecular lines and found a clear chemical spatial differentiation for molecules with nitrogen, oxygen and sulfur. Using the ARTIST radiative transfer code (Brinch & Hogerheijde 2010, Padovani et al., 2011, 2012, Jørgensen et al., 2014), we simulated the emission of the different molecules detected and estimated their abundance. In addition, we estimated the magnetic field properties of the core (using the Chandrasekhar-Fermi approximation) from polarization data previously obtained by Alves et al., (2014). Finally, we found interesting correlations between the polarization properties and the chemistry in the region. The second project is the study of a high-mass star-forming region called NGC6334V. NGC6334V is in a more advanced evolutionary state and in an environment surrounded by other massive star-forming

  10. Dynamical evolution of star-forming regions - II. Basic kinematics

    NASA Astrophysics Data System (ADS)

    Parker, Richard J.; Wright, Nicholas J.

    2016-04-01

    We follow the dynamical evolution of young star-forming regions with a wide range of initial conditions and examine how the radial velocity dispersion, σ, evolves over time. We compare this velocity dispersion to the theoretically expected value for the velocity dispersion if a region were in virial equilibrium, σvir and thus assess the virial state (σ/σvir) of these systems. We find that in regions that are initially subvirial, or in global virial equilibrium but subvirial on local scales, the system relaxes to virial equilibrium within several million years, or roughly 25-50 crossing times, according to the measured virial ratio. However, the measured velocity dispersion, σ, appears to be a bad diagnostic of the current virial state of these systems as it suggests that they become supervirial when compared to the velocity dispersion estimated from the virial mass, σvir. We suggest that this discrepancy is caused by the fact that the regions are never fully relaxed, and that the early non-equilibrium evolution is imprinted in the one-dimensional velocity dispersion at these early epochs. If measured early enough (<2 Myr in our simulations, or ˜20 crossing times), the velocity dispersion can be used to determine whether a region was highly supervirial at birth without the risk of degeneracy. We show that combining σ, or the ratio of σ to the interquartile range (IQR) dispersion, with measures of spatial structure, places stronger constraints on the dynamical history of a region than using the velocity dispersion in isolation.

  11. Planar H2O masers in star-forming regions

    NASA Technical Reports Server (NTRS)

    Elitzur, Moshe; Hollenbach, David J.; Mckee, Christopher F.

    1992-01-01

    The paper examines the planar geometry of shocked material, which is the key property in enabling the high brightness temperatures of H2O masers in star-forming regions. The brightness temperature, beaming angle, and the maser spot size are determined for thin, saturated planar masers under the assumption that the velocity change across the maser due to ordered motions is small compared with the thermal or microturbulent line width. For a given set of physical parameters, the brightness temperature is essentially fully determined by the length of the velocity-coherent region in the shocked plane along the line of sight. Effective aspect ratios (about 5-50) are found that are in agreement with values previously inferred from observed brightness temperatures.

  12. Cometary nucleus and active regions

    NASA Technical Reports Server (NTRS)

    Whipple, F. L.

    1984-01-01

    On the basis of the icy conglomerate model of cometary nuclei, various observations demonstrate the spotted nature of many or most nuclei, i.e., regions of unusual activity, either high or low. Rotation periods, spin axes and even precession of the axes are determined. The observational evidence for variations in activity over the surfaces of cometary nuclei are listed and discussed. On June 11 the comet IRAS-ARAKI-ALCOCK approached the Earth to a distance of 0.031 AU, the nearest since C/Lexell, 1770 I, providing a unique opportunity for near-nucleus observations. Preliminary analysis of these images establishes the spin axis of the nucleus, with an oblioquity to the orbit plane of approximately 50 deg, and a lag angle of sublimation approximately 35 deg from the solar meridian on the nucleus. Asymmetries of the inner coma suggests a crazy-quilt distribution of ices with differing volatility over the surface of the nucleus. The observations of Comet P/Homes 1892 III, exhibiting two 8-10 magnitude bursts, are carefully analyzed. The grazing encounter produced, besides the first great burst, an active area on the nucleus, which was rotating retrograde with a period of 16.3hr and inclination nearly 180 deg. After the first burst the total magnitude fell less than two magnitudes from November 7 to November 30 (barely naked eye) while the nuclear region remained diffuse or complex, rarely if ever showing a stellar appearance. The fading was much more rapid after the second burst. The grazing encounter distributed a volume of large chunks in the neighborhood of the nucleus, maintaining activity for weeks.

  13. Examining the radiation field in a star forming region

    NASA Astrophysics Data System (ADS)

    Bellardini, Matthew; Keller, Luke

    We examined the propagation of photoionizing radiation in a star forming region within the Orion nebula (M42), across the barrier between ionized hydrogen and a molecular hydrogen cloud, by using infrared emissions of polycyclic aromatic hydrocarbons (PAHs). Photoionizing radiation affects the structure of the interstellar medium, how gas is heated, and how gas is ionized; this affects the physical environment and chemical structure for future star formation in the cloud. We have gathered both slit spectroscopic data and narrowband imaging data of the boundary using the FORCAST instrument on SOFIA. The spectroscopic data were taken over a wavelength range which covered three features. The imaging data were taken using three filters corresponding to the peak wavelengths of the features examined. We created and analyzed flux profiles of the features to show that the emissions peak within the boundary and decay at different rates with progression into the molecular hydrogen cloud. Our examination of the emission intensity ratio of the different features shows how photoionizing radiation propagates with spatial progression from the region of ionized hydrogen into the dense molecular cloud where gravitational collapse will eventually form new stars.

  14. Combinatorial methodologies for determination of glass-forming region

    NASA Astrophysics Data System (ADS)

    Inoue, Satoru; Todoroki, Shinichi; Matsumoto, Takehisa; Hondo, Takaharu; Araki, Tetsuo; Watanabe, Yuichi

    2002-04-01

    The combinatorial methodologies have been studied to automate the process for the determination of glass-forming region. The glass batches were prepared automatically and were melted simultaneously by applying various heating techniques, followed by cooling to room temperature to get the melt-quench samples. In this study, the combinatorial methods for the preparation of batches and the melting in the crucibles have been developed. The apparatus for the preparation of glass batches (automatic batch preparation apparatus) has been developed firstly in the world. The apparatus can prepare 24 different glass batches at one time in a 4-component system. The furnace designed for melting some glass batches simultaneously (automatic batch-melting apparatus) has been developed. The automatic batch-melting apparatus can work on the melting of 10 glass batches and the casting of the 10 melts onto the metal plates. The other possible methods for the determination of glass-forming regions have been discussed to develop the further advancements of the combinatorial methodologies.

  15. Stellar Feedback in Massive Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    Baldwin, Jack; Pellegrini, Eric; Ferland, Gary; Murray, Norm; Hanson, Margaret

    2008-02-01

    Star formation rates and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study in the two nearest giant star-forming regions to nail down the physics that produces the 10-20 parsec bubbles seen to surround young massive clusters in the Milky Way. This will determine if and how the clusters disrupt their natal giant molecular clouds (GMCs). Here we request 4 nights on the Blanco telescope to obtain dense grids of optical long-slit spectra criss-crossing each nebula. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3000 different spots in each nebula. From this we can determine a number of dynamically important quantities, such as the gas density and temperature, hence pressure in and around these bubbles. These quantities can be compared to the dynamical (gravitationally induced) pressure, and the radiation pressure. All can be employed in dynamical models for the evolution of a GMC under the influence of an embedded massive star cluster. This research will elucidate the detailed workings of the star-forming regions which dominate the star formation rate in the Milky Way, and also will steadily improve our calibration and understanding of more distant, less well-resolved objects such as ULIRGS, Lyman break, and submillimeter galaxies.

  16. VLBA Changes Picture of Famous Star-Forming Region

    NASA Astrophysics Data System (ADS)

    2007-10-01

    Using the supersharp radio "vision" of the National Science Foundation's Very Long Baseline Array (VLBA), astronomers have made the most precise measurement ever of the distance to a famous star-forming region. The measurement -- to the heavily studied Orion Nebula -- changes scientists' understanding of the characteristics of the young stars in the region. Parallax Diagram Trigonometric Parallax method determines distance to star by measuring its slight shift in apparent position as seen from opposite ends of Earth's orbit. CREDIT: Bill Saxton, NRAO/AUI/NSF Star Track Apparent track of star GMR A in the Orion Nebula Cluster, showing shift caused by Earth's orbital motion and star's movement in space. CREDIT: Sandstrom et al., NRAO/AUI/NSF Click on Images for Larger Files "This measurement is four times more precise than previous distance estimates. Because our measurement reduces the distance to this region, it tells us that the stars there are less bright than thought before, and changes the estimates of their ages," said Geoff Bower, an astronomer at the University of California at Berkeley. Bower, along with Karin Sandstrom, J.E.G. Peek, Alberto Bolatto and Richard Plambeck, all of Berkeley, published their findings in the October 10 edition of the Astrophysical Journal. The scientists determined the distance to a star called GMR A, one of a cluster of stars in the Orion Nebula, by measuring the slight shift in the star's apparent position in the sky caused by the Earth's motion around the Sun. Observing the star when the Earth is on opposite sides of its annual orbit allows astronomers to measure the angle of this small shift and thus provides a direct trigonometric calculation of its distance. "By using this technique, called parallax, we get a direct measurement that does not depend on various assumptions that are required to use less-direct methods," Bower said. "Only a telescope with the remarkable ability to see fine detail that is provided by the VLBA is

  17. VLA 7-mm Observations of Massive Star-forming Regions

    NASA Astrophysics Data System (ADS)

    Linz, Hendrik; Hofner, Peter; Araya, Esteban; Stecklum, Bringfried

    2003-07-01

    The early stages during the formation of massive stars are deeply enshrouded due to the presence of dense and dusty natal material. This prevents observations in the optical and often also in the near-infrared. The emission of the star-forming regions peaks in the far-infrared and sub-mm regime, but at these wavelengths, single-dish observations are restricted in spatial resolution and can give only upper limits on the energetics of the objects of interest. Interferometry at mm wavelengths is one appropriate technique to overcome these limitations. We have started an extensive programme to observe pre-selected massive star-forming regions. Our tool is the VLA and its 7-mm receiver system. The VLA can be operated in several antenna configurations delivering resolutions from 1.5 arcsec down to 0.05 arcsec, which is superior to other current mm-interferometers. Sub-arcsec resolution is strongly needed to disentangle the often crowded regions of high-mass star formation and to clearly separate our objects of interest from the adjacent ultracompact HII regions. At 7 mm we are on the save ground of the Rayleigh-Jeans limit even for emission of cold dust (a fact that is not always true for observations at smaller wavelengths). Almost all circumstellar density configurations are optically thin at 7 mm, thus, the observations will trace the total dust content. However, at 7 mm also the free-free emission from ionised gas (caused by the UV emission of the young massive stars) can contribute to the observed signal. Therefore, we have to identify and remove these "parasitic" constituents by extrapolating interferometric data obtained at cm-wavelengths. The targets are either taken from the list of Molinari (Molinari et al. 2000, A&A, 355, 617) or are well-known massive star-forming complexes, for which we have already acquired additional data at other wavelengths. We have started with observations at lower and medium resolution (1.5 - 0.5 arcsec) to distinguish candidates for

  18. 75 FR 51093 - Agency Information Collection Activities: Form I-864, Form I-864A, Form I-864EZ, and Form I-864W...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-18

    ... Collection Activities: Form I-864, Form I- 864A, Form I-864EZ, and Form I-864W; Extension of a Currently... Review: Form I- 864, Affidavit of Support Under Section 213A of the Act; Form I-864A, Contract Between Sponsor and Household Member, Form I-864 EZ, Affidavit of Support Under Section 213A of the Act; Form I...

  19. HUBBLE'S PANORAMIC PORTRAIT OF A VAST STAR-FORMING REGION

    NASA Technical Reports Server (NTRS)

    2002-01-01

    NASA's Hubble Space Telescope has snapped a panoramic portrait of a vast, sculpted landscape of gas and dust where thousands of stars are being born. This fertile star-forming region, called the 30 Doradus Nebula, has a sparkling stellar centerpiece: the most spectacular cluster of massive stars in our cosmic neighborhood of about 25 galaxies. The mosaic picture shows that ultraviolet radiation and high-speed material unleashed by the stars in the cluster, called R136 [the large blue blob left of center], are weaving a tapestry of creation and destruction, triggering the collapse of looming gas and dust clouds and forming pillar-like structures that are incubators for nascent stars. The photo offers an unprecedented, detailed view of the entire inner region of 30 Doradus, measuring 200 light-years wide by 150 light-years high. The nebula resides in the Large Magellanic Cloud (a satellite galaxy of the Milky Way), 170,000 light-years from Earth. Nebulas like 30 Doradus are the 'signposts' of recent star birth. High-energy ultraviolet radiation from the young, hot, massive stars in R136 causes the surrounding gaseous material to glow. Previous Hubble telescope observations showed that R136 contains several dozen of the most massive stars known, each about 100 times the mass of the Sun and about 10 times as hot. These stellar behemoths all formed at the same time about 2 million years ago. The stars in R136 are producing intense 'stellar winds' (streams of material traveling at several million miles an hour), which are wreaking havoc on the gas and dust in the surrounding neighborhood. The winds are pushing the gas away from the cluster and compressing the inner regions of the surrounding gas and dust clouds [the pinkish material]. The intense pressure is triggering the collapse of parts of the clouds, producing a new generation of star formation around the central cluster. The new stellar nursery is about 30 to 50 light-years from R136. Most of the stars in the

  20. 76 FR 61725 - Agency Information Collection Activities: Case Submission Form, Case Assistance Form; (Form DHS...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-05

    ..., Case Assistance Form; (Form DHS-7001), Online Ombudsman Form DHS-7001 AGENCY: Office of the Citizenship... System'' to ``Online Ombudsman Form DHS-7001''. The instructions have been updated to reflect the... Services Ombudsman--001 Virtual Ombudsman System (March 2010) to reflect the name change to Online...

  1. THE DISK POPULATION OF THE TAURUS STAR-FORMING REGION

    SciTech Connect

    Luhman, K. L.; Allen, P. R.; Espaillat, C.

    2010-01-01

    We have analyzed nearly all images of the Taurus star-forming region at 3.6, 4.5, 5.8, 8.0, and 24 {mu}m that were obtained during the cryogenic mission of the Spitzer Space Telescope (46 deg{sup 2}) and have measured photometry for all known members of the region that are within these data, corresponding to 348 sources, or 99% of the known stellar population. By combining these measurements with previous observations with the Spitzer Infrared Spectrograph and other facilities, we have classified the members of Taurus according to whether they show evidence of circumstellar disks and envelopes (classes I, II, and III). Throughmore » these classifications, we find that the disk fraction in Taurus, N(II)/N(II+III), is {approx}75% for solar-mass stars and declines to {approx}45% for low-mass stars and brown dwarfs (0.01-0.3 M {sub sun}). This dependence on stellar mass is similar to that measured for Chamaeleon I, although the disk fraction in Taurus is slightly higher overall, probably because of its younger age (1 Myr versus 2-3 Myr). In comparison, the disk fraction for solar-mass stars is much lower ({approx}20%) in IC 348 and {sigma} Ori, which are denser than Taurus and Chamaeleon I and are roughly coeval with the latter. These data indicate that disk lifetimes for solar-mass stars are longer in star-forming regions that have lower stellar densities. Through an analysis of multiple epochs of Spitzer photometry that are available for {approx}200 Taurus members, we find that stars with disks exhibit significantly greater mid-infrared (mid-IR) variability than diskless stars, which agrees with the results of similar variability measurements for a smaller sample of stars in Chamaeleon I. The variability fraction for stars with disks is higher in Taurus than in Chamaeleon I, indicating that the IR variability of disks decreases with age. Finally, we have used our data in Taurus to refine the observational criteria for primordial, evolved, and transitional disks

  2. Optical spectroscopic studies of two star forming regions

    NASA Astrophysics Data System (ADS)

    Erickson, Kristen Leilani

    The Rho Ophiuchi and Serpens molecular clouds are sites of low mass star formation. The goals of this study were to identify young stellar objects (YSOs) and estimate ages and masses in order to infer an initial mass function (IMF), investigate disk evolution, and determine the star-forming history. Optical spectroscopic surveys of an unbiased sample of candidate young stars have been completed. Optical images taken in different photometric bands were used to create color-magnitude diagrams from which sources were selected for spectroscopic observation. In combination with published data, 135 association members in Rho Ophiuchi and 63 association members plus 16 possible members in Serpens have been identified based on the presence of H-alpha in emission, lithium absorption, X-ray emission, a mid-infrared excess, and/or reflection nebulosity. Effective temperatures and bolometric luminosities were compared with theoretical tracks and isochrones for pre-main-sequence stars to estimate ages and masses. Both regions have similar median ages, supporting the idea that star formation is a relatively fast process. In Rho Ophiuchi, no age spread was found. In Serpens, an age spread of 1-5 Myrs was found; it could not be determined if this age spread was intrinsic or a result of contamination from foreground young stars. Consistent with these ages similar circumstellar disk frequencies were found. In Rho Ophiuchi, an IMF consistent with the field star IMF for YSOs with masses > 0.2 Msun was inferred. In Serpens, the IMF was in agreement with the field star IMF for M > Msun. Previous studies of these regions have been biased towards particular stages in the star formation process. This study has provided an unbiased sample of pre-main sequence objects, necessary to obtain a complete picture of star formation.

  3. Water in star- and planet-forming regions.

    PubMed

    Bergin, Edwin A; van Dishoeck, Ewine F

    2012-06-13

    In this paper, we discuss the astronomical search for water vapour in order to understand the disposition of water in all its phases throughout the processes of star and planet formation. Our ability to detect and study water vapour has recently received a tremendous boost with the successful launch and operation of the Herschel Space Observatory. Herschel spectroscopic detections of numerous transitions in a variety of astronomical objects, along with previous work by other space-based observatories, will be threaded throughout this paper. In particular, we present observations of water tracing the earliest stage of star birth where it is predominantly frozen as ice. When a star is born, the local energy release by radiation liberates ices in its surrounding envelope and powers energetic outflows that appear to be water factories. In these regions, water plays an important role in the gas physics. Finally, we end with an exploration of water in planet-forming discs surrounding young stars. The availability of accurate molecular data (frequencies, collisional rate coefficients and chemical reaction rates) is crucial to analyse the observations at each of these steps.

  4. Millimetre wavelength methanol masers survey towards massive star forming regions

    NASA Astrophysics Data System (ADS)

    Umemoto, T.; Mochizuki, N.; Shibata, K. M.; Roh, D.-G.; Chung, H.-S.

    2007-03-01

    We present the results of a mm wavelength methanol maser survey towards massive star forming regions. We have carried out Class II methanol maser observations at 86.6 GHz, 86.9 GHz and 107.0 GHz, simultaneously, using the Nobeyama 45 m telescope. We selected 108 6.7 GHz methanol maser sources with declinations above -25 degrees and fluxes above 20 Jy. The detection limit of maser observations was ~3 Jy. Of the 93 sources surveyed so far, we detected methanol emission in 25 sources (27%) and “maser” emission in nine sources (10%), of which thre “maser” sources are new detections. The detection rate for maser emission is about half that of a survey of the southern sky (Caswell et al. 2000). There is a correlation between the maser flux of 107 GHz and 6.7 GHz/12 GHz emission, but no correlation with the “thermal” (non maser) emission. From results of other molecular line observations, we found that the sources with methanol emission show higher gas temperatures and twice the detection rate of SiO emission. This may suggest that dust evaporation and destruction by shock are responsible for the high abundance of methanol molecules, one of the required physical conditions for maser emission.

  5. Emerging flux in active regions. [of sun

    NASA Technical Reports Server (NTRS)

    Liggett, M.; Zirin, H.

    1985-01-01

    The rates at which flux emerges in active and quiet solar regions within the sunspot belts are compared. The emerging flux regions (EFRs) were identified by the appearance of arch filament structures in H-alpha. All EFRs in high resolution films of active regions made at Big Bear in 1978 were counted. The comparable rate of flux emergence in quiet regions was obtained from SGD data and independently from EFRs detected outside the active region perimeter on the same films. The rate of flux emergence is 10 times higher in active regions than in quiet regions. A sample of all active regions in 31 days of 1983 gave a ratio of 7.5. Possible mechanisms which might funnel new magnetic flux to regions of strong magnetic field are discussed.

  6. Multiple active forms of thrombin. IV. Relative activities of meizothrombins

    SciTech Connect

    Doyle, M.F.; Mann, K.G.

    1990-06-25

    The prothrombin activation intermediates meizothrombin and meizothrombin(desF1) (meizothrombin that has been autoproteolyzed to remove fragment 1) have been obtained in a relatively pure, active form with minimal autolysis, making them suitable for enzymatic characterization. When compared at equimolar concentrations, alpha-thrombin, fragment 1.2+ alpha-thrombin, meizothrombin(desF1), and meizothrombin have approximately 100, 100, 10, and 1% activity, respectively, toward the macromolecular substrates factor V, fibrinogen, and platelets. The difference in activity of these four enzymes cannot be attributed to alterations in the catalytic triad, as all four enzymes have nearly identical catalytic efficiency toward the chromogenic substrate S2238. Further, the ability of meizothrombinmore » and meizothrombin(desF1) to activate protein C was 75% of the activity exhibited by alpha-thrombin or fragment 1.2+ alpha-thrombin. All four enzymes bind to thrombomodulin, as judged by the enhanced rate of protein C activation upon preincubation of the enzymes with thrombomodulin. The extent of rate enhancement varied, with meizothrombin/thrombomodulin exhibiting only 50% of the alpha-thrombin/thrombomodulin rate. This difference in rate is not due to a decreased affinity of the meizothrombin for thrombomodulin since the apparent dissociation constants for the alpha-thrombin-thrombomodulin complex and the meizothrombin-thrombomodulin complex are virtually identical. The difference in the observed rate is due in part to the higher Km for protein C exhibited by the meizothrombin-thrombomodulin complex. Incubation of the thrombomodulin-enzyme complex with phospholipid vesicles caused an increase in the protein C activation rates. The kinetic constants for protein C activation in the presence of phospholipid are virtually identical for these enzyme-thrombomodulin complexes.« less

  7. Not Your Grandmother's HII Regions: An X-ray Tour of Massive Star-forming Regions

    NASA Astrophysics Data System (ADS)

    Townsley, Leisa K.

    2006-09-01

    Chandra and XMM-Newton are providing remarkable new views of massive star-forming regions, revealing all stages in the life cycle of high-mass stars and their effects on their surroundings. We will tour several such regions, highlighting physical processes that characterize the life of a cluster of massive stars, from deeply-embedded cores too young to have established an HII region to superbubbles so large that they shape our views of galaxies. Along the way we see that X-ray observations reveal hundreds of pre-main sequence stars accompanying the massive stars that power great HII region complexes. The most massive stars themselves are often anomalously hard X-ray emitters; this may be a new indicator of close binarity. These complexes are sometimes suffused by diffuse X-ray structures, signatures of multi-million-degree plasmas created by fast O-star winds. In older regions we see the X-ray remains of the deaths of massive stars that stayed close to their birthplaces, exploding as cavity supernovae within the superbubbles that these clusters created.

  8. Kinked Loop Stretching Between Two Active Regions

    NASA Image and Video Library

    2017-07-25

    Numerous arches of magnetic field lines danced and swayed above a large active region over about a 30-hour period (July 17-18, 2017). We can also see the magnetic field lines from the large active region reached out and connected with a smaller active region. Those linked lines then strengthened (become brighter), but soon began to develop a kink in them and rather swiftly faded from view. All of this activity is driven by strong magnetic forces associated with the active regions. The images were taken in a wavelength of extreme ultraviolet light. https://photojournal.jpl.nasa.gov/catalog/PIA21838

  9. Nanoflare Properties throughout Active Regions: Comparing SDO/AIA Observations with Modeled Active Region Light Curves

    NASA Technical Reports Server (NTRS)

    Viall, Nicholeen

    2012-01-01

    Coronal plasma in active regions is typically measured to be at temperatures near 1-3 MK. Is the majority of the coronal plasma in hydrostatic equilibrium, maintained at these temperatures through a form of quasi-steady heating, or is this simply a measure of the average temperature of widely varying, impulsively heated coronal plasma? Addressing this question is complicated by the fact that the corona is optically thin: many thousands of flux tubes which are heated completely independently are contributing to the total emission along a given line of sight. There is a large body of work focused on the heating of isolated features - coronal loops - which are impulsively heated, however it is the diffuse emission between loops which often comprises the majority of active region emission. Therefore in this study we move beyond isolated features and analyze all of the emission in an entire active region from all contributing flux tubes. We investigate light curves systematically using SDO/AIA observations. We also model the active region corona as a line-of-sight integration of many thousands of completely independently heated flux tubes. The emission from these flux tubes may be time dependent, quasi-steady, or a mix of both, depending on the cadence of heat release. We demonstrate that despite the superposition of randomly heated flux tubes, different distributions of nanoflare cadences produce distinct signatures in light curves observed with multi-wavelength and high time cadence data, such as those from SDO/AIA. We conclude that the majority of the active region plasma is not maintained in hydrostatic equilibrium, rather it is undergoing dynamic heating and cooling cycles. The observed emission is consistent with heating through impulsive nanoflares, whose energy is a function of location within the active region.

  10. Modulation of solar irradiance by active regions

    NASA Technical Reports Server (NTRS)

    Schatten, K. H.

    1984-01-01

    Hoyt and Eddy (1983) have modeled solar irradiance by accounting for active regions. It is presently noted, however, in contradiction to this model, that in active region modeling of solar irradiance care should be taken to not merely employ average contrasts of faculae. This caveat is especially applicable if the model proceeds to ignore the active region facular areas when their contrasts are low, since this doubly devalues the faculae contribution relative to that of sunspots.

  11. The Main Sequence of Explosive Solar Active Regions: Comparison of Emerging and Mature Active Regions

    NASA Technical Reports Server (NTRS)

    Falconer, David; Moore, Ron

    2011-01-01

    For mature active regions, an active region s magnetic flux content determines the maximum free energy the active region can have. Most Large flares and CMEs occur in active regions that are near their free-energy limit. Active-region flare power radiated in the GOES 1-8 band increases steeply as the free-energy limit is approached. We infer that the free-energy limit is set by the rate of release of an active region s free magnetic energy by flares, CMEs and coronal heating balancing the maximum rate the Sun can put free energy into the active region s magnetic field. This balance of maximum power results in explosive active regions residing in a "mainsequence" in active-region (flux content, free energy content) phase space, which sequence is analogous to the main sequence of hydrogen-burning stars in (mass, luminosity) phase space.

  12. Star forming regions in gas-rich SO galaxies

    NASA Technical Reports Server (NTRS)

    Pogge, Richard W.; Eskridge, Paul B.

    1987-01-01

    The first results of an H alpha imaging survey of HI rich SO galaxies, which were searched for HII regions and other sources of emission, are presented. The charge coupled device H alpha interference filter images were made of 16 galaxies. Eight of these galaxies show evidence for on-going star formation, one has nuclear emission but no HII regions, and the remaining seven have no emissions detected within well defined upper limits. With the exception of one notably peculiar galaxy in which the emission from HII regions appears pervasive, the HII regions are either organized into inner-disk rings or randomly distributed throughout the disk. A few of these galaxies are found to be clearly not SO's; or peculiar objects atypical of the SO class. Using simple models star formation rates (SFRs) and gas depletion times from the observed H alpha fluxes were estimated. In general, the derived SFRs are much lower than those found in isolated field spiral galaxies and the corresponding gas depletion time scales are also longer.

  13. NUCLEAR ACTIVITY IS MORE PREVALENT IN STAR-FORMING GALAXIES

    SciTech Connect

    Rosario, D. J.; Lutz, D.; Berta, S.

    2013-07-01

    We explore the question of whether low and moderate luminosity active galactic nuclei (AGNs) are preferentially found in galaxies that are undergoing a transition from active star formation (SF) to quiescence. This notion has been suggested by studies of the UV-optical colors of AGN hosts, which find them to be common among galaxies in the so-called Green Valley, a region of galaxy color space believed to be composed mostly of galaxies undergoing SF quenching. Combining the deepest current X-ray and Herschel/PACS far-infrared (FIR) observations of the two Chandra Deep Fields with redshifts, stellar masses, and rest-frame photometry derived from themore » extensive and uniform multi-wavelength data in these fields, we compare the rest-frame U - V color distributions and star formation rate distributions of AGNs and carefully constructed samples of inactive control galaxies. The UV-to-optical colors of AGNs are consistent with equally massive inactive galaxies at redshifts out to z {approx} 2, but we show that such colors are poor tracers of SF. While the FIR distributions of both star-forming AGNs and star-forming inactive galaxies are statistically similar, we show that AGNs are preferentially found in star-forming host galaxies, or, in other words, AGNs are less likely to be found in weakly star-forming or quenched galaxies. We postulate that, among X-ray-selected AGNs of low and moderate accretion luminosities, the supply of cold gas primarily determines the accretion rate distribution of the nuclear black holes.« less

  14. New far infrared images of bright, nearby, star-forming regions

    NASA Technical Reports Server (NTRS)

    Harper, D. AL, Jr.; Cole, David M.; Dowell, C. Darren; Lees, Joanna F.; Lowenstein, Robert F.

    1995-01-01

    Broadband imaging in the far infrared is a vital tool for understanding how young stars form, evolve, and interact with their environment. As the sensitivity and size of detector arrays has increased, a richer and more detailed picture has emerged of the nearest and brightest regions of active star formation. We present data on M 17, M 42, and S 106 taken recently on the Kuiper Airborne Observatory with the Yerkes Observatory 60-channel far infrared camera, which has pixel sizes of 17 in. at 60 microns, 27 in. at 100 microns, and 45 in. at 160 and 200 microns. In addition to providing a clearer view of the complex central cores of the regions, the images reveal new details of the structure and heating of ionization fronts and photodissociation zones where radiation form luminous stars interacts with adjacent molecular clouds.

  15. Abundant cyanopolyynes as a probe of infall in the Serpens South cluster-forming region

    NASA Astrophysics Data System (ADS)

    Friesen, R. K.; Medeiros, L.; Schnee, S.; Bourke, T. L.; di Francesco, J.; Gutermuth, R.; Myers, P. C.

    2013-12-01

    We have detected bright HC7N J = 21 - 20 emission towards multiple locations in the Serpens South cluster-forming region using the K-Band Focal Plane Array at the Robert C. Byrd Green Bank Telescope. HC7N is seen primarily towards cold filamentary structures that have yet to form stars, largely avoiding the dense gas associated with small protostellar groups and the main central cluster of Serpens South. Where detected, the HC7N abundances are similar to those found in other nearby star-forming regions. Towards some HC7N `clumps', we find consistent variations in the line centroids relative to NH3 (1,1) emission, as well as systematic increases in the HC7N non-thermal line widths, which we argue reveal infall motions on to dense filaments within Serpens South with minimum mass accretion rates of M ˜ 2-5 M⊙ Myr-1. The relative abundance of NH3 to HC7N suggests that the HC7N is tracing gas that has been at densities n ˜ 104 cm-3 for time-scales t ≲ 1-2 × 105 yr. Since HC7N emission peaks are rarely co-located with those of either NH3 or continuum, it is likely that Serpens South is not particularly remarkable in its abundance of HC7N, but instead the serendipitous mapping of HC7N simultaneously with NH3 has allowed us to detect HC7N at low abundances in regions where it otherwise may not have been looked for. This result extends the known star-forming regions containing significant HC7N emission from typically quiescent regions, like the Taurus molecular cloud, to more complex, active environments.

  16. Distances, Kinematics, And Structure Of Nearby Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    Kounkel, Marina

    2017-08-01

    In this thesis I present an analysis of the structure and kinematics of the Orion Molecular Cloud Complex in an effort to better characterize the dynamical state of the closest region of the ongoing massive star formation and to provide a baseline for comparison of the upcoming results from the Gaia space telescope. In order to achieve this goal, I measured stellar parallax and proper motions, using very large baseline radio interferometry of non-thermally-emitting sources.. Based on these observations I measured the average distance in Orion A molecular cloud of 388±5 pc toward the Orion Nebula Cluster (ONC), 428±10 pc toward the southern portion of L1641, as well as the distance in Orion B of 388±10 pc toward NGC 2068, and roughly ˜420 pc toward NGC 2024. These are the first direct distance measurements with < 5% uncertainty to the regions within the Orion Complex outside of the ONC. Little can be said about the proper motions due to the sparcity of the sample size; however, I identified a number of binary systems and fitted their orbital motion, which allows for the direct measurement of the masses of the individual components. I also identified three stars that have been ejected from the ONC due to the gravitational interactions with its most massive stars.I complemented the parallax and proper motion measurements with the observations of radial velocities (RV) of the stars toward the Orion Complex, probing the histories of both dynamic evolution and star formation in the region. I found that in the Orion A cloud and in NGC 2024 there exists an asymmetry between the stellar RVs and those of the molecular gas, with a small fraction of the stars stars being preferentially blueshifted relative to the gas. Several possible explanations for this have been proposed, although presently there is not yet a definitive solution. I also analyzed the multiplicity fraction of the spectroscopic binaries in the ONC, and found that it is largely consistent to what is

  17. The Physics of Molecular Shocks in Star-Forming Regions

    NASA Technical Reports Server (NTRS)

    Hollenbach, David; Cuzzi, Jeffrey (Technical Monitor)

    1996-01-01

    Molecular shocks are produced by the impact of the supersonic infall of gas and dust onto protostars and by the interaction of the supersonic outflow from the protostar with the circumstellar material. Infalling gas creates an accretion shock around the circumstellar disk which emits a unique infrared spectrum and which processes the interstellar dust as it enters the disk. The winds and jets from protostars also impact the disk, the infalling material, and the ambient molecular cloud core creating shocks whose spectrum and morphology diagnose the mass loss processes of the protostar and the orientation and structure of the star forming system. We discuss the physics of these shocks, the model spectra derived from theoretical models, and comparisons with observations of H2O masers, H2 emission, as well as other shocks tracers. We show the strong effect of magnetic fields on molecular shock structure, and elucidate the chemical changes induced by the shock heating and compression.

  18. Pu-238 fuel form activities, January 1-31, 1982

    SciTech Connect

    Not Available

    1982-03-01

    This monthly report for /sup 238/Pu fuel form activities has two main sections: SRP-PuFF facility and SRL fuel form activities. The program status, budget information, and milestone schedules are discussed in each main section. The Work Breakdown Structure (WBS) for this program is shown. Only one monthly report per year is processed for EDB.

  19. Software Displays Data on Active Regions of the Sun

    NASA Technical Reports Server (NTRS)

    Golightly, Mike; Weyland, Mark; Raben, Vern

    2011-01-01

    The Solar Active Region Display System is a computer program that generates, in near real time, a graphical display of parameters indicative of the spatial and temporal variations of activity on the Sun. These parameters include histories and distributions of solar flares, active region growth, coronal mass ejections, size, and magnetic configuration. By presenting solar-activity data in graphical form, this program accelerates, facilitates, and partly automates what had previously been a time-consuming mental process of interpretation of solar-activity data presented in tabular and textual formats. Intended for original use in predicting space weather in order to minimize the exposure of astronauts to ionizing radiation, the program might also be useful on Earth for predicting solar-wind-induced ionospheric effects, electric currents, and potentials that could affect radio-communication systems, navigation systems, pipelines, and long electric-power lines. Raw data for the display are obtained automatically from the Space Environment Center (SEC) of the National Oceanic and Atmospheric Administration (NOAA). Other data must be obtained from the NOAA SEC by verbal communication and entered manually. The Solar Active Region Display System automatically accounts for the latitude dependence of the rate of rotation of the Sun, by use of a mathematical model that is corrected with NOAA SEC active-region position data once every 24 hours. The display includes the date, time, and an image of the Sun in H light overlaid with latitude and longitude coordinate lines, dots that mark locations of active regions identified by NOAA, identifying numbers assigned by NOAA to such regions, and solar-region visual summary (SRVS) indicators associated with some of the active regions. Each SRVS indicator is a small pie chart containing five equal sectors, each of which is color-coded to provide a semiquantitative indication of the degree of hazard posed by one aspect of the activity at

  20. Infall and Outflow Motions towards a Sample of Massive Star Forming Regions from the RMS Survey

    NASA Astrophysics Data System (ADS)

    Cunningham, N.; Lumsden, S. L.; Moore, T. J. T.; Maud, L. T.; Mendigutía, I.

    2018-03-01

    We present the results of an outflow and infall survey towards a distance limited sample of 31 massive star forming regions drawn from the RMS survey. The presence of young, active outflows is identified from SiO (8-7) emission and the infall dynamics are explored using HCO+/H13CO+ (4-3) emission. We investigate if the infall and outflow parameters vary with source properties, exploring whether regions hosting potentially young active outflows show similarities or differences with regions harbouring more evolved, possibly momentum driven, "fossil" outflows. SiO emission is detected towards approximately 46% of the sources. When considering sources with and without an SiO detection (i.e. potentially active and fossil outflows respectively), only the 12CO outflow velocity shows a significant difference between samples, indicating SiO is more prevalent towards sources with higher outflow velocities. Furthermore, we find the SiO luminosity increases as a function of the Herschel 70 μm to WISE 22μm flux ratio, suggesting the production of SiO is prevalent in younger, more embedded regions. Similarly, we find tentative evidence that sources with an SiO detection have a smaller bolometric luminosity-to-mass ratio, indicating SiO (8-7) emission is associated with potentially younger regions. We do not find a prevalence towards sources displaying signatures of infall in our sample. However, the higher energy HCO+ transitions may not be the best suited tracer of infall at this spatial resolution in these regions.

  1. Complex Network for Solar Active Regions

    NASA Astrophysics Data System (ADS)

    Daei, Farhad; Safari, Hossein; Dadashi, Neda

    2017-08-01

    In this paper we developed a complex network of solar active regions (ARs) to study various local and global properties of the network. The values of the Hurst exponent (0.8-0.9) were evaluated by both the detrended fluctuation analysis and the rescaled range analysis applied on the time series of the AR numbers. The findings suggest that ARs can be considered as a system of self-organized criticality (SOC). We constructed a growing network based on locations, occurrence times, and the lifetimes of 4227 ARs recorded from 1999 January 1 to 2017 April 14. The behavior of the clustering coefficient shows that the AR network is not a random network. The logarithmic behavior of the length scale has the characteristics of a so-called small-world network. It is found that the probability distribution of the node degrees for undirected networks follows the power law with exponents of about 3.7-4.2. This indicates the scale-free nature of the AR network. The scale-free and small-world properties of the AR network confirm that the system of ARs forms a system of SOC. Our results show that the occurrence probability of flares (classified by GOES class C> 5, M, and X flares) in the position of the AR network hubs takes values greater than that obtained for other nodes.

  2. Tribal Minor NSR Synthetic Minor Limit Application Form in EPA's South Central Region

    EPA Pesticide Factsheets

    This Tribal Minor NSR application form should be used to notify the EPA Region 6 Tribal NSR Permitting Program of requested synthetic minor emission limits associated with a new source general application form.

  3. Regional Intestinal Permeability in Dogs: Biopharmaceutical Aspects for Development of Oral Modified-Release Dosage Forms.

    PubMed

    Dahlgren, David; Roos, Carl; Johansson, Pernilla; Lundqvist, Anders; Tannergren, Christer; Abrahamsson, Bertil; Sjögren, Erik; Lennernäs, Hans

    2016-09-06

    The development of oral modified-release (MR) dosage forms requires an active pharmaceutical ingredient (API) with a sufficiently high absorption rate in both the small and large intestine. Dogs are commonly used in preclinical evaluation of regional intestinal absorption and in the development of novel MR dosage forms. This study determined regional intestinal effective permeability (Peff) in dogs with the aim to improve regional Peff prediction in humans. Four model drugs, atenolol, enalaprilat, metoprolol, and ketoprofen, were intravenously and regionally dosed twice as a solution into the proximal small intestine (P-SI) and large intestine (LI) of three dogs with intestinal stomas. Based on plasma data from two separate study occasions for each dog, regional Peff values were calculated using a validated intestinal deconvolution method. The determined mean Peff values were 0.62, 0.14, 1.06, and 3.66 × 10(-4) cm/s in the P-SI, and 0.13, 0.02, 1.03, and 2.20 × 10(-4) cm/s in the LI, for atenolol, enalaprilat, metoprolol, and ketoprofen, respectively. The determined P-SI Peff values in dog were highly correlated (R(2) = 0.98) to the historically directly determined human jejunal Peff after a single-pass perfusion. The determined dog P-SI Peff values were also successfully implemented in GI-Sim to predict the risk for overestimation of LI absorption of low permeability drugs. We conclude that the dog intestinal stoma model is a useful preclinical tool for determination of regional intestinal permeability. Still, further studies are recommended to evaluate additional APIs, sources of variability, and formulation types, for more accurate determination of the dog model in the drug development process.

  4. Energy Flow Continuity in Solar Active Regions

    NASA Technical Reports Server (NTRS)

    Schatten, K. H.

    1984-01-01

    The models for sunspots are combined into an active region model with consideration for the energy flow beneath active regions. An apparent average energy balance exists between the sunspot deficit and the facular excess, i.e., no 11 year variations in solar luminosity associated with the activity centers. This is seen as a consequence of the upper convection zone's inability to store these significant amounts of energy for periods greatly in excess of weeks. This view is supported by observed active region behavior and detailed numerical modelling. Increases in facular and spot brightness are nearly commensurate, with the faculae outlasting the spots on time scales of the order of weeks to a couple of months. Foukal finds the radiation (deficit from a sunspot blocking model) recovers slowly on a timescale of approximately 83 days.

  5. Perceptual knowledge retrieval activates sensory brain regions.

    PubMed

    Goldberg, Robert F; Perfetti, Charles A; Schneider, Walter

    2006-05-03

    Although knowledge indexes our experiences of the world, the neural basis of this relationship remains to be determined. Previous neuroimaging research, especially involving knowledge biased to visual and functional information, suggests that semantic representations depend on modality-specific brain mechanisms. However, it is unclear whether sensory cortical regions, in general, support retrieval of perceptual knowledge. Using neuroimaging methods, we show that semantic decisions that index tactile, gustatory, auditory, and visual knowledge specifically activate brain regions associated with encoding these sensory experiences. Retrieval of tactile knowledge was specifically associated with increased activation in somatosensory, motor, and premotor cortical regions. In contrast, decisions involving flavor knowledge increased activation in an orbitofrontal region previously implicated in processing semantic comparisons among edible items. Perceptual knowledge retrieval that references visual and auditory experiences was associated with increased activity in distinct temporal brain regions involved in the respective sensory processing. These results indicate that retrieval of perceptual knowledge relies on brain regions used to mediate sensory experiences with the referenced objects.

  6. The Magnetic Free Energy in Active Regions

    NASA Technical Reports Server (NTRS)

    Metcalf, Thomas R.; Mickey, Donald L.; LaBonte, Barry J.

    2001-01-01

    The magnetic field permeating the solar atmosphere governs much of the structure, morphology, brightness, and dynamics observed on the Sun. The magnetic field, especially in active regions, is thought to provide the power for energetic events in the solar corona, such as solar flares and Coronal Mass Ejections (CME) and is believed to energize the hot coronal plasma seen in extreme ultraviolet or X-rays. The question remains what specific aspect of the magnetic flux governs the observed variability. To directly understand the role of the magnetic field in energizing the solar corona, it is necessary to measure the free magnetic energy available in active regions. The grant now expiring has demonstrated a new and valuable technique for observing the magnetic free energy in active regions as a function of time.

  7. Quantifying the Complexity of Flaring Active Regions

    NASA Astrophysics Data System (ADS)

    Stark, B.; Hagyard, M. J.

    1997-05-01

    While solar physicists have a better understanding of the importance magnetic fields play in the solar heating mechanism, it is still not possible to predict whether or when an active region will flare. In recent decades, qualitative studies of the changes in active region morphology have shown that there is generally an increase in the complexity of the spatial configuration of a solar active region leading up to a flare event. In this study, we quantify the spatial structure of the region using the Differential Box-Counting Method (DBC)of fractal analysis. We analyze data from NASA/Marshall Space Flight Center's vector magnetograph from two flaring active regions: AR 6089 from June 10, 1990, which produced one M1.7 flare, and AR 6659 from June 8, 9 and 10, 1991, this data set including one C5.7 and two M(6.4 and 3.2) flares. (AR 6659 produced several other flares). Several magnetic parameters are studied, including the transverse and longitudinal magnetic field components (Bt and Bl), the total field (Bmag), and the magnetic shear, which describes the non-potentiality of the field. Results are presented for the time series of magnetograms in relation to the timing of flare events.

  8. Active Region Coming Around the Bend

    NASA Image and Video Library

    2018-04-23

    A good-sized active region with bright, towering arches began to rotate into view (Apr. 18-19, 2018). The arches consist of charged particles spiraling along magnetic field lines revealed in this wavelength of extreme ultraviolet light. They rise up above the sun's surface many times the size of Earth. The video covers just 16 hours of activity. We will keep our eyes on this region to see if it has the kind of dynamism to produce solar storms. Videos are available at https://photojournal.jpl.nasa.gov/catalog/PIA22430

  9. Chemical shift assignments for the apo-form of the catalytic domain, the linker region, and the carbohydrate-binding domain of the cellulose-active lytic polysaccharide monooxygenase ScLPMO10C.

    PubMed

    Courtade, Gaston; Forsberg, Zarah; Vaaje-Kolstad, Gustav; Eijsink, Vincent G H; Aachmann, Finn L

    2017-10-01

    The apo-form of the 21.4 kDa catalytic domain and the 10.7 kDa carbohydrate binding domain of the AA10 family lytic polysaccharide monooxygenase ScLPMO10C from Streptomyces coelicolor have been isotopically labeled and recombinantly expressed in Escherichia coli. In this paper, we report the 1 H, 13 C, and 15 N chemical shift assignments of each individual domain as well as an ensemble of the assignment for the full-length protein, including its approximately 30-amino acid long linker.

  10. 76 FR 41763 - Proposed Information Collection; Comment Request; Alaska Region Logbook Family of Forms

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-15

    ... Collection; Comment Request; Alaska Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric... (NMFS) Alaska Region manages the United States (U.S.) groundfish fisheries of the Exclusive Economic.... NMFS Alaska Region requests information from participating groundfish participants. This information...

  11. 76 FR 17839 - Proposed Information Collection; Comment Request; Northeast Region Permit Family of Forms

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-31

    ... Collection; Comment Request; Northeast Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric... Region manages the United States (U.S.) fisheries of the exclusive economic zone (EEZ) off the South Atlantic, Caribbean, and Gulf of Mexico under the Fishery Management Plans (FMP) for each Region. The...

  12. Local Helioseismology of Emerging Active Regions: A Case Study

    NASA Astrophysics Data System (ADS)

    Kosovichev, Alexander G.; Zhao, Junwei; Ilonidis, Stathis

    2018-04-01

    Local helioseismology provides a unique opportunity to investigate the subsurface structure and dynamics of active regions and their effect on the large-scale flows and global circulation of the Sun. We use measurements of plasma flows in the upper convection zone, provided by the Time-Distance Helioseismology Pipeline developed for analysis of solar oscillation data obtained by Helioseismic and Magnetic Imager (HMI) on Solar Dynamics Observatory (SDO), to investigate the subsurface dynamics of emerging active region NOAA 11726. The active region emergence was detected in deep layers of the convection zone about 12 hours before the first bipolar magnetic structure appeared on the surface, and 2 days before the emergence of most of the magnetic flux. The speed of emergence determined by tracking the flow divergence with depth is about 1.4 km/s, very close to the emergence speed in the deep layers. As the emerging magnetic flux becomes concentrated in sunspots local converging flows are observed beneath the forming sunspots. These flows are most prominent in the depth range 1-3 Mm, and remain converging after the formation process is completed. On the larger scale converging flows around active region appear as a diversion of the zonal shearing flows towards the active region, accompanied by formation of a large-scale vortex structure. This process occurs when a substantial amount of the magnetic flux emerged on the surface, and the converging flow pattern remains stable during the following evolution of the active region. The Carrington synoptic flow maps show that the large-scale subsurface inflows are typical for active regions. In the deeper layers (10-13 Mm) the flows become diverging, and surprisingly strong beneath some active regions. In addition, the synoptic maps reveal a complex evolving pattern of large-scale flows on the scale much larger than supergranulation

  13. Thoughts on the development of active regional public health systems.

    PubMed

    Reis, Ademar Arthur Chioro Dos; Sóter, Ana Paula Menezes; Furtado, Lumena Almeida Castro; Pereira, Silvana Souza da Silva

    2017-04-01

    Decentralization and regionalization are strategic themes for reforms in the health system. This paper analyzes the complex process of health regionalization being developed in Brazil. This paper identifies that the normative framework from the Brazilian National Health System, SUS has made advances with respect to its institutionalization and overcoming the initial centrality involved in municipalization. This has strengthened the development of regionalization and the intergovernmental agreement on health but the evidence points to the need to promote a revision. Based on document analysis, literature review and the views given by the authors involved in management in SUS as well as generating radically different views, the challenges for the construction of a regionalization that is active, is debated. We also discuss: its relations with planning and the dimensioning of service networks, the production of active care networks and shared management spaces, the inter-federative agreements and regional regulations, the capacity to coordinate regional systems and financing and the impact of the political dimension and electoral cycles. Regionalization (and SUS itself) is an open book, therefore ways and possibilities on how to maintain an active form of regionalization can be recommended.

  14. Form-Focused Discovery Activities in English Classes

    ERIC Educational Resources Information Center

    Ogeyik, Muhlise Cosgun

    2011-01-01

    Form-focused discovery activities allow language learners to grasp various aspects of a target language by contributing implicit knowledge by using discovered explicit knowledge. Moreover, such activities can assist learners to perceive and discover the features of their language input. In foreign language teaching environments, they can be used…

  15. Activated carbon fibers and engineered forms from renewable resources

    DOEpatents

    Baker, Frederick S.

    2010-06-01

    A method of producing activated carbon fibers (ACFs) includes the steps of providing a natural carbonaceous precursor fiber material, blending the carbonaceous precursor material with a chemical activation agent to form chemical agent-impregnated precursor fibers, spinning the chemical agent-impregnated precursor material into fibers, and thermally treating the chemical agent-impregnated precursor fibers. The carbonaceous precursor material is both carbonized and activated to form ACFs in a single step. The method produces ACFs exclusive of a step to isolate an intermediate carbon fiber.

  16. Activated carbon fibers and engineered forms from renewable resources

    DOEpatents

    Baker, Frederick S

    2013-02-19

    A method of producing activated carbon fibers (ACFs) includes the steps of providing a natural carbonaceous precursor fiber material, blending the carbonaceous precursor material with a chemical activation agent to form chemical agent-impregnated precursor fibers, spinning the chemical agent-impregnated precursor material into fibers, and thermally treating the chemical agent-impregnated precursor fibers. The carbonaceous precursor material is both carbonized and activated to form ACFs in a single step. The method produces ACFs exclusive of a step to isolate an intermediate carbon fiber.

  17. Supergranule Diffusion and Active Region Decay

    NASA Technical Reports Server (NTRS)

    Hathaway, David H.; Choudhary, Debi Prasad

    2004-01-01

    Models of the Sun's magnetic dynamo include turbulent diffusion to parameterize the effects of convective motions on the evolution of the Sun's magnetic field. Supergranules are known to dominate the evolution of the surface magnetic field structure as evidenced by the structure of both the active and quiet magnetic network. However, estimates for the dif hivity attributed to su perymules differ by an order of magnitude from about 100 km sup2/s to more than 1000 km sup2/s. We examine this question of the e i v i t y using three merent approaches. 1) We study the decay of more than 30,000 active regions by determining the rate of change in the sunspot area of each active region from day-to-day. 2) We study the decay of a single isolated active region near the time of solar minimum by examining the magnetic field evolution over five solar rotations fiom SOHOMDI magnetograms obtained at 96-minute intervals. 3) We study the characteristics of supergranules that influence the estimates of their diffusive properties - flow speeds and lifetimes as functions of size - fiom SOHO/MDI Dopplergrams.

  18. 77 FR 47370 - Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-08

    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Northeast Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA). ACTION: Notice. SUMMARY: The Department of Commerce, as part of its...

  19. 78 FR 19649 - Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-02

    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Southwest Region Permit Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA), Commerce. ACTION: Notice. SUMMARY: The Department of Commerce, as part of its continuing...

  20. 78 FR 10600 - Proposed Information Collection; Comment Request; Southeast Region Logbook Family of Forms

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-14

    ... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration Proposed Information Collection; Comment Request; Southeast Region Logbook Family of Forms AGENCY: National Oceanic and Atmospheric Administration (NOAA). ACTION: Notice. SUMMARY: The Department of Commerce, as part of its...

  1. The Role of Grain Surface Reactions in the Chemistry of Star Forming Regions

    NASA Technical Reports Server (NTRS)

    Kress, M. E.; Tielens, A. G. G. M.; Roberge, W. G.

    1998-01-01

    The importance of reactions at the surfaces of dust grains has long been recognized to be one of the two main chemical processes that form molecules in cold, dark interstellar clouds where simple, saturated (fully-hydrogenated) molecules such as H2 water, methanol, H2CO, H2S, ammonia and CH4 are present in quantities far too high to be consistent with their extremely low gas phase formation rates. In cold dark regions of interstellar space, dust grains provide a substrate onto which gas-phase species can accrete and react. Grains provide a "third body" or a sink for the energy released in the exothermic reactions that form chemical bonds. In essence, the surfaces of dust grains open up alternative reaction pathways to form observed molecules whose abundances cannot be explained with gas-phase chemistry alone. This concept is taken one step further in this work: instead of merely acting as a substrate onto which radicals and molecules may physically adsorb, some grains may actively participate in the reaction itself, forming chemical bonds with the accreting species. Until recently, surface chemical reactions had not been thought to be important in warm circumstellar media because adspecies rapidly desorb from grains at very low temperatures; thus, the residence times of molecules and radicals on the surface of grains at all but the lowest temperatures are far too short to allow these reactions to occur. However, if the adspecies could adsorb more strongly, via a true chemical bond with surfaces of some dust grains, then grain surface reactions will play an important role in warm circumstellar regions as well. In this work, the surface-catalyzed reaction CO + 3 H2 yields CH4 + H2O is studied in the context that it may be very effective at converting the inorganic molecule CO into the simplest organic compound, methane. H2 and CO are the most abundant molecules in space, and the reaction converting them to methane, while kinetically inhibited in the gas phase under

  2. Proper Motion Of Emerging Active Regions

    NASA Astrophysics Data System (ADS)

    Tian, Lirong

    2009-05-01

    Observational and modeling results indicate that typically the leading magnetic field of bipolar active regions is often spatially more compact, while more dispersed and fragmented in following polarity. Tian & Alexander (2009, ApJ, 695) studied 15 emerging active regions and find that magnetic helicity flux injected into the corona by the leading polarity is generally several times larger than that injected by the following polarity. They argue that the asymmetry of the magnetic helicity should be responsible for the asymmetry of the magnetic morphology. This argument is supported by two resent model results that magnetic flux tubes with higher degree of twist (and therefor greater magnetic tension) have higher rates of emergence (Murray & Hood 2008, A&A, 479; Cheung et al. 2008, ApJ, 687). These results are consistent because the proper motion (related to the emergence) of the leading polarity was found to be faster than that of the following polarity (van Driel-Gesztelyi & Petrovay 1990, Solar Phys., 126). In this paper, we will reinvestigate the proper motion of leading and following polarities of the emerging active regions, and study possible relationship between the proper motion and magnetic helicity.

  3. 76 FR 22675 - Proposed Information Collection; Comment Request; Pacific Islands Region Permit Family of Forms

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-22

    ... limited entry permit, 45 min.; Main Hawaiian Islands longline prohibited area exemptions, 2 hours; all... Collection; Comment Request; Pacific Islands Region Permit Family of Forms AGENCY: National Oceanic and... Marine Fisheries Service (NMFS) Pacific Islands Region (PIR) manages the U.S. Fisheries of the Exclusive...

  4. DOPPLER SHIFTS IN ACTIVE REGION MOSS USING SOHO/SUMER

    SciTech Connect

    Winebarger, Amy; Tripathi, Durgesh; Mason, Helen E.

    2013-04-20

    The velocity of the plasma at the footpoint of hot loops in active region cores can be used to discriminate between different heating frequencies. Velocities on the order of a few kilometers per second would indicate low-frequency heating on sub-resolution strands, while velocities close to zero would indicate high-frequency (steady) heating. To discriminate between these two values requires accurate velocity measurements; previous velocity measurements suffer from large uncertainties, mainly due to the lack of an absolute wavelength reference scale. In this paper, we determine the velocity in the loop footpoints using observations from Solar Ultraviolet Measurements of Emitted Radiation (SUMER)more » on Solar and Heliospheric Observatory. We use neutral spectral lines to determine the wavelength scale of the observations with an uncertainty in the absolute velocity of <3.5 km s{sup -1} and co-aligned Transition Region and Coronal Explorer (TRACE) images to identify footpoint regions. We studied three different active regions and found average redshifts in the Ne VIII 770 A emission line (formed at 6 Multiplication-Sign 10{sup 5} K) of 5.17 {+-} 5.37 km s{sup -1} and average redshifts in the C IV 1548 and 1550 A emission lines (formed at 1 Multiplication-Sign 10{sup 5} K) of 13.94 {+-} 4.93 km s{sup -1} and 14.91 {+-} 6.09 km s{sup -1}, respectively. We find no correlation between the brightness in the spectral line and the measured velocity, nor do we find correlation between the Ne VIII and C IV velocities measured co-spatially and co-temporally. SUMER scanned two of the active regions twice; in those active regions we find positive correlation between the co-spatial velocities measured during the first and second scans. These results provide definitive and quantitative measurements for comparisons with simulations of different coronal heating mechanisms.« less

  5. An X-shooter survey of star forming regions: Low-mass stars and sub-stellar objects

    NASA Astrophysics Data System (ADS)

    Alcalá, J. M.; Stelzer, B.; Covino, E.; Cupani, G.; Natta, A.; Randich, S.; Rigliaco, E.; Spezzi, L.; Testi, L.; Bacciotti, F.; Bonito, R.; Covino, S.; Flaccomio, E.; Frasca, A.; Gandolfi, D.; Leone, F.; Micela, G.; Nisini, B.; Whelan, E.

    2011-03-01

    We present preliminary results of our X-shooter survey in star forming regions. In this contribution we focus on sub-samples of young stellar and sub-stellar objects (YSOs) in the Lupus star forming region and in the TW Hya association. We show that the X-shooter spectra are suitable for conducting several parallel studies such as YSO + disk fundamental parameters, accretion and outflow activity in the very low-mass (VLM) and sub-stellar regimes, as well as magnetic activity in young VLM YSOs, and Li abundance determinations. The capabilities of X-shooter in terms of wide spectral coverage, resolution and limiting magnitudes, allow us to assess simultaneously the accretion/outflow, magnetic activity, and disk diagnostics, from the UV and optical to the near-IR, avoiding ambiguities due to possible YSO variability. Based on observations collected at the European Southern Observatory, Chile, under Programmes 084.C-0269 and 085.C-0238.

  6. The Lifetimes of Phases in High-mass Star-forming Regions

    NASA Astrophysics Data System (ADS)

    Battersby, Cara; Bally, John; Svoboda, Brian

    2017-02-01

    High-mass stars form within star clusters from dense, molecular regions (DMRs), but is the process of cluster formation slow and hydrostatic or quick and dynamic? We link the physical properties of high-mass star-forming regions with their evolutionary stage in a systematic way, using Herschel and Spitzer data. In order to produce a robust estimate of the relative lifetimes of these regions, we compare the fraction of DMRs above a column density associated with high-mass star formation, N(H2) > 0.4-2.5 × 1022 cm-2, in the “starless” (no signature of stars ≳10 {M}⊙ forming) and star-forming phases in a 2° × 2° region of the Galactic Plane centered at ℓ = 30°. Of regions capable of forming high-mass stars on ˜1 pc scales, the starless (or embedded beyond detection) phase occupies about 60%-70% of the DMR lifetime, and the star-forming phase occupies about 30%-40%. These relative lifetimes are robust over a wide range of thresholds. We outline a method by which relative lifetimes can be anchored to absolute lifetimes from large-scale surveys of methanol masers and UCHII regions. A simplistic application of this method estimates the absolute lifetime of the starless phase to be 0.2-1.7 Myr (about 0.6-4.1 fiducial cloud free-fall times) and the star-forming phase to be 0.1-0.7 Myr (about 0.4-2.4 free-fall times), but these are highly uncertain. This work uniquely investigates the star-forming nature of high column density gas pixel by pixel, and our results demonstrate that the majority of high column density gas is in a starless or embedded phase.

  7. Functional Specificity of the Visual Word Form Area: General Activation for Words and Symbols but Specific Network Activation for Words

    ERIC Educational Resources Information Center

    Reinke, Karen; Fernandes, Myra; Schwindt, Graeme; O'Craven, Kathleen; Grady, Cheryl L.

    2008-01-01

    The functional specificity of the brain region known as the Visual Word Form Area (VWFA) was examined using fMRI. We explored whether this area serves a general role in processing symbolic stimuli, rather than being selective for the processing of words. Brain activity was measured during a visual 1-back task to English words, meaningful symbols…

  8. Exoplanet Transits of Stellar Active Regions

    NASA Astrophysics Data System (ADS)

    Giampapa, Mark S.; Andretta, Vincenzo; Covino, Elvira; Reiners, Ansgar; Esposito, Massimiliano

    2018-01-01

    We report preliminary results of a program to obtain high spectral- and temporal-resolution observations of the neutral helium triplet line at 1083.0 nm in transiting exoplanet systems. The principal objective of our program is to gain insight on the properties of active regions, analogous to solar plages, on late-type dwarfs by essentially using exoplanet transits as high spatial resolution probes of the stellar surface within the transit chord. The 1083 nm helium line is a particularly appropriate diagnostic of magnetized areas since it is weak in the quiet photosphere of solar-type stars but appears strongly in absorption in active regions. Therefore, during an exoplanet transit over the stellar surface, variations in its absorption equivalent width can arise that are functions of the intrinsic strength of the feature in the active region and the known relative size of the exoplanet. We utilized the Galileo Telescope and the GIANO-B near-IR echelle spectrograph to obtain 1083 nm spectra during transits in bright, well-known systems that include HD 189733, HD 209458, and HD 147506 (HAT-P-2). We also obtained simultaneous auxiliary data on the same telescope with the HARPS-N UV-Visible echelle spectrograph. We will present preliminary results from our analysis of the observed variability of the strength of the He I 1083 nm line during transits.Acknowledgements: Based on observations made with the Italian Telescopio Nazionale Galileo (TNG) operated on the island of La Palma by the Fundación Galileo Galilei of the INAF (Istituto Nazionale di Astrofisica) at the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofisica de Canarias. The NSO is operated by AURA under a cooperative agreement with the NSF.

  9. HEROES Observations of a Quiescent Active Region

    NASA Astrophysics Data System (ADS)

    Shih, A. Y.; Christe, S.; Gaskin, J.; Wilson-Hodge, C.

    2014-12-01

    Hard X-ray (HXR) observations of solar flares reveal the signatures of energetic electrons, and HXR images with high dynamic range and high sensitivity can distinguish between where electrons are accelerated and where they stop. Even in the non-flaring corona, high-sensitivity HXR measurements may be able to detect the presence of electron acceleration. The High Energy Replicated Optics to Explore the Sun (HEROES) balloon mission added the capability of solar observations to an existing astrophysics balloon payload, HERO, which used grazing-incidence optics for direct HXR imaging. HEROES measures HXR emission from ~20 to ~75 keV with an angular resolution of 33" HPD. HEROES launched on 2013 September 21 from Fort Sumner, New Mexico, and had a successful one-day flight. We present the detailed analysis of the 7-hour observation of AR 11850, which sets new upper limits on the HXR emission from a quiescent active region, with corresponding constraints on the numbers of tens of keV energetic electrons present. Using the imaging capability of HEROES, HXR upper limits are also obtained for the quiet Sun surrounding the active region. We also discuss what can be achieved with new and improved HXR instrumentation on balloons.

  10. Two oligomeric forms of plasma ficolin have differential lectin activity.

    PubMed

    Ohashi, T; Erickson, H P

    1997-05-30

    Ficolins are plasma proteins with binding activity for carbohydrates, elastin, and corticosteroids. The ficolin polypeptide has a collagen-like domain that presumably brings three subunits together in a triple helical rod, a C-terminal fibrinogen-like domain (fbg) similar to that of tenascin, which presumably has the binding activities, and a small N-terminal domain that we find to be the primary site for forming the ficolin oligomer. By sedimentation equilibrium we determined that the main plasma form, which we call big ficolin, had mass of 827,000 Da, consistent with 24 subunits. Little ficolin, about half this size, was obtained after binding to a GlcNAc affinity column. Electron microscopy of little ficolin showed a parachute-like structure, with a small globe at one end, corresponding to the 12 N-terminal domains, and the fbg domains clustered together at the ends of the collagen rods. Big ficolin was formed by the face to face fusion of the fbg domains of two little ficolins, leaving the rods and N-terminal domains projecting at opposite ends. Little ficolin maintained a high affinity for the GlcNAc column, and big ficolin had a low affinity or none. The binding sites for ligands may be obscured in this big ficolin oligomer, providing a regulation of their activity.

  11. 76 FR 31972 - Agency Information Collection Activities: Form I-508 and Form I-508F, Extension of a Currently...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-02

    ... Collection Activities: Form I-508 and Form I- 508F, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Forms I- 508 and I-508F..., USCIS will be evaluating whether to revise the Forms I-508 and I-508F. Should USCIS decide to revise...

  12. 76 FR 30738 - Agency Information Collection Activities: Form G-845 and Form G-845 Supplement, Revision of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-26

    ... Collection Activities: Form G-845 and Form G- 845 Supplement, Revision of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection under Review: Form G- 845 and Form G-845 Supplement, Document Verification Request and Document Verification Request Supplement; OMB...

  13. [Surface active agents in drug forms and biological systems].

    PubMed

    Eros, István

    2005-01-01

    The application areas of surface active agents in the pharmaceutical technology are surveyed. Three topics are summarized: (i) application of surfactant as traditional additives, (ii) the role of surfactant in modern drug delivery systems, and (iii) biopharmaceutical use of surfactants in different dosage forms. The team dealing with colloid carriers at the Pharmaceutical-Technological Department in Szeged has worked out several relationships in mathematical form. These relationships establish the formulation and give an exact character to it. Exponential functions were found between contact angle of wetting and the consistency parameters of water free coherent ointment-systems. There is an exponential relationship between contact angle and structure solidification of ointments measured during storage, between contact angle and structure-forming constant of coherent emulsions, and between contact angle and activation energy of thermostability. There is a linear relation between the contact angle of wetting and water uptake ability of absorbing ointments. On the investigation of emulsions a relationship was evaluated between the surfactant amount accumulated of the interface of oil and water phase and the viscosity and stability of emulsions. The amount of surfactant accumulated on the interface can determine the formation of multiple emulsions. On the area of solubilization there is a reciprocal relationship between the surface tension of surfactant solution and the solubilized amount of drugs. On the area of drug liberation a relationship characterized with a maximum curve can be described between the concentration of surfactant and the released drug. These functions can help the formulation of compositions having a suitable bioavailability.

  14. Solar cell with improved N-region contact and method of forming the same

    NASA Technical Reports Server (NTRS)

    Bube, K. R. (Inventor)

    1979-01-01

    An improved solar cell, and method of forming the same are disclosed. It is characterized by a semiconductor silicon wafer of P-type material having diffused therein a shallow N-type region. A sintered silver contact is affixed to the surface of the N-type region at the outer surface. The improved solar cell is formulated from silver powder blended with silver metaphosphate for establishing a zone of increased carrier concentration. An aluminum or silver-aluminum alloy contact is affixed to the P-type wafer at the outer surface opposite the N-type region.

  15. New results on the massive star-forming region S106 by BEAR spectro-imagery

    NASA Astrophysics Data System (ADS)

    Noel, B.; Joblin, C.; Maillard, J. P.; Paumard, T.

    2005-06-01

    source, not directed along the axis of the H II region. Emission lines of He I and [Fe III] are detected in a bright area to the southwest of S106 IR, with point-like structures suggesting photoevaporating clumps. From the velocity data, a 3-D model of the environment of S106 IR is proposed. S106 is an example of an evolved H II region seen face-on. The central source located at the edge of its parent molecular cloud has carved an expanding cylinder of turbulent, atomic gas of ≃0.1 pc in radius. This massive object was formed by an accretion disk process. The disk is still present and the bipolar outflows are remnants of the massive star activity. A time scale of 1400 yr is estimated for the most recent event. A thin and quiescent clumpy layer of warm H2 marks the transition of the H II region to the molecular cloud. From the data, there are locally no signs of ongoing star formation.

  16. Weak and Compact Radio Emission in Early High-Mass Star Forming Regions

    NASA Astrophysics Data System (ADS)

    Rosero Rueda, Viviana Andrea

    2017-04-01

    I present a high sensitivity radio continuum survey at 6 and 1.3 cm using the Karl. G. Jansky Very Large Array towards a sample of 58 high-mass star forming regions. The sample was chosen from clumps within infrared dark clouds, also known as cold molecular clumps (CMCs) with and without IR sources (CMC-IRs, CMCs, respectively) and hot molecular cores (HMCs), with no previous radio continuum detection at the 1 mJy level. Due to the remarkable improvement in the continuum sensitivity of the VLA, this survey achieved map rms levels of 3-10 ?Jy/beam at sub-arcsecond angular resolution. From this dataset I extracted 70 centimeter continuum sources that are associated with 1.2 mm dust clumps. Most sources are weak, compact, and are prime candidates for high-mass protostars. Detection rates of radio sources associated with the mm dust clumps for CMCs, CMC-IRs and HMCs are 6%, 53% and 100%, respectively. This result is consistent with increasing high-mass star formation activity from CMCs to HMCs. I calculated 5-25 GHz spectral indices using power law fits and obtain a median value of 0.5 (i.e., flux increasing with frequency), which is consistent with thermal emission from ionized jets. Moreover, these detected ionized jets towards high-mass stars are well correlated with jets formed towards lower masses, providing further evidence that ionized jets from any luminosity have a common origin. Ultimately, this set of detections will likely provide good candidates to enable new tests of high-mass star formation theories, in particular testing predictions of core accretion and competitive accretion models.

  17. Chemical modelling of complex organic molecules with peptide-like bonds in star-forming regions

    NASA Astrophysics Data System (ADS)

    Quénard, David; Jiménez-Serra, Izaskun; Viti, Serena; Holdship, Jonathan; Coutens, Audrey

    2018-02-01

    Peptide bonds (N-C = O) play a key role in metabolic processes since they link amino acids into peptide chains or proteins. Recently, several molecules containing peptide-like bonds have been detected across multiple environments in the interstellar medium, growing the need to fully understand their chemistry and their role in forming larger pre-biotic molecules. We present a comprehensive study of the chemistry of three molecules containing peptide-like bonds: HNCO, NH2CHO, and CH3NCO. We also included other CHNO isomers (HCNO, HOCN) and C2H3NO isomers (CH3OCN, CH3CNO) to the study. We have used the UCLCHEM gas-grain chemical code and included in our chemical network all possible formation/destruction pathways of these peptide-like molecules recently investigated either by theoretical calculations or in laboratory experiments. Our predictions are compared to observations obtained towards the proto-star IRAS 16293-2422 and the L1544 pre-stellar core. Our results show that some key reactions involving the CHNO and C2H3NO isomers need to be modified to match the observations. Consistently with recent laboratory findings, hydrogenation is unlikely to produce NH2CHO on grain surfaces, while a combination of radical-radical surface reactions and gas-phase reactions is a better alternative. In addition, better results are obtained for NH2CHO when a slightly higher activation energy of 25 K is considered for the gas-phase reaction NH2 + H2CO → NH2CHO + H. Finally, our modelling shows that the observed correlation between NH2CHO and HNCO in star-forming regions may come from the fact that HNCO and NH2CHO react to temperature in the same manner rather than from a direct chemical link between the two species.

  18. Inner and outer star forming regions over the discs of spiral galaxies I. Sample characterization

    NASA Astrophysics Data System (ADS)

    Rodríguez-Baras, Marina; Díaz, A. I.; Rosales-Ortega, F. F.

    2017-03-01

    This project is aimed at understanding the dependence of star formation on the environment by analysing young stellar populations in two very different positions in disk galaxies: circumnuclear and outer disk giant regions. Integral field spectroscopy (IFS) provide an ideal means to achieve these goals providing simultaneous spatial and spectral resolution. Here we present the characterization of the work sample, composed by 671 outer regions and 725 inner regions from 263 isolated spirals galaxies observed by the CALIFA survey. The wide number of regions in both samples allows us to obtain statistically relevant results about the influence of metallicity, density and environment on star formation, and how it disseminates over the galaxy, to obtain evolutionary stories for the star-forming regions and to compare our results with models of massive star formation and galactic chemical evolution.

  19. WIDE-FIELD INFRARED SURVEY EXPLORER OBSERVATIONS OF THE EVOLUTION OF MASSIVE STAR-FORMING REGIONS

    SciTech Connect

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.

    2012-01-10

    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the 'fireworksmore » hypothesis' since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.« less

  20. Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions

    NASA Technical Reports Server (NTRS)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Assef, R. J.

    2011-01-01

    We present the results of a mid-infrared survey of 11 outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars.We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks.We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  1. Wide-Field Infrared Survey Explorer Observations of the Evolution of Massive Star-Forming Regions

    NASA Technical Reports Server (NTRS)

    Koenig, X. P.; Leisawitz, D. T.; Benford, D. J.; Rebull, L. M.; Padgett, D. L.; Asslef, R. J.

    2012-01-01

    We present the results of a mid-infrared survey of II outer Galaxy massive star-forming regions and 3 open clusters with data from the Wide-field Infrared Survey Explorer (WISE). Using a newly developed photometric scheme to identify young stellar objects and exclude extragalactic contamination, we have studied the distribution of young stars within each region. These data tend to support the hypothesis that latter generations may be triggered by the interaction of winds and radiation from the first burst of massive star formation with the molecular cloud material leftover from that earlier generation of stars. We dub this process the "fireworks hypothesis" since star formation by this mechanism would proceed rapidly and resemble a burst of fireworks. We have also analyzed small cutout WISE images of the structures around the edges of these massive star-forming regions. We observe large (1-3 pc size) pillar and trunk-like structures of diffuse emission nebulosity tracing excited polycyclic aromatic hydrocarbon molecules and small dust grains at the perimeter of the massive star-forming regions. These structures contain small clusters of emerging Class I and Class II sources, but some are forming only a single to a few new stars.

  2. Region 9 Tribal Minor NSR: New Source General Application (Form NEW)

    EPA Pesticide Factsheets

    This form should be used to register New or Modified Minor Sources (except Oil and Gas Industry Sources until March 2, 2016) with proposed construction or modifications that are subject to minor NSR with the EPA Region 9 Tribal NSR Permitting Program.

  3. YOUNG STELLAR OBJECTS IN THE MASSIVE STAR-FORMING REGION W49

    SciTech Connect

    Saral, G.; Hora, J. L.; Willis, S. E.

    2015-11-01

    We present the initial results of our investigation of the star-forming complex W49, one of the youngest and most luminous massive star-forming regions in our Galaxy. We used Spitzer/Infrared Array Camera (IRAC) data to investigate massive star formation with the primary objective of locating a representative set of protostars and the clusters of young stars that are forming around them. We present our source catalog with the mosaics from the IRAC data. In this study we used a combination of IRAC, MIPS, Two Micron All Sky Survey, and UKIRT Deep Infrared Sky Survey (UKIDSS) data to identify and classify the youngmore » stellar objects (YSOs). We identified 232 Class 0/I YSOs, 907 Class II YSOs, and 74 transition disk candidate objects using color–color and color–magnitude diagrams. In addition, to understand the evolution of star formation in W49, we analyzed the distribution of YSOs in the region to identify clusters using a minimal spanning tree method. The fraction of YSOs that belong to clusters with ≥7 members is found to be 52% for a cutoff distance of 96″, and the ratio of Class II/I objects is 2.1. We compared the W49 region to the G305 and G333 star-forming regions and concluded that W49 has the richest population, with seven subclusters of YSOs.« less

  4. The growth of the central region by acquisition of counterrotating gas in star-forming galaxies.

    PubMed

    Chen, Yan-Mei; Shi, Yong; Tremonti, Christy A; Bershady, Matt; Merrifield, Michael; Emsellem, Eric; Jin, Yi-Fei; Huang, Song; Fu, Hai; Wake, David A; Bundy, Kevin; Stark, David; Lin, Lihwai; Argudo-Fernandez, Maria; Bergmann, Thaisa Storchi; Bizyaev, Dmitry; Brownstein, Joel; Bureau, Martin; Chisholm, John; Drory, Niv; Guo, Qi; Hao, Lei; Hu, Jian; Li, Cheng; Li, Ran; Lopes, Alexandre Roman; Pan, Kai-Ke; Riffel, Rogemar A; Thomas, Daniel; Wang, Lan; Westfall, Kyle; Yan, Ren-Bin

    2016-10-19

    Galaxies grow through both internal and external processes. In about 10% of nearby red galaxies with little star formation, gas and stars are counter-rotating, demonstrating the importance of external gas acquisition in these galaxies. However, systematic studies of such phenomena in blue, star-forming galaxies are rare, leaving uncertain the role of external gas acquisition in driving evolution of blue galaxies. Here, based on new measurements with integral field spectroscopy of a large representative galaxy sample, we find an appreciable fraction of counter-rotators among blue galaxies (9 out of 489 galaxies). The central regions of blue counter-rotators show younger stellar populations and more intense, ongoing star formation than their outer parts, indicating ongoing growth of the central regions. The result offers observational evidence that the acquisition of external gas in blue galaxies is possible; the interaction with pre-existing gas funnels the gas into nuclear regions (<1 kpc) to form new stars.

  5. Inner and outer star forming regions over the disks of spiral galaxies. I. Sample characterization

    NASA Astrophysics Data System (ADS)

    Rodríguez-Baras, M.; Díaz, A. I.; Rosales-Ortega, F. F.; Sánchez, S. F.

    2018-01-01

    Context. The knowledge of abundance distributions is central to understanding the formation and evolution of galaxies. Most of the relations employed for the derivation of gas abundances have so far been derived from observations of outer disk H ii regions, despite the known differences between inner and outer regions. Aims: Using integral field spectroscopy (IFS) observations we aim to perform a systematic study and comparison of two inner and outer H ii regions samples. The spatial resolution of the IFS, the number of objects and the homogeneity and coherence of the observations allow a complete characterization of the main observational properties and differences of the regions. Methods: We analyzed a sample of 725 inner H ii regions and a sample of 671 outer H ii regions, all of them detected and extracted from the observations of a sample of 263 nearby, isolated, spiral galaxies observed by the CALIFA survey. Results: We find that inner H ii regions show smaller equivalent widths, greater extinction and luminosities, along with greater values of [N ii] λ6583/Hα and [O ii] λ3727/[O iii] λ5007 emission-line ratios, indicating higher metallicities and lower ionization parameters. Inner regions have also redder colors and higher photometric and ionizing masses, although MionMphot is slighty higher for the outer regions. Conclusions: This work shows important observational differences between inner and outer H ii regions in star forming galaxies not previously studied in detail. These differences indicate that inner regions have more evolved stellar populations and are in a later evolution state with respect to outer regions, which goes in line with the inside-out galaxy formation paradigm. Table 4 is only available at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/609/A102

  6. Emission Measure Distribution and Heating of Two Active Region Cores

    NASA Technical Reports Server (NTRS)

    Tripathi, Durgesh; Klimchuk, James A.; Mason, Helen E.

    2011-01-01

    Using data from the Extreme-ultraviolet Imaging Spectrometer aboard Hinode, we have studied the coronal plasma in the core of two active regions. Concentrating on the area between opposite polarity moss, we found emission measure distributions having an approximate power-law form EM/T(exp 2.4) from log T = 5.55 up to a peak at log T = 6.57. The observations are explained extremely well by a simple nanoflare model. However, in the absence of additional constraints, the observations could possibly also be explained by steady heating.

  7. A {sup 13}CO SURVEY OF INTERMEDIATE-MASS STAR-FORMING REGIONS

    SciTech Connect

    Lundquist, Michael J.; Kobulnicky, Henry A.; Kerton, Charles R.

    2015-06-10

    We have conducted a {sup 13}CO survey of a sample of 128 infrared color-selected intermediate-mass star-forming region (IM SFR) candidates. We utilized the Onsala 20 m telescope to observe {sup 13}CO (1–0) toward 67 northern IM SFRs, used the 12 m Atacama Pathfinder Experiment telescope to observe {sup 13}CO (2–1) toward 22 southern IM SFRs, and incorporated an additional 39 sources from the Boston University Five College Radio Astronomy Observatory Galactic Ring Survey which observed {sup 13}CO (1–0). We detect {sup 13}CO (1–0) in 58 of the 67 northern sources and {sup 13}CO (2–1) in 20 of the 22 southernmore » sources. The mean molecular column densities and {sup 13}CO linewidths in the inner Galaxy are higher by factors of 3.4 and 1.5, respectively, than the outer Galaxy. We attribute this difference to molecular clouds in the inner Galaxy being more massive and hosting star forming regions with higher luminosities on average than the outer Galaxy. IM SFRs have mean a molecular column density of 7.89 × 10{sup 21} cm{sup −2}, a factor of 3.1 lower than that for a sample of high-mass regions, and have a mean {sup 13}CO linewidth of 1.84 km s{sup −1}, a factor of 1.5 lower than that for high-mass regions. We demonstrate a correlation between {sup 13}CO linewidth and infrared luminosity as well as between molecular column density and infrared luminosity for the entire sample of intermediate-mass and high-mass regions. IM SFRs appear to form in distinctly lower-density environments with mean linewidths and beam-averaged column densities a factor of several lower than high-mass star-forming regions.« less

  8. Auditory selective attention to speech modulates activity in the visual word form area.

    PubMed

    Yoncheva, Yuliya N; Zevin, Jason D; Maurer, Urs; McCandliss, Bruce D

    2010-03-01

    Selective attention to speech versus nonspeech signals in complex auditory input could produce top-down modulation of cortical regions previously linked to perception of spoken, and even visual, words. To isolate such top-down attentional effects, we contrasted 2 equally challenging active listening tasks, performed on the same complex auditory stimuli (words overlaid with a series of 3 tones). Instructions required selectively attending to either the speech signals (in service of rhyme judgment) or the melodic signals (tone-triplet matching). Selective attention to speech, relative to attention to melody, was associated with blood oxygenation level-dependent (BOLD) increases during functional magnetic resonance imaging (fMRI) in left inferior frontal gyrus, temporal regions, and the visual word form area (VWFA). Further investigation of the activity in visual regions revealed overall deactivation relative to baseline rest for both attention conditions. Topographic analysis demonstrated that while attending to melody drove deactivation equivalently across all fusiform regions of interest examined, attending to speech produced a regionally specific modulation: deactivation of all fusiform regions, except the VWFA. Results indicate that selective attention to speech can topographically tune extrastriate cortex, leading to increased activity in VWFA relative to surrounding regions, in line with the well-established connectivity between areas related to spoken and visual word perception in skilled readers.

  9. NGVLA Observations of Dense Gas Filaments in Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    Di Francesco, James; Chen, Mike; Keown, Jared; GAS Team, KEYSTONE Team

    2018-01-01

    Recent observations of continuum emission from nearby star-forming regions with Herschel and JCMT have revealed that filaments are ubiquitous structures within molecular clouds. Such filaments appear to be intimately connected to star formation, with those having column densities of AV > 8 hosting the majority of prestellar cores and young protostars in clouds. Indeed, this “threshold” can be explained simply as the result of supercritical cylinder fragmentation. How specifically star-forming filaments form in molecular clouds, however, remains unclear, though gravity and turbulence are likely involved. Observations of their kinematics are needed to understand how mass flows both onto and through these filaments. We show here results from two recent surveys, the Green Bank Ammonia Survey (GAS) and the K-band Examinations of Young Stellar Object Natal Environments (KEYSTONE) that have used the Green Bank Telescope’s K-band Focal Plane Array instrument to map NH3 (1,1) emission from dense gas in nearby star-forming regions. Data from both surveys show that NH3 emission traces extremely well the high column density gas across these star-forming regions. In particular, the GAS results for NGC 1333 show NH3-based velocity gradients either predominantly parallel or perpendicular to the filament spines. Though the GAS and KEYSTONE data are vital for probing filaments, higher resolutions than possible with the GBT alone are needed to examine the kinematic patterns on the 0.1-pc scales of star-forming cores within filaments. We describe how the Next Generation Very Large Array (NGVLA) will uniquely provide the key wide-field data of high sensitivity needed to explore how ambient gas in molecular clouds forms filaments that evolve toward star formation.

  10. Armenia as a Regional Centre for Astronomy for Development activities

    NASA Astrophysics Data System (ADS)

    Mickaelian, A.

    2015-03-01

    The Byurakan Astrophysical Observatory (BAO, Armenia, http://www.bao.am) are among the candidate IAU Regional Nodes for Astronomy for Development activities. It is one of the main astronomical centers of the former Soviet Union and the Middle East region. At present there are 48 qualified researchers at BAO, including six Doctors of Science and 30 PhDs. Five important observational instruments are installed at BAO, the larger ones being 2.6m Cassegrain (ZTA-2.6) and 1m Schmidt (the one that provided the famous Markarian survey). BAO is regarded as a national scientific-educational center, where a number of activities are being organized, such as: international conferences (4 IAU symposia and 1 IAU colloquium, JENAM-2007, etc.), small workshops and discussions, international summer schools (1987, 2006, 2008 and 2010), and Olympiads. BAO collaborates with scientists from many countries. The Armenian Astronomical Society (ArAS, http://www.aras.am/) is an NGO founded in 2001; it has 93 members and it is rather active in the organization of educational, amateur, popular, promotional and other matters. The Armenian Virtual Observatory (ArVO, http://www.aras.am/Arvo/arvo.htm) is one of the 17 national VO projects forming the International Virtual Observatories Alliance (IVOA) and is the only VO project in the region serving also for educational purposes. A number of activities are planned, such as management, coordination and evaluation of the IAU programs in the area of development and education, establishment of the new IAU endowed lectureship program and organization of seminars and public lectures, coordination and initiation of fundraising activities for astronomy development, organization of regional scientific symposia, conferences and workshops, support to Galileo Teacher Training Program (GTTP), production/publication of educational and promotional materials, etc.

  11. A Near-Infrared Study of the NGC 7538 Star-forming Region

    NASA Astrophysics Data System (ADS)

    Ojha, D. K.; Tamura, M.; Nakajima, Y.; Fukagawa, M.; Sugitani, K.; Nagashima, C.; Nagayama, T.; Nagata, T.; Sato, S.; Vig, S.; Ghosh, S. K.; Pickles, A. J.; Momose, M.; Ogura, K.

    2004-12-01

    We present subarcsecond (FWHM~0.7"), near-infrared (NIR) JHKs-band images and a high-sensitivity radio continuum image at 1280 MHz, using SIRIUS on the University of Hawaii 88 inch (2.2 m) telescope and the Giant Metrewave Radio Telescope (GMRT). The NIR survey covers an area of ~24 arcmin2 with 10 σ limiting magnitudes of ~19.5, 18.4, and 17.3 in the J, H, and Ks bands, respectively. Our NIR images are deeper than any JHK surveys to date for the larger area of the NGC 7538 star-forming region. We construct JHK color-color and J-H/J and H-K/K color-magnitude diagrams to identify young stellar objects (YSOs) and to estimate their masses. Based on these color-color and color-magnitude diagrams, we identified a rich population of YSOs (Class I and Class II) associated with the NGC 7538 region. A large number of red sources (H-K>2) have also been detected around NGC 7538. We argue that these red stars are most probably pre-main-sequence stars with intrinsic color excesses. Most of the YSOs in NGC 7538 are arranged from the northwest toward the southeast regions, forming a sequence in age: a diffuse H II region (northwest and oldest, where most of the Class II and Class I sources are detected), a compact IR core (center), and regions with an extensive IR reflection nebula and a cluster of red young stars (southeast and south). We find that the slope of the Ks-band luminosity function of NGC 7538 is lower than the typical values reported for young embedded clusters, although equally low values have also been reported in the W3 Main star-forming region. From the slope of the Ks-band luminosity function and the analysis by Megeath and coworkers, we infer that the embedded stellar population is composed of YSOs with an age of ~1 Myr. Based on the comparison of models of pre-main-sequence stars with the observed color-magnitude diagram, we find that the stellar population in NGC 7538 is primarily composed of low-mass pre-main-sequence stars similar to those observed in the

  12. A Comparative Observational Study of YSO Classification in Four Small Star-forming H ii Regions

    SciTech Connect

    Kang, Sung-Ju; Choi, Minho; Kang, Miju

    2017-08-10

    We have developed a new young stellar object (YSO) identification and classification technique using mid-infrared Wide-field Infrared Survey Explorer (WISE) data. We compare this new technique with previous WISE YSO detection and classification methods that used either infrared colors or spectral energy distribution slopes. In this study, we also use the new technique to detect and examine the YSO population associated with four small H ii regions: KR 7, KR 81, KR 120, and KR 140. The relatively simple structure of these regions allows us to effectively use both spatial and temporal constraints to identify YSOs that are potential productsmore » of triggered star formation. We are also able to identify regions of active star formation around these H ii regions that are clearly not influenced by the H ii region expansion, and thus demonstrate that star formation is on-going on megayear timescales in some of these molecular clouds.« less

  13. {sup 13}C ISOTOPIC FRACTIONATION OF HC{sub 3}N IN STAR-FORMING REGIONS: LOW-MASS STAR-FORMING REGION L1527 AND HIGH-MASS STAR-FORMING REGION G28.28-0.36

    SciTech Connect

    Taniguchi, Kotomi; Saito, Masao; Ozeki, Hiroyuki, E-mail: kotomi.taniguchi@nao.ac.jp

    2016-10-20

    We observed the J = 9–8 and 10–9 rotational lines of three {sup 13}C isotopologues of HC{sub 3}N in L1527 and G28.28-0.36, with the 45 m radio telescope of the Nobeyama Radio Observatory, in order to constrain the main formation mechanisms of HC{sub 3}N in each source. The abundance ratios of the three {sup 13}C isotopologues of HC{sub 3}N are found to be 0.9 (±0.2) : 1.00 : 1.29 (±0.19) (1 σ ), and 1.0 (±0.2) : 1.00 : 1.47 (±0.17) (1 σ ), for [H{sup 13}CCCN : HC{sup 13}CCN : HCC{sup 13}CN] in L1527 and G28.28-0.36, respectively. We recognize,more » from a similar {sup 13}C isotopic fractionation pattern, that the abundances of H{sup 13}CCCN and HC{sup 13}CCN are comparable, and HCC{sup 13}CN is more abundant than the others. Based on the results, we discuss the main formation pathway of HC{sub 3}N. The {sup 13}C isotopic fractionation pattern derived from our observations can be explained by the neutral-neutral reaction between C{sub 2}H{sub 2} and CN in both the low-mass (L1527) and high-mass (G28.28-0.36) star-forming regions.« less

  14. Inflammasome - activated gasdermin D causes pyroptosis by forming membrane pores

    PubMed Central

    Liu, Xing; Zhang, Zhibin; Ruan, Jianbin; Pan, Youdong; Magupalli, Venkat Giri; Wu, Hao; Lieberman, Judy

    2017-01-01

    Inflammatory caspases (caspases 1, 4, 5 and 11) are activated in response to microbial infection and danger signals. When activated, they cleave mouse and human gasdermin D (GSDMD) after Asp276 and Asp275, respectively, to generate an N-terminal cleavage product (GSDMD-NT) that triggers inflammatory death (pyroptosis) and release of inflammatory cytokines such as interleukin-1β1,2. Cleavage removes the C-terminal fragment (GSDMD-CT), which is thought to fold back on GSDMD-NT to inhibit its activation. However, how GSDMD-NT causes cell death is unknown. Here we show that GSDMD-NT oligomerizes in membranes to form pores that are visible by electron microscopy. GSDMD-NT binds to phosphatidylinositol phosphates and phosphatidylserine (restricted to the cell membrane inner leaflet) and cardiolipin (present in the inner and outer leaflets of bacterial membranes). Mutation of four evolutionarily conserved basic residues blocks GSDMD-NT oligomerization, membrane binding, pore formation and pyroptosis. Because of its lipid-binding preferences, GSDMD-NT kills from within the cell, but does not harm neighbouring mammalian cells when it is released during pyroptosis. GSDMD-NT also kills cell-free bacteria in vitro and may have a direct bactericidal effect within the cytosol of host cells, but the importance of direct bacterial killing in controlling in vivo infection remains to be determined. PMID:27383986

  15. 76 FR 53144 - Agency Information Collection Activities: Form I-508 and Form I-508F, Extension of a Currently...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-25

    ... Collection Activities: Form I-508 and Form I- 508F, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 508 and I-508F... on June 2, 2011, at 76 FR 31972, allowing for a 60-day public comment period. USCIS did not receive...

  16. Evolution and excitation conditions of outflows in high-mass star-forming regions

    NASA Astrophysics Data System (ADS)

    Sánchez-Monge, Á.; López-Sepulcre, A.; Cesaroni, R.; Walmsley, C. M.; Codella, C.; Beltrán, M. T.; Pestalozzi, M.; Molinari, S.

    2013-09-01

    regions with higher densities and/or temperatures than the SiO emission at the ambient gas velocity. Conclusions: The properties of the SiO and HCO+ outflow emission suggest a scenario in which SiO is largely enhanced in the first evolutionary stages, probably owing to strong shocks produced by the protostellar jet. As the object evolves, the power of the jet would decrease and so does the SiO abundance. During this process, however, the material surrounding the protostar would have been been swept up by the jet, and the outflow activity, traced by entrained molecular material (HCO+), would increase with time. Appendix A is available in electronic form at http://www.aanda.orgDatacubes as FITS files are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/557/A94

  17. The comparison of physical properties derived from gas and dust in a massive star-forming region

    SciTech Connect

    Battersby, Cara; Bally, John; Ginsburg, Adam

    2014-05-10

    We explore the relationship between gas and dust in a massive star-forming region by comparing the physical properties derived from each. We compare the temperatures and column densities in a massive star-forming Infrared Dark Cloud (G32.02+0.05), which shows a range of evolutionary states, from quiescent to active. The gas properties were derived using radiative transfer modeling of the (1,1), (2,2), and (4,4) transitions of NH{sub 3} on the Karl G. Jansky Very Large Array, while the dust temperatures and column densities were calculated using cirrus-subtracted, modified blackbody fits to Herschel data. We compare the derived column densities to calculate anmore » NH{sub 3} abundance, χ{sub NH{sub 3}} = 4.6 × 10{sup –8}. In the coldest star-forming region, we find that the measured dust temperatures are lower than the measured gas temperatures (mean and standard deviations T {sub dust,} {sub avg} ∼ 11.6 ± 0.2 K versus T {sub gas,} {sub avg} ∼ 15.2 ± 1.5 K), which may indicate that the gas and dust are not well-coupled in the youngest regions (∼0.5 Myr) or that these observations probe a regime where the dust and/or gas temperature measurements are unreliable. Finally, we calculate millimeter fluxes based on the temperatures and column densities derived from NH{sub 3}, which suggest that millimeter dust continuum observations of massive star-forming regions, such as the Bolocam Galactic Plane Survey or ATLASGAL, can probe hot cores, cold cores, and the dense gas lanes from which they form, and are generally not dominated by the hottest core.« less

  18. The mineralogy of newly formed dust in active galactic nuclei

    NASA Astrophysics Data System (ADS)

    Srinivasan, Sundar; Kemper, F.; Zhou, Yeyan; Hao, Lei; Gallagher, Sarah C.; Shangguan, Jinyi; Ho, Luis C.; Xie, Yanxia; Scicluna, Peter; Foucaud, Sebastien; Peng, Rita H. T.

    2017-12-01

    The tori around active galactic nuclei (AGN) are potential formation sites for large amounts of dust, and they may help resolve the so-called dust budget crisis at high redshift. We investigate the dust composition in 53 of the 87 Palomar Green (PG) quasars showing the 9.7 μm silicate feature in emission. By simultaneously fitting the mid-infrared spectroscopic features and the underlying continuum, we estimate the mass fraction in various amorphous and crystalline dust species. We find that the dust consists predominantly of alumina and amorphous silicates, with a small fraction in crystalline form. The mean crystallinity is 8 ±6%, with more than half of the crystallinities greater than 5%, well above the upper limit determined for the Galaxy. Higher values of crystallinity are found for higher oxide fractions and for more luminous sources.

  19. The Non-Thermal Radio Jet in the NGC 2264 Star-Forming Region

    NASA Astrophysics Data System (ADS)

    Trejo, A.; Rodríguez, L. F.

    2008-06-01

    We investigated the non-thermal radio jet in the NGC 2264 star forming region. The jet was discovered by tet{t-re04}, and it has a non-thermal spectrum and high polarization. We made new observations with the VLA in 2006 and compared with 1995 archival data to search for proper motions and flux density variability. We only detect flux variability in the core. The general lack of variability and proper motions favors an extragalactic nature for this jet.

  20. YOUNG STELLAR POPULATIONS IN MYStIX STAR-FORMING REGIONS: CANDIDATE PROTOSTARS

    SciTech Connect

    Romine, Gregory; Feigelson, Eric D.; Getman, Konstantin V.

    2016-12-20

    The Massive Young Star-Forming Complex in Infrared and X-ray (MYStIX) project provides a new census on stellar members of massive star-forming regions within 4 kpc. Here the MYStIX Infrared Excess catalog and Chandra -based X-ray photometric catalogs are mined to obtain high-quality samples of Class I protostars using criteria designed to reduce extragalactic and Galactic field star contamination. A total of 1109 MYStIX Candidate Protostars (MCPs) are found in 14 star-forming regions. Most are selected from protoplanetary disk infrared excess emission, but 20% are found from their ultrahard X-ray spectra from heavily absorbed magnetospheric flare emission. Two-thirds of the MCP sample ismore » newly reported here. The resulting samples are strongly spatially associated with molecular cores and filaments on Herschel far-infrared maps. This spatial agreement and other evidence indicate that the MCP sample has high reliability with relatively few “false positives” from contaminating populations. But the limited sensitivity and sparse overlap among the infrared and X-ray subsamples indicate that the sample is very incomplete with many “false negatives.” Maps, tables, and source descriptions are provided to guide further study of star formation in these regions. In particular, the nature of ultrahard X-ray protostellar candidates without known infrared counterparts needs to be elucidated.« less

  1. Observations of HDO in the High-Mass Star Forming Regions

    NASA Astrophysics Data System (ADS)

    Kulczak-Jastrzębska, M.

    2016-06-01

    I present observations of the ground state (10,1-00,0) rotational transition of HDO at 464.925 GHz toward several high-mass star forming regions carried out with the Caltech Submillimeter Observatory. The spectra are modeled together with observations of higher-energy HDO transitions and submillimeter dust continuum fluxes present in the literature. Spherically symmetric radiative transfer model was used to derive the radial distribution of the HDO abundance in the target sources. The abundance profile is divided into an inner hot core region, with kinetic temperatures higher than 100 K, and a cold outer envelope. The derived HDO abundances relative to H2 are: (0.6-3.5)×10-8 and (0.1-25)×10-11 in the hot inner region and the cold outer envelope, respectively.

  2. The Charon-forming giant impact as a source of Pluto's dark equatorial regions

    NASA Astrophysics Data System (ADS)

    Sekine, Yasuhito; Genda, Hidenori; Kamata, Shunichi; Funatsu, Taro

    2017-01-01

    Pluto exhibits complex regional diversity in its surface materials 1,2 . One of the most striking features is the dark reddish material, possibly organic matter, along Pluto's equator coexisting with the H2O-rich crust 2 . Little is known, however, about the surface process responsible for the dark equatorial regions. Here, we propose that Pluto's dark regions were formed through reactions in elongated pools of liquid water near the equator, generated by the giant impact that formed Charon 3-5 . Our laboratory experiments show that dark reddish organic matter, comparable to Pluto's dark materials, is produced through polymerization of simple organic compounds 6,7 that would have been present in proto-Pluto (for example, formaldehyde) by prolonged heating at temperatures ≥50 °C. Through hydrodynamic impact simulations, we demonstrate that an impactor, one-third the mass of Pluto, colliding with proto-Pluto—with an interior potential temperature of 150-200 K—could have generated both a Charon-sized satellite and high-temperature regions around Pluto's equator. We also propose that high-velocity giant impacts result in global or hemispherical darkening and reddening, suggesting that the colour variety of large Kuiper belt objects 8-12 could have been caused by frequent, stochastic giant impacts in a massive outer protoplanetary disk in the early Solar System 13-16 .

  3. Chemical modelling of glycolaldehyde and ethylene glycol in star-forming regions

    NASA Astrophysics Data System (ADS)

    Coutens, A.; Viti, S.; Rawlings, J. M. C.; Beltrán, M. T.; Holdship, J.; Jiménez-Serra, I.; Quénard, D.; Rivilla, V. M.

    2018-04-01

    Glycolaldehyde (HOCH2CHO) and ethylene glycol ((CH2OH)2) are two complex organic molecules detected in the hot cores and hot corinos of several star-forming regions. The ethylene glycol/glycolaldehyde abundance ratio seems to show an increase with the source luminosity. In the literature, several surface-chemistry formation mechanisms have been proposed for these two species. With the UCLCHEM chemical code, we explored the different scenarios and compared the predictions for a range of sources of different luminosities with the observations. None of the scenarios reproduce perfectly the trend. A better agreement is, however, found for a formation through recombination of two HCO radicals followed by successive hydrogenations. The reaction between HCO and CH2OH could also contribute to the formation of glycolaldehyde in addition to the hydrogenation pathway. The predictions are improved when a trend of decreasing H2 density within the core region with T≥100 K as a function of luminosity is included in the model. Destruction reactions of complex organic molecules in the gas phase would also need to be investigated, since they can affect the abundance ratios once the species have desorbed in the warm inner regions of the star-forming regions.

  4. Lipid droplets form from distinct regions of the cell in the fission yeast Schizosaccharomyces pombe

    DOE PAGES

    Meyers, Alex; del Rio, Zuania P.; Beaver, Rachael A.; ...

    2016-04-29

    Eukaryotic cells store cholesterol/sterol esters (SEs) and triacylglycerols (TAGs) in lipid droplets, which form from the contiguous endoplasmic reticulum (ER) network. However, it is not known if droplets preferentially form from certain regions of the ER over others. Here, we used fission yeast Schizosaccharomyces pombe cells where the nuclear and cortical/peripheral ER domains are distinguishable by light microscopy to show that SE-enriched lipid droplets form away from the nucleus at the cell tips, whereas TAG-enriched lipid droplets form around the nucleus. Sterols localize to the regions of the cells where droplets enriched in SEs are observed. TAG droplet formation aroundmore » the nucleus appears to be a strong function of diacylglycerol (DAG) homeostasis with Cpt1p, which coverts DAG into phosphatidylcholine and phosphatidylethanolamine localized exclusively to the nuclear ER. Also, Dgk1p, which converts DAG into phosphatidic acid localized strongly to the nuclear ER over the cortical/peripheral ER. We also show that TAG more readily translocates from the ER to lipid droplets than do SEs. Lastly, the results augment the standard lipid droplet formation model, which has SEs and TAGs flowing into the same nascent lipid droplet regardless of its biogenesis point in the cell.« less

  5. Effects of the form factor on inclusive (e,e') reactions in the quasielastic region

    NASA Astrophysics Data System (ADS)

    Kim, K. S.; Cheoun, Myung Ki

    2003-03-01

    We discuss the effect of nuclear medium on the inclusive (e,e') reactions for 40Ca and 208Pb targets by introducing the form factors of the nucleons inside nuclei in the quasielastic region. These form factors include the change of nucleon properties in nuclear medium. Longitudinal and transverse structure functions for given momenta and energy transfers are extracted from the cross section calculated by using the form factors with the Rosenbluth separation method. A relativistic Hartree single particle model for the bound state and continuum nucleon wave functions is used and the effects of the electron Coulomb distortion are included in the calculation. We compare the results with the experimental data measured at Bates and Saclay.

  6. The Limit of Free Magnetic Energy in Active Regions

    NASA Technical Reports Server (NTRS)

    Moore, Ron; Falconer, David; Sterling, Alphonse

    2012-01-01

    By measuring from active-region magnetograms a proxy of the free energy in the active region fs magnetic field, it has been found previously that (1) there is an abrupt upper limit to the free energy the field can hold that increases with the amount of magnetic field in the active region, the active region fs magnetic flux content, and (2) the free energy is usually near its limit when the field explodes in a CME/flare eruption. That is, explosive active regions are concentrated in a main-sequence path bordering the free-energy ]limit line in (flux content, free-energy proxy) phase space. Here, from measurement of Marshall Space Flight Center vector magnetograms, we find the magnetic condition that underlies the free ]energy limit and the accompanying main sequence of explosive active regions. Using a suitable free ]energy proxy measured from vector magnetograms of 44 active regions, we find that (1) in active regions at and near their free ]energy limit, the ratio of magnetic-shear free energy to the non ]free magnetic energy the potential field would have is approximately 1 in the core field, the field rooted along the neutral line, and (2) this ratio is progressively less in active regions progressively farther below their free ]energy limit. This shows that most active regions in which this core-field energy ratio is much less than 1 cannot be triggered to explode; as this ratio approaches 1, most active regions become capable of exploding; and when this ratio is 1 or greater, most active regions are compelled to explode. From these results we surmise the magnetic condition that determines the free ]energy limit is the ratio of the free magnetic energy to the non-free energy the active region fs field would have were it completely relaxed to its potential ]field configuration, and that this ratio is approximately 1 at the free-energy limit and in the main sequence of explosive active regions.

  7. On Issue of Algorithm Forming for Assessing Investment Attractiveness of Region Through Its Technospheric Security

    NASA Astrophysics Data System (ADS)

    Filimonova, L. A.; Skvortsova, N. K.

    2017-11-01

    The article examines the problematic aspects of assessing the investment attractiveness of a region associated with the consideration of methodological issues that require refinement from the point of view of its technospheric security. Such issues include the formation of a sound system of indicators for the assessment of man-made risk which has a particular impact on the level of investment attractiveness of the region. In the context of the instability of the economic situation in Russia, the problem of man-made risks assessing in the context of the regional investment attractiveness based on an integrated approach and taking into account such principles as flexibility, adaptability, innovative orientation has not only lost its relevance but was also transformed into one of the most important conditions for ensuring the effective management of all spheres of the regional activities. The article poses the classical problem of making decisions on the results of the assessment of the investment attractiveness of the region in a matrix format evaluating the utility function. The authors of the article recommended a universal risk assessment model with its subsequent synthesis into technospheric security for the comprehensive assessment of regional investment attractiveness. The principal distinguishing feature of the study results are the schemes for manipulation in the evaluation activity associated with the selection of the optimality criteria groups and models for their study. These iterations make it possible to substantiate the choice of the solution for preserving the technospheric security of the region, a field of compromises or an “ideal” solution to the problem of the regional investment attractiveness loss.

  8. Active region upflows. I. Multi-instrument observations

    NASA Astrophysics Data System (ADS)

    Vanninathan, K.; Madjarska, M. S.; Galsgaard, K.; Huang, Z.; Doyle, J. G.

    2015-12-01

    responsible for the formation of the upflow region. High cadence Hα observations are used to study the chromosphere at the footpoints of the upflow region. We find no significant jet-like (spicule/rapid blue excursion) activity to account for several hours/days of plasma upflow. The jet-like activity in this region is not continuous and blueward asymmetries are a bare minimum. Using an image enhancement technique for imaging and spectral data, we show that the coronal structures seen in the AIA 193 Å channel are comparable to the EIS Fe xii images, while images in the AIA 171 Å channel reveal additional loops that are a result of contribution from cooler emission to this channel. Conclusions: Our results suggest that at chromospheric heights there are no signatures that support the possible contribution of spicules to active region upflows. We suggest that magnetic flux diffusion is responsible for the formation of the coronal upflows. The existence of two velocity components possibly indicates the presence of two different flows, which are produced by two different physical mechanisms, e.g. magnetic reconnection and pressure-driven jets. Movies associated to Figs. A.1-A.3 are available in electronic form at http://www.aanda.org

  9. STATISTICAL ANALYSIS OF ACOUSTIC WAVE PARAMETERS NEAR SOLAR ACTIVE REGIONS

    SciTech Connect

    Rabello-Soares, M. Cristina; Bogart, Richard S.; Scherrer, Philip H., E-mail: cristina@fisica.ufmg.br

    2016-08-20

    In order to quantify the influence of magnetic fields on acoustic mode parameters and flows in and around active regions, we analyze the differences in the parameters in magnetically quiet regions nearby an active region (which we call “nearby regions”), compared with those of quiet regions at the same disk locations for which there are no neighboring active regions. We also compare the mode parameters in active regions with those in comparably located quiet regions. Our analysis is based on ring-diagram analysis of all active regions observed by the Helioseismic and Magnetic Imager (HMI) during almost five years. We findmore » that the frequency at which the mode amplitude changes from attenuation to amplification in the quiet nearby regions is around 4.2 mHz, in contrast to the active regions, for which it is about 5.1 mHz. This amplitude enhacement (the “acoustic halo effect”) is as large as that observed in the active regions, and has a very weak dependence on the wave propagation direction. The mode energy difference in nearby regions also changes from a deficit to an excess at around 4.2 mHz, but averages to zero over all modes. The frequency difference in nearby regions increases with increasing frequency until a point at which the frequency shifts turn over sharply, as in active regions. However, this turnover occurs around 4.9 mHz, which is significantly below the acoustic cutoff frequency. Inverting the horizontal flow parameters in the direction of the neigboring active regions, we find flows that are consistent with a model of the thermal energy flow being blocked directly below the active region.« less

  10. Neutral and ionized hydrides in star-forming regions. Observations with Herschel/HIFI.

    PubMed

    Benz, Arnold O; Bruderer, Simon; van Dishoeck, Ewine F; Stäuber, Pascal; Wampfler, Susanne F

    2013-10-03

    The cosmic abundance of hydrides depends critically on high-energy UV, X-ray, and particle irradiation. Here we study hydrides in star-forming regions where irradiation by the young stellar object can be substantial, and density and temperature can be much enhanced over interstellar values. Lines of OH, CH, NH, and SH and their ions OH(+), CH(+), NH(+), SH(+), H2O(+), and H3O(+) were observed in star-forming regions by the HIFI spectrometer onboard the Herschel Space Observatory. Molecular column densities are derived from observed ground-state lines, models, or rotational diagrams. We report here on two prototypical high-mass regions, AFGL 2591 and W3 IRS5, and compare them to chemical calculations by making assumptions on the high-energy irradiation. A model assuming no ionizing protostellar emission is compared with (i) a model assuming strong protostellar X-ray emission and (ii) a two-dimensional (2D) model including emission in the far UV (FUV, 6-13.6 eV), irradiating the outflow walls that separate the outflowing gas and infalling envelope material. We confirm that the effect of FUV in two-dimensional models with enlarged irradiated surfaces is clearly noticeable. A molecule that is very sensitive to FUV irradiation is CH(+), enhanced in abundance by more than 5 orders of magnitude. The HIFI observations of CH(+) lines agree with the two-dimensional FUV model by Bruderer et al., which computes abundances, non-LTE excitation, and line radiative transfer.20 It is concluded that CH(+) is a good FUV tracer in star-forming regions. The effect of potential X-ray irradiation is not excluded but cannot be demonstrated by the present data.

  11. Global Infrared–Radio Spectral Energy Distributions of Galactic Massive Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    Povich, Matthew Samuel; Binder, Breanna Arlene

    2018-01-01

    We present a multiwavelength study of 30 Galactic massive star-forming regions. We fit multicomponent dust, blackbody, and power-law continuum models to 3.6 µm through 10 mm spectral energy distributions obtained from Spitzer, MSX, IRAS, Herschel, and Planck archival survey data. Averaged across our sample, ~20% of Lyman continuum photons emitted by massive stars are absorbed by dust before contributing to the ionization of H II regions, while ~50% of the stellar bolometric luminosity is absorbed and reprocessed by dust in the H II regions and surrounding photodissociation regions. The most luminous, infrared-bright regions that fully sample the upper stellar initial mass function (ionizing photon rates NC ≥ 1050 s–1 and total infrared luminosity LTIR ≥ 106.8 L⊙) have higher percentages of absorbed Lyman continuum photons (~40%) and dust-reprocessed starlight (~80%). The monochromatic 70-µm luminosity L70 is linearly correlated with LTIR, and on average L70/LTIR = 50%, in good agreement with extragalactic studies. Calibrated against the known massive stellar content in our sampled H II regions, we find that star formation rates based on L70 are in reasonably good agreement with extragalactic calibrations, when corrected for the smaller physical sizes of the Galactic regions. We caution that absorption of Lyman continuum photons prior to contributing to the observed ionizing photon rate may reduce the attenuation-corrected Hα emission, systematically biasing extragalactic calibrations toward lower star formation rates when applied to spatially-resolved studies of obscured star formation.This work was supported by the National Science Foundation under award CAREER-1454333.

  12. Image Patch Analysis of Sunspots and Active Regions

    NASA Astrophysics Data System (ADS)

    Moon, K.; Delouille, V.; Hero, A.

    2017-12-01

    The flare productivity of an active region has been observed to be related to its spatial complexity. Separating active regions that are quiet from potentially eruptive ones is a key issue in space weather applications. Traditional classification schemes such as Mount Wilson and McIntosh have been effective in relating an active region large scale magnetic configuration to its ability to produce eruptive events. However, their qualitative nature does not use all of the information present in the observations. In our work, we present an image patch analysis for characterizing sunspots and active regions. We first propose fine-scale quantitative descriptors for an active region's complexity such as intrinsic dimension, and we relate them to the Mount Wilson classification. Second, we introduce a new clustering of active regions that is based on the local geometry observed in Line of Sight magnetogram and continuum images. To obtain this local geometry, we use a reduced-dimension representation of an active region that is obtained by factoring the corresponding data matrix comprised of local image patches using the singular value decomposition. The resulting factorizations of active regions can be compared via the definition of appropriate metrics on the factors. The distances obtained from these metrics are then used to cluster the active regions. Results. We find that these metrics result in natural clusterings of active regions. The clusterings are related to large scale descriptors of an active region such as its size, its local magnetic field distribution, and its complexity as measured by the Mount Wilson classification scheme. We also find that including data focused on the neutral line of an active region can result in an increased correspondence between our clustering results and other active region descriptors such as the Mount Wilson classifications and the R-value.

  13. Formation of ethylene glycol and other complex organic molecules in star-forming regions

    NASA Astrophysics Data System (ADS)

    Rivilla, V. M.; Beltrán, M. T.; Cesaroni, R.; Fontani, F.; Codella, C.; Zhang, Q.

    2017-02-01

    Context. The detection of complex organic molecules related with prebiotic chemistry in star-forming regions allows us to investigate how the basic building blocks of life are formed. Aims: Ethylene glycol (CH2OH)2 is the simplest sugar alcohol and the reduced alcohol of the simplest sugar glycoladehyde (CH2OHCHO). We study the molecular abundance and spatial distribution of (CH2OH)2, CH2OHCHO and other chemically related complex organic species (CH3OCHO, CH3OCH3, and C2H5OH) towards the chemically rich massive star-forming region G31.41+0.31. Methods: We analyzed multiple single-dish (Green Bank Telescope and IRAM 30 m) and interferometric (Submillimeter Array) spectra towards G31.41+0.31, covering a range of frequencies from 45 to 258 GHz. We fitted the observed spectra with a local thermodynamic equilibrium (LTE) synthetic spectra, and obtained excitation temperatures and column densities. We compared our findings in G31.41+0.31 with the results found in other environments, including low- and high-mass star-forming regions, quiescent clouds and comets. Results: We report for the first time the presence of the aGg' conformer of (CH2OH)2 towards G31.41+0.31, detecting more than 30 unblended lines. We also detected multiple transitions of other complex organic molecules such as CH2OHCHO, CH3OCHO, CH3OCH3, and C2H5OH. The high angular resolution images show that the (CH2OH)2 emission is very compact, peaking towards the maximum of the 1.3 mm continuum. These observations suggest that low abundance complex organic molecules, like (CH2OH)2 or CH2OHCHO, are good probes of the gas located closer to the forming stars. Our analysis confirms that (CH2OH)2 is more abundant than CH2OHCHO in G31.41+0.31, as previously observed in other interstellar regions. Comparing different star-forming regions we find evidence of an increase of the (CH2OH)2/CH2OHCHO abundance ratio with the luminosity of the source. The CH3OCH3/CH3OCHO and (CH2OH)2/C2H5OH ratios are nearly constant with

  14. The Structure of the Nearby Giant Star-Forming Region 30 Doradus

    NASA Astrophysics Data System (ADS)

    Pellegrini, Eric; Baldwin, Jack; Hanson, Margaret; Ferland, Gary; Troland, Thomas

    2007-08-01

    The rates of star formation and chemical evolution are controlled in part by the interaction of stellar radiation and winds with the remnant molecular gas from which the stars have formed. We are carrying out a detailed, panchromatic study of these processes in the two nearest giant star-forming regions, 30 Doradus and NGC 3603, as an aide in understanding the nature of Giant Extragalactic H II Regions, starbursts, and Ultra-Luminous IR Galaxies. We recently completed our observations of NGC 3603. Here we request 2 nights on the Blanco telescope to obtain a dense grid of optical long-slit spectra criss- crossing 30 Dor. These will cover the [S II] doublet (to measure N_e) and also [O III], H(beta), [O I], H(alpha) and [N II] to measure the ionization mechanism and ionization parameter, at ~3800 different spots in the nebula. We also request 3 nights on SOAR to take K-band long slit spectra covering H^+ Br(gamma) and several H_2 lines across three representative edge-on ionization fronts in 30 Dor. The IR spectra will be taken in locations also covered by the optical spectra, and will tell us about the structure, pressure support and heating mechanisms in the photo-dissociation regions (PDRs) at these points. Either half of this project can stand on its own, but both parts together will permit the PI to complete his PhD thesis.

  15. The growth of the central region by acquisition of counterrotating gas in star-forming galaxies

    PubMed Central

    Chen, Yan-Mei; Shi, Yong; Tremonti, Christy A.; Bershady, Matt; Merrifield, Michael; Emsellem, Eric; Jin, Yi-Fei; Huang, Song; Fu, Hai; Wake, David A.; Bundy, Kevin; Stark, David; Lin, Lihwai; Argudo-Fernandez, Maria; Bergmann, Thaisa Storchi; Bizyaev, Dmitry; Brownstein, Joel; Bureau, Martin; Chisholm, John; Drory, Niv; Guo, Qi; Hao, Lei; Hu, Jian; Li, Cheng; Li, Ran; Lopes, Alexandre Roman; Pan, Kai-Ke; Riffel, Rogemar A.; Thomas, Daniel; Wang, Lan; Westfall, Kyle; Yan, Ren-Bin

    2016-01-01

    Galaxies grow through both internal and external processes. In about 10% of nearby red galaxies with little star formation, gas and stars are counter-rotating, demonstrating the importance of external gas acquisition in these galaxies. However, systematic studies of such phenomena in blue, star-forming galaxies are rare, leaving uncertain the role of external gas acquisition in driving evolution of blue galaxies. Here, based on new measurements with integral field spectroscopy of a large representative galaxy sample, we find an appreciable fraction of counter-rotators among blue galaxies (9 out of 489 galaxies). The central regions of blue counter-rotators show younger stellar populations and more intense, ongoing star formation than their outer parts, indicating ongoing growth of the central regions. The result offers observational evidence that the acquisition of external gas in blue galaxies is possible; the interaction with pre-existing gas funnels the gas into nuclear regions (<1 kpc) to form new stars. PMID:27759033

  16. Spontaneous activity in the developing mammalian retina: Form and function

    NASA Astrophysics Data System (ADS)

    Butts, Daniel Allison

    Spontaneous neuronal activity is present in the immature mammalian retina during the initial stages of visual system development, before the retina is responsive to light. This activity consists of bursts of action potentials fired by retinal ganglion cells, and propagates in a wavelike manner across the inner plexiform layer of the retina. Unlike waves in other neural systems, retinal waves have large variability in both their rate and direction of propagation, and individual waves only propagate across small regions of the retina. The unique properties of retinal activity arise from dynamic processes within the developing retina, and produce characteristic spatiotemporal properties. These spatiotemporal properties are of particular interest, since they are believed to play a role in visual system development. This dissertation addresses the complex spatiotemporal patterning of the retinal waves from two different perspectives. First, it proposes how the immature circuitry of the developing retina generates these patterns of activity. In order to reproduce the distinct spatiotemporal properties observed in experiments, a model of the immature retinal circuitry must meet certain requirements, which are satisfied by a coarse-grained model of the developing retina that we propose. Second, this dissertation addresses how the particular spatiotemporal patterning of the retinal waves provides information to the rest of the visual system and, as a result, can be used to guide visual system development. By measuring the properties of this information, we place constraints on the developmental mechanisms that use this activity, and show how the particular spatiotemporal properties of the retinal waves provide this information. Together, this dissertation demonstrates how the apparent complexity of retinal wave patterning can be understood both through the immature circuitry that generates it, and through the developmental mechanisms that may use it. The first three

  17. Monitoring rice farming activities in the Mekong Delta region

    NASA Astrophysics Data System (ADS)

    Nguyen, S. T.; Chen, C. F.; Chen, C. R.; Chiang, S. H.; Chang, L. Y.; Khin, L. V.

    2015-12-01

    . The results in forms of spatialtemporal and quantitative information of rice sowing and harvesting activities were vital for crop management, and the methods are thus suggested for rice crop monitoring in the study region and could be transferable to other regions for crop monitoring.

  18. Gas kinematics in high-mass star-forming regions from the Perseus spiral arm

    NASA Astrophysics Data System (ADS)

    Kirsanova, M. S.; Sobolev, A. M.; Thomasson, M.

    2017-09-01

    We present results of a survey of 14 star-forming regions from the Perseus spiral armin CS (2-1) and 13CO (1-0) lines with the Onsala Space Observatory 20 m telescope. Maps of 10 sources in both lines are obtained. For the remaining sources a map in just one line or a single-point spectrum is obtained. On the basis of newly obtained and published observational data we consider the relation between velocities of the "quasi-thermal" CS (2-1) line and 6.7 GHz methanol maser line in 24 high-mass star-forming regions in the Perseus arm. We show that, surprisingly, velocity ranges of 6.7 GHz methanol maser emission are predominantly red-shifted with respect to corresponding CS (2-1) line velocity ranges in the Perseus arm. We suggest that the predominance of the "red-shifted masers" in the Perseus arm could be related to the alignment of gas flows caused by the large-scalemotions in the Galaxy. Large-scale galactic shock related to the spiral structure is supposed to affect the local kinematics of the star-forming regions. Part of the Perseus arm, between galactic longitudes from 85° to 124° , does not contain blue-shifted masers at all. Radial velocities of the sources are the greatest in this particular part of the arm, so the velocity difference is clearly pronounced. 13CO (1-0) and CS (2-1) velocity maps of G183.35-0.58 show gas velocity difference between the center and the periphery of the molecular clump up to 1.2 km s-1. Similar situation is likely to occur in G85.40-0.00. This can correspond to the case when the large-scale shock wave entrains the outer parts of a molecular clump in motion while the dense central clump is less affected by the shock.

  19. Multi-wavelength, Multi-scale Observations of Outflows in Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    Plunkett, Adele Laurie Dennis

    ratio of outflow energy to gravitational binding energy; further, if gas escapes from NGC 1333, then outflow energy and gravitational energy may become comparable within the next N ~ 0.5 Myr, possibly disrupting the cluster. Finally, we investigate the properties of a particular Class 0 molecular outflow in Serpens South, providing evidence for episodic outflow events and corresponding accretion at a very early stage. This remarkable outflow remains intact even within the active, central hub region of Serpens South.

  20. Deep VLA observations of nearby star forming regions I: Barnard 59 and Lupus 1

    NASA Astrophysics Data System (ADS)

    Dzib, S. A.; Loinard, L.; Medina, S.-N. X.; Rodríguez, L. F.; Mioduszewski, A. J.; Torres, R. M.

    2016-10-01

    Barnard 59 and Lupus 1 are two nearby star-forming regions visible from the southern hemisphere. In this manuscript, we present deep (σ˜15 μJy) radio observations (ν=6 GHz) of these regions, and report the detection of a total of 114 sources. Thirteen of these sources are associated with known young stellar objects, nine in Barnard 59 and four in Lupus 1. The properties of the radio emission (spectral index and, in some cases, polarization) suggest a thermal origin for most young stellar objects. Only for two sources (Sz 65 and Sz 67) are there indications for a possible non-thermal origin. The remaining radio detections do not have counterparts at other wavelengths, and the number of sources detected per unit solid angle is in agreement with extragalactic number counts, suggesting that they are extragalactic sources.

  1. A kinematic analysis of the Giant star-forming Region of N11

    NASA Astrophysics Data System (ADS)

    Torres-Flores, Sergio; Barbá, Rodolfo; Maíz Apellániz, Jesús; Rubio, Mónica; Bosch, Guillermo

    2015-02-01

    In this work we present high resolution spectroscopic data of the giant star-forming region of N11, obtained with the GIRAFFE instrument at the Very Large Telescope. By using this data set, we find that most of the Hα emission lines profiles in this complex can be fitted by a single Gaussian, however, multiple emission line profiles can be observed in the central region of N11. By adding all the spectra, we derive the integrated Hα profile of this complex, which displays a width (σ) of about 12 km s-1 (corrected by instrumental and thermal width). We find that a single Gaussian fit on the integrated Hα profile leaves remaining wings, which can be fitted by a secondary broad Gaussian component. In addition, we find high velocity features, which spatially correlate with soft diffuse X-ray emission.

  2. Kinematics and structure of star-forming regions: insights from cold collapse models

    NASA Astrophysics Data System (ADS)

    Kuznetsova, Aleksandra; Hartmann, Lee; Ballesteros-Paredes, Javier

    2018-01-01

    The origin of the observed morphological and kinematic substructure of young star-forming regions is a matter of debate. We offer a new analysis of data from simulations of globally gravitationally collapsing clouds of progenitor gas to answer questions about sub-structured star formation in the context of cold collapse. As a specific example, we compare our models to recent radial velocity survey data from the IN-SYNC survey of Orion and new observations of dense gas kinematics, and offer possible interpretations of kinematic and morphological signatures in the region. In the context of our model, we find the frequently observed hub-filament morphology of the gas naturally arises during gravitational evolution, as well as the dynamically distinct kinematic substructure of stars. We emphasize that the global and not just the local gravitational potential plays an important role in determining the dynamics of both clusters and filaments.

  3. An accretion disks in the high-mass star forming region IRA 23151+5912

    NASA Astrophysics Data System (ADS)

    Migenes, Victor; Rodríguez-Esnard, T.; Trinidad, M. A.

    2014-01-01

    We present observations of radio continuum emission at 1.3 and 3.6 cm and H2O masers toward the high-mass star-forming regions IRA 23151+5912 carried out with the VLA-EVLA. We detected one continuum source at 1.3 cm and 13 water maser spots which are distributed in three groups aligned along the northeast-southwest direction. Our results suggest that the 1.3 cm emission is consistent with an HC HII region, probably with an embedded zero-age main sequence star of type B2. In particular, we find that this radio continuum source is probably associated with a circumstellar disk of about 68 AU, as traced by water masers. Furthermore, the masers of the second group are probably describing another circumstellar disk of about 86 AU, whose central protostar is still undetected. We discuss this results in the light of more recent high-resolution observations.

  4. NASA's western regional applications training activity

    NASA Technical Reports Server (NTRS)

    Poulton, C. E.

    1980-01-01

    Direct involvement of educational institutions in the transfer of remote sensing technology must be increased so that the training component of the Western Regional Applications Program can be expanded within the various states. The implications of essential goals in remote sensing education and training are considered in relation to the functions of the NASA University Affairs program.

  5. A CATALOG OF METHANOL MASERS IN MASSIVE STAR-FORMING REGIONS. III. THE MOLECULAR OUTFLOW SAMPLE

    SciTech Connect

    Gómez-Ruiz, A. I.; Kurtz, S. E.; Loinard, L.

    2016-02-15

    We present an interferometric survey of the 44 GHz class I methanol maser transition toward a sample of 69 sources consisting of high-mass protostellar object (HMPO) candidates and ultracompact (UC) H ii regions. We found a 38% detection rate (16 of 42) in the HMPO candidates and a 54% detection rate (13 of 24) for the regions with ionized gas. This result indicates that class I methanol maser emission is more common toward the more evolved young stellar objects of our sample. Comparing with similar interferometric data sets, our observations show narrower linewidths, likely due to our higher spatial resolution.more » Based on a comparison between molecular outflow tracers and the maser positions, we find several cases where the masers appear to be located at the outflow interface with the surrounding core. Unlike previous surveys, we also find several cases where the masers appear to be located close to the base of the molecular outflow, although we cannot discard projection effects. This and other surveys of class I methanol masers not only suggest that these masers may trace shocks at different stages, but also that they may even trace shocks arising from a number of different phenomena occurring in star-forming regions: young/old outflows, cloud–cloud collisions, expanding H ii regions, among others.« less

  6. THE EXPANSION OF ACTIVE REGIONS INTO THE EXTENDED SOLAR CORONA

    SciTech Connect

    Morgan, Huw; Jeska, Lauren; Leonard, Drew, E-mail: hmorgan@aber.ac.uk

    2013-06-01

    Advanced image processing of Large Angle and Spectrometric Coronagraph Experiment (LASCO) C2 observations reveals the expansion of the active region closed field into the extended corona. The nested closed-loop systems are large, with an apparent latitudinal extent of 50 Degree-Sign , and expanding to heights of at least 12 R{sub Sun }. The expansion speeds are {approx}10 km s{sup -1} in the AIA/SDO field of view, below {approx}20 km s{sup -1} at 2.3 R{sub Sun }, and accelerate linearly to {approx}60 km s{sup -1} at 5 R{sub Sun }. They appear with a frequency of one every {approx}3 hr overmore » a time period of around three days. They are not coronal mass ejections (CMEs) since their gradual expansion is continuous and steady. They are also faint, with an upper limit of 3% of the brightness of background streamers. Extreme ultraviolet images reveal continuous birth and expansion of hot, bright loops from a new active region at the base of the system. The LASCO images show that the loops span a radial fan-like system of streamers, suggesting that they are not propagating within the main coronal streamer structure. The expanding loops brighten at low heights a few hours prior to a CME eruption, and the expansion process is temporarily halted as the closed field system is swept away. Closed magnetic structures from some active regions are not isolated from the extended corona and solar wind, but can expand to large heights in the form of quiescent expanding loops.« less

  7. Artificial Syntactic Violations Activate Broca's Region

    ERIC Educational Resources Information Center

    Petersson, Karl Magnus; Forkstam, Christian; Ingvar, Martin

    2004-01-01

    In the present study, using event-related functional magnetic resonance imaging, we investigated a group of participants on a grammaticality classification task after they had been exposed to well-formed consonant strings generated from an artificial regular grammar. We used an implicit acquisition paradigm in which the participants were exposed…

  8. Iron meteorites as remnants of planetesimals formed in the terrestrial planet region.

    PubMed

    Bottke, William F; Nesvorný, David; Grimm, Robert E; Morbidelli, Alessandro; O'Brien, David P

    2006-02-16

    Iron meteorites are core fragments from differentiated and subsequently disrupted planetesimals. The parent bodies are usually assumed to have formed in the main asteroid belt, which is the source of most meteorites. Observational evidence, however, does not indicate that differentiated bodies or their fragments were ever common there. This view is also difficult to reconcile with the fact that the parent bodies of iron meteorites were as small as 20 km in diameter and that they formed 1-2 Myr earlier than the parent bodies of the ordinary chondrites. Here we show that the iron-meteorite parent bodies most probably formed in the terrestrial planet region. Fast accretion times there allowed small planetesimals to melt early in Solar System history by the decay of short-lived radionuclides (such as 26Al, 60Fe). The protoplanets emerging from this population not only induced collisional evolution among the remaining planetesimals but also scattered some of the survivors into the main belt, where they stayed for billions of years before escaping via a combination of collisions, Yarkovsky thermal forces, and resonances. We predict that some asteroids are main-belt interlopers (such as (4) Vesta). A select few may even be remnants of the long-lost precursor material that formed the Earth.

  9. A Survey of Large Molecules of Biological Interest toward Selected High Mass Star Forming Regions

    NASA Technical Reports Server (NTRS)

    Remijan, A.; Shiao, Y.-S.; Friedel, D. N.; Meier, D. S.; Snyder, L. E.

    2004-01-01

    We have surveyed three high mass Galactic star forming regions for interstellar methanol (CH3OH), formic acid (HCOOH), acetic acid (CH3COOH), methyl formate (HCOOCH3), methyl cyanide (CH3CN), and ethyl cyanide (CH3CH2CN) with the BIMA Array. From our observations, we have detected two new sources of interstellar HCOOH toward the hot core regions G19.61-0.23 and W75N. We have also made the first detections of CH3CH2CN and HCOOCH3 toward G19.61-0.23. The relative HCOOH/HCOOCH3 abundance ratio toward G19.61-0.23 is 0.18 which is comparable to the abundance ratios found by Liu and colleagues toward Sgr B2(N-LMH), Orion and W51(approximately 0.10). We have made the first detection of HCOOCH3 toward W75N. The relative HCOOH/HCOOCH3 abundance ratio toward W75N is 0.26 which is more than twice as large as the abundance ratios found by Liu and colleagues. Furthermore, the hot core regions around W75N show a chemical differentiation between the O and N cores similar to what is seen toward the Orion Hot Core and Compact Ridge and W3(OH) and W3(H2O). It is also apparent from our observations that the high mass star forming region G45.47+0.05 does not contain any compact hot molecular core and as a consequence its chemistry may be similar to cold dark clouds. Finally, the formation of CH3COOH appears to favor HMCs with well mixed N and O, despite the fact that CH3COOH does not contain a N atom. If proved to be true, this is an important constraint on CH3COOH formation and possibly other structurally similar biomolecules.

  10. 77 FR 50520 - Agency Information Collection Activities: Application for Regional Center Under the Immigrant...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-21

    ... copy of the information collection instrument with supplementary documents, or need additional...-0061] Agency Information Collection Activities: Application for Regional Center Under the Immigrant Investor Pilot Program, Form I-924 and Form I-924A; Extension, Without Change, of a Currently Approved...

  11. Super active regions and production of major solar flares

    NASA Technical Reports Server (NTRS)

    Bai, T.

    1986-01-01

    The success of imaging detectors with small fields of veiw such as HXIS or P/OF (Pinhole/Occulter Facility) depends heavily on pointing to the right place at the right time. During the solar maximum years many active regions coexist on the solar disk. Therefore, in order to point the imaging detector to the right place, it is important to know which active region is most likely to produce major flares. This knowledge is also important for flare prediction. As a first step toward this goal active regions have been identified which produced major flares observed by HXRBS (Hard X-Ray Burst Spectrometer) on SMM during February 1980 through December 1983. For this study the HXRBS Event List, an updated flare list compiled by the HXRBS group, and the Comprehensive Reports of the Solar Geophysical Data were used. During this period, HXRBS detected hard X-rays from approx 7000 solar flares, out of which only 441 flares produced X-rays with peak count rates exceeding 1000 counts/s. Flares with such high peak count rates are major flares. During the same time period about 2100 active regions passed across the solar disk, out of which only 153 were observed to produce major flares. (Some active regions are known to persist for several solar rotations, but at each passage new active region numbers are assigned and the estimate is based on active region numbers.) Out of these 153 active regions, 25 were observed to produce 5 or more major flares. Considering their high productivity of major flares, we may call these active regions super active regions. These 25 super active regions produced 209 major flares, accounting for 51% of all the major flares with identified active regions.

  12. The molecular environment of the massive star forming region NGC 2024: Multi CO transition analysis

    NASA Astrophysics Data System (ADS)

    Emprechtinger, M.; Wiedner, M. C.; Simon, R.; Wieching, G.; Volgenau, N. H.; Bielau, F.; Graf, U. U.; Güsten, R.; Honingh, C. E.; Jacobs, K.; Rabanus, D.; Stutzki, J.; Wyrowski, F.

    2009-03-01

    Context: Sites of massive star formation have complex internal structures. Local heating by young stars and kinematic processes, such as outflows and stellar winds, generate large temperature and velocity gradients. Complex cloud structures lead to intricate emission line shapes. CO lines from high mass star forming regions are rarely Gaussian and show often multiple peaks. Furthermore, the line shapes vary significantly with the quantum number J_up, due to the different probed physical conditions and opacities. Aims: The goal of this paper is to show that the complex line shapes of 12CO and 13CO in NGC 2024 showing multiple emission and absorption features, which vary with rotational quantum number J can be explained consistently with a model, whose temperature and velocity structure are based on the well-established scenario of a PDR and the "Blister model". Methods: We present velocity-resolved spectra of seven 12CO and 13CO lines ranging from J_up=3 to J _up=13. We combined these data with 12CO high-frequency data from the ISO satellite and analyzed the full set of CO lines using an escape probability code and a one-dimensional full radiative transfer code. Results: We find that the bulk of the molecular cloud associated with NGC 2024 consists of warm (75 K) and dense (9× 105 cm-3) gas. An additional hot (~300 K) component, located at the interface of the HII region and the molecular cloud, is needed to explain the emission of the high-J CO lines. Deep absorption notches indicate that very cold material (~20 K) exists in front of the warm material, too. Conclusions: A temperature and column density structure consistent with those predicted by PDR models, combined with the velocity structure of a "Blister model", appropriately describes the observed emission line profiles of this massive star forming region. This case study of NGC 2024 shows that, with physical insights into these complex regions and careful modeling, multi-line observations of 12CO and 13CO

  13. A complex of active regions in April-August 1980 period

    NASA Astrophysics Data System (ADS)

    Ishkov, V. N.; Kulcar, L.

    1983-09-01

    Evidence is presented that a group of active flare regions formed a complex of flare activity. The regions were observed during the SERF program of the Maximum Solar Year in May and June, 1980. The evidence is based on the following characteristics of the complex: the influence of differential rotation on the individual components of the complex; magnetic field structures and the behavior of magnetic fluxes in the complex components; the occurrence of quasi-synchronous flares in active regions of the complex. In an analysis of these characteristics it was confirmed that there is a close physical connection between the activities of individual active regions and a complex of activity. The complex of activity is estimated to have lasted at least 5 months between April and August, 1980 and was most active and compact during the month of June.

  14. Tracking Photospheric Energy Transport in Active Regions with SDO

    NASA Astrophysics Data System (ADS)

    Attié, R.; Thompson, B. J.

    2017-12-01

    The solar photosphere presents flow fields at all observable scales. Where energy-bearing magnetic active regions break through the photosphere these flows are particularly strong, as sheared and twisted magnetic fields come into equilibrium with their surroundings while transporting magnetic energy into the corona. A part of this magnetic energy - the so-called `free energy' stored in the magnetic field in the form of "twisted" and shear of the field - is released in flares and eruptions. We can quantify the energy arrival and build-up in the corona by tracking flow fields and magnetic features at the photosphere as magnetic flux emerges and evolves before and after a flare or eruption.To do this reliably requires two things: a long series of photospheric observations at high sensitivity, spatial and temporal resolution, and an efficient, reliable and robust framework that tracks the photospheric plasma flows and magnetic evolution in both the quiet sun and active regions. SDO/HMI provides the observations, and we present here an innovative high resolution tracking framework that involves the `Balltracking' and `Magnetic Balltracking' algorithms. We show the first results of a systematic, quantitative and comprehensive measurements of the flows and transport of magnetic energy into the solar atmosphere and investigate whether this dynamic view can improve predictions of flares and Coronal Mass Ejections (CMEs).

  15. MATERIAL SUPPLY AND MAGNETIC CONFIGURATION OF AN ACTIVE REGION FILAMENT

    SciTech Connect

    Zou, P.; Fang, C.; Chen, P. F.

    2016-11-10

    It is important to study the fine structures of solar filaments with high-resolution observations, since it can help us understand the magnetic and thermal structures of the filaments and their dynamics. In this paper, we study a newly formed filament located inside the active region NOAA 11762, which was observed by the 1.6 m New Solar Telescope at Big Bear Solar Observatory from 16:40:19 UT to 17:07:58 UT on 2013 June 5. As revealed by the H α filtergrams, cool material is seen to be injected into the filament spine with a speed of 5–10 km s{sup -1}. At themore » source of the injection, brightenings are identified in the chromosphere, which are accompanied by magnetic cancellation in the photosphere, implying the importance of magnetic reconnection in replenishing the filament with plasmas from the lower atmosphere. Counter-streamings are detected near one endpoint of the filament, with the plane-of-the-sky speed being 7–9 km s{sup -1} in the H α red-wing filtergrams and 9–25 km s{sup -1} in the blue-wing filtergrams. The observations are indicative that this active region filament is supported by a sheared arcade without magnetic dips, and the counter-streamings are due to unidirectional flows with alternative directions, rather than due to the longitudinal oscillations of filament threads as in many other filaments.« less

  16. LOW-LATITUDE CORONAL HOLES, DECAYING ACTIVE REGIONS, AND GLOBAL CORONAL MAGNETIC STRUCTURE

    SciTech Connect

    Petrie, G. J. D.; Haislmaier, K. J.

    2013-10-01

    We study the relationship between decaying active-region magnetic fields, coronal holes, and the global coronal magnetic structure using Global Oscillations Network Group synoptic magnetograms, Solar TErrestrial RElations Observatory extreme-ultraviolet synoptic maps, and coronal potential-field source-surface models. We analyze 14 decaying regions and associated coronal holes occurring between early 2007 and late 2010, 4 from cycle 23 and 10 from cycle 24. We investigate the relationship between asymmetries in active regions' positive and negative magnetic intensities, asymmetric magnetic decay rates, flux imbalances, global field structure, and coronal hole formation. Whereas new emerging active regions caused changes in the large-scale coronal field,more » the coronal fields of the 14 decaying active regions only opened under the condition that the global coronal structure remained almost unchanged. This was because the dominant slowly varying, low-order multipoles prevented opposing-polarity fields from opening and the remnant active-region flux preserved the regions' low-order multipole moments long after the regions had decayed. Thus, the polarity of each coronal hole necessarily matched the polar field on the side of the streamer belt where the corresponding active region decayed. For magnetically isolated active regions initially located within the streamer belt, the more intense polarity generally survived to form the hole. For non-isolated regions, flux imbalance and topological asymmetry prompted the opposite to occur in some cases.« less

  17. A multi-wavelength database of water vapor in planet-forming regions

    NASA Astrophysics Data System (ADS)

    Pontoppidan, Klaus

    The inner few astronomical units of gas-rich protoplanetary disk are environments characterized by a rich and active gaseous chemistry. Primitive material left over from the formation of our own Solar System has for a long time yielded tantalizing clues to a heterogenous nebula with intricate dynamical, thermal and chemical structure that ultimately led to a great diversity in the planets and planetesimals of the Solar System. The discovery of a rich chemistry in protoplanetary disks via a forest of strong 3-40 micron molecular emission lines (H2O, OH, CO2, HCN, C2H2,...) allows us for the first time to investigate chemical diversity in other planet-forming environmments (Salyk et al. 2008; Carr & Najita 2008). Further efforts, supported by the Origins program, has established that this molecular forest is seen in the disks surrounding most young solar- type stars (Pontoppidan et al. 2010). We propose a 3-year program to analyze our growing multi-wavelength database of observations of water, OH and organic molecules in the surfaces of protoplanetary disks. The database includes high (R~25,000-100,000) and medium resolution (R~600-3000) 3- 200 micron spectra from a wide range of facilities (Keck-NIRSPEC, VLT-CRIRES, Spitzer-IRS, VLT-VISIR, Gemini-Michelle and Herschel-PACS). Our previous efforts have focused on demonstrating feasibility for observing water and other molecules in planet-forming regions, building statistics to show that the molecular forest is ubiquitous in disks around low-mass and solar-type stars and taking the first steps in understanding the implied chemical abundances. Now, as the next logical step, we will combine multi- wavelength data from our unique multi-wavelength database to map the radial distribution of, in particular, water and its derivatives. 1) Â We will use both line profile information from the high-resolution spectra, as well as line strengths, from a combination of high and low temperature lines to constrain the radial

  18. A multi-wavelength database of water vapor in planet-forming regions

    NASA Astrophysics Data System (ADS)

    Pontoppidan, Klaus

    The inner few astronomical units of gas-rich protoplanetary disk are environments characterized by a rich and active gaseous chemistry. Primitive material left over from the formation of our own Solar System has for a long time yielded tantalizing clues to a heterogenous nebula with intricate dynamical, thermal and chemical structure that ultimately led to a great diversity in the planets and planetesimals of the Solar System. The discovery of a rich chemistry in protoplanetary disks via a forest of strong 3-40 micron molecular emission lines (H2O, OH, CO2, HCN, C2H2,...) allows us for the first time to investigate chemical diversity in other planet-forming environmments (Salyk et al. 2008; Carr & Najita 2008). Further efforts, supported by the Origins program, has established that this molecular forest is seen in the disks surrounding most young solar- type stars (Pontoppidan et al. 2010). We propose a 3-year program to analyze our growing multi-wavelength database of observations of water, OH and organic molecules in the surfaces of protoplanetary disks. The database includes high (R~25,000-100,000) and medium resolution (R~600-3000) 3- 200 micron spectra from a wide range of facilities (Keck-NIRSPEC, VLT-CRIRES, Spitzer-IRS, VLT-VISIR, Gemini-Michelle and Herschel-PACS). Our previous efforts have focused on demonstrating feasibility for observing water and other molecules in planet-forming regions, building statistics to show that the molecular forest is ubiquitous in disks around low-mass and solar-type stars and taking the first steps in understanding the implied chemical abundances. Now, as the next logical step, we will combine multi- wavelength data from our unique multi-wavelength database to map the radial distribution of, in particular, water and its derivatives. 1) We will use both line profile information from the high-resolution spectra, as well as line strengths, from a combination of high and low temperature lines to constrain the radial abundance

  19. OBSERVING CORONAL NANOFLARES IN ACTIVE REGION MOSS

    SciTech Connect

    Testa, Paola; DeLuca, Ed; Golub, Leon

    2013-06-10

    The High-resolution Coronal Imager (Hi-C) has provided Fe XII 193A images of the upper transition region moss at an unprecedented spatial ({approx}0.''3-0.''4) and temporal (5.5 s) resolution. The Hi-C observations show in some moss regions variability on timescales down to {approx}15 s, significantly shorter than the minute-scale variability typically found in previous observations of moss, therefore challenging the conclusion of moss being heated in a mostly steady manner. These rapid variability moss regions are located at the footpoints of bright hot coronal loops observed by the Solar Dynamics Observatory/Atmospheric Imaging Assembly in the 94 A channel, and by the Hinode/X-Raymore » Telescope. The configuration of these loops is highly dynamic, and suggestive of slipping reconnection. We interpret these events as signatures of heating events associated with reconnection occurring in the overlying hot coronal loops, i.e., coronal nanoflares. We estimate the order of magnitude of the energy in these events to be of at least a few 10{sup 23} erg, also supporting the nanoflare scenario. These Hi-C observations suggest that future observations at comparable high spatial and temporal resolution, with more extensive temperature coverage, are required to determine the exact characteristics of the heating mechanism(s).« less

  20. Subsurface helicity of active regions 12192 and 10486

    NASA Astrophysics Data System (ADS)

    Komm, Rudolf; Tripathy, Sushant; Howe, Rachel; Hill, Frank

    2015-04-01

    The active region 10486 that produced the Halloween flares in 2003 initiated our interest in the kinetic helicity of subsurface flows associated with active regions. This lead to the realization that the helicity of subsurface flows is related to the flare activity of active regions. Eleven years later, a similarly enormous active region (12192) appeared on the solar surface. We plan to study the kinetic helicity of the subsurface flows associated with region 12192 and compare it to that of region 10486. For 10486, we have analyzed Dopplergrams obtained with the Michelson Doppler Imager (MDI) onboard the Solar and Heliospheric Observatory (SOHO) and the Global Oscillation Network Group (GONG) with a dense-pack ring-diagram analysis. For 12192, we have analyzed Dopplergrams from GONG and the Helioseismic and Magnetic Imager (HMI) onboard the Solar Dynamics Observatory (SDO). We will present the latest results.

  1. Homologous flares and the evolution of NOAA Active Region 2372

    NASA Technical Reports Server (NTRS)

    Strong, K. T.; Smith, J. B., Jr.; Mccabe, M. K.; Machado, M. E.; Saba, J. L. R.; Simnett, G. M.

    1984-01-01

    A detailed record of the evolution of NOAA Active Region 2372 has been compiled by the FBS Homology Study Group. It was one of the most prolific flare-producing regions observed by SMM. The flares occurred in distinct stages which corresponded to particular evolutionary phases in the development of the active region magnetic field. By comparison with a similar but less productive active region, it is found that the activity seems to be related to the magnetic complexity of the region and the amount of shear in the field. Further, the soft X-ray emission in the quiescent active region is related to its flare rate. Within the broader definition of homology adopted, there was a degree of homology between the events within each stage of evolution of AR2372.

  2. A Fractal Dimension Survey of Active Region Complexity

    NASA Technical Reports Server (NTRS)

    McAteer, R. T. James; Gallagher, Peter; Ireland, Jack

    2005-01-01

    A new approach to quantifying the magnetic complexity of active regions using a fractal dimension measure is presented. This fully-automated approach uses full disc MDI magnetograms of active regions from a large data set (2742 days of the SoHO mission; 9342 active regions) to compare the calculated fractal dimension to both Mount Wilson classification and flare rate. The main Mount Wilson classes exhibit no distinct fractal dimension distribution, suggesting a self-similar nature of all active regions. Solar flare productivity exhibits an increase in both the frequency and GOES X-ray magnitude of flares from regions with higher fractal dimensions. Specifically a lower threshold fractal dimension of 1.2 and 1.25 exists as a necessary, but not sufficient, requirement for an active region to produce M- and X-class flares respectively .

  3. The X-ray Emitting OB Population of MYStIX Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    Busk, Heather

    Despite the large influence of massive stars on their environments, they remain incompletely catalogued. High extinction, diffuse emission, and contamination by foreground and background stars hinder the improvement of the census within massive star forming regions. These difficulties are alleviated by restricting the search to only stars with detectable X-ray emission, and by using infrared photometry. OB stars are distinguished from young stellar objects by fitting the photometry to stellar atmosphere models incorporating extinction. The results are a list of candidate OB stars with inferred extinctions and spectral types, in each of eighteen regions studied in the Massive Young Stellar Complexes in the Infrared and X-ray (MYStIX) project. If correct, these results increase the population of stars of spectral types B1 and earlier by 28% over all the observed regions, with varying percentages of new candidates in each region. Notable results include: the identification of the OB population of a recently discovered third cluster in NGC 6357; the possible identification of a new massive cluster near the Trifid Nebula; the potential identification of some of the influential stars and an increase of 175% of the OB population in NGC 6334; a lack of candidates in the Flame Nebula; a doubling of the OB population in RCW 38, and an increase of 80% in NGC 3576; as well as a number of O candidates, with some potentially as early as O3. Finally, W4 has an overabundance of massive stars for its X-ray emitting population. We also compare to observed spectral types for the candidates in M17 obtained by C. Kobulnicky (private communication), and find that if the proportion holds true for other regions, roughly 67% of the candidates are correctly identified as massive, so that the overall increase of the OB population is 19%.

  4. Young Stellar Objects in the Massive Star-forming Regions W51 and W43

    SciTech Connect

    Saral, G.; Audard, M.; Hora, J. L.

    2017-04-20

    We present the results of our investigation of the star-forming complexes W51 and W43, two of the brightest in the first Galactic quadrant. In order to determine the young stellar object (YSO) populations in W51 and W43 we used color–magnitude relations based on Spitzer mid-infrared and 2MASS/UKIDSS near-infrared data. We identified 302 Class I YSOs and 1178 Class II/transition disk candidates in W51, and 917 Class I YSOs and 5187 Class II/transition disk candidates in W43. We also identified tens of groups of YSOs in both regions using the Minimal Spanning Tree (MST) method. We found similar cluster densities inmore » both regions, even though Spitzer was not able to probe the densest part of W43. By using the Class II/I ratios, we traced the relative ages within the regions and, based on the morphology of the clusters, we argue that several sites of star formation are independent of one another in terms of their ages and physical conditions. We used spectral energy distribution-fitting to identify the massive YSO (MYSO) candidates since they play a vital role in the star formation process, and then examined them to see if they are related to any massive star formation tracers such as UCH ii regions, masers, or dense fragments. We identified 17 MYSO candidates in W51, and 14 in W43, respectively, and found that groups of YSOs hosting MYSO candidates are positionally associated with H ii regions in W51, though we do not see any MYSO candidates associated with previously identified massive dense fragments in W43.« less

  5. PARALLAXES OF STAR-FORMING REGIONS IN THE OUTER SPIRAL ARM OF THE MILKY WAY

    SciTech Connect

    Hachisuka, K.; Choi, Y. K.; Reid, M. J.

    2015-02-10

    We report parallaxes and proper motions of three water maser sources in high-mass star-forming regions in the Outer Spiral Arm of the Milky Way. The observations were conducted with the Very Long Baseline Array as part of Bar and Spiral Structure Legacy Survey and double the number of such measurements in the literature. The Outer Arm has a pitch angle of 14.°9 ± 2.°7 and a Galactocentric distance of 14.1 ± 0.6 kpc toward the Galactic anticenter. The average motion of these sources toward the Galactic center is 10.7 ± 2.1 km s{sup –1} and we see no sign ofmore » a significant fall in the rotation curve out to 15 kpc from the Galactic center. The three-dimensional locations of these star-forming regions are consistent with a Galactic warp of several hundred parsecs from the plane.« less

  6. Tracing the atomic nitrogen abundance in star-forming regions with ammonia deuteration

    NASA Astrophysics Data System (ADS)

    Furuya, Kenji; Persson, Magnus V.

    2018-03-01

    Partitioning of elemental nitrogen in star-forming regions is not well constrained. Most nitrogen is expected to be partitioned among atomic nitrogen (N I), molecular nitrogen (N2), and icy N-bearing molecules, such as NH3 and N2. N I is not directly observable in the cold gas. In this paper, we propose an indirect way to constrain the amount of N I in the cold gas of star-forming clouds, via deuteration in ammonia ice, the [ND2H/NH2D]/[NH2D/NH3] ratio. Using gas-ice astrochemical simulations, we show that if atomic nitrogen remains as the primary reservoir of nitrogen during cold ice formation stages, the [ND2H/NH2D]/[NH2D/NH3] ratio is close to the statistical value of 1/3 and lower than unity, whereas if atomic nitrogen is largely converted into N-bearing molecules, the ratio should be larger than unity. Observability of ammonia isotopologues in the inner hot regions around low-mass protostars, where ammonia ice has sublimated, is also discussed. We conclude that the [ND2H/NH2D]/[NH2D/NH3] ratio can be quantified using a combination of VLA and ALMA observations with reasonable integration times, at least toward IRAS 16293-2422 where high molecular column densities are expected.

  7. Zeeman effect in sulfur monoxide. A tool to probe magnetic fields in star forming regions

    NASA Astrophysics Data System (ADS)

    Cazzoli, Gabriele; Lattanzi, Valerio; Coriani, Sonia; Gauss, Jürgen; Codella, Claudio; Ramos, Andrés Asensio; Cernicharo, José; Puzzarini, Cristina

    2017-09-01

    Context. Magnetic fields play a fundamental role in star formation processes and the best method to evaluate their intensity is to measure the Zeeman effect of atomic and molecular lines. However, a direct measurement of the Zeeman spectral pattern from interstellar molecular species is challenging due to the high sensitivity and high spectral resolution required. So far, the Zeeman effect has been detected unambiguously in star forming regions for very few non-masing species, such as OH and CN. Aims: We decided to investigate the suitability of sulfur monoxide (SO), which is one of the most abundant species in star forming regions, for probing the intensity of magnetic fields via the Zeeman effect. Methods: We investigated the Zeeman effect for several rotational transitions of SO in the (sub-)mm spectral regions by using a frequency-modulated, computer-controlled spectrometer, and by applying a magnetic field parallel to the radiation propagation (I.e., perpendicular to the oscillating magnetic field of the radiation). To support the experimental determination of the g factors of SO, a systematic quantum-chemical investigation of these parameters for both SO and O2 has been carried out. Results: An effective experimental-computational strategy for providing accurate g factors as well as for identifying the rotational transitions showing the strongest Zeeman effect has been presented. Revised g factors have been obtained from a large number of SO rotational transitions between 86 and 389 GHz. In particular, the rotational transitions showing the largest Zeeman shifts are: N,J = 2, 2 ← 1, 1 (86.1 GHz), N,J = 4, 3 ← 3, 2 (159.0 GHz), N,J = 1, 1 ← 0, 1 (286.3 GHz), N,J = 2, 2 ← 1, 2 (309.5 GHz), and N,J = 2, 1 ← 1, 0 (329.4 GHz). Our investigation supports SO as a good candidate for probing magnetic fields in high-density star forming regions. The complete list of measured Zeeman components is only available at the CDS via anonymous ftp to http

  8. Smoking Discriminately Changes the Serum Active and Non-Active Forms of Vitamin B12.

    PubMed

    Shekoohi, Niloofar; Javanbakht, Mohammad Hassan; Sohrabi, Marjan; Zarei, Mahnaz; Mohammadi, Hamed; Djalali, Mahmoud

    2017-06-01

    Smoking may modify the appetite, and consequently affect nutrient intake and serum micronutrients. The effect of smoking on vitamin B12 status has been considered in several studies. The research proposed that organic nitrites, nitro oxide, cyanides, and isocyanides of cigarette smoke interfere with vitamin B12 metabolism, and convert it to inactive forms. This research was carried out to determine the serum level of active and inactive forms of vitamin B12 in male smokers in comparison with male nonsmokers. This is a case-control study, in which the participants were 85 male smokers and 85 male nonsmokers. The serum levels of total and active form of vitamin B12 were measured. Dietary intake was recorded by a quantitative food frequency questionnaire and one-day 24-hour dietary recall method. Independent two sample T test was used to compare quantitative variables between the case and control groups. The serum level of total vitamin B12 was not significantly different between two groups, but serum level of active form of vitamin B12 in the smoking group was significantly lower than non-smoking group (P<0.001). This is one of the first studies that evaluated the serum level of active form of vitamin B12 in smokers in the Iranian community. The results of this study identified that serum level of total vitamin B12 might be not different between smoking and non-smoking people, but the function of this vitamin is disturbed in the body of smokers through the reduction of serum level of active form of vitamin B12.

  9. 75 FR 26782 - Agency Information Collection Activities: Form I-864, Form I-864A, Form I-864EZ, and Form I-864W...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-12

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... Household Member, Form I-864EZ, Affidavit of Support Under Section 213A of the Act; Form I-864W, Intending..., U.S. Citizenship and Immigration Services (USCIS) has submitted the following information collection...

  10. 76 FR 41279 - Agency Information Collection Activities; Form I-864, Form I-864A, Form I-864EZ, and Form I-864W...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-13

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... Household Member, Form I-864 EZ, Affidavit of Support Under Section 213A of the Act; Form I-864W, Intending... Immigration Services (USCIS) will be submitting the following information collection request to the Office of...

  11. Infrared polarization images of star-forming regions. I - The ubiquity of bipolar structure

    NASA Technical Reports Server (NTRS)

    Tamura, M.; Gatley, Ian; Joyce, R. R.; Ueno, M.; Suto, H.; Sekiguchi, M.

    1991-01-01

    The inefficiency of the stellar formation process leads rather generally to high residual dust densities, and so to the existence of infrared reflection nebulosity (IRN), in regions of star formation. Polarization images of several star-forming regions with mass outflows (GSS 30, S255, GL 5180, GL 2591, GGD 27, and NGC 7538) presented here: (1) establish the universality of bipolarity and of shell or cavity structure in the IRN consistent with that of CO outflow; (2) identify the source of the mass outflow in each case; (3) show that the opening angle near this central source is large; and (4) demonstrate several instances of multiple shells, probably arising from episodic mass loss. Astrometry of 2.2-micron sources with arcsecond accuracy identifies the illuminating source of each IRN uniquely with a compact H II region or a bright IR source. The polarization images provide strong evidence for large-scale dust toroids around each of these sources. The density and mass of these disks are estimated from the extinction through the disk.

  12. High angular resolution observations of star-forming regions with BETTII and SOFIA

    NASA Astrophysics Data System (ADS)

    Rizzo, Maxime; Rinehart, Stephen; Mundy, Lee G.; Benford, Dominic J.; Dhabal, Arnab; Fixsen, Dale J.; Leisawitz, David; Maher, Stephen F.; Mentzell, Eric; Silverberg, Robert F.; Staguhn, Johannes; Veach, Todd; Cardiff BETTII Team

    2016-01-01

    High angular resolution observations in the far-infrared are important to understand the star formation process in embedded star clusters where extinction is large and stars form in close proximity. The material taking part in the star forming process is heated by the young stars and emits primarily in the far-IR; hence observations of the far-IR dust emission yields vital information about the gravitational potential, the mass and energy distribution, and core/star formation process. Previous observatories, such as Herschel, Spitzer and WISE lack the angular resolution required to study these dense star forming cores and are further limited by saturation in bright cores.The Balloon Experimental Twin Telescope for Infrared Interferometry (BETTII) is pioneering the path to sub-arcsecond resolution at far-IR wavelengths. This thesis talk discusses the instrumental challenges in building BETTII, as well as results from our SOFIA survey to illustrate the potential of higher-angular resolution observations. The 8m-long two element interferometer is being tested at NASA GSFC and is scheduled for first flight in fall 2016. BETTII will provide 0.5 to 1 arcsecond spatial resolution and spectral resolving power of 10 to 100 between 30 and 90 microns, where most of the dust continuum emission peaks in local star forming regions. It will achieve spatially-resolved spectroscopy of bright, dense cores with unprecedented high definition. This talk focuses on the main challenges and solutions associated with building BETTII: thermal stability, attitude/pointing control, and path length stabilization. In each of these areas we look at the trade-off between design, control, and knowledge in order to achieve the best-possible instrumental capability and sensitivity.As a first step towards resolving cluster cores, we surveyed 10 nearby star-forming clusters with SOFIA FORCAST at 11, 19, 31 and 37 microns. The FORCAST instrument has the highest angular resolution currently available in

  13. Spontaneous activity forms a foundation for odor-evoked activation maps in the rat olfactory bulb.

    PubMed

    Thompson, Garth J; Sanganahalli, Basavaraju G; Baker, Keeley L; Herman, Peter; Shepherd, Gordon M; Verhagen, Justus V; Hyder, Fahmeed

    2018-01-31

    Fluctuations in spontaneous activity have been observed by many neuroimaging techniques, but because these resting-state changes are not evoked by stimuli, it is difficult to determine how they relate to task-evoked activations. We conducted multi-modal neuroimaging scans of the rat olfactory bulb, both with and without odor, to examine interaction between spontaneous and evoked activities. Independent component analysis of spontaneous fluctuations revealed resting-state networks, and odor-evoked changes revealed activation maps. We constructed simulated activation maps using resting-state networks that were highly correlated to evoked activation maps. Simulated activation maps derived by intrinsic optical signal (IOS), which covers the dorsal portion of the glomerular sheet, significantly differentiated one odor's evoked activation map from the other two. To test the hypothesis that spontaneous activity of the entire glomerular sheet is relevant for representing odor-evoked activations, we used functional magnetic resonance imaging (fMRI) to map the entire glomerular sheet. In contrast to the IOS results, the fMRI-derived simulated activation maps significantly differentiated all three odors' evoked activation maps. Importantly, no evoked activation maps could be significantly differentiated using simulated activation maps produced using phase-randomized resting-state networks. Given that some highly organized resting-state networks did not correlate with any odors' evoked activation maps, we posit that these resting-state networks may characterize evoked activation maps associated with odors not studied. These results emphasize that fluctuations in spontaneous activity form a foundation for active processing, signifying the relevance of resting-state mapping to functional neuroimaging. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Pharmacovigilance study of a regional intravenous immunoglobulin (II): evaluation and comparison of an improved pharmaceutical form.

    PubMed

    Mahieu, A C; Sisti, A M; Joekes, S; Manfredi, M J

    2006-01-01

    Intravenous immunoglobulin (IVIG) therapy is an effective treatment in patients with different diseases. This product must comply with all the regulatory requirements established by the World Health Organization and the European Pharmacopoeia for clinical tolerance, therapeutic efficacy, and viral safety. Although IVIG are effective and safe products, in some patients they may cause adverse reactions. The aim of this study was to assess the clinical tolerance of two pharmaceutical forms (lyophilized and liquid) of Imunoglobulina G Endovenosa UNC (IVIG UNC), a regional IVIG preparation, and to compare the reported data. The pharmacovigilance reports of 149 infusions in 51 patients treated with lyophilized IVIG UNC and of 157 infusions in 53 patients treated with liquid IVIG UNC were statistically evaluated. Clinical tolerance was evaluated through the adverse reactions reported. Lyophilized IVIG UNC: adverse reactions were reported in 6.7 % of the total number of infusions. Of these reactions, 4.0 % were mild, 2.0 % were moderate, and 0.7 % severe. Liquid IVIG UNC: adverse reactions were reported in 3.2 % of the total number of infusions; of these, 1.3 % were mild, 1.9 % were moderate, and 0.0 % were severe. Statistical analysis showed no association between tolerance and the pharmaceutical form used (p > 0.05) and indicated similar tolerance for both preparations. Based on the results obtained, the excellent clinical tolerance of both pharmaceutical forms of IVIG UNC can be confirmed.

  15. Is the filamentary dark cloud GF 6 a star forming region? — Stability analysis and infrared properties

    NASA Astrophysics Data System (ADS)

    Kim, Jaeheon; Kim, Hyun-Goo; Kim, Sang Joon; Zhang, Bo

    2017-12-01

    We present the results of mapping observations and stability analyses toward the filamentary dark cloud GF 6. We investigate the internal structures of a typical filamentary dark cloud GF 6 to know whether the filamentary dark cloud will form stars. We perform radio observations with both 12CO (J=1-0) and 13CO (J=1-0) emission lines to examine the mass distribution and its evolutionary status. The 13CO gas column density map shows eight subclumps in the GF 6 region with sizes on a sub-pc scale. The resulting local thermodynamic equilibrium masses of all the subclumps are too low to form stars against the turbulent dissipation. We also investigate the properties of embedded infrared point sources to know whether they are newly formed stars. The infrared properties also indicate that these point sources are not related to star forming activities associated with GF 6. Both radio and infrared properties indicate that the filamentary dark cloud GF 6 is too light to contract gravitationally and will eventually be dissipated away.

  16. Structure and Form. Elementary Science Activity Series, Volume 2.

    ERIC Educational Resources Information Center

    Blackwell, Frank F.

    This book is number 2 of a series of elementary science books that presents a wealth of ideas for science activities for the elementary school teacher. Each activity includes a standard set of information designed to help teachers determine the activity's appropriateness for their students, plan its implementation, and help children focus on a…

  17. Remote sensing application to regional activities

    NASA Technical Reports Server (NTRS)

    Shahrokhi, F.; Jones, N. L.; Sharber, L. A.

    1976-01-01

    Two agencies within the State of Tennessee were identified whereby the transfer of aerospace technology, namely remote sensing, could be applied to their stated problem areas. Their stated problem areas are wetland and land classification and strip mining studies. In both studies, LANDSAT data was analyzed with the UTSI video-input analog/digital automatic analysis and classification facility. In the West Tennessee area three land-use classifications could be distinguished; cropland, wetland, and forest. In the East Tennessee study area, measurements were submitted to statistical tests which verified the significant differences due to natural terrain, stripped areas, various stages of reclamation, water, etc. Classifications for both studies were output in the form of maps of symbols and varying shades of gray.

  18. Long-term Variability of H2CO Masers in Star-forming Regions

    NASA Astrophysics Data System (ADS)

    Andreev, N.; Araya, E. D.; Hoffman, I. M.; Hofner, P.; Kurtz, S.; Linz, H.; Olmi, L.; Lorran-Costa, I.

    2017-10-01

    We present results of a multi-epoch monitoring program on variability of 6 cm formaldehyde (H2CO) masers in the massive star-forming region NGC 7538 IRS 1 from 2008 to 2015, conducted with the Green Bank Telescope, the Westerbork Radio Telescope , and the Very Large Array. We found that the similar variability behaviors of the two formaldehyde maser velocity components in NGC 7538 IRS 1 (which was pointed out by Araya and collaborators in 2007) have continued. The possibility that the variability is caused by changes in the maser amplification path in regions with similar morphology and kinematics is discussed. We also observed 12.2 GHz methanol and 22.2 GHz water masers toward NGC 7538 IRS 1. The brightest maser components of CH3OH and H2O species show a decrease in flux density as a function of time. The brightest H2CO maser component also shows a decrease in flux density and has a similar LSR velocity to the brightest H2O and 12.2 GHz CH3OH masers. The line parameters of radio recombination lines and the 20.17 and 20.97 GHz CH3OH transitions in NGC 7538 IRS 1 are also reported. In addition, we observed five other 6 cm formaldehyde maser regions. We found no evidence of significant variability of the 6 cm masers in these regions with respect to previous observations, the only possible exception being the maser in G29.96-0.02. All six sources were also observed in the {{{H}}}213{CO} isotopologue transition of the 6 cm H2CO line; {{{H}}}213{CO} absorption was detected in five of the sources. Estimated column density ratios [{{{H}}}212{CO}]/[{{{H}}}213{CO}] are reported.

  19. Self-similar fragmentation regulated by magnetic fields in a region forming massive stars

    NASA Astrophysics Data System (ADS)

    Li, Hua-Bai; Yuen, Ka Ho; Otto, Frank; Leung, Po Kin; Sridharan, T. K.; Zhang, Qizhou; Liu, Hauyu; Tang, Ya-Wen; Qiu, Keping

    2015-04-01

    Most molecular clouds are filamentary or elongated. For those forming low-mass stars (<8 solar masses), the competition between self-gravity and turbulent pressure along the dynamically dominant intercloud magnetic field (10 to 100 parsecs) shapes the clouds to be elongated either perpendicularly or parallel to the fields. A recent study also suggested that on the scales of 0.1 to 0.01 parsecs, such fields are dynamically important within cloud cores forming massive stars (>8 solar masses). But whether the core field morphologies are inherited from the intercloud medium or governed by cloud turbulence is unknown, as is the effect of magnetic fields on cloud fragmentation at scales of 10 to 0.1 parsecs. Here we report magnetic-field maps inferred from polarimetric observations of NGC 6334, a region forming massive stars, on the 100 to 0.01 parsec scale. NGC 6334 hosts young star-forming sites where fields are not severely affected by stellar feedback, and their directions do not change much over the entire scale range. This means that the fields are dynamically important. The ordered fields lead to a self-similar gas fragmentation: at all scales, there exist elongated gas structures nearly perpendicular to the fields. Many gas elongations have density peaks near the ends, which symmetrically pinch the fields. The field strength is proportional to the 0.4th power of the density, which is an indication of anisotropic gas contractions along the field. We conclude that magnetic fields have a crucial role in the fragmentation of NGC 6334.

  20. Observations of Cyanopolyynes toward Four High-mass Star-forming Regions Containing Hot Cores

    NASA Astrophysics Data System (ADS)

    Taniguchi, Kotomi; Saito, Masao; Hirota, Tomoya; Ozeki, Hiroyuki; Miyamoto, Yusuke; Kaneko, Hiroyuki; Minamidani, Tetsuhiro; Shimoikura, Tomomi; Nakamura, Fumitaka; Dobashi, Kazuhito

    2017-07-01

    We carried out line survey observations at the 26-30 GHz band toward the four high-mass star-forming regions containing hot cores, G10.30-0.15, G12.89+0.49, G16.86-2.16, and G28.28-0.36, with the Robert C. Byrd Green Bank Telescope. We have detected HC5N from all of the sources, and HC7N from the three sources, except for G10.30-0.15. We further conducted observations of HC5N at the 42-46 GHz and 82-103 GHz bands toward the three sources, G12.89+0.49, G16.86-2.16, and G28.28-0.36, with the Nobeyama 45 m radio telescope. The rotational lines of HC5N with the high-excitation energies ({E}{{u}}/k˜ 63{--}100 K), which are hardly excited in the cold dark clouds, have been detected from the three sources. The rotational temperatures of HC5N are found to be ˜13-20 K in the three sources. The detection of the lines with the high-excitation energies and the derived rotational temperatures indicate that HC5N exists in the warm gas within 0.07-0.1 pc radii around massive young stellar objects. The column densities of HC5N in the three sources are derived to be (˜2.0-2.8) × {10}13 cm-2. We compare the ratios between N(HC5N) the column density of HC5N and W(CH3OH) the integrated intensity of the thermal CH3OH emission line among the three high-mass star-forming regions. We found a possibility of the chemical differentiation in the three high-mass star-forming regions; G28.28-0.36 shows the largest N(HC5N)/W(CH3OH) ratio of > 8.0× {10}14 in units of (K km s-1)-1 cm-2, while G12.89+0.49 and G16.86-2.16 show the smaller values (˜ 2× {10}13).

  1. Molecular Hydrogen Images of Star Forming Regions in the Magellanic Clouds

    NASA Astrophysics Data System (ADS)

    Probst, Ronald G.; Barba, R.; Bolatto, A.; Chu, Y.; Points, S.; Rubio, M.; Smith, C.

    2011-01-01

    The Large and Small Magellanic Clouds exhibit a variety of star formation physics with multiple phase components in low metallicity, gas rich environments. The 10 K, 100 K, and 104 K regimes are well explored. We are imaging LMC and SMC star forming regions in 2.12 micron H2 emission which arises in the 1000 K transition zone of molecular clouds. This is an NOAO Survey program using the widefield IR camera NEWFIRM on the CTIO 4-m Blanco telescope during its limited southern deployment. The data set will have immediate morphological applications and will provide target selection for followup infrared spectroscopy. We will provide a public archive of fully calibrated images with no proprietary period. NOAO is operated by the Association of Universities for Research in Astronomy, under cooperative agreement with the National Science Foundation.

  2. Deep Near-Infrared Surveys and Young Brown Dwarf Populations in Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    Tamura, M.; Naoi, T.; Oasa, Y.; Nakajima, Y.; Nagashima, C.; Nagayama, T.; Baba, D.; Nagata, T.; Sato, S.; Kato, D.; Kurita, M.; Sugitani, K.; Itoh, Y.; Nakaya, H.; Pickles, A.

    2003-06-01

    We are currently conducting three kinds of IR surveys of star forming regions (SFRs) in order to seek for very low-mass young stellar populations. First is a deep JHKs-bands (simultaneous) survey with the SIRIUS camera on the IRSF 1.4m or the UH 2.2m telescopes. Second is a very deep JHKs survey with the CISCO IR camera on the Subaru 8.2m telescope. Third is a high resolution companion search around nearby YSOs with the CIAO adaptive optics coronagraph IR camera on the Subaru. In this contribution, we describe our SIRIUS camera and present preliminary results of the ongoing surveys with this new instrument.

  3. Gold ore-forming fluids of the Tanami region, Northern Australia

    NASA Astrophysics Data System (ADS)

    Mernagh, Terrence P.; Wygralak, Andrew S.

    2007-01-01

    Fluid inclusion studies have been carried out on major gold deposits and prospects in the Tanami region to determine the compositions of the associated fluids and the processes responsible for gold mineralization. Pre-ore, milky quartz veins contain only two-phase aqueous inclusions with salinities ≤19 wt% NaCl eq. and homogenization temperatures that range from 110 to 410°C. In contrast, the ore-bearing veins typically contain low to moderate salinity (<14 wt% NaCl eq.), H2O + CO2 ± CH4 ± N2-bearing fluids. The CO2-bearing inclusions coexist with two-phase aqueous inclusions that exhibit a wider range of salinities (≤21 wt% NaCl eq.). Post-ore quartz and carbonate veins contain mainly two-phase aqueous inclusions, with a last generation of aqueous inclusions being very CaCl2-rich. Salinities range from 7 to 33 wt% NaCl eq. and homogenization temperatures vary from 62 to 312°C. Gold deposits in the Tanami region are hosted by carbonaceous or iron-rich sedimentary rocks and/or mafic rocks. They formed over a range of depths at temperatures from 200 to 430°C. The Groundrush deposit formed at the greatest temperatures and depths (260-430°C and ≤11 km), whereas deposits in the Tanami goldfield formed at the lowest temperatures (≥200°C) and at the shallowest depths (1.5-5.6 km). There is also evidence in the Tanami goldfield for late-stage isothermal mixing with higher salinity (≤21 wt% NaCl eq.) fluids at temperatures between 100 and 200°C. Other deposits (e.g., The Granites, Callie, and Coyote) formed at intermediate depths and at temperatures ranging from 240 to 360°C. All ore fluids contained CO2 ± N2 ± CH4, with the more deeply formed deposits being enriched in CH4 and higher level deposits being enriched in CO2. Fluids from deposits hosted mainly by sedimentary rocks generally contained appreciable quantities of N2. The one exception is the Tanami goldfield, where the quartz veins were dominated by aqueous inclusions with rare CO2-bearing

  4. A Chandra X-ray Mosaic of the Onsala 2 Star-Forming Region

    NASA Astrophysics Data System (ADS)

    Skinner, Steve L.; Sokal, Kimberly; Guedel, Manuel

    2018-01-01

    Multiple lines of evidence for active high-mass star-formation in the Onsala 2 (ON2) complex in Cygnus include masers, compact HII (cHII) regions, and massive outflows. ON2 is thought to be physically associated with the young stellar cluster Berkeley 87 which contains several optically-identified OB stars and the rare oxygen-type (WO) Wolf-Rayet star WR 142. WO stars are undergoing advanced nuclear core burning as they approach the end of their lives as supernovae, and only a few are known in the Galaxy. We present results of a sensitive 70 ks Chandra ACIS-I observation of the northern half of ON2 obtained in 2016. This new observation, when combined with our previous 70 ks ACIS-I observation of the southern half in 2009, provides a complete X-ray mosaic of ON2 at arcsecond spatial resolution and reveals several hundred X-ray sources. We will summarize key results emerging from our ongoing analysis including the detection of an embedded population of young stars revealed as a tight grouping of X-ray sources surrounding the cHII region G75.77+0.34, possible diffuse X-ray emission (or unresolved faint point sources) near the cHII region G75.84+0.40, and confirmation of hard heavily-absorbed X-ray emission from WR 142 that was seen in the previous 2009 Chandra observation.

  5. Characterization of methanol as a magnetic field tracer in star-forming regions

    NASA Astrophysics Data System (ADS)

    Lankhaar, Boy; Vlemmings, Wouter; Surcis, Gabriele; van Langevelde, Huib Jan; Groenenboom, Gerrit C.; van der Avoird, Ad

    2018-02-01

    Magnetic fields play an important role during star formation1. Direct magnetic field strength observations have proven particularly challenging in the extremely dynamic protostellar phase2-4. Because of their occurrence in the densest parts of star-forming regions, masers, through polarization observations, are the main source of magnetic field strength and morphology measurements around protostars2. Of all maser species, methanol is one of the strongest and most abundant tracers of gas around high-mass protostellar disks and in outflows. However, as experimental determination of the magnetic characteristics of methanol has remained largely unsuccessful5, a robust magnetic field strength analysis of these regions could hitherto not be performed. Here, we report a quantitative theoretical model of the magnetic properties of methanol, including the complicated hyperfine structure that results from its internal rotation6. We show that the large range in values of the Landé g factors of the hyperfine components of each maser line lead to conclusions that differ substantially from the current interpretation based on a single effective g factor. These conclusions are more consistent with other observations7,8 and confirm the presence of dynamically important magnetic fields around protostars. Additionally, our calculations show that (nonlinear) Zeeman effects must be taken into account to further enhance the accuracy of cosmological electron-to-proton mass ratio determinations using methanol9-12.

  6. Dominant Form of Congenital Hyperinsulinism Maps to HK1 Region on 10q

    PubMed Central

    Pinney, Sara E.; Ganapathy, Karthik; Bradfield, Jonathan; Stokes, David; Sasson, Ariella; Mackiewicz, Katarzyna; Boodhansingh, Kara; Hughes, Nkecha; Becker, Susan; Givler, Stephanie; Macmullen, Courtney; Monos, Dimitrios; Ganguly, Arupa; Hakonarson, Hakon; Stanley, Charles A.

    2013-01-01

    Background/Aims In a family with congenital hyperinsulinism (HI), first described in the 1950s by MacQuarrie, we examined the genetic locus and clinical phenotype of a novel form of dominant HI. Methods We surveyed 25 affected individuals, 7 of whom participated in tests of insulin dysregulation (24-hour fasting, oral glucose and protein tolerance tests). To identify the disease locus and potential disease-associated mutations we performed linkage analysis, whole transcriptome sequencing, whole genome sequencing, gene capture, and next generation sequencing. Results Most affecteds were diagnosed with HI before age one and 40% presented with a seizure. All affecteds responded well to diazoxide. Affecteds failed to adequately suppress insulin secretion following oral glucose tolerance test or prolonged fasting; none had protein-sensitive hypoglycemia. Linkage analysis mapped the HI locus to Chr10q21–22, a region containing 48 genes. Three novel non-coding variants were found in hexokinase 1 (HK1) and one missense variant in the coding region of DNA2. Conclusion Dominant, diazoxide-responsive HI in this family maps to a novel locus on Chr10q21–22. HK1 is the more attractive disease gene candidate since a mutation interfering with the normal suppression of HK1 expression in beta-cells could readily explain the hypoglycemia phenotype of this pedigree. PMID:23859901

  7. VLBA SURVEYS OF OH MASERS IN STAR-FORMING REGIONS. I. SATELLITE LINES

    SciTech Connect

    Ruiz-Velasco, A. E.; Felli, D.; Migenes, V.

    2016-05-10

    Using the Very Long Baseline Array we performed a high-resolution OH maser survey in Galactic star-forming regions (SFRs). We observed all the ground state spectral lines: the main lines at 1665 and 1667 MHz and the satellite lines at 1612 and 1720 MHz. Due to the exceptionality of finding satellite lines in SFRs, we will focus our discussion on those lines. In our sample of 41 OH maser sources, five (12%) showed the 1612 MHz line and ten (24%) showed the 1720 MHz line, with only one source showing both lines. We find that 1720 MHz emission is correlated withmore » the presence of H ii regions, suggesting that this emission could be used to diagnose or trace high-mass star formation. We include an analysis of the possible mechanisms that could be causing this correlation as well as assessing the possible relationships between lines in our sample. In particular, the presence of magnetic fields seems to play an important role as we found Zeeman splitting in four of our sources (W75 N, W3(OH), W51 and NGC 7538). Our results have implications for current understanding of the formation of high-mass stars as well as on the masing processes present in SFRs.« less

  8. The hottest gas in massive star forming regions. Observations of HC_{3}N in hot cores

    NASA Astrophysics Data System (ADS)

    Rivilla, V. M.; Martín-Pintado, J.; Jiménez-Serra, I.

    2013-05-01

    Hot (T>150 K), dense (n>10^{7} cm^{-3}) and chemically very rich molecular cores are considered the cradle of massive stars. These regions are hidden behind large extinction (A_{V}> 20 mag), and contain hot dust emitting in the 15-50 μm range. This IR radiation excites the vibrational levels of HC_{3}N (HC_{3}N*), whose abundance is enhanced due to evaporation of grain mantles. Therefore, HC_{3}N* is a very well suited molecule to study the kinematics of the dense and hot gas surrounding very young massive stars. We present spectra of the J =5-4 transition of HC_{3}N* and its isotopes HC^{13}CCN* and HCC^{13}CN* toward two galactic hot cores (Orion Hot Core and G10.47+0.03) carried out with the Green Bank Telescope in May 2012. The spectral coverage is 45-46 GHz (Q band receiver), the spectral resolution is ˜2.5 km s^{-1}, and the angular resolution is 16". We have used the MADCUBA software to develop a LTE analysis that calculates the column density and the excitation conditions of the hottest gas in these massive star forming regions. Additional interferometric observations with higher resolution (1-5") show evidences of high excited gas outflowing from the cores.

  9. Chemical enrichment of the planet-forming region as probed by accretion

    NASA Astrophysics Data System (ADS)

    Booth, Richard A.; Clarke, Cathie J.

    2018-01-01

    The chemical conditions in the planet-forming regions of protoplanetary discs remain difficult to observe directly. Gas accreting from the disc on to the star provides a way to measure the elemental abundances because even refractory species are in an atomic gaseous form. Here, we compare the abundance ratios derived from ultraviolet lines probing T Tauri accretion streams to simple models of disc evolution. Although the interpretation of line ratios in terms of abundances is highly uncertain, discs with large cavities in mm images tend to have lower Si emission. Since this can naturally be explained by the suppressed accretion of dust, this suggests that abundance variations are at least partially responsible for the variations seen in the line ratios. Our models of disc evolution due to grain growth, radial drift and the flux of volatile species carried as ices on grain surfaces give rise to a partial sorting of the atomic species based on the volatility of their dominant molecular carriers. This arises because volatiles are left behind at their snow lines while the grains continue to drift. We show that this reproduces the main features seen in the accretion line ratio data, such as carbon-to-nitrogen ratios which are a few times solar and the correlation between the Si to volatile ratio with mm flux. We highlight the fact that developing a more robust linkage between line ratios and abundance ratios and acquiring data for larger samples have the potential to cast considerable light on the chemical history of protoplanetary discs.

  10. Phosphorylated Nuclear Receptor CAR Forms a Homodimer To Repress Its Constitutive Activity for Ligand Activation

    PubMed Central

    Shizu, Ryota; Osabe, Makoto; Perera, Lalith; Moore, Rick; Sueyoshi, Tatsuya

    2017-01-01

    ABSTRACT The nuclear receptor CAR (NR1I3) regulates hepatic drug and energy metabolism as well as cell fate. Its activation can be a critical factor in drug-induced toxicity and the development of diseases, including diabetes and tumors. CAR inactivates its constitutive activity by phosphorylation at threonine 38. Utilizing receptor for protein kinase 1 (RACK1) as the regulatory subunit, protein phosphatase 2A (PP2A) dephosphorylates threonine 38 to activate CAR. Here we demonstrate that CAR undergoes homodimer-monomer conversion to regulate this dephosphorylation. By coexpression of two differently tagged CAR proteins in Huh-7 cells, mouse primary hepatocytes, and mouse livers, coimmunoprecipitation and two-dimensional gel electrophoresis revealed that CAR can form a homodimer in a configuration in which the PP2A/RACK1 binding site is buried within its dimer interface. Epidermal growth factor (EGF) was found to stimulate CAR homodimerization, thus constraining CAR in its inactive form. The agonistic ligand CITCO binds directly to the CAR homodimer and dissociates phosphorylated CAR into its monomers, exposing the PP2A/RACK1 binding site for dephosphorylation. Phenobarbital, which is not a CAR ligand, binds the EGF receptor, reversing the EGF signal to monomerize CAR for its indirect activation. Thus, the homodimer-monomer conversion is the underlying molecular mechanism that regulates CAR activation, by placing phosphorylated threonine 38 as the common target for both direct and indirect activation of CAR. PMID:28265001

  11. SPITZER INFRARED SPECTROGRAPH SURVEY OF YOUNG STARS IN THE CHAMAELEON I STAR-FORMING REGION

    SciTech Connect

    Manoj, P.; Kim, K. H.; Watson, Dan M.

    2011-03-15

    We present 5-36 {mu}m mid-infrared spectra of 82 young stars in the {approx}2 Myr old Chamaeleon I star-forming region, obtained with the Spitzer Infrared Spectrograph (IRS). We have classified these objects into various evolutionary classes based on their spectral energy distributions and the spectral features seen in the IRS spectra. We have analyzed the mid-IR spectra of Class II objects in Chamaeleon I in detail, in order to study the vertical and radial structure of the protoplanetary disks surrounding these stars. We find evidence for substantial dust settling in most protoplanetary disks in Chamaeleon I. We have identified several disksmore » with altered radial structures in Chamaeleon I, among them transitional disk candidates which have holes or gaps in their disks. Analysis of the silicate emission features in the IRS spectra of Class II objects in Cha I shows that the dust grains in these disks have undergone significant processing (grain growth and crystallization). However, disks with radial holes/gaps appear to have relatively unprocessed grains. We further find the crystalline dust content in the inner ({approx}<1-2 AU) and the intermediate ({approx}<10 AU) regions of the protoplanetary disks to be tightly correlated. We also investigate the effects of accretion and stellar multiplicity on the disk structure and dust properties. Finally, we compare the observed properties of protoplanetary disks in Cha I with those in slightly younger Taurus and Ophiuchus regions and discuss the effects of disk evolution in the first 1-2 Myr.« less

  12. B- AND A-TYPE STARS IN THE TAURUS-AURIGA STAR-FORMING REGION

    SciTech Connect

    Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa

    2013-07-10

    We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of themore » Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), {tau} Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.« less

  13. Deep Near-Infrared Observations of the W3 Main Star-forming Region

    NASA Astrophysics Data System (ADS)

    Ojha, D. K.; Tamura, M.; Nakajima, Y.; Fukagawa, M.; Sugitani, K.; Nagashima, C.; Nagayama, T.; Nagata, T.; Sato, S.; Pickles, A. J.; Ogura, K.

    2004-06-01

    We present a deep JHKs-band imaging survey of the W3 Main star-forming region, using the near-infrared camera SIRIUS mounted on the University of Hawaii 2.2 m telescope. The near-infrared survey covers an area of ~24 arcmin2 with 10 σ limiting magnitudes of ~19.0, 18.1, and 17.3 in the J, H, and Ks bands, respectively. We construct JHK color-color and J versus J-H and K versus H-K color-magnitude diagrams to identify young stellar objects and estimate their masses. Based on these color-color and color-magnitude diagrams, a rich population of young stellar objects is identified that is associated with the W3 Main region. A large number of previously unreported red sources (H-K>2) have also been detected around W3 Main. We argue that these red stars are most probably pre-main-sequence stars with intrinsic color excesses. We find that the slope of the Ks-band luminosity function (KLF) of W3 Main is lower than the typical values reported for young embedded clusters. The derived slope of the KLF is the same as that found in 1996 by Megeath and coworkers, from which analysis indicated that the W3 Main region has an age in the range of 0.3-1 Myr. Based on the comparison between models of pre-main-sequence stars and the observed color-magnitude diagram, we find that the stellar population in W3 Main is primarily composed of low-mass pre-main-sequence stars. We also report the detection of isolated young stars with large infrared excesses that are most probably in their earliest evolutionary phases.

  14. B- and A-Type Stars in the Taurus-Auriga Star-Forming Region

    NASA Technical Reports Server (NTRS)

    Mooley, Kunal; Hillenbrand, Lynne; Rebull, Luisa; Padgett, Deborah; Knapp, Gillian

    2013-01-01

    We describe the results of a search for early-type stars associated with the Taurus-Auriga molecular cloud complex, a diffuse nearby star-forming region noted as lacking young stars of intermediate and high mass. We investigate several sets of possible O, B, and early A spectral class members. The first is a group of stars for which mid-infrared images show bright nebulae, all of which can be associated with stars of spectral-type B. The second group consists of early-type stars compiled from (1) literature listings in SIMBAD, (2) B stars with infrared excesses selected from the Spitzer Space Telescope survey of the Taurus cloud, (3) magnitude- and color-selected point sources from the Two Micron All Sky Survey, and (4) spectroscopically identified early-type stars from the Sloan Digital Sky Survey coverage of the Taurus region. We evaluated stars for membership in the Taurus-Auriga star formation region based on criteria involving: spectroscopic and parallactic distances, proper motions and radial velocities, and infrared excesses or line emission indicative of stellar youth. For selected objects, we also model the scattered and emitted radiation from reflection nebulosity and compare the results with the observed spectral energy distributions to further test the plausibility of physical association of the B stars with the Taurus cloud. This investigation newly identifies as probable Taurus members three B-type stars: HR 1445 (HD 28929), t Tau (HD 29763), 72 Tau (HD 28149), and two A-type stars: HD 31305 and HD 26212, thus doubling the number of stars A5 or earlier associated with the Taurus clouds. Several additional early-type sources including HD 29659 and HD 283815 meet some, but not all, of the membership criteria and therefore are plausible, though not secure, members.

  15. 76 FR 9806 - Agency Information Collection Activities: Passenger List/Crew List (CBP Form I-418)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-22

    ... Activities: Passenger List/Crew List (CBP Form I-418) AGENCY: U.S. Customs and Border Protection, Department... List/Crew List (CBP Form I-418). This is a proposed extension of an information collection that was...: Passenger List/Crew List. OMB Number: 1651-0103. Form Number: CBP Form I-418. Abstract: CBP Form I-418 is...

  16. 77 FR 2561 - Agency Information Collection Activities: Passenger List/Crew List (CBP Form I-418)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-18

    ... Activities: Passenger List/Crew List (CBP Form I-418) AGENCY: U.S. Customs and Border Protection (CBP... collection requirement concerning the Passenger List/Crew List (CBP Form I-418). This request for comment is...: Title: Passenger List/Crew List. OMB Number: 1651-0103. Form Number: CBP Form I-418. Abstract: CBP Form...

  17. 78 FR 26648 - Agency Information Collection Activities: Passenger List/Crew List (CBP Form I-418)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-07

    ... Activities: Passenger List/Crew List (CBP Form I-418) AGENCY: U.S. Customs and Border Protection (CBP... collection requirement concerning the Passenger List/Crew List (CBP Form I-418). This request for comment is...: Passenger List/Crew List. OMB Number: 1651-0103. Form Number: CBP Form I-418. Abstract: CBP Form I-418 is...

  18. Sports participation, physical activity, and health in the European regions.

    PubMed

    Lera-López, Fernando; Marco, Rocio

    2018-08-01

    In a context of stagnation of the level of health-enhancing physical activity in Europe, this study examines the geographical stratification of sports participation and physical activity (PA) at the regional level in 28 European countries. While previous research has focused on the national approach, this study considers the regional level across 208 European regions. Individual survey data from the Eurobarometer 80.2 is combined with a regional-level approach to the 208 regions to quantify sports participation and PA at the regional level. The results show important differences and a geographical stratification of sports participation and PA among the European regions, albeit following different patterns. In particular, a north-south gap is identified in terms of PA rates and an east-west gap is detected in terms of sports participation levels. Applying the cluster technique, a taxonomy of four different European regions is developed considering both types of indicators. Finally, the existence of sports spatial spillovers among regions is verified, obtaining a positive autocorrelation among neighbouring regions for being involved in PA and sporting activities. The results may have significant implications in terms of policy measures to improve health through PA and sports participation at the regional level in Europe.

  19. Multi-wavelength observations of the star forming region in L1616

    NASA Astrophysics Data System (ADS)

    Alcalá, J. M.; Wachter, S.; Covino, E.; Sterzik, M. F.; Durisen, R. H.; Freyberg, M. J.; Hoard, D. W.; Cooksey, K.

    2004-03-01

    We present the results of a multi-wavelength study of the star forming region in L1616. Our observations include ROSAT All-Sky Survey (RASS) and High Resolution Imager (HRI) X-ray observations, optical wide-field imaging and near-IR imaging data and optical long-slit and multi-object spectroscopic follow-up. 22 new low-mass pre-main sequence (PMS) stars are found to be distributed mainly to the East of the L1616 cometary cloud, in about a one-square-degree field. We find that the class-III infrared sources outnumber the class-II infrared sources by a factor of about three. The X-ray properties of the PMS stars in L1616 are quite similar to those of PMS stars detected in the Orion Nebula Cluster. The comparison of the position of the L1616 PMS stars in the HR diagram with theoretical PMS evolutionary tracks yields an average age of 1-2 Myr, with a very small age spread of about 1 Myr. Unlike the fossil star forming regions in Orion, L1616 appears to be a region of on-going star formation relatively far from the Orion A and B clouds. Given the small age spread, the spatial distribution of the PMS stars relative to the head of the cloud, as well as its cometary shape and high star formation efficiency, we conclude that the star formation in L1616 was most likely induced by a single event, the impact of the winds of the massive stars of the Orion OB association or a supernova explosion being the possible triggers. The Initial Mass Function (IMF) in L1616 is roughly consistent with that of the field in the mass range 0.3< M/M⊙ < 2.5. Several faint objects, detected in our optical images, are good candidates for young Brown Dwarfs (BDs). We might expect the number of BDs in L1616 to be intermediate between Taurus and the Trapezium. Based on observations carried out at the European Southern Observatory, La Silla, Chile under proposals numbers 56.E-0566 and 64.I-0355, and at the Calar Alto observatory.

  20. ACTIVE REGION MORPHOLOGIES SELECTED FROM NEAR-SIDE HELIOSEISMIC DATA

    SciTech Connect

    MacDonald, G. A.; McAteer, R. T. J.; Henney, C. J.

    2015-07-01

    We estimate the morphology of near-side active regions using near-side helioseismology. Active regions from two data sets, Air Force Data Assimilative Photospheric flux Transport synchronic maps and Global Oscillation Network Group near-side helioseismic maps, were matched and their morphologies compared. Our algorithm recognizes 382 helioseismic active regions between 2002 April 25 and 2005 December 31 and matches them to their corresponding magnetic active regions with 100% success. A magnetic active region occupies 30% of the area of its helioseismic signature. Recovered helioseismic tilt angles are in good agreement with magnetic tilt angles. Approximately 20% of helioseismic active regions can bemore » decomposed into leading and trailing polarity. Leading polarity components show no discernible scaling relationship, but trailing magnetic polarity components occupy approximately 25% of the area of the trailing helioseismic component. A nearside phase-magnetic calibration is in close agreement with a previous far-side helioseismic calibration and provides confidence that these morphological relationships can be used with far-side helioseismic data. Including far-side active region morphology in synchronic maps will have implications for coronal magnetic topology predictions and solar wind forecasts.« less

  1. Star and jet multiplicity in the high-mass star forming region IRAS 05137+3919

    NASA Astrophysics Data System (ADS)

    Cesaroni, R.; Massi, F.; Arcidiacono, C.; Beltrán, M. T.; Persi, P.; Tapia, M.; Molinari, S.; Testi, L.; Busoni, L.; Riccardi, A.; Boutsia, K.; Bisogni, S.; McCarthy, D.; Kulesa, C.

    2015-09-01

    Context. We present a study of the complex high-mass star forming region IRAS 05137+3919 (also known as Mol8), where multiple jets and a rich stellar cluster have been described in previous works. Aims: Our goal is to determine the number of jets and shed light on their origin, and thus determine the nature of the young stars powering these jets. We also wish to analyse the stellar clusters by resolving the brightest group of stars. Methods: The star forming region was observed in various tracers and the results were complemented with ancillary archival data. The new data represent a substantial improvement over previous studies both in resolution and frequency coverage. In particular, adaptive optics provides us with an angular resolution of 80 mas in the near IR, while new mid- and far-IR data allow us to sample the peak of the spectral energy distribution and thus reliably estimate the bolometric luminosity. Results: Thanks to the near-IR continuum and millimetre line data we can determine the structure and velocity field of the bipolar jets and outflows in this star forming region. We also find that the stars are grouped into three clusters and the jets originate in the richest of these, whose luminosity is ~ 2.4 × 104L⊙. Interestingly, our high-resolution near-IR images allow us to resolve one of the two brightest stars (A and B) of the cluster into a double source (A1+A2). Conclusions: We confirm that there are two jets and establish that they are powered by B-type stars belonging to cluster C1. On this basis and on morphological and kinematical arguments, we conclude that the less extended jet is almost perpendicular to the line of sight and that it originates in the brightest star of the cluster, while the more extended one appears to be associated with the more extincted, double source A1+A2. We propose that this is not a binary system, but a small bipolar reflection nebula at the root of the large-scale jet, outlining a still undetected circumstellar

  2. Antioxidant activity relates to plant part, life form and growing condition in some diabetes remedies.

    PubMed

    McCune, Letitia M; Johns, Timothy

    2007-07-25

    Selection, collection and preparation of 35 plant species used by traditional healers in the boreal regions of Canada for treatment of the symptoms of diabetes were supported empirically by antioxidant activity of the plants. Because antioxidants fluctuate with growth parameters and environmental factors, these remedies were evaluated in relation to the affect of plant part, life form and growing condition on the level of activity. The parts used here more frequently as medicines were roots and bark. Activity (IC(50)) of the bark extracts used medicinally averaged to 21.38+/-3.84 ppm while root extracts used medicinally had an IC(50) of 185.11+/-32.18 ppm in a free radical DPPH assay. In contrast the analysis of extracts of overall parts (medicinal or not) in these species found leaves and bark to have the least activity (112.22+/-30.63 ppm and 123.02+/-21.13 ppm, respectively). The highest activity was found in tree extracts (24.88+/-3.32 ppm) as compared to herbs and shrubs, and increased activity was found in plant extracts from growing conditions of decreased water/fertility. The antioxidant activity of these traditional plant remedies have the potential to be partially deduced through environment signals interpreted by the traditional herbalist.

  3. Common Characteristics of the Active Regions of Strong Proton Flares

    NASA Astrophysics Data System (ADS)

    Zhou, Shu-Rong; Zheng, Xing-Wu

    1998-08-01

    Common characteristics of nine active regions with strong proton flares in the 22nd solar activity cycle have been presented. Results show that the typical morphology of these active regions is a delta-type sunspot with a single multiple structure, in which there are many umbras with different magnetic polarities, packed tightly by a single penumbra. In these active regions, the rotating directions of the sunspot groups are nearly independent of their position on the solar disk. When the angle of rotation approaches the positive or the negative maximum, proton flares may occur in these active regions. After proton flares, sunspot groups rotate in the inverse direction because of the slack in the flux rope.

  4. Regional Observation of Seismic Activity in Baekdu Mountain

    NASA Astrophysics Data System (ADS)

    Kim, Geunyoung; Che, Il-Young; Shin, Jin-Soo; Chi, Heon-Cheol

    2015-04-01

    Seismic unrest in Baekdu Mountain area between North Korea and Northeast China region has called attention to geological research community in Northeast Asia due to her historical and cultural importance. Seismic bulletin shows level of seismic activity in the area is higher than that of Jilin Province of Northeast China. Local volcanic observation shows a symptom of magmatic unrest in period between 2002 and 2006. Regional seismic data have been used to analyze seismic activity of the area. The seismic activity could be differentiated from other seismic phenomena in the region by the analysis.

  5. An x-ray study of massive star forming regions with CHANDRA

    NASA Astrophysics Data System (ADS)

    Wang, Junfeng

    2007-08-01

    Massive stars are characterized by powerful stellar winds, strong ultraviolet (UV) radiation, and consequently devastating supernovae explosions, which have a profound influence on their natal clouds and galaxy evolution. However, the formation and evolution of massive stars themselves and how their low-mass siblings are affected in the wind-swept and UV-radiation-dominated environment are not well understood. Much of the stellar populations inside of the massive star forming regions (MSFRs) are poorly studied in the optical and IR wavelengths because of observational challenges caused by large distance, high extinction, and heavy contamination from unrelated sources. Although it has long been recognized that X-rays open a new window to sample the young stellar populations residing in the MSFRs, the low angular resolution of previous generation X-ray telescopes has limited the outcome from such studies. The sensitive high spatial resolution X-ray observations enabled by the Chandra X- ray Observatory and the Advanced CCD Imaging Spectrometer (ACIS) have significantly improved our ability to study the X-ray-emitting populations in the MSFRs in the last few years. In this thesis, I analyzed seven high spatial resolution Chandra /ACIS images of two massive star forming complexes, namely the NGC 6357 region hosting the 1 Myr old Pismis 24 cluster (Chapter 3) and the Rosette Complex including the 2 Myr old NGC 2244 cluster immersed in the Rosette Nebula (Chapter 4), embedded clusters in the Rosette Molecular Cloud (RMC; Chapter 5), and a triggered cluster NGC 2237 (Chapter 6). The X-ray sampled stars were studied in great details. The unique power of X-ray selection of young stellar cluster members yielded new knowledge in the stellar populations, the cluster structures, and the star formation histories. The census of cluster members is greatly improved in each region. A large fraction of the X-ray detections have optical or near-infrared (NIR) stellar counterparts

  6. Forming a Learning Culture to Promote Fracture Prevention Activities

    ERIC Educational Resources Information Center

    Hjalmarson, Helene V.; Strandmark, Margaretha

    2012-01-01

    Purpose: The purpose of this paper is to explore interprofessional experiences of incorporating fracture prevention activities in clinical practice inspired by an empowerment approach. Design/methodology/approach: Data collection consisted primarily of focus groups interviews, systematized and analyzed by the grounded theory method. The study took…

  7. Offerings from the COMPLETE Survey of Star-Forming Regions, c. 2005

    NASA Astrophysics Data System (ADS)

    Goodman, A. A.; Alves, J. F.; Arce, H. G.; Bethell, T.; Borkin, M. A.; Caselli, P.; Di Francesco, J.; Foster, J. B.; Halle, M.; Heyer, M.; Johnstone, D.; Kirk, H.; Kosslyn, D. A.; Li, D.; Li, J.; Lombardi, M.; Pineda, J.; Ridge, N. A.; Schnee, S. L.; Tafalla, M.; Whitehorn, N.

    2005-12-01

    The COMPLETE (COordinated Molecular Probe Line Extinction Thermal Emission) Survey of Star-Forming Regions has now mapped the full extent (as defined by the Spitzer c2d Legacy Survey) of the Perseus, Ophiuchus, and Serpens star-forming regions in: 1) 12CO and 13CO maps (featuring >200,000 spectra) from FCRAO with 40 arcsec resolution; 2) extinction, using the ``NICER" method on 2MASS data; and 3) thermal emission using a combination of IRAS (60 and 100 micron) and SCUBA (850 micron) data. The molecular line maps give kinematic information, while the combination of the extinction and thermal emission maps give the most accurate view of the clouds' dust column density and temperature distributions to date. The COMPLETEd ``wide-field" maps represent ``Phase 1" of the Survey, and ``Phase 2," which offers close-up views of nearly all of the embedded ``cores" within the COMPLETE fields is well underway. Our key results to date include: 1) a new methodology for calibrating dust emission maps with extinction maps (Schnee et al. 2005); 2) a new appreciation of the fundamental uncertainty in the line-of-sight variations in dust temperature introduced into column-density measurements using dust emission (Schnee et al. 2006) 3) evidence for important interactions of spherical winds from B-type stars with molecular clouds (see Ridge et al. 2006a); 4) an extinction ``threshold" for star formation in Ophiuchus (Johnstone et al. 2004); 5) demonstration that extinction mapping routinely yields log-normal density distributions, which disagree with molecular-line map based density distributions, because the line data is biased by excitation and optical depth effects (Goodman et al. 2006); 6) the discovery of ubiquitous ``cloudshine" coming from dark clouds (Foster & Goodman 2005); 7) measurement and identification of uncertainties in the clump mass function for Perseus (Pineda et al. 2006); and 8) testing and new use of 3D medical-imaging software for identification and analysis of

  8. A search for companions to brown dwarfs in the Taurus and Chamaeleon star-forming regions

    SciTech Connect

    Todorov, K. O.; Luhman, K. L.; Konopacky, Q. M.

    2014-06-10

    We have used WFPC2 on board the Hubble Space Telescope to obtain images of 47 members of the Taurus and Chamaeleon I star-forming regions that have spectral types of M6-L0 (M ∼ 0.01-0.1 M {sub ☉}). An additional late-type member of Taurus, FU Tau (M7.25+M9.25), was also observed with adaptive optics at Keck Observatory. In these images, we have identified promising candidate companions to 2MASS J04414489+2301513 (ρ = 0.''105/15 AU), 2MASS J04221332+1934392 (ρ = 0.''05/7 AU), and ISO 217 (ρ = 0.''03/5 AU). We reported the first candidate in a previous study, showing that it has a similar proper motionmore » as the primary in images from WFPC2 and Gemini adaptive optics. We have collected an additional epoch of data with Gemini that further supports that result. By combining our survey with previous high-resolution imaging in Taurus, Chamaeleon I, and Upper Sco (τ ∼ 10 Myr), we measure binary fractions of 14/93 = 0.15{sub −0.03}{sup +0.05} for M4-M6 (M ∼ 0.1-0.3 M {sub ☉}) and 4/108 = 0.04{sub −0.01}{sup +0.03} for >M6 (M ≲ 0.1 M {sub ☉}) at separations of >10 AU. Given the youth and low density of these regions, the lower binary fraction at later types is probably primordial rather than due to dynamical interactions among association members. The widest low-mass binaries (>100 AU) also appear to be more common in Taurus and Chamaeleon I than in the field, which suggests that the widest low-mass binaries are disrupted by dynamical interactions at >10 Myr, or that field brown dwarfs have been born predominantly in denser clusters where wide systems are disrupted or inhibited from forming.« less

  9. Cluster and nebular properties of the central star-forming region of NGC 1140

    NASA Astrophysics Data System (ADS)

    Moll, S. L.; Mengel, S.; de Grijs, R.; Smith, L. J.; Crowther, P. A.

    2007-12-01

    We present new high spatial resolution Hubble Space Telescope/Advanced Camera for Surveys (ACS) imaging of NGC 1140 and high spectral resolution Very Large Telescope/Ultraviolet and Visual Echelle Spectrograph spectroscopy of its central star-forming region. The central region contains several clusters, the two brightest of which are clusters 1 and 6 from Hunter, O'Connell & Gallagher, located within star-forming knots A and B, respectively. A nebular analysis indicates that the knots have a Large Magellanic Cloud-like metallicity of 12 + logO/H = 8.29 +/-0.09. According to continuum-subtracted Hα ACS imaging, cluster 1 dominates the nebular emission of the brighter knot A. Conversely, negligible nebular emission in knot B originates from cluster 6. Evolutionary synthesis modelling implies an age of 5 +/-1 Myr for cluster 1, from which a photometric mass of (1.1 +/-0.3) × 106Msolar is obtained. For this age and photometric mass, the modelling predicts the presence of ~5900 late O stars within cluster 1. Wolf-Rayet (WR) features are observed in knot A, suggesting 550 late-type nitrogen-rich (WNL) and 200 early-type carbon-rich (WCE) stars. Therefore, N(WR)/N(O) ~ 0.1, assuming that all the WR stars are located within cluster 1. The velocity dispersions of the clusters were measured from constituent red supergiants as σ ~ 23 +/-1kms-1 for cluster 1 and σ ~ 26 +/-1kms-1 for cluster 6. Combining σ with half-light radii of 8 +/- 2 and 6.0 +/-0.2 pc measured from the F625W ACS image implies virial masses of (10 +/-3) × 106 and (9.1 +/-0.8) × 106Msolar for clusters 1 and 6, respectively. The most likely reason for the difference between the dynamical and photometric masses of cluster 1 is that the velocity dispersion of knot A is not due solely to cluster 1, as assumed, but has an additional component associated with cluster 2. E-mail: s.moll@sheffield.ac.uk Based on observations collected at the European Southern Observatory, Chile, under programme ESO 71.B-0058(A

  10. Companions and Environments of Low-Mass Stars: From Star-Forming Regions to the Field

    NASA Astrophysics Data System (ADS)

    Ward-Duong, Kimberly; Patience, Jenny; De Rosa, Robert J.; Bulger, Joanna; Rajan, Abhijith; Goodwin, Simon; Parker, Richard J.; McCarthy, Donald W.; Kulesa, Craig; van der Plas, Gerrit; Menard, Francois; Pinte, Christophe; Jackson, Alan Patrick; Bryden, Geoffrey; Turner, Neal J.; Harvey, Paul M.; Hales, Antonio

    2017-01-01

    We present results from two studies probing the multiplicity and environmental properties of low-mass stars: (1) The MinMs (M-dwarfs in Multiples) Survey, a large, volume-limited survey of 245 field M-dwarfs within 15 pc, and (2) the TBOSS (Taurus Boundary of Stellar/Substellar) Survey, an ongoing study of disk properties for the lowest-mass members within the Taurus star-forming region. The MinMs Survey provides new measurements of the companion star fraction, separation distribution, and mass ratio distribution for the nearest K7-M6 dwarfs, utilizing a combination of high-resolution adaptive optics imaging and digitized widefield archival plates to cover an unprecedented separation range of ~1-10,000 AU. Within these data, we also identify companions below the stellar/brown dwarf boundary, enabling characterization of the substellar companion population to low-mass field stars. For the much younger population in Taurus, we present results from ALMA Band 7 continuum observations of low-mass stellar and substellar Class II objects, spanning spectral types from M4-M7.75. The sub-millimeter detections of these disks provide key estimates of the dust mass in small grains, which is then assessed within the context of region age, environment, and viability for planet formation. This young population also includes a number of interesting young binary systems. Covering both young (1-2 Myr) and old (>5 Gyr) populations of low-mass stars, the results from these studies provide benchmark measurements on the population statistics of low-mass field stars, and on the early protoplanetary environments of their younger M-star counterparts.

  11. VLBA Determination of the Distance to Nearby Star-forming Regions. VII. Monoceros R2

    NASA Astrophysics Data System (ADS)

    Dzib, Sergio A.; Ortiz-León, Gisela N.; Loinard, Laurent; Mioduszewski, Amy J.; Rodríguez, Luis F.; Torres, Rosa M.; Deller, Adam

    2016-08-01

    We present a series of 16 Very Long Baseline Array high angular resolution observations of a cluster of suspected low-mass young stars in the Monoceros R2 region. Four compact and highly variable radio sources are detected; three of them in only one epoch, the fourth one a total of seven times. This latter source is seen in the direction of the previously known UC H II region VLA 1, and has radio properties that resemble those of magnetically active stars; we shall call it VLA 1⋆. We model its displacement on the celestial sphere as a combination of proper motion and trigonometric parallax. The fit obtained using a uniform proper motion yields a parallax ϖ = 1.10 ± 0.18 mas, but with a fairly high post-fit dispersion. If acceleration terms (probably due to an undetected companion) are included, the quality of the fit improves dramatically, and the best estimate of the parallax becomes ϖ = 1.12 ± 0.05 mas. The magnitude of the fitted acceleration suggests an orbital period of the order of a decade. The measured parallax corresponds to a distance d = {893}-40+44 {pc} , in very good agreement with previous, indirect determinations.

  12. Hemisphere Rule in Active Regions with Different Properties

    NASA Astrophysics Data System (ADS)

    Liu, Y.; Xiong, X.

    2017-12-01

    Magnetic twist in solar active regions has been found to have a hemispheric preferencein sign (hemisphere rule): negative in the northern hemisphere and positive in the southern.The strength of the preference reported in previous studies ranges greatly, from 58% to 82%.In this presentation, we will show an investigation that examines this hemispheric preference bystudying active regions in Solar Cycle 24 using the vector magnetic field data taken by the Helioseismicand Magnetic Imager (HMI). While in general the strength of the hemisphere preference is wellwithin the range reported by the previous studies, it differs substantially in different groupsof active regions that possess different properties in magnetic helicity: the group with theopposite signs of magnetic twist and writhe has a much stronger preference strength than thegroup with the same signs. This difference becomes even more significant in emerging activeregions. We place here a discussion on possible links between origin of magnetic twist, hemispherepreference, and emergence and evolution of active regions.

  13. Prediction of Active-Region CME Productivity from Magnetograms

    NASA Technical Reports Server (NTRS)

    Falconer, D. A.; Moore, R. L.; Gary, G. A.

    2004-01-01

    We report results of an expanded evaluation of whole-active-region magnetic measures as predictors of active-region coronal mass ejection (CME) productivity. Previously, in a sample of 17 vector magnetograms of 12 bipolar active regions observed by the Marshall Space Flight Center (MSFC) vector magnetograph, from each magnetogram we extracted a measure of the size of the active region (the active region s total magnetic flux a) and four measures of the nonpotentiality of the active region: the strong-shear length L(sub SS), the strong-gradient length L(sub SG), the net vertical electric current I(sub N), and the net-current magnetic twist parameter alpha (sub IN). This sample size allowed us to show that each of the four nonpotentiality measures was statistically significantly correlated with active-region CME productivity in time windows of a few days centered on the day of the magnetogram. We have now added a fifth measure of active-region nonpotentiality (the best-constant-alpha magnetic twist parameter (alpha sub BC)), and have expanded the sample to 36 MSFC vector magnetograms of 31 bipolar active regions. This larger sample allows us to demonstrate statistically significant correlations of each of the five nonpotentiality measures with future CME productivity, in time windows of a few days starting from the day of the magnetogram. The two magnetic twist parameters (alpha (sub 1N) and alpha (sub BC)) are normalized measures of an active region s nonpotentially in that they do not depend directly on the size of the active region, while the other three nonpotentiality measures (L(sub SS), L(sub SG), and I(sub N)) are non-normalized measures in that they do depend directly on active-region size. We find (1) Each of the five nonpotentiality measures is statistically significantly correlated (correlation confidence level greater than 95%) with future CME productivity and has a CME prediction success rate of approximately 80%. (2) None of the nonpotentiality

  14. THE COLD SHOULDER: EMISSION MEASURE DISTRIBUTIONS OF ACTIVE REGION CORES

    SciTech Connect

    Schmelz, J. T.; Pathak, S., E-mail: jschmelz@memphis.edu

    2012-09-10

    The coronal heating mechanism for active region core loops is difficult to determine because these loops are often not resolved and cannot be studied individually. Rather, we concentrate on the 'inter-moss' areas between loop footpoints. We use observations from the Hinode EUV Imaging Spectrometer and the X-Ray Telescope to calculate the emission measure distributions of eight inter-moss areas in five different active regions. The combined data sets provide both high- and low-temperature constraints and ensure complete coverage in the temperature range appropriate for active regions. For AR 11113, the emission can be modeled with heating events that occur on timescalesmore » less than the cooling time. The loops in the core regions appear to be close to equilibrium and are consistent with steady heating. The other regions studied, however, appear to be dominated by nanoflare heating. Our results are consistent with the idea that active region age is an important parameter in determining whether steady or nanoflare heating is primarily responsible for the core emission, that is, older regions are more likely to be dominated by steady heating, while younger regions show more evidence of nanoflares.« less

  15. Folding of Aggregated Proteins to Functionally Active Form

    DTIC Science & Technology

    2006-06-01

    reduce the disulfide bonds, cooled down, and loaded onto a Superdex 200 26/60 preparatory column. The refolded protein was monomeric and tested positively...13]. The protein was then refolded by SEC and the disulfide bonds restored by incubation in a reduced/oxidized glutathione solution. The final activity...In another interesting approach, a so-called ‘mini-chaperone’ GroEL fragment (amino acids 191– 345), disulfide isomerase DsbA, and peptidyl prolyl

  16. Active Ageing Level of Older Persons: Regional Comparison in Thailand.

    PubMed

    Haque, Md Nuruzzaman

    2016-01-01

    Active ageing level and its discrepancy in different regions (Bangkok, Central, North, Northeast, and South) of Thailand have been examined for prioritizing the policy agenda to be implemented. Attempt has been made to test preliminary active ageing models for Thai older persons and hence active ageing index (AAI, ranges from 0 to 1) has been estimated. Using nationally representative data and confirmatory factor analysis approach, this study justified active ageing models for female and male older persons in Thailand. Results revealed that active ageing level of Thai older persons is not high (mean AAIs for female and male older persons are 0.64 and 0.61, resp., and those are significantly different (p < 0.001)). Mean AAI in Central region is lower than North, Northeast, and South regions but there is no significant difference in the latter three regions of Thailand. Special emphasis should be given to Central region and policy should be undertaken for increasing active ageing level. Implementation of an Integrated Active Ageing Package (IAAP), containing policies for older persons to improve their health and economic security, to promote participation in social groups and longer working lives, and to arrange learning programs, would be helpful for increasing older persons' active ageing level in Thailand.

  17. Trigonometric parallaxes of high mass star forming regions: the structure and kinematics of the Milky Way

    SciTech Connect

    Reid, M. J.; Dame, T. M.; Menten, K. M.

    2014-03-10

    Over 100 trigonometric parallaxes and proper motions for masers associated with young, high-mass stars have been measured with the Bar and Spiral Structure Legacy Survey, a Very Long Baseline Array key science project, the European VLBI Network, and the Japanese VLBI Exploration of Radio Astrometry project. These measurements provide strong evidence for the existence of spiral arms in the Milky Way, accurately locating many arm segments and yielding spiral pitch angles ranging from about 7° to 20°. The widths of spiral arms increase with distance from the Galactic center. Fitting axially symmetric models of the Milky Way with the three-dimensionalmore » position and velocity information and conservative priors for the solar and average source peculiar motions, we estimate the distance to the Galactic center, R {sub 0}, to be 8.34 ± 0.16 kpc, a circular rotation speed at the Sun, Θ{sub 0}, to be 240 ± 8 km s{sup –1}, and a rotation curve that is nearly flat (i.e., a slope of –0.2 ± 0.4 km s{sup –1} kpc{sup –1}) between Galactocentric radii of ≈5 and 16 kpc. Assuming a 'universal' spiral galaxy form for the rotation curve, we estimate the thin disk scale length to be 2.44 ± 0.16 kpc. With this large data set, the parameters R {sub 0} and Θ{sub 0} are no longer highly correlated and are relatively insensitive to different forms of the rotation curve. If one adopts a theoretically motivated prior that high-mass star forming regions are in nearly circular Galactic orbits, we estimate a global solar motion component in the direction of Galactic rotation, V {sub ☉} = 14.6 ± 5.0 km s{sup –1}. While Θ{sub 0} and V {sub ☉} are significantly correlated, the sum of these parameters is well constrained, Θ{sub 0} + V {sub ☉} = 255.2 ± 5.1 km s{sup –1}, as is the angular speed of the Sun in its orbit about the Galactic center, (Θ{sub 0} + V {sub ☉})/R {sub 0} = 30.57 ± 0.43 km s{sup –1} kpc{sup –1}. These parameters improve the accuracy

  18. Some features of active regions and bursts in millimetric range.

    NASA Astrophysics Data System (ADS)

    Yu, Xingfeng; Yao, Jinxing

    1995-09-01

    The characteristics of active regions and bursts at mm wavelengths, observed with the 13.7 m radio telescope at Quinghai from Nov 16 to Dec 1, 1993, are analyzed. It appears that the active region collapsed and vanished while there occurred a coronal loop with two polarities. GRE bursts at mm wavelength may be interpreted by thermal gyro-resonance radiation and are part of the chromospheric eruption. There is no indication of FFS in 10 ms recordings.

  19. Solar Irradiance Variations on Active Region Time Scales

    NASA Technical Reports Server (NTRS)

    Labonte, B. J. (Editor); Chapman, G. A. (Editor); Hudson, H. S. (Editor); Willson, R. C. (Editor)

    1984-01-01

    The variations of the total solar irradiance is an important tool for studying the Sun, thanks to the development of very precise sensors such as the ACRIM instrument on board the Solar Maximum Mission. The largest variations of the total irradiance occur on time scales of a few days are caused by solar active regions, especially sunspots. Efforts were made to describe the active region effects on total and spectral irradiance.

  20. EXTERNALLY HEATED PROTOSTELLAR CORES IN THE OPHIUCHUS STAR-FORMING REGION

    SciTech Connect

    Lindberg, Johan E.; Charnley, Steven B.; Cordiner, Martin A.

    2017-01-20

    We present APEX 218 GHz observations of molecular emission in a complete sample of embedded protostars in the Ophiuchus star-forming region. To study the physical properties of the cores, we calculate H{sub 2}CO and c -C{sub 3}H{sub 2} rotational temperatures, both of which are good tracers of the kinetic temperature of the molecular gas. We find that the H{sub 2}CO temperatures range between 16 K and 124 K, with the highest H{sub 2}CO temperatures toward the hot corino source IRAS 16293-2422 (69–124 K) and the sources in the ρ Oph A cloud (23–49 K) located close to the luminous Herbigmore » Be star S1, which externally irradiates the ρ Oph A cores. On the other hand, the c -C{sub 3}H{sub 2} rotational temperature is consistently low (7–17 K) in all sources. Our results indicate that the c -C{sub 3}H{sub 2} emission is primarily tracing more shielded parts of the envelope whereas the H{sub 2}CO emission (at the angular scale of the APEX beam; 3600 au in Ophiuchus) mainly traces the outer irradiated envelopes, apart from in IRAS 16293-2422, where the hot corino emission dominates. In some sources, a secondary velocity component is also seen, possibly tracing the molecular outflow.« less

  1. Insights from Synthetic Star-forming Regions. I. Reliable Mock Observations from SPH Simulations

    NASA Astrophysics Data System (ADS)

    Koepferl, Christine M.; Robitaille, Thomas P.; Dale, James E.; Biscani, Francesco

    2017-11-01

    Through synthetic observations of a hydrodynamical simulation of an evolving star-forming region, we assess how the choice of observational techniques affects the measurements of properties that trace star formation. Testing and calibrating observational measurements requires synthetic observations that are as realistic as possible. In this part of the series (Paper I), we explore different techniques for mapping the distributions of densities and temperatures from the particle-based simulations onto a Voronoi mesh suitable for radiative transfer and consequently explore their accuracy. We further test different ways to set up the radiative transfer in order to produce realistic synthetic observations. We give a detailed description of all methods and ultimately recommend techniques. We have found that the flux around 20 μm is strongly overestimated when blindly coupling the dust radiative transfer temperature with the hydrodynamical gas temperature. We find that when instead assuming a constant background dust temperature in addition to the radiative transfer heating, the recovered flux is consistent with actual observations. We present around 5800 realistic synthetic observations for Spitzer and Herschel bands, at different evolutionary time-steps, distances, and orientations. In the upcoming papers of this series (Papers II, III, and IV), we will test and calibrate measurements of the star formation rate, gas mass, and the star formation efficiency using our realistic synthetic observations.

  2. Hubble Space Telescope imaging of the central star forming region in NGC 1140 (exp 1)

    NASA Technical Reports Server (NTRS)

    Hunter, Deidre A.; O'Connell, Robert W.; Gallagher, John S. Iii

    1994-01-01

    We present broadband images taken with the Hubble Space Telescope's Planetary Camera of the central supergiant H II region in the amorphous galaxy NGC 1140. These images allow observations to a resolution of about 13 pc at the galaxy, and they reveal that its central 1/2 kpc contains 6-7 blue, luminous, compact super star clusters, many of which would be comparable in luminosity to globular clusters at the same age. A blue arc-shaped structure near the center may be a grouping of less luminous, R136/NGC 2070-sized clusters or a sheet of OB stars. Additional somewhat less luminous and redder clusters are also found farther out from the center. If these clusters are older, they too could have had luminosities comparable to those of the central six clusters at a comparable age. Thus, we find that NGC 1140 is remarkable in the number of extreme clusters that it has formed recently in a relatively small area of the galaxy. Since NGC 1140 exhibits global characteristics that are consistent with a recent merger, these clusters are likely to be a product of that event. This galaxy adds to the number of cases where rapid star formation has evidently produced super star clusters.

  3. Trigonometric parallaxes of star forming regions in the Scutum spiral arm

    SciTech Connect

    Sato, M.; Wu, Y. W.; Immer, K.

    2014-10-01

    We report measurements of trigonometric parallaxes for six high-mass star-forming regions in the Scutum spiral arm of the Milky Way as part of the BeSSeL Survey. Combining our measurements with 10 previous measurements from the BeSSeL Survey yields a total sample of 16 sources in the Scutum arm with trigonometric parallaxes in the Galactic longitude range from 5° to 32°. Assuming a logarithmic spiral model, we estimate a pitch angle of 19.°8 ± 3.°1 for the Scutum arm, which is larger than pitch angles reported for other spiral arms. The high pitch angle of the arm may be due tomore » the arm's proximity to the Galactic bar. The Scutum arm sources show an average peculiar motion of 4 km s{sup –1} slower than the Galactic rotation and 8 km s{sup –1} toward the Galactic center. While the direction of this non-circular motion has the same sign as determined for sources in other spiral arms, the motion toward the Galactic center is greater for the Scutum arm sources.« less

  4. Molecular maser flares in the high-mass star-forming region IRAS18566+0408

    NASA Astrophysics Data System (ADS)

    Halbe, Daniel M.

    We report results of a long-termmonitoring study of 6cmformaldehyde (H 2CO), 6.035GHz hydroxyl (OH), and 6.7GHz methanol (CH3OH) masers in the young high-mass protostellar object IRAS18566+0408 (G37.55+0.20). This is the only high-mass star-forming region where correlated variability of three different maser species has been reported. The observations were conducted with the 305m Arecibo Radio Telescope, and together with data from the literature, we present H2CO flux density measurements from 2002 to 2014, CH3OH data from 2006 to 2013, and discuss OH observations obtained between 2008 and 2012. Our extended monitoring observations of the H2CO maser agree with the quasi-periodic flare phenomenon and exponential decrease in quiescent and flare flux densities proposed by Araya and collaborators in 2010. We also confirm the occurrence of 6.035GHz OH flares and a time delay with respect to the H2CO flares. An analysis between the variability behavior of different CH3OH maser components and the H2CO maser suggests that multiple variability mechanisms are responsible for CH3OH flux density changes.

  5. Following the Water: the Evolution of Ice-forming Regions in the Early Solar Nebula

    NASA Technical Reports Server (NTRS)

    Davis, Sanford S.

    2006-01-01

    The abundances of water-vapor and water-ice during the first ten million years of the protoplanetary solar nebula are simulated using a new condensation/sublimation model. This study builds on a "snow line" model reported in ApJ 627 L153 (2005); it uses a simple phenomenological model where water vapor molecules evolve from solar atomic abundance and eventually condenses to ice at colder points in the nebula once the water-vapor partial pressure exceeds a value determined by the phase diagram for water. The synthesis of water vapor from elementary species is modeled with a chemical network consisting of about 400 species and 4000 reactions. The evolution of the icy zone (and its relative abundance of solid ice) is traced from a limited region in the early hotter disk to its final state at the time when the gas is expelled and a planetary system begins to form. Possible effects of this dynamic motion on disk chemistry and organic molecule formation are also described.

  6. Phosphorus-bearing molecules in solar-type star-forming regions: first PO detection

    NASA Astrophysics Data System (ADS)

    Lefloch, Bertrand; Vastel, C.; Viti, S.; Jimenez-Serra, I.; Codella, C.; Podio, L.; Ceccarelli, C.; Mendoza, E.; Lepine, J. R. D.; Bachiller, R.

    2016-11-01

    As part of the Large Program Astrochemical Surveys At IRAM, we have used the IRAM 30 m telescope to lead a systematic search for the emission of rotational transitions of P-bearing species between 80 and 350 GHz towards L1157-B1, a shock position in the solar-type star-forming region L1157. We report the detection of several transitions of PN and, for the first time, of pre-biotic molecule PO. None of these species are detected towards the driving protostar of the outflow L1157-mm. Analysis of the line profiles shows that PN arises from the outflow cavity, where SiO, a strong shock tracer, is produced. Radiative transfer analysis yields an abundance of 2.5 × 10-9 and 0.9 × 10-9 for PO and PN, respectively. These results imply a strong depletion (≈100) of phosphorus in the quiescent cloud gas. Shock modelling shows that atomic N plays a major role in the chemistry of PO and PN. The relative abundance of PO and PN brings constraints both on the duration of the pre-shock phase, which has to be ˜106 yr, and on the shock parameters. The maximum temperature in the shock has to be larger than 4000 K, which implies a shock velocity of 40 km s-1.

  7. Insights from Synthetic Star-forming Regions. I. Reliable Mock Observations from SPH Simulations

    SciTech Connect

    Koepferl, Christine M.; Robitaille, Thomas P.; Biscani, Francesco

    2017-11-01

    Through synthetic observations of a hydrodynamical simulation of an evolving star-forming region, we assess how the choice of observational techniques affects the measurements of properties that trace star formation. Testing and calibrating observational measurements requires synthetic observations that are as realistic as possible. In this part of the series (Paper I), we explore different techniques for mapping the distributions of densities and temperatures from the particle-based simulations onto a Voronoi mesh suitable for radiative transfer and consequently explore their accuracy. We further test different ways to set up the radiative transfer in order to produce realistic synthetic observations. We give amore » detailed description of all methods and ultimately recommend techniques. We have found that the flux around 20 μ m is strongly overestimated when blindly coupling the dust radiative transfer temperature with the hydrodynamical gas temperature. We find that when instead assuming a constant background dust temperature in addition to the radiative transfer heating, the recovered flux is consistent with actual observations. We present around 5800 realistic synthetic observations for Spitzer and Herschel bands, at different evolutionary time-steps, distances, and orientations. In the upcoming papers of this series (Papers II, III, and IV), we will test and calibrate measurements of the star formation rate, gas mass, and the star formation efficiency using our realistic synthetic observations.« less

  8. Externally Heated Protostellar Cores in the Ophiuchus Star-Forming Region

    NASA Technical Reports Server (NTRS)

    Lindberg, Johan E.; Charnley, Steven B.; Jorgensen, Jes K.; Cordiner, Martin A.; Bjerkeli, Per

    2017-01-01

    We present APEX 218 GHz observations of molecular emission in a complete sample of embedded protostars in the Ophiuchus star-forming region. To study the physical properties of the cores, we calculate H2CO and c-C3H2 rotational temperatures, both of which are good tracers of the kinetic temperature of the molecular gas. We find that the H2CO temperatures range between 16K and 124K, with the highest H2CO temperatures toward the hot corino source IRAS 16293-2422 (69-124 K) and the sources in the rho Oph A cloud (23-49 K) located close to the luminous Herbig Be star S1, which externally irradiates the rho Oph A cores. On the other hand, the c-C3H2 rotational temperature is consistently low (7-17 K) in all sources. Our results indicate that the c-C3H2 emission is primarily tracing more shielded parts of the envelope whereas the H2CO emission (at the angular scale of the APEX beam; 3600 au in Ophiuchus) mainly traces the outer irradiated envelopes, apart from in IRAS?16293-2422, where the hot corino emission dominates. In some sources, a secondary velocity component is also seen, possibly tracing the molecular outflow.

  9. 77 FR 65702 - Agency Information Collection Activities: Refugee/Asylee Relative Petition, Form Number I-730...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-30

    ...-0037] Agency Information Collection Activities: Refugee/Asylee Relative Petition, Form Number I-730... request. (2) Title of the Form/Collection: Refugee/Asylee Relative Petition. (3) Agency form number, if... households. Form I- 730 will be used by an asylee or refugee to file on behalf of his or her spouse and/or...

  10. 77 FR 18255 - Agency Information Collection Activities: Form N-565; Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-27

    ... Collection Activities: Form N-565; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day notice of information collection under review; Form N- 565, Application for Replacement... evaluating whether to revise the Form N-565. Should USCIS decide to revise Form N-565 we will advise the...

  11. 75 FR 80835 - Agency Information Collection Activities: Form N-565; Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-23

    ... Collection Activities: Form N-565; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Form N- 565, Application for Replacement... evaluating whether to revise the Form N-565. Should USCIS decide to revise Form N-565 we will advise the...

  12. 76 FR 20362 - Agency Information Collection Activities: Form I-905, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-12

    ... Collection Activities: Form I-905, Extension of a Currently Approved Information Collection; Comment Request Action: 60-Day Notice of Information Collection Under Review: Form I- 905, Application for Authorization... evaluating whether to revise the Form I-905. Should USCIS decide to revise Form I-905 we will advise the...

  13. 75 FR 11898 - Agency Information Collection Activities: Form I-612, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-12

    ... Collection Activities: Form I-612, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 612, Application for Waiver of the... revise the Form I-612. Should USCIS decide to revise the Form I-612 it will advise the public when it...

  14. 75 FR 37821 - Agency Information Collection Activities: Form I-751, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-30

    ... Collection Activities: Form I-751, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 751, Petition to Remove Conditions... the Form I-751. Should USCIS decide to revise Form I-751 we will advise the public when we publish the...

  15. 77 FR 49822 - Agency Information Collection Activities: Application for Removal, Form I-243; Revision of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-17

    ...-0019] Agency Information Collection Activities: Application for Removal, Form I-243; Revision of a... period, USCIS will be evaluating whether to revise the Form I-243. Should USCIS decide to revise Form I... Form I-243. Written comments and suggestions regarding items contained in this information collection...

  16. 76 FR 66946 - Agency Information Collection Activities: Form I-539, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-28

    ... Collection Activities: Form I-539, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 539, Application to Extend/Change... revise the Form I-539. Should USCIS decide to revise Form I-539 we will advise the public when we publish...

  17. 77 FR 65706 - Agency Information Collection Activities: Immigrant Petition for Alien Worker, Form I-140...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-30

    ...-0015] Agency Information Collection Activities: Immigrant Petition for Alien Worker, Form I-140... Form/Collection: Immigrant Petition for Alien Worker. (3) Agency form number, if any, and the... information furnished on Form I-140 will be used by USCIS to classify aliens under sections 203(b)(1), 203(b...

  18. 78 FR 4858 - Agency Information Collection Activities: Immigrant Petition for Alien Workers, Form I-140...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-23

    ...-0015] Agency Information Collection Activities: Immigrant Petition for Alien Workers, Form I-140... Approved Collection. (2) Title of the Form/Collection: Immigrant Petition for Alien Worker. (3) Agency form... other for-profit. The information furnished on Form I-140 will be used by USCIS to classify aliens under...

  19. 76 FR 24908 - Agency Information Collection Activities: Form G-639; Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-03

    ... Collection Activities: Form G-639; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Form G- 639, Freedom of Information/Privacy Act... Form G-639. Should USCIS decide to revise Form G-639 we will advise the [[Page 24909

  20. 76 FR 28444 - Agency Information Collection Activities: Form G-884, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-17

    ... Collection Activities: Form G-884, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of information collection under review: Form G- 884, Request for the Return of... the Form G-884. Should USCIS decide to revise Form G-884 we will advise the public when we publish the...

  1. 76 FR 43337 - Proposed Information Collection; Hunting and Fishing Application Forms and Activity Reports for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-20

    ... (Quota Deer Hunt Application). FWS Form 3-2355 (Waterfowl Lottery Application). FWS Form 3-2356 (Big...] Proposed Information Collection; Hunting and Fishing Application Forms and Activity Reports for National.... We use nine application and report forms associated with hunting and fishing on refuges. We may not...

  2. Spectroscopic Observations of Fe XVIII in Solar Active Regions

    NASA Astrophysics Data System (ADS)

    Teriaca, Luca; Warren, Harry P.; Curdt, Werner

    2012-08-01

    The large uncertainties associated with measuring the amount of high temperature emission in solar active regions (ARs) represents a significant impediment to making progress on the coronal heating problem. Most current observations at temperatures of 3 MK and above are taken with broadband soft X-ray instruments. Such measurements have proven difficult to interpret unambiguously. Here, we present the first spectroscopic observations of the Fe XVIII 974.86 Å emission line in an on-disk AR taken with the SUMER instrument on SOHO. Fe XVIII has a peak formation temperature of 7.1 MK and provides important constraints on the amount of impulsive heating in the corona. Detailed evaluation of the spectra and comparison of the SUMER data with soft X-ray images from the X-Ray Telescope on Hinode confirm that this line is unblended. We also compare the spectroscopic data with observations from the Atmospheric Imaging Assembly (AIA) 94 Å channel on the Solar Dynamics Observatory. The AIA 94 Å channel also contains Fe XVIII, but is blended with emission formed at lower temperatures. We find that it is possible to remove the contaminating blends and form relatively pure Fe XVIII images that are consistent with the spectroscopic observations from SUMER. The observed spectra also contain the Ca XIV 943.63 Å line that, although a factor 2-6 weaker than the Fe XVIII 974.86 Å line, allows us to probe the plasma around 3.5 MK. The observed ratio between the two lines indicates (isothermal approximation) that most of the plasma in the brighter Fe XVIII AR loops is at temperatures between 3.5 and 4 MK.

  3. Earth resources-regional transfer activity contracts review

    NASA Technical Reports Server (NTRS)

    Bensko, J., Jr.; Daniels, J. L.; Downs, S. W., Jr.; Jones, N. L.; Morton, R. R.; Paludan, C. T.

    1977-01-01

    A regional transfer activity contracts review held by the Earth Resources Office was summarized. Contracts in the earth resources field primarily directed toward applications of satellite data and technology in solution of state and regional problems were reviewed. A summary of the progress of each contract was given in order to share experiences of researchers across a seven state region. The region included Missouri, Kentucky, Tennessee, Mississippi, Alabama, Georgia, and North Carolina. Research in several earth science disciplines included forestry, limnology, water resources, land use, geology, and mathematical modeling. The use of computers for establishment of information retrieval systems was also emphasized.

  4. Regional brain activity in women grieving a romantic relationship breakup.

    PubMed

    Najib, Arif; Lorberbaum, Jeffrey P; Kose, Samet; Bohning, Daryl E; George, Mark S

    2004-12-01

    Separation from loved ones commonly leads to grief reactions. In some individuals, grief can evolve into a major depressive episode. The brain regions involved in grief have not been specifically studied. The authors studied brain activity in women actively grieving a recent romantic relationship breakup. It was hypothesized that while remembering their ex-partner, subjects would have altered brain activity in regions identified in sadness imaging studies: the cerebellum, anterior temporal cortex, insula, anterior cingulate, and prefrontal cortex. Nine right-handed women whose romantic relationship ended within the preceding 4 months were studied. Subjects were scanned using blood-oxygen-level-dependent functional magnetic resonance imaging while they alternated between recalling a sad, ruminative thought about their loved one (grief state) and a neutral thought about a different person they knew an equally long time. Acute grief (grief minus neutral state) was associated with increased group activity in posterior brain regions, including the cerebellum, posterior brainstem, and posterior temporoparietal and occipital brain regions. Decreased activity was more prominent anteriorly and on the left and included the anterior brainstem, thalamus, striatum, temporal cortex, insula, and dorsal and ventral anterior cingulate/prefrontal cortex. When a more lenient statistical threshold for regions of interest was used, additional increases were found in the lateral temporal cortex, supragenual anterior cingulate/medial prefrontal cortex, and right inferomedial dorsolateral prefrontal cortex, all of which were adjacent to spatially more prominent decreases. In nearly all brain regions showing brain activity decreases with acute grief, activity decreases were greater in women reporting higher grief levels over the past 2 weeks. During acute grief, subjects showed brain activity changes in the cerebellum, anterior temporal cortex, insula, anterior cingulate, and prefrontal

  5. Chirality of Intermediate Filaments and Magnetic Helicity of Active Regions

    NASA Astrophysics Data System (ADS)

    Lim, Eun-Kyung; Chae, Jongchul

    2009-02-01

    Filaments that form either between or around active regions (ARs) are called intermediate filaments. Even though there have been many theoretical studies, the origin of the chirality of filaments is still unknown. We investigated how intermediate filaments are related to their associated ARs, especially from the point of view of magnetic helicity and the orientation of polarity inversion lines (PILs). The chirality of filaments has been determined based on the orientations of barbs observed in full-disk Hα images taken at Big Bear Solar Observatory during the rising phase of solar cycle 23. The sign of magnetic helicity of ARs has been determined using S/inverse-S shaped sigmoids from Yohkoh SXT images. As a result, we have found good correlation between the chirality of filaments and the magnetic helicity sign of ARs. Among 45 filaments, 42 filaments have shown the same sign as helicity sign of nearby ARs. It has been also confirmed that the role of both the orientation and the relative direction of PILs to ARs in determining the chirality of filaments is not significant, against a theoretical prediction. These results suggest that the chirality of intermediate filaments may originate from magnetic helicity of their associated ARs.

  6. Chirality of Intermediate Filaments and Magnetic Helicity of Active Regions

    NASA Astrophysics Data System (ADS)

    Lim, Eun-Kyung; Chae, J.

    2009-05-01

    Filaments that form either between or around active regions (ARs) are called intermediate filaments. Even though there have been many theoretical studies, the origin of the chirality of filaments is still unknown. We investigated how intermediate filaments are related to their associated ARs, especially from the point of view of magnetic helicity and the orientation of polarity inversion lines (PILs). The chirality of filaments has been determined based on the orientations of barbs observed in the full-disk Hα images taken at Big Bear Solar Observatory during the rising phase of solar cycle 23. The sign of magnetic helicity of ARs has been determined using S/inverse-S shaped sigmoids from Yohkoh SXT images. As a result, we have found a good correlation between the chirality of filaments and the magnetic helicity sign of ARs. Among 45 filaments, 42 filaments have shown the same sign as helicity sign of nearby ARs. It has been also confirmed that the role of both the orientation and the relative direction of PILs to ARs in determining the chirality of filaments is not significant, against a theoretical prediction. These results suggest that the chirality of intermediate filaments may originate from magnetic helicity of their associated ARs.

  7. CO2 infrared emission as a diagnostic of planet-forming regions of disks

    NASA Astrophysics Data System (ADS)

    Bosman, Arthur D.; Bruderer, Simon; van Dishoeck, Ewine F.

    2017-05-01

    Context. The infrared ro-vibrational emission lines from organic molecules in the inner regions of protoplanetary disks are unique probes of the physical and chemical structure of planet-forming regions and the processes that shape them. These observed lines are mostly interpreted with local thermal equilibrium (LTE) slab models at a single temperature. Aims: We aim to study the non-LTE excitation effects of carbon dioxide (CO2) in a full disk model to evaluate: (I) what the emitting regions of the different CO2 ro-vibrational bands are; (II) how the CO2 abundance can be best traced using CO2 ro-vibrational lines using future JWST data and; (III) what the excitation and abundances tell us about the inner disk physics and chemistry. CO2 is a major ice component and its abundance can potentially test models with migrating icy pebbles across the iceline. Methods: A full non-LTE CO2 excitation model has been built starting from experimental and theoretical molecular data. The characteristics of the model are tested using non-LTE slab models. Subsequently the CO2 line formation was modelled using a two-dimensional disk model representative of T Tauri disks where CO2 is detected in the mid-infrared by the Spitzer Space Telescope. Results: The CO2 gas that emits in the 15 μm and 4.5 μm regions of the spectrum is not in LTE and arises in the upper layers of disks, pumped by infrared radiation. The v2 15 μm feature is dominated by optically thick emission for most of the models that fit the observations and increases linearly with source luminosity. Its narrowness compared with that of other molecules stems from a combination of the low rotational excitation temperature ( 250 K) and the inherently narrower feature for CO2. The inferred CO2 abundances derived for observed disks range from 3 × 10-9 to 1 × 10-7 with respect to total gas density for typical gas/dust ratios of 1000, similar to earlier LTE disk estimates. Line-to-continuum ratios are low, in the order of a

  8. Magnetic Separatrix as the Source Region of the Plasma Supply for an Active-region Filament

    SciTech Connect

    Zou, P.; Fang, C.; Chen, P. F.

    2017-02-10

    Solar filaments can be formed via chromospheric evaporation followed by condensation in the corona or by the direct injection of cool plasma from the chromosphere to the corona. We here confirm with high-resolution H α data observed by the 1.6 m New Solar Telescope of the Big Bear Solar Observatory on 2015 August 21 that an active-region filament is maintained by the continuous injection of cold chromospheric plasma. We find that the filament is rooted along a bright ridge in H α , which corresponds to the intersection of a magnetic quasi-separatrix layer with the solar surface. This bright ridgemore » consists of many small patches whose sizes are comparable to the width of the filament threads. It is found that upflows originate from the brighter patches of the ridge, whereas the downflows move toward the weaker patches of the ridge. The whole filament is composed of two opposite-direction streams, implying that longitudinal oscillations are not the only cause of the counterstreamings, and unidirectional siphon flows with alternative directions are another possibility.« less

  9. Surface active complexes formed between keratin polypeptides and ionic surfactants.

    PubMed

    Pan, Fang; Lu, Zhiming; Tucker, Ian; Hosking, Sarah; Petkov, Jordan; Lu, Jian R

    2016-12-15

    Keratins are a group of important proteins in skin and hair and as biomaterials they can provide desirable properties such as strength, biocompatibility, and moisture regaining and retaining. The aim of this work is to develop water-soluble keratin polypeptides from sheep wool and then explore how their surface adsorption behaves with and without surfactants. Successful preparation of keratin samples was demonstrated by identification of the key components from gel electrophoresis and the reproducible production of gram scale samples with and without SDS (sodium dodecylsulphate) during wool fibre dissolution. SDS micelles could reduce the formation of disulphide bonds between keratins during extraction, reducing inter-molecular crosslinking and improving keratin polypeptide solubility. However, Zeta potential measurements of the two polypeptide batches demonstrated almost identical pH dependent surface charge distributions with isoelectric points around pH 3.5, showing complete removal of SDS during purification by dialysis. In spite of different solubility from the two batches of keratin samples prepared, very similar adsorption and aggregation behavior was revealed from surface tension measurements and dynamic light scattering. Mixing of keratin polypeptides with SDS and C 12 TAB (dodecyltrimethylammonium bromide) led to the formation of keratin-surfactant complexes that were substantially more effective at reducing surface tension than the polypeptides alone, showing great promise in the delivery of keratin polypeptides via the surface active complexes. Neutron reflection measurements revealed the coexistence of surfactant and keratin polypeptides at the interface, thus providing the structural support to the observed surface tension changes associated with the formation of the surface active complexes. Copyright © 2016. Published by Elsevier Inc.

  10. Gamma-ray Bursts May Originate in Star-Forming Regions

    NASA Astrophysics Data System (ADS)

    2001-04-01

    New findings from two X-ray satellites suggest that gamma-ray bursts, some of the most intense blasts in the universe, may be created in the same area where stars are born. Dr. Luigi Piro of the Consiglio Nazionale delle Ricerche (CNR) in Rome, Italy, presented data from NASA's Chandra X-ray Observatory and the Italian-Dutch ASI BeppoSAX observatory today at the Gamma Ray 2001 conference in Baltimore, MD. "We know that when a gamma-ray burst explodes, it produces a blast of material called a fireball, which expands at relativistic speeds like a rapidly inflating bubble," said Piro, who works within CNR's Istituto di Astrofisica Spaziale. "Our team found evidence that the blast wave caused by the fireball brakes against a wall of very dense gas, which we believe is the crowded region where stars form." Several theories exist about what causes gamma-ray bursts. Among more popular theories are that gamma-ray bursts come from various combinations of merging neutron stars and black holes, or, from the explosion of massive stars, called hypernovae. "Because gamma-ray bursts are going off in extremely distant galaxies, it is difficult to 'see' the regions that harbor them," said Piro. "We can only gather circumstantial evidence as to where and how they form." Piro's observations support the hypernova model. Scientists believe that within dense star-forming regions, the massive star required for a hypernova explosion evolves extremely rapidly. On astronomical time scales, the supermassive star would evolve over the course of only about one million years. Thus, the hypernova explosion may occur in the same stellar environment that originally produced the massive star itself, and perhaps may trigger even more star formation. The hint that gamma-ray bursts can occur in dense media came during a Chandra observation of an afterglow that occurred on September 26, 2000. Prof. Gordon Garmire of Pennsylvania State University, University Park, PA, found X-ray emission to be greater

  11. Predictions of active region flaring probability using subsurface helicity measurements

    NASA Astrophysics Data System (ADS)

    Reinard, A. A.; Komm, R.; Hill, F.

    2010-12-01

    Solar flares are responsible for a number of hazardous effects on the earth such as disabling high-frequency radio communications, interfering with GPS measurements, and disrupting satellites. However, forecasting flare occurrence is currently very difficult. One possible means for predicting flare occurrence lies in helioseismology, i.e. analysis of the region below the active region for signs of an impending flare. Time series helioseismic data collected by the Global Oscillation Network Group (GONG) has been analyzed for a subset of active regions that produce large flares and a subset with very high magnetic field strength that produce no flares. A predictive parameter has been developed and analyzed using discriminant analysis as well as traditional forecasting tools such as the Heidke skill score. Preliminary results show that this parameter predicts the flaring probability of an active region 2-3 days in advance with a relatively high degree of success.

  12. RADIO JETS AND DISKS IN THE INTERMEDIATE-MASS STAR-FORMING REGION NGC2071IR

    SciTech Connect

    Trinidad, M. A.; Rodriguez, T.; Rodriguez, L. F., E-mail: trinidad@astro.ugto.m

    2009-11-20

    We report the results of simultaneous radio continuum and water maser observations toward the NGC 2071IR star-forming region, carried out with the VLA in its A configuration. We detect continuum emission toward the infrared sources IRS 1 and IRS 3 at 1.3 and 3.6 cm. In addition, a new continuum source, VLA 1, is also detected at both wavelengths, which is located between IRS 1 and IRS 3. IRS 1 breaks up into three continuum peaks (IRS 1E, 1C, and 1W), aligned in the east-west direction (P.A. = 100{sup 0}). IRS 1 is the central source, while the sources Emore » and W seem to be condensations ejected by IRS 1. In the same way, IRS 3 is also forming a triple system (IRS 3N, 3C and 3S), which is elongated in the northeast-southwest direction and the condensations, IRS 3N and IRS 3S, are symmetrically located along the major axis. Based on the morphology and the continuum emission, we suggest that both IRS 1 and IRS 3 are radio jets, which have ejected condensations into the interstellar medium. Moreover, IRS 1 and IRS 3 seem to be the driving sources of the large-scale outflows observed in H{sub 2} and CO, respectively. In addition, we also detected water emission toward the systems IRS 1, IRS 3, and the new source VLA 1. Based on the spatial-kinematic distribution of the water masers, we find evidence that the water masers are tracing part of circumstellar disks around IRS 1C and IRS 3C. Moreover, we estimate that the sources IRS 1C and IRS 3C have central masses of approx5 and approx1 M {sub sun}, respectively. We conclude that the radio continuum and water maser emission are tracing disk-YSO-outflow systems toward IRS 1 and IRS 3, which are low- and intermediate-mass young stellar objects, respectively.« less

  13. Weak and Compact Radio Emission in Early High-Mass Star Forming Regions

    NASA Astrophysics Data System (ADS)

    Rosero, Viviana; P. Hofner, M. Claussen, S. Kurtz, R. Cesaroni, E. D. Araya, C. Carrasco-González, L. F. Rodríguez, K. M. Menten, F. Wyrowski, L. Loinard, S. P. Ellingsen

    2018-01-01

    High-mass protostars are difficult to detect: they have short evolutionary timescales, they tend to be located at large distances, and they are usually embedded within complicated cluster environments. In this work, we aimed to identify and analyze candidates at the earliest stages of high-mass star formation, where only low-level (< 1 mJy) radio emission is expected. We used the Karl G. Jansky Very Large Array to achieve one of the most sensitive (image RMS < 3 -- 10 μJy/beam) centimeter continuum surveys towards high-mass star forming regions to date, with observations at 1.3 and 6 cm and an angular resolution < 0.5". The sample is composed of cold molecular clumps with and without infrared sources (CMC--IRs and CMCs, respectively) and hot molecular cores (HMCs), covering a wide range of parameters such as bolometric luminosity and distance. We detected 70 radio continuum sources that are associated with dust clumps, most of which are weak and compact. We detected centimeter wavelength sources in 100% of our HMCs, which is a higher fraction than previously expected and suggests that radio continuum may be detectable at weak levels in all HMCs. The lack of radio detections for some objects in the sample (including most CMCs) contributes strong evidence that these are prestellar clumps, providing interesting constraints and ideal follow up candidates for studies of the earliest stages of high-mass stars. Our results show further evidence for an evolutionary sequence in the formation of high-mass stars, from starless cores (i.e., CMCs) to relatively more evolved ones (i.e., HMCs). Many of our detections have morphologies and other observational parameters that resemble collimated ionized jets, which is highly relevant for recent theoretical models based on core accretion that predict that the first stages of ionization from high-mass stars are in the form of jets. Additionally, we found that properties of ionized jets from low and high-mass stars are extremely well

  14. IFLA General Conference, 1985. Division on Regional Activities. Papers.

    ERIC Educational Resources Information Center

    International Federation of Library Associations, The Hague (Netherlands).

    Papers on regional library activities which were presented at the 1985 International Federation of Library Associations (IFLA) conference include: (1) "Importance of Information Resources in National Development with Particular Reference to the Asian Scene" (Yogendra P. Dubey, India); (2) "Report of the Activities of the Regional…

  15. Universities and Economic Development Activities: A UK Regional Comparison

    ERIC Educational Resources Information Center

    Decter, Moira; Cave, Frank; Rose, Mary; Peers, Gill; Fogg, Helen; Smith, Susan M.

    2011-01-01

    A number of UK universities prioritize economic development or regeneration activities and for some of these universities such activities are the main focus of their knowledge transfer work. This study compares two regions of the UK--the North West and the South East of England--which have very different levels of economic performance.…

  16. 75 FR 41216 - Agency Information Collection Activities: Form N-644, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-15

    ... Collection Activities: Form N-644, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 644, Application for Posthumous...

  17. 76 FR 20361 - Agency Information Collection Activities: Form I-907, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-12

    ... Collection Activities: Form I-907, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-day notice of information collection under review: Form I- 907, Request for Premium Processing... the [[Page 20362

  18. Wound Healing Activity of Topical Application Forms Based on Ayurveda

    PubMed Central

    Datta, Hema Sharma; Mitra, Shankar Kumar; Patwardhan, Bhushan

    2011-01-01

    The traditional Indian medicine—Ayurveda, describes various herbs, fats, oils and minerals with anti-aging as well as wound healing properties. With aging, numerous changes occur in skin, including decrease in tissue cell regeneration, decrease in collagen content, loss of skin elasticity and mechanical strength. We prepared five topical anti-aging formulations using cow ghee, flax seed oil, Phyllanthus emblica fruits, Shorea robusta resin, Yashada bhasma as study materials. For preliminary efficacy evaluation of the anti-aging activity we chose excision and incision wound healing animal models and studied the parameters including wound contraction, collagen content and skin breaking strength which in turn is indicative of the tissue cell regeneration capacity, collagenation capacity and mechanical strength of skin. The group treated with the formulations containing Yashada bhasma along with Shorea robusta resin and flax seed oil showed significantly better wound contraction (P < .01), higher collagen content (P < .05) and better skin breaking strength (P < .01) as compared to control group; thus proposing them to be effective prospective anti-aging formulations. PMID:19252191

  19. [L forms of Staphylococcus aureus. Behavior of coagulase, hemolytic and desoxyribonuclease activities and antibiotic sensitivity].

    PubMed

    Loschiavo, F; Giarrizzo, S

    1977-01-01

    L Forms derived from strains of coagulase positive Staphylococcus aureus, have, on the whole, preserved their DNAsic, haemolitic and coagulastic activities. L. forms showed high resistence to antibiotics acting on the bacterial cell-wall. The sensibility to other antibiotics was, roughly, analogous for the L forms as well as for the bacterial strains ones, with the exception of the clortetraciclin and the diidrostreptomicin, ehich proved to be comparatively more active on the L forms.

  20. SUB-STELLAR COMPANIONS AND STELLAR MULTIPLICITY IN THE TAURUS STAR-FORMING REGION

    SciTech Connect

    Daemgen, Sebastian; Bonavita, Mariangela; Jayawardhana, Ray

    2015-02-01

    We present results from a large, high-spatial-resolution near-infrared imaging search for stellar and sub-stellar companions in the Taurus-Auriga star-forming region. The sample covers 64 stars with masses between those of the most massive Taurus members at ∼3 M {sub ☉} and low-mass stars at ∼0.2 M {sub ☉}. We detected 74 companion candidates, 34 of these reported for the first time. Twenty-five companions are likely physically bound, partly confirmed by follow-up observations. Four candidate companions are likely unrelated field stars. Assuming physical association with their host star, estimated companion masses are as low as ∼2 M {sub Jup}. The inferred multiplicity frequency withinmore » our sensitivity limits between ∼10-1500 AU is 26.3{sub −4.9}{sup +6.6}%. Applying a completeness correction, 62% ± 14% of all Taurus stars between 0.7 and 1.4 M {sub ☉} appear to be multiple. Higher order multiples were found in 1.8{sub −1.5}{sup +4.2}% of the cases, in agreement with previous observations of the field. We estimate a sub-stellar companion frequency of ∼3.5%-8.8% within our sensitivity limits from the discovery of two likely bound and three other tentative very low-mass companions. This frequency appears to be in agreement with what is expected from the tail of the stellar companion mass ratio distribution, suggesting that stellar and brown dwarf companions share the same dominant formation mechanism. Further, we find evidence for possible evolution of binary parameters between two identified sub-populations in Taurus with ages of ∼2 Myr and ∼20 Myr, respectively.« less

  1. A Multi-Wavelength View of Planet Forming Regions: Unleashing the Full Power of ALMA

    NASA Astrophysics Data System (ADS)

    Tazzari, Marco

    2017-11-01

    Observations at sub-mm/mm wavelengths allow us to probe the solids in the interior of protoplanetary disks, where the bulk of the dust is located and planet formation is expected to occur. However, the actual size of dust grains is still largely unknown due to the limited angular resolution and sensitivity of past observations. The upgraded VLA and, especially, the ALMA observatories provide now powerful tools to resolve grain growth in disks, making the time ripe for developing a multi-wavelength analysis of sub-mm/mm observations of disks. In my contribution I will present a novel analysis method for multi-wavelength ALMA/VLA observations which, based on the self-consistent modelling of the sub-mm/mm disk continuum emission, allows us to constrain simultaneously the size distribution of dust grains and the disk's physical structure (Tazzari et al. 2016, A&A 588 A53). I will also present the recent analysis of spatially resolved ALMA Band 7 observations of a large sample of disks in the Lupus star forming region, from which we obtained a tentative evidence of a disk size-disk mass correlation (Tazzari et al. 2017, arXiv:1707.01499). Finally, I will introduce galario, a GPU Accelerated Library for the Analysis of Radio Interferometry Observations. Fitting the observed visibilities in the uv-plane is computationally demanding: with galario we solve this problem for the current as well as for the full-science ALMA capabilities by leveraging on the computing power of GPUs, providing the computational breakthrough needed to fully exploit the new wealth of information delivered by ALMA.

  2. MULTIPLICITY, DISKS, AND JETS IN THE NGC 2071 STAR-FORMING REGION

    SciTech Connect

    Carrasco-Gonzalez, Carlos; Osorio, Mayra; Anglada, Guillem

    2012-02-10

    We present centimeter (cm) and millimeter (mm) observations of the NGC 2071 star-forming region performed with the Very Large Array (VLA) and Combined Array for Research in Millimeter-wave Astronomy (CARMA). We detected counterparts at 3.6 cm and 3 mm for the previously known sources IRS 1, IRS 2, IRS 3, and VLA 1. All these sources show spectral energy distributions (SEDs) dominated by free-free thermal emission at cm wavelengths and thermal dust emission at mm wavelengths, suggesting that all of them are associated with young stellar objects (YSOs). IRS 1 shows a complex morphology at 3.6 cm, with changes inmore » the direction of its elongation. We discuss two possible explanations to this morphology: the result of changes in the direction of a jet due to interactions with a dense ambient medium, or that we are actually observing the superposition of two jets arising from two components of a binary system. Higher angular resolution observations at 1.3 cm support the second possibility, since a double source is inferred at this wavelength. IRS 3 shows a clear jet-like morphology at 3.6 cm. Over a timespan of four years, we observed changes in the morphology of this source that we interpret as due to ejection of ionized material in a jet. The emission at 3 mm of IRS 3 is angularly resolved, with a deconvolved size (FWHM) of {approx}120 AU, and seems to be tracing a dusty circumstellar disk perpendicular to the radio jet. An irradiated accretion disk model around an intermediate-mass YSO can account for the observed SED and spatial intensity profile at 3 mm, supporting this interpretation.« less

  3. A Survey for Planetary-mass Brown Dwarfs in the Chamaeleon I Star-forming Region

    NASA Astrophysics Data System (ADS)

    Esplin, T. L.; Luhman, K. L.; Faherty, J. K.; Mamajek, E. E.; Bochanski, J. J.

    2017-08-01

    We have performed a search for planetary-mass brown dwarfs in the Chamaeleon I star-forming region using proper motions and photometry measured from optical and infrared images from the Spitzer Space Telescope, the Hubble Space Telescope, and ground-based facilities. Through near-IR spectroscopy at Gemini Observatory, we have confirmed six of the candidates as new late-type members of Chamaeleon I (≥M8). One of these objects, Cha J11110675-7636030, has the faintest extinction-corrected M K among known members, which corresponds to a mass of 3-6 {M}{Jup} according to evolutionary models. That object and two other new members have redder mid-IR colors than young photospheres at ≤M9.5, which may indicate the presence of disks. However, since those objects may be later than M9.5 and the mid-IR colors of young photospheres are ill-defined at those types, we cannot determine conclusively whether color excesses from disks are present. If Cha J11110675-7636030 does have a disk, it would be a contender for the least-massive known brown dwarf with a disk. Since the new brown dwarfs that we have found extend below our completeness limit of 6-10 M {}{Jup}, deeper observations are needed to measure the minimum mass of the initial mass function in Chamaeleon I. Based on observations made with the Spitzer Space Telescope, the NASA/ESA Hubble Space Telescope, Gemini Observatory, the ESO Telescopes at Paranal Observatory, Magellan Observatory, the Cerro Tololo Inter-American Observatory, and the ESA Gaia mission.

  4. Distribution of 26Al in the CR chondrite chondrule-forming region of the protoplanetary disk

    NASA Astrophysics Data System (ADS)

    Schrader, Devin L.; Nagashima, Kazuhide; Krot, Alexander N.; Ogliore, Ryan C.; Yin, Qing-Zhu; Amelin, Yuri; Stirling, Claudine H.; Kaltenbach, Angela

    2017-03-01

    trends with major and minor element or O-isotope compositions between these populations. The weighted mean (26Al/27Al)0 of 22 CR chondrules measured is (1.8 ± 0.3) × 10-6. An apparent agreement between the 26Al-26Mg ages (using weighted mean value) and the revised (using 238U/235U ratio for bulk CR chondrites of 137.7789 ± 0.0085) 207Pb-206Pb age of a set of chondrules from CR chondrites (Amelin et al., 2002, Science297, 1678) is consistent with the initial 26Al/27Al ratio in the CR chondrite chondrule-forming region at the canonical level (∼5.2 × 10-5), allowing the use of 26Al-26Mg systematics as a chronometer for CR chondrules. To prove chronological significance of 26Al for CR chondrules, measurements of Al-Mg and U-Pb isotope systematics on individual chondrules are required. The presence of several generations among CR chondrules indicates some chondrules that accreted into the CR chondrite parent asteroid avoided melting by later chondrule-forming events, suggesting chondrule-forming processes may have occurred on relatively limited spatial scales. Accretion of the CR chondrite parent body occurred at >4.0-0.3+0.5 Ma after the formation of CAIs with the canonical 26Al/27Al ratio, although rapid accretion after formation of the major population of CR chondrules is not required by our data.

  5. EVIDENCE OF IMPULSIVE HEATING IN ACTIVE REGION CORE LOOPS

    SciTech Connect

    Tripathi, Durgesh; Mason, Helen E.; Klimchuk, James A., E-mail: d.tripathi@damtp.cam.ac.u

    2010-11-01

    Using a full spectral scan of an active region from the Extreme-Ultraviolet Imaging Spectrometer (EIS) we have obtained emission measure EM(T) distributions in two different moss regions within the same active region. We have compared these with theoretical transition region EMs derived for three limiting cases, namely, static equilibrium, strong condensation, and strong evaporation from Klimchuk et al. The EM distributions in both the moss regions are strikingly similar and show a monotonically increasing trend from log T[K] = 5.15-6.3. Using photospheric abundances, we obtain a consistent EM distribution for all ions. Comparing the observed and theoretical EM distributions, wemore » find that the observed EM distribution is best explained by the strong condensation case (EM{sub con}), suggesting that a downward enthalpy flux plays an important and possibly dominant role in powering the transition region moss emission. The downflows could be due to unresolved coronal plasma that is cooling and draining after having been impulsively heated. This supports the idea that the hot loops (with temperatures of 3-5 MK) seen in the core of active regions are heated by nanoflares.« less

  6. Distribution of active and inactive forms of endorphins in rat pituitary and brain.

    PubMed Central

    Zakarian, S; Smyth, D

    1979-01-01

    The recent isolation and identification of alpha-N-acetyl forms of the C-Fragment of lipotropin (beta-endorphin, residues 61-91) and the C'-Fragment (residues 61-87) [Smyth, D.G., Massey, D.E., Zakarian, S. & Finnie, M. (1979) Nature (London) 279, 252-254] has led to a study of their distribution in the pituitary and brain of the rat. Regions were mapped by the method of immunofluorescent staining and the reactive peptides were determined by immunoassay after extraction, gel filtration, and ion exchange chromatography. The major immunoreactive peptides in both lobes of the pituitary were found to be C'-Fragment and N-acetyl C'-Fragment, which are weakly active or inactive as opiates; the C-Fragment and its N-acetyl derivative represented minor components. This indicates that in the rat the circulating "endorphins" released from pituitary would have little morphinomimetic activity. The same four immunoreactive peptides were observed in rat brain. In the hippocampus the C'-Fragment was the principal component in the midbrain there was more C-Fragment but C'-Fragment predominated; in the hypothalamus the C-Fragment was the major peptide, almost to the exclusion of the other peptides. The results demonstrate that the processing of lipotropin is under differential control in anatomically distinct regions of the central nervous system. The processing of lipotropin in the hypothalamus is directed specifically to the production of lipotropin C-Fragment. Images PMID:392510

  7. Alarin but not its alternative-splicing form, GALP (Galanin-like peptide) has antimicrobial activity

    SciTech Connect

    Wada, Akihiro, E-mail: a-wada@nagasaki-u.ac.jp; Wong, Pooi-Fong; Hojo, Hironobu

    2013-05-03

    Highlights: • Alarin inhibits the growth of E. coli but not S. aureus. • Alarin’s potency is comparable to LL-37 in inhibiting the growth of E. coli. • Alarin can cause bacterial membrane blebbing. • Alalin does not induce hemolysis on erythrocytes. -- Abstract: Alarin is an alternative-splicing form of GALP (galanin-like peptide). It shares only 5 conserved amino acids at the N-terminal region with GALP which is involved in a diverse range of normal brain functions. This study seeks to investigate whether alarin has additional functions due to its differences from GALP. Here, we have shown using a radialmore » diffusion assay that alarin but not GALP inhibited the growth of Escherichia coli (strain ML-35). The conserved N-terminal region, however, remained essential for the antimicrobial activity of alarin as truncated peptides showed reduced killing effect. Moreover, alarin inhibited the growth of E. coli in a similar potency as human cathelicidin LL-37, a well-studied antimicrobial peptide. Electron microscopy further showed that alarin induced bacterial membrane blebbing but unlike LL-37, it did not cause hemolysis of erythrocytes. In addition, alarin is only active against the gram-negative bacteria, E. coli but not the gram-positive bacteria, Staphylococcus aureus. Thus, these data suggest that alarin has potentials as an antimicrobial and should be considered for the development in human therapeutics.« less

  8. Eruptions that Drive Coronal Jets in a Solar Active Region

    NASA Technical Reports Server (NTRS)

    Sterling, Alphonse C.; Moore, Ronald L.; Falconer, David A.; Panesar, Navdeep K.; Akiyama, Sachiko; Yashiro, Seiji; Gopalswamy, Nat

    2016-01-01

    Solar coronal jets are common in both coronal holes and in active regions (e.g., Shibata et al. 1992, Shimojo et al. 1996, Cirtain et al. 2007. Savcheva et al. 2007). Recently, Sterling et al. (2015), using data from Hinode/XRT and SDO/AIA, found that coronal jets originating in polar coronal holes result from the eruption of small-scale filaments (minifilaments). The jet bright point (JBP) seen in X-rays and hotter EUV channels off to one side of the base of the jet's spire develops at the location where the minifilament erupts, consistent with the JBPs being miniature versions of typical solar flares that occur in the wake of large-scale filament eruptions. Here we consider whether active region coronal jets also result from the same minifilament-eruption mechanism, or whether they instead result from a different mechanism (e.g. Yokoyama & Shibata 1995). We present observations of an on-disk active region (NOAA AR 11513) that produced numerous jets on 2012 June 30, using data from SDO/AIA and HMI, and from GOES/SXI. We find that several of these active region jets also originate with eruptions of miniature filaments (size scale 20'') emanating from small-scale magnetic neutral lines of the region. This demonstrates that active region coronal jets are indeed frequently driven by minifilament eruptions. Other jets from the active region were also consistent with their drivers being minifilament eruptions, but we could not confirm this because the onsets of those jets were hidden from our view. This work was supported by funding from NASA/LWS, NASA/HGI, and Hinode. A full report of this study appears in Sterling et al. (2016).

  9. Investigation of OH and H2O masers in the star-forming region G 188.946+0.886

    NASA Astrophysics Data System (ADS)

    Ashimbaeva, N. T.; Colom, P.; Lekht, E. E.; Pashchenko, M. I.; Rudnitskii, G. M.; Tolmachev, A. M.

    2016-10-01

    We present the results of our observations of the maser radio emission source G188.946+0.886 in hydroxyl (OH) molecular lines with the radio telescope of the Nançay Observatory (France) and in the H2O line at λ = 1.35 cm with the RT-22 radio telescope at the Pushchino Observatory (Russia). An emission feature in the 1720-MHz satellite line of the OH ground state has been detected for the first time. The radial velocity of the feature, V LSR = 3.6 km s-1, has a "blue" shift relative to the range of emission velocities in the main 1665- and 1667-MHz OH lines, which is 8-11 km s-1. This suggests a probable connection of the observed feature in the 1720-MHz line with the "blue" wing of the bipolar outflow observed in this region in the CO line. We have estimated the magnetic field strength for three features (0.90 and 0.8 mG for 1665 MHz and 0.25 mG for 1720 MHz) from the Zeeman splitting in the 1665- and 1720-MHz lines. No emission and (or) absorption has been detected in the other 1612-MHz satellite OH line. Three cycles of H2O maser activity have been revealed. The variability is quasi-periodic in pattern. There is a general tendency for the maser activity to decrease. Some clusters of H2O maser spots can form organized structures, for example, chains and other forms.

  10. Flows in active region loops observed by Hinode EIS

    NASA Astrophysics Data System (ADS)

    Del Zanna, G.

    2008-04-01

    We aim to investigate the overall characteristics of coronal active region loops and their evolution. The Hinode database was searched for observations of active regions as they crossed the Sun centre. NOAA 10926 was selected. The morphology of this young active region did not significantly change over the course of a few days. Persistent redshifts, stronger in cooler lines (about 5-10 km s-1 in Fe XII and 20-30 km s-1 in Fe VIII), were observed in most loop structures with the EUV Imaging Spectrometer. Persistent blueshifts, stronger in the hotter lines (typically 5-20 km s-1 in Fe XII and 10-30 km s-1 in Fe XV), were present in areas of weak emission, in a sharp boundary between the low-lying “hot” 3 MK loops and the higher “cooler” 1 MK loops.

  11. TARPs: Tracked Active Region Patches from SoHO/MDI

    NASA Astrophysics Data System (ADS)

    Turmon, M.; Hoeksema, J. T.; Bobra, M.

    2013-12-01

    We describe progress toward creating a retrospective MDI data product consisting of tracked magnetic features on the scale of solar active regions, abbreviated TARPs (Tracked Active Region Patches). The TARPs are being developed as a backward-looking extension (covering approximately 3500 regions spanning 1996-2010) to the HARP (HMI Active Region Patch) data product that has already been released for HMI (2010-present). Like the HARPs, the MDI TARP data set is designed to be a catalog of active regions (ARs), indexed by a region ID number, analogous to a NOAA AR number, and time. TARPs from MDI are computed based on the 96-minute synoptic magnetograms and pseudo-continuum intensitygrams. As with the related HARP data product, the approximate threshold for significance is 100G. Use of both image types together allows faculae and sunspots to be separated out as sub-classes of activity, in addition to identifying the overall active region that the faculae/sunspots are part of. After being identified in single images, the magnetically-active patches are grouped and tracked from image to image. Merges among growing active regions, as well as faint active regions hovering at the threshold of detection, are handled automatically. Regions are tracked from their inception until they decay within view, or transit off the visible disk. The final data product is indexed by a nominal AR number and time. For each active region and for each time, a bitmap image is stored containing the precise outline of the active region. Additionaly, metadata such as areas and integrated fluxes are stored for each AR and for each time. Because there is a calibration between the HMI and MDI magnetograms (Liu, Hoeksema et al. 2012), it is straightforward to use the same classification and tracking rules for the HARPs (from HMI) and the MDI TARPs. We anticipate that this will allow a consistent catalog spanning both instruments. We envision several uses for the TARP data product, which will be

  12. The THMIS-MTR observation of a active region filament

    NASA Astrophysics Data System (ADS)

    Zong, W. G.; Tang, Y. H.; Fang, C.

    We present some THMIS-MTR observations of a active region filament on September 4, 2002. The full stokes parameters of the filament were obtained in Hα, CaII 8542 and FeI 6302. By use of the data with high spatial resolution(0.44" per pixel), we probed the fine structure of the filament and gave out the parameters at the barbs' endpoints, including intensity, velocity and longitudinal magnetic field. Comparing the quiescent filament which we have discussed before, we find that: 1)The velocities of the barbs' endpoints are much bigger in the active region filament, the values are more than one thousand meters per second. 2)The barbs' endpoints terminate at the low logitudinal magnetic field in the active region filament, too.

  13. Active Region Moss: Doppler Shifts from Hinode/EIS Observations

    NASA Technical Reports Server (NTRS)

    Tripathi, Durgesh; Mason, Helen E.; Klimchuk, James A.

    2012-01-01

    Studying the Doppler shifts and the temperature dependence of Doppler shifts in moss regions can help us understand the heating processes in the core of the active regions. In this paper we have used an active region observation recorded by the Extreme-ultraviolet Imaging Spectrometer (EIS) onboard Hinode on 12-Dec- 2007 to measure the Doppler shifts in the moss regions. We have distinguished the moss regions from the rest of the active region by defining a low density cut-off as derived by Tripathi et al. (2010). We have carried out a very careful analysis of the EIS wavelength calibration based on the method described in Young, O Dwyer and Mason (2012). For spectral lines having maximum sensitivity between log T = 5.85 and log T = 6.25 K, we find that the velocity distribution peaks at around 0 km/s with an estimated error of 4 km/s. The width of the distribution decreases with temperature. The mean of the distribution shows a blue shift which increases with increasing temperature and the distribution also shows asymmetries towards blue-shift. Comparing these results with observables predicted from different coronal heating models, we find that these results are consistent with both steady and impulsive heating scenarios. Further observational constraints are needed to distinguish between these two heating scenarios.

  14. The structure of the cometary globule CG 12: a high-latitude star-forming region

    NASA Astrophysics Data System (ADS)

    Haikala, L. K.; Olberg, M.

    2007-04-01

    regions. Based on observations collected at the European Southern Observatory, La Silla, Chile. Figures 11 and 12 and Appendix A are only available in electronic form via http://www.aanda.org

  15. Computational identification of harmful mutation regions to the activity of transposable elements.

    PubMed

    Jin, Lingling; McQuillan, Ian; Li, Longhai

    2017-11-17

    Transposable elements (TEs) are interspersed DNA sequences that can move or copy to new positions within a genome. TEs are believed to promote speciation and their activities play a significant role in human disease. In the human genome, the 22 AluY and 6 AluS TE subfamilies have been the most recently active, and their transposition has been implicated in many inherited human diseases and in various forms of cancer. Therefore, understanding their transposition activity is very important and identifying the factors that affect their transpositional activity is of great interest. Recently, there has been some work done to quantify the activity levels of active Alu TEs based on variation in the sequence. Given this activity data, an analysis of TE activity based on the position of mutations is conducted. A method/simulation is created to computationally predict so-called harmful mutation regions in the consensus sequence of a TE; that is, mutations that occur in these regions decrease the transpositional activity dramatically. The methods are applied to the most active subfamily, AluY, to identify the harmful regions, and seven harmful regions are identified within the AluY consensus with q-values less than 0.05. A supplementary simulation also shows that the identified harmful regions covering the AluYa5 RNA functional regions are not occurring by chance. This method is then applied to two additional TE families: the Alu family and the L1 family, to computationally detect the harmful regions in these elements. We use a computational method to identify a set of harmful mutation regions. Mutations within the identified harmful regions decrease the transpositional activity of active elements. The correlation between the mutations within these regions and the transpositional activity of TEs are shown to be statistically significant. Verifications are presented using the activity of AluY elements and the secondary structure of the AluYa5 RNA, providing evidence that the

  16. THz quantum cascade lasers with wafer bonded active regions.

    PubMed

    Brandstetter, M; Deutsch, C; Benz, A; Cole, G D; Detz, H; Andrews, A M; Schrenk, W; Strasser, G; Unterrainer, K

    2012-10-08

    We demonstrate terahertz quantum-cascade lasers with a 30 μm thick double-metal waveguide, which are fabricated by stacking two 15 μm thick active regions using a wafer bonding process. By increasing the active region thickness more optical power is generated inside the cavity, the waveguide losses are decreased and the far-field is improved due to a larger facet aperture. In this way the output power is increased by significantly more than a factor of 2 without reducing the maximum operating temperature and without increasing the threshold current.

  17. Photoreactivity of the linker region of two consecutive G-quadruplexes formed by human telomeric DNA.

    PubMed

    Li, Yue; Sugiyama, Hiroshi

    2015-05-25

    We report the application of a photoreaction method for probing two consecutive G-quadruplexes formed by human telomeric DNA. This method can discriminate the loop structure located between two consecutive G-quadruplexes formed by eight TTAGGG repeats in K(+) and Na(+) solutions.

  18. 76 FR 11807 - Agency Information Collection Activities: Form N-565, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-03

    ... Collection Activities: Form N-565, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 565, Application for Replacement... of the Department of Homeland Security sponsoring the collection: Form N-565; U.S. Citizenship and...

  19. 76 FR 59710 - Agency Information Collection Activities: Form N-600; Revision of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-27

    ... Collection Activities: Form N-600; Revision of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Form N- 600, Application for Certificate of... the applicable component of the Department of Homeland Security sponsoring the collection: Form N-600...

  20. 75 FR 43535 - Agency Information Collection Activities: Form N-644, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-26

    ... Collection Activities: Form N-644, Revision of a Currently Approved Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: Form N- 644, Application for Posthumous...-day comment period USCIS would be evaluating whether to revise the Form [[Page 43536

  1. 76 FR 69275 - Agency Information Collection Activities: Form N-400, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ... Collection Activities: Form N-400, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 400, Application for Naturalization... sponsoring the collection: Form N-400. U.S. Citizenship and Immigration Services. (4) Affected public who...

  2. 75 FR 5099 - Agency Information Collection Activities: Form N-648, Revision of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-01

    ... Collection Activities: Form N-648, Revision of an Existing Information Collection Request; Comment Request ACTION: 60-day notice of information collection under review: Form N- 648, Medical Certification for..., and the applicable component of the Department of Homeland Security sponsoring the collection: Form N...

  3. 76 FR 53144 - Agency Information Collection Activities: Form N-336; Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-25

    ... Collection Activities: Form N-336; Revision of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form N- 336, Request for Hearing on a... Homeland Security sponsoring the collection: Form N-336; U.S. Citizenship and Immigration Services (USCIS...

  4. 76 FR 38197 - Agency Information Collection Activities; Form N-600K, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-29

    ... Collection Activities; Form N-600K, Revision of a Currently Approved Information Collection; Comment Request ACTION: 60-Day notice of information collection under review: form N- 600K, application for citizenship... sponsoring the collection: Form N-600K, U.S. Citizenship and Immigration Services. (4) Affected public who...

  5. 75 FR 70277 - Agency Information Collection Activities: Form N-336, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-17

    ... Collection Activities: Form N-336, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 336, Request for Hearing on a... Security sponsoring the collection: Form N-336; U.S. Citizenship and Immigration Services (USCIS). (4...

  6. 75 FR 70278 - Agency Information Collection Activities: Form N-600, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-17

    ... Collection Activities: Form N-600, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 600, Application for Certificate of... Homeland Security sponsoring the collection: Form N-600; U.S. Citizenship and Immigration Services (USCIS...

  7. 75 FR 18871 - Agency Information Collection Activities: Form N-600K, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-13

    ... Collection Activities: Form N-600K, Revision of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection under Review: Form N- 600K, Application for Citizenship... sponsoring the collection: Form N-600K, U.S. Citizenship and Immigration Services. (4) Affected public who...

  8. 75 FR 21013 - Agency Information Collection Activities: Form N-644; Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-22

    ... Collection Activities: Form N-644; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Form N- 644, Application for Posthumous... until June 21, 2010. During this 60 day period, USCIS will be evaluating whether to revise the Form N...

  9. 75 FR 13776 - Agency Information Collection Activities: Form N-300; Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-23

    ... Collection Activities: Form N-300; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Form N- 300, Application to File Declaration of... until May 24, 2010. During this 60-day period, USCIS will be evaluating whether to revise the Form N-300...

  10. 76 FR 69276 - Agency Information Collection Activities: Form N-336, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ... Activities: Form N-336, Revision of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 336, Request for Hearing on a Decision in... collection: Form N-336. U.S. Citizenship and Immigration Services. (4) Affected public who will be asked or...

  11. 76 FR 39415 - Agency Information Collection Activities: Form N-644, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-06

    ... Collection Activities: Form N-644, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 644, Application for Posthumous... Homeland Security sponsoring the collection: Form N-644; U.S. Citizenship and Immigration Services (USCIS...

  12. 77 FR 24507 - Agency Information Collection Activities: Form N-25, Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-24

    ... Collection Activities: Form N-25, Extension of an Existing Information Collection Request; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 25, Request for Verification of... component of the Department of Homeland Security sponsoring the collection: Form N-25. U.S. Citizenship and...

  13. 76 FR 45844 - Agency Information Collection Activities: Form N-426, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-01

    ... Collection Activities: Form N-426, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 426, Request for Certification of... Department of Homeland Security sponsoring the collection: Form N-426. U.S. Citizenship and Immigration...

  14. 76 FR 52961 - Agency Information Collection Activities: Form N-300; Revision of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-24

    ... Collection Activities: Form N-300; Revision of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Form N- 300, Application to File Declaration of... the Department of Homeland Security sponsoring the collection: Form N-300; U.S. Citizenship and...

  15. 75 FR 5098 - Agency Information Collection Activities: Form N-565, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-01

    ... Collection Activities: Form N-565, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-day notice of information collection under review: Form N- 565, Application for Replacement... collection: Form N-565; U.S. Citizenship and Immigration Services (USCIS). (4) Affected public who will be...

  16. 75 FR 70277 - Agency Information Collection Activities: Form N-400, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-17

    ... Collection Activities: Form N-400, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 400, Application for Naturalization... Security sponsoring the collection: Form N-400; U.S. Citizenship and Immigration Services (USCIS). (4...

  17. 75 FR 78264 - Agency Information Collection Activities: Form N-336, Revision to an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-15

    ...-0050] Agency Information Collection Activities: Form N-336, Revision to an Existing Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: Form N- 336... announcing the extension of the Form N-336. The 60-day notice announced that during the 60-day comment period...

  18. 75 FR 71451 - Agency Information Collection Activities: Form N-470, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-23

    ... Collection Activities: Form N-470, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 470, Application to Preserve... collection: Form N-470; U.S. Citizenship and Immigration Services (USCIS). (4) Affected public who will be...

  19. 76 FR 21913 - Agency Information Collection Activities: Form N-644; Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-19

    ... Collection Activities: Form N-644; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form N- 644, Application for Posthumous... 60 days until June 20, 2011 this 60-day period, USCIS will be evaluating whether to revise the Form N...

  20. 75 FR 32800 - Agency Information Collection Activities: Form N-300; Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-09

    ... Collection Activities: Form N-300; Extension of an Existing Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review; Form N- 300, Application To File Declaration of... sponsoring the collection: Form N-300; U.S. Citizenship and Immigration Services (USCIS). (4) Affected public...

  1. 77 FR 128 - Agency Information Collection Activities: Form N-600, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-03

    ... Collection Activities: Form N-600, Revision of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form N- 600, Application for Certificate of..., and the applicable component of the Department of Homeland Security sponsoring the collection: Form N...

  2. 77 FR 71432 - Agency Information Collection Activities: Application for Travel Document, Form Number I-131...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-30

    ...-0013] Agency Information Collection Activities: Application for Travel Document, Form Number I-131... information collection as DACA recipients that can establish a need to travel outside of the United States... of the Form/Collection: Application for Travel Document. (3) Agency form number, if any, and the...

  3. 77 FR 3484 - Agency Information Collection Activities: Form I-914, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-24

    ... Collection Activities: Form I-914, Extension of a Currently Approved Information Collection; Comment Request. ACTION: 30-Day Notice of Information Collection Under Review: Form I- 914 and Supplements A and B...: Form I-914, 500 responses at 2.25 hours per response; Supplement A, 500 responses at 1 hour per...

  4. 76 FR 41282 - Agency Information Collection Activities: Form I-363, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-13

    ... Activities: Form I-363, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 363, Request to Petition for Custody for...: Primary: Individuals or Households. Form I- 363 is used by applicants to ensure the financial support of a...

  5. 77 FR 36285 - Agency Information Collection Activities: Form I-693, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-18

    ... Collection Activities: Form I-693, Revision of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 693, Report of Medical Examination...: Revision of a currently approved information collection. (2) Title of the Form/Collection: Report of...

  6. 75 FR 75182 - Agency Information Collection Activities: Form I-914, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-02

    ... Collection Activities: Form I-914, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection under Review: Form I- 914 and Supplements A and B... average respondent to respond: Form I-914, 500 responses at 2.25 hours per response; Supplement A, 500...

  7. 75 FR 51094 - Agency Information Collection Activities: Form I-363, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-18

    ...-0022] Agency Information Collection Activities: Form I-363, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection under Review: Form I... support of a U.S. citizen. Without the use of Form I-363, the USCIS is not able to ensure the child does...

  8. 76 FR 12751 - Agency Information Collection Activities: Form I-589, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-08

    ... Collection Activities: Form I-589, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 589, Application for Asylum and for... asked or required to respond, as well as a brief abstract: Primary: Individuals or Households. Form I...

  9. 76 FR 11808 - Agency Information Collection Activities: Form I-590, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-03

    ... Collection Activities: Form I-590, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 590, Registration for... abstract: Primary: Individuals or Households. Form I- 590 provides a uniform method for applicants to apply...

  10. 76 FR 20361 - Agency Information Collection Activities: Form I-694, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-12

    ... Collection Activities: Form I-694, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 694, Notice of Appeal of Decision... a brief abstract: Primary: Individuals and households. USCIS uses the information provided on Form I...

  11. 76 FR 12364 - Agency Information Collection Activities: Form I-881, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-07

    ... Collection Activities: Form I-881, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 881, Application for Suspension of... abstract: Primary: Individuals or Households. Form I- 881 is used by a nonimmigrant to apply for suspension...

  12. 77 FR 34053 - Agency Information Collection Activities: Form I-590, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-08

    ... Collection Activities: Form I-590, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 590, Registration for... or Households. Form I- 590 provides a uniform method for applicants to apply for refugee status and...

  13. 75 FR 52539 - Agency Information Collection Activities: Form I-777, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-26

    ... Collection Activities: Form I-777, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: Form I- 777, Application for Replacement of... asked or required to respond, as well as a brief abstract: Primary: Individuals or Households. Form I...

  14. 76 FR 66944 - Agency Information Collection Activities: Form I-914; Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-28

    ... Collection Activities: Form I-914; Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 914 and Supplements A and B...: Form I-914, 500 responses at 2.25 hours per response; Supplement A, 500 responses at 1 hour per...

  15. 76 FR 24908 - Agency Information Collection Activities: Form I-693, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-03

    ... Collection Activities: Form I-693, Revision of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 693, Report of Medical Examination... Information Collection: Revision of a currently approved information collection. (2) Title of the Form...

  16. 77 FR 21104 - Agency Information Collection Activities: Form I-694, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-09

    ... Collection Activities: Form I-694, Extension of a Currently Approved Information Collection; Comment Request... and households. USCIS uses the information provided on Form I-694 in considering the appeal from a... 210 or 245A, Form I-694. The Department of Homeland Security (DHS), U.S. Citizenship and Immigration...

  17. 75 FR 5101 - Agency Information Collection Activities: Form I-590, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-01

    ... Collection Activities: Form I-590, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-day notice of information collection under review: Form I- 590, Registratiod for... Households. Form I- 590 provides a uniform method for applicants to apply for refugee status and contains the...

  18. 75 FR 29780 - Agency Information Collection Activities: Form I-612, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-27

    ... Collection Activities: Form I-612, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 612, Application for Waiver of the... well as a brief abstract: Primary: Individuals or Households. Form I- 612 is used by USCIS to determine...

  19. 77 FR 9259 - Agency Information Collection Activities: Form I-361, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-16

    ... Collection Activities: Form I-361, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 361, Affidavit of Financial Support... this 60-day period, USCIS will be evaluating whether to revise the Form I-361. Should USCIS decide to...

  20. 77 FR 74687 - Agency Information Collection Activities: Application for Employment Authorization, Form I-765...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-17

    ...-0040] Agency Information Collection Activities: Application for Employment Authorization, Form I-765; Form I-765 Work Sheet, Form I- 765WS; Revision of a Currently Approved Collection ACTION: 60-Day notice....), DHS is requesting public comment on a proposed revision to an approved information collection. On...

  1. 77 FR 31033 - Agency Information Collection Activities: Form I-589, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-24

    ... Collection Activities: Form I-589, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 589, Application for Asylum and for... asked or required to respond, as well as a brief abstract: Primary: Individuals or Households. Form I...

  2. 76 FR 66944 - Agency Information Collection Activities: Form I-129F; Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-28

    ... Activities: Form I-129F; Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 129F, Petition for Alien Fiance(e). OMB... required to respond, as well as a brief abstract: Primary--Individuals or households. Form I- 129F must be...

  3. 76 FR 45845 - Agency Information Collection Activities: Form I-777, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-01

    ... Collection Activities: Form I-777, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 777, Application for Replacement of... a brief abstract: Primary: Individuals or Households. Form I- 777 is used by applicants applying for...

  4. 78 FR 13368 - Agency Information Collection Activities: Application for Employment Authorization, Form I-765...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-27

    ...-0040] Agency Information Collection Activities: Application for Employment Authorization, Form I-765; Form I-765 Work Sheet, Form I- 765WS; Revision of a Currently Approved Collection ACTION: 30-day notice...-765 and I-765WS. The monetary costs incurred to secure supporting documents from sources such as a...

  5. 75 FR 32799 - Agency Information Collection Activities: Form I-243, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-09

    ... Collection Activities: Form I-243, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 243, Application for Removal; OMB... until August 9, 2010. During this 60-day period USCIS will be evaluating whether to revise the Form I...

  6. 75 FR 29779 - Agency Information Collection Activities: Form I-918, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-27

    ... Collection Activities: Form I-918, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 918, Petition for U Nonimmigrant... respond: Form I-918-- 12,000 responses at 5 hours per response; Supplement A--24,000 responses at 1.5 hour...

  7. 75 FR 41215 - Agency Information Collection Activities: Form I-821, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-15

    ... Collection Activities: Form I-821, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 821, Application for Temporary...: Primary: Individuals or Households. Form I- 821 is necessary in order for USCIS to make a determination...

  8. 77 FR 12071 - Agency Information Collection Activities: Form I-601, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-28

    ... Collection Activities: Form I-601, Revision of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 601, Application for Waiver of... Collection: Revision of a currently approved information collection. (2) Title of the Form/Collection...

  9. 77 FR 65898 - Agency Information Collection Activities: InfoPass System, No Form Number; Extension, Without...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-31

    ...-0113] Agency Information Collection Activities: InfoPass System, No Form Number; Extension, Without...) Title of the Form/Collection: InfoPass System. (3) Agency form number, if any, and the applicable... InfoPass system allows an applicant or petitioner to schedule an interview appointment with USCIS...

  10. 75 FR 14179 - Agency Information Collection Activities: Form I-9 CNMI; Revision to an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-24

    ... SECURITY U.S. Citizenship and Immigration Services Agency Information Collection Activities: Form I-9 CNMI... Collection under Review: Form I-9 CNMI, CNMI Employment Eligibility Verification; OMB Control No. 1615- 0112... component of the Department of Homeland Security sponsoring the collection: Form I-9 CNMI; U.S. Citizenship...

  11. 76 FR 31971 - Agency Information Collection Activities: Form I-212; Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-02

    ... Collection Activities: Form I-212; Extension of an Existing Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 212, Application for Permission to... collection: Form I-212; U.S. Citizenship and Immigration Services (USCIS). (4) Affected public who will be...

  12. 76 FR 9810 - Agency Information Collection Activities: Comment Request for the Ferrous Metals Surveys (17 Forms)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-22

    ... Activities: Comment Request for the Ferrous Metals Surveys (17 Forms) AGENCY: U.S. Geological Survey (USGS... with domestic consumption data of 13 ores, concentrates, metals, and ferroalloys, some of which are...-0068. Form Number: Various (17 forms). Title: Ferrous Metals Surveys. Type of Request: Extension of a...

  13. 76 FR 9805 - Agency Information Collection Activities: Form G-845 and Supplement; Revision of a Currently...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-22

    ... Collection Activities: Form G-845 and Supplement; Revision of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form G- 845 and Supplement... other forms of information technology, e.g., permitting electronic submission of responses. Overview of...

  14. 75 FR 23785 - Agency Information Collection Activities: Form G-639; Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-05-04

    ... Collection Activities: Form G-639; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Form G- 639, Freedom of Information/Privacy Act... until July 6, 2010. During this 60 day period, USCIS will be evaluating whether to revise the Form G-639...

  15. ON THE ACTIVE REGION BRIGHT GRAINS OBSERVED IN THE TRANSITION REGION IMAGING CHANNELS OF IRIS

    SciTech Connect

    Skogsrud, H.; Voort, L. Rouppe van der; Pontieu, B. De

    2016-02-01

    The Interface Region Imaging Spectrograph (IRIS) provides spectroscopy and narrow band slit-jaw (SJI) imaging of the solar chromosphere and transition region at unprecedented spatial and temporal resolutions. Combined with high-resolution context spectral imaging of the photosphere and chromosphere as provided by the Swedish 1 m Solar Telescope (SST), we can now effectively trace dynamic phenomena through large parts of the solar atmosphere in both space and time. IRIS SJI 1400 images from active regions, which primarily sample the transition region with the Si iv 1394 and 1403 Å lines, reveal ubiquitous bright “grains” which are short-lived (two to five minute)more » bright roundish small patches of sizes 0.″5–1.″7 that generally move limbward with velocities up to about 30 km s{sup −1}. In this paper, we show that many bright grains are the result of chromospheric shocks impacting the transition region. These shocks are associated with dynamic fibrils (DFs), most commonly observed in Hα. We find that the grains show the strongest emission in the ascending phase of the DF, that the emission is strongest toward the top of the DF, and that the grains correspond to a blueshift and broadening of the Si iv lines. We note that the SJI 1400 grains can also be observed in the SJI 1330 channel which is dominated by C ii lines. Our observations show that a significant part of the active region transition region dynamics is driven from the chromosphere below rather than from coronal activity above. We conclude that the shocks that drive DFs also play an important role in the heating of the upper chromosphere and lower transition region.« less

  16. Analysis of nucleon electromagnetic form factors from light-front holographic QCD: The spacelike region

    NASA Astrophysics Data System (ADS)

    Sufian, Raza Sabbir; de Téramond, Guy F.; Brodsky, Stanley J.; Deur, Alexandre; Dosch, Hans Günter

    2017-01-01

    We present a comprehensive analysis of the spacelike nucleon electromagnetic form factors and their flavor decomposition within the framework of light-front (LF) holographic QCD (LFHQCD) We show that the inclusion of the higher Fock components |q q q q q ¯ ⟩ has a significant effect on the spin-flip elastic Pauli form factor and almost zero effect on the spin-conserving Dirac form factor. We present light-front holographic QCD results for the proton and neutron form factors at any momentum transfer range, including asymptotic predictions, and show that our results agree with the available experimental data with high accuracy. In order to correctly describe the Pauli form factor we need an admixture of a five quark state of about 30% in the proton and about 40% in the neutron. We also extract the nucleon charge and magnetic radii and perform a flavor decomposition of the nucleon electromagnetic form factors. The free parameters needed to describe the experimental nucleon form factors are very few: two parameters for the probabilities of higher Fock states for the spin-flip form factor and a phenomenological parameter r , required to account for possible SU(6) spin-flavor symmetry breaking effects in the neutron, whereas the Pauli form factors are normalized to the experimental values of the anomalous magnetic moments. The covariant spin structure for the Dirac and Pauli nucleon form factors prescribed by AdS5 semiclassical gravity incorporates the correct twist scaling behavior from hard scattering and also leads to vector dominance at low energy.

  17. Analysis of nucleon electromagnetic form factors from light-front holographic QCD: The spacelike region

    SciTech Connect

    Sufian, Raza Sabbir; de Teramond, Guy F.; Brodsky, Stanley J.

    2017-01-10

    We present a comprehensive analysis of the space-like nucleon electromagnetic form factors and their flavor decomposition within the framework of light-front holographic QCD. We show that the inclusion of the higher Fock componentsmore » $$|{qqqq\\bar{q}}$$ has a significant effect on the spin-flip elastic Pauli form factor and almost zero effect on the spin-conserving Dirac form factor. We present light-front holographic QCD results for the proton and neutron form factors at any momentum transfer range, including asymptotic predictions, and show that our results agree with the available experimental data with high accuracy. In order to correctly describe the Pauli form factor we need an admixture of a five quark state of about 30$$\\%$$ in the proton and about 40$$\\%$$ in the neutron. We also extract the nucleon charge and magnetic radii and perform a flavor decomposition of the nucleon electromagnetic form factors. The free parameters needed to describe the experimental nucleon form factors are very few: two parameters for the probabilities of higher Fock states for the spin-flip form factor and a phenomenological parameter $r$, required to account for possible SU(6) spin-flavor symmetry breaking effects in the neutron, whereas the Pauli form factors are normalized to the experimental values of the anomalous magnetic moments. As a result, the covariant spin structure for the Dirac and Pauli nucleon form factors prescribed by AdS$$_5$$ semiclassical gravity incorporates the correct twist scaling behavior from hard scattering and also leads to vector dominance at low energy.« less

  18. VLA Observations of Flux Density Variations at 3.6 cm in the Massive Star Forming Region W49A

    NASA Astrophysics Data System (ADS)

    De Pree, Christopher G.; Bates, Jennifer; Galvan-Madrid, Roberto; Goss, Miller; Klessen, Ralf; Mac Low, Mordecai; Melo, Theresa; Peters, Thomas; Presler-Marshall, Brynn; Webb-Forgus, Rowen; Wilner, David

    2018-01-01

    In recent years, a number of ultracompact Galactic star forming regions have been detected to vary in flux density on short timescales ($\\sim$10-20 years). This variation can result when ionizing stars, orbiting within the filamentary structures formed in a gravitationally collapsing cloud, enter or leave a dense filament. The increase or decrease in the recombination rate from the change of density causes the H II region surrounding the star to shrink or grow. Here we focus on the massive star-forming region W49A, which was observed with the Karl G. Jansky Very Large Array (VLA) at 3.6 cm with the B-configuration in February 2015. These high resolution ($\\sim$0.8$\\arcsec$) observations were compared with B-configuration observations of the same region made with the VLA in August 1994, almost 21 years earlier. As expected, most of the sources in the crowded field of ultracompact (UC) and hypercompact (HC) HII regions exhibit no significant changes over this time period. One source, however, W49A/G2 has decreased by $\\sim$40\\% in peak intensity, from 202$\\pm$10 mJy/beam to 124$\\pm$10 mJy/beam. We present the 1994 and 2015 images of the W49A region, the difference images that indicate the position of the flux density decrease, and discuss possible explanations of the detected decrease near the position of W49A/G2.

  19. Relative share of asymptomatic forms of hepatitis a in Plovdiv region, Bulgaria.

    PubMed

    Vatev, Nikolai T; Stoycheva, Mariyana V; Petrov, Andrey I; Atanasova, Maria V

    2011-01-01

    To study the relative share of asymptomatic forms of Hepatitis A in family reservoirs of infection with different hygienic conditions. Asymptomatic forms were identified by detecting anti-HAV IgM using ELISA. Two types of households: with poor hygiene and with good hygiene, were studied. The study was designed as case-control. A group of Hepatitis A contact children attending day nurseries and kindergartens was also included in the study. The relative share of asymptomatic forms of HAV infection in poor hygiene households was 58.62%, while in those with good hygiene it was 41.57%. The comparison using Fisher's exact test yielded OR = 1.99 and 95% CI (P < 0.05). Asymptomatic forms were found in 7.75% of the investigated contacts among children attending day nurseries and kindergartens. Asymptomatic forms of hepatitis A are very common which makes them epidemiologically quite significant as many of the cases remain unrecognized and later become focal points of new cases of the disease. Poor hygiene conditions are likely to cause more asymptomatic forms. The high relative share of asymptomatic forms found in the households supports the need for immunoprophylaxis of the contacts.

  20. Composition and topology of activity cliff clusters formed by bioactive compounds.

    PubMed

    Stumpfe, Dagmar; Dimova, Dilyana; Bajorath, Jürgen

    2014-02-24

    The assessment of activity cliffs has thus far mostly focused on compound pairs, although the majority of activity cliffs are not formed in isolation but in a coordinated manner involving multiple active compounds and cliffs. However, the composition of coordinated activity cliff configurations and their topologies are unknown. Therefore, we have identified all activity cliff configurations formed by currently available bioactive compounds and analyzed them in network representations where activity cliff configurations occur as clusters. The composition, topology, frequency of occurrence, and target distribution of activity cliff clusters have been determined. A limited number of large cliff clusters with unique topologies were identified that were centers of activity cliff formation. These clusters originated from a small number of target sets. However, most clusters were of small to moderate size. Three basic topologies were sufficient to describe recurrent activity cliff cluster motifs/topologies. For example, frequently occurring clusters with star topology determined the scale-free character of the global activity cliff network and represented a characteristic activity cliff configuration. Large clusters with complex topology were often found to contain different combinations of basic topologies. Our study provides a first view of activity cliff configurations formed by currently available bioactive compounds and of the recurrent topologies of activity cliff clusters. Activity cliff clusters of defined topology can be selected, and from compounds forming the clusters, SAR information can be obtained. The SAR information of activity cliff clusters sharing a/one specific activity and topology can be compared.

  1. Characterization of the C-terminal region of molecular forms of human milk bile salt-stimulated lipase.

    PubMed

    McKillop, A M; O'Hare, M M T; Craig, J S; Halliday, H L

    2004-01-01

    Bile salt-stimulated lipase (BSSL) in human milk exists in multiple molecular forms and it has been shown that approximately one-third of lactating mothers secrete two forms. to determine the structural features of BSSL that may give rise to this heterogeneity. Oligosaccharides present in the proline-rich region in the C-terminus of BSSL were investigated using deglycosylating enzymes and lectin affinity probing to determine the origin of the multiple molecular forms. It was found that the variability in the molecular mass of BSSL is due predominantly to glycosylation. The molecular forms contain similar sugar chains; all forms possess the core disaccharide Galbeta1-3GalNAc and beta-D-galactose, fucose linked at alpha1-6 and sialic acid linkage alpha2-3 to galactose. The molecular mass difference in the BSSL molecular forms cannot be attributed to the type of carbohydrate moiety in the sugar chains of the N- and O-linked sites suggesting that the differences arise from the extent or quantity of glycosylation. The oligosaccharides in the C-terminal region contain Lewis x and b and, less prominently, Lewis a antigenic structures. Owing to the presence of these blood-group-related antigenic determinants, the C-terminal region of BSSL may have an adhesive function in cell-cell interactions.

  2. Diagnostics of Coronal Heating in Solar Active Regions

    NASA Astrophysics Data System (ADS)

    Fludra, A.; Ireland, J.

    2004-01-01

    We study the relationship between EUV spectral line intensities emitted at transition region temperatures and the photospheric magnetic field in solar active regions. We use magnetograms from SOHO/MDI and EUV spectra of the O V 629.7 A line (220000 K) from the Coronal Diagnostic Spectrometer on SOHO recorded for 25 active regions. We overlay and compare spatial patterns of the OV emission and the magnetic flux concentrations with a 2''x2'' spatial resolution and search for a relationship between the local OV line intensity and the photospheric magnetic flux density in each active region. While this dependence exhibits a certain amount of scatter it can be represented by a power law fit. We find that the power indeces are similar in all regions. Applying static loop models we derive the dependence of the heating rate on the magnetic flux density and compare it to the dependence predicted by the coronal heating models. This spatially resolved analysis extends the previous work of Fludra and Ireland (2002 2003) who studied the relationship between area-integrated coronal line intensities and the total magnetic flux.

  3. Socioeconomic and regional differences in active transportation in Brazil

    PubMed Central

    de Sá, Thiago Hérick; Pereira, Rafael Henrique Moraes; Duran, Ana Clara; Monteiro, Carlos Augusto

    2016-01-01

    ABSTRACT OBJECTIVE To present national estimates regarding walking or cycling for commuting in Brazil and in 10 metropolitan regions. METHODS By using data from the Health section of 2008’s Pesquisa Nacional por Amostra de Domicílio (Brazil’s National Household Sample Survey), we estimated how often employed people walk or cycle to work, disaggregating our results by sex, age range, education level, household monthly income per capita, urban or rural address, metropolitan regions, and macro-regions in Brazil. Furthermore, we estimated the distribution of this same frequency according to quintiles of household monthly income per capita in each metropolitan region of the country. RESULTS A third of the employed men and women walk or cycle from home to work in Brazil. For both sexes, this share decreases as income and education levels rise, and it is higher among younger individuals, especially among those living in rural areas and in the Northeast region of the country. Depending on the metropolitan region, the practice of active transportation is two to five times more frequent among low-income individuals than among high-income individuals. CONCLUSIONS Walking or cycling to work in Brazil is most frequent among low-income individuals and the ones living in less economically developed areas. Active transportation evaluation in Brazil provides important information for public health and urban mobility policy-making PMID:27355465

  4. Ride-sharing activities in the Richmond regional planning district.

    DOT National Transportation Integrated Search

    1977-01-01

    This report gives the results of a survey made of industries in the Richmond Regional Planning District to determine the current and expected ride-sharing activities there and the type of information deemed most useful in planning ride-sharing progra...

  5. IFLA General Conference, 1987. Division of Regional Activities. Papers.

    ERIC Educational Resources Information Center

    International Federation of Library Associations, The Hague (Netherlands).

    Six of the seven papers in this collection focus on regional library activities in Africa, Asia and Oceania, and Latin America and the Caribbean: (1) "Libraries and Information Services in a Changing World: The Challenges African Information Services Face at the End of the 1980s" (Dejen Abate, Ethiopia); (2) "The Computer and…

  6. Unwinding Motion of a Twisted Active Region Filament

    NASA Astrophysics Data System (ADS)

    Yan, X. L.; Xue, Z. K.; Liu, J. H.; Kong, D. F.; Xu, C. L.

    2014-12-01

    To better understand the structures of active region filaments and the eruption process, we study an active region filament eruption in active region NOAA 11082 in detail on 2010 June 22. Before the filament eruption, the opposite unidirectional material flows appeared in succession along the spine of the filament. The rising of the filament triggered two B-class flares at the upper part of the filament. As the bright material was injected into the filament from the sites of the flares, the filament exhibited a rapid uplift accompanying the counterclockwise rotation of the filament body. From the expansion of the filament, we can see that the filament consisted of twisted magnetic field lines. The total twist of the filament is at least 5π obtained by using a time slice method. According to the morphology change during the filament eruption, it is found that the active region filament was a twisted flux rope and its unwinding motion was like a solar tornado. We also find that there was a continuous magnetic helicity injection before and during the filament eruption. It is confirmed that magnetic helicity can be transferred from the photosphere to the filament. Using the extrapolated potential fields, the average decay index of the background magnetic fields over the filament is 0.91. Consequently, these findings imply that the mechanism of solar filament eruption could be due to the kink instability and magnetic helicity accumulation.

  7. IFLA General Conference, 1989. Division of Regional Activities. Section on Regional Activities--Africa; Section on Regional Activities--Asia and Oceania; Section on Regional Activities--Latin America and the Caribbean. Booklet 80.

    ERIC Educational Resources Information Center

    International Federation of Library Associations, The Hague (Netherlands).

    There are five papers in this collection from the Division of Regional Activities: (1) "Communication and Information in Contemporary African Society" (Bimpe Aboyade), which discusses how libraries can make themselves relevant to other institutions concerned with information transfer; (2) "Libraries and Rural Development: Village…

  8. Unwinding motion of a twisted active region filament

    SciTech Connect

    Yan, X. L.; Xue, Z. K.; Kong, D. F.

    2014-12-10

    To better understand the structures of active region filaments and the eruption process, we study an active region filament eruption in active region NOAA 11082 in detail on 2010 June 22. Before the filament eruption, the opposite unidirectional material flows appeared in succession along the spine of the filament. The rising of the filament triggered two B-class flares at the upper part of the filament. As the bright material was injected into the filament from the sites of the flares, the filament exhibited a rapid uplift accompanying the counterclockwise rotation of the filament body. From the expansion of the filament,more » we can see that the filament consisted of twisted magnetic field lines. The total twist of the filament is at least 5π obtained by using a time slice method. According to the morphology change during the filament eruption, it is found that the active region filament was a twisted flux rope and its unwinding motion was like a solar tornado. We also find that there was a continuous magnetic helicity injection before and during the filament eruption. It is confirmed that magnetic helicity can be transferred from the photosphere to the filament. Using the extrapolated potential fields, the average decay index of the background magnetic fields over the filament is 0.91. Consequently, these findings imply that the mechanism of solar filament eruption could be due to the kink instability and magnetic helicity accumulation.« less

  9. The yeast THO complex forms a 5-subunit assembly that directly interacts with active chromatin.

    PubMed

    Gewartowski, Kamil; Cuéllar, Jorge; Dziembowski, Andrzej; Valpuesta, José María

    2012-01-01

    The THO complex is a nuclear structure whose architecture is conserved among all kingdoms and plays an important role in mRNP biogenesis connecting transcription elongation with mRNA maturation and export. Recent data indicates that the THO complex is necessary for the proper expression of some genes, assurance of genetic stability by preventing transcription-associated recombination. Yeast THO has been described as a heterotetramer (Tho2, Hpr1, Mft1 and Thp2) that performs several functions through the interaction with other proteins like Tex1 or the mRNA export factors Sub2 and Yra1, with which it forms the TRanscription and EXport complex (TREX). In this article we review the cellular role of THO, which we show to be composed of five subunits with Tex1 being also an integral part of the complex. We also show a low-resolution structure of THO and localize some of its components. We discuss the consequences of THO interaction with nucleic acids through the unfolded C-terminal region of Tho2, highlighting the importance of unfolded regions in eukaryotic proteins. Finally, we comment on THO recruitment to active chromatin, a role that is linked to mRNA biogenesis.

  10. Regional differences in rat conjunctival ion transport activities

    PubMed Central

    Yu, Dongfang; Thelin, William R.; Rogers, Troy D.; Stutts, M. Jackson; Randell, Scott H.; Grubb, Barbara R.

    2012-01-01

    Active ion transport and coupled osmotic water flow are essential to maintain ocular surface health. We investigated regional differences in the ion transport activities of the rat conjunctivas and compared these activities with those of cornea and lacrimal gland. The epithelial sodium channel (ENaC), sodium/glucose cotransporter 1 (Slc5a1), transmembrane protein 16 (Tmem16a, b, f, and g), cystic fibrosis transmembrane conductance regulator (Cftr), and mucin (Muc4, 5ac, and 5b) mRNA expression was characterized by RT-PCR. ENaC proteins were measured by Western blot. Prespecified regions (palpebral, fornical, and bulbar) of freshly isolated conjunctival tissues and cell cultures were studied electrophysiologically with Ussing chambers. The transepithelial electrical potential difference (PD) of the ocular surface was also measured in vivo. The effect of amiloride and UTP on the tear volume was evaluated in lacrimal gland excised rats. All selected genes were detected but with different expression patterns. We detected αENaC protein in all tissues, βENaC in palpebral and fornical conjunctiva, and γENaC in all tissues except lacrimal glands. Electrophysiological studies of conjunctival tissues and cell cultures identified functional ENaC, SLC5A1, CFTR, and TMEM16. Fornical conjunctiva exhibited the most active ion transport under basal conditions amongst conjunctival regions. PD measurements confirmed functional ENaC-mediated Na+ transport on the ocular surface. Amiloride and UTP increased tear volume in lacrimal gland excised rats. This study demonstrated that the different regions of the conjunctiva exhibited a spectrum of ion transport activities. Understanding the specific functions of distinct regions of the conjunctiva may foster a better understanding of the physiology maintaining hydration of the ocular surface. PMID:22814399

  11. Ages and distances to star forming regions from the synergy of X-rays and IR observations

    NASA Astrophysics Data System (ADS)

    Pillitteri, I.; Wolk, S. J.; Megeath, S. T.

    We present two studies based on XMM-Newton observations aimed at inferring the distances and the ages of young groups of stars around Kappa Ori, south to the Orion Nebula, and Rho Ophiuchi. By leveraging on the characteristics levels of X-ray luminosities of very young stars we determined that around Kappa Ori a group of stars has formed at a distance of 250 pc from the Sun, and thus it is unrelated to the Orion complex at 400 pc. To the same group belong V1818 Ori and the surrounding young stars, and we exclude that these stars belong to the Mon R2 region at 900 pc as suggested before. Around Rho Ophiuchi we found X-ray active and disk-less stars with ages estimated in 5-10 Myr, thus older than the young stellar objects in the main core of the cloud, L1688. Rho Ophiuchi itself is a strong, periodic emitter of X-rays, and we ascribe this behavior to an intrinsic magnetism or an unknown low mass companion.

  12. A Definitive Test of Triggered-Sequential Star Formation in the Massive Star Forming Regions W3/4/5

    NASA Astrophysics Data System (ADS)

    Stringfellow, Guy; Bally, John; Koenig, Xavier; Ginsburg, Adam; Allen, Lori; Probst, Ron; Swaters, Rob; Valdes, Francisco

    2008-08-01

    We propose to conduct a near-infrared JHK full imaging survey of the W3/4/5 star forming complex down to ~20 mag, ~5 mag deeper than 2MASS. Select regions within W3/4/5 of new jet and outflow sources require H_2, [Fe II], and (in some cases) Br(gamma) imaging. This will complete our ground-based survey, providing essential data on the residing stellar populations, outflows and jets, and interaction of the ionizing OB stellar radiation with the ISM and dense molecular gas (pillars) in which active star formation is occurring. The main objectives are: [1] combine the JHK photometry with optical and Spitzer data to construct complete color-color and magnitude-color diagrams, yielding spatial resolved luminosity and mass functions of the various complexes; [2] identify which Bolocam 1.1(micron) cores contain stars; [3] obtain critical narrow-band imaging of key YSOs (jet, outflow, and proplyd/cometary sources) previously identified from our Mayall 4m MOSAIC H(alpha), [S II], and i-band imaging survey (2007B: Bally N0425) - these provide direct evidence and insight for recent (triggered?) star formation; [4] combine these data with our other extensive multi-wavelength data to investigate spatially segregated age gradients, and definitively determine whether triggered and sequential star formation has occurred.

  13. PEERING INTO THE GIANT-PLANET-FORMING REGION OF THE TW HYDRAE DISK WITH THE GEMINI PLANET IMAGER

    SciTech Connect

    Rapson, Valerie A.; Kastner, Joel H.; Millar-Blanchaer, Maxwell A.

    2015-12-20

    We present Gemini Planet Imager (GPI) adaptive optics near-infrared images of the giant-planet-forming regions of the protoplanetary disk orbiting the nearby (D = 54 pc), pre-main-sequence (classical T Tauri) star TW Hydrae. The GPI images, which were obtained in coronagraphic/polarimetric mode, exploit starlight scattered off small dust grains to elucidate the surface density structure of the TW Hya disk from ∼80 AU to within ∼10 AU of the star at ∼1.5 AU resolution. The GPI polarized intensity images unambiguously confirm the presence of a gap in the radial surface brightness distribution of the inner disk. The gap is centered near ∼23 AU,more » with a width of ∼5 AU and a depth of ∼50%. In the context of recent simulations of giant-planet formation in gaseous, dusty disks orbiting pre-main-sequence stars, these results indicate that at least one young planet with a mass ∼0.2 M{sub J} could be present in the TW Hya disk at an orbital semimajor axis similar to that of Uranus. If this (proto)planet is actively accreting gas from the disk, it may be readily detectable by GPI or a similarly sensitive, high-resolution infrared imaging system.« less

  14. Feeding patterns of molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in a region of high hybridization

    PubMed Central

    2013-01-01

    Background Two biological forms of the mosquito Culex pipiens s.s., denoted pipiens and molestus, display behavioural differences that may affect their role as vectors of arboviruses. In this study, the feeding patterns of molestus and pipiens forms were investigated in Comporta (Portugal), where high levels of inter-form admixture have been recorded. Methods Indoor and outdoor mosquito collections were performed in the summer of 2010. Collected Cx. pipiens s.l. females were molecularly identified to species and form by PCR and genotyped for six microsatellites. The source of the blood meal in post-fed females was determined by ELISA and mitochondrial DNA sequencing. Results The distribution of the forms differed according to the collection method. The molestus form was present only in indoor collections, whereas pipiens and admixed individuals were sampled both indoors and outdoors. In both forms, over 90% of blood meals were made on avian hosts. These included blood meals taken from Passeriformes (Passer domesticus and Turdus merula) by females caught resting inside domestic shelters. Conclusion Genetic structure and blood meal analyses suggest the presence of a bird biting molestus population in the study area. Both forms were found to rest indoors, mainly in avian shelters, but at least a proportion of females of the pipiens form may bite outdoors in sylvan habitats and then search for anthropogenic resting sites to complete their gonotrophic cycle. This behaviour may potentiate the accidental transmission of arboviruses to humans in the region. PMID:23578139

  15. Feeding patterns of molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in a region of high hybridization.

    PubMed

    Gomes, Bruno; Sousa, Carla A; Vicente, José L; Pinho, Leonor; Calderón, Isabel; Arez, Eliane; Almeida, António Pg; Donnelly, Martin J; Pinto, João

    2013-04-11

    Two biological forms of the mosquito Culex pipiens s.s., denoted pipiens and molestus, display behavioural differences that may affect their role as vectors of arboviruses. In this study, the feeding patterns of molestus and pipiens forms were investigated in Comporta (Portugal), where high levels of inter-form admixture have been recorded. Indoor and outdoor mosquito collections were performed in the summer of 2010. Collected Cx. pipiens s.l. females were molecularly identified to species and form by PCR and genotyped for six microsatellites. The source of the blood meal in post-fed females was determined by ELISA and mitochondrial DNA sequencing. The distribution of the forms differed according to the collection method. The molestus form was present only in indoor collections, whereas pipiens and admixed individuals were sampled both indoors and outdoors. In both forms, over 90% of blood meals were made on avian hosts. These included blood meals taken from Passeriformes (Passer domesticus and Turdus merula) by females caught resting inside domestic shelters. Genetic structure and blood meal analyses suggest the presence of a bird biting molestus population in the study area. Both forms were found to rest indoors, mainly in avian shelters, but at least a proportion of females of the pipiens form may bite outdoors in sylvan habitats and then search for anthropogenic resting sites to complete their gonotrophic cycle. This behaviour may potentiate the accidental transmission of arboviruses to humans in the region.

  16. Opposite effects of visual and auditory word-likeness on activity in the visual word form area

    PubMed Central

    Ludersdorfer, Philipp; Schurz, Matthias; Richlan, Fabio; Kronbichler, Martin; Wimmer, Heinz

    2013-01-01

    The present fMRI study investigated the effects of word-likeness of visual and auditory stimuli on activity along the ventral visual stream. In the context of a one-back task, we presented visual and auditory words, pseudowords, and artificial stimuli (i.e., false-fonts and reversed-speech, respectively). Main findings were regionally specific effects of word-likeness on activation in a left ventral occipitotemporal region corresponding to the classic localization of the Visual Word Form Area (VWFA). Specifically, we found an inverse word-likeness effect for the visual stimuli in the form of decreased activation for words compared to pseudowords which, in turn, elicited decreased activation compared to the artificial stimuli. For the auditory stimuli, we found positive word-likeness effects as both words and pseudowords elicited more activation than the artificial stimuli. This resulted from a marked deactivation in response to the artificial stimuli and no such deactivation for words and pseudowords. We suggest that the opposite effects of visual and auditory word-likeness on VWFA activation can be explained by assuming the involvement of visual orthographic memory representations. For the visual stimuli, these representations reduce the coding effort as a function of word-likeness. This results in highest activation to the artificial stimuli and least activation to words for which corresponding representations exist. The positive auditory word-likeness effects may result from activation of orthographic information associated with the auditory words and pseudowords. The view that the VWFA has a primarily visual function is supported by our findings of high activation to the visual artificial stimuli (which have no phonological or semantic associations) and deactivation to the auditory artificial stimuli. According to the phenomenon of cross-modal sensory suppression such deactivations during demanding auditory processing are expected in visual regions. PMID

  17. The Effect of "Rogue" Active Regions on the Solar Cycle

    NASA Astrophysics Data System (ADS)

    Nagy, Melinda; Lemerle, Alexandre; Labonville, François; Petrovay, Kristóf; Charbonneau, Paul

    2017-11-01

    The origin of cycle-to-cycle variations in solar activity is currently the focus of much interest. It has recently been pointed out that large individual active regions with atypical properties can have a significant impact on the long-term behavior of solar activity. We investigate this possibility in more detail using a recently developed 2×2D dynamo model of the solar magnetic cycle. We find that even a single "rogue" bipolar magnetic region (BMR) in the simulations can have a major effect on the further development of solar activity cycles, boosting or suppressing the amplitude of subsequent cycles. In extreme cases, an individual BMR can completely halt the dynamo, triggering a grand minimum. Rogue BMRs also have the potential to induce significant hemispheric asymmetries in the solar cycle. To study the effect of rogue BMRs in a more systematic manner, a series of dynamo simulations were conducted, in which a large test BMR was manually introduced in the model at various phases of cycles of different amplitudes. BMRs emerging in the rising phase of a cycle can modify the amplitude of the ongoing cycle, while BMRs emerging in later phases will only affect subsequent cycles. In this model, the strongest effect on the subsequent cycle occurs when the rogue BMR emerges around cycle maximum at low latitudes, but the BMR does not need to be strictly cross-equatorial. Active regions emerging as far as 20° from the equator can still have a significant effect. We demonstrate that the combined effect of the magnetic flux, tilt angle, and polarity separation of the BMR on the dynamo is via their contribution to the dipole moment, δ D_{BMR}. Our results indicate that prediction of the amplitude, starting epoch, and duration of a cycle requires an accurate accounting of a broad range of active regions emerging in the previous cycle.

  18. Shock-excited NH3 (3, 3) masers in the NGC 6334 star-forming region

    NASA Technical Reports Server (NTRS)

    Kraemer, Kathleen E.; Jackson, James M.

    1995-01-01

    We report the discovery of four NH3 (3, 3) masers in the NGC 6334 star formation region. The masers are found in two of the seven far-infrared continuum sources where high-mass star formation is taking place in this molecular cloud. These masers occur at the ends of high-velocity molecular outflows; no maser emission was found near regions without high-velocity outflows. The NH3 masers are not associated with any other type of maser. These results confirm that the NH3 (3, 3) masers are caused by shocks and probably mark the location where the molecular outflow jet impinges upon the ambient medium.

  19. Patterns of Activity Revealed by a Time Lag Analysis of a Model Active Region

    NASA Astrophysics Data System (ADS)

    Bradshaw, Stephen; Viall, Nicholeen

    2016-05-01

    We investigate the global activity patterns predicted from a model active region heated by distributions of nanoflares that have a range of average frequencies. The activity patterns are manifested in time lag maps of narrow-band instrument channel pairs. We combine an extrapolated magnetic skeleton with hydrodynamic and forward modeling codes to create a model active region, and apply the time lag method to synthetic observations. Our aim is to recover some typical properties and patterns of activity observed in active regions. Our key findings are: 1. Cooling dominates the time lag signature and the time lags between the channel pairs are generally consistent with observed values. 2. Shorter coronal loops in the core cool more quickly than longer loops at the periphery. 3. All channel pairs show zero time lag when the line-of-sight passes through coronal loop foot-points. 4. There is strong evidence that plasma must be re-energized on a time scale comparable to the cooling timescale to reproduce the observed coronal activity, but it is likely that a relatively broad spectrum of heating frequencies operates across active regions. 5. Due to their highly dynamic nature, we find nanoflare trains produce zero time lags along entire flux tubes in our model active region that are seen between the same channel pairs in observed active regions.

  20. The Central California Regional Obesity Prevention Program: Changing Nutrition and Physical Activity Environments in California's Heartland

    PubMed Central

    Samuels, Sarah E.; Capitman, John; Ruwe, Mathilda; Boyle, Maria; Flores, George

    2010-01-01

    The goals of the Central California Regional Obesity Prevention Program (CCROPP) are to promote safe places for physical activity, increase access to fresh fruits and vegetables, and support community and youth engagement in local and regional efforts to change nutrition and physical activity environments for obesity prevention. CCROPP has created a community-driven policy and environmental change model for obesity prevention with local and regional elements in low-income, disadvantaged ethnic and rural communities in a climate of poor resources and inadequate infrastructure. Evaluation data collected from 2005–2009 demonstrate that CCROPP has made progress in changing nutrition and physical activity environments by mobilizing community members, engaging and influencing policymakers, and forming organizational partnerships. PMID:20864732

  1. The Central California Regional Obesity Prevention Program: changing nutrition and physical activity environments in California's heartland.

    PubMed

    Schwarte, Liz; Samuels, Sarah E; Capitman, John; Ruwe, Mathilda; Boyle, Maria; Flores, George

    2010-11-01

    The goals of the Central California Regional Obesity Prevention Program (CCROPP) are to promote safe places for physical activity, increase access to fresh fruits and vegetables, and support community and youth engagement in local and regional efforts to change nutrition and physical activity environments for obesity prevention. CCROPP has created a community-driven policy and environmental change model for obesity prevention with local and regional elements in low-income, disadvantaged ethnic and rural communities in a climate of poor resources and inadequate infrastructure. Evaluation data collected from 2005-2009 demonstrate that CCROPP has made progress in changing nutrition and physical activity environments by mobilizing community members, engaging and influencing policymakers, and forming organizational partnerships.

  2. Formation and Survival of Water Vapor in the Terrestrial Planet-Forming Region

    NASA Astrophysics Data System (ADS)

    Bethell, Thomas; Bergin, Edwin

    2009-12-01

    Recent astronomical observations have revealed what may prove to be the ubiquity of water vapor during the early stages of planet formation. We present here a simple mechanism showing how water vapor forms in situ and is capable of shielding itself from molecule-destroying stellar radiation. The absorption of this radiation by water can control the thermodynamics of the terrestrial planet-forming zone. Similar to Earth's ozone layer, which shelters the chemistry of life, the water layer protects other water molecules and allows for a rich organic chemistry. The total abundance of water vapor in the natal habitable zone is equal to that of several thousand oceans.

  3. Similarity of urinary risk factors among stone-forming patients in five regions of the United States

    NASA Technical Reports Server (NTRS)

    Harvey, J. A.; Hill, K. D.; Pak, C. Y.

    1990-01-01

    Study Objective: To compare urinary biochemical risk factors among stone-forming patients in the Southeast (SE) or "stone belt" versus four other regions of the United States. Design: Prospective biochemical survey for regional comparisons. Setting: Referral-based nephrolithiasis clinics, urologists, nephrologists, and family practitioners. Patients: Consecutive sample of 3473 stone-forming patients who submitted 24-hour urine collections for biochemical analyses of stone-forming risk factors. Interventions: None. Subjects taking medication known to interfere with stone-forming risk factors were deleted from the final data compilation. Measurements and Main Results: Overall, the mean values for each urinary parameter spanned a narrow range without significant difference between the five regions. Among "metabolic" factors, 40% in the SE had hypercalciuria (> 6.25 mmol/d), compared to 35%-43% in other regions, and hyperuricosuria (> 4.2 mmol/d) was found in 16% in the SE versus 17%-19% elsewhere. Among "environmental" factors, low urine volume ( < 2 L/d) was found in 77% patients in the SE compared to 69%-78% elsewhere, and high sodium was encountered in 27% in the SE versus 24%-29% elsewhere. No differences were noted in occurrence of other abnormal risk factors: hyperoxaluria, hypocitraturia, low pH, high sulfate, high phosphorus, or low magnesium. Conclusions: Despite expected regional differences in nutritional and environmental influences, the results of this study showed a striking similarity in urinary biochemical risk factor profiles of stone-formers in all five regions of the United States.

  4. c-Myc quadruplex-forming sequence Pu-27 induces extensive damage in both telomeric and nontelomeric regions of DNA.

    PubMed

    Islam, Md Ashraful; Thomas, Shelia D; Murty, Vundavalli V; Sedoris, Kara J; Miller, Donald M

    2014-03-21

    Quadruplex-forming DNA sequences are present throughout the eukaryotic genome, including in telomeric DNA. We have shown that the c-Myc promoter quadruplex-forming sequence Pu-27 selectively kills transformed cells (Sedoris, K. C., Thomas, S. D., Clarkson, C. R., Muench, D., Islam, A., Singh, R., and Miller, D. M. (2012) Genomic c-Myc quadruplex DNA selectively kills leukemia. Mol. Cancer Ther. 11, 66-76). In this study, we show that Pu-27 induces profound DNA damage, resulting in striking chromosomal abnormalities in the form of chromatid or chromosomal breaks, radial formation, and telomeric DNA loss, which induces γ-H2AX in U937 cells. Pu-27 down-regulates telomeric shelterin proteins, DNA damage response mediators (RAD17 and RAD50), double-stranded break repair molecule 53BP1, G2 checkpoint regulators (CHK1 and CHK2), and anti-apoptosis gene survivin. Interestingly, there are no changes of DNA repair molecules H2AX, BRCA1, and the telomere maintenance gene, hTERT. ΔB-U937, where U937 cells stably transfected with deleted basic domain of TRF2 is partially sensitive to Pu-27 but exhibits no changes in expression of shelterin proteins. However, there is an up-regulation of CHK1, CHK2, H2AX, BRCA1, and survivin. Telomere dysfunction-induced foci assay revealed co-association of TRF1with γ-H2AX in ATM deficient cells, which are differentially sensitive to Pu-27 than ATM proficient cells. Alt (alternating lengthening of telomere) cells are relatively resistant to Pu-27, but there are no significant changes of telomerase activity in both Alt and non-Alt cells. Lastly, we show that this Pu-27-mediated sensitivity is p53-independent. The data therefore support two conclusions. First, Pu-27 induces DNA damage within both telomeric and nontelomeric regions of the genome. Second, Pu-27-mediated telomeric damage is due, at least in part, to compromise of the telomeric shelterin protein complex.

  5. Patterns of Activity in A Global Model of A Solar Active Region

    NASA Technical Reports Server (NTRS)

    Bradshaw, S. J.; Viall, N. M.

    2016-01-01

    In this work we investigate the global activity patterns predicted from a model active region heated by distributions of nanoflares that have a range of frequencies. What differs is the average frequency of the distributions. The activity patterns are manifested in time lag maps of narrow-band instrument channel pairs. We combine hydrodynamic and forward modeling codes with a magnetic field extrapolation to create a model active region and apply the time lag method to synthetic observations. Our aim is not to reproduce a particular set of observations in detail, but to recover some typical properties and patterns observed in active regions. Our key findings are the following. (1) Cooling dominates the time lag signature and the time lags between the channel pairs are generally consistent with observed values. (2) Shorter coronal loops in the core cool more quickly than longer loops at the periphery. (3) All channel pairs show zero time lag when the line of sight passes through coronal loop footpoints. (4) There is strong evidence that plasma must be re-energized on a timescale comparable to the cooling timescale to reproduce the observed coronal activity, but it is likely that a relatively broad spectrum of heating frequencies are operating across active regions. (5) Due to their highly dynamic nature, we find nanoflare trains produce zero time lags along entire flux tubes in our model active region that are seen between the same channel pairs in observed active regions.

  6. Determining Heating Timescales in Solar Active Region Cores from AIA/SDO Fe XVIII Images

    NASA Astrophysics Data System (ADS)

    Ugarte-Urra, Ignacio; Warren, Harry P.

    2014-03-01

    We present a study of the frequency of transient brightenings in the core of solar active regions as observed in the Fe XVIII line component of AIA/SDO 94 Å filter images. The Fe XVIII emission is isolated using an empirical correction to remove the contribution of "warm" emission to this channel. Comparing with simultaneous observations from EIS/Hinode, we find that the variability observed in Fe XVIII is strongly correlated with the emission from lines formed at similar temperatures. We examine the evolution of loops in the cores of active regions at various stages of evolution. Using a newly developed event detection algorithm, we characterize the distribution of event frequency, duration, and magnitude in these active regions. These distributions are similar for regions of similar age and show a consistent pattern as the regions age. This suggests that these characteristics are important constraints for models of solar active regions. We find that the typical frequency of the intensity fluctuations is about 1400 s for any given line of sight, i.e., about two to three events per hour. Using the EBTEL 0D hydrodynamic model, however, we show that this only sets a lower limit on the heating frequency along that line of sight.

  7. IRX– β RELATION OF STAR-FORMING REGIONS IN NGC 628 BASED ON INTEGRAL FIELD SPECTROSCOPY

    SciTech Connect

    Ye, Chengyun; Lian, Jianhui; Hu, Ning

    2016-08-01

    It has been found that the infrared-to-ultraviolet luminosity ratio (IRX) and ultraviolet spectral slope ( β ) have a tight correlation in starburst galaxies, while in normal galaxies the relation is deviated and has a much larger scatter. Star formation regions are much simpler in both morphology and physical properties than galaxies, so their photometric and spectroscopic properties are more easily and accurately determined. We have used the integral field spectroscopy and multiband photometric images to study the IRX– β relation of H ii regions in a nearby galaxy, NGC 628. There are obvious correlations between the D{sub n} (4000),more » stellar population age, star formation rate, especially H α equivalent width EW(H α), and deviation distance d {sub p} from the starburst IRX– β relation. However, there is little correlation between the Balmer decrement, metallicity, and d {sub p}. It is much more complicated than expected, so that we cannot introduce a single second parameter to describe the scatter and deviation of the H ii region IRX– β relation.« less

  8. Coronal Jets from Minifilament Eruptions in Active Regions

    NASA Technical Reports Server (NTRS)

    Martinez, Francisco; Sterling, Alphonse C.; Falconer, David A.; Moore, Ronald L.

    2016-01-01

    Solar coronal jets are transient (frequently of lifetime approx.10 min) features that shoot out from near the solar surface, become much longer than their width, and occur in all solar regions, including coronal holes, quiet Sun, and active regions (e.g., Shimojo et al. 1996, Cirtain et al. 2007). Sterling et al. (2015) and other studies found that in coronal holes and in quiet Sun the jets result when small-scale filaments, called "minifilaments" erupt onto nearby open or high-reaching field lines. Additional studies found that coronal-jet-onset locations (and hence presumably the minifilament-eruption-onset locations) coincided with locations of magnetic-flux cancelation. For active region (AR) jets however the situation is less clear. Sterling et al. (2016) studied jets in one active region over a 24-hour period; they found that some AR jets indeed resulted from minifilament eruptions, usually originating from locations of episodes of magnetic-flux cancelation. In some cases however they could not determine whether flux was emerging or canceling at the polarity inversion line from which the minifilament erupted, and for other jets of that region minifilaments were not conclusively apparent prior to jet occurrence. Here we further study AR jets, by observing them in a single AR over a one-week period, using X-ray images from Hinode/XRT and EUV/UV images from SDO/AIA, and line-of-sight magnetograms and white-light intensity-grams from SDO/HMI. We initially identified 13 prominent jets in the XRT data, and examined corresponding AIA and HMI data. For at least several of the jets, our findings are consistent with the jets resulting from minifilament eruptions, and originating from sites of magnetic-field cancelation.

  9. PHYSICAL PROPERTIES OF COOLING PLASMA IN QUIESCENT ACTIVE REGION LOOPS

    SciTech Connect

    Landi, E.; Miralles, M. P.; Curdt, W.

    2009-04-10

    In the present work, we use SOHO/SUMER, SOHO/UVCS, SOHO/EIT, SOHO/LASCO, STEREO/EUVI, and Hinode/EIS coordinated observations of an active region (AR 10989) at the west limb taken on 2008 April 8 to study the cooling of coronal loops. The cooling plasma is identified using the intensities of SUMER spectral lines emitted at temperatures in the 4.15 {<=} log T {<=} 5.45 range. EIS and SUMER spectral observations are used to measure the physical properties of the loops. We found that before cooling took place these loops were filled with coronal hole-like plasma, with temperatures in the 5.6 {<=} log T {<=}more » 5.9 range. SUMER spectra also allowed us to determine the plasma temperature, density, emission measure, element abundances, and dynamic status during the cooling process. The ability of EUVI to observe the emitting region from a different direction allowed us to measure the volume of the emitting region and estimate its emission measure. Comparison with values measured from line intensities provided us with an estimate of the filling factor. UVCS observations of the coronal emission above the active region showed no streamer structure associated with AR 10989 at position angles between 242{sup 0}and 253.{sup 0} EIT, LASCO, and EUVI-A narrowband images and UVCS spectral observations were used to discriminate between different scenarios and monitor the behavior of the active region in time. The present study provides the first detailed measurements of the physical properties of cooling loops, a very important benchmark for theoretical models of loop cooling and condensation.« less

  10. Diagnostics of Coronal Heating in Solar Active Regions

    NASA Astrophysics Data System (ADS)

    Fludra, Andrzej; Hornsey, Christopher; Nakariakov, Valery

    2015-04-01

    We aim to develop a diagnostic method for the coronal heating mechanism in active region loops. Observational constraints on coronal heating models have been sought using measurements in the X-ray and EUV wavelengths. Statistical analysis, using EUV emission from many active regions, was done by Fludra and Ireland (2008) who studied power-law relationships between active region integrated magnetic flux and emission line intensities. A subsequent study by Fludra and Warren (2010) for the first time compared fully resolved images in an EUV spectral line of OV 63.0 nm with the photospheric magnetic field, leading to the identification of a dominant, ubiquitous variable component of the transition region EUV emission and a discovery of a steady basal heating, and deriving the dependence of the basal heating rate on the photospheric magnetic flux density. In this study, we compare models of single coronal loops with EUV observations. We assess to what degree observations of individual coronal loops made in the EUV range are capable of providing constraints on the heating mechanism. We model the coronal magnetic field in an active region using an NLFF extrapolation code applied to a photospheric vector magnetogram from SDO/HMI and select several loops that match an SDO/AIA 171 image of the same active region. We then model the plasma in these loops using a 1D hydrostatic code capable of applying an arbitrary heating rate as a function of magnetic field strength along the loop. From the plasma parameters derived from this model, we calculate the EUV emission along the loop in AIA 171 and 335 bands, and in pure spectral lines of Fe IX 17.1 nm and Fe XVI 33.5 nm. We use different spatial distributions of the heating function: concentrated near the loop top, uniform and concentrated near the footpoints, and investigate their effect on the modelled EUV intensities. We find a diagnostics based on the dependence of the total loop intensity on the shape of the heating function

  11. Electric currents and coronal heating in NOAA active region 6952

    NASA Technical Reports Server (NTRS)

    Metcalf, T. R.; Canfield, R. C.; Hudson, H. S.; Mickey, D. L.; Wulser, J. -P.; Martens, P. C. H.; Tsuneta, S.

    1994-01-01

    We examine the spatial and temporal relationship between coronal structures observed with the soft X-ray telescope (SXT) on board the Yohkoh spacecraft and the vertical electric current density derived from photospheric vector magnetograms obtained using the Stokes Polarimeter at the Mees Solar Observatory. We focus on a single active region: AR 6952 which we observed on 7 days during 1991 December. For 11 independent maps of the vertical electric current density co-aligned with non-flaring X-ray images, we search for a morphological relationship between sites of high vertical current density in the photosphere and enhanced X-ray emission in the overlying corona. We find no compelling spatial or temporal correlation between the sites of vertical current and the bright X-ray structures in this active region.

  12. Insights from Synthetic Star-forming Regions. III. Calibration of Measurement and Techniques of Star Formation Rates

    SciTech Connect

    Koepferl, Christine M.; Robitaille, Thomas P.; Dale, James E., E-mail: koepferl@usm.lmu.de

    2017-11-01

    Through an extensive set of realistic synthetic observations (produced in Paper I), we assess in this part of the paper series (Paper III) how the choice of observational techniques affects the measurement of star formation rates (SFRs) in star-forming regions. We test the accuracy of commonly used techniques and construct new methods to extract the SFR, so that these findings can be applied to measure the SFR in real regions throughout the Milky Way. We investigate diffuse infrared SFR tracers such as those using 24 μ m, 70 μ m and total infrared emission, which have been previously calibrated formore » global galaxy scales. We set up a toy model of a galaxy and show that the infrared emission is consistent with the intrinsic SFR using extra-galactic calibrated laws (although the consistency does not prove their reliability). For local scales, we show that these techniques produce completely unreliable results for single star-forming regions, which are governed by different characteristic timescales. We show how calibration of these techniques can be improved for single star-forming regions by adjusting the characteristic timescale and the scaling factor and give suggestions of new calibrations of the diffuse star formation tracers. We show that star-forming regions that are dominated by high-mass stellar feedback experience a rapid drop in infrared emission once high-mass stellar feedback is turned on, which implies different characteristic timescales. Moreover, we explore the measured SFRs calculated directly from the observed young stellar population. We find that the measured point sources follow the evolutionary pace of star formation more directly than diffuse star formation tracers.« less

  13. PATTERNS OF ACTIVITY IN A GLOBAL MODEL OF A SOLAR ACTIVE REGION

    SciTech Connect

    Bradshaw, S. J.; Viall, N. M., E-mail: stephen.bradshaw@rice.edu, E-mail: Nicholeen.M.Viall@nasa.gov

    2016-04-10

    In this work we investigate the global activity patterns predicted from a model active region heated by distributions of nanoflares that have a range of frequencies. What differs is the average frequency of the distributions. The activity patterns are manifested in time lag maps of narrow-band instrument channel pairs. We combine hydrodynamic and forward modeling codes with a magnetic field extrapolation to create a model active region and apply the time lag method to synthetic observations. Our aim is not to reproduce a particular set of observations in detail, but to recover some typical properties and patterns observed in activemore » regions. Our key findings are the following. (1) Cooling dominates the time lag signature and the time lags between the channel pairs are generally consistent with observed values. (2) Shorter coronal loops in the core cool more quickly than longer loops at the periphery. (3) All channel pairs show zero time lag when the line of sight passes through coronal loop footpoints. (4) There is strong evidence that plasma must be re-energized on a timescale comparable to the cooling timescale to reproduce the observed coronal activity, but it is likely that a relatively broad spectrum of heating frequencies are operating across active regions. (5) Due to their highly dynamic nature, we find nanoflare trains produce zero time lags along entire flux tubes in our model active region that are seen between the same channel pairs in observed active regions.« less

  14. Uncovering the monster stars in W49: the most luminous star-forming region in the Milky Way

    NASA Astrophysics Data System (ADS)

    Wu, Shiwei; Bik, Arjan; Henning, Thomas; Pasquali, Anna; Brandner, Wolfgang; Stolte, Andrea

    2015-08-01

    As a part of the LOBSTAR project (Luci OBservations of STARburst regions), which aims at understanding the stellar content of some of the most massive star-forming regions, we present our result on the high-mass stellar content of W49. K-band spectra of the candidate massive stars from VLT/ISAAC and LBT/LUCI provide us with reliable spectral types of dozens of massive stars in this HII region.The first results show that this region hosts several of the most massive stars in our galaxy. Two most brightest stars, one in the core of the central cluster and one in W49 South, were identified as very massive stars (M > 100 M⊙). Their K-band spectra exhibit strong stellar wind features, and they are classified as O2-3.5If* supergiant stars. After comparison to the Geneva evolutionary models, the mass range of W49nr1 was estimated to be between 100 M⊙ and 180 M⊙. Additionally we find 12 O stars with spectral types between O7V and O3V and masses from 25 M⊙ to 125 M⊙, respectively.These results allow us to derive the fundamental parameters of the cluster (mass, age) as well as the total energy output in the form of ionising photons. This will enable us to study the feedback effects of this extreme star forming region in great detail. To our surprise, two young stellar objects with infrared excess feature showing CO emission lines in their spectra are identified. This suggests that circumstellar disks can survive even in this extreme environment. Finally the spatial distribution of the massive stars is analysed to discuss the star formation history and identify potential runaway stars. The extreme properties of this region makes it a good template for more extreme star formation outside our galaxy.

  15. Modification of "Pressed" Atmospheres in Active Regions of Ultracool Stars

    NASA Astrophysics Data System (ADS)

    Zaitsev, V. V.; Kronshtadtov, P. V.; Stepanov, A. V.

    2017-12-01

    Ultracool stars usually have active regions, which is confirmed by their high-power radiofrequency emission modulated by the star axial rotation. The interpretation of this emission is commonly based on the electron cyclotron maser mechanism realized in the active regions. A plasma mechanism of radiofrequency emission is not considered, because ultracool star atmospheres are tightly "pressed" against the star surface, and the plasma frequency is much lower than the electron gyrofrequency ( f L ≪ f B) at the coronal levels. This paper explores active regions of ultracool stars for the possible existence of a system of coronal magnetic loops carrying electric current generated by photospheric convection. It is shown that current dissipation induces a temperature increase inside the loops to about 107 K, which causes an increase in the scale of height of the inhomogeneous atmosphere and, at the coronal levels, effectuates condition f L ≫ f B, at which the plasma mechanism of radiofrequency emission prevails over the electron cyclotron maser mechanism. The magnetic loop parameters, intensity of electric currents generated by the photospheric convection, and efficiency of plasma heating inside the magnetic loops are evaluated on the example of the brown dwarf TVLM513-46546. The scale of the height of the modified atmosphere, which appears to be comparable to the star radius, is calculated; it is shown that the soft X-ray flow created by the hot modified atmosphere inside a coronal magnetic loop is about equal to that observed for brown dwarf TVLM513-46546.

  16. The magnetic fields and the heating of active regions

    NASA Astrophysics Data System (ADS)

    Fludra, A.; Ireland, J.

    2002-10-01

    Fludra and Ireland (2002) established empirical power-laws between the EUV line intensity averaged over the active region area and the magnetic flux density, using SOHO/MDI magnetograms and two EUV spectral lines, O V 629.7 Å (2.2×105K) and Fe XVI 360.76 Å (2.0×106K), recorded by the SOHO Coronal Diagnostic Spectrometer for 45 active regions. These relationships were used to derive the heating rate as a function of the magnetic flux density. In this paper we examine a subset of 26 active regions without sunspots, to investigate the change in these relationships in the absence of strong sunspot magnetic fields. We find a reduced power index in the power-law dependence between the average line intensities and the magnetic flux density. This translates as a reduced power index in the dependence of the heating rate on the magnetic flux density, EH ∝ B0.9, and affirms that most of the DC models of coronal heating, predicting an EH ∝ B2 dependence, are incompatible with our observations.

  17. 76 FR 66127 - Reports, Forms and Recordkeeping Requirements; Agency Information Collection Activity Under OMB...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-25

    ... Maritime Administration Reports, Forms and Recordkeeping Requirements; Agency Information Collection Activity Under OMB Review AGENCY: Maritime Administration, DOT. ACTION: Notice and request for comments... November 25, 2011. FOR FURTHER INFORMATION CONTACT: Dennis Brennan, Maritime Administration, 1200 New...

  18. 77 FR 53962 - Reports, Forms and Recordkeeping Requirements; Agency Information Collection Activity Under OMB...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-04

    ... Maritime Administration Reports, Forms and Recordkeeping Requirements; Agency Information Collection Activity Under OMB Review AGENCY: Maritime Administration, DOT. ACTION: Notice and request for comments..., 2012. FOR FURTHER INFORMATION CONTACT: Dennis Brennan, Maritime Administration, 1200 New Jersey Avenue...

  19. 78 FR 32261 - Agency Information Collection Activities: Immigrant Petition by Alien Entrepreneur, Form Number I...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-29

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615-0026] Agency Information Collection Activities: Immigrant Petition by Alien Entrepreneur, Form Number I... collection. [[Page 32262

  20. 78 FR 9049 - Agency Information Collection Activities: Proposed Collection Renewal; Comment Request Re Forms...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-07

    ... FEDERAL DEPOSIT INSURANCE CORPORATION Agency Information Collection Activities: Proposed Collection Renewal; Comment Request Re Forms Relating to Processing Deposit Insurance Claims AGENCY: Federal Deposit Insurance Corporation (FDIC). ACTION: Notice of proposed information collection renewal and...

  1. 78 FR 27965 - Agency Information Collection Activities: Submission for OMB Review; Comment Request Re Forms...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-13

    ... FEDERAL DEPOSIT INSURANCE CORPORATION Agency Information Collection Activities: Submission for OMB Review; Comment Request Re Forms Relating To Processing Deposit Insurance Claims AGENCY: Federal Deposit Insurance Corporation (FDIC). ACTION: Notice of proposed information collection renewal and comment request...

  2. 77 FR 74647 - Agency Information Collection Activities: Proposed Collection, Comment Request: Form TO, Annual...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-17

    ...). Note that the swap definition excludes options on futures (which must be traded on a designated... COMMODITY FUTURES TRADING COMMISSION Agency Information Collection Activities: Proposed Collection, Comment Request: Form TO, Annual Notice Filing for Counterparties to Unreported Trade Options AGENCY...

  3. Study of diffuse H II regions potentially forming part of the gas streams around Sgr A*

    NASA Astrophysics Data System (ADS)

    Armijos-Abendaño, J.; López, E.; Martín-Pintado, J.; Báez-Rubio, A.; Aravena, M.; Requena-Torres, M. A.; Martín, S.; Llerena, M.; Aldás, F.; Logan, C.; Rodríguez-Franco, A.

    2018-05-01

    We present a study of diffuse extended ionized gas towards three clouds located in the Galactic Centre (GC). One line of sight (LOS) is towards the 20 km s-1 cloud (LOS-0.11) in the Sgr A region, another LOS is towards the 50 km s-1 cloud (LOS-0.02), also in Sgr A, while the third is towards the Sgr B2 cloud (LOS+0.693). The emission from the ionized gas is detected from Hnα and Hmβ radio recombination lines (RRLs). Henα and Hemβ RRL emission is detected with the same n and m as those from the hydrogen RRLs only towards LOS+0.693. RRLs probe gas with positive and negative velocities towards the two Sgr A sources. The Hmβ to Hnα ratios reveal that the ionized gas is emitted under local thermodynamic equilibrium conditions in these regions. We find a He to H mass fraction of 0.29±0.01 consistent with the typical GC value, supporting the idea that massive stars have increased the He abundance compared to its primordial value. Physical properties are derived for the studied sources. We propose that the negative velocity component of both Sgr A sources is part of gas streams considered previously to model the GC cloud kinematics. Associated massive stars with what are presumably the closest H II regions to LOS-0.11 (positive velocity gas), LOS-0.02, and LOS+0.693 could be the main sources of ultraviolet photons ionizing the gas. The negative velocity components of both Sgr A sources might be ionized by the same massive stars, but only if they are in the same gas stream.

  4. 76 FR 43336 - Agency Information Collection Activities: Form AR-11, Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-20

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information Collection Activities: Form AR-11, Extension of an Existing Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection under Review: Form AR- 11, Alien's Change of Address Card; OMB Control No. 1615-0007. The Department of...

  5. 77 FR 71432 - Agency Information Collection Activities: Immigrant Petition by Alien Entrepreneur, Form I-526...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-30

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615-0026] Agency Information Collection Activities: Immigrant Petition by Alien Entrepreneur, Form I-526.../Collection: Immigrant Petition by Alien Entrepreneur. (3) Agency form number, if any, and the applicable...

  6. 75 FR 52541 - Agency Information Collection Activities: Form I-865, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-26

    ... Collection Activities: Form I-865, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 865, Sponsor's Notice of Change of... 32801, allowing for a 60-day public comment period. USCIS did not receive any comments for this...

  7. 76 FR 41282 - Agency Information Collection Activities: Form I-693, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-13

    ... Activities: Form I-693, Revision of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 693, Report of Medical Examination and... was previously published in the Federal Register on May 13, 2011, at 76 FR 24908, allowing for a 60...

  8. 77 FR 3486 - Agency Information Collection Activities: Form I-539, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-24

    ... Collection Activities: Form I-539, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 539, Application to Extend/Change..., allowing for a 60-day public comment period. USCIS did not receive any comments on the 60-day notice. The...

  9. 75 FR 70016 - Agency Information Collection Activities: Form I-566, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-16

    ... Collection Activities: Form I-566, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 566, Interagency Record of Individual Requesting Change/Adjustment To or From A or G Status or Requesting A, G, or NATO Dependent...

  10. 76 FR 69274 - Agency Information Collection Activities: Form I-817, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ... Activities: Form I-817, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 817, Application for Family Unity Benefits..., at 76 FR 50237, allowing for a 60-day public comment period. USCIS did not receive any comments on...

  11. 76 FR 76982 - Agency Information Collection Activities: Form I-130, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-09

    ... Collection Activities: Form I-130, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 130, Petition for Alien Relative... notice was published in the Federal Register on September 30, 2011, at 76 FR 60852, allowing for a 60-day...

  12. 77 FR 3485 - Agency Information Collection Activities: Form I-129F, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-24

    ... Collection Activities: Form I-129F, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 129F, Petition for Alien Fiance(e... a 60-day public comment period. USCIS did not receive any comments on the 60-day notice. The purpose...

  13. 76 FR 16800 - Agency Information Collection Activities: Form I-601, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-25

    ... Collection Activities: Form I-601, Revision of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 601, Application for Waiver of... on December 9, 2010, at 75 FR 76745, allowing for a 60-day public comment period. USCIS received one...

  14. 76 FR 39414 - Agency Information Collection Activities: Form I-694, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-06

    ... Collection Activities: Form I-694, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 694, Notice of Appeal of Decision... published in the Federal Register on April 12, 2011, at 76 FR 20361, allowing for a 60-day public comment...

  15. 75 FR 12250 - Agency Information Collection Activities: Form I-191, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-15

    ... Collection Activities: Form I-191, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection under Review: Form I- 191, Application for Advance... Federal Register on November 24, 2009, at 74 FR 61359 allowing for a 60-day public comment period. USCIS...

  16. 77 FR 33759 - Agency Information Collection Activities: Form I-601, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-07

    ... Collection Activities: Form I-601, Revision of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 601, Application for Waiver of... 12071, allowing for a 60-day public comment period. USCIS received no comments in connection with that...

  17. 76 FR 69275 - Agency Information Collection Activities: Form I-192, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ... Collection Activities: Form I-192, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 192, Application for Advance... FR 50239, allowing for a 60- day public comment period. USCIS received one comment on the extension...

  18. 75 FR 76745 - Agency Information Collection Activities: Form I-601, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-12-09

    ... Collection Activities: Form I-601, Extension of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 601, Application for Waiver of Grounds of Inadmissibility; OMB Control Number 1615-0029. On November 30, 2010, USCIS published a 60-day...

  19. 75 FR 65022 - Agency Information Collection Activities: Form I-751, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-21

    ...-0038] Agency Information Collection Activities: Form I-751, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I... the Federal Register on June 30, 2010, at 75 FR 37821, allowing for a 60-day public comment period...

  20. 75 FR 71451 - Agency Information Collection Activities: Form I-130, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-23

    ... Collection Activities: Form I-130, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 130, Petition for Alien Relative... FR 52540, allowing for a 60-day public comment period. USCIS did not receive any comments for this...

  1. 76 FR 70747 - Agency Information Collection Activities: Form I-90; Revision of a Currently Approved Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-15

    ... Collection Activities: Form I-90; Revision of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 90, Application to Replace... Collection (1) Type of Information Collection: Revision of a currently approved information collection. (2...

  2. 75 FR 65500 - Agency Information Collection Activities: Form I-360, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-25

    ... Collection Activities: Form I-360, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 360, Petition for Amerasian, Widow... on June 30, 2010, at 75 FR 37820, allowing for a 60-day public comment period. USCIS did not receive...

  3. 76 FR 11805 - Agency Information Collection Activities: Form I-134, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-03

    ... Collection Activities: Form I-134, Extension of a Currently Approved Information Collection; Comment Request. ACTION: 30-Day Notice of Information Collection Under Review: Form I- 134, Affidavit of Support; OMB..., allowing for a 60-day public comment period. USCIS did not receive any comments for this information...

  4. 77 FR 23734 - Agency Information Collection Activities: Form I-361, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-20

    ... Collection Activities: Form I-361, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 361, Affidavit of Financial Support... Federal Register on February 16, 2012, at 77 FR 9259, allowing for a 60-day public comment period. USCIS...

  5. 75 FR 41215 - Agency Information Collection Activities: Form I-687, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-15

    ... Collection Activities: Form I-687, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 687, Application for Status as... published in the Federal Register on April 23, 2010, at 75 FR 21340, allowing for a 60-day public comment...

  6. 75 FR 47824 - Agency Information Collection Activities: Form I-643, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-09

    ... Collection Activities: Form I-643, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 643, Health and Human Services... Federal Register on May 4, 2010, at 75 FR 23784, allowing for a 60-day public comment period. USCIS did...

  7. 75 FR 52541 - Agency Information Collection Activities: Form I-243, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-26

    ... Collection Activities: Form I-243, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 243, Application for Removal; OMB... 32799, allowing for a 60-day public comment period. USCIS did not receive any comments for this...

  8. 76 FR 71056 - Agency Information Collection Activities: Form I-566, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-16

    ... Collection Activities: Form I-566, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 566, Interagency Record of Request, A, G or NATO Dependent Employment Authorization or Change/Adjustment To/From A, G or NATO Status...

  9. 76 FR 40385 - Agency Information Collection Activities: Form I-907, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-08

    ... Collection Activities: Form I-907, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: form I- 907, request for premium processing... was previously published in the Federal Register on April 12, 2011, at 76 FR 20361, allowing for a 60...

  10. 77 FR 35419 - Agency Information Collection Activities: Form I-601, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-13

    ... Collection Activities: Form I-601, Revision of a Currently Approved Information Collection; Correction ACTION: 30-Day Notice of Information Collection Under Review: Form I- 601, Application for Waiver of Grounds... and Immigration Services (USCIS) published a 30-day information collection notice in the Federal...

  11. 75 FR 74071 - Agency Information Collection Activities: Form I-601, Revision of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-30

    ... Collection Activities: Form I-601, Revision of a Currently Approved Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review: Form I- 601, Application for Waiver of... This Information Collection (1) Type of Information Collection: Revision of a currently approved...

  12. 76 FR 43335 - Agency Information Collection Activities: Form I-765, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-20

    ... Collection Activities: Form I-765, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 756, Application for Employment... FR 21912 allowing for a 60-day public comment period. USCIS did not receive any comments for this...

  13. 75 FR 39271 - Agency Information Collection Activities: Form I-694, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-08

    ... Collection Activities: Form I-694, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form I- 694, Notice of Appeal of Decision... published in the Federal Register on April 22, 2010, at 75 FR 21014, allowing for a 60-day public comment...

  14. 75 FR 65022 - Agency Information Collection Activities: Form I-698, Extension of a Currently Approved...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-21

    ... Collection Activities: Form I-698, Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-day notice of information collection under review: Form I- 698, Application to Adjust Status... Federal Register on June 23, 2010, at 75 FR 35825, allowing for a 60-day public comment period. USCIS did...

  15. 77 FR 2560 - Agency Information Collection Activities: Form I-90, Revision of a Currently Approved Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-18

    ... Collection Activities: Form I-90, Revision of a Currently Approved Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: Form I- 90, Application to Replace... 70747, allowing for a 60-day public comment period. USCIS did not receive any comments on the 60-day...

  16. 78 FR 5477 - Agency Information Collection Activities: InfoPass System, No Form Number; Extension, Without...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-25

    ...-0113] Agency Information Collection Activities: InfoPass System, No Form Number; Extension, Without... Change, of a Currently Approved Collection. (2) Title of the Form/Collection: InfoPass System. (3) Agency...: Primary: Individuals or households. The InfoPass system allows an applicant or petitioner to schedule an...

  17. 75 FR 57049 - Agency Information Collection Activities: Form I-777, Application for Replacement of Northern...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-17

    ... Collection Activities: Form I-777, Application for Replacement of Northern Mariana Card ACTION: Correction to 30-day notice of Information Collection Under Review: Form I-777, Application for Replacement of...-777 should read ``Application for Replacement of Northern Mariana Card'', instead of ``Application for...

  18. 76 FR 48874 - Agency Information Collection Activities: Form G-884, Extension of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-09

    ... Activities: Form G-884, Extension of an Existing Information Collection; Comment Request ACTION: 30-Day Notice of Information Collection Under Review: Form G- 884, Request for the Return of Original Document(s... information technology, e.g., permitting electronic submission of responses. Overview of This Information...

  19. Analysis on the forms and regional characteristics of the traditional dwellings in mountainous central Shandong Province

    NASA Astrophysics Data System (ADS)

    Lu, Haiyong; Hu, Haiyan; Miao, Lei; Zhou, Bo

    2017-08-01

    The traditional dwellings in mountainous central Shandong Province show rich historic cultural deposits and distinctive regional characteristics under the influence of the geographic environment, resource endowment and historic culture. Research was done on the main construction patterns of the traditional dwellings in mountainous central Shandong Province, as well as relevant data and techniques, revealing the symbiotic interdependence between the traditional dwellings and nature in different natural and humanistic environments, providing a certain theoretical reference for the diversified conservation and heritage of the traditional dwellings.

  20. Dynamic Positional Fate Map of the Primary Heart-Forming Region

    PubMed Central

    Cui, Cheng; Cheuvront, Tracey J.; Lansford, Rusty D.; Moreno-Rodriguez, Ricardo A.; Schultheiss, Thomas M.; Rongish, Brenda J.

    2009-01-01

    Here we show the temporal-spatial orchestration of early heart morphogenesis at cellular level resolution, in vivo, and reconcile conflicting positional fate-mapping data regarding the primary heart-forming field(s). We determined the positional-fates of precardiac cells using a precision electroporation approach in combination with wide-field time-lapse microscopy in the quail embryo, a warm-blooded vertebrate (HH Stages 4 through 10). Contrary to previous studies, the results demonstrate the existence of a “continuous” circle-shaped heart field that spans the midline, appearing at HH Stage 4, which then expands to form a wide arc of progenitors at HH stages 5–7. Our time-resolved image data show that a subset of these cardiac progenitor cells do not overlap with the expression of common cardiogenic factors, Nkx-2.5 and Bmp-2, until HH Stage 10, when a tubular heart has formed, calling into question when cardiac fate is specified and by which key factors. Sub-groups and anatomical bands (cohorts) of heart precursor cells dramatically change their relative positions in a process largely driven by endodermal folding and other large-scale tissue deformations. Thus, our novel dynamic positional fate maps resolve the origin of cardiac progenitor cells in amniotes. The data also establish the concept that tissue motion contributes significantly to cellular position fate — i.e., much of the cellular displacement that occurs during assembly of a midline heart tube (HH Stage 9) is NOT due to “migration” (autonomous motility), a commonly held belief. Computational analysis of our time-resolved data lays the foundation for more precise analyses of how cardiac gene regulatory networks correlate with early heart tissue morphogenesis in birds and mammals. PMID:19497319

  1. 15N Fractionation in Star-Forming Regions and Solar System Objects

    NASA Technical Reports Server (NTRS)

    Wirstrom, Eva; Milam, Stefanie; Adande, GIlles; Charnley, Steven; Cordiner, Martin

    2015-01-01

    A central issue for understanding the formation and evolution of matter in the early Solar System is the relationship between the chemical composition of star-forming interstellar clouds and that of primitive Solar System materials. The pristinemolecular content of comets, interplanetary dust particles and carbonaceous chondrites show significant bulk nitrogen isotopic fractionation relative to the solar value, 14N15N 440. In addition, high spatial resolution measurements in primitive materials locally show even more extreme enhancements of 14N15N 100.

  2. An Array of Novel Murine Spleen Focus-Forming Viruses That Activate the Erythropoietin Receptor

    PubMed Central

    Gomez-Lucia, Esperanza; Zhi, Yu; Nabavi, Melud; Zhang, Weibin; Kabat, David; Hoatlin, Maureen E.

    1998-01-01

    The Friend spleen focus-forming virus (SFFV) env gene encodes a 409-amino-acid glycoprotein with an apparent Mr of 55,000 (gp55) that binds to erythropoietin receptors (EpoR) to stimulate erythroblastosis. We reported previously the in vivo selection during serial passages in mice of several evolutionary intermediates that culminated in the formation of a novel SFFV (M. E. Hoatlin, E. Gomez-Lucia, F. Lilly, J. H. Beckstead, and D. Kabat, J. Virol. 72:3602–3609, 1998). A mouse injected with a retroviral vector in the presence of a nonpathogenic helper virus developed long-latency erythroblastosis, and subsequent viral passages resulted in more pathogenic isolates. The viruses taken from these mice converted an erythropoietin-dependent cell line (BaF3/EpoR) into factor-independent derivatives. Western blot analysis of cell extracts with an antiserum that broadly reacts with murine retroviral envelope glycoproteins suggested that the spleen from the initial mouse with mild erythoblastosis contained an array of viral components that were capable of activating EpoR. DNA sequence analysis of the viral genomes cloned from different factor-independent cell clones revealed env genes with open reading frames encoding 644, 449, and 187 amino acids. All three env genes contained 3′ regions identical to that of SFFV, including a 6-bp duplication and a single-base insertion that have been shown previously to be critical for pathogenesis. However, the three env gene sequences did not contain any polytropic sequences and were divergent in their 5′ regions, suggesting that they had originated by recombination and partial deletions of endogenously inherited MuLV env sequences. These results suggest that the requirements for EpoR activation by SFFV-related viruses are dependent on sequences at the 3′ end of the env gene and not on the polytropic regions or on the 585-base deletions that are common among the classical strains of SFFV. Moreover, sequence analysis of the

  3. Far-infrared observations of a star-forming region in the Corona Australis dark cloud

    NASA Technical Reports Server (NTRS)

    Cruz-Gonzalez, I.; Mcbreen, B.; Fazio, G. G.

    1984-01-01

    A high-resolution far-IR (40-250-micron) survey of a 0.9-sq-deg section of the core region of the Corona Australis dark cloud (containing very young stellar objects such as T Tauri stars, Herbig Ae and Be stars, Herbig-Haro objects, and compact H II regions) is presented. Two extended far-IR sources were found, one associated with the Herbig emission-line star R CrA and the other with the irregular emission-line variable star TY CrA. The two sources have substantially more far-IR radiation than could be expected from a blackbody extrapolation of their near-IR fluxes. The total luminosities of these sources are 145 and 58 solar luminosity, respectively, implying that the embedded objects are of intermediate or low mass. The infrared observations of the sources associated with R CrA and TY CrA are consistent with models of the evolution of protostellar envelopes of intermediate mass. However, the TY CrA source appears to have passed the evolutionary stage of expelling most of the hot dust near the central source, yielding an age of about 1 Myr.

  4. Carbon Monoxide Observations Toward Star Forming Regions in the Outer Scutum-CentaurusSpiral Arm

    NASA Astrophysics Data System (ADS)

    Ferraro, Nicholas; Wenger, Trey V.; Khan, Asad; Balser, Dana; Armentrout, William Paul; Anderson, Loren Dean; Bania, Thomas

    2018-01-01

    The Outer Scutum-Centaurus arm (OSC) is the most distant molecular spiral arm known in the Milky Way. The Scutum-Centaurus spiral arm is posited to start at the end of the Galactic bar and to extend beyond the Solar orbit into the outer Galaxy. Carbon monoxide (CO) emission from molecular clouds is a bright star formation tracer that was recently discovered in the OSC in the first Galactic quadrant and may extend into the second quadrant. The population of star formation tracers in the OSC remains largely uncharacterized in part because the arm is distant enough from the Galactic Center to be affected by the Galactic warp. The OSC rises above the Galactic plane by nearly 4 degrees in the first quadrant, meaning most in-plane surveys of molecular gas or star formation tracers have missed the arm previously. Here we use the Arizona Radio Observatory (ARO) 12m telescope to observe 12CO J = 1-0 and 13CO J = 1-0 transitions toward 158 HII region candidates in the first and second Galactic quadrants chosen from the WISE Catalog of Galactic HII Regions. These targets are spatially coincident with the Galactic longitude-latitude (l, b) OSC locus as defined by HI emission. We detect CO toward most of our targets, many of which have at least one emission line originating beyond the Solar orbit. We compare the physical properties of molecular clouds in the OSC to the physical properties of molecular clouds located elsewhere in the Galaxy.

  5. Observational studies of the structure, content and environment of intermediate and high-mass star-forming regions

    NASA Astrophysics Data System (ADS)

    Arvidsson, Kim

    This thesis describes observational studies of star-forming regions and their influence on the interstellar medium. First, in an effort to understand the factors that govern the transition from low- to high-mass star formation, a sample of intermediate-mass star-forming regions (IM SFRs) is identified for the first time. IM SFRs constitute embedded clusters where stars up to---but not exceeding--- ˜ 8 M⊙ are being produced. They are at an early evolutionary stage akin to compact H II regions, but they lack the massive ionizing central star(s). IRAS colors, Spitzer Space Telescope mid-IR images, millimeter continuum and 13CO maps were used to compile a sample of 50 IM SFRs in the inner Galaxy. The photodissociation regions that demarcate IM SFRs have typical diameters of ˜ 1 pc and luminosities of ˜ 104 L⊙ , making them an order of magnitude less luminous than (ultra)compact H II regions. IM SFRs coincide with molecular clumps of mass ˜ 103 M⊙ which, in turn, lie within larger molecular clouds spanning the lower end of the giant molecular cloud mass range, 104--10 5 M⊙ . The IR luminosity and associated molecular mass of IM SFRs are correlated, consistent with the known luminosity--mass relationship of compact H II regions. Peak mass column densities within IM SFRs are ˜ 0.1--0.5 g cm-2, a factor of several lower than ultra-compact H II regions, supporting the proposition that there is a threshold for massive star formation at ˜ 1 g cm -2. Second, an investigation into the enormous H II region CTB 102 was carried out for the first time. Through a combination of new radio recombination line observations and available archival data, analysis shows that the filamentary structure surrounding the central region is physically associated with the central region. The first ever distance estimate for this H II region is provided, 4.3 kpc. The overall morphology and size of CTB 102 indicates that it is likely a large H II region combined with a wind

  6. Warrego Valles and Other Candidate Sites of Local Hydrothermal Activity Within The Thaumasia Region, Mars

    NASA Technical Reports Server (NTRS)

    Dohm, J. M.; Tanaka, K. L.; Lias, J. H.; Hare, T. M.; Anderson, R. C.; Gulick, V. C.

    1998-01-01

    We have previously demonstrated for the Thaumasia region of Mars that: (1) valley formation peaked during the Noachian and declined substantially during the Hesperian and Amazonian Periods and (2) valleys, many of which form networking systems, largely occur near volcanoes, highly faulted terrains, and large impact craters of similar age, thus suggesting hydrothermal activity. In Tanaka et al, the various hypotheses for valley formation on Mars are presented, and a geologic explanation for valley erosion in the Thaumasia region is given that "best fits" the region's geographic and geologic datasets. That comprehensive GIS-based investigation suggests that hydrothermal and seismic activity were the primary causes of valley formation in the Thaumasia region; the data make widespread precipitation less likely as a major factor in valley formation, except perhaps during the Early Noachian, for which much of the geologic record has been destroyed. Based on the reconstruction of the stratigraphic, tectonic, volcanic, and erosional histories and the close association of valleys in time and space with Noachian to Early Hesperian volcanoes and rift systems and Hesperian to Early Amazonian impact craters less than 50 km in diameter, we propose 13 sites of hydrothermal activity within the Thaumasia region; these are the best examples of valleys associated with these geologic features, but there are other less pronounced correlations elsewhere in the region.

  7. WEAK AND COMPACT RADIO EMISSION IN EARLY HIGH-MASS STAR-FORMING REGIONS. I. VLA OBSERVATIONS

    SciTech Connect

    Rosero, V.; Hofner, P.; Claussen, M.

    2016-12-01

    We present a high-sensitivity radio continuum survey at 6 and 1.3 cm using the Karl G. Jansky Very Large Array toward a sample of 58 high-mass star-forming regions. Our sample was chosen from dust clumps within infrared dark clouds with and without IR sources (CMC–IRs and CMCs, respectively), and hot molecular cores (HMCs), with no previous, or relatively weak radio continuum detection at the 1 mJy level. Due to the improvement in the continuum sensitivity of the Very Large Array, this survey achieved map rms levels of ∼3–10  μ Jy beam{sup −1} at sub-arcsecond angular resolution. We extracted 70 continuum sourcesmore » associated with 1.2 mm dust clumps. Most sources are weak, compact, and prime candidates for high-mass protostars. Detection rates of radio sources associated with the millimeter dust clumps for CMCs, CMC–IRs, and HMCs are 6%, 53%, and 100%, respectively. This result is consistent with increasing high-mass star formation activity from CMCs to HMCs. The radio sources located within HMCs and CMC–IRs occur close to the dust clump centers, with a median offset from it of 12,000 au and 4000 au, respectively. We calculated 5–25 GHz spectral indices using power-law fits and obtained a median value of 0.5 (i.e., flux increasing with frequency), suggestive of thermal emission from ionized jets. In this paper we describe the sample, observations, and detections. The analysis and discussion will be presented in Paper II.« less

  8. Active Region Jets II: Triggering and Evolution of Violent Jets

    NASA Astrophysics Data System (ADS)

    Sterling, Alphonse C.; Moore, Ronald L.; Falconer, David; Panesar, Navdeep K.; Martinez, Francisco

    2017-08-01

    We study a series of X-ray-bright, rapidly evolving active-region coronal jets outside the leading sunspot of AR 12259, using Hinode/XRT, SDO/AIA and HMI, and IRIS/SJ data. The detailed evolution of such rapidly evolving “violent” jets remained a mystery after our previous investigation of active region jets (Sterling et al. 2016, ApJ, 821, 100). The jets we investigate here erupt from three localized subregions, each containing a rapidly evolving (positive) minority-polarity magnetic-flux patch bathed in a (majority) negative-polarity magnetic-flux background. At least several of the jets begin with eruptions of what appear to be thin (thickness ˜<2‧‧) miniature-filament (minifilament) “strands” from a magnetic neutral line where magnetic flux cancelation is ongoing, consistent with the magnetic configuration presented for coronal-hole jets in Sterling et al. (2015, Nature, 523, 437). For some jets strands are difficult/ impossible to detect, perhaps due to their thinness, obscuration by surrounding bright or dark features, or the absence of erupting cool-material minifilaments in those jets. Tracing in detail the flux evolution in one of the subregions, we find bursts of strong jetting occurring only during times of strong flux cancelation. Averaged over seven jetting episodes, the cancelation rate was ~1.5×10^19 Mx/hr. An average flux of ~5×10^18 Mx canceled prior to each episode, arguably building up ~10^28—10^29 ergs of free magnetic energy per jet. From these and previous observations, we infer that flux cancelation is the fundamental process responsible for the pre-eruption buildup and triggering of at least many jets in active regions, quiet regions, and coronal holes.

  9. Correlating regional aeroallergen effects on internet search activity.

    PubMed

    Willson, Thomas J; Lospinoso, Joshua; Weitzel, Erik; McMains, Kevin

    2015-02-01

    To investigate the correlation between the change in regional aeroallergen levels and Internet search activity related to allergies. A retrospective time series analysis using a graphical analytical approach and statistical modeling was used. Tertiary academic hospital setting. There were no specific enrolled subjects. Data from Google Trends were obtained (google.com/trends) for the following search terms: "allergy," "allergies," "pollen," "runny nose," "congestion," and "post nasal drainage." Daily pollen and mold spore count data were obtained for the same period from throughout Texas. Graphical analysis, correlation, and autoregressive integrated moving average (ARIMA) were employed to assess the relationship between aeroallergens on Google search activity. A strong positive correlation was observed between observed pollen counts and search activity for the terms "allergies" (r pollen = 0.798), "allergy" (r pollen = 0.781), and "pollen" (r pollen = 0.849). Symptom term searches were weakly correlated with pollen and mold counts. Also, ARIMA modeling supported the relationships indicated by the correlations. Search activities for surrogate terms such as "allergy," "allergies," and "pollen" correlate strongly with observed pollen counts but not mold counts. These data demonstrate the usefulness of Google Trends search data in assessing regional disease burdens and offer insight into how the public seeks information about their own illness. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2014.

  10. Effect of chemical form of selenium on tissue glutathione peroxidase activity in developing rats

    NASA Technical Reports Server (NTRS)

    Lane, Helen W.; Strength, Ralph; Johnson, Janet; White, Marguerite T.

    1991-01-01

    The hypothesis that the stage of development of rats may affect the availability of various forms of selenium for the activity of glutathione peroxidase (GSHPx) in the rat was experimentally investigated. One experiment evaluated the availability of selenium as selenite or selenomethionine for GSPHx activity during three developmental states in rats: fetus and 7-day old and 14-day old nursing pups. In all tissues studied, GSHPx activity was highest in the 14-day-old pups whose dams were in the selenomethionine group. Rat pups given intraperitoneal selenite had higher liver and kidney GSHPx activity than pups given the same amount of selenium as intraperitoneal selenomethionine. In a second experiment, all dams were fed the same basal diet and pups were weaned to diets containing one of two levels of selenium and one of three forms of selenium (selenite, selenomethionine, or selenocystine). The results also supported the hypothesis these dietary forms of selenium are differentially available for GSHPx activity.

  11. INTERACTION BETWEEN THE SUPERNOVA REMNANT HB 3 AND THE NEARBY STAR-FORMING REGION W3

    SciTech Connect

    Zhou, Xin; Yang, Ji; Fang, Min

    2016-12-10

    We performed millimeter observations of CO lines toward the supernova remnant (SNR) HB 3. Substantial molecular gas around −45 km s{sup −1} is detected in the conjunction region between the SNR HB 3 and the nearby W3 complex. This molecular gas is distributed along the radio continuum shell of the remnant. Furthermore, the shocked molecular gas indicated by line wing broadening features is also distributed along the radio shell and inside it. By both morphological correspondence and dynamical evidence, we confirm that the SNR HB 3 interacts with the −45 km s{sup −1} molecular cloud (MC), in essence, with the nearby H ii region/MC complexmore » W3. The redshifted line wing broadening features indicate that the remnant is located at the nearside of the MC. With this association, we could place the remnant at the same distance as the W3/W4 complex, which is 1.95 ± 0.04 kpc. The spatial distribution of aggregated young stellar object candidates shows a correlation with the shocked molecular strip associated with the remnant. We also find a binary clump of CO at ( l = 132.°94, b = 1.°12) around −51.5 km s{sup −1} inside the projected extent of the remnant, and it is associated with significant mid-infrared emission. The binary system also has a tail structure resembling the tidal tails of interacting galaxies. According to the analysis of CO emission lines, the larger clump in this binary system is about stable, and the smaller clump is significantly disturbed.« less

  12. Carbon Monoxide Observations toward Star-forming Regions in the Outer Scutum–Centaurus Spiral Arm

    NASA Astrophysics Data System (ADS)

    Wenger, Trey V.; Khan, Asad A.; Ferraro, Nicholas G.; Balser, Dana S.; Armentrout, W. P.; Anderson, L. D.; Bania, T. M.

    2018-01-01

    The Outer Scutum–Centaurus arm (OSC) is the most distant molecular spiral arm known in the Milky Way. The OSC may be the very distant end of the well-known Scutum–Centaurus arm, which stretches from the end of the Galactic bar to the outer Galaxy. At this distance the OSC is seen in the first Galactic quadrant. The population of star formation tracers in the OSC remains largely uncharacterized. Extragalactic studies show a strong correlation between molecular gas and star formation, and carbon monoxide (CO) emission was recently discovered in the OSC. Here we use the Arizona Radio Observatory (ARO) 12 {{m}} telescope to observe the 12CO J = 1–0 and 13CO J = 1–0 transitions toward 78 H II region candidates chosen from the WISE Catalog of Galactic H II Regions. These targets are spatially coincident with the Galactic longitude–latitude ({\\ell },b) OSC locus as defined by H I emission. We detect CO emission in ∼80% of our targets. In total, we detect 117 12CO and 40 13CO emission lines. About two-thirds of our targets have at least one emission line originating beyond the solar orbit. Most of the detections beyond the solar orbit are associated with the outer arm, but there are 17 12CO emission lines and 8 13CO emission lines with LSR velocities that are consistent with the velocities of the OSC. There is no apparent difference between the physical properties (e.g., molecular column density) of these OSC molecular clouds and non-OSC molecular clouds within our sample.

  13. Electromagnetic transition form factors of baryons in the space-like momentum region

    NASA Astrophysics Data System (ADS)

    Sanchis-Alepuz, Hèlios; Alkofer, Reinhard; Fischer, Christian S.

    2018-03-01

    We present results from a calculation of the electromagnetic transition form factors between ground-state octet and decuplet baryons as well as the octet-only Σ0 to Λ transition. We work in the combined framework of Dyson-Schwinger equations and covariant Bethe-Salpeter equations with all elements, the baryon three-body wave function, the quark propagators and the dressed quark-photon vertex determined from a well-established, momentum dependent approximation for the quark-gluon interaction. We discuss in particular the similarities among the different transitions as well as the differences induced by SU(3)-isospin symmetry breaking. We furthermore provide estimates for the slopes of the electric and magnetic Σ0 to Λ transitions at the zero photon momentum point.

  14. A regional reconstruction of debris-flow activity in the Northern Calcareous Alps, Austria

    NASA Astrophysics Data System (ADS)

    Procter, Emily; Bollschweiler, Michelle; Stoffel, Markus; Neumann, Mathias

    2011-09-01

    Dendrogeomorphic dating of historical debris-flow events is a highly valuable tool for improving historical records in the field of natural hazard management. Previous dendrogeomorphic investigations generally have focused on case studies of single torrents; however, regional investigations may offer a more accurate reconstruction of regional patterns of activity and therefore may have an advantage over individual cases. The aim of the study is to provide a regional reconstruction of debris-flow events for a site in the Northern Calcareous Alps of western Austria (Gamperdonatal, Vorarlberg) and to document spatial and temporal morphological changes in individual and neighboring torrents. Analysis of 442 trees (268 Pinus mugo ssp. uncinata, 164 Picea abies, and 10 Abies alba) allowed identification of 579 growth disturbances corresponding to 63 debris-flow events since A.D. 1839. The majority of growth disturbances were in the form of growth suppression or release (76%) owing to the nature of both the deposited material and the process characteristics. Regional patterns of event frequency indicated a paucity of activity in the early to mid-twentieth century and increased activity since A.D. 1948, whereby large events were followed by subsequent years of continued activity of smaller magnitude. Patterns of frequency could be attributed primarily to spatiotemporal changes in channel morphology, but may also be reflective of changes in transport conditions within the valley. This study provides the first regional investigation in the Austrian Alps and contributes to the documentation of tree responses to geomorphic disturbances in calcareous material.

  15. Cloud Structure of Three Galactic Infrared Dark Star-forming Regions from Combining Ground- and Space-based Bolometric Observations

    NASA Astrophysics Data System (ADS)

    Lin, Yuxin; Liu, Hauyu Baobab; Dale, James E.; Li, Di; Busquet, Gemma; Zhang, Zhi-Yu; Ginsburg, Adam; Galván-Madrid, Roberto; Kovács, Attila; Koch, Eric; Qian, Lei; Wang, Ke; Longmore, Steve; Chen, Huei-Ru; Walker, Daniel

    2017-05-01

    We have modified the iterative procedure introduced by Lin et al., to systematically combine the submillimeter images taken from ground-based (e.g., CSO, JCMT, APEX) and space (e.g., Herschel, Planck) telescopes. We applied the updated procedure to observations of three well-studied Infrared Dark Clouds (IRDCs): G11.11-0.12, G14.225-0.506, and G28.34+0.06, and then performed single-component, modified blackbody fits to each pixel to derive ˜10″ resolution dust temperature and column density maps. The derived column density maps show that these three IRDCs exhibit complex filamentary structures embedded with rich clumps/cores. We compared the column density probability distribution functions (N-PDFs) and two-point correlation (2PT) functions of the column density field between these IRDCs with several OB-cluster-forming regions. Based on the observed correlation between the luminosity-to-mass ratio and the power-law index of the N-PDF, and complementary hydrodynamical simulations for a 104 {M}⊙ molecular cloud, we hypothesize that cloud evolution can be better characterized by the evolution of the (column) density distribution function and the relative power of dense structures as a function of spatial scales, rather than merely based on the presence of star-forming activity. An important component of our approach is to provide a model-independent quantification of cloud evolution. Based on the small analyzed sample, we propose four evolutionary stages, namely, cloud integration, stellar assembly, cloud pre-dispersal, and dispersed cloud. The initial cloud integration stage and the final dispersed cloud stage may be distinguished from the two intermediate stages by a steeper than -4 power-law index of the N-PDF. The cloud integration stage and the subsequent stellar assembly stage are further distinguished from each other by the larger luminosity-to-mass ratio (>40 {L}⊙ /{M}⊙ ) of the latter. A future large survey of molecular clouds with high angular

  16. Holocene fire activity in the Carpathian region: regional climate vs. local controls

    NASA Astrophysics Data System (ADS)

    Florescu, Gabriela; Feurdean, Angelica

    2015-04-01

    Introduction. Fire drives significant changes in ecosystem structure and function, diversity, species evolution, biomass dynamics and atmospheric composition. Palaeodata and model-based studies have pointed towards a strong connection between fire activity, climate, vegetation and people. Nevertheless, the relative importance of these factors appears to be strongly variable and a better understanding of these factors and their interaction needs a thorough investigation over multiple spatial (local to global) and temporal (years to millennia) scales. In this respect, sedimentary charcoal, associated with other proxies of climate, vegetation and human impact, represents a powerful tool of investigating changes in past fire activity, especially in regions with scarce fire dataset such as the CE Europe. Aim. To increase the spatial and temporal coverage of charcoal records and facilitate a more critical examination of the patterns, drivers and consequences of biomass burning over multiple spatial and temporal scales in CE Europe, we have investigated 6 fossil sequences in the Carpathian region (northern Romania). These are located in different geographical settings, in terms of elevation, vegetation composition, topography and land-use. Specific questions are: i) determine trends in timing and magnitude of fire activity, as well as similarities and differences between elevations; ii) disentangle the importance of regional from local controls in fire activity; iii) evaluate ecological consequences of fire on landscape composition, structure and diversity. Methods. We first determine the recent trends in fire activity (the last 150 years) from charcoal data and compare them with instrumental records of temperature, precipitation, site history and topography for a better understanding of the relationship between sedimentary charcoal and historical fire activity. We then statistically quantify centennial to millennial trends in fire activity (frequency, magnitude) based on

  17. Oscillations In Emerging Active Regions on the Sun

    NASA Astrophysics Data System (ADS)

    Garcia, M. A.; Muglach, K.

    2017-12-01

    Active regions (ARs) on the Sun are directly related to space weather phenomena like flares and coronal mass ejections (CMEs). It is well known that both can have impacts not only on Earth, but also on nearby orbits and beyond. Predicting when and where active regions will emerge at the surface of the Sun would strengthen space weather forecasting abilities. In this study, data from the Solar Dynamics Observatory (SDO) are used to produce images of the magnetic field and Doppler Velocity at the photosphere of the Sun. This data is used to study the emergence of ARs at the surface of the Sun. Since global oscillations that travel through the solar interior are modified by the magnetic field, the oscillation patterns in and around ARs should be different from the oscillation patterns in the quiet, non-active Sun. Thus, a change in oscillation patterns can be determined before an AR is visible at the Sun's surface. Using Fast Fourier Transforms, the oscillation patterns can be calculated from the SDO Dopplergrams. Magnetograms provide the time when the magnetic field of the active region reaches the solar surface. Thus, both the calculated oscillation frequencies and power can be compared to the information of an AR's emergence in the magnetograms. In particular, it can be determined if there is any time delay between the change of oscillation power and magnetic field emergence. For this particular AR studied, it was found that the 5-min oscillation power starts to decrease at the time the AR emerges. The 3-min oscillation power also decreases first but increases again a few hours after the start of the emergence. This observation is probably due to 3-min oscillation power halos around the AR and has been observed before. A few hours before the AR starts to emerge, an increase was found in both 5-min and 3-min oscillation power. This effect is promising, however, it has not been observed before and has to be verified with additional observations.

  18. Soil phosphorus forms and profile distributions in the tidal river network region in the Yellow River Delta estuary.

    PubMed

    Yu, Junbao; Qu, Fanzhu; Wu, Huifeng; Meng, Ling; Du, Siyao; Xie, Baohua

    2014-01-01

    Modified Hedley fraction method was used to study the forms and profile distribution in the tidal river network region subjected to rapid deposition and hydrologic disturbance in the Yellow River Delta (YRD) estuary, eastern China. The results showed that the total P (Pt) ranged from 612.1 to 657.8 mg kg(-1). Dilute HCl extractable inorganic P (Pi) was the predominant form in all profiles, both as absolute values and as a percentage of total extracted Pi. The NaOH extractable organic P (Po) was the predominant form of total extracted Po, while Bicarb-Pi and C.HCl-Po were the lowest fractions of total extracted Pi and Po in all the P forms. The Resin-P concentrations were high in the top soil layer and decreased with depth. The Pearson correlation matrix indicated that Resin-P, Bicarb-Pi, NaOH-Pi, and C.HCl-Pi were strongly positively correlated with salinity, TOC, Ca, Al, and Fe but negatively correlated with pH. The significant correlation of any studied form of organic P (Bicarb-Po, NaOH-Po, and C.HCl-Po) with geochemical properties were not observed in the study. Duncan multiple-range test indicated that the P forms and distribution heterogeneity in the profiles could be attributed to the influences of vegetation cover and hydrologic disturbance.

  19. Soil Phosphorus Forms and Profile Distributions in the Tidal River Network Region in the Yellow River Delta Estuary

    PubMed Central

    Yu, Junbao; Qu, Fanzhu; Wu, Huifeng; Meng, Ling; Du, Siyao; Xie, Baohua

    2014-01-01

    Modified Hedley fraction method was used to study the forms and profile distribution in the tidal river network region subjected to rapid deposition and hydrologic disturbance in the Yellow River Delta (YRD) estuary, eastern China. The results showed that the total P (Pt) ranged from 612.1 to 657.8 mg kg−1. Dilute HCl extractable inorganic P (Pi) was the predominant form in all profiles, both as absolute values and as a percentage of total extracted Pi. The NaOH extractable organic P (Po) was the predominant form of total extracted Po, while Bicarb-Pi and C.HCl-Po were the lowest fractions of total extracted Pi and Po in all the P forms. The Resin-P concentrations were high in the top soil layer and decreased with depth. The Pearson correlation matrix indicated that Resin-P, Bicarb-Pi, NaOH-Pi, and C.HCl-Pi were strongly positively correlated with salinity, TOC, Ca, Al, and Fe but negatively correlated with pH. The significant correlation of any studied form of organic P (Bicarb-Po, NaOH-Po, and C.HCl-Po) with geochemical properties were not observed in the study. Duncan multiple-range test indicated that the P forms and distribution heterogeneity in the profiles could be attributed to the influences of vegetation cover and hydrologic disturbance. PMID:24971393

  20. Extreme ultraviolet spectrum of a solar active region from SERTS

    NASA Technical Reports Server (NTRS)

    Thomas, Roger J.; Neupert, Werner M.

    1994-01-01

    We present wavelengths and absolute intensities for 243 emission lines from a single active region observed by the Solar Extreme Ultraviolet (EUV) Rocket Telescope and Spectrograph (SERTS) on 1989 May 5. For this catalog, the imaged spectra have been spatially averaged over a field of view 7 sec x 276 sec cutting through the center of AR5464 at S18 W45. Wavelength coverage is 170-450 A with a spectral resolution approaching 10,000. Most of the line positions are determined to 5 mA or better, representing the highest accuracy yet obtained for solar wavelengths throughout this spectral interval. The relative photometric calibration of the instrument is good to +/- 20% over its first-order range, and has been placed onto an absolute scale that should be correct to within a factor less than 2. Where known, identifications, atomic transitions and formation temperatures are also given. The identified lines arise from temperatures that cover the range log T greater than or equal to 4.7 and less than or equal to 6.8, providing information about the Sun's corona and upper transition region. Upper limits to the intensity of any emission line not included here can be estimated from the measured instrumental sensitivity. This averaged EUV spectrum should prove useful as a source of accurate wavelengths and intensities for emission characteristic of the high-temperature plasma associated with a solar active region and small subflare.

  1. The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region

    NASA Astrophysics Data System (ADS)

    Belik, Anton; Devyatova, Tatiana; Bozhko, Svetlana; Gorbunova, Yulia

    2016-04-01

    The infield varietu of available forms in the forest-steppe of western part Central Chernozemic region The Central Chernozemic region of Russia has been a region with a strong agricultural industry and determines the food security of the state by most part. The soil cover of the region is represented mainly by chernozems and is favorable for the cultivation of major crops and produce high crop yields. However, the high development of agriculture in the territory of Central Chernozemic region are led to the development of agrogenic degradation processes which impacts on the growth of the soil cover complexity and contrast, and as a consequence a significant infield variety of soil fertility and yields of major crops. In this regard, very promising direction in CChR is the development and practical application technologies of precision agriculture, which implies the spatial variety of soil fertility analysis within specific fields and work areas, especially the content of available forms of nutrients. The aim of our research was a study of the agro-ecological characteristics of the spatial variety of the content by available forms to plants of major nutrients in representative areas of sloping agricultural landscapes with forest-steppe chernozems in the western part of Central Chernozemic region of Russia. The research of infield variety by content of available forms of major nutrients are carried in the fields of Russian Research Institute of Agriculture and Protect the Soil from Erosion experimental and industrial farm in Medvensky district of Kursk region. The area characterized by a complex organization of relief. The soil cover is represented by full-profile typical (conventional and carbonate), leached chernozems. The growth of contrast of the soil cover are largely determined by the appearance of eroded soils of these analogues, as well as zoogenic dug and accumulative soils All of the studied areas with the forest-steppe chernozems were characterized by

  2. Bloom forming and toxic phytoplankton in transitional and coastal waters of Cantabria region coast (Southeastern Bay of Biscay, Spain).

    PubMed

    Seoane, Sergio; Puente, Araceli; Guinda, Xabier; Juanes, Jose Antonio

    2012-12-01

    Phytoplankton monitoring has extended to practically all the regions of the European coast due to the implementation of the European Water Framework Directive. In this way, the study of phytoplankton taxonomic composition and dynamic is being performed in many areas poorly studied or not studied before. During the last years, a monitoring programme has been carried out at the coast of Cantabria region (SE Bay of Biscay); the presence of some potentially toxic and bloom forming species (>7.5 × 10⁵ cells per litre) has been observed. Diatoms and cryptophytes are the main blooming taxa in this region in the majority of the estuaries and in some of the coastal sites. All estuaries and coastal stations showed at least one potentially toxic species, being the dinoflagellates the group with the highest number of taxa observed. The potentially toxic species found in highest concentrations were the genera Pseudo-nitzschia and Chrysochromulina. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Active Region Oscillations: Results from SOHO JOP 097

    NASA Astrophysics Data System (ADS)

    O'Shea, E.; Fleck, B.; Muglach, K.; Sütterlin, P.

    2001-05-01

    We present here an analysis of data obtained in a sunspot region, using the Coronal Diagnostic Spectrometer (CDS) on SOHO. These data were obtained in the context of the Joint Observing Program (JOP) 97 which, together with CDS, included the Michelson Doppler Imaging (MDI) instrument on SOHO, the TRACE satellite and various ground based observatories, e.g. the DOT on La Palma. Using the lines of Fe XVI 335, Mg IX 368, He I 584, O III 599, Mg X 624 and O V 624 of CDS time series data were obtained in the pore and plage regions of sunspots associated with active regions AR 9166, 9166 and 9169 between September 19-29 2000. In addition to the time series datasets we also obtained 240 arcsec x 240 arcsec raster images of the sunspot regions examined. Using different time series analysis techniques we analyse the different periods of oscillation found in time series datasets and present the results here. This research is part of the European Solar Magnetometry Network supported by the EC through the TMR programme.

  4. Differential Expression of Extracellular Lipase and Protease Activities of Mycelial and Yeast Forms in Malassezia furfur.

    PubMed

    Juntachai, Weerapong; Kajiwara, Susumu

    2015-10-01

    Malassezia furfur is a dimorphic yeast that is part of the human skin microflora. This fungus is a pathogen of a certain skin diseases, such as pityriasis versicolor, and in rare cases causes systemic infection in neonates. However, the role of dimorphism in the pathogenicity remains unclear. A modified induction medium (IM) was successfully able to induce mycelial growth of M. furfur under both solid and liquid condition. Filamentous elements with branching hyphae were observed when cultured in the IM. Furthermore, addition of bovine fetus serum into the liquid IM did not promote hyphal formation; on the contrary, it retrograded hyphae to the yeast form. Plate-washing assay showed that M. furfur hyphae did not possess the ability of invasive growth. Secretory proteins from both yeast and hyphal forms were isolated, and lipase and protease activities were analyzed. Intriguingly, the hyphal form showed higher activities than those of the yeast form, particularly the protease activity.

  5. Differential cellulolytic activity of native-form and C-terminal tagged-form cellulase derived from coptotermes formosanus and expressed in E. coli

    USDA-ARS?s Scientific Manuscript database

    The endogenous cellulase gene (CfEG3a) of Coptotermes formosanus, an economically important pest termite, was cloned and overexpressed in both native form (nCfEG) and C-terminal His-tagged form (tCfEG) in E.coli. Both forms of recombinant cellulases showed hydrolytic activity on cellulosic substrate...

  6. Education Technologies in Addressing the Problem of Forming the Socially Active Individual

    ERIC Educational Resources Information Center

    Popova, Irina N.

    2016-01-01

    The article is devoted to the analysis of technological support of the educational process in solving the problem of forming the socially active individual. The authors studied the value of the category "social activity" and analyzed educational technologies that have an impact on its formation. The obtained results gave the possibility…

  7. Effects of Three Forms of Reading-Based Output Activity on L2 Vocabulary Learning

    ERIC Educational Resources Information Center

    Rassaei, Ehsan

    2017-01-01

    The current study investigated the effects of three forms of output activity on EFL learners' recognition and recall of second language (L2) vocabulary. To this end, three groups of learners of English as a foreign language (EFL) were instructed to employ the following three output activities after reading two narrative texts: (1) summarizing the…

  8. Comparing Two Forms of Concept Map Critique Activities to Facilitate Knowledge Integration Processes in Evolution Education

    ERIC Educational Resources Information Center

    Schwendimann, Beat A.; Linn, Marcia C.

    2016-01-01

    Concept map activities often lack a subsequent revision step that facilitates knowledge integration. This study compares two collaborative critique activities using a Knowledge Integration Map (KIM), a form of concept map. Four classes of high school biology students (n?=?81) using an online inquiry-based learning unit on evolution were assigned…

  9. Scientific results and prospects from the 8.2-m Subaru Telescope: star forming regions

    NASA Astrophysics Data System (ADS)

    Hayashi, Masahiko; Sekiguchi, Kazuhiro

    2000-06-01

    This article describes results of the first light observations of the Orion nebular an dL1551 IRS 5 carried out with the Subaru telescope in January 1999. The new RI images of the Orion nebula, taken under the seeing conditions of 0.2 inch-0.5 inch, cover the area of 5 by 5 feet centered on the Trapezium cluster, revealing details of the BN/KL region, the bright bar, and other conspicuous features as well as several new H2 emission sources. There are more than 500 stars detected; most of them are not visible in optical images and are embedded in the molecular cloud behind the nebula. Their K'-band luminosity function confirmed the bump around 12 mag with a tail toward the fainter end of 17 mag. Some of these most faint stars may be good candidates for young brown dwarfs. The J-band image of L1551 IRS 5 revealed a pair of twisted jets emanating possibly from each of the binary protostars. The two jets are spatially resolved for the first time from the ground, with wiggly and knotty appearance similar to the R-band image taken with the Hubble Space Telescope, suggesting that the appearance is intrinsic to them and is not caused due to the spatial variation of extinction. Successive grism spectroscopy proved that the jet emission predominantly arises from the (Fe II) lines.

  10. Structure and chemistry of the high mass star forming region S255 on small scales

    NASA Astrophysics Data System (ADS)

    Zinchenko, I.; Kurtz, S.; Liu, S. Y.; Ojha, D.; Su, Y. N.

    2011-05-01

    S255, a molecular condensation at a distance of about 2 kpc consists of two main components (S255 IR and S255 N) separated by slightly over 1'. Observations by single-dish telescopes inferred dense gas residing in both components suitable for forming massive stars and clusters. We performed observations of these two components with SMA, VLA and GMRT at an angular resolution of a few arc seconds. SMA observations covered broad frequency ranges around 220, 230, 279 and 288 GHz. The continuum emission and about 50 spectral lines from about 20 different species were detected (including N2H+, SiO, DCN, DNC, DCO+, H2CO, HNCO, etc.). VLA observations provide data on NH3 (1,1) and (2,2) while at GMRT we mapped the 610 and 1280 MHz continuum emission. We combine these data to obtain a rather complete picture of this area. Distributions of various molecules are quite different (some maps for S255IR are shown in Fig. 1). Several new clumps are revealed; some of them have no visible counterpart in continuum. In both components high velocity outflows and disk-like structures are present. We estimate physical parameters of the observed objects and discuss their chemistry with an emphasis on N2H+, NH3 and deuterated species.

  11. On the origin of phosphorus nitride in star-forming regions

    NASA Astrophysics Data System (ADS)

    Mininni, C.; Fontani, F.; Rivilla, V. M.; Beltrán, M. T.; Caselli, P.; Vasyunin, A.

    2018-05-01

    We present multitransition observations of phosphorus nitride (PN) towards a sample of nine massive dense cores in different evolutionary stages. Using transitions with different excitation conditions, we have found for the first time that the excitation temperatures of PN are in the range ˜5-30 K. To investigate the main chemical route for the PN formation (surface-chemistry versus gas-phase chemistry), and the dominant desorption mechanism (thermal versus shock), we have compared our results with those obtained from molecules tracing different chemical and physical conditions (SiO, SO, CH3OH, and N2H+). We have found that the PN line profiles are very well correlated with those of SiO and SO in six out of the nine targets, which indicate that PN may be released by sputtering of dust grains due to shocks. This finding is corroborated by a faint but statistically significant positive trend between the PN abundance and those of SiO and SO. However, in three objects the PN lines have no hints of high-velocity wings, which indicates an alternative origin of PN. Overall, our results indicate that the origin of PN is not unique, as it can be formed not only in protostellar shocks, but also in colder and more quiescent gas through alternative pathways.

  12. Theta Frequency Stimulation Induces a Local Form of Late Phase LTP in the CA1 Region of the Hippocampus

    ERIC Educational Resources Information Center

    Huang, Yan-You; Kandel, Eric R.

    2005-01-01

    The late phase of LTP (L-LTP) is typically induced by repeated high-frequency stimulation. This form of LTP requires activation of transcription and translation and results in the cell-wide distribution of gene products that can be captured by other marked synapses. Here we report that theta frequency stimulation (5 Hz, 30 sec) applied to the…

  13. Active tectonics and earthquake potential of the Myanmar region

    NASA Astrophysics Data System (ADS)

    Wang, Yu; Sieh, Kerry; Tun, Soe Thura; Lai, Kuang-Yin; Myint, Than

    2014-04-01

    This paper describes geomorphologic evidence for the principal neotectonic features of Myanmar and its immediate surroundings. We combine this evidence with published structural, geodetic, and seismic data to present an overview of the active tectonic architecture of the region and its seismic potential. Three tectonic systems accommodate oblique collision of the Indian plate with Southeast Asia and extrusion of Asian territory around the eastern syntaxis of the Himalayan mountain range. Subduction and collision associated with the Sunda megathrust beneath and within the Indoburman range and Naga Hills accommodate most of the shortening across the transpressional plate boundary. The Sagaing fault system is the predominant locus of dextral motion associated with the northward translation of India. Left-lateral faults of the northern Shan Plateau, northern Laos, Thailand, and southern China facilitate extrusion of rocks around the eastern syntaxis of the Himalaya. All of these systems have produced major earthquakes within recorded history and continue to present major seismic hazards in the region.

  14. THE EFFECTS OF EPISODIC STAR FORMATION ON THE FUV-NUV COLORS OF STAR FORMING REGIONS IN OUTER DISKS

    SciTech Connect

    Barnes, Kate L.; Van Zee, Liese; Dowell, Jayce D., E-mail: barneskl@astro.indiana.edu, E-mail: vanzee@astro.indiana.edu, E-mail: jdowell@unm.edu

    2013-09-20

    We run stellar population synthesis models to examine the effects of a recently episodic star formation history (SFH) on UV and Hα colors of star forming regions. Specifically, the SFHs we use are an episodic sampling of an exponentially declining star formation rate (SFR; τ model) and are intended to simulate the SFHs in the outer disks of spiral galaxies. To enable comparison between our models and observational studies of star forming regions in outer disks, we include in our models sensitivity limits that are based on recent deep UV and Hα observations in the literature. We find significant dispersionmore » in the FUV-NUV colors of simulated star forming regions with frequencies of star formation episodes of 1 × 10{sup –8} to 4 × 10{sup –9} yr{sup –1}. The dispersion in UV colors is similar to that found in the outer disk of nearby spiral galaxies. As expected, we also find large variations in L{sub H{sub α}}/L{sub FUV}. We interpret our models within the context of inside-out disk growth, and find that a radially increasing τ and decreasing metallicity with an increasing radius will only produce modest FUV-NUV color gradients, which are significantly smaller than what is found for some nearby spiral galaxies. However, including moderate extinction gradients with our models can better match the observations with steeper UV color gradients. We estimate that the SFR at which the number of stars emitting FUV light becomes stochastic is ∼2 × 10{sup –6} M{sub ☉} yr{sup –1}, which is substantially lower than the SFR of many star forming regions in outer disks. Therefore, we conclude that stochasticity in the upper end of the initial mass function is not likely to be the dominant cause of dispersion in the FUV-NUV colors of star forming regions in outer disks. Finally, we note that if outer disks have had an episodic SFH similar to that used in this study, this should be taken into account when estimating gas depletion timescales and modeling

  15. High Spatial Resolution Fe XII Observations of Solar Active Regions

    NASA Astrophysics Data System (ADS)

    Testa, Paola; De Pontieu, Bart; Hansteen, Viggo

    2016-08-01

    We use UV spectral observations of active regions with the Interface Region Imaging Spectrograph (IRIS) to investigate the properties of the coronal Fe xii 1349.4 Å emission at unprecedented high spatial resolution (˜0.33″). We find that by using appropriate observational strategies (I.e., long exposures, lossless compression), Fe xii emission can be studied with IRIS at high spatial and spectral resolution, at least for high-density plasma (e.g., post-flare loops and active region moss). We find that upper transition region (TR; moss) Fe xii emission shows very small average Doppler redshifts ({v}{{D}} ˜ 3 km s-1) as well as modest non-thermal velocities (with an average of ˜24 km s-1 and the peak of the distribution at ˜15 km s-1). The observed distribution of Doppler shifts appears to be compatible with advanced three-dimensional radiative MHD simulations in which impulsive heating is concentrated at the TR footpoints of a hot corona. While the non-thermal broadening of Fe xii 1349.4 Å peaks at similar values as lower resolution simultaneous Hinode Extreme Ultraviolet Imaging Spectrometer (EIS) measurements of Fe xii 195 Å, IRIS observations show a previously undetected tail of increased non-thermal broadening that might be suggestive of the presence of subarcsecond heating events. We find that IRIS and EIS non-thermal line broadening measurements are affected by instrumental effects that can only be removed through careful analysis. Our results also reveal an unexplained discrepancy between observed 195.1/1349.4 Å Fe xii intensity ratios and those predicted by the CHIANTI atomic database.

  16. Precessing Jet and Large Dust Grains in the V380 Ori NE Star-forming Region

    NASA Astrophysics Data System (ADS)

    Choi, Minho; Kang, Miju; Lee, Jeong-Eun; Tatematsu, Ken'ichi; Kang, Sung-Ju; Sayers, Jack; Evans, Neal J., II; Cho, Jungyeon; Kwon, Jungmi; Park, Geumsook; Ohashi, Satoshi; Yoo, Hyunju; Lee, Youngung

    2017-10-01

    The V380 Ori NE bipolar outflow was imaged in the SiO and CO J=1\\to 0 lines, and dense cores in L1641 were observed in the 2.0-0.89 mm continuum. The highly collimated SiO jet shows point-symmetric oscillation patterns in both position and velocity, which suggests that the jet axis is precessing and the driving source may belong to a non-coplanar binary system. By considering the position and velocity variabilities together, accurate jet parameters were derived. The protostellar system is viewed nearly edge-on, and the jet has a flow speed of ˜35 km s-1 and a precession period of ˜1600 years. The CO outflow length gives a dynamical timescale of ˜6300 years, and the protostar must be extremely young. The inferred binary separation of 6-70 au implies that this protobinary system may have been formed through the disk instability process. The continuum spectra of L1641 dense cores indicate that the emission comes from dust, and the fits with modified blackbody functions give emissivity power indices of β = 0.3-2.2. The emissivity index shows a positive correlation with the molecular line width, but no strong correlation with bolometric luminosity or temperature. V380 Ori NE has a particularly low value of β = 0.3, which tentatively suggests the presence of millimeter-sized dust grains. Because the dust growth takes millions of years, much longer than the protostellar age, this core may have produced large grains in the starless core stage. HH 34 MMS and HH 147 MMS also have low emissivity indices.

  17. Ultraviolet spectra of extreme nearby star-forming regions - approaching a local reference sample for JWST

    NASA Astrophysics Data System (ADS)

    Senchyna, Peter; Stark, Daniel P.; Vidal-García, Alba; Chevallard, Jacopo; Charlot, Stéphane; Mainali, Ramesh; Jones, Tucker; Wofford, Aida; Feltre, Anna; Gutkin, Julia

    2017-12-01

    Nearby dwarf galaxies provide a unique laboratory in which to test stellar population models below Z⊙/2. Such tests are particularly important for interpreting the surprising high-ionization ultraviolet (UV) line emission detected at z > 6 in recent years. We present HST/COS UV spectra of 10 nearby metal-poor star-forming galaxies selected to show He II emission in SDSS optical spectra. The targets span nearly a dex in gas-phase oxygen abundance (7.8 < 12 + log O/H < 8.5) and present uniformly large specific star formation rates (sSFR ∼102 Gyr-1). The UV spectra confirm that metal-poor stellar populations can power extreme nebular emission in high-ionization UV lines, reaching C III] equivalent widths comparable to those seen in systems at z ∼ 6-7. Our data reveal a marked transition in UV spectral properties with decreasing metallicity, with systems below 12 + log O/H ≲ 8.0 (Z/Z⊙ ≲ 1/5) presenting minimal stellar wind features and prominent nebular emission in He II and C IV. This is consistent with nearly an order of magnitude increase in ionizing photon production beyond the He+-ionizing edge relative to H-ionizing flux as metallicity decreases below a fifth solar, well in excess of standard stellar population synthesis predictions. Our results suggest that often-neglected sources of energetic radiation such as stripped binary products and very massive O-stars produce a sharper change in the ionizing spectrum with decreasing metallicity than expected. Consequently, nebular emission in C IV and He II powered by these stars may provide useful metallicity constraints in the reionization era.

  18. The Border Health Consortium of the Californias—Forming a Binational (California–Baja California) Entity to Address the Health of a Border Region: A Case Study

    PubMed Central

    Kozo, Justine; Zapata-Garibay, Rogelio; Rangel-Gomez, María Gudelia; Fernandez, April; Hirata-Okamoto, Ricardo; Wooten, Wilma; Vargas-Ojeda, Adriana; Jiménez, Barbara; Zepeda-Cisneros, Hector; Matthews, Charles Edwards

    2018-01-01

    The California–Baja California border region is one of the most frequently traversed areas in the world with a shared population, environment, and health concerns. The Border Health Consortium of the Californias (the “Consortium”) was formed in 2013 to bring together leadership working in the areas of public health, health care, academia, government, and the non-profit sector, with the goal of aligning efforts to improve health outcomes in the region. The Consortium utilizes a Collective Impact framework which supports a shared vision for a healthy border region, mutually reinforcing activities among member organizations and work groups, and a binational executive committee that ensures continuous communication and progress toward meeting its goals. The Consortium is comprised of four binational work groups which address human immunodeficiency virus, tuberculosis, obesity, and mental health, all mutual priorities in the border region. The Consortium holds two general binational meetings each year alternating between California and Baja California. The work groups meet regularly to share information, resources and provide binational training opportunities. Since inception, the Consortium has been successful in strengthening binational communication, coordination, and collaboration by providing an opportunity for individuals to meet one another, learn about each other systems, and foster meaningful relationships. With binational leadership support and commitment, the Consortium could certainly be replicated in other border jurisdictions both nationally and internationally. The present article describes the background, methodology, accomplishments, challenges, and lessons learned in forming the Consortium. PMID:29404318

  19. Implications of Special Regions to Conducting Human Activities on Mars

    NASA Astrophysics Data System (ADS)

    Rummel, J. D.; Barlow, N. G.; Beaty, D. W.; Jones, M. A.; Hipkin, V.

    2014-12-01

    A MEPAG Science Analysis Group (SAG) has undertaken an analysis of Special Regions (SR) on Mars—regions where indigenous martian life could exist or where Earth microbes, if introduced, could survive and reproduce. The SR-SAG has considered the impact of SR on future human activities on the martian surface. Human exploration requires access to in-situ resources, some of which may be found in SR. Water and oxygen for ISRU are found in the atmosphere, surface/near-surface ice, hydrated minerals, and perchlorates. Water ice is most abundant at latitudes poleward of ~60 degrees, but polar darkness, cold temperatures, and CO2 degassing present hazards to human operations in these regions. Accessible water is more limited toward the equator, though temperature and solar energy conditions become more favorable. The possible presence of liquid water in Recurring Slope Lineae and active gullies leads to their treatment as SR. Fuel for surface operations and propellants for crew ascent could be manufactured from the martian atmosphere and surface materials, but dust in the atmosphere may clog ISRU equipment and perchlorate is toxic to humans. Power may be produced from solar or nuclear energy. Reliance on solar energy limits operations to the equatorial zone where easily accessible ice resources are limited. Nuclear power allows surface operations at a range of latitudes, but waste heat could convert some non-SR into SR. Radiation shielding is necessary for long-term human operations on Mars and could be obtained by deposition of regolith or by water storage in tanks or as ice around habitats, or the use of underground habitats. SR-SAG recognizes that it will be impossible for all human-associated processes and operations to be conducted within entirely closed systems. Protocols need to be established so (1) human missions to Mars will not contaminate SR nor be contaminated by materials from them, and (2) human activities on Mars will avoid converting areas into SR.

  20. Temporal evolution of continental lithospheric strength in actively deforming regions

    USGS Publications Warehouse

    Thatcher, W.; Pollitz, F.F.

    2008-01-01

    It has been agreed for nearly a century that a strong, load-bearing outer layer of earth is required to support mountain ranges, transmit stresses to deform active regions and store elastic strain to generate earthquakes. However the dept and extent of this strong layer remain controversial. Here we use a variety of observations to infer the distribution of lithospheric strength in the active western United States from seismic to steady-state time scales. We use evidence from post-seismic transient and earthquake cycle deformation reservoir loading glacio-isostatic adjustment, and lithosphere isostatic adjustment to large surface and subsurface loads. The nearly perfectly elastic behavior of Earth's crust and mantle at the time scale of seismic wave propagation evolves to that of a strong, elastic crust and weak, ductile upper mantle lithosphere at both earthquake cycle (EC, ???10?? to 103 yr) and glacio-isostatic adjustment (GIA, ???103 to 104 yr) time scales. Topography and gravity field correlations indicate that lithosphere isostatic adjustment (LIA) on ???106-107 yr time scales occurs with most lithospheric stress supported by an upper crust overlying a much weaker ductile subtrate. These comparisons suggest that the upper mantle lithosphere is weaker than the crust at all time scales longer than seismic. In contrast, the lower crust has a chameleon-like behavior, strong at EC and GIA time scales and weak for LIA and steady-state deformation processes. The lower crust might even take on a third identity in regions of rapid crustal extension or continental collision, where anomalously high temperatures may lead to large-scale ductile flow in a lower crustal layer that is locally weaker than the upper mantle. Modeling of lithospheric processes in active regions thus cannot use a one-size-fits-all prescription of rheological layering (relation between applied stress and deformation as a function of depth) but must be tailored to the time scale and tectonic

  1. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identifiedmore » in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.« less

  2. New Insights into the Nature of Transition Disks from a Complete Disk Survey of the Lupus Star-forming Region

    NASA Astrophysics Data System (ADS)

    van der Marel, Nienke; Williams, Jonathan P.; Ansdell, M.; Manara, Carlo F.; Miotello, Anna; Tazzari, Marco; Testi, Leonardo; Hogerheijde, Michiel; Bruderer, Simon; van Terwisga, Sierk E.; van Dishoeck, Ewine F.

    2018-02-01

    Transition disks with large dust cavities around young stars are promising targets for studying planet formation. Previous studies have revealed the presence of gas cavities inside the dust cavities, hinting at recently formed, giant planets. However, many of these studies are biased toward the brightest disks in the nearby star-forming regions, and it is not possible to derive reliable statistics that can be compared with exoplanet populations. We present the analysis of 11 transition disks with large cavities (≥20 au radius) from a complete disk survey of the Lupus star-forming region, using ALMA Band 7 observations at 0.″3 (22–30 au radius) resolution of the 345 GHz continuum, 13CO and C18O 3–2 observations, and the spectral energy distribution of each source. Gas and dust surface density profiles are derived using the physical–chemical modeling code DALI. This is the first study of transition disks of large cavities within a complete disk survey within a star-forming region. The dust cavity sizes range from 20 to 90 au radius, and in three cases, a gas cavity is resolved as well. The deep drops in gas density and large dust cavity sizes are consistent with clearing by giant planets. The fraction of transition disks with large cavities in Lupus is ≳ 11 % , which is inconsistent with exoplanet population studies of giant planets at wide orbits. Furthermore, we present a hypothesis of an evolutionary path for large massive disks evolving into transition disks with large cavities.

  3. 15N fractionation in star-forming regions and Solar System objects

    NASA Astrophysics Data System (ADS)

    Wirström, Eva; Milam, Stefanie; Adande, Gilles; Charnley, Steven B.; Cordiner, Martin A.

    2015-08-01

    A central issue for understanding the formation and evolution of matter in the early Solar System is the relationship between the chemical composition of star-forming interstellar clouds and that of primitive Solar System materials. The pristine molecular content of comets, interplanetary dust particles and carbonaceous chondrites show significant bulk nitrogen isotopic fractionation relative to the solar value, 14N/15N ~ 440. In addition, high spatial resolution measurements in primitive materials locally show even more extreme enhancements of 14N/15N < 100.The coherent 15N enrichment in comets from different formation zones suggests that these isotopic enhancements are remnants of the interstellar chemistry in the natal molecular cloud core and the outer protosolar nebula. Indeed, early chemical models of gas-phase ion-molecule nitrogen fractionation showed that HCN and HNC (nitriles) can hold significant 15N enrichments in cold dark clouds where CO is depleted onto dust grains. In addition, 15N fractionation in nitriles and amines (NH2, NH3) follow different chemical pathways. More recently we have shown that once the spin-state dependence in rates of reactions with H2 is included in the models, amines can either be enhanced or depleted in 15N, depending on the core’s evolutionary stage. Observed 15N fractionation in amines and nitriles therefore cannot be expected to be the same, instead their ratio is a potential chemical clock.Observations of molecular isotope ratios in dark cores are challenging. Limited published results in general show higher 15N/14N ratios in HCN and HNC than ammonia, but more measurements are necessary to confirm these trends. We will present recent results from our ongoing observing campaign of 14N/15N isotopic ratios in HCN, HNC and NH3 in dense cores and protostars which seem consistent with significant fractionation in nitriles as compared to other molecules in each object. The few 14N/15N ratios observed in N2H+ are similar to

  4. Chromospheric Evolution and the Flare Activity of Super-Active Region NOAA 6555

    NASA Technical Reports Server (NTRS)

    PrasadC, Debi; Ambastha, Ashok; Srivastava, Nandita; Tripathy, Sushanta C.; Hagyard, Mona J.

    1997-01-01

    Super-active region NOAA 6555 was highly flare productive during the period March 21st - 27th, 1991 of its disk passage. We have studied its chromospheric activity using high spatial resolution H alpha filtergrams taken at Udaipur along with MSFC vector magnetograms. A possible relationship of flare productivity and the variation in shear has been explored. Flares were generally seen in those subareas of the active region which possessed closed magnetic field configuration, whereas only minor flares and/or surges occurred in subareas showing open magnetic field configuration. Physical mechanisms responsible for the observed surges are also discussed.

  5. Effects of external radiation fields on line emission—application to star-forming regions

    SciTech Connect

    Chatzikos, Marios; Ferland, G. J.; Williams, R. J. R.

    2013-12-20

    A variety of astronomical environments contain clouds irradiated by a combination of isotropic and beamed radiation fields. For example, molecular clouds may be irradiated by the isotropic cosmic microwave background, as well as by a nearby active galactic nucleus. These radiation fields excite atoms and molecules and produce emission in different ways. We revisit the escape probability theorem and derive a novel expression that accounts for the presence of external radiation fields. We show that when the field is isotropic the escape probability is reduced relative to that in the absence of external radiation. This is in agreement with previousmore » results obtained under ad hoc assumptions or with the two-level system, but can be applied to complex many-level models of atoms or molecules. This treatment is in the development version of the spectral synthesis code CLOUDY. We examine the spectrum of a Spitzer cloud embedded in the local interstellar radiation field and show that about 60% of its emission lines are sensitive to background subtraction. We argue that this geometric approach could provide an additional tool toward understanding the complex radiation fields of starburst galaxies.« less

  6. Plasma Beta Above a Solar Active Region: Rethinking the Paradigm

    NASA Technical Reports Server (NTRS)

    Gary, G. Allen; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    In this paper, we present a model of the plasma beta above an active region and discuss its consequences in terms of coronal magnetic field modeling. The beta-plasma model is representative and derived from a collection of sources. The resulting beta variation with height is used to emphasize the assumption that the magnetic pressure dominates over the plasma pressure must be carefully considered depending on what part of the solar atmosphere is being considered. This paper points out (1) that the paradigm that the coronal magnetic field can be constructed from a force-free magnetic field must be used in the correct context, since the forcefree region is sandwiched between two regions which have beta greater than 1, (2) that the chromospheric MgIICIV magnetic measurements occur near the beta-minimum, and (3) that, moving from the photosphere upwards, beta can return to 1 at relatively low coronal heights, e.g. R approximately 1.2R(sub)s.

  7. Magnetized Converging Flows toward the Hot Core in the Intermediate/High-mass Star-forming Region NGC 6334 V

    SciTech Connect

    Juárez, Carmen; Girart, Josep M.; Zamora-Avilés, Manuel

    2017-07-20

    We present Submillimeter Array (SMA) observations at 345 GHz toward the intermediate/high-mass cluster-forming region NGC 6334 V. From the dust emission we spatially resolve three dense condensations, the brightest one presenting the typical chemistry of a hot core. The magnetic field (derived from the dust polarized emission) shows a bimodal converging pattern toward the hot core. The molecular emission traces two filamentary structures at two different velocities, separated by 2 km s{sup −1}, converging to the hot core and following the magnetic field distribution. We compare the velocity field and the magnetic field derived from the SMA observations with magnetohydrodynamicmore » simulations of star-forming regions dominated by gravity. This comparison allows us to show how the gas falls in from the larger-scale extended dense core (∼0.1 pc) of NGC 6334 V toward the higher-density hot core region (∼0.02 pc) through two distinctive converging flows dragging the magnetic field, whose strength seems to have been overcome by gravity.« less

  8. Self-Reported Physical Activity Among American Indian Adults From Two Diverse Regions.

    PubMed

    Roberts, Erica Blue; Fleischhacker, Sheila; Pardilla, Marla; Treuth, Margarita; Gadhoke, Preety; Christiansen, Karina; Gittelsohn, Joel

    2016-01-01

    Physical activity may be a protective factor against the disproportionate rates of chronic diseases faced by American Indians. Nevertheless, few studies report any cultural adoptions made to capture physical activity behaviors among this hard-to-reach population. Existing studies reporting the prevalence of physical activity among American Indians are often aggregated and tend to obscure regional, local, and tribal-level variations. This study examines the prevalence of physical activity and inactivity levels, along with associated factors, among rural dwelling American Indian adults from 2 distinct regions. Baseline self-reported data were collected using a culturally modified version of the International Physical Activity Questionnaire (IPAQ) short form during the Obesity Research Prevention and Evaluation of Intervention Effectiveness in Native North Americans trial (OPREVENT) among rural American Indian adults (aged 18-75 years) from 5 tribal communities in Michigan and New Mexico. Most participants were classified as moderately physically active (43.5%), and the majority reported access to physical activity facilities (83.5%). Michigan participants reported engaging in more moderate and total physical activity than those in New Mexico (P < .001) and reported spending less time sitting (P < .001). Differences in physical activity among the American Indian communities may be due to regional variations in occupations, climate, and tribal and community support and infrastructure. The unexpected high level of activity evokes uncertainty in the accuracy and appropriateness of the data collection instrument. Research is needed to understand culturally appropriate approaches to measure physical activity and inactivity among rural American Indians. © 2015 National Rural Health Association.

  9. ACTIVE REGION FILAMENTS MIGHT HARBOR WEAK MAGNETIC FIELDS

    SciTech Connect

    Díaz Baso, C. J.; Martínez González, M. J.; Asensio Ramos, A., E-mail: cdiazbas@iac.es

    2016-05-01

    Recent spectropolarimetric observations of active region filaments have revealed polarization profiles with signatures typical of the strong field Zeeman regime. The conspicuous absence in those observations of scattering polarization and Hanle effect signatures was then pointed out by some authors. This was interpreted as either a signature of mixed “turbulent” field components or as a result of optical thickness. In this article, we present a natural scenario to explain these Zeeman-only spectropolarimetric observations of active region (AR) filaments. We propose a two-component model, one on top of the other. Both components have horizontal fields, with the azimuth difference between themmore » being close to 90°. The component that lies lower in the atmosphere is permeated by a strong field of the order of 600 G, while the upper component has much weaker fields, of the order of 10 G. The ensuing scattering polarization signatures of the individual components have opposite signs, so its combination along the line of sight reduces—and even can cancel out—the Hanle signatures, giving rise to an apparent Zeeman-only profile. This model is also applicable to other chromospheric structures seen in absorption above ARs.« less

  10. THE MAGNETIC CLASSIFICATION OF SOLAR ACTIVE REGIONS 1992–2015

    SciTech Connect

    Jaeggli, S. A.; Norton, A. A., E-mail: sarah.jaeggli@nasa.gov

    2016-03-20

    The purpose of this Letter is to address a blindspot in our knowledge of solar active region (AR) statistics. To the best of our knowledge, there are no published results showing the variation of the Mount Wilson magnetic classifications as a function of solar cycle based on modern observations. We show statistics for all ARs reported in the daily Solar Region Summary from 1992 January 1 to 2015 December 31. We find that the α and β class ARs (including all sub-groups, e.g., βγ, βδ) make up fractions of approximately 20% and 80% of the sample, respectively. This fraction ismore » relatively constant during high levels of activity; however, an increase in the α fraction to about 35% and and a decrease in the β fraction to about 65% can be seen near each solar minimum and are statistically significant at the 2σ level. Over 30% of all ARs observed during the years of solar maxima were appended with the classifications γ and/or δ, while these classifications account for only a fraction of a percent during the years near the solar minima. This variation in the AR types indicates that the formation of complex ARs may be due to the pileup of frequent emergence of magnetic flux during solar maximum, rather than the emergence of complex, monolithic flux structures.« less

  11. 75 FR 16492 - Agency Information Collection Activities: Form G-28, and Form G-28I, Revision of an Existing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-01

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... Attorney. OMB Control No. 1615-0105. The Department of Homeland Security, U.S. Citizenship and Immigration... of Homeland Security sponsoring the collection: Form G-28, and Form G-28I. U.S. Citizenship and...

  12. 76 FR 27077 - Agency Information Collection Activities: Form AR-11 and Form AR-11SR, Extension of an Existing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-10

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information.... Citizenship and Immigration Services (USCIS) will be submitting the following information collection request... Homeland Security sponsoring this collection: Form AR-11 and Form AR-11SR. U.S. Citizenship and Immigration...

  13. 76 FR 25364 - Agency Information Collection Activities: Form I-864, Form I-864A, Form I-864EZ, and From I-864W...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-04

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... Household Member, Form I-864 EZ, Affidavit of Support Under Section 213A of the Act; Form I-864W, Intending..., U.S. Citizenship and Immigration Services (USCIS) will be submitting the following information...

  14. Interaction of neuropeptidase activities in cortico-limbic regions after acute restraint stress.

    PubMed

    Hernández, Joaquín; Prieto, Isabel; Segarra, Ana B; de Gasparo, Marc; Wangensteen, Rosemary; Villarejo, Ana B; Banegas, Inmaculada; Vives, Francisco; Cobo, Justo; Ramírez-Sánchez, Manuel

    2015-01-01

    Brain enkephalin, vasopressin and oxytocin are anxiolytic agents involved in the stress response. Acute restraint stress influences certain neuropeptidase activities, such as some enkephalin-degrading peptidases and vasopressinase/oxytocinase, in the medial prefrontal cortex (mPFC), amygdala (AM) or hippocampus (HC), which are involved in this response. Because these regions form a unified circuit and cooperate in their response to stress, it is important to analyze the profile of the regional distribution of these activities as well as their inter-regional model of interaction in this circuit. Regarding the regional study, although most activities showed a marked predominance of the AM over the HC and mPFC, both in control and stressed animals, enkephalin-degrading activity, assayed as membrane-bound alanyl aminopeptidase activity, showed a change after stress, increasing in the HC and decreasing in the AM. The correlational study in controls indicated essentially a positive interaction between the mPFC and AM. In marked contrast, there was a highly significant change in the functional status of this circuit after stress, showing mainly a positive correlation between the mPFC and HC and between the AM and HC. The existence of correlations does not demonstrate a direct relationship between regions. However, reasons for such strong associations after restraint stress should be examined. The present study may indicate a connection between neuropeptidase activities and their corresponding neuropeptidergic substrates due to significant changes in the functional status of the cortico-limbic circuit after restraint stress. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  15. The Proline/Glycine-Rich Region of the Biofilm Adhesion Protein Aap Forms an Extended Stalk that Resists Compaction.

    PubMed

    Yarawsky, Alexander E; English, Lance R; Whitten, Steven T; Herr, Andrew B

    2017-01-20

    Staphylococcus epidermidis is one of the primary bacterial species responsible for healthcare-associated infections. The most significant virulence factor for S. epidermidis is its ability to form a biofilm, which renders the bacteria highly resistant to host immune responses and antibiotic action. Intercellular adhesion within the biofilm is mediated by the accumulation-associated protein (Aap), a cell wall-anchored protein that self-assembles in a zinc-dependent manner. The C-terminal portion of Aap contains a 135-aa-long, proline/glycine-rich region (PGR) that has not yet been characterized. The region contains a set of 18 nearly identical AEPGKP repeats. Analysis of the PGR using biophysical techniques demonstrated the region is a highly extended, intrinsically disordered polypeptide with unusually high polyproline type II helix propensity. In contrast to many intrinsically disordered polypeptides, there was a minimal temperature dependence of the global conformational state of PGR in solution as measured by analytical ultracentrifugation and dynamic light scattering. Furthermore, PGR was resistant to conformational collapse or α-helix formation upon the addition of the osmolyte trimethylamine N-oxide or the cosolvent 2,2,2-trifluoroethanol. Collectively, these results suggest PGR functions as a resilient, extended stalk that projects the rest of Aap outward from the bacterial cell wall, promoting intercellular adhesion between cells in the biofilm. This work sheds light on regions of low complexity often found near the attachment point of bacterial cell wall-anchored proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Can regional strain and strain rate measurement be performed during both dobutamine and exercise echocardiography, and do regional deformation responses differ with different forms of stress testing?

    PubMed

    Davidavicius, Giedrius; Kowalski, Miroslaw; Williams, R Ian; D'hooge, Jan; Di Salvo, Giovanni; Pierre-Justin, Gilbert; Claus, Piet; Rademakers, Frank; Herregods, Marie-Christine; Fraser, Alan G; Pierard, Luc A; Bijnens, Bart; Sutherland, George R

    2003-04-01

    Regional strain (epsilon) and strain rate (SR) measurement could be the optimal approach to quantifying stress echocardiography images. However, signal noise could preclude their use. Study aims Our aim was to compare the feasibility of regional peak systolic (p) velocity (Vel), pSR/epsilon measurement, and their normal responses during upright (group 1, n = 10) and supine (group 2, n = 10) bicycle exercise and (group 3, n = 10) dobutamine stress. For each type of stress study, pVel/pSR/epsilon data were acquired at baseline, low (100-120 bpm), and peak (140-160 bpm) heart rate (HR); and during recovery. During dobutamine pVel/pSR/epsilon were interpretable in >95% of segments at every stress stage, whereas in groups 1 and 2 pSR/epsilon responses were noninterpretable in >36% of segments (P <.0002). The highest proportions of data exclusions were from the lateral and anterior walls. In all groups, regional systolic pVel and SR values increased linearly and reached maximal value at peak HR (P <.0006 vs baseline). Pepsilon showed a biphasic response, initially increasing at low HR, and then remaining constant or falling at peak HR. PSR/pepsilon quantification of stress echocardiography may currently be restricted to dobutamine as increased signal noise precludes adequate data acquisition during exercise. For all forms of stress both pSR and pVel increased linearly, whereas pepsilon response was biphasic as a result of the reduced filling at higher HRs.

  17. Synthesis of Catalytically Active Form III Ribulose 1,5-Bisphosphate Carboxylase/Oxygenase in Archaea

    PubMed Central

    Finn, Michael W.; Tabita, F. Robert

    2003-01-01

    Ribulose 1,5 bisphosphate carboxylase/oxygenase (RubisCO) catalyzes the biological reduction and assimilation of carbon dioxide gas to organic carbon; it is the key enzyme responsible for the bulk of organic matter found on earth. Until recently it was believed that there are only two forms of RubisCO, form I and form II. However, the recent completion of several genome-sequencing projects uncovered open reading frames resembling RubisCO in the third domain of life, the archaea. Previous work and homology comparisons suggest that these enzymes represent a third form of RubisCO, form III. While earlier work indicated that two structurally distinct recombinant archaeal RubisCO proteins catalyzed bona fide RubisCO reactions, it was not established that the rbcL genes of anaerobic archaea can be transcribed and translated to an active enzyme in the native organisms. In this report, it is shown not only that Methanococcus jannaschii, Archaeoglobus fulgidus, Methanosarcina acetivorans, and Methanosarcina barkeri possess open reading frames with the residues required for catalysis but also that the RubisCO protein from these archaea accumulates in an active form under normal growth conditions. In addition, the form III RubisCO gene (rbcL) from M. acetivorans was shown to complement RubisCO deletion strains of Rhodobacter capsulatus and Rhodobacter sphaeroides under both photoheterotrophic and photoautotrophic growth conditions. These studies thus indicate for the first time that archaeal form III RubisCO functions in a physiologically significant fashion to fix CO2. Furthermore, recombinant M. jannaschii, M. acetivorans, and A. fulgidus RubisCO possess unique properties with respect to quaternary structure, temperature optima, and activity in the presence of molecular oxygen compared to the previously described Thermococcus kodakaraensis and halophile proteins. PMID:12730164

  18. Synthesis of catalytically active form III ribulose 1,5-bisphosphate carboxylase/oxygenase in archaea.

    PubMed

    Finn, Michael W; Tabita, F Robert

    2003-05-01

    Ribulose 1,5 bisphosphate carboxylase/oxygenase (RubisCO) catalyzes the biological reduction and assimilation of carbon dioxide gas to organic carbon; it is the key enzyme responsible for the bulk of organic matter found on earth. Until recently it was believed that there are only two forms of RubisCO, form I and form II. However, the recent completion of several genome-sequencing projects uncovered open reading frames resembling RubisCO in the third domain of life, the archaea. Previous work and homology comparisons suggest that these enzymes represent a third form of RubisCO, form III. While earlier work indicated that two structurally distinct recombinant archaeal RubisCO proteins catalyzed bona fide RubisCO reactions, it was not established that the rbcL genes of anaerobic archaea can be transcribed and translated to an active enzyme in the native organisms. In this report, it is shown not only that Methanococcus jannaschii, Archaeoglobus fulgidus, Methanosarcina acetivorans, and Methanosarcina barkeri possess open reading frames with the residues required for catalysis but also that the RubisCO protein from these archaea accumulates in an active form under normal growth conditions. In addition, the form III RubisCO gene (rbcL) from M. acetivorans was shown to complement RubisCO deletion strains of Rhodobacter capsulatus and Rhodobacter sphaeroides under both photoheterotrophic and photoautotrophic growth conditions. These studies thus indicate for the first time that archaeal form III RubisCO functions in a physiologically significant fashion to fix CO(2). Furthermore, recombinant M. jannaschii, M. acetivorans, and A. fulgidus RubisCO possess unique properties with respect to quaternary structure, temperature optima, and activity in the presence of molecular oxygen compared to the previously described Thermococcus kodakaraensis and halophile proteins.

  19. Repetitive Transcranial Magnetic Stimulation Activates Specific Regions in Rat Brain

    NASA Astrophysics Data System (ADS)

    Ji, Ru-Rong; Schlaepfer, Thomas E.; Aizenman, Carlos D.; Epstein, Charles M.; Qiu, Dike; Huang, Justin C.; Rupp, Fabio

    1998-12-01

    Repetitive transcranial magnetic stimulation (rTMS) is a noninvasive technique to induce electric currents in the brain. Although rTMS is being evaluated as a possible alternative to electroconvulsive therapy for the treatment of refractory depression, little is known about the pattern of activation induced in the brain by rTMS. We have compared immediate early gene expression in rat brain after rTMS and electroconvulsive stimulation, a well-established animal model for electroconvulsive therapy. Our result shows that rTMS applied in conditions effective in animal models of depression induces different patterns of immediate-early gene expression than does electroconvulsive stimulation. In particular, rTMS evokes strong neural responses in the paraventricular nucleus of the thalamus (PVT) and in other regions involved in the regulation of circadian rhythms. The response in PVT is independent of the orientation of the stimulation probe relative to the head. Part of this response is likely because of direct activation, as repetitive magnetic stimulation also activates PVT neurons in brain slices.

  20. Gas versus solid-phase deuterated chemistry: HDCO and D2CO in massive star-forming regions

    NASA Astrophysics Data System (ADS)

    Zahorecz, S.; Jimenez-Serra, I.; Testi, L.; Immer, K.; Fontani, F.; Caselli, P.; Wang, K.; Toth, L. V.

    2017-06-01

    Context. The formation of deuterated molecules is favoured at low temperatures and high densities. Therefore, the deuteration fraction (Dfrac) is expected to be enhanced in cold, dense prestellar cores and to decrease after protostellar birth. Previous studies have shown that the deuterated forms of species such as N2H+ (formed in the gas phase) and CH3OH (formed on grain surfaces) can be used as evolutionary indicators and to constrain their dominant formation processes and timescales. Aims: Formaldehyde (H2CO) and its deuterated forms can be produced both in the gas phase and on grain surfaces. However, the relative importance of these two chemical pathways is unclear. Comparison of the deuteration fraction of H2CO with respect to that of N2H+, NH3, and CH3OH can help us to understand its formation processes and timescales. Methods: With the new SEPIA Band 5 receiver on APEX, we have observed the J = 3 → 2 rotational lines of HDCO and D2CO at 193 GHz and 175 GHz toward three massive star-forming regions hosting objects at different evolutionary stages: two high-mass starless cores (HMSC), two high-mass protostellar objects (HMPOs), and one ultracompact HII region (UC HII). By using previously obtained H2CO J = 3 → 2 data, the deuteration fractions HDCO/H2CO and D2CO/HDCO are estimated. Results: Our observations show that singly deuterated H2CO is detected toward all sources and that the deuteration fraction of H2CO increases from the HMSC to the HMPO phase and then sharply decreases in the latest evolutionary stage (UCHII). The doubly deuterated form of H2CO is detected only in the earlier evolutionary stages, with D2CO/H2CO showing a pattern that is qualitatively consistent with the pattern of HDCO/H2CO, within current uncertainties. Conclusions: Our initial results show that H2CO may display a similar Dfrac pattern as that of CH3OH in massive young stellar objects. This finding suggests that solid-state reactions dominate its formation.

  1. Ages of calderas, large explosive craters and active volcanoes in the Kuril-Kamchatka region, Russia

    NASA Astrophysics Data System (ADS)

    Braitseva, O. A.; Melekestsev, I. V.; Ponomareva, V. V.; Sulerzhitsky, L. D.

    1995-12-01

    The ages of most of calderas, large explosive craters and active volcanoes in the Kuril-Kamchatka region have been determined by extensive geological, geomorphological, tephrochronological and isotopic geochronological studies, including more than 600 14C dates. Eight ‘Krakatoa-type’ and three ‘Hawaiian-type’ calderas and no less than three large explosive craters formed here during the Holocene. Most of the Late Pleistocene Krakatoa-type calderas were established around 30 000 40 000 years ago. The active volcanoes are geologically very young, with maximum ages of about 40 000 50 000 years. The overwhelming majority of recently active volcanic cones originated at the very end of the Late Pleistocene or in the Holocene. These studies show that all Holocene stratovolcanoes in Kamchatka were emplaced in the Holocene only in the Eastern volcanic belt. Periods of synchronous, intensified Holocene volcanic activity occurred within the time intervals of 7500 7800 and 1300 1800 14C years BP.

  2. Socioeconomic and regional differences in active transportation in Brazil.

    PubMed

    Sá, Thiago Hérick de; Pereira, Rafael Henrique Moraes; Duran, Ana Clara; Monteiro, Carlos Augusto

    2016-06-27

    To present national estimates regarding walking or cycling for commuting in Brazil and in 10 metropolitan regions. By using data from the Health section of 2008's Pesquisa Nacional por Amostra de Domicílio (Brazil's National Household Sample Survey), we estimated how often employed people walk or cycle to work, disaggregating our results by sex, age range, education level, household monthly income per capita, urban or rural address, metropolitan regions, and macro-regions in Brazil. Furthermore, we estimated the distribution of this same frequency according to quintiles of household monthly income per capita in each metropolitan region of the country. A third of the employed men and women walk or cycle from home to work in Brazil. For both sexes, this share decreases as income and education levels rise, and it is higher among younger individuals, especially among those living in rural areas and in the Northeast region of the country. Depending on the metropolitan region, the practice of active transportation is two to five times more frequent among low-income individuals than among high-income individuals. Walking or cycling to work in Brazil is most frequent among low-income individuals and the ones living in less economically developed areas. Active transportation evaluation in Brazil provides important information for public health and urban mobility policy-making. Apresentar estimativas nacionais sobre o deslocamento a pé ou de bicicleta no trajeto casa-trabalho no Brasil e em 10 de suas regiões metropolitanas. Utilizando dados do Suplemento sobre Saúde da Pesquisa Nacional por Amostra de Domicílios de 2008, estimamos a frequência de pessoas empregadas que se deslocam a pé ou de bicicleta no trajeto casa-trabalho estratificada por sexo, e segundo faixa etária, escolaridade, renda domiciliar per capita, residência em área urbana ou rural, regiões metropolitanas e macrorregiões do país. Adicionalmente, estimamos a distribuição da mesma frequ

  3. Active macromolecules of honey form colloidal particles essential for honey antibacterial activity and hydrogen peroxide production.

    PubMed

    Brudzynski, Katrina; Miotto, Danielle; Kim, Linda; Sjaarda, Calvin; Maldonado-Alvarez, Liset; Fukś, Henryk

    2017-08-09

    Little is known about the global structure of honey and the arrangement of its main macromolecules. We hypothesized that the conditions in ripened honeys resemble macromolecular crowding in the cell and affect the concentration, reactivity, and conformation of honey macromolecules. Combined results from UV spectroscopy, DLS and SEM showed that the concentration of macromolecules was a determining factor in honey structure. The UV spectral scans in 200-400 nm visualized and allowed quantification of UV-absorbing compounds in the following order: dark > medium > light honeys (p < 0.0001). The high concentration of macromolecules promoted their self-assembly to micron-size superstructures, visible in SEM as two-phase system consisting of dense globules distributed in sugar solution. These particles showed increased conformational stability upon dilution. At the threshold concentration, the system underwent phase transition with concomitant fragmentation of large micron-size particles to nanoparticles in hierarchical order. Honey two-phase conformation was an essential requirement for antibacterial activity and hydrogen peroxide production. These activities disappeared beyond the phase transition point. The realization that active macromolecules of honey are arranged into compact, stable multicomponent assemblies with colloidal properties reframes our view on global structure of honey and emerges as a key property to be considered in investigating its biological activity.

  4. Process for forming a homogeneous oxide solid phase of catalytically active material

    DOEpatents

    Perry, Dale L.; Russo, Richard E.; Mao, Xianglei

    1995-01-01

    A process is disclosed for forming a homogeneous oxide solid phase reaction product of catalytically active material comprising one or more alkali metals, one or more alkaline earth metals, and one or more Group VIII transition metals. The process comprises reacting together one or more alkali metal oxides and/or salts, one or more alkaline earth metal oxides and/or salts, one or more Group VIII transition metal oxides and/or salts, capable of forming a catalytically active reaction product, in the optional presence of an additional source of oxygen, using a laser beam to ablate from a target such metal compound reactants in the form of a vapor in a deposition chamber, resulting in the deposition, on a heated substrate in the chamber, of the desired oxide phase reaction product. The resulting product may be formed in variable, but reproducible, stoichiometric ratios. The homogeneous oxide solid phase product is useful as a catalyst, and can be produced in many physical forms, including thin films, particulate forms, coatings on catalyst support structures, and coatings on structures used in reaction apparatus in which the reaction product of the invention will serve as a catalyst.

  5. SIGN SINGULARITY AND FLARES IN SOLAR ACTIVE REGION NOAA 11158

    SciTech Connect

    Sorriso-Valvo, L.; De Vita, G.; Kazachenko, M. D.

    2015-03-01

    Solar Active Region NOAA 11158 has hosted a number of strong flares, including one X2.2 event. The complexity of current density and current helicity are studied through cancellation analysis of their sign-singular measure, which features power-law scaling. Spectral analysis is also performed, revealing the presence of two separate scaling ranges with different spectral index. The time evolution of parameters is discussed. Sudden changes of the cancellation exponents at the time of large flares and the presence of correlation with Extreme-Ultra-Violet and X-ray flux suggest that eruption of large flares can be linked to the small-scale properties of the current structures.

  6. On the modified active region design of interband cascade lasers

    SciTech Connect

    Motyka, M.; Ryczko, K.; Dyksik, M.

    2015-02-28

    Type II InAs/GaInSb quantum wells (QWs) grown on GaSb or InAs substrates and designed to be integrated in the active region of interband cascade lasers (ICLs) emitting in the mid infrared have been investigated. Optical spectroscopy, combined with band structure calculations, has been used to probe their electronic properties. A design with multiple InAs QWs has been compared with the more common double W-shaped QW and it has been demonstrated that it allows red shifting the emission wavelength and enhancing the transition oscillator strength. This can be beneficial for the improvements of the ICLs performances, especially when considering their long-wavelengthmore » operation.« less

  7. Insights from Synthetic Star-forming Regions. II. Verifying Dust Surface Density, Dust Temperature, and Gas Mass Measurements with Modified Blackbody Fitting

    NASA Astrophysics Data System (ADS)

    Koepferl, Christine M.; Robitaille, Thomas P.; Dale, James E.

    2017-11-01

    We use a large data set of realistic synthetic observations (produced in Paper I of this series) to assess how observational techniques affect the measurement physical properties of star-forming regions. In this part of the series (Paper II), we explore the reliability of the measured total gas mass, dust surface density and dust temperature maps derived from modified blackbody fitting of synthetic Herschel observations. We find from our pixel-by-pixel analysis of the measured dust surface density and dust temperature a worrisome error spread especially close to star formation sites and low-density regions, where for those “contaminated” pixels the surface densities can be under/overestimated by up to three orders of magnitude. In light of this, we recommend to treat the pixel-based results from this technique with caution in regions with active star formation. In regions of high background typical in the inner Galactic plane, we are not able to recover reliable surface density maps of individual synthetic regions, since low-mass regions are lost in the far-infrared background. When measuring the total gas mass of regions in moderate background, we find that modified blackbody fitting works well (absolute error: + 9%; -13%) up to 10 kpc distance (errors increase with distance). Commonly, the initial images are convolved to the largest common beam-size, which smears contaminated pixels over large areas. The resulting information loss makes this commonly used technique less verifiable as now χ 2 values cannot be used as a quality indicator of a fitted pixel. Our control measurements of the total gas mass (without the step of convolution to the largest common beam size) produce similar results (absolute error: +20%; -7%) while having much lower median errors especially for the high-mass stellar feedback phase. In upcoming papers (Paper III; Paper IV) of this series we test the reliability of measured star formation rate with direct and indirect techniques.

  8. The transcriptionally active regions in the genome of Bacillus subtilis.

    PubMed

    Rasmussen, Simon; Nielsen, Henrik Bjørn; Jarmer, Hanne

    2009-09-01

    The majority of all genes have so far been identified and annotated systematically through in silico gene finding. Here we report the finding of 3662 strand-specific transcriptionally active regions (TARs) in the genome of Bacillus subtilis by the use of tiling arrays. We have measured the genome-wide expression during mid-exponential growth on rich (LB) and minimal (M9) medium. The identified TARs account for 77.3% of the genes as they are currently annotated and additionally we find 84 putative non-coding RNAs (ncRNAs) and 127 antisense transcripts. One ncRNA, ncr22, is predicted to act as a translational control on cstA and an antisense transcript was observed opposite the housekeeping sigma factor sigA. Through this work we have discovered a long conserved 3' untranslated region (UTR) in a group of membrane-associated genes that is predicted to fold into a large and highly stable secondary structure. One of the genes having this tail is efeN, which encodes a target of the twin-arginine translocase (Tat) protein translocation system.

  9. Microstructure and kinematics of H2O masers in the massive star-forming region IRAS 06061+2151

    NASA Astrophysics Data System (ADS)

    Motogi, K.; Watanabe, Y.; Sorai, K.; Habe, A.; Honma, M.; Imai, H.; Yamauchi, A.; Kobayashi, H.; Fujisawa, K.; Omodaka, T.; Takaba, H.; Shibata, K. M.; Minamidani, T.; Wakamatsu, K.; Sudou, H.; Kawai, E.; Koyama, Y.

    2008-10-01

    We have made multi-epoch very long baseline interferometer (VLBI) observations of H2O maser emission in the massive star-forming region IRAS 06061+2151 with the Japanese VLBI network (JVN) from 2005 May to 2007 October. The detected maser features are distributed within a 1 × 1 arcsec2 area (2000 × 2000 au2 at the source position) around the ultracompact HII region seen in radio continuum emission. The bipolar morphology and expanding motion traced through their relative proper motions indicate that they are excited by an energetic bipolar outflow. Our three-dimensional model fitting has shown that the maser kinematical structure in IRAS 06061+2151 can be explained by a biconical outflow with a large opening angle (>50°). The position angle of the flow major axis coincides very well with that of the large-scale jet seen in 2.1 μm hydrogen emission. This maser geometry indicates the existence of dual structures composed of a collimated jet and a less collimated massive molecular flow. We have also detected a large velocity gradient in the southern maser group. This can be explained by a very small (on a scale of several tens of astronomical units) and clumpy (the density contrast by an order of magnitude or more) structure of the parental cloud. Such a structure may be formed by strong instability of the shock front or splitting of the high density core.

  10. X-RAY AND RADIO OBSERVATIONS OF THE MASSIVE STAR-FORMING REGION IRAS 20126+4104

    SciTech Connect

    Montes, V. A.; Hofner, P.; Anderson, C.

    2015-08-15

    We present results from Chandra ACIS-I and Karl G. Jansky Very Large Array 6 cm continuum observations of the IRAS 20126+4104 massive star-forming region. We detect 150 X-ray sources within the 17′ × 17′ ACIS-I field, and a total of 13 radio sources within the 9.′2 primary beam at 4.9 GHz. Among these observtions are the first 6 cm detections of the central sources reported by Hofner et al., namely, I20N1, I20S, and I20var. A new variable radio source is also reported. Searching the 2MASS archive, we identified 88 near-infrared (NIR) counterparts to the X-ray sources. Only four of the X-raymore » sources had 6 cm counterparts. Based on an NIR color–color analysis and on the Besançon simulation of Galactic stellar populations, we estimate that approximately 80 X-ray sources are associated with this massive star-forming region. We detect an increasing surface density of X-ray sources toward the massive protostar and infer the presence of a cluster of at least 43 young stellar objects within a distance of 1.2 pc from the massive protostar.« less

  11. 76 FR 17426 - Agency Information Collection Activities: Application for Waiver of Passport and/or Visa (Form I...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-29

    ... Activities: Application for Waiver of Passport and/or Visa (Form I-193) AGENCY: U.S. Customs and Border... Visa (Form I-193). This request for comment is being made pursuant to the Paperwork Reduction Act of... Number: 1651-0107. Form Number: CBP Form I-193. Abstract: The data collected on CBP Form I-193...

  12. PROCESS FOR THE PRODUCTION OF AN ACTIVATED FORM OF UO$sub 2$

    DOEpatents

    Polissar, M.J.

    1957-09-24

    A process for producing a highly active form of UO/sub 2/ characterized both by rapid oxidation in air and by rapid chlorination with CCl/sub 4/ vapor at an elevated temperature is reported. In accordance with the process, commercial UO/sub 2/, is subjected to a series of oxidation-reduction operations to produce a form of UC/sub 2/ of enhanced reactivity. By treatimg commercial UO/sub 2/ at a temperature between 335 and 485 deg C with methane, then briefly with an oxygen containing gas and followimg this by a second treatment with a methane containing gas, the original relatively stable charge of UO/sub 2/ will be transformed into an active form of UO/sub 2/.

  13. 75 FR 21623 - Commission Information Collection Activities (FERC Form Nos. 6 and 6-Q); Comment Request...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-26

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket Nos. IC10-6-001 and IC10-6Q-001] Commission Information Collection Activities (FERC Form Nos. 6 and 6-Q); Comment Request; Submitted for OMB Review April 19, 2010. AGENCY: Federal Energy Regulatory Commission. ACTION: Notice. SUMMARY: In...

  14. 78 FR 28820 - Commission Information Collection Activities (FERC Form 80); Comment Request; Revision

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-16

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. IC13-14-000] Commission Information Collection Activities (FERC Form 80); Comment Request; Revision AGENCY: Federal Energy Regulatory... Paperwork Reduction Act of 1995, 44 U.S.C. 3506(c)(2)(A), the Federal Energy Regulatory Commission...

  15. 78 FR 52824 - Proposed Information Collection (Bowel and Bladder Care Billing Form) Activity: Comment Request

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-26

    ... and Bladder Care Billing Form) Activity: Comment Request AGENCY: Veterans Health Administration.... This notice solicits comments on the information needed to evaluate the Bowel and Bladder Care Billing... specifically to bowel and bladder care. DATES: Written comments and recommendations on the proposed collection...

  16. 75 FR 71452 - Agency Information Collection Activities: Customs Declaration (Form 6059B)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-23

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Customs and Border Protection Agency Information Collection Activities: Customs Declaration (Form 6059B) AGENCY: U.S. Customs and Border Protection, Department of... collection: 1651-0009. SUMMARY: U.S. Customs and Border Protection (CBP) of the Department of Homeland...

  17. 75 FR 57480 - Agency Information Collection Activities: Customs Declaration (Form 6059B)

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-21

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Customs And Border Protection Agency Information Collection Activities: Customs Declaration (Form 6059B) AGENCY: U.S. Customs and Border Protection (CBP), Department of... requirement concerning the Customs Declaration. This request for comment is being made pursuant to the...

  18. 78 FR 63487 - Agency Information Collection Activities: Petition for a Nonimmigrant Worker, Form I-129...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-24

    ...-0009] Agency Information Collection Activities: Petition for a Nonimmigrant Worker, Form I-129; Revision of a Currently Approved Collection ACTION: 30-Day notice. SUMMARY: The Department of Homeland... published in the Federal Register on July 5, 2013, at 78 FR 40490, allowing for a 60-day public comment...

  19. 78 FR 26647 - Agency Information Collection Activities: Application To Replace Permanent Resident Card, Form I...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-07

    ...-0082] Agency Information Collection Activities: Application To Replace Permanent Resident Card, Form I-90, Revision of a Currently Approved Collection ACTION: 60-Day Notice. SUMMARY: The Department of... other Federal agencies to comment on this proposed revision of a currently approved collection. In...

  20. 78 FR 40490 - Agency Information Collection Activities: Petition for a Nonimmigrant Worker, Form I-129...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-05

    ...-0009] Agency Information Collection Activities: Petition for a Nonimmigrant Worker, Form I-129; Revision of a Currently Approved Collection ACTION: 60-Day Notice. * * * * * SUMMARY: The Department of... other Federal agencies to comment on this proposed revision of a currently approved collection of...