Science.gov

Sample records for active regulatory elements

  1. Peak-valley-peak pattern of histone modifications delineates active regulatory elements and their directionality.

    PubMed

    Pundhir, Sachin; Bagger, Frederik O; Lauridsen, Felicia B; Rapin, Nicolas; Porse, Bo T

    2016-05-19

    Formation of nucleosome free region (NFR) accompanied by specific histone modifications at flanking nucleosomes is an important prerequisite for enhancer and promoter activity. Due to this process, active regulatory elements often exhibit a distinct shape of histone signal in the form of a peak-valley-peak (PVP) pattern. However, different features of PVP patterns and their robustness in predicting active regulatory elements have never been systematically analyzed. Here, we present PARE, a novel computational method that systematically analyzes the H3K4me1 or H3K4me3 PVP patterns to predict NFRs. We show that NFRs predicted by H3K4me1 and me3 patterns are associated with active enhancers and promoters, respectively. Furthermore, asymmetry in the height of peaks flanking the central valley can predict the directionality of stable transcription at promoters. Using PARE on ChIP-seq histone modifications from four ENCODE cell lines and four hematopoietic differentiation stages, we identified several enhancers whose regulatory activity is stage specific and correlates positively with the expression of proximal genes in a particular stage. In conclusion, our results demonstrate that PVP patterns delineate both the histone modification landscape and the transcriptional activities governed by active enhancers and promoters, and therefore can be used for their prediction. PARE is freely available at http://servers.binf.ku.dk/pare. PMID:27095194

  2. Peak-valley-peak pattern of histone modifications delineates active regulatory elements and their directionality

    PubMed Central

    Pundhir, Sachin; Bagger, Frederik O.; Lauridsen, Felicia B.; Rapin, Nicolas; Porse, Bo T.

    2016-01-01

    Formation of nucleosome free region (NFR) accompanied by specific histone modifications at flanking nucleosomes is an important prerequisite for enhancer and promoter activity. Due to this process, active regulatory elements often exhibit a distinct shape of histone signal in the form of a peak-valley-peak (PVP) pattern. However, different features of PVP patterns and their robustness in predicting active regulatory elements have never been systematically analyzed. Here, we present PARE, a novel computational method that systematically analyzes the H3K4me1 or H3K4me3 PVP patterns to predict NFRs. We show that NFRs predicted by H3K4me1 and me3 patterns are associated with active enhancers and promoters, respectively. Furthermore, asymmetry in the height of peaks flanking the central valley can predict the directionality of stable transcription at promoters. Using PARE on ChIP-seq histone modifications from four ENCODE cell lines and four hematopoietic differentiation stages, we identified several enhancers whose regulatory activity is stage specific and correlates positively with the expression of proximal genes in a particular stage. In conclusion, our results demonstrate that PVP patterns delineate both the histone modification landscape and the transcriptional activities governed by active enhancers and promoters, and therefore can be used for their prediction. PARE is freely available at http://servers.binf.ku.dk/pare. PMID:27095194

  3. Quantitative comparison of cis-regulatory element (CRE) activities in transgenic Drosophila melanogaster.

    PubMed

    Rogers, William A; Williams, Thomas M

    2011-01-01

    Gene expression patterns are specified by cis-regulatory element (CRE) sequences, which are also called enhancers or cis-regulatory modules. A typical CRE possesses an arrangement of binding sites for several transcription factor proteins that confer a regulatory logic specifying when, where, and at what level the regulated gene(s) is expressed. The full set of CREs within an animal genome encodes the organism's program for development, and empirical as well as theoretical studies indicate that mutations in CREs played a prominent role in morphological evolution. Moreover, human genome wide association studies indicate that genetic variation in CREs contribute substantially to phenotypic variation. Thus, understanding regulatory logic and how mutations affect such logic is a central goal of genetics. Reporter transgenes provide a powerful method to study the in vivo function of CREs. Here a known or suspected CRE sequence is coupled to heterologous promoter and coding sequences for a reporter gene encoding an easily observable protein product. When a reporter transgene is inserted into a host organism, the CRE's activity becomes visible in the form of the encoded reporter protein. P-element mediated transgenesis in the fruit fly species Drosophila (D.) melanogaster has been used for decades to introduce reporter transgenes into this model organism, though the genomic placement of transgenes is random. Hence, reporter gene activity is strongly influenced by the local chromatin and gene environment, limiting CRE comparisons to being qualitative. In recent years, the phiC31 based integration system was adapted for use in D. melanogaster to insert transgenes into specific genome landing sites. This capability has made the quantitative measurement of gene and, relevant here, CRE activity feasible. The production of transgenic fruit flies can be outsourced, including phiC31-based integration, eliminating the need to purchase expensive equipment and/or have proficiency at

  4. Prediction and Validation of Gene Regulatory Elements Activated During Retinoic Acid Induced Embryonic Stem Cell Differentiation.

    PubMed

    Simandi, Zoltan; Horvath, Attila; Nagy, Peter; Nagy, Laszlo

    2016-01-01

    Embryonic development is a multistep process involving activation and repression of many genes. Enhancer elements in the genome are known to contribute to tissue and cell-type specific regulation of gene expression during the cellular differentiation. Thus, their identification and further investigation is important in order to understand how cell fate is determined. Integration of gene expression data (e.g., microarray or RNA-seq) and results of chromatin immunoprecipitation (ChIP)-based genome-wide studies (ChIP-seq) allows large-scale identification of these regulatory regions. However, functional validation of cell-type specific enhancers requires further in vitro and in vivo experimental procedures. Here we describe how active enhancers can be identified and validated experimentally. This protocol provides a step-by-step workflow that includes: 1) identification of regulatory regions by ChIP-seq data analysis, 2) cloning and experimental validation of putative regulatory potential of the identified genomic sequences in a reporter assay, and 3) determination of enhancer activity in vivo by measuring enhancer RNA transcript level. The presented protocol is detailed enough to help anyone to set up this workflow in the lab. Importantly, the protocol can be easily adapted to and used in any cellular model system. PMID:27403939

  5. Transcription of Mammalian cis-Regulatory Elements Is Restrained by Actively Enforced Early Termination.

    PubMed

    Austenaa, Liv M I; Barozzi, Iros; Simonatto, Marta; Masella, Silvia; Della Chiara, Giulia; Ghisletti, Serena; Curina, Alessia; de Wit, Elzo; Bouwman, Britta A M; de Pretis, Stefano; Piccolo, Viviana; Termanini, Alberto; Prosperini, Elena; Pelizzola, Mattia; de Laat, Wouter; Natoli, Gioacchino

    2015-11-01

    Upon recruitment to active enhancers and promoters, RNA polymerase II (Pol II) generates short non-coding transcripts of unclear function. The mechanisms that control the length and the amount of ncRNAs generated by cis-regulatory elements are largely unknown. Here, we show that the adaptor protein WDR82 and its associated complexes actively limit such non-coding transcription. WDR82 targets the SET1 H3K4 methyltransferases and the nuclear protein phosphatase 1 (PP1) complexes to the initiating Pol II. WDR82 and PP1 also interact with components of the transcriptional termination and RNA processing machineries. Depletion of WDR82, SET1, or the PP1 subunit required for its nuclear import caused distinct but overlapping transcription termination defects at highly expressed genes and active enhancers and promoters, thus enabling the increased synthesis of unusually long ncRNAs. These data indicate that transcription initiated from cis-regulatory elements is tightly coordinated with termination mechanisms that impose the synthesis of short RNAs. PMID:26593720

  6. Identification of active transcriptional regulatory elements from GRO-seq data.

    PubMed

    Danko, Charles G; Hyland, Stephanie L; Core, Leighton J; Martins, Andre L; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G; Kraus, W Lee; Lis, John T; Siepel, Adam

    2015-05-01

    Modifications to the global run-on and sequencing (GRO-seq) protocol that enrich for 5'-capped RNAs can be used to reveal active transcriptional regulatory elements (TREs) with high accuracy. Here, we introduce discriminative regulatory-element detection from GRO-seq (dREG), a sensitive machine learning method that uses support vector regression to identify active TREs from GRO-seq data without requiring cap-based enrichment (https://github.com/Danko-Lab/dREG/). This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Predicted TREs are more enriched for several marks of transcriptional activation—including expression quantitative trait loci, disease-associated polymorphisms, acetylated histone 3 lysine 27 (H3K27ac) and transcription factor binding—than those identified by alternative functional assays. Using dREG, we surveyed TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  7. Putative cis-Regulatory Elements Associated with Heat Shock Genes Activated During Excystation of Cryptosporidium parvum

    PubMed Central

    Lara, Ana M.; Serrano, Myrna; Sheth, Nihar; Buck, Gregory

    2010-01-01

    Background Cryptosporidiosis is a ubiquitous infectious disease, caused by the protozoan parasites Cryptosporidium hominis and C. parvum, leading to acute, persistent and chronic diarrhea worldwide. Although the complications of this disease can be serious, even fatal, in immunocompromised patients of any age, they have also been found to lead to long term effects, including growth inhibition and impaired cognitive development, in infected immunocompetent children. The Cryptosporidium life cycle alternates between a dormant stage, the oocyst, and a highly replicative phase that includes both asexual vegetative stages as well as sexual stages, implying fine genetic regulatory mechanisms. The parasite is extremely difficult to study because it cannot be cultured in vitro and animal models are equally challenging. The recent publication of the genome sequence of C. hominis and C. parvum has, however, significantly advanced our understanding of the biology and pathogenesis of this parasite. Methodology/Principal Findings Herein, our goal was to identify cis-regulatory elements associated with heat shock response in Cryptosporidium using a combination of in silico and real time RT-PCR strategies. Analysis with Gibbs-Sampling algorithms of upstream non-translated regions of twelve genes annotated as heat shock proteins in the Cryptosporidium genome identified a highly conserved over-represented sequence motif in eleven of them. RT-PCR analyses, described herein and also by others, show that these eleven genes bearing the putative element are induced concurrent with excystation of parasite oocysts via heat shock. Conclusions/Significance Our analyses suggest that occurrences of a motif identified in the upstream regions of the Cryptosporidium heat shock genes represent parts of the transcriptional apparatus and function as stress response elements that activate expression of these genes during excystation, and possibly at other stages in the life cycle of the parasite

  8. Quantitative Analysis of Cis-Regulatory Element Activity Using Synthetic Promoters in Transgenic Plants.

    PubMed

    Benn, Geoffrey; Dehesh, Katayoon

    2016-01-01

    Synthetic promoters, introduced stably or transiently into plants, are an invaluable tool for the identification of functional regulatory elements and the corresponding transcription factor(s) that regulate the amplitude, spatial distribution, and temporal patterns of gene expression. Here, we present a protocol describing the steps required to identify and characterize putative cis-regulatory elements. These steps include application of computational tools to identify putative elements, construction of a synthetic promoter upstream of luciferase, identification of transcription factors that regulate the element, testing the functionality of the element introduced transiently and/or stably into the species of interest followed by high-throughput luciferase screening assays, and subsequent data processing and statistical analysis. PMID:27557758

  9. De novo DNA demethylation and noncoding transcription define active intergenic regulatory elements.

    PubMed

    Schlesinger, Felix; Smith, Andrew D; Gingeras, Thomas R; Hannon, Gregory J; Hodges, Emily

    2013-10-01

    Deep sequencing of mammalian DNA methylomes has uncovered a previously unpredicted number of discrete hypomethylated regions in intergenic space (iHMRs). Here, we combined whole-genome bisulfite sequencing data with extensive gene expression and chromatin-state data to define functional classes of iHMRs, and to reconstruct the dynamics of their establishment in a developmental setting. Comparing HMR profiles in embryonic stem and primary blood cells, we show that iHMRs mark an exclusive subset of active DNase hypersensitive sites (DHS), and that both developmentally constitutive and cell-type-specific iHMRs display chromatin states typical of distinct regulatory elements. We also observe that iHMR changes are more predictive of nearby gene activity than the promoter HMR itself, and that expression of noncoding RNAs within the iHMR accompanies full activation and complete demethylation of mature B cell enhancers. Conserved sequence features corresponding to iHMR transcript start sites, including a discernible TATA motif, suggest a conserved, functional role for transcription in these regions. Similarly, we explored both primate-specific and human population variation at iHMRs, finding that while enhancer iHMRs are more variable in sequence and methylation status than any other functional class, conservation of the TATA box is highly predictive of iHMR maintenance, reflecting the impact of sequence plasticity and transcriptional signals on iHMR establishment. Overall, our analysis allowed us to construct a three-step timeline in which (1) intergenic DHS are pre-established in the stem cell, (2) partial demethylation of blood-specific intergenic DHSs occurs in blood progenitors, and (3) complete iHMR formation and transcription coincide with enhancer activation in lymphoid-specified cells. PMID:23811145

  10. De novo DNA demethylation and noncoding transcription define active intergenic regulatory elements

    PubMed Central

    Schlesinger, Felix; Smith, Andrew D.; Gingeras, Thomas R.; Hannon, Gregory J.; Hodges, Emily

    2013-01-01

    Deep sequencing of mammalian DNA methylomes has uncovered a previously unpredicted number of discrete hypomethylated regions in intergenic space (iHMRs). Here, we combined whole-genome bisulfite sequencing data with extensive gene expression and chromatin-state data to define functional classes of iHMRs, and to reconstruct the dynamics of their establishment in a developmental setting. Comparing HMR profiles in embryonic stem and primary blood cells, we show that iHMRs mark an exclusive subset of active DNase hypersensitive sites (DHS), and that both developmentally constitutive and cell-type-specific iHMRs display chromatin states typical of distinct regulatory elements. We also observe that iHMR changes are more predictive of nearby gene activity than the promoter HMR itself, and that expression of noncoding RNAs within the iHMR accompanies full activation and complete demethylation of mature B cell enhancers. Conserved sequence features corresponding to iHMR transcript start sites, including a discernible TATA motif, suggest a conserved, functional role for transcription in these regions. Similarly, we explored both primate-specific and human population variation at iHMRs, finding that while enhancer iHMRs are more variable in sequence and methylation status than any other functional class, conservation of the TATA box is highly predictive of iHMR maintenance, reflecting the impact of sequence plasticity and transcriptional signals on iHMR establishment. Overall, our analysis allowed us to construct a three-step timeline in which (1) intergenic DHS are pre-established in the stem cell, (2) partial demethylation of blood-specific intergenic DHSs occurs in blood progenitors, and (3) complete iHMR formation and transcription coincide with enhancer activation in lymphoid-specified cells. PMID:23811145

  11. Activation of Sterol Regulatory Element Binding Factors by Fenofibrate and Gemfibrozil Stimulates Myelination in Zebrafish

    PubMed Central

    Ashikawa, Yoshifumi; Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio

    2016-01-01

    Oligodendrocytes are major myelin-producing cells and play essential roles in the function of a healthy nervous system. However, they are also one of the most vulnerable neural cell types in the central nervous system (CNS), and myelin abnormalities in the CNS are found in a wide variety of neurological disorders, including multiple sclerosis, adrenoleukodystrophy, and schizophrenia. There is an urgent need to identify small molecular weight compounds that can stimulate myelination. In this study, we performed comparative transcriptome analysis to identify pharmacodynamic effects common to miconazole and clobetasol, which have been shown to stimulate myelination by mouse oligodendrocyte progenitor cells (OPCs). Of the genes differentially expressed in both miconazole- and clobetasol-treated mouse OPCs compared with untreated cells, we identified differentially expressed genes (DEGs) common to both drug treatments. Gene ontology analysis revealed that these DEGs are significantly associated with the sterol biosynthetic pathway, and further bioinformatics analysis suggested that sterol regulatory element binding factors (SREBFs) might be key upstream regulators of the DEGs. In silico screening of a public database for chemicals associated with SREBF activation identified fenofibrate, a peroxisome proliferator-activated receptor α (PPARα) agonist, as a drug that increases the expression of known SREBF targets, raising the possibility that fenofibrate may also stimulate myelination. To test this, we performed in vivo imaging of zebrafish expressing a fluorescent reporter protein under the control of the myelin basic protein (mbp) promoter. Treatment of zebrafish with fenofibrate significantly increased expression of the fluorescent reporter compared with untreated zebrafish. This increase was attenuated by co-treatment with fatostatin, a specific inhibitor of SREBFs, confirming that the fenofibrate effect was mediated via SREBFs. Furthermore, incubation of zebrafish

  12. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  13. Multiple cis Regulatory Elements Control RANTES Promoter Activity in Alveolar Epithelial Cells Infected with Respiratory Syncytial Virus

    PubMed Central

    Casola, Antonella; Garofalo, Roberto P.; Haeberle, Helene; Elliott, Todd F.; Lin, Rongtuan; Jamaluddin, Mohammad; Brasier, Allan R.

    2001-01-01

    Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part through its ability to induce chemokine synthesis in infected airway epithelial cells. RANTES (regulated upon activation, normally T-cell expressed and presumably secreted) is a CC chemokine which recruits and activates monocytes, lymphocytes, and eosinophils, all cell types present in the lung inflammatory infiltrate induced by RSV infection. In this study, we analyzed the mechanism of RSV-induced RANTES promoter activation in human type II alveolar epithelial cells (A549 cells). Promoter deletion and mutagenesis experiments indicate that RSV requires the presence of five different cis regulatory elements, located in the promoter fragment spanning from −220 to +55 nucleotides, corresponding to NF-κB, C/EBP, Jun/CREB/ATF, and interferon regulatory factor (IRF) binding sites. Although site mutations of the NF-κB, C/EBP, and CREB/AP-1 like sites reduce RSV-induced RANTES gene transcription to 50% or less, only mutations affecting IRF binding completely abolish RANTES inducibility. Supershift and microaffinity isolation assays were used to identify the different transcription factor family members whose DNA binding activity was RSV inducible. Expression of dominant negative mutants of these transcription factors further established their central role in virus-induced RANTES promoter activation. Our finding that the presence of multiple cis regulatory elements is required for full activation of the RANTES promoter in RSV-infected alveolar epithelial cells supports the enhanceosome model for RANTES gene transcription, which is absolutely dependent on binding of IRF transcription factors. The identification of regulatory mechanisms of RANTES gene expression is fundamental for rational design of inhibitors of RSV-induced lung inflammation. PMID:11413310

  14. Transcriptional Regulatory Elements in Fungal Secondary Metabolism

    PubMed Central

    Yin, Wenbing; Keller, Nancy P.

    2013-01-01

    Filamentous fungi produce a variety of secondary metabolites of diverse beneficial and detrimental activities to humankind. The genes encoding the enzymatic machinery required to make these metabolites are typically clustered in fungal genomes. There is considerable evidence that secondary metabolite gene regulation is, in part, by transcriptional control through hierarchical levels of transcriptional regulatory elements involved in secondary metabolite cluster regulation. Identification of secondary metabolism regulatory elements could potentially provide a means of increasing production of beneficial metabolites, decreasing production of detrimental metabolites, aid in the identification of ‘silent’ natural products and also contribute to a broader understanding of molecular mechanisms by which secondary metabolites are produced. This review summarizes regulation of secondary metabolism associated on transcriptional regulatory elements from a broad view as well as tremendous advances in discovery of cryptic or novel secondary metabolites by genomic mining in the basis of this knowledge. PMID:21717315

  15. Piperine Induces Hepatic Low-Density Lipoprotein Receptor Expression through Proteolytic Activation of Sterol Regulatory Element-Binding Proteins

    PubMed Central

    Ochiai, Ayasa; Miyata, Shingo; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2015-01-01

    Elevated plasma low-density lipoprotein (LDL) cholesterol is considered as a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) uptakes plasma lipoproteins and lowers plasma LDL cholesterol, the activation of LDLR is a promising drug target for atherosclerosis. In the present study, we identified the naturally occurring alkaloid piperine, as an inducer of LDLR gene expression by screening the effectors of human LDLR promoter. The treatment of HepG2 cells with piperine increased LDLR expression at mRNA and protein levels and stimulated LDL uptake. Subsequent luciferase reporter gene assays revealed that the mutation of sterol regulatory element-binding protein (SREBP)-binding element abolished the piperine-mediated induction of LDLR promoter activity. Further, piperine treatments increased mRNA levels of several SREBP targets and mature forms of SREBPs. However, the piperine-mediated induction of the mature forms of SREBPs was not observed in SRD–15 cells, which lack insulin-induced gene–1 (Insig–1) and Insig–2. Finally, the knockdown of SREBPs completely abolished the piperine-meditated induction of LDLR gene expression in HepG2 cells, indicating that piperine stimulates the proteolytic activation of SREBP and subsequent induction of LDLR expression and activity. PMID:26431033

  16. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation*

    PubMed Central

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2015-01-01

    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome. PMID:26140926

  17. Two regulatory elements of similar structure and placed in tandem account for the repressive activity of the first intron of the human apolipoprotein A-II gene.

    PubMed Central

    Bossu, J P; Chartier, F L; Fruchart, J C; Auwerx, J; Staels, B; Laine, B

    1996-01-01

    Recent reports indicate that apolipoprotein (apo) A-II, the second most abundant protein of high-density lipoproteins, plays a crucial role in counteracting the beneficial effect of apo A-I against atherogenesis. Transcription of the human apo A-II gene is controlled by an enhancer comprising 14 regulatory elements located upstream of its promoter whereas the first intron of this gene behaves as a silencer. Here we show that two sequence elements account for the repressive activity of this intron and correspond to negative regulatory elements termed NRE I and NRE II. The activity of intron I and the nuclear proteins binding to NRE I and II are encountered in hepatic cells but not in non-hepatic cells studied here. Both NREs form nucleoprotein complexes of very similar physicochemical characteristics and bind the same or closely related proteins. Site-directed mutagenesis, transient transfection and gel-shift analysis experiments indicate that both NREs exhibit similar structures, being composed of two sites required for maximal activity and optimal binding of transcription factors. Therefore two negative regulatory elements of similar structure and function, placed in tandem, account for the repressive activity of the first intron of the human apo A-II gene. These NREs do not exhibit structural similarity with known NREs of other genes. PMID:8809045

  18. Identifying Synonymous Regulatory Elements in Vertebrate Genomes

    SciTech Connect

    Ovcharenko, I; Nobrega, M A

    2005-02-07

    Synonymous gene regulation, defined as driving shared temporal and/or spatial expression of groups of genes, is likely predicated on genomic elements that contain similar modules of certain transcription factor binding sites (TFBS). We have developed a method to scan vertebrate genomes for evolutionary conserved modules of TFBS in a predefined configuration, and created a tool, named SynoR that identify synonymous regulatory elements (SREs) in vertebrate genomes. SynoR performs de novo identification of SREs utilizing known patterns of TFBS in active regulatory elements (REs) as seeds for genome scans. Layers of multiple-species conservation allow the use of differential phylogenetic sequence conservation filters in the search of SREs and the results are displayed as to provide an extensive annotation of genes containing detected REs. Gene Ontology categories are utilized to further functionally classify the identified genes, and integrated GNF Expression Atlas 2 data allow the cataloging of tissue-specificities of the predicted SREs. We illustrate how this new tool can be used to establish a linkage between human diseases and noncoding genomic content. SynoR is publicly available at http://synor.dcode.org.

  19. A method for using direct injection of plasmid DNA to study cis-regulatory element activity in F0 Xenopus embryos and tadpoles.

    PubMed

    Wang, Chen; Szaro, Ben G

    2015-02-01

    The ability to express exogenous reporter genes in intact, externally developing embryos, such as Xenopus, is a powerful tool for characterizing the activity of cis-regulatory gene elements during development. Although methods exist for generating transgenic Xenopus lines, more simplified methods for use with F0 animals would significantly speed the characterization of these elements. We discovered that injecting 2-cell stage embryos with a plasmid bearing a ϕC31 integrase-targeted attB element and two dual β-globin HS4 insulators flanking a reporter transgene in opposite orientations relative to each other yielded persistent expression with sufficiently high penetrance for characterizing the activity of the promoter without having to coinject integrase RNA. Expression began appropriately during development and persisted into swimming tadpole stages without perturbing the expression of the cognate endogenous gene. Coinjected plasmids having the same elements but expressing different reporter proteins were reliably coexpressed within the same cells, providing a useful control for variations in injections between animals. To overcome the high propensity of these plasmids to undergo recombination, we developed a method for generating them using conventional cloning methods and DH5α cells for propagation. We conclude that this method offers a convenient and reliable way to evaluate the activity of cis-regulatory gene elements in the intact F0 embryo. PMID:25448690

  20. Uncovering drug-responsive regulatory elements

    PubMed Central

    Luizon, Marcelo R; Ahituv, Nadav

    2016-01-01

    Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224

  1. EPAct Transportation Regulatory Activities

    SciTech Connect

    2011-11-21

    The U.S. Department of Energy's (DOE) Vehicle Technologies Program manages several transportation regulatory activities established by the Energy Policy Act of 1992 (EPAct), as amended by the Energy Conservation Reauthorization Act of 1998, EPAct 2005, and the Energy Independence and Security Act of 2007 (EISA).

  2. p75 Neurotrophin Receptor Signaling Activates Sterol Regulatory Element-binding Protein-2 in Hepatocyte Cells via p38 Mitogen-activated Protein Kinase and Caspase-3.

    PubMed

    Pham, Dan Duc; Do, Hai Thi; Bruelle, Céline; Kukkonen, Jyrki P; Eriksson, Ove; Mogollón, Isabel; Korhonen, Laura T; Arumäe, Urmas; Lindholm, Dan

    2016-05-13

    Nerve growth factor (NGF) influences the survival and differentiation of a specific population of neurons during development, but its role in non-neuronal cells has been less studied. We observed here that NGF and its pro-form, pro-NGF, are elevated in fatty livers from leptin-deficient mice compared with controls, concomitant with an increase in low density lipoprotein receptors (LDLRs). Stimulation of mouse primary hepatocytes with NGF or pro-NGF increased LDLR expression through the p75 neurotrophin receptor (p75NTR). Studies using Huh7 human hepatocyte cells showed that the neurotrophins activate the sterol regulatory element-binding protein-2 (SREBP2) that regulates genes involved in lipid metabolism. The mechanisms for this were related to stimulation of p38 mitogen-activated protein kinase (p38 MAPK) and activation of caspase-3 and SREBP2 cleavage following NGF and pro-NGF stimulations. Cell fractionation experiments showed that caspase-3 activity was increased particularly in the membrane fraction that harbors SREBP2 and caspase-2. Experiments showed further that caspase-2 interacts with pro-caspase-3 and that p38 MAPK reduced this interaction and caused caspase-3 activation. Because of the increased caspase-3 activity, the cells did not undergo cell death following p75NTR stimulation, possibly due to concomitant activation of nuclear factor-κB (NF-κB) pathway by the neurotrophins. These results identify a novel signaling pathway triggered by ligand-activated p75NTR that via p38 MAPK and caspase-3 mediate the activation of SREBP2. This pathway may regulate LDLRs and lipid uptake particularly after injury or during tissue inflammation accompanied by an increased production of growth factors, including NGF and pro-NGF. PMID:26984409

  3. Rationales for regulatory activity

    SciTech Connect

    Perhac, R.M.

    1997-02-01

    The author provides an outline which touches on the types of concerns about risk evaluation which are addressed in the process of establishing regulatory guides. Broadly he says regulatory activity serves three broad constituents: (1) Paternalism (private risk); (2) Promotion of social welfare (public risks); (3) Protection of individual rights (public risks). He then discusses some of the major issues encountered in reaching a decision on what is an acceptable level of risk within each of these areas, and how one establishes such a level.

  4. Docosahexaenoic acid inhibits proteolytic processing of sterol regulatory element-binding protein-1c (SREBP-1c) via activation of AMP-activated kinase.

    PubMed

    Deng, Xiong; Dong, Qingming; Bridges, Dave; Raghow, Rajendra; Park, Edwards A; Elam, Marshall B

    2015-12-01

    In hyperinsulinemic states including obesity and T2DM, overproduction of fatty acid and triglyceride contributes to steatosis of the liver, hyperlipidemia and hepatic insulin resistance. This effect is mediated in part by the transcriptional regulator sterol responsive element binding protein-1c (SREBP-1c), which stimulates the expression of genes involved in hepatic fatty acid and triglyceride synthesis. SREBP-1c is up regulated by insulin both via increased transcription of nascent full-length SREBP-1c and by enhanced proteolytic processing of the endoplasmic reticulum (ER)-bound precursor to yield the transcriptionally active n-terminal form, nSREBP-1c. Polyunsaturated fatty acids of marine origin (n-3 PUFA) prevent induction of SREBP-1c by insulin thereby reducing plasma and hepatic triglycerides. Despite widespread use of n-3 PUFA supplements to reduce triglycerides in clinical practice, the exact mechanisms underlying their hypotriglyceridemic effect remain elusive. Here we demonstrate that the n-3 PUFA docosahexaenoic acid (DHA; 22:5 n-3) reduces nSREBP-1c by inhibiting regulated intramembrane proteolysis (RIP) of the nascent SREBP-1c. We further show that this effect of DHA is mediated both via activation of AMP-activated protein kinase (AMPK) and by inhibition of mechanistic target of rapamycin complex 1 (mTORC1). The inhibitory effect of AMPK on SREBP-1c processing is linked to phosphorylation of serine 365 of SREBP-1c in the rat. We have defined a novel regulatory mechanism by which n-3 PUFA inhibit induction of SREBP-1c by insulin. These findings identify AMPK as an important negative regulator of hepatic lipid synthesis and as a potential therapeutic target for hyperlipidemia in obesity and T2DM. PMID:26327595

  5. Identification of a key regulatory element for the basal activity of the human insulin-like growth factor II gene promoter P3.

    PubMed Central

    Rietveld, L E; Holthuizen, P E; Sussenbach, J S

    1997-01-01

    Transcription of the human insulin-like growth factor II (IGF-II) gene is under the control of four promoters (P1-P4) that are differentially active during growth and development. Promoter 3 (P3) is the most active promoter during fetal development as well as in most adult tissues. P3 is also the most active promoter in tumour tissues and cell lines expressing IGF-II. Transient transfections of HeLa and Hep3B cells with truncated promoter constructs revealed that the region between -289 and -183 relative to the transcription start site supports basal promoter activity in both cell lines. Footprint experiments showed that the region between positions -192 and -172 (P3-4) is the only element bound by nuclear proteins. P3-4 is bound by five proteins, of which three proteins (proteins 3, 4 and 5) bind specifically and are expressed at the same levels in HeLa and Hep3B cells. Electrophoretic mobility shift assays and differential footprint experiments revealed the presence of two protein-binding regions within the P3-4 element. Proteins 4 and 5 bind box A (-193 to -188), whereas box B (-183 to -172) is bound by protein 3. From transcription experiments in vitro it can be concluded that Box A is essential for P3 activity. Box A is part of a region 11 dG residues long and is protected by proteins 4 and 5 that bind a contiguous set of six dG residues. DNA-binding of proteins 4 and 5 to box A requires the presence of Zn2+ ions. Thus structural and functional analysis reveals that the P3-4 element is a key regulatory element of P3 that contains two separate binding sites for proteins essential for the basal activity of IGF-II P3. PMID:9581544

  6. Semi-Empirical Structure Determination of Escherichia coli Hsp33 and Identification of Dynamic Regulatory Elements for the Activation Process.

    PubMed

    Lee, Yoo-Sup; Lee, Jinhyuk; Ryu, Kyoung-Seok; Lee, Yuno; Jung, Tai-Geun; Jang, Jeong-Hwa; Sim, Dae-Won; Kim, Eun-Hee; Seo, Min-Duk; Lee, Keun Woo; Won, Hyung-Sik

    2015-12-01

    The activation process of the redox-regulated chaperone heat shock protein 33 (Hsp33) is constituted by the oxidation-induced unfolding of the C-terminal zinc-binding domain and concomitant oligomerization of the N-terminal core domain. Herein, the semi-empirical solution structure of Escherichia coli Hsp33 in the reduced, inactive form was generated through conformational space annealing calculations, utilizing minimalistic NMR data and multiple homology restraints. The various conformations of oxidized Hsp33 and some mutant forms were also investigated in solution. Interestingly, a specific region concentrated around the interdomain linker stretch and its interacting counterparts, the N-terminal β-strand 1 and α-helix 1, hardly showed up as signals in the NMR measurements. The NMR spectra of an Hsp33 derivative with a six-residue deletion in the disordered N-terminus implied a plausible conformational exchange associated with the identified region, and the corresponding exchange rate appeared slower than that of the wild type. Subsequent mutations that destroyed the structure of the β1 or α1 elements resulted in the formation of a reduced but active monomer, without the unfolding of the zinc-binding domain. Collectively, structural insights into the inactive and active conformations, including wild-type and mutant proteins, suggest that the dynamic interactions of the N-terminal segments with their contacting counterpart, the interdomain linker stretch, in the reduced, inactive state are the structural determinants regulating the activation process of the post-translationally regulated chaperone, Hsp33. PMID:26453802

  7. Light-dependent and circadian clock-regulated activation of sterol regulatory element-binding protein, X-box-binding protein 1, and heat shock factor pathways.

    PubMed

    Hatori, Megumi; Hirota, Tsuyoshi; Iitsuka, Michiko; Kurabayashi, Nobuhiro; Haraguchi, Shogo; Kokame, Koichi; Sato, Ryuichiro; Nakai, Akira; Miyata, Toshiyuki; Tsutsui, Kazuyoshi; Fukada, Yoshitaka

    2011-03-22

    The circadian clock is phase-delayed or -advanced by light when given at early or late subjective night, respectively. Despite the importance of the time-of-day-dependent phase responses to light, the underlying molecular mechanism is poorly understood. Here, we performed a comprehensive analysis of light-inducible genes in the chicken pineal gland, which consists of light-sensitive clock cells representing a prototype of the clock system. Light stimulated expression of 62 genes and 40 ESTs by >2.5-fold, among which genes responsive to the heat shock and endoplasmic reticulum stress as well as their regulatory transcription factors heat shock factor (HSF)1, HSF2, and X-box-binding protein 1 (XBP1) were strongly activated when a light pulse was given at late subjective night. In contrast, the light pulse at early subjective night caused prominent induction of E4bp4, a key regulator in the phase-delaying mechanism of the pineal clock, along with activation of a large group of cholesterol biosynthetic genes that are targets of sterol regulatory element-binding protein (SREBP) transcription factor. We found that the light pulse stimulated proteolytic formation of active SREBP-1 that, in turn, transactivated E4bp4 expression, linking SREBP with the light-input pathway of the pineal clock. As an output of light activation of cholesterol biosynthetic genes, we found light-stimulated pineal production of a neurosteroid, 7α-hydroxypregnenolone, demonstrating a unique endocrine function of the pineal gland. Intracerebroventricular injection of 7α-hydroxypregnenolone activated locomotor activities of chicks. Our study on the genome-wide gene expression analysis revealed time-of-day-dependent light activation of signaling pathways and provided molecular connection between gene expression and behavior through neurosteroid release from the pineal gland. PMID:21383147

  8. The Hepatitis C Virus-induced NLRP3 Inflammasome Activates the Sterol Regulatory Element-binding Protein (SREBP) and Regulates Lipid Metabolism.

    PubMed

    McRae, Steven; Iqbal, Jawed; Sarkar-Dutta, Mehuli; Lane, Samantha; Nagaraj, Abhiram; Ali, Naushad; Waris, Gulam

    2016-02-12

    Hepatitis C virus (HCV) relies on host lipids and lipid droplets for replication and morphogenesis. The accumulation of lipid droplets in infected hepatocytes manifests as hepatosteatosis, a common pathology observed in chronic hepatitis C patients. One way by which HCV promotes the accumulation of intracellular lipids is through enhancing de novo lipogenesis by activating the sterol regulatory element-binding proteins (SREBPs). In general, activation of SREBPs occurs during cholesterol depletion. Interestingly, during HCV infection, the activation of SREBPs occurs under normal cholesterol levels, but the underlying mechanisms are still elusive. Our previous study has demonstrated the activation of the inflammasome complex in HCV-infected human hepatoma cells. In this study, we elucidate the potential link between chronic hepatitis C-associated inflammation and alteration of lipid homeostasis in infected cells. Our results reveal that the HCV-activated NLRP3 inflammasome is required for the up-regulation of lipogenic genes such as 3-hydroxy-3-methylglutaryl-coenzyme A synthase, fatty acid synthase, and stearoyl-CoA desaturase. Using pharmacological inhibitors and siRNA against the inflammasome components (NLRP3, apoptosis-associated speck-like protein containing a CARD, and caspase-1), we further show that the activation of the NLRP3 inflammasome plays a critical role in lipid droplet formation. NLRP3 inflammasome activation in HCV-infected cells enables caspase-1-mediated degradation of insulin-induced gene proteins. This subsequently leads to the transport of the SREBP cleavage-activating protein·SREBP complex from the endoplasmic reticulum to the Golgi, followed by proteolytic activation of SREBPs by S1P and S2P in the Golgi. Typically, inflammasome activation leads to viral clearance. Paradoxically, here we demonstrate how HCV exploits the NLRP3 inflammasome to activate SREBPs and host lipid metabolism, leading to liver disease pathogenesis associated with

  9. Evolution of anterior Hox regulatory elements among chordates

    PubMed Central

    2011-01-01

    Background The Hox family of transcription factors has a fundamental role in segmentation pathways and axial patterning of embryonic development and their clustered organization is linked with the regulatory mechanisms governing their coordinated expression along embryonic axes. Among chordates, of particular interest are the Hox paralogous genes in groups 1-4 since their expression is coupled to the control of regional identity in the anterior nervous system, where the highest structural diversity is observed. Results To investigate the degree of conservation in cis-regulatory components that form the basis of Hox expression in the anterior nervous system, we have used assays for transcriptional activity in ascidians and vertebrates to compare and contrast regulatory potential. We identified four regulatory sequences located near the CiHox1, CiHox2 and CiHox4 genes of the ascidian Ciona intestinalis which direct neural specific domains of expression. Using functional assays in Ciona and vertebrate embryos in combination with sequence analyses of enhancer fragments located in similar positions adjacent to Hox paralogy group genes, we compared the activity of these four Ciona cis-elements with a series of neural specific enhancers from the amphioxus Hox1-3 genes and from mouse Hox paralogous groups 1-4. Conclusions This analysis revealed that Kreisler and Krox20 dependent enhancers critical in segmental regulation of the hindbrain appear to be specific for the vertebrate lineage. In contrast, neural enhancers that function as Hox response elements through the action of Hox/Pbx binding motifs have been conserved during chordate evolution. The functional assays reveal that these Hox response cis-elements are recognized by the regulatory components of different and extant species. Together, our results indicate that during chordate evolution, cis-elements dependent upon Hox/Pbx regulatory complexes, are responsible for key aspects of segmental Hox expression in neural

  10. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  11. Transcription factor trapping by RNA in gene regulatory elements

    PubMed Central

    Sigova, Alla A.; Abraham, Brian J.; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M.; Eric Guo, Yang; Jangi, Mohini; Giallourakis, Cosmas C.; Sharp, Phillip A.; Young, Richard A.

    2016-01-01

    Transcription factors (TFs) bind specific sequences in promoter-proximal and distal DNA elements in order to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA-binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF YY1 binds to both gene regulatory elements and also to their associated RNA species genome-wide. Reduced transcription of regulatory elements diminishes YY1 occupancy whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive feedback loop that contributes to the stability of gene expression programs. PMID:26516199

  12. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. PMID:26516199

  13. Mapping open chromatin with formaldehyde-assisted isolation of regulatory elements.

    PubMed

    Nammo, Takao; Rodríguez-Seguí, Santiago A; Ferrer, Jorge

    2011-01-01

    Noncoding regulatory genomic elements are central for cellular function, differentiation, and disease, but remain poorly characterized. FAIRE (formaldehyde-assisted isolation of regulatory elements) has emerged as a simple method to identify and analyze active regulatory sequences based on their decreased nucleosomal content. More recently FAIRE was combined with high-throughput sequencing (FAIRE-seq) to locate tissue-specific regulatory elements at a genome scale in purified human pancreatic islets. Here we describe the implementation of the FAIRE method in human pancreatic islet cells. PMID:21913087

  14. The relationship of sterol regulatory element-binding protein cleavage-activation protein and apolipoprotein E gene polymorphisms with metabolic changes during weight reduction.

    PubMed

    Nieminen, Tuomo; Matinheikki, Jussi; Nenonen, Arja; Kukkonen-Harjula, Katriina; Lindi, Virpi; Hämelahti, Päivi; Laaksonen, Reijo; Fan, Yue-Mei; Kähönen, Mika; Fogelholm, Mikael; Lehtimäki, Terho

    2007-07-01

    Sterol regulatory element-binding protein cleavage-activating protein (SCAP) and apolipoprotein E (apo E) regulate cellular and plasma lipid metabolism. Therefore, variations in the corresponding genes might influence weight reduction and obesity-associated metabolic changes. We investigated the relationships of SCAP (Ile796Val) and apo E polymorphisms on metabolic changes during weight reduction by using a 12-week very low-energy diet. Body composition, serum lipids, plasma glucose, and insulin were assessed in 78 healthy premenopausal women (initial body mass index, 34 +/- 4 kg/m(2); age, 40 +/- 4 years) before and after the intervention. The SCAP genotype groups did not differ in the responses of any parameters measured during weight reduction. Apo E did not differentiate the weight loss, but the changes in total and low-density lipoprotein cholesterol for the genotype groups apo E epsilon2/3, epsilon3/3, as well as epsilon3/4 and epsilon4/4 combined were -0.94 +/- 0.56 and -0.59 +/- 0.32, -0.71 +/- 0.49 and -0.49 +/- 0.45, and -0.55 +/- 0.47 and -0.37 +/- 0.39 mmol/L, respectively (P < .05 for both). In conclusion, neither the SCAP Ile796Val nor the apo E polymorphism was associated with weight loss in obese premenopausal women. However, the apo E-but not SCAP genotype-seems to be one of the modifying factors for serum cholesterol concentrations during very low-energy diet in obese premenopausal women. PMID:17570245

  15. AMP-activated protein kinase and carbohydrate response element binding protein: A study of two potential regulatory factors in the hepatic lipogenic program of broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study investigated the effects of fasting and refeeding on AMP-activated protein kinase (AMPK) and carbohydrate response element binding protein (ChREBP) mRNA, protein and activity levels; as well as the expression of lipogenic genes involved in regulating lipid synthesis in broiler chicken liv...

  16. Allyl isothiocyanate suppresses the proteolytic activation of sterol regulatory element-binding proteins and de novo fatty acid and cholesterol synthesis.

    PubMed

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2016-05-01

    Sterol regulatory element-binding proteins (SREBPs) are a family of transcription factors that regulate lipid homeostasis by controlling the expression of genes involved in fatty acid and cholesterol synthesis. In this study, we used a stable cell line that expresses a luciferase reporter gene driven by an SRE-containing fatty acid synthase promoter to identify allyl isothiocyanate (AITC), one of the major isothiocyanates in cruciferous vegetables, as a novel SREBP inactivator. We found that AITC downregulated the proteolytic processing of SREBPs and the expression of their target genes in human hepatoma Huh-7 cells. Furthermore, AITC reduced the de novo synthesis of both fatty acids and cholesterol. Our results indicate a novel physiological function of AITC in lipid metabolism regulation. PMID:26822063

  17. Regulatory Elements of the Staphylococcus aureus Protein A (Spa) Promoter†

    PubMed Central

    Gao, Jinxin; Stewart, George C.

    2004-01-01

    Staphylococcal protein A (Spa) is an important virulence factor of Staphylococcus aureus. Transcription of the spa determinant occurs during the exponential growth phase and is repressed when the cells enter the postexponential growth phase. Regulation of spa expression has been found to be complicated, with regulation involving multiple factors, including Agr, SarA, SarS, SarT, Rot, and MgrA. Our understanding of how these factors work on the spa promoter to regulate spa expression is incomplete. To identify regulatory sites within the spa promoter, analysis of deletion derivatives of the promoter in host strains deficient in one or more of the regulatory factors was undertaken, and several critical features of spa regulation were revealed. The transcriptional start sites of spa were determined by primer extension. The spa promoter sequences were subcloned in front of a promoterless chloramphenicol acetyltransferase reporter gene. Various lengths of spa truncations with the same 3′ end were constructed, and the resultant plasmids were transduced into strains with different regulatory genetic backgrounds. Our results identified upstream promoter sequences necessary for Agr system regulation of spa expression. The cis elements for SarS activity, an activator of spa expression, and for SarA activity, a repressor of spa expression, were identified. The well-characterized SarA consensus sequence on the spa promoter was found to be insufficient for SarA repression of the spa promoter. Full repression required the presence of a second consensus site adjacent to the SarS binding site. Sequences directly upstream of the core promoter sequence were found to stimulate transcription. PMID:15175287

  18. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis1[OPEN

    PubMed Central

    Guo, Xu Qiu; Adams, Keith L.

    2015-01-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. PMID:26474639

  19. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  20. Regulatory elements mediating transcription from the Drosophila melanogaster actin 5C proximal promoter.

    PubMed Central

    Chung, Y T; Keller, E B

    1990-01-01

    The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the proximal one of which controls constitutive synthesis of actin in all growing tissues. To locate regulatory elements required for constitutive activity of the proximal promoter, mutants of this promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. An essential regulatory element has been located 313 base pairs upstream from the cap site. Deletion of this element lowered expression to one-third of the wild-type level. The element has the sequence AAGTTGTAGTTG, as shown by protein-binding footprinting with the reagent methidiumpropyl-EDTA-Fe(II). This element is probably not a general one, since it was not detected in a search of the published 5'-flanking sequences of 27 Drosophila genes. In addition to this regulatory element, there are five GAGA elements in the actin 5C proximal promoter, some or all of which are essential for the promoter activity as shown by an in vivo competition assay. Although this promoter has no classical TATA element, there is an essential promoter region about 35 base pairs upstream from the cap site that could be a TATA surrogate. The promoter also shows sequences homologous to the alcohol dehydrogenase factor 1-binding site and to the core of the vertebrate serum response element, but mutations of these sites did not affect promoter activity in transient expression assays. Images PMID:2104658

  1. Structural and Regulatory Elements of HCV NS5B Polymerase – β-Loop and C-Terminal Tail – Are Required for Activity of Allosteric Thumb Site II Inhibitors

    PubMed Central

    Boyce, Sarah E.; Tirunagari, Neeraj; Niedziela-Majka, Anita; Perry, Jason; Wong, Melanie; Kan, Elaine; Lagpacan, Leanna; Barauskas, Ona; Hung, Magdeleine; Fenaux, Martijn; Appleby, Todd; Watkins, William J.; Schmitz, Uli; Sakowicz, Roman

    2014-01-01

    Elucidation of the mechanism of action of the HCV NS5B polymerase thumb site II inhibitors has presented a challenge. Current opinion holds that these allosteric inhibitors stabilize the closed, inactive enzyme conformation, but how this inhibition is accomplished mechanistically is not well understood. Here, using a panel of NS5B proteins with mutations in key regulatory motifs of NS5B – the C-terminal tail and β-loop – in conjunction with a diverse set of NS5B allosteric inhibitors, we show that thumb site II inhibitors possess a distinct mechanism of action. A combination of enzyme activity studies and direct binding assays reveals that these inhibitors require both regulatory elements to maintain the polymerase inhibitory activity. Removal of either element has little impact on the binding affinity of thumb site II inhibitors, but significantly reduces their potency. NS5B in complex with a thumb site II inhibitor displays a characteristic melting profile that suggests stabilization not only of the thumb domain but also the whole polymerase. Successive truncations of the C-terminal tail and/or removal of the β-loop lead to progressive destabilization of the protein. Furthermore, the thermal unfolding transitions characteristic for thumb site II inhibitor – NS5B complex are absent in the inhibitor – bound constructs in which interactions between C-terminal tail and β-loop are abolished, pointing to the pivotal role of both regulatory elements in communication between domains. Taken together, a comprehensive picture of inhibition by compounds binding to thumb site II emerges: inhibitor binding provides stabilization of the entire polymerase in an inactive, closed conformation, propagated via coupled interactions between the C-terminal tail and β-loop. PMID:24416288

  2. Structural and regulatory elements of HCV NS5B polymerase--β-loop and C-terminal tail--are required for activity of allosteric thumb site II inhibitors.

    PubMed

    Boyce, Sarah E; Tirunagari, Neeraj; Niedziela-Majka, Anita; Perry, Jason; Wong, Melanie; Kan, Elaine; Lagpacan, Leanna; Barauskas, Ona; Hung, Magdeleine; Fenaux, Martijn; Appleby, Todd; Watkins, William J; Schmitz, Uli; Sakowicz, Roman

    2014-01-01

    Elucidation of the mechanism of action of the HCV NS5B polymerase thumb site II inhibitors has presented a challenge. Current opinion holds that these allosteric inhibitors stabilize the closed, inactive enzyme conformation, but how this inhibition is accomplished mechanistically is not well understood. Here, using a panel of NS5B proteins with mutations in key regulatory motifs of NS5B--the C-terminal tail and β-loop--in conjunction with a diverse set of NS5B allosteric inhibitors, we show that thumb site II inhibitors possess a distinct mechanism of action. A combination of enzyme activity studies and direct binding assays reveals that these inhibitors require both regulatory elements to maintain the polymerase inhibitory activity. Removal of either element has little impact on the binding affinity of thumb site II inhibitors, but significantly reduces their potency. NS5B in complex with a thumb site II inhibitor displays a characteristic melting profile that suggests stabilization not only of the thumb domain but also the whole polymerase. Successive truncations of the C-terminal tail and/or removal of the β-loop lead to progressive destabilization of the protein. Furthermore, the thermal unfolding transitions characteristic for thumb site II inhibitor-NS5B complex are absent in the inhibitor-bound constructs in which interactions between C-terminal tail and β-loop are abolished, pointing to the pivotal role of both regulatory elements in communication between domains. Taken together, a comprehensive picture of inhibition by compounds binding to thumb site II emerges: inhibitor binding provides stabilization of the entire polymerase in an inactive, closed conformation, propagated via coupled interactions between the C-terminal tail and β-loop. PMID:24416288

  3. Isolation of a non-genomic origin fluoroquinolone responsive regulatory element using a combinatorial bioengineering approach

    PubMed Central

    Srivastava, Santosh Kumar; Iyer, V. Rajesh; Ghosh, Tamoghna; Lambadi, Paramesh Ramulu; Pathania, Ranjana; Navani, Naveen Kumar

    2016-01-01

    Advances in chemical biology have led to selection of synthetic functional nucleic acids for in vivo applications. Discovery of synthetic nucleic acid regulatory elements has been a long-standing goal of chemical biologists. Availability of vast genome level genetic resources has motivated efforts for discovery and understanding of inducible synthetic genetic regulatory elements. Such elements can lead to custom-design of switches and sensors, oscillators, digital logic evaluators and cell–cell communicators. Here, we describe a simple, robust and universally applicable module for discovery of inducible gene regulatory elements. The distinguishing feature is the use of a toxic peptide as a reporter to suppress the background of unwanted bacterial recombinants. Using this strategy, we show that it is possible to isolate genetic elements of non-genomic origin which specifically get activated in the presence of DNA gyrase A inhibitors belonging to fluoroquinolone (FQ) group of chemicals. Further, using a system level genetic resource, we prove that the genetic regulation is exerted through histone-like nucleoid structuring (H-NS) repressor protein. Till date, there are no reports of in vivo selection of non-genomic origin inducible regulatory promoter like elements. Our strategy opens an uncharted route to discover inducible synthetic regulatory elements from biologically-inspired nucleic acid sequences. PMID:26837578

  4. Isolation of a non-genomic origin fluoroquinolone responsive regulatory element using a combinatorial bioengineering approach.

    PubMed

    Srivastava, Santosh Kumar; Iyer, V Rajesh; Ghosh, Tamoghna; Lambadi, Paramesh Ramulu; Pathania, Ranjana; Navani, Naveen Kumar

    2016-03-18

    Advances in chemical biology have led to selection of synthetic functional nucleic acids for in vivo applications. Discovery of synthetic nucleic acid regulatory elements has been a long-standing goal of chemical biologists. Availability of vast genome level genetic resources has motivated efforts for discovery and understanding of inducible synthetic genetic regulatory elements. Such elements can lead to custom-design of switches and sensors, oscillators, digital logic evaluators and cell-cell communicators. Here, we describe a simple, robust and universally applicable module for discovery of inducible gene regulatory elements. The distinguishing feature is the use of a toxic peptide as a reporter to suppress the background of unwanted bacterial recombinants. Using this strategy, we show that it is possible to isolate genetic elements of non-genomic origin which specifically get activated in the presence of DNA gyrase A inhibitors belonging to fluoroquinolone (FQ) group of chemicals. Further, using a system level genetic resource, we prove that the genetic regulation is exerted through histone-like nucleoid structuring (H-NS) repressor protein. Till date, there are no reports of in vivo selection of non-genomic origin inducible regulatory promoter like elements. Our strategy opens an uncharted route to discover inducible synthetic regulatory elements from biologically-inspired nucleic acid sequences. PMID:26837578

  5. Study of Cis-regulatory Elements in the Ascidian Ciona intestinalis.

    PubMed

    Irvine, Steven Q

    2013-03-01

    The ascidian (sea squirt) C. intestinalis has become an important model organism for the study of cis-regulation. This is largely due to the technology that has been developed for assessing cis-regulatory activity through the use of transient reporter transgenes introduced into fertilized eggs. This technique allows the rapid and inexpensive testing of endogenous or altered DNA for regulatory activity in vivo. This review examines evidence that C. intestinalis cis-regulatory elements are located more closely to coding regions than in other model organisms. I go on to compare the organization of cis-regulatory elements and conserved non-coding sequences in Ciona, mammals, and other deuterostomes for three representative C.intestinalis genes, Pax6, FoxAa, and the DlxA-B cluster, along with homologs in the other species. These comparisons point out some of the similarities and differences between cis-regulatory elements and their study in the various model organisms. Finally, I provide illustrations of how C. intestinalis lends itself to detailed study of the structure of cis-regulatory elements, which have led, and promise to continue to lead, to important insights into the fundamentals of transcriptional regulation. PMID:23997651

  6. Transcriptional Targeting in the Airway Using Novel Gene Regulatory Elements

    PubMed Central

    Burnight, Erin R.; Wang, Guoshun; McCray, Paul B.

    2012-01-01

    The delivery of cystic fibrosis transmembrane conductance regulator (CFTR) to airway epithelia is a goal of many gene therapy strategies to treat cystic fibrosis. Because the native regulatory elements of the CFTR are not well characterized, the development of vectors with heterologous promoters of varying strengths and specificity would aid in our selection of optimal reagents for the appropriate expression of the vector-delivered CFTR gene. Here we contrasted the performance of several novel gene-regulatory elements. Based on airway expression analysis, we selected putative regulatory elements from BPIFA1 and WDR65 to investigate. In addition, we selected a human CFTR promoter region (∼ 2 kb upstream of the human CFTR transcription start site) to study. Using feline immunodeficiency virus vectors containing the candidate elements driving firefly luciferase, we transduced murine nasal epithelia in vivo. Luciferase expression persisted for 30 weeks, which was the duration of the experiment. Furthermore, when the nasal epithelium was ablated using the detergent polidocanol, the mice showed a transient loss of luciferase expression that returned 2 weeks after administration, suggesting that our vectors transduced a progenitor cell population. Importantly, the hWDR65 element drove sufficient CFTR expression to correct the anion transport defect in CFTR-null epithelia. These results will guide the development of optimal vectors for sufficient, sustained CFTR expression in airway epithelia. PMID:22447971

  7. Identification of germline transcriptional regulatory elements in Aedes aegypti

    NASA Astrophysics Data System (ADS)

    Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

    2014-02-01

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  8. Computational discovery of regulatory elements in a continuous expression space

    PubMed Central

    2012-01-01

    Approaches for regulatory element discovery from gene expression data usually rely on clustering algorithms to partition the data into clusters of co-expressed genes. Gene regulatory sequences are then mined to find overrepresented motifs in each cluster. However, this ad hoc partition rarely fits the biological reality. We propose a novel method called RED2 that avoids data clustering by estimating motif densities locally around each gene. We show that RED2 detects numerous motifs not detected by clustering-based approaches, and that most of these correspond to characterized motifs. RED2 can be accessed online through a user-friendly interface. PMID:23186104

  9. Mutational analysis of regulatory cis-acting elements for the transcriptional activation of the dmsCBA operon in Rhodobacter sphaeroides f. sp. denitrificans.

    PubMed

    Yamamoto, I; Ujiiye, T; Ohshima, Y; Satoh, T

    2001-07-01

    Four direct repeats of a 10-nt sequence, called dms boxes, are located upstream of the dmsCBA operon encoding dimethyl sulfoxide (DMSO) reductase in Rhodobacter sphaeroides f. sp. denitrificans IL106. Two dms boxes 1 and 2 have been shown to be binding sites of DmsR protein, a response regulator of a two-component system involved in the anaerobic induction by DMSO of DMSO reductase synthesis. In this study, functions of four dms boxes in the transcriptional regulation of the dmsCBA operon were investigated. The transcription start site of the dmsCBA genes was identified at the distance of 23 nt downstream of the closest dms box 4. Expression of the dmsC-lacZ gene fusion which included the dmsCBA promoter region containing the dms boxes was examined and its anaerobic induction by DMSO and DmsR-dependency were demonstrated in the phototroph. The examination with nucleotide substitutions in the four respective dms boxes showed that the set of four dms boxes is required for the dmsCBA operon activation. Moreover, the importance of the nucleotide sequence of TTCAC in dms box 4 and of A at the center in dms box 1 was significantly shown. These facts suggest that the pentad nucleotides TTCAC and TTAAC in the dms boxes serve as cis-acting elements in the transcriptional activation of the dmsCBA operon. PMID:11479376

  10. Transcriptionally active MuDR, the regulatory element of the mutator transposable element family of Zea mays, is present in some accessions of the Mexican land race Zapalote chico.

    PubMed Central

    de la Luz Gutiérrez-Nava, M; Warren, C A; León, P; Walbot, V

    1998-01-01

    To date, mobile Mu transposons and their autonomous regulator MuDR have been found only in the two known Mutator lines of maize and their immediate descendants. To gain insight into the origin, organization, and regulation of Mutator elements, we surveyed exotic maize and related species for cross-hybridization to MuDR. Some accessions of the mexican land race Zapalote chico contain one to several copies of full-length, unmethylated, and transcriptionally active MuDR-like elements plus non-autonomous Mu elements. The sequenced 5.0-kb MuDR-Zc element is 94.6% identical to MuDR, with only 20 amino acid changes in the 93-kD predicted protein encoded by mudrA and ten amino acid changes in the 23-kD predicted protein of mudrB. The terminal inverted repeat (TIR) A of MuDR-Zc is identical to standard MuDR; TIRB is 11.2% divergent from TIRA. In Zapalote chico, mudrA transcripts are very rare, while mudrB transcripts are as abundant as in Mutator lines with a few copies of MuDR. Zapalote chico lines with MuDR-like elements can trans-activate reporter alleles in inactive Mutator backgrounds; they match the characteristic increased forward mutation frequency of standard Mutator lines, but only after outcrossing to another line. Zapalote chico accessions that lack MuDR-like elements and the single copy MuDR a1-mum2 line produce few mutations. New mutants recovered from Zapalote chico are somatically stable. PMID:9584107

  11. Dynamics and function of distal regulatory elements during neurogenesis and neuroplasticity.

    PubMed

    Thakurela, Sudhir; Sahu, Sanjeeb Kumar; Garding, Angela; Tiwari, Vijay K

    2015-09-01

    Gene regulation in mammals involves a complex interplay between promoters and distal regulatory elements that function in concert to drive precise spatiotemporal gene expression programs. However, the dynamics of the distal gene regulatory landscape and its function in the transcriptional reprogramming that underlies neurogenesis and neuronal activity remain largely unknown. Here, we performed a combinatorial analysis of genome-wide data sets for chromatin accessibility (FAIRE-seq) and the enhancer mark H3K27ac, revealing the highly dynamic nature of distal gene regulation during neurogenesis, which gets progressively restricted to distinct genomic regions as neurons acquire a post-mitotic, terminally differentiated state. We further find that the distal accessible and active regions serve as target sites for distinct transcription factors that function in a stage-specific manner to contribute to the transcriptional program underlying neuronal commitment and maturation. Mature neurons respond to a sustained activity of NMDA receptors by epigenetic reprogramming at a large number of distal regulatory regions as well as dramatic reorganization of super-enhancers. Such massive remodeling of the distal regulatory landscape in turn results in a transcriptome that confers a transient loss of neuronal identity and gain of cellular plasticity. Furthermore, NMDA receptor activity also induces many novel prosurvival genes that function in neuroprotective pathways. Taken together, these findings reveal the dynamics of the distal regulatory landscape during neurogenesis and uncover novel regulatory elements that function in concert with epigenetic mechanisms and transcription factors to generate the transcriptome underlying neuronal development and activity. PMID:26170447

  12. Dynamics and function of distal regulatory elements during neurogenesis and neuroplasticity

    PubMed Central

    Thakurela, Sudhir; Sahu, Sanjeeb Kumar; Garding, Angela; Tiwari, Vijay K.

    2015-01-01

    Gene regulation in mammals involves a complex interplay between promoters and distal regulatory elements that function in concert to drive precise spatiotemporal gene expression programs. However, the dynamics of the distal gene regulatory landscape and its function in the transcriptional reprogramming that underlies neurogenesis and neuronal activity remain largely unknown. Here, we performed a combinatorial analysis of genome-wide data sets for chromatin accessibility (FAIRE-seq) and the enhancer mark H3K27ac, revealing the highly dynamic nature of distal gene regulation during neurogenesis, which gets progressively restricted to distinct genomic regions as neurons acquire a post-mitotic, terminally differentiated state. We further find that the distal accessible and active regions serve as target sites for distinct transcription factors that function in a stage-specific manner to contribute to the transcriptional program underlying neuronal commitment and maturation. Mature neurons respond to a sustained activity of NMDA receptors by epigenetic reprogramming at a large number of distal regulatory regions as well as dramatic reorganization of super-enhancers. Such massive remodeling of the distal regulatory landscape in turn results in a transcriptome that confers a transient loss of neuronal identity and gain of cellular plasticity. Furthermore, NMDA receptor activity also induces many novel prosurvival genes that function in neuroprotective pathways. Taken together, these findings reveal the dynamics of the distal regulatory landscape during neurogenesis and uncover novel regulatory elements that function in concert with epigenetic mechanisms and transcription factors to generate the transcriptome underlying neuronal development and activity. PMID:26170447

  13. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements.

    PubMed

    Schoenfelder, Stefan; Furlan-Magaril, Mayra; Mifsud, Borbala; Tavares-Cadete, Filipe; Sugar, Robert; Javierre, Biola-Maria; Nagano, Takashi; Katsman, Yulia; Sakthidevi, Moorthy; Wingett, Steven W; Dimitrova, Emilia; Dimond, Andrew; Edelman, Lucas B; Elderkin, Sarah; Tabbada, Kristina; Darbo, Elodie; Andrews, Simon; Herman, Bram; Higgs, Andy; LeProust, Emily; Osborne, Cameron S; Mitchell, Jennifer A; Luscombe, Nicholas M; Fraser, Peter

    2015-04-01

    The mammalian genome harbors up to one million regulatory elements often located at great distances from their target genes. Long-range elements control genes through physical contact with promoters and can be recognized by the presence of specific histone modifications and transcription factor binding. Linking regulatory elements to specific promoters genome-wide is currently impeded by the limited resolution of high-throughput chromatin interaction assays. Here we apply a sequence capture approach to enrich Hi-C libraries for >22,000 annotated mouse promoters to identify statistically significant, long-range interactions at restriction fragment resolution, assigning long-range interacting elements to their target genes genome-wide in embryonic stem cells and fetal liver cells. The distal sites contacting active genes are enriched in active histone modifications and transcription factor occupancy, whereas inactive genes contact distal sites with repressive histone marks, demonstrating the regulatory potential of the distal elements identified. Furthermore, we find that coregulated genes cluster nonrandomly in spatial interaction networks correlated with their biological function and expression level. Interestingly, we find the strongest gene clustering in ES cells between transcription factor genes that control key developmental processes in embryogenesis. The results provide the first genome-wide catalog linking gene promoters to their long-range interacting elements and highlight the complex spatial regulatory circuitry controlling mammalian gene expression. PMID:25752748

  14. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements

    PubMed Central

    Schoenfelder, Stefan; Furlan-Magaril, Mayra; Mifsud, Borbala; Tavares-Cadete, Filipe; Sugar, Robert; Javierre, Biola-Maria; Nagano, Takashi; Katsman, Yulia; Sakthidevi, Moorthy; Wingett, Steven W.; Dimitrova, Emilia; Dimond, Andrew; Edelman, Lucas B.; Elderkin, Sarah; Tabbada, Kristina; Darbo, Elodie; Andrews, Simon; Herman, Bram; Higgs, Andy; LeProust, Emily; Osborne, Cameron S.; Mitchell, Jennifer A.

    2015-01-01

    The mammalian genome harbors up to one million regulatory elements often located at great distances from their target genes. Long-range elements control genes through physical contact with promoters and can be recognized by the presence of specific histone modifications and transcription factor binding. Linking regulatory elements to specific promoters genome-wide is currently impeded by the limited resolution of high-throughput chromatin interaction assays. Here we apply a sequence capture approach to enrich Hi-C libraries for >22,000 annotated mouse promoters to identify statistically significant, long-range interactions at restriction fragment resolution, assigning long-range interacting elements to their target genes genome-wide in embryonic stem cells and fetal liver cells. The distal sites contacting active genes are enriched in active histone modifications and transcription factor occupancy, whereas inactive genes contact distal sites with repressive histone marks, demonstrating the regulatory potential of the distal elements identified. Furthermore, we find that coregulated genes cluster nonrandomly in spatial interaction networks correlated with their biological function and expression level. Interestingly, we find the strongest gene clustering in ES cells between transcription factor genes that control key developmental processes in embryogenesis. The results provide the first genome-wide catalog linking gene promoters to their long-range interacting elements and highlight the complex spatial regulatory circuitry controlling mammalian gene expression. PMID:25752748

  15. Identifying splicing regulatory elements with de Bruijn graphs.

    PubMed

    Badr, Eman; Heath, Lenwood S

    2014-12-01

    Splicing regulatory elements (SREs) are short, degenerate sequences on pre-mRNA molecules that enhance or inhibit the splicing process via the binding of splicing factors, proteins that regulate the functioning of the spliceosome. Existing methods for identifying SREs in a genome are either experimental or computational. Here, we propose a formalism based on de Bruijn graphs that combines genomic structure, word count enrichment analysis, and experimental evidence to identify SREs found in exons. In our approach, SREs are not restricted to a fixed length (i.e., k-mers, for a fixed k). As a result, we identify 2001 putative exonic enhancers and 3080 putative exonic silencers for human genes, with lengths varying from 6 to 15 nucleotides. Many of the predicted SREs overlap with experimentally verified binding sites. Our model provides a novel method to predict variable length putative regulatory elements computationally for further experimental investigation. PMID:25393830

  16. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.

    2016-01-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  17. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.

    PubMed

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R

    2016-09-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  18. Diverse regulatory circuits for transfer of conjugative elements.

    PubMed

    Singh, Praveen K; Meijer, Wilfried J J

    2014-09-01

    Conjugation systems are present on many plasmids as well as on chromosomally integrated elements. Conjugation, which is a major route by which bacteria exchange genetic material, is a complex and energy-consuming process. Hence, a shared feature of conjugation systems is that expression of the genes involved is strictly controlled in such a way that conjugation is kept in a default 'OFF' state and that the process is switched on only under conditions that favor the transfer of the conjugative element into a recipient cell. However, there is a remarkable diversity in the way by which conjugation genes present on different transferable elements are regulated. Here, we review these diverse regulatory circuits on the basis of several prototypes with a special focus on the recently discovered regulation of the conjugation genes present on the native Bacillus subtilis plasmid pLS20. PMID:24995588

  19. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  20. BRCA1 EXON 11, a CERES (composite regulatory element of splicing) element involved in splice regulation.

    PubMed

    Tammaro, Claudia; Raponi, Michela; Wilson, David I; Baralle, Diana

    2014-01-01

    Unclassified variants (UV) of BRCA1 can affect normal pre-mRNA splicing. Here, we investigate the UV c.693G>A, a "silent" change in BRCA1 exon 11, which we have found induces aberrant splicing in patient carriers and in vitro. Using a minigene assay, we show that the UV c.693G>A has a strong effect on the splicing isoform ratio of BRCA1. Systematic site-directed mutagenesis of the area surrounding the nucleotide position c.693G>A induced variable changes in the level of exon 11 inclusion/exclusion in the mRNA, pointing to the presence of a complex regulatory element with overlapping enhancer and silencer functions. Accordingly, protein binding analysis in the region detected several splicing regulatory factors involved, including SRSF1, SRSF6 and SRSF9, suggesting that this sequence represents a composite regulatory element of splicing (CERES). PMID:25056543

  1. Binding of estrogen receptors to switch sites and regulatory elements in the immunoglobulin heavy chain locus of activated B cells suggests a direct influence of estrogen on antibody expression.

    PubMed

    Jones, Bart G; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Neale, Geoff; Gearhart, Patricia J; Hurwitz, Julia L

    2016-09-01

    Females and males differ in antibody isotype expression patterns and in immune responses to foreign- and self-antigens. For example, systemic lupus erythematosus is a condition that associates with the production of isotype-skewed anti-self antibodies, and exhibits a 9:1 female:male disease ratio. To explain differences between B cell responses in males and females, we sought to identify direct interactions of the estrogen receptor (ER) with the immunoglobulin heavy chain locus. This effort was encouraged by our previous identification of estrogen response elements (ERE) in heavy chain switch (S) regions. We conducted a full-genome chromatin immunoprecipitation analysis (ChIP-seq) using DNA from LPS-activated B cells and an ERα-specific antibody. Results revealed ER binding to a wide region of DNA, spanning sequences from the JH cluster to Cδ, with peaks in Eμ and Sμ sites. Additional peaks of ERα binding were coincident with hs1,2 and hs4 sites in the 3' regulatory region (3'RR) of the heavy chain locus. This first demonstration of direct binding of ER to key regulatory elements in the immunoglobulin locus supports our hypothesis that estrogen and other nuclear hormone receptors and ligands may directly influence antibody expression and class switch recombination (CSR). Our hypothesis encourages the conduct of new experiments to evaluate the consequences of ER binding. A better understanding of ER:DNA interactions in the immunoglobulin heavy chain locus, and respective mechanisms, may ultimately translate to better control of antibody expression, better protection against pathogens, and prevention of pathologies caused by auto-immune disease. PMID:27494228

  2. Regulatory Elements of the Floral Homeotic Gene AGAMOUS Identified by Phylogenetic Footprinting and ShadowingW⃞

    PubMed Central

    Hong, Ray L.; Hamaguchi, Lynn; Busch, Maximilian A.; Weigel, Detlef

    2003-01-01

    In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3-kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae species, several other motifs, but not the LFY and WUS binding sites identified previously, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for the activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection but also demonstrate that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites. PMID:12782724

  3. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    SciTech Connect

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  4. A compilation of composite regulatory elements affecting gene transcription in vertebrates.

    PubMed Central

    Kel, O V; Romaschenko, A G; Kel, A E; Wingender, E; Kolchanov, N A

    1995-01-01

    Over the past years, evidence has been accumulating for a fundamental role of protein-protein interactions between transcription factors in gene-specific transcription regulation. Many of these interactions run within composite elements containing binding sites for several factors. We have selected 101 composite regulatory elements identified experimentally in the regulatory regions of 64 genes of vertebrates and of their viruses and briefly described them in a compilation. Of these, 82 composite elements are of the synergistic type and 19 of the antagonistic type. Within the synergistic type composite elements, transcription factors bind to the corresponding sites simultaneously, thus cooperatively activating transcription. The factors, binding to their target sites within antagonistic type composite elements, produce opposing effects on transcription. The nucleotide sequence and localization in the genes, the names and brief description of transcription factors, are provided for each composite element, including a representation of experimental data on its functioning. Most of the composite elements (3/4) fall between -250 bp and the transcription start site. The distance between the binding sites within the composite elements described varies from complete overlapping to 80 bp. The compilation of composite elements is presented in the database COMPEL which is electronically accessible by anonymous ftp via internet. PMID:7479071

  5. Epistatic Interactions in the Arabinose Cis-Regulatory Element

    PubMed Central

    Lagator, Mato; Igler, Claudia; Moreno, Anaísa B.; Guet, Călin C.; Bollback, Jonathan P.

    2016-01-01

    Changes in gene expression are an important mode of evolution; however, the proximate mechanism of these changes is poorly understood. In particular, little is known about the effects of mutations within cis binding sites for transcription factors, or the nature of epistatic interactions between these mutations. Here, we tested the effects of single and double mutants in two cis binding sites involved in the transcriptional regulation of the Escherichia coli araBAD operon, a component of arabinose metabolism, using a synthetic system. This system decouples transcriptional control from any posttranslational effects on fitness, allowing a precise estimate of the effect of single and double mutations, and hence epistasis, on gene expression. We found that epistatic interactions between mutations in the araBAD cis-regulatory element are common, and that the predominant form of epistasis is negative. The magnitude of the interactions depended on whether the mutations are located in the same or in different operator sites. Importantly, these epistatic interactions were dependent on the presence of arabinose, a native inducer of the araBAD operon in vivo, with some interactions changing in sign (e.g., from negative to positive) in its presence. This study thus reveals that mutations in even relatively simple cis-regulatory elements interact in complex ways such that selection on the level of gene expression in one environment might perturb regulation in the other environment in an unpredictable and uncorrelated manner. PMID:26589997

  6. Epistatic Interactions in the Arabinose Cis-Regulatory Element.

    PubMed

    Lagator, Mato; Igler, Claudia; Moreno, Anaísa B; Guet, Călin C; Bollback, Jonathan P

    2016-03-01

    Changes in gene expression are an important mode of evolution; however, the proximate mechanism of these changes is poorly understood. In particular, little is known about the effects of mutations within cis binding sites for transcription factors, or the nature of epistatic interactions between these mutations. Here, we tested the effects of single and double mutants in two cis binding sites involved in the transcriptional regulation of the Escherichia coli araBAD operon, a component of arabinose metabolism, using a synthetic system. This system decouples transcriptional control from any posttranslational effects on fitness, allowing a precise estimate of the effect of single and double mutations, and hence epistasis, on gene expression. We found that epistatic interactions between mutations in the araBAD cis-regulatory element are common, and that the predominant form of epistasis is negative. The magnitude of the interactions depended on whether the mutations are located in the same or in different operator sites. Importantly, these epistatic interactions were dependent on the presence of arabinose, a native inducer of the araBAD operon in vivo, with some interactions changing in sign (e.g., from negative to positive) in its presence. This study thus reveals that mutations in even relatively simple cis-regulatory elements interact in complex ways such that selection on the level of gene expression in one environment might perturb regulation in the other environment in an unpredictable and uncorrelated manner. PMID:26589997

  7. Bezafibrate at clinically relevant doses decreases serum/liver triglycerides via down-regulation of sterol regulatory element-binding protein-1c in mice: a novel peroxisome proliferator-activated receptor alpha-independent mechanism.

    PubMed

    Nakajima, Takero; Tanaka, Naoki; Kanbe, Hiroki; Hara, Atsushi; Kamijo, Yuji; Zhang, Xiaowei; Gonzalez, Frank J; Aoyama, Toshifumi

    2009-04-01

    The triglyceride-lowering effect of bezafibrate in humans has been attributed to peroxisome proliferator-activated receptor (PPAR) alpha activation based on results from rodent studies. However, the bezafibrate dosages used in conventional rodent experiments are typically higher than those in clinical use (> or =50 versus < or =10 mg/kg/day), and thus it remains unclear whether such data can be translated to humans. Furthermore, because bezafibrate is a pan-PPAR activator, the actual contribution of PPARalpha to its triglyceride-lowering properties remains undetermined. To address these issues, bezafibrate at clinically relevant doses (10 mg/kg/day; low) was administered to wild-type and Ppara-null mice, and its effects were compared with those from conventionally used doses (100 mg/kg/day; high). Pharmacokinetic analyses showed that maximum plasma concentration and area under the concentration-time curve in bezafibrate-treated mice were similar to those in humans at low doses, but not at high doses. Low-dose bezafibrate decreased serum/liver triglycerides in a PPARalpha-independent manner by attenuation of hepatic lipogenesis and triglyceride secretion. It is noteworthy that instead of PPAR activation, down-regulation of sterol regulatory element-binding protein (SREBP)-1c was observed in mice undergoing low-dose treatment. High-dose bezafibrate decreased serum/liver triglycerides by enhancement of hepatic fatty acid uptake and beta-oxidation via PPARalpha activation, as expected. In conclusion, clinically relevant doses of bezafibrate exert a triglyceride-lowering effect by suppression of the SREBP-1c-regulated pathway in mice and not by PPARalpha activation. Our results may provide novel information about the pharmacological mechanism of bezafibrate action and new insights into the treatment of disorders involving SREBP-1c. PMID:19124612

  8. Muscle-specific activity of the skeletal troponin I promoter requires interaction between upstream regulatory sequences and elements contained within the first transcribed exon.

    PubMed Central

    Nikovits, W; Mar, J H; Ordahl, C P

    1990-01-01

    Expression of the skeletal troponin I (sTnI) gene is regulated transcriptionally in a muscle-specific fashion. We show here that the region of the sTnI gene between -160 and +61 (relative to the transcription initiation site) is able to direct expression of the bacterial chloramphenicol acetyltransferase (CAT) gene is muscle cultures at a level approximately 100 times higher than in fibroblast cultures. RNA analysis demonstrated that transcription of the CAT gene was initiated at the same site as transcription of the endogenous sTnI gene and that CAT activity levels were approximately proportional to CAT mRNA levels. Deletion analysis demonstrated that the region between nucleotides -160 and -40 contained sequences essential for full promoter activity. Surprisingly, 3' deletion analysis indicated that the first exon (-6 to +61) of the sTnI gene was also required for full activity of the sTnI promoter in skeletal muscle cells. Chimeric promoter experiments, in which segments of the sTnI and the herpes simplex virus thymidine kinase promoter were interchanged, indicated that reconstitution of a muscle-specific promoter required inclusion of both the upstream and exon I regions of the sTnI gene. Exon I, and the region immediately upstream, showed DNase protection over sequence motifs related to those found in other genes, including the tar region of human immunodeficiency virus type 1. These results demonstrate that expression of the sTnI promoter in embryonic skeletal muscle cells requires complex interaction between two separate promoter regions, one of which resides within the first 61 transcribed nucleotides of the gene. Images PMID:2355914

  9. Massive contribution of transposable elements to mammalian regulatory sequences.

    PubMed

    Rayan, Nirmala Arul; Del Rosario, Ricardo C H; Prabhakar, Shyam

    2016-09-01

    Barbara McClintock discovered the existence of transposable elements (TEs) in the late 1940s and initially proposed that they contributed to the gene regulatory program of higher organisms. This controversial idea gained acceptance only much later in the 1990s, when the first examples of TE-derived promoter sequences were uncovered. It is now known that half of the human genome is recognizably derived from TEs. It is thus important to understand the scope and nature of their contribution to gene regulation. Here, we provide a timeline of major discoveries in this area and discuss how transposons have revolutionized our understanding of mammalian genomes, with a special emphasis on the massive contribution of TEs to primate evolution. Our analysis of primate-specific functional elements supports a simple model for the rate at which new functional elements arise in unique and TE-derived DNA. Finally, we discuss some of the challenges and unresolved questions in the field, which need to be addressed in order to fully characterize the impact of TEs on gene regulation, evolution and disease processes. PMID:27174439

  10. MicroRNAs as regulatory elements in immune system logic.

    PubMed

    Mehta, Arnav; Baltimore, David

    2016-04-28

    MicroRNAs (miRNAs) are crucial post-transcriptional regulators of haematopoietic cell fate decisions. They act by negatively regulating the expression of key immune development genes, thus contributing important logic elements to the regulatory circuitry. Deletion studies have made it increasingly apparent that they confer robustness to immune cell development, especially under conditions of environmental stress such as infectious challenge and ageing. Aberrant expression of certain miRNAs can lead to pathological consequences, such as autoimmunity and haematological cancers. In this Review, we discuss the mechanisms by which several miRNAs influence immune development and buffer normal haematopoietic output, first at the level of haematopoietic stem cells, then in innate and adaptive immune cells. We then discuss the pathological consequences of dysregulation of these miRNAs. PMID:27121651

  11. SREBP2 Activation Induces Hepatic Long-chain Acyl-CoA Synthetase 1 (ACSL1) Expression in Vivo and in Vitro through a Sterol Regulatory Element (SRE) Motif of the ACSL1 C-promoter.

    PubMed

    Singh, Amar Bahadur; Kan, Chin Fung Kelvin; Dong, Bin; Liu, Jingwen

    2016-03-01

    Long-chain acyl-CoA synthetase 1 (ACSL1) plays a key role in fatty acid metabolism. To identify novel transcriptional modulators of ACSL1, we examined ACSL1 expression in liver tissues of hamsters fed a normal diet, a high fat diet, or a high cholesterol and high fat diet (HCHFD). Feeding hamsters HCHFD markedly reduced hepatic Acsl1 mRNA and protein levels as well as acyl-CoA synthetase activity. Decreases in Acsl1 expression strongly correlated with reductions in hepatic Srebp2 mRNA level and mature Srebp2 protein abundance. Conversely, administration of rosuvastatin (RSV) to hamsters increased hepatic Acsl1 expression. These new findings were reproduced in mice treated with RSV or fed the HCHFD. Furthermore, the RSV induction of acyl-CoA activity in mouse liver resulted in increases in plasma and hepatic cholesterol ester concentrations and reductions in free cholesterol amounts. Investigations on different ACSL1 transcript variants in HepG2 cells revealed that the mRNA expression of C-ACSL1 was specifically regulated by the sterol regulatory element (SRE)-binding protein (SREBP) pathway, and RSV treatment increased the C-ACSL1 abundance from a minor mRNA species to an abundant transcript. We analyzed 5'-flanking sequence of exon 1C of the human ACSL1 gene and identified one putative SRE site. By performing a promoter activity assay and DNA binding assays, we firmly demonstrated the key role of this SRE motif in SREBP2-mediated activation of C-ACSL1 gene transcription. Finally, we demonstrated that knockdown of endogenous SREBP2 in HepG2 cells lowered ACSL1 mRNA and protein levels. Altogether, this work discovered an unprecedented link between ACSL1 and SREBP2 via the specific regulation of the C-ACSL1 transcript. PMID:26728456

  12. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

    PubMed Central

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

    2015-01-01

    Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Contact: Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

  13. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  14. Inference of Splicing Regulatory Activities by Sequence Neighborhood Analysis

    PubMed Central

    Stadler, Michael B; Shomron, Noam; Yeo, Gene W; Schneider, Aniket; Xiao, Xinshu; Burge, Christopher B

    2006-01-01

    Sequence-specific recognition of nucleic-acid motifs is critical to many cellular processes. We have developed a new and general method called Neighborhood Inference (NI) that predicts sequences with activity in regulating a biochemical process based on the local density of known sites in sequence space. Applied to the problem of RNA splicing regulation, NI was used to predict hundreds of new exonic splicing enhancer (ESE) and silencer (ESS) hexanucleotides from known human ESEs and ESSs. These predictions were supported by cross-validation analysis, by analysis of published splicing regulatory activity data, by sequence-conservation analysis, and by measurement of the splicing regulatory activity of 24 novel predicted ESEs, ESSs, and neutral sequences using an in vivo splicing reporter assay. These results demonstrate the ability of NI to accurately predict splicing regulatory activity and show that the scope of exonic splicing regulatory elements is substantially larger than previously anticipated. Analysis of orthologous exons in four mammals showed that the NI score of ESEs, a measure of function, is much more highly conserved above background than ESE primary sequence. This observation indicates a high degree of selection for ESE activity in mammalian exons, with surprisingly frequent interchangeability between ESE sequences. PMID:17121466

  15. Recurrent Modification of a Conserved Cis-Regulatory Element Underlies Fruit Fly Pigmentation Diversity

    PubMed Central

    Rogers, William A.; Salomone, Joseph R.; Tacy, David J.; Camino, Eric M.; Davis, Kristen A.; Rebeiz, Mark; Williams, Thomas M.

    2013-01-01

    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages. PMID:24009528

  16. Transcriptional regulatory elements downstream of the JunB gene.

    PubMed Central

    Perez-Albuerne, E D; Schatteman, G; Sanders, L K; Nathans, D

    1993-01-01

    JunB is an immediate early transcription factor that is induced by a variety of extracellular signaling agents, including growth factors, phorbol esters, and agents that elevate cyclic AMP. The mechanism of activation of the gene encoding JunB by these agents is not well understood. By using the JunB gene together with flanking DNA in transfection experiments, we show that a serum response element (SRE) and/or a cAMP response element (CRE) downstream of the gene mediate the response of the gene in mouse NIH 3T3 cells to serum, platelet-derived growth factor, basic fibroblast growth factor, phorbol ester, and forskolin. In addition, a segment of DNA just upstream of the TATA box is required for optimal activation of the gene. Images Fig. 1 Fig. 5 PMID:8265655

  17. Close sequence comparisons are sufficient to identify human cis-regulatory elements.

    PubMed

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M; Couronne, Olivier; Pennacchio, Len A

    2006-07-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons. To address this problem, we identified evolutionarily conserved noncoding regions in primate, mammalian, and more distant comparisons using a uniform approach (Gumby) that facilitates unbiased assessment of the impact of evolutionary distance on predictive power. We benchmarked computational predictions against previously identified cis-regulatory elements at diverse genomic loci and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using an in vivo enhancer assay in transgenic mice. Human regulatory elements were identified with acceptable sensitivity (53%-80%) and true-positive rate (27%-67%) by comparison with one to five other eutherian mammals or six other simian primates. More distant comparisons (marsupial, avian, amphibian, and fish) failed to identify many of the empirically defined functional noncoding elements. Our results highlight the practical utility of close sequence comparisons, and the loss of sensitivity entailed by more distant comparisons. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole-genome comparative analysis that explains most of the observations from empirical benchmarking. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for in vivo testing at embryonic time points. PMID:16769978

  18. Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage

    PubMed Central

    Sanges, Remo; Kalmar, Eva; Claudiani, Pamela; D'Amato, Maria; Muller, Ferenc; Stupka, Elia

    2006-01-01

    Background All vertebrates share a remarkable degree of similarity in their development as well as in the basic functions of their cells. Despite this, attempts at unearthing genome-wide regulatory elements conserved throughout the vertebrate lineage using BLAST-like approaches have thus far detected noncoding conservation in only a few hundred genes, mostly associated with regulation of transcription and development. Results We used a unique combination of tools to obtain regional global-local alignments of orthologous loci. This approach takes into account shuffling of regulatory regions that are likely to occur over evolutionary distances greater than those separating mammalian genomes. This approach revealed one order of magnitude more vertebrate conserved elements than was previously reported in over 2,000 genes, including a high number of genes found in the membrane and extracellular regions. Our analysis revealed that 72% of the elements identified have undergone shuffling. We tested the ability of the elements identified to enhance transcription in zebrafish embryos and compared their activity with a set of control fragments. We found that more than 80% of the elements tested were able to enhance transcription significantly, prevalently in a tissue-restricted manner corresponding to the expression domain of the neighboring gene. Conclusion Our work elucidates the importance of shuffling in the detection of cis-regulatory elements. It also elucidates how similarities across the vertebrate lineage, which go well beyond development, can be explained not only within the realm of coding genes but also in that of the sequences that ultimately govern their expression. PMID:16859531

  19. Transcription regulatory elements are punctuation marks for DNA replication.

    PubMed

    Mirkin, Ekaterina V; Castro Roa, Daniel; Nudler, Evgeny; Mirkin, Sergei M

    2006-05-01

    Collisions between DNA replication and transcription significantly affect genome organization, regulation, and stability. Previous studies have described collisions between replication forks and elongating RNA polymerases. Although replication collisions with the transcription-initiation or -termination complexes are potentially even more important because most genes are not actively transcribed during DNA replication, their existence and mechanisms remained unproven. To address this matter, we have designed a bacterial promoter that binds RNA polymerase and maintains it in the initiating mode by precluding the transition into the elongation mode. By using electrophoretic analysis of replication intermediates, we have found that this steadfast transcription-initiation complex inhibits replication fork progression in an orientation-dependent manner during head-on collisions. Transcription terminators also appeared to attenuate DNA replication, but in the opposite, codirectional orientation. Thus, transcription regulatory signals may serve as "punctuation marks" for DNA replication in vivo. PMID:16670199

  20. [Regulatory potential of S/MAR elements in transient expression].

    PubMed

    Sass, A V; Ruda, V M; Akopov, S B; Snezhkov, E V; Nikolaev, L G; Sverdlov, E D

    2005-01-01

    S/MARs (scaffold/matrix attachment regions) are the DNA regions that are involved in the interaction with the nuclear matrix and are identified by in vitro methods. According to the available information, S/MARs possess an insulating activity, i.e., the ability to block the interaction between the enhancer and promoter in vivo, and are, probably, intact insulators or their fragments. Nevertheless, there is still no direct proof for this correspondence. To obtain additional information on the insulator activity of S/MARs, we selected five DNA fragments of different lengths and affinities for the nuclear matrix from the previously constructed library of S/MARs and tested their ability to serve as insulators. Two of five elements exhibited an insulator (enhancer-blocking) activity upon the transient transfection of CHO cells. None of the S/MARs displayed either promoter or enhancer/silencer activities in these cells. PMID:15787217

  1. Identification of transcriptional regulatory elements for Ntng1 and Ntng2 genes in mice

    PubMed Central

    2014-01-01

    Background Higher brain function is supported by the precise temporal and spatial regulation of thousands of genes. The mechanisms that underlie transcriptional regulation in the brain, however, remain unclear. The Ntng1 and Ntng2 genes, encoding axonal membrane adhesion proteins netrin-G1 and netrin-G2, respectively, are paralogs that have evolved in vertebrates and are expressed in distinct neuronal subsets in a complementary manner. The characteristic expression patterns of these genes provide a part of the foundation of the cortical layer structure in mammals. Results We used gene-targeting techniques, bacterial artificial chromosome (BAC)-aided transgenesis techniques, and in vivo enhancer assays to examine transcriptional mechanisms in vivo to gain insight into how the characteristic expression patterns of these genes are acquired. Analysis of the gene expression patterns in the presence or absence of netrin-G1 and netrin-G2 functional proteins allowed us to exclude the possibility that a feedback or feedforward mechanism mediates their characteristic expression patterns. Findings from the BAC deletion series revealed that widely distributed combinations of cis-regulatory elements determine the differential gene expression patterns of these genes and that major cis-regulatory elements are located in the 85–45 kb upstream region of Ntng2 and in the 75–60 kb upstream region and intronic region of Ntng1. In vivo enhancer assays using 2-kb evolutionarily conserved regions detected enhancer activity in the distal upstream regions of both genes. Conclusions The complementary expression patterns of Ntng1 and Ntng2 are determined by transcriptional cis-regulatory elements widely scattered in these loci. The cis-regulatory elements characterized in this study will facilitate the development of novel genetic tools for functionally dissecting neural circuits to better understand vertebrate brain function. PMID:24642214

  2. Structural property of regulatory elements in human promoters

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2008-04-01

    The capacity of transcription factors to activate gene expression is encoded in the promoter sequences, which are composed of short regulatory motifs that function as transcription factor binding sites (TFBSs) for specific proteins. To the best of our knowledge, the structural property of TFBSs that controls transcription is still poorly understood. Rigidity is one of the important structural properties of DNA, and plays an important role in guiding DNA-binding proteins to the target sites efficiently. After analyzing the rigidity of 2897 TFBSs in 1871 human promoters, we show that TFBSs are generally more flexible than other genomic regions such as exons, introns, 3' untranslated regions, and TFBS-poor promoter regions. Furthermore, we find that the density of TFBSs is consistent with the average rigidity profile of human promoters upstream of the transcription start site, which implies that TFBSs directly influence the promoter structure. We also examine the local rigid regions probably caused by specific TFBSs such as the DNA sequence TATA(A/T)A(A/T) box, which may inhibit nucleosomes and thereby facilitate the access of transcription factors bound nearby. Our results suggest that the structural property of TFBSs accounts for the promoter structure as well as promoter activity.

  3. Positive and negative regulatory elements mediating transcription from the Drosophila melanogaster actin 5C distal promoter.

    PubMed Central

    Chung, Y T; Keller, E B

    1990-01-01

    The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the distal one of which controls synthesis of actin in a tissue- and developmental stage-specific manner. This very strong promoter has widely been used for expression of heterologous genes in cultured cells. To locate functional regulatory elements in this distal promoter, mutants of the promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. The results showed that the upstream end of the promoter extends to 522 bp from the transcription start site. In addition, there are two remote activating regions about 2 kb upstream. Between -522 and -379 are two regions that exert a strong negative effect. Downstream from these negative regions are at least six positive regions and a TATA element. The strongest positive determinant of the promoter was identified at -320 as AAAATGTG by footprinting and by a replacement experiment. When the relevant region was replaced by a synthetic sequence containing this element in a random context, the transient expression activity was restored. The sequence TGTATG located at -355 was also identified as a positive element by a similar replacement approach. Apparently the very high activity of this promoter is the result of the combined activities of multiple factors. Images PMID:2123290

  4. BET bromodomain inhibition releases the Mediator complex from select cis-regulatory elements

    PubMed Central

    Bhagwat, Anand S.; Roe, Jae-Seok; Mok, Beverly A.; Hohmann, Anja F.; Shi, Junwei; Vakoc, Christopher R.

    2016-01-01

    The bromodomain and extraterminal (BET) protein BRD4 can physically interact with the Mediator complex, but the relevance of this association to the therapeutic effects of BET inhibitors in cancer is unclear. Here, we show that BET inhibition causes a rapid release of Mediator from a subset of cis-regulatory elements in the genome of acute myeloid leukemia (AML) cells. These sites of Mediator eviction were highly correlated with transcriptional suppression of neighboring genes, which are enriched for targets of the transcription factor MYB and for functions related to leukemogenesis. An shRNA screen of Mediator in AML cells identified the MED12, MED13, MED23, and MED24 subunits as performing a similar regulatory function to BRD4 in this context, including a shared role in sustaining a block in myeloid maturation. These findings suggest that the interaction between BRD4 and Mediator has functional importance for gene-specific transcriptional activation and for AML maintenance. PMID:27068464

  5. Exaptation of Transposable Elements into Novel Cis-Regulatory Elements: Is the Evidence Always Strong?

    PubMed Central

    de Souza, Flávio S.J.; Franchini, Lucía F.; Rubinstein, Marcelo

    2013-01-01

    Transposable elements (TEs) are mobile genetic sequences that can jump around the genome from one location to another, behaving as genomic parasites. TEs have been particularly effective in colonizing mammalian genomes, and such heavy TE load is expected to have conditioned genome evolution. Indeed, studies conducted both at the gene and genome levels have uncovered TE insertions that seem to have been co-opted—or exapted—by providing transcription factor binding sites (TFBSs) that serve as promoters and enhancers, leading to the hypothesis that TE exaptation is a major factor in the evolution of gene regulation. Here, we critically review the evidence for exaptation of TE-derived sequences as TFBSs, promoters, enhancers, and silencers/insulators both at the gene and genome levels. We classify the functional impact attributed to TE insertions into four categories of increasing complexity and argue that so far very few studies have conclusively demonstrated exaptation of TEs as transcriptional regulatory regions. We also contend that many genome-wide studies dealing with TE exaptation in recent lineages of mammals are still inconclusive and that the hypothesis of rapid transcriptional regulatory rewiring mediated by TE mobilization must be taken with caution. Finally, we suggest experimental approaches that may help attributing higher-order functions to candidate exapted TEs. PMID:23486611

  6. Variation in vertebrate cis-regulatory elements in evolution and disease.

    PubMed

    Douglas, Adam Thomas; Hill, Robert D

    2014-01-01

    Much of the genetic information that drives animal diversity lies within the vast non-coding regions of the genome. Multi-species sequence conservation in non-coding regions of the genome flags important regulatory elements and more recently, techniques that look for functional signatures predicted for regulatory sequences have added to the identification of thousands more. For some time, biologists have argued that changes in cis-regulatory sequences creates the basic genetic framework for evolutionary change. Recent advances support this notion and show that there is extensive genomic variability in non-coding regulatory elements associated with trait variation, speciation and disease. PMID:25764334

  7. Variation in Vertebrate Cis-Regulatory Elements in Evolution and Disease.

    PubMed

    Douglas, Adam T; Hill, Robert E

    2014-05-01

    Much of the genetic information that drives animal diversity lies within the vast non-coding regions of the genome. Multi-species sequence conservation in non-coding regions of the genome flags important regulatory elements and more recently, techniques that look for functional signatures predicted for regulatory sequences have added to the identification of thousands more. For some time, biologists have argued that changes in cis-regulatory sequences creates the basic genetic framework for evolutionary change. Recent advances support this notion and show that there is extensive genomic variability in non-coding regulatory elements associated with trait variation, speciation and disease. PMID:24802895

  8. Variation in Vertebrate Cis-Regulatory Elements in Evolution and Disease

    PubMed Central

    Douglas, Adam Thomas; Hill, Robert E

    2014-01-01

    Much of the genetic information that drives animal diversity lies within the vast non-coding regions of the genome. Multi-species sequence conservation in non-coding regions of the genome flags important regulatory elements and more recently, techniques that look for functional signatures predicted for regulatory sequences have added to the identification of thousands more. For some time, biologists have argued that changes in cis-regulatory sequences creates the basic genetic framework for evolutionary change. Recent advances support this notion and show that there is extensive genomic variability in non-coding regulatory elements associated with trait variation, speciation and disease. PMID:25764334

  9. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.

    1999-01-01

    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  10. Functional Annotation of Putative Regulatory Elements at Cancer Susceptibility Loci

    PubMed Central

    Rosse, Stephanie A; Auer, Paul L; Carlson, Christopher S

    2014-01-01

    Most cancer-associated genetic variants identified from genome-wide association studies (GWAS) do not obviously change protein structure, leading to the hypothesis that the associations are attributable to regulatory polymorphisms. Translating genetic associations into mechanistic insights can be facilitated by knowledge of the causal regulatory variant (or variants) responsible for the statistical signal. Experimental validation of candidate functional variants is onerous, making bioinformatic approaches necessary to prioritize candidates for laboratory analysis. Thus, a systematic approach for recognizing functional (and, therefore, likely causal) variants in noncoding regions is an important step toward interpreting cancer risk loci. This review provides a detailed introduction to current regulatory variant annotations, followed by an overview of how to leverage these resources to prioritize candidate functional polymorphisms in regulatory regions. PMID:25288875

  11. Target activation by regulatory RNAs in bacteria

    PubMed Central

    Papenfort, Kai; Vanderpool, Carin K.

    2015-01-01

    Bacterial small regulatory RNAs (sRNAs) are commonly known to repress gene expression by base pairing to target mRNAs. In many cases, sRNAs base pair with and sequester mRNA ribosome-binding sites, resulting in translational repression and accelerated transcript decay. In contrast, a growing number of examples of translational activation and mRNA stabilization by sRNAs have now been documented. A given sRNA often employs a conserved region to interact with and regulate both repressed and activated targets. However, the mechanisms underlying activation differ substantially from repression. Base pairing resulting in target activation can involve sRNA interactions with the 5′ untranslated region (UTR), the coding sequence or the 3′ UTR of the target mRNAs. Frequently, the activities of protein factors such as cellular ribonucleases and the RNA chaperone Hfq are required for activation. Bacterial sRNAs, including those that function as activators, frequently control stress response pathways or virulence-associated functions required for immediate responses to changing environments. This review aims to summarize recent advances in knowledge regarding target mRNA activation by bacterial sRNAs, highlighting the molecular mechanisms and biological relevance of regulation. PMID:25934124

  12. A steganalysis-based approach to comprehensive identification and characterization of functional regulatory elements

    PubMed Central

    Wang, Guandong; Zhang, Weixiong

    2006-01-01

    The comprehensive identification of cis-regulatory elements on a genome scale is a challenging problem. We develop a novel, steganalysis-based approach for genome-wide motif finding, called WordSpy, by viewing regulatory regions as a stegoscript with cis-elements embedded in 'background' sequences. We apply WordSpy to the promoters of cell-cycle-related genes of Saccharomyces cerevisiae and Arabidopsis thaliana, identifying all known cell-cycle motifs with high ranking. WordSpy can discover a complete set of cis-elements and facilitate the systematic study of regulatory networks. PMID:16787547

  13. Tissue-Specific Enrichment of Lymphoma Risk Loci in Regulatory Elements

    PubMed Central

    Hayes, James E.; Trynka, Gosia; Vijai, Joseph; Offit, Kenneth; Raychaudhuri, Soumya; Klein, Robert J.

    2015-01-01

    Though numerous polymorphisms have been associated with risk of developing lymphoma, how these variants function to promote tumorigenesis is poorly understood. Here, we report that lymphoma risk SNPs, especially in the non-Hodgkin’s lymphoma subtype chronic lymphocytic leukemia, are significantly enriched for co-localization with epigenetic marks of active gene regulation. These enrichments were seen in a lymphoid-specific manner for numerous ENCODE datasets, including DNase-hypersensitivity as well as multiple segmentation-defined enhancer regions. Furthermore, we identify putatively functional SNPs that are both in regulatory elements in lymphocytes and are associated with gene expression changes in blood. We developed an algorithm, UES, that uses a Monte Carlo simulation approach to calculate the enrichment of previously identified risk SNPs in various functional elements. This multiscale approach integrating multiple datasets helps disentangle the underlying biology of lymphoma, and more broadly, is generally applicable to GWAS results from other diseases as well. PMID:26422229

  14. Identification of two regulatory elements controlling Fucosyltransferase 7 transcription in murine CD4+ T cells.

    PubMed

    Pink, Matthias; Ratsch, Boris A; Mardahl, Maibritt; Schröter, Micha F; Engelbert, Dirk; Triebus, Julia; Hamann, Alf; Syrbe, Uta

    2014-11-01

    Fucosyltransferase VII encoded by the gene Fut7 is essential in CD4(+) T cells for the generation of E- and P-selectin ligands (E- and P-lig) which facilitate recruitment of lymphocytes into inflamed tissues and into the skin. This study aimed to identify regulatory elements controlling the inducible Fut7 expression in CD4(+) T cells that occurs upon activation and differentiation of naive T cells into effector cells. Comparative analysis of the histone modification pattern in non-hematopoetic cells and CD4(+) T cell subsets revealed a differential histone modification pattern within the Fut7 locus including a conserved non-coding sequence (CNS) identified by cross-species conservation comparison suggesting that regulatory elements are confined to this region. Cloning of the CNS located about 500 bp upstream of the Fut7 locus, into a luciferase reporter vector elicited reporter activity after transfection of the αβ-WT T cell line, but not after transfection of primary murine CD4(+) Th1 cells. As quantification of different Fut7 transcripts revealed a predominance of transcripts lacking the first exons in primary Th1 cells we searched for an alternative promoter. Cloning of an intragenic region spanning a 1kb region upstream of exon 4 into an enhancer-containing vector indeed elicited promoter activity. Interestingly, also the CNS enhanced activity of this intragenic minimal promoter in reporter assays in primary Th1 cells suggesting that both elements interact in primary CD4(+) T cells to induce Fut7 transcription. PMID:24915132

  15. Transcription factor MITF and remodeller BRG1 define chromatin organisation at regulatory elements in melanoma cells

    PubMed Central

    Laurette, Patrick; Strub, Thomas; Koludrovic, Dana; Keime, Céline; Le Gras, Stéphanie; Seberg, Hannah; Van Otterloo, Eric; Imrichova, Hana; Siddaway, Robert; Aerts, Stein; Cornell, Robert A; Mengus, Gabrielle; Davidson, Irwin

    2015-01-01

    Microphthalmia-associated transcription factor (MITF) is the master regulator of the melanocyte lineage. To understand how MITF regulates transcription, we used tandem affinity purification and mass spectrometry to define a comprehensive MITF interactome identifying novel cofactors involved in transcription, DNA replication and repair, and chromatin organisation. We show that MITF interacts with a PBAF chromatin remodelling complex comprising BRG1 and CHD7. BRG1 is essential for melanoma cell proliferation in vitro and for normal melanocyte development in vivo. MITF and SOX10 actively recruit BRG1 to a set of MITF-associated regulatory elements (MAREs) at active enhancers. Combinations of MITF, SOX10, TFAP2A, and YY1 bind between two BRG1-occupied nucleosomes thus defining both a signature of transcription factors essential for the melanocyte lineage and a specific chromatin organisation of the regulatory elements they occupy. BRG1 also regulates the dynamics of MITF genomic occupancy. MITF-BRG1 interplay thus plays an essential role in transcription regulation in melanoma. DOI: http://dx.doi.org/10.7554/eLife.06857.001 PMID:25803486

  16. Regulation of human PTCH1b expression by different 5' untranslated region cis-regulatory elements

    PubMed Central

    Ozretić, Petar; Bisio, Alessandra; Musani, Vesna; Trnski, Diana; Sabol, Maja; Levanat, Sonja; Inga, Alberto

    2015-01-01

    PTCH1 gene codes for a 12-pass transmembrane receptor with a negative regulatory role in the Hedgehog-Gli signaling pathway. PTCH1 germline mutations cause Gorlin syndrome, a disorder characterized by developmental abnormalities and tumor susceptibility. The autosomal dominant inheritance, and the evidence for PTCH1 haploinsufficiency, suggests that fine-tuning systems of protein patched homolog 1 (PTC1) levels exist to properly regulate the pathway. Given the role of 5' untranslated region (5'UTR) in protein expression, our aim was to thoroughly explore cis-regulatory elements in the 5'UTR of PTCH1 transcript 1b. The (CGG)n polymorphism was the main potential regulatory element studied so far but with inconsistent results and no clear association between repeat number and disease risk. Using luciferase reporter constructs in human cell lines here we show that the number of CGG repeats has no strong impact on gene expression, both at mRNA and protein levels. We observed variability in the length of 5'UTR and changes in abundance of the associated transcripts after pathway activation. We show that upstream AUG codons (uAUGs) present only in longer 5'UTRs could negatively regulate the amount of PTC1 isoform L (PTC1-L). The existence of an internal ribosome entry site (IRES) observed using different approaches and mapped in the region comprising the CGG repeats, would counteract the effect of the uAUGs and enable synthesis of PTC1-L under stressful conditions, such as during hypoxia. Higher relative translation efficiency of PTCH1b mRNA in HEK 293T cultured hypoxia was observed by polysomal profiling and Western blot analyses. All our results point to an exceptionally complex and so far unexplored role of 5'UTR PTCH1b cis-element features in the regulation of the Hedgehog-Gli signaling pathway. PMID:25826662

  17. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei

    PubMed Central

    Gazestani, Vahid H.; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei. PMID:26529602

  18. Two cis-DNA elements involved in myeloid-cell-specific expression and gamma interferon (IFN-gamma) activation of the human high-affinity Fc gamma receptor gene: a novel IFN regulatory mechanism.

    PubMed Central

    Perez, C; Wietzerbin, J; Benech, P D

    1993-01-01

    The human high-affinity receptor for the constant region of immunoglobulin G (human Fc gamma R1) is encoded by two mRNAs induced selectively by gamma interferon (IFN-gamma) and expressed in cells of myeloid lineage. The cis-DNA element (GRR) previously found to confer IFN-gamma responsiveness to this gene acts as an inducible enhancer and is the target of an IFN-gamma-activated factor(s) (GIRE-BP) in cells of different origins. Although the GRR motif is not related to the DNA elements involved in the regulation of other IFN-stimulated genes, GIRE-BP binding depends on the IFN-gamma-dependent activation of the 91-kDa protein known to be one of the factors of a transcriptional complex activated by IFN-alpha. Deletions of the Fc gamma R1 promoter allowed us to identify a 25-bp element, downstream from the GRR motif, conferring cell-type-specific expression. This element, called MATE (myeloid activating transcription element), is the DNA target for constitutive factors forming two complexes, MATE-BP1 and MATE-BP2. In accordance with the functional analysis, MATE-BP binding activities were detected in extracts prepared from myeloid cell lines such as THP-1, HL-60, and U-937 but not in HeLa cell extracts. The MATE motif is present not only in the promoter of other Fc receptor genes but also in several promoters of genes whose expression is restricted to monocytic cells. Our results suggest that human Fc gamma R1 gene expression in myeloid cells is initiated by the interaction of IFN-gamma-activated factors with cell-type-specific factors through their binding to the GRR and MATE motifs. Images PMID:8455606

  19. Effects of species combination on comparative analyses of conserved regulatory elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cross-species DNA sequence comparison is the primary approach to discover regulatory elements by identifying highly conserved sequences due to evolutionary constraints. Previously, we reported that a systematic approach, combining position-specific weight matrixes (JASPAR) and phylogenetic footprint...

  20. Systematic identification of conserved regulatory elements in upstream promoter regions of the cattle genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cross-species DNA sequence comparison is the primary approach to discover regulatory elements by identifying highly conserved sequences due to evolutionary constraints. Previously, we reported that a systematic approach, combining position-specific weight matrixes (JASPAR) and phylogenetic footprint...

  1. Prediction of conserved regulatory elements in promoter regions of the cattle genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cross-species DNA sequence comparison is the primary approach to discover regulatory elements by identifying highly conserved sequences due to evolutionary constraints. Previously, we reported that a systematic approach, combining position-specific weight matrixes (JASPAR) and phylogenetic footprint...

  2. A transcriptional regulatory element in the coding sequence of the human Bcl-2 gene

    PubMed Central

    Lang, Georgina; Gombert, Wendy M; Gould, Hannah J

    2005-01-01

    We investigated the protein-binding sites in a DNAse I hypersensitive site associated with bcl-2 gene expression in human B cells. We mapped this hypersensitive site to the coding sequence of exon 2 of the bcl-2 gene in the bcl-2-expressing REH B-cell line. Electrophoretic mobility shift assays (EMSAs) with extracts from REH cells revealed three previously unrecognized B-Myb-binding sites in this sequence. The protein was identified as B-Myb by using a specific antibody and EMSAs. Accordingly, the levels of B-Myb and bcl-2 proteins, and of Myb EMSA activity, were correlated over a wide range of cell lines, representing different stages of B-cell development. Transfection of REH cells with antisense B-myb down-regulated EMSA activity and the level of bcl-2, and led to the apoptosis of REH cells. Transfection of the bcl-2-non-expressing RPMI 8226 cell line with a B-Myb expression vector induced B-Myb EMSA activity and the expression of bcl-2. Reporter assays indicated that the HSS8 sequence containing the three B-Myb sites may act as an enhancer when it is linked to the bcl-2 gene promoter. Interaction of B-Myb with HSS8 may enhance bcl-2 gene expression by co-operating with positive regulatory elements (e.g. previously identified B-Myb response elements) or silencing negative response elements in the bcl-2 gene promoter. PMID:15606792

  3. Functional characterization of transcriptional regulatory elements in the upstream region of the yeast GLK1 gene.

    PubMed Central

    Herrero, P; Flores, L; de la Cera, T; Moreno, F

    1999-01-01

    The glucokinase gene GLK1 of the yeast Saccharomyces cerevisiae is transcriptionally regulated in response to the carbon source of the growth medium. Northern-blot analysis shows that the GLK1 gene is expressed at a basal level in the presence of glucose, de-repressed more than 6-fold under conditions of sugar limitation and more than 25-fold under conditions of ethanol induction. lacZ fusions of the GLK1 gene promoter were constructed and a deletion analysis was performed in order to identify the cis-acting regulatory elements of the promoter that controls GLK1 gene expression. First, the expression seemed to be mediated mainly by one GCR1 and three stress-responsive element (STRE) activating elements. Secondly, an ethanol repression autoregulation (ERA)/twelve-fold TA repeat (TAB) repressor element was identified within the promoter region of the GLK1 gene. A specific and differential protein binding to the STRE was observed with extracts from de-repressed and repressed cells. No differential binding to the GCR1 or ERA/TAB elements was observed with extracts from de-repressed and repressed cells, but, in both cases, the binding was competed for by an excess of the unlabelled GLK1(GCR1) and GLK1(ERA) sequence. The transcription factors Msn2 and Msn4, which bind to the GLK1 upstream region through the STRE, contribute to inductive activation. The transcription factor Gcr1, which binds through the GCR1 element, contributes to constitutive activation. In order to achieve the severe glucose repression of GLK1, constitutive repressor factors acting through the ERA/TAB element must counteract constitutive activation generated by Gcr1 binding to the GCR1 element. Full expression of the GLK1 gene is produced by inductive activation of three STRE when Msn2 and Msn4 proteins are translocated to the nucleus by covalent modification. The combinatorial effect of the entire region leads to the regulated transcription of GLK1, i.e., silent in media with glucose and other

  4. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1995-01-01

    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  5. Splicing regulation: From a parts list of regulatory elements to an integrated splicing code

    PubMed Central

    Wang, Zefeng; Burge, Christopher B.

    2008-01-01

    Alternative splicing of pre-mRNAs is a major contributor to both proteomic diversity and control of gene expression levels. Splicing is tightly regulated in different tissues and developmental stages, and its disruption can lead to a wide range of human diseases. An important long-term goal in the splicing field is to determine a set of rules or “code” for splicing that will enable prediction of the splicing pattern of any primary transcript from its sequence. Outside of the core splice site motifs, the bulk of the information required for splicing is thought to be contained in exonic and intronic cis-regulatory elements that function by recruitment of sequence-specific RNA-binding protein factors that either activate or repress the use of adjacent splice sites. Here, we summarize the current state of knowledge of splicing cis-regulatory elements and their context-dependent effects on splicing, emphasizing recent global/genome-wide studies and open questions. PMID:18369186

  6. Engineering Synthetic cis-Regulatory Elements for Simultaneous Recognition of Three Transcriptional Factors in Bacteria.

    PubMed

    Amores, Gerardo Ruiz; Guazzaroni, María-Eugenia; Silva-Rocha, Rafael

    2015-12-18

    Recognition of cis-regulatory elements by transcription factors (TF) at target promoters is crucial to gene regulation in bacteria. In this process, binding of TFs to their cognate sequences depends on a set of physical interactions between these proteins and specific nucleotides in the operator region. Previously, we showed that in silico optimization algorithms are able to generate short sequences that are recognized by two different TFs of Escherichia coli, namely, CRP and IHF, thus generating an AND logic gate. Here, we expanded this approach in order to engineer DNA sequences that can be simultaneously recognized by three unrelated TFs (CRP, IHF, and Fis). Using in silico optimization and experimental validation strategies, we were able to obtain a candidate promoter (Plac-CFI1) regulated by only two TFs with an AND logic, thus demonstrating a limitation in the design. Subsequently, we modified the algorithm to allow the optimization of extended sequences, and were able to design two synthetic promoters (PCFI20-1 and PCFI22-5) that were functional in vivo. Expression assays in E. coli mutant strains for each TF revealed that while CRP positively regulates the promoter activities, IHF and Fis are strong repressors of both the promoter variants. Taken together, our results demonstrate the potential of in silico strategies in bacterial synthetic promoter engineering. Furthermore, the study also shows how small modifications in cis-regulatory elements can drastically affect the final logic of the resulting promoter. PMID:26305598

  7. [Identification and mapping of cis-regulatory elements within long genomic sequences].

    PubMed

    Akopov, S B; Chernov, I P; Vetchinova, A S; Bulanenkova, S S; Nikolaev, L G

    2007-01-01

    The publication of the human and other metazoan genome sequences opened up the possibility for mapping and analysis of genomic regulatory elements. Unfortunately, experimental data on genomic positions of such sequences as enhancers, silencers, insulators, transcription terminators, and replication origins are very limited, especially at the whole genome level. As most genomic regulatory elements (e.g., enhancers) are generally gene-, tissue-, or cell-specific, the prediction of these elements in silico is often ambiguous. Therefore, the development of high-throughput experimental approaches for identification and mapping of genomic functional elements is highly desirable. In this review we discuss novel approaches to high-throughput experimental identification of mammalian genomes cis-regulatory elements which is a necessary step toward the complete genome annotation. PMID:18240562

  8. Structure of Proximal and Distant Regulatory Elements in the Human Genome

    NASA Astrophysics Data System (ADS)

    Ovcharenko, Ivan

    Clustering of multiple transcription factor binding sites (TFBSs) for the same transcription factor (TF) is a common feature of cis-regulatory modules in invertebrate animals, but the occurrence of such homotypic clusters of TFBSs (HCTs) in the human genome has remained largely unknown. To explore whether HCTs are also common in human and other vertebrates, we used known binding motifs for vertebrate TFs and a hidden Markov model-based approach to detect HCTs in the human, mouse, chicken, and fugu genomes, and examined their association with cis-regulatory modules. We found that evolutionarily conserved HCTs occupy nearly 2% of the human genome, with experimental evidence for individual TFs supporting their binding to predicted HCTs. More than half of promoters of human genes contain HCTs, with a distribution around the transcription start site in agreement with the experimental data from the ENCODE project. In addition, almost half of 487 experimentally validated developmental enhancers contain them as well - a number more than 25-fold larger than expected by chance. We also found evidence of negative selection acting on TFBSs within HCTs, as the conservation of TFBSs is stronger than the conservation of sequences separating them. The important role of HCTs as components of developmental enhancers is additionally supported by a strong correlation between HCTs and the binding of the enhancer-associated co-activator protein p300. Experimental validation of HCT-containing elements in both zebrafish and mouse suggest that HCTs could be used to predict both the presence of enhancers and their tissue specificity, and are thus a feature that can be effectively used in deciphering the gene regulatory code. In conclusion, our results indicate that HCTs are a pervasive feature of human cis-regulatory modules and suggest that they play an important role in gene regulation in the human and other vertebrate genomes.

  9. Identification and Functional Characterization of Cis-Regulatory Elements Controlling Expression of the Porcine ADRB2 Gene

    PubMed Central

    Jaeger, Alexandra; Fritschka, Stephan; Ponsuksili, Siriluck; Wimmers, Klaus; Muráni, Eduard

    2015-01-01

    The beta-2 adrenergic receptor (beta-2 AR) modulates metabolic processes in skeletal muscle, liver, and adipose tissue in response to catecholamine stimulation. We showed previously that expression of the porcine beta-2 AR gene (ADRB2) is affected by cis-regulatory polymorphisms. These are most likely responsible for the association of ADRB2 with economically relevant muscle-related traits in pigs. The present study focused on characterization of promoter elements involved in basal transcriptional regulation of the porcine ADRB2 in different cell types to aid identification of its cis-regulatory polymorphisms. Based on in silico analysis, luciferase reporter gene assays and gel shift assays were performed using COS-7, HepG2, C2C12, and 3T3-L1 cells. Deletion mapping of the 5´ flanking region (-1324 to +33) of ADRB2 revealed the region between -307 and -269 to be the minimal promoter, including regulatory elements essential for the basal transcriptional activity in all four tested cell types. Directly upstream (-400 to -323) we identified an important enhancer element required for maximal promoter activity. In silico analysis and gel shift assays revealed that this GC-rich element harbors two evolutionarily conserved binding sites of Sp1, a constitutive transcriptional activator. Significant transcriptional activation of the porcine ADRB2 promoter was demonstrated by overexpression of Sp1. Our results demonstrate, for the first time, an important role of Sp1 and of the responsive enhancer element in the regulation of ADRB2 expression. Polymorphisms located in this domain of the porcine ADRB2 promoter represent candidate causal cis-regulatory variants. PMID:26221068

  10. Predictive modelling of gene expression from transcriptional regulatory elements.

    PubMed

    Budden, David M; Hurley, Daniel G; Crampin, Edmund J

    2015-07-01

    Predictive modelling of gene expression provides a powerful framework for exploring the regulatory logic underpinning transcriptional regulation. Recent studies have demonstrated the utility of such models in identifying dysregulation of gene and miRNA expression associated with abnormal patterns of transcription factor (TF) binding or nucleosomal histone modifications (HMs). Despite the growing popularity of such approaches, a comparative review of the various modelling algorithms and feature extraction methods is lacking. We define and compare three methods of quantifying pairwise gene-TF/HM interactions and discuss their suitability for integrating the heterogeneous chromatin immunoprecipitation (ChIP)-seq binding patterns exhibited by TFs and HMs. We then construct log-linear and ϵ-support vector regression models from various mouse embryonic stem cell (mESC) and human lymphoblastoid (GM12878) data sets, considering both ChIP-seq- and position weight matrix- (PWM)-derived in silico TF-binding. The two algorithms are evaluated both in terms of their modelling prediction accuracy and ability to identify the established regulatory roles of individual TFs and HMs. Our results demonstrate that TF-binding and HMs are highly predictive of gene expression as measured by mRNA transcript abundance, irrespective of algorithm or cell type selection and considering both ChIP-seq and PWM-derived TF-binding. As we encourage other researchers to explore and develop these results, our framework is implemented using open-source software and made available as a preconfigured bootable virtual environment. PMID:25231769

  11. From Cis-Regulatory Elements to Complex RNPs and Back

    PubMed Central

    Gebauer, Fátima; Preiss, Thomas; Hentze, Matthias W.

    2012-01-01

    Messenger RNAs (mRNAs), the templates for translation, have evolved to harbor abundant cis-acting sequences that affect their posttranscriptional fates. These elements are frequently located in the untranslated regions and serve as binding sites for trans-acting factors, RNA-binding proteins, and/or small non-coding RNAs. This article provides a systematic synopsis of cis-acting elements, trans-acting factors, and the mechanisms by which they affect translation. It also highlights recent technical advances that have ushered in the era of transcriptome-wide studies of the ribonucleoprotein complexes formed by mRNAs and their trans-acting factors. PMID:22751153

  12. Biosynthesis of nitric oxide activates iron regulatory factor in macrophages.

    PubMed Central

    Drapier, J C; Hirling, H; Wietzerbin, J; Kaldy, P; Kühn, L C

    1993-01-01

    Biosynthesis of nitric oxide (NO) from L-arginine modulates activity of iron-dependent enzymes, including mitochondrial acontiase, an [Fe-S] protein. We examined the effect of NO on the activity of iron regulatory factor (IRF), a cytoplasmic protein which modulates both ferritin mRNA translation and transferrin receptor mRNA stability by binding to specific mRNA sequences called iron responsive elements (IREs). Murine macrophages were activated with interferon-gamma and lipopolysaccharide to induce NO synthase activity and cultured in the presence or absence of NG-substituted analogues of L-arginine which served as selective inhibitors of NO synthesis. Measurement of the nitrite concentration in the culture medium was taken as an index of NO production. Mitochondria-free cytosols were then prepared and aconitase activity as well as IRE binding activity and induction of IRE binding activity were correlated and depended on NO synthesis after IFN-gamma and/or LPS stimulation. Authentic NO gas as well as the NO-generating compound 3-morpholinosydnonimine (SIN-1) also conversely modulated aconitase and IRE binding activities of purified recombinant IRF. These results provide evidence that endogenously produced NO may modulate the post-transcriptional regulation of genes involved in iron homeostasis and support the hypothesis that the [Fe-S] cluster of IRF mediates iron-dependent regulation. Images PMID:7504626

  13. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element

    SciTech Connect

    Mao, Grace; Brody, James P.

    2007-11-09

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16 bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16 bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014 s{sup -1}. We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase.

  14. SORPTION OF ELEMENTAL MERCURY BY ACTIVATED CARBONS

    EPA Science Inventory

    The mechanisms and rate of elemental mercury (HgO) capture by activated carbons have been studied using a bench-scale apparatus. Three types of activated carbons, two of which are thermally activated (PC-100 and FGD) and one with elemental sulfur (S) impregnated in it (HGR), were...

  15. Lessons from Domestication: Targeting Cis-Regulatory Elements for Crop Improvement.

    PubMed

    Swinnen, Gwen; Goossens, Alain; Pauwels, Laurens

    2016-06-01

    Domestication of wild plant species has provided us with crops that serve our human nutritional needs. Advanced DNA sequencing has propelled the unveiling of underlying genetic changes associated with domestication. Interestingly, many changes reside in cis-regulatory elements (CREs) that control the expression of an unmodified coding sequence. Sequence variation in CREs can impact gene expression levels, but also developmental timing and tissue specificity of expression. When genes are involved in multiple pathways or active in several organs and developmental stages CRE modifications are favored in contrast to mutations in coding regions, due to the lack of detrimental pleiotropic effects. Therefore, learning from domestication, we propose that CREs are interesting targets for genome editing to create new alleles for plant breeding. PMID:26876195

  16. A small regulatory element from chromosome 19 enhances liver-specific gene expression

    PubMed Central

    Li, C; Hirsch, M; Carter, P; Asokan, A; Zhou, X; Wu, Z; Samulski, RJ

    2016-01-01

    Tissue-specific promoters for gene therapy are typically too big for adeno-associated virus (AAV) vectors; thus, the exploration of small effective non-viral regulatory elements is of particular interest. Wild-type AAV can specifically integrate into a region on human chromosome 19 termed AAVS1. Earlier work has determined that a 347 bp fragment (Chr19) of AAVS1 has promoter and transcriptional enhancer activities. In this study, we further characterized this genetic regulation and investigated its application to AAV gene therapy in vitro and in vivo. The Chr19 347 bp fragment was dissected into three regulatory elements in human embryonic kidney cells: (i) TATA-independent promoter activity distributed throughout the fragment regardless of orientation, (ii) an orientation-dependent insulator function near the 5′ end and (iii) a 107 bp enhancer region near the 3′ end. The small enhancer region, coupled to the mini-CMV promoter, was used to drive the expression of several reporters following transduction by AAV2. In vivo data demonstrated enhanced transgene expression from the Chr19-mini-CMV promoter cassette after tail vein injection primarily in the liver at levels comparable to the chicken β-actin promoter and higher than the liver-specific TTR promoter (>2-fold). However, we did not observe this increase after muscle injection, suggesting tissue-specific enhancement. All of the results support identification of a small DNA fragment (347 bp) from AAV Chr19 integration site capable of providing efficient and enhanced liver-specific transcription when used in recombinant AAV vectors. PMID:18701910

  17. Functional conservation of Pax6 regulatory elements in humans and mice demonstrated with a novel transgenic reporter mouse

    PubMed Central

    Tyas, David A; Simpson, T Ian; Carr, Catherine B; Kleinjan, Dirk A; van Heyningen, Veronica; Mason, John O; Price, David J

    2006-01-01

    Background The Pax6 transcription factor is expressed during development in the eyes and in specific CNS regions, where it is essential for normal cell proliferation and differentiation. Mice lacking one or both copies of the Pax6 gene model closely humans with loss-of-function mutations in the PAX6 locus. The sequence of the Pax6/PAX6 protein is identical in mice and humans and previous studies have shown structural conservation of the gene's regulatory regions. Results We generated a transgenic mouse expressing green fluorescent protein (GFP) and neomycin resistance under the control of the entire complement of human PAX6 regulatory elements using a modified yeast artificial chromosome (YAC). Expression of GFP was studied in embryos from 9.5 days on and was confined to cells known to express Pax6. GFP expression was sufficiently strong that expressing cells could be distinguished from non-expressing cells using flow cytometry. Conclusion This work demonstrates the functional conservation of the regulatory elements controlling Pax6/PAX6 expression in mice and humans. The transgene provides an excellent tool for studying the functions of different Pax6/PAX6 regulatory elements in controlling Pax6 expression in animals that are otherwise normal. It will allow the analysis and isolation of cells in which Pax6 is activated, irrespective of the status of the endogenous locus. PMID:16674807

  18. Rat beta 1-adrenergic receptor regulatory region containing consensus AP-2 elements recognizes novel transactivator proteins.

    PubMed

    Kirigiti, P; Yang, Y F; Li, X; Li, B; Midson, C N; Machida, C A

    2000-03-01

    beta 1-Adrenergic receptors (beta1-ARs) serve as important regulators of central nervous system (CNS)-mediated behavior and several neural functions, including mood, memory, neuroendocrine control, and stimulation of autonomic function. Using beta 1-AR-luciferase reporter recombinants, we have previously determined that important beta 1-AR genetic elements controlling expression within the C6 glioma cell line are contained within the region -396 to -299, relative to the translational start site. By conducting progressive internal deletions of the rat beta 1-AR 5' flanking region and with the use of beta 1-AR-luciferase recombinants, we have verified that this region contains the primary beta 1-AR promoter and/or major regulatory elements. To begin the identification of protein factors involved in beta 1-AR transcriptional activity conferred by this beta 1-AR region and flanking sequences, we conducted electrophoretic mobility shift assays using defined beta 1-AR DNA subregion probes. One probe (GS-1), encompassing the region -396 to -367, was found to produce two major and two minor mobility shift complexes when bound to nuclear extracts from the beta 1-AR expresser C6 cell line. UV-crosslinking of DNA-protein complexes, coupled with DNase I digestion, indicated that this beta 1-AR region interacts with one major protein of approximately 117 kDa molecular weight and additional minor proteins. GS-1 DNA-protein complexes were observed using beta 1-AR expresser tissues in the CNS, including cortex, hippocampus, and olfactory bulb. No DNA-protein complexes were observed when using nuclear extracts from beta 1-AR nonexpresser tissues; in some cases, using L6 cells, previously characterized to express little or no beta1-ARs, a reduction in intensities of the DNA-protein complexes was observed. Competition experiments indicate that nuclear protein binds to one of two subregions within the GS-1 sequence that contain AP-2-like consensus elements. Recombinant AP-2 protein

  19. Long Terminal Repeats: From Parasitic Elements to Building Blocks of the Transcriptional Regulatory Repertoire.

    PubMed

    Thompson, Peter J; Macfarlan, Todd S; Lorincz, Matthew C

    2016-06-01

    The life cycle of endogenous retroviruses (ERVs), also called long terminal repeat (LTR) retrotransposons, begins with transcription by RNA polymerase II followed by reverse transcription and re-integration into the host genome. While most ERVs are relics of ancient integration events, "young" proviruses competent for retrotransposition-found in many mammals, but not humans-represent an ongoing threat to host fitness. As a consequence, several restriction pathways have evolved to suppress their activity at both transcriptional and post-transcriptional stages of the viral life cycle. Nevertheless, accumulating evidence has revealed that LTR sequences derived from distantly related ERVs have been exapted as regulatory sequences for many host genes in a wide range of cell types throughout mammalian evolution. Here, we focus on emerging themes from recent studies cataloging the diversity of ERV LTRs acting as important transcriptional regulatory elements in mammals and explore the molecular features that likely account for LTR exaptation in developmental and tissue-specific gene regulation. PMID:27259207

  20. Genetic Analysis of Transvection Effects Involving Cis-Regulatory Elements of the Drosophila Ultrabithorax Gene

    PubMed Central

    Micol, J. L.; Castelli-Gair, J. E.; Garcia-Bellido, A.

    1990-01-01

    The Ultrabithorax (Ubx) gene of Drosophila melanogaster contains two functionally distinguishable regions: the protein-coding Ubx transcription unit and, upstream of it, the transcribed but non-protein-coding bxd region. Numerous recessive, partial loss-of-function mutations which appear to be regulatory mutations map within the bxd region and within the introns of the Ubx transcription unit. In addition, mutations within the Ubx unit exons are known and most of these behave as null alleles. Ubx(1) is one such allele. We have confirmed that, although the Ubx(1) allele does not produce detectable Ubx proteins (UBX), it does retain other genetic functions detectable by their effects on the expression of a paired, homologous Ubx allele, i.e., by transvection. We have extended previous analyses made by E. B. Lewis by mapping the critical elements of the Ubx gene which participate in transvection effects. Our results show that the Ubx(1) allele retains wild-type functions whose effectiveness can be reduced (1) by additional cis mutations in the bxd region or in introns of the Ubx transcription unit, as well as (2) by rearrangements disturbing pairing between homologous Ubx genes. Our results suggest that those remnant functions in Ubx(1) are able to modulate the activity of the allele located in the homologous chromosome. We discuss the normal cis regulatory role of these functions involved in trans interactions between homologous Ubx genes, as well as the implications of our results for the current models on transvection. PMID:2123161

  1. Human polyomavirus JCV late leader peptide region contains important regulatory elements

    SciTech Connect

    Akan, Ilhan; Sariyer, Ilker Kudret; Biffi, Renato; Palermo, Victoria; Woolridge, Stefanie; White, Martyn K.; Amini, Shohreh |; Khalili, Kamel; Safak, Mahmut . E-mail: msafak@temple.edu

    2006-05-25

    Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader

  2. Widespread contribution of transposable elements to the innovation of gene regulatory networks.

    PubMed

    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter; Snyder, Michael P; Wang, Ting

    2014-12-01

    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF-TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution. PMID:25319995

  3. Widespread contribution of transposable elements to the innovation of gene regulatory networks

    PubMed Central

    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter

    2014-01-01

    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF–TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution. PMID:25319995

  4. EMERGE: a flexible modelling framework to predict genomic regulatory elements from genomic signatures

    PubMed Central

    van Duijvenboden, Karel; de Boer, Bouke A.; Capon, Nicolas; Ruijter, Jan M.; Christoffels, Vincent M.

    2016-01-01

    Regulatory DNA elements, short genomic segments that regulate gene expression, have been implicated in developmental disorders and human disease. Despite this clinical urgency, only a small fraction of the regulatory DNA repertoire has been confirmed through reporter gene assays. The overall success rate of functional validation of candidate regulatory elements is low. Moreover, the number and diversity of datasets from which putative regulatory elements can be identified is large and rapidly increasing. We generated a flexible and user-friendly tool to integrate the information from different types of genomic datasets, e.g. ATAC-seq, ChIP-seq, conservation, aiming to increase the ease and success rate of functional prediction. To this end, we developed the EMERGE program that merges all datasets that the user considers informative and uses a logistic regression framework, based on validated functional elements, to set optimal weights to these datasets. ROC curve analysis shows that a combination of datasets leads to improved prediction of tissue-specific enhancers in human, mouse and Drosophila genomes. Functional assays based on this prediction can be expected to have substantially higher success rates. The resulting integrated signal for prediction of functional elements can be plotted in a build-in genome browser or exported for further analysis. PMID:26531828

  5. The role and activities of the ISCT Regulatory Affairs Committee.

    PubMed

    Kelley, L

    2003-01-01

    The following article is written as part of a series of reviews addressing regulatory issues relevant to the field of cellular therapy. The first in the series describes the activities and mission of the Legal and Regulatory Affairs Committee of ISCT. PMID:12944232

  6. The identification of cis-regulatory elements: A review from a machine learning perspective.

    PubMed

    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

    2015-12-01

    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field. PMID:26499213

  7. A novel mutation of the GATA site in the erythroid cell-specific regulatory element of the ABO gene in a blood donor with the Am B phenotype.

    PubMed

    Oda, A; Isa, K; Ogasawara, K; Kameyama, K; Okuda, K; Hirashima, M; Ishii, H; Kimura, K; Matsukura, H; Hirayama, F; Kawa, K

    2015-05-01

    The Am and Bm phenotypes are characterized by weak expression of the A or B antigens, respectively, by red blood cells with a normal expression by the saliva of secretors. Deletion of the regulatory element in the first intron of the ABO gene and disruption of the GATA motif in the element were found to be responsible. In this study, we identified a novel mutation within the GATA motif (G>C substitution at position c.28 + 5830) in the regulatory element of the A allele that might diminish transcription activity causing the generation of the Am B phenotype. PMID:25557060

  8. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    SciTech Connect

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

    2010-12-22

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  9. Characterization of a novel positive transcription regulatory element that differentially regulates the alpha-2-macroglobulin gene in replicative senescence.

    PubMed

    Li, Renzhong; Ma, Liwei; Huang, Yu; Zhang, Zongyu; Tong, Tanjun

    2011-12-01

    Alpha-2-macroglobulin (α2M), a protease inhibitor, is implicated in Alzheimer's disease, atherosclerosis, and other age-related diseases. The elevated level of α2M mRNA has been described in replicative senescence and it could be used as a biomarker of the aging cells. However, the mechanism responsible for the up-regulation of its expression is still unclear. This report identified a novel transcriptional regulatory element, the α2M transcription enhancement element (ATEE), within the α2M promoter. This element differentially activates α2M expression in senescent versus young fibroblasts. Electrophoretic mobility shift assays revealed abundant complexes in senescent cell nuclear extracts compared with young cell nuclear extracts. The DNase I footprint revealed the protein-binding core sequence through which the protein binds the ATEE. Mutation within ATEE selectively abolished α2M promoter activity in senescent (but not young) cells. These results indicated the ATEE, as a positive transcription regulatory element, contributes to the up-regulation of α2M during replicative senescence. PMID:21541797

  10. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements

    PubMed Central

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; d'Alché-Buc, Florence; Benoit, Gérard

    2015-01-01

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated with RAR/RXR genomic redistribution during the differentiation process. In-depth analysis of RAR/RXR binding sites occupancy dynamics and composition show that in undifferentiated cells, RAR/RXR interact with genomic regions characterized by binding of pluripotency-associated factors and high prevalence of the non-canonical DR0-containing RA response element. By contrast, in differentiated cells, RAR/RXR bound regions are enriched in functional Sox17 binding sites and are characterized with a higher frequency of the canonical DR5 motif. Our data offer an unprecedentedly detailed view on the action of RA in triggering pluripotent cell differentiation and demonstrate that RAR/RXR action is mediated via two different sets of regulatory regions tightly associated with cell differentiation status. PMID:25897113

  11. RAR/RXR binding dynamics distinguish pluripotency from differentiation associated cis-regulatory elements.

    PubMed

    Chatagnon, Amandine; Veber, Philippe; Morin, Valérie; Bedo, Justin; Triqueneaux, Gérard; Sémon, Marie; Laudet, Vincent; d'Alché-Buc, Florence; Benoit, Gérard

    2015-05-26

    In mouse embryonic cells, ligand-activated retinoic acid receptors (RARs) play a key role in inhibiting pluripotency-maintaining genes and activating some major actors of cell differentiation. To investigate the mechanism underlying this dual regulation, we performed joint RAR/RXR ChIP-seq and mRNA-seq time series during the first 48 h of the RA-induced Primitive Endoderm (PrE) differentiation process in F9 embryonal carcinoma (EC) cells. We show here that this dual regulation is associated with RAR/RXR genomic redistribution during the differentiation process. In-depth analysis of RAR/RXR binding sites occupancy dynamics and composition show that in undifferentiated cells, RAR/RXR interact with genomic regions characterized by binding of pluripotency-associated factors and high prevalence of the non-canonical DR0-containing RA response element. By contrast, in differentiated cells, RAR/RXR bound regions are enriched in functional Sox17 binding sites and are characterized with a higher frequency of the canonical DR5 motif. Our data offer an unprecedentedly detailed view on the action of RA in triggering pluripotent cell differentiation and demonstrate that RAR/RXR action is mediated via two different sets of regulatory regions tightly associated with cell differentiation status. PMID:25897113

  12. Detecting conserved regulatory elements with the model genome of the Japanese puffer fish, Fugu rubripes.

    PubMed Central

    Aparicio, S; Morrison, A; Gould, A; Gilthorpe, J; Chaudhuri, C; Rigby, P; Krumlauf, R; Brenner, S

    1995-01-01

    Comparative vertebrate genome sequencing offers a powerful method for detecting conserved regulatory sequences. We propose that the compact genome of the teleost Fugu rubripes is well suited for this purpose. The evolutionary distance of teleosts from other vertebrates offers the maximum stringency for such evolutionary comparisons. To illustrate the comparative genome approach for F. rubripes, we use sequence comparisons between mouse and Fugu Hoxb-4 noncoding regions to identify conserved sequence blocks. We have used two approaches to test the function of these conserved blocks. In the first, homologous sequences were deleted from a mouse enhancer, resulting in a tissue-specific loss of activity when assayed in transgenic mice. In the second approach, Fugu DNA sequences showing homology to mouse sequences were tested for enhancer activity in transgenic mice. This strategy identified a neural element that mediates a subset of Hoxb-4 expression that is conserved between mammals and teleosts. The comparison of noncoding vertebrate sequences with those of Fugu, coupled to a transgenic bioassay, represents a general approach suitable for many genome projects. Images Fig. 2 Fig. 3 Fig. 4 PMID:7878040

  13. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  14. Regulatory elements responsible for inducible expression of the granulocyte colony-stimulating factor gene in macrophages.

    PubMed Central

    Nishizawa, M; Nagata, S

    1990-01-01

    Granulocyte colony-stimulating factor (G-CSF) plays an essential role in granulopoiesis during bacterial infection. Macrophages produce G-CSF in response to bacterial endotoxins such as lipopolysaccharide (LPS). To elucidate the mechanism of the induction of G-CSF gene in macrophages or macrophage-monocytes, we have examined regulatory cis elements in the promoter of mouse G-CSF gene. Analyses of linker-scanning and internal deletion mutants of the G-CSF promoter by the chloramphenicol acetyltransferase assay have indicated that at least three regulatory elements are indispensable for the LPS-induced expression of the G-CSF gene in macrophages. When one of the three elements was reiterated and placed upstream of the TATA box of the G-CSF promoter, it mediated inducibility as a tissue-specific and orientation-independent enhancer. Although this element contains a conserved NF-kappa B-like binding site, the gel retardation assay and DNA footprint analysis with nuclear extracts from macrophage cell lines demonstrated that nuclear proteins bind to the DNA sequence downstream of the NF-kappa B-like element, but not to the conserved element itself. The DNA sequence of the binding site was found to have some similarities to the LPS-responsive element which was recently identified in the promoter of the mouse class II major histocompatibility gene. Images PMID:1691438

  15. Disease-associated variants in different categories of disease located in distinct regulatory elements

    PubMed Central

    2015-01-01

    Background The invention of high throughput sequencing technologies has led to the discoveries of hundreds of thousands of genetic variants associated with thousands of human diseases. Many of these genetic variants are located outside the protein coding regions, and as such, it is challenging to interpret the function of these genetic variants by traditional genetic approaches. Recent genome-wide functional genomics studies, such as FANTOM5 and ENCODE have uncovered a large number of regulatory elements across hundreds of different tissues or cell lines in the human genome. These findings provide an opportunity to study the interaction between regulatory elements and disease-associated genetic variants. Identifying these diseased-related regulatory elements will shed light on understanding the mechanisms of how these variants regulate gene expression and ultimately result in disease formation and progression. Results In this study, we curated and categorized 27,558 Mendelian disease variants, 20,964 complex disease variants, 5,809 cancer predisposing germline variants, and 43,364 recurrent cancer somatic mutations. Compared against nine different types of regulatory regions from FANTOM5 and ENCODE projects, we found that different types of disease variants show distinctive propensity for particular regulatory elements. Mendelian disease variants and recurrent cancer somatic mutations are 22-fold and 10- fold significantly enriched in promoter regions respectively (q<0.001), compared with allele-frequency-matched genomic background. Separate from these two categories, cancer predisposing germline variants are 27-fold enriched in histone modification regions (q<0.001), 10-fold enriched in chromatin physical interaction regions (q<0.001), and 6-fold enriched in transcription promoters (q<0.001). Furthermore, Mendelian disease variants and recurrent cancer somatic mutations share very similar distribution across types of functional effects. We further found that

  16. Identification of a novel cis-regulatory element essential for immune tolerance.

    PubMed

    LaFlam, Taylor N; Seumois, Grégory; Miller, Corey N; Lwin, Wint; Fasano, Kayla J; Waterfield, Michael; Proekt, Irina; Vijayanand, Pandurangan; Anderson, Mark S

    2015-11-16

    Thymic central tolerance is essential to preventing autoimmunity. In medullary thymic epithelial cells (mTECs), the Autoimmune regulator (Aire) gene plays an essential role in this process by driving the expression of a diverse set of tissue-specific antigens (TSAs), which are presented and help tolerize self-reactive thymocytes. Interestingly, Aire has a highly tissue-restricted pattern of expression, with only mTECs and peripheral extrathymic Aire-expressing cells (eTACs) known to express detectable levels in adults. Despite this high level of tissue specificity, the cis-regulatory elements that control Aire expression have remained obscure. Here, we identify a highly conserved noncoding DNA element that is essential for Aire expression. This element shows enrichment of enhancer-associated histone marks in mTECs and also has characteristics of being an NF-κB-responsive element. Finally, we find that this element is essential for Aire expression in vivo and necessary to prevent spontaneous autoimmunity, reflecting the importance of this regulatory DNA element in promoting immune tolerance. PMID:26527800

  17. Organisation of regulatory elements in two closely spaced Drosophila genes with common expression characteristics.

    PubMed

    Gigliotti, S; Balz, V; Malva, C; Schäfer, M A

    1997-11-01

    Sperm tail proteins that are components of a specific structure formed late during spermatid elongation have been found to be encoded by the Mst(3)CGP gene family. These genes have been demonstrated to be regulated both at the transcriptional as well as at the translational level. We report here on the dissection of the regulatory regions for two members of the gene family, Mst84Da and Mst84Db. While high level transcription and negative translational control of Mst84Da is mediated by a short gene segment of 205 nt (-152/+53), Mst84Db expression is controlled by a number of distinct regulatory elements with different effects that all reside within the gene itself. We identify a transcriptional control element between +154 and +216, a translational repression element around +216 to +275 and an RNA stability element within the 3'UTR. Irrespective of the final common expression characteristics, correct regulation for any individual member of the gene family seems to be achieved by very different means. This confirms earlier observations that did not detect any other sequence elements in common apart from the TCE (translational control element). PMID:9431808

  18. Mutagenesis of GATA motifs controlling the endoderm regulator elt-2 reveals distinct dominant and secondary cis-regulatory elements.

    PubMed

    Du, Lawrence; Tracy, Sharon; Rifkin, Scott A

    2016-04-01

    Cis-regulatory elements (CREs) are crucial links in developmental gene regulatory networks, but in many cases, it can be difficult to discern whether similar CREs are functionally equivalent. We found that despite similar conservation and binding capability to upstream activators, different GATA cis-regulatory motifs within the promoter of the C. elegans endoderm regulator elt-2 play distinctive roles in activating and modulating gene expression throughout development. We fused wild-type and mutant versions of the elt-2 promoter to a gfp reporter and inserted these constructs as single copies into the C. elegans genome. We then counted early embryonic gfp transcripts using single-molecule RNA FISH (smFISH) and quantified gut GFP fluorescence. We determined that a single primary dominant GATA motif located 527bp upstream of the elt-2 start codon was necessary for both embryonic activation and later maintenance of transcription, while nearby secondary GATA motifs played largely subtle roles in modulating postembryonic levels of elt-2. Mutation of the primary activating site increased low-level spatiotemporally ectopic stochastic transcription, indicating that this site acts repressively in non-endoderm cells. Our results reveal that CREs with similar GATA factor binding affinities in close proximity can play very divergent context-dependent roles in regulating the expression of a developmentally critical gene in vivo. PMID:26896592

  19. Identification of a positive transcription regulatory element within the coding region of the nifLA operon in Azotobacter vinelandii.

    PubMed

    Mitra, Ranjana; Das, Hirendra K; Dixit, Aparna

    2005-07-01

    Nitrogen fixation in Azotobacter vinelandii is regulated by the nifLA operon. NifA activates the transcription of nif genes, while NifL antagonizes the transcriptional activator NifA in response to fixed nitrogen and molecular oxygen levels. However, transcriptional regulation of the nifLA operon of A. vinelandii itself is not fully understood. Using the S1 nuclease assay, we mapped the transcription start site of the nifLA operon, showing it to be similar to the sigma54-dependent promoters. We also identified a positive cis-acting regulatory element (+134 to +790) of the nifLA operon within the coding region of the nifL gene of A. vinelandii. Deletion of this element results in complete loss of promoter activity. Several protein factors bind to this region, and the specific binding sites have been mapped by DNase I foot printing. Two of these sites, namely dR1 (+134 to +204) and dR2 (+745 to +765), are involved in regulating the nifLA promoter activity. The absence of NtrC-like binding sites in the upstream region of the nifLA operon in A. vinelandii makes the identification of these downstream elements a highly significant finding. The interaction of the promoter with the proteins binding to the dR2 region spanning +745 to +765 appears to be dependent on the face of the helix as introduction of 4 bases just before this region completely disrupts promoter activity. Thus, the positive regulatory element present within the BglII-BglII fragment may play, in part; an important role in nifLA regulation in A. vinelandii. PMID:16000781

  20. PREDetector: a new tool to identify regulatory elements in bacterial genomes.

    PubMed

    Hiard, Samuel; Marée, Raphaël; Colson, Séverine; Hoskisson, Paul A; Titgemeyer, Fritz; van Wezel, Gilles P; Joris, Bernard; Wehenkel, Louis; Rigali, Sébastien

    2007-06-15

    In the post-genomic area, the prediction of transcription factor regulons by position weight matrix-based programmes is a powerful approach to decipher biological pathways and to modelize regulatory networks in bacteria. The main difficulty once a regulon prediction is available is to estimate its reliability prior to start expensive experimental validations and therefore trying to find a way how to identify true positive hits from an endless list of potential target genes of a regulatory protein. Here we introduce PREDetector (Prokaryotic Regulatory Elements Detector), a tool developed for predicting regulons of DNA-binding proteins in bacterial genomes that, beside the automatic prediction, scoring and positioning of potential binding sites and their respective target genes in annotated bacterial genomes, it also provides an easy way to estimate the thresholds where to find reliable possible new target genes. PREDetector can be downloaded freely at http://www.montefiore.ulg.ac.be/~hiard/PreDetector/PreDetector.php. PMID:17451648

  1. Highly Specific Epigenome Editing by CRISPR/Cas9 Repressors for Silencing of Distal Regulatory Elements

    PubMed Central

    Thakore, Pratiksha I.; D’Ippolito, Anthony M; Song, Lingyun; Safi, Alexias; Shivakumar, Nishkala K.; Kabadi, Ami M.; Reddy, Timothy E.; Crawford, Gregory E.; Gersbach, Charles A.

    2015-01-01

    Epigenome editing with the CRISPR/Cas9 platform is a promising technology to modulate gene expression to direct cell phenotype and to dissect the causal epigenetic mechanisms of gene regulation. Fusions of the nuclease-inactive dCas9 to the KRAB repressor (dCas9-KRAB) can silence target gene expression, but the genome-wide specificity and the extent of heterochromatin formation catalyzed by dCas9-KRAB is not known. We targeted dCas9-KRAB to the HS2 enhancer, a distal regulatory element that orchestrates expression of multiple globin genes. Genome-wide analyses demonstrated that localization of dCas9-KRAB to HS2 specifically induced H3K9 tri-methylation (H3K9me3) at the enhancer and reduced the chromatin accessibility of both the enhancer and its promoter targets. Targeted epigenetic modification of HS2 silenced the expression of multiple globin genes, with minimal off-target changes in gene expression. These results demonstrate that repression mediated by dCas9-KRAB is sufficiently specific to disrupt the activity of individual enhancers via local modification of the epigenome. PMID:26501517

  2. RNA structure is a key regulatory element in pathological ATM and CFTR pseudoexon inclusion events

    PubMed Central

    Buratti, Emanuele; Dhir, Ashish; Lewandowska, Marzena A.; Baralle, Francisco E.

    2007-01-01

    Genomic variations deep in the intronic regions of pre-mRNA molecules are increasingly reported to affect splicing events. However, there is no general explanation why apparently similar variations may have either no effect on splicing or cause significant splicing alterations. In this work we have examined the structural architecture of pseudoexons previously described in ATM and CFTR patients. The ATM case derives from the deletion of a repressor element and is characterized by an aberrant 5′ss selection despite the presence of better alternatives. The CFTR pseudoexon instead derives from the creation of a new 5′ss that is used while a nearby pre-existing donor-like sequence is never selected. Our results indicate that RNA structure is a major splicing regulatory factor in both cases. Furthermore, manipulation of the original RNA structures can lead to pseudoexon inclusion following the exposure of unused 5′ss already present in their wild-type intronic sequences and prevented to be recognized because of their location in RNA stem structures. Our data show that intrinsic structural features of introns must be taken into account to understand the mechanism of pseudoexon activation in genetic diseases. Our observations may help to improve diagnostics prediction programmes and eventual therapeutic targeting. PMID:17580311

  3. Using pipe line GIS tools for regulatory activities

    SciTech Connect

    Not Available

    1994-05-01

    US government regulators in increasing numbers are turning to GIS technology as a tool to help oversee pipe line regulatory activities. In some fashion, the pipe line industry is scrutinized by practically every federal agency responsible for monitoring pipe line safety, integrity, and public welfare, in addition to transportation, defense, environmental protection, health, tax revenue, royalties, energy regulations, parks and wildlife management, Indian affairs, occupational safety and others. This paper discusses the use of GIS to help meet these various regulatory concerns.

  4. Increasing the dynamic control space of mammalian transcription devices by combinatorial assembly of homologous regulatory elements from different bacterial species.

    PubMed

    Bacchus, William; Weber, Wilfried; Fussenegger, Martin

    2013-01-01

    Prokaryotic transcriptional regulatory elements are widely utilized building blocks for constructing regulatory genetic circuits adapted for mammalian cells and have found their way into a broad range of biotechnological applications. Prokaryotic transcriptional repressors, fused to eukaryotic transactivation or repression domains, compose the transcription factor, which binds and adjusts transcription from chimeric promoters containing the repressor-specific operator sequence. Escherichia coli and Chlamydia trachomatis share common features in the regulatory mechanism of the biosynthesis of l-tryptophan. The repressor protein TrpR of C. trachomatis regulates the trpRBA operon and the TrpR of E. coli regulates the trpEDCBA operon, both requiring l-tryptophan as a co-repressor. Fusion of these bacterial repressors to the VP16 transactivation domain of Herpes simplex virus creates synthetic transactivators that could bind and activate chimeric promoters, assembled by placing repressor-specific operator modules adjacent to a minimal promoter, in an l-tryptophan-adjustable manner. Combinations of different transactivator and promoter variants from the same or different bacterial species resulted in a multitude of regulatory systems where l-tryptophan regulation properties, background noise, and maximal gene expression levels were significantly diverse. Different l-tryptophan analogues showed diverse regulatory capacity depending on the promoter/transactivator combination. We believe the systems approach to rationally choose promoters, transactivators and inducer molecules, to obtain desired and predefined genetic expression dynamics and control profiles, will significantly advance the design of new regulatory circuits as well as improving already existing ones. PMID:23178502

  5. Sterol regulatory element-binding proteins are regulators of the NIS gene in thyroid cells.

    PubMed

    Ringseis, Robert; Rauer, Christine; Rothe, Susanne; Gessner, Denise K; Schütz, Lisa-Marie; Luci, Sebastian; Wen, Gaiping; Eder, Klaus

    2013-05-01

    The uptake of iodide into the thyroid, an essential step in thyroid hormone synthesis, is an active process mediated by the sodium-iodide symporter (NIS). Despite its strong dependence on TSH, the master regulator of the thyroid, the NIS gene was also reported to be regulated by non-TSH signaling pathways. In the present study we provide evidence that the rat NIS gene is subject to regulation by sterol regulatory element-binding proteins (SREBPs), which were initially identified as master transcriptional regulators of lipid biosynthesis and uptake. Studies in FRTL-5 thyrocytes revealed that TSH stimulates expression and maturation of SREBPs and expression of classical SREBP target genes involved in lipid biosynthesis and uptake. Almost identical effects were observed when the cAMP agonist forskolin was used instead of TSH. In TSH receptor-deficient mice, in which TSH/cAMP-dependent gene regulation is blocked, the expression of SREBP isoforms in the thyroid was markedly reduced when compared with wild-type mice. Sterol-mediated inhibition of SREBP maturation and/or RNA interference-mediated knockdown of SREBPs reduced expression of NIS and NIS-specific iodide uptake in FRTL-5 cells. Conversely, overexpression of active SREBPs caused a strong activation of the 5'-flanking region of the rat NIS gene mediated by binding to a functional SREBP binding site located in the 5'-untranslated region of the rat NIS gene. These findings show that TSH acts as a regulator of SREBP expression and maturation in thyroid epithelial cells and that SREBPs are novel transcriptional regulators of NIS. PMID:23542164

  6. Structural Requirements for Sterol Regulatory Element-binding Protein (SREBP) Cleavage in Fission Yeast*

    PubMed Central

    Cheung, Rocky; Espenshade, Peter J.

    2013-01-01

    Sterol regulatory element-binding proteins (SREBPs) are central regulators of cellular lipid synthesis and homeostasis. Mammalian SREBPs are proteolytically activated and liberated from the membrane by Golgi Site-1 and Site-2 proteases. Fission yeast SREBPs, Sre1 and Sre2, employ a different mechanism that genetically requires the Golgi Dsc E3 ligase complex for cleavage activation. Here, we established Sre2 as a model to define structural requirements for SREBP cleavage. We showed that Sre2 cleavage does not require the N-terminal basic helix-loop-helix zipper transcription factor domain, thus separating cleavage of Sre2 from its transcription factor function. From a mutagenesis screen of 94 C-terminal residues of Sre2, we isolated 15 residues required for cleavage and further identified a glycine-leucine sequence required for Sre2 cleavage. Importantly, the glycine-leucine sequence is located at a conserved distance before the first transmembrane segment of both Sre1 and Sre2 and cleavage occurs in between this sequence and the membrane. Bioinformatic analysis revealed a broad conservation of this novel glycine-leucine motif in SREBP homologs of ascomycete fungi, including the opportunistic human pathogen Aspergillus fumigatus where SREBP is required for virulence. Consistent with this, the sequence was also required for cleavage of the oxygen-responsive transcription factor Sre1 and adaptation to hypoxia, demonstrating functional conservation of this cleavage recognition motif. These cleavage mutants will aid identification of the fungal SREBP protease and facilitate functional dissection of the Dsc E3 ligase required for SREBP activation and fungal pathogenesis. PMID:23729666

  7. Cell-type-specific enrichment of risk-associated regulatory elements at ovarian cancer susceptibility loci

    PubMed Central

    Coetzee, Simon G.; Shen, Howard C.; Hazelett, Dennis J.; Lawrenson, Kate; Kuchenbaecker, Karoline; Tyrer, Jonathan; Rhie, Suhn K.; Levanon, Keren; Karst, Alison; Drapkin, Ronny; Ramus, Susan J.; Couch, Fergus J.; Offit, Kenneth; Chenevix-Trench, Georgia; Monteiro, Alvaro N.A.; Antoniou, Antonis; Freedman, Matthew; Coetzee, Gerhard A.; Pharoah, Paul D.P.; Noushmehr, Houtan; Gayther, Simon A.

    2015-01-01

    Understanding the regulatory landscape of the human genome is a central question in complex trait genetics. Most single-nucleotide polymorphisms (SNPs) associated with cancer risk lie in non-protein-coding regions, implicating regulatory DNA elements as functional targets of susceptibility variants. Here, we describe genome-wide annotation of regions of open chromatin and histone modification in fallopian tube and ovarian surface epithelial cells (FTSECs, OSECs), the debated cellular origins of high-grade serous ovarian cancers (HGSOCs) and in endometriosis epithelial cells (EECs), the likely precursor of clear cell ovarian carcinomas (CCOCs). The regulatory architecture of these cell types was compared with normal human mammary epithelial cells and LNCaP prostate cancer cells. We observed similar positional patterns of global enhancer signatures across the three different ovarian cancer precursor cell types, and evidence of tissue-specific regulatory signatures compared to non-gynecological cell types. We found significant enrichment for risk-associated SNPs intersecting regulatory biofeatures at 17 known HGSOC susceptibility loci in FTSECs (P = 3.8 × 10−30), OSECs (P = 2.4 × 10−23) and HMECs (P = 6.7 × 10−15) but not for EECs (P = 0.45) or LNCaP cells (P = 0.88). Hierarchical clustering of risk SNPs conditioned on the six different cell types indicates FTSECs and OSECs are highly related (96% of samples using multi-scale bootstrapping) suggesting both cell types may be precursors of HGSOC. These data represent the first description of regulatory catalogues of normal precursor cells for different ovarian cancer subtypes, and provide unique insights into the tissue specific regulatory variation with respect to the likely functional targets of germline genetic susceptibility variants for ovarian cancer. PMID:25804953

  8. Detection and characterization of regulatory elements using probabilistic conditional random field and hidden Markov models.

    PubMed

    Wang, Hongyan; Zhou, Xiaobo

    2013-04-01

    By altering the electrostatic charge of histones or providing binding sites to protein recognition molecules, Chromatin marks have been proposed to regulate gene expression, a property that has motivated researchers to link these marks to cis-regulatory elements. With the help of next generation sequencing technologies, we can now correlate one specific chromatin mark with regulatory elements (e.g. enhancers or promoters) and also build tools, such as hidden Markov models, to gain insight into mark combinations. However, hidden Markov models have limitation for their character of generative models and assume that a current observation depends only on a current hidden state in the chain. Here, we employed two graphical probabilistic models, namely the linear conditional random field model and multivariate hidden Markov model, to mark gene regions with different states based on recurrent and spatially coherent character of these eight marks. Both models revealed chromatin states that may correspond to enhancers and promoters, transcribed regions, transcriptional elongation, and low-signal regions. We also found that the linear conditional random field model was more effective than the hidden Markov model in recognizing regulatory elements, such as promoter-, enhancer-, and transcriptional elongation-associated regions, which gives us a better choice. PMID:23237214

  9. P Element Regulatory Products Enhance Zeste(1) Repression of a P[white(duplicated)] Transgene in Drosophila Melanogaster

    PubMed Central

    Coen, D.

    1990-01-01

    Drosophila P element mobilization is subject to a complex array of regulatory mechanisms. A fruitful approach to study them is the use of insertion mutations whose expression is influenced by P regulation. In the present report, it is shown that P element somatic products may influence the expression of an unrelated gene inserted in a P transposon. The P[w(d1)9.3]19DE transgene carries an in vitro modified white gene harboring a duplication of the 5' regulatory sequences. Expression of this transgene is repressed in a P background. No maternal effect is detected and repression can be relieved as soon as P chromosomes are replaced by M ones. The amplitude of repression is correlated to the P transposase activity of the individuals examined. Repression appears to be exerted by somatic products of complete autonomous P elements or of in vitro modified P elements lacking the capacity to express the fourth P exon. The P repression of P[w(d1)9.3]19DE is strongly dependent on the insertion site of this transgene. This P repression effect occurs only in the presence of the zeste(1) allele and is suppressed by Su(z)2 mutations. No qualitative differences of transcription pattern are observed between white(+) and P[w(d1)9.3]19DE in any backgrounds. P repression acts to reduce the amount of the major white transcript. This suggests that P regulatory products may act through cis-interactions at a distance of over 3 kb. PMID:1963871

  10. Characterization of oocyte-expressed GDF9 gene in buffalo and mapping of its TSS and putative regulatory elements.

    PubMed

    Roy, B; Rajput, S; Raghav, S; Kumar, P; Verma, A; Jain, A; Jain, T; Singh, D; De, S; Goswami, S L; Datta, T K

    2013-05-01

    Summary In spite of emerging evidence about the vital role of GDF9 in determination of oocyte competence, there is insufficient information about its regulation of oocyte-specific expression, particularly in livestock animals. Because of the distinct prominence of buffalo as a dairy animal, the present study was undertaken to isolate and characterize GDF9 cDNA using orthologous primers based on the bovine GDF9 sequence. GDF9 transcripts were found to be expressed in oocytes irrespective of their follicular origin, and shared a single transcription start site (TSS) at -57 base pairs (bp) upstream of ATG. Assignment of the TSS is consistent with the presence of a TATA element at -23 of the TSS mapped in this study. Localization of a buffalo-specific minimal promoter within 320 bp upstream of ATG was consolidated by identification of an E-box element at -113bp. Presence of putative transcription factor binding sites and other cis regulatory elements were analyzed at ~5 kb upstream of TSS. Various germ cell-specific cis-acting regulatory elements (BNCF, BRNF, NR2F, SORY, Foxh1, OCT1, LHXF etc.) have been identified in the 5' flanking region of the buffalo GDF9 gene, including NOBOX DNA binding elements and consensuses E-boxes (CANNTG). Presence of two conserved E-boxes found on buffalo sequence at -520 and -718 positions deserves attention in view of its sequence deviation from other species. Two NOBOX binding elements (NBE) were detected at the -3471 and -203 positions. The fall of the NBE within the putative minimal promoter territory of buffalo GDF9 and its unique non-core binding sequence could have a possible role in the control of the core promoter activity. PMID:22230197

  11. Overview of regulatory strategies and molecular elements in metabolic engineering of bacteria.

    PubMed

    Wang, Tianwen; Ma, Xingyuan; Du, Guocheng; Chen, Jian

    2012-11-01

    From a viewpoint of biotechnology, metabolic engineering mainly aims to change the natural status of a pathway in a microorganism towards the overproduction of certain bioproducts. The biochemical nature of a pathway implies us that changed pathway is often the collective results of altered behavior of the metabolic enzymes encoded by corresponding genes. By finely modulating the expression of these genes or the properties of the enzyme, we can gain efficient control on the pathway. In this article, we reviewed the typical methods that have been applied to regulate the expression of genes in metabolic engineering. These methods are grouped according to the operation targets in a typical gene. The transcription of a gene is controlled by an indispensable promoter. By utilizing promoters with different strengths, expected levels of expression can be easily achieved, and screening a promoter library may find suitable mutant promoters that can provide tunable expression of a gene. Auto-responsive promoter (quorum sensing (QS)-based or oxygen-inducible) simplifies the induction process by driving the expression of a gene in an automated manner. Light responsive promoter enables reversible and noninvasive control on gene activity, providing a promising method in controlling gene expression with time and space resolution in metabolic engineering involving complicated genetic circuits. Through directed evolution and/or rational design, the encoding sequences of a gene can be altered, leading to the possibly most profound changes in properties of a metabolic enzyme. Introducing an engineered riboswitch in mRNA can make it a regulatory molecule at the same time; ribosomal binding site is commonly engineered to be more attractive for a ribosome through design. Terminator of a gene will affect the stability of an mRNA, and intergenic region will influence the expression of many related genes. Improving the performance of these elements are generally the main activities in

  12. The Heritable Activation of Cryptic Suppressor-Mutator Elements by an Active Element

    PubMed Central

    Fedoroff, N.

    1989-01-01

    A weakly active maize Suppressor-mutator (Spm-w) element is able to heritably activate cryptic Spm elements in the maize genome. The spontaneous activation frequency, which is 1-5 X 10(-5) in the present genetic background, increases by about 100-fold in the presence of an Spm-w and remains an order of magnitude above the background level a generation after removal of the activating Spm-w. Sectorial somatic reactivation of cryptic elements can be detected phenotypically in kernels. Selection of such kernels constitutes an efficient selection for plants with reactivated Spm elements. Analysis of the reactivation process reveals that it is gradual and proceeds through genetically metastable intermediates that exhibit different patterns of element expression during plant development. Newly reactivated elements tend to return to an inactive form. However, the probability that an element will remain in a heritably active state increases when the element is maintained in the presence of an active Spm element for several generations. PMID:2541047

  13. Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice

    PubMed Central

    Wang, Rui; Zhu, Menglin; Ye, Rongjian; Liu, Zuoxiong; Zhou, Fei; Chen, Hao; Lin, Yongjun

    2015-01-01

    As an important part of synthetic biology, synthetic promoter has gradually become a hotspot in current biology. The purposes of the present study were to synthesize green tissue-specific promoters and to discover green tissue-specific cis-elements. We first assembled several regulatory sequences related to tissue-specific expression in different combinations, aiming to obtain novel green tissue-specific synthetic promoters. GUS assays of the transgenic plants indicated 5 synthetic promoters showed green tissue-specific expression patterns and different expression efficiencies in various tissues. Subsequently, we scanned and counted the cis-elements in different tissue-specific promoters based on the plant cis-elements database PLACE and the rice cDNA microarray database CREP for green tissue-specific cis-element discovery, resulting in 10 potential cis-elements. The flanking sequence of one potential core element (GEAT) was predicted by bioinformatics. Then, the combination of GEAT and its flanking sequence was functionally identified with synthetic promoter. GUS assays of the transgenic plants proved its green tissue-specificity. Furthermore, the function of GEAT flanking sequence was analyzed in detail with site-directed mutagenesis. Our study provides an example for the synthesis of rice tissue-specific promoters and develops a feasible method for screening and functional identification of tissue-specific cis-elements with their flanking sequences at the genome-wide level in rice. PMID:26655679

  14. An ant colony optimization based algorithm for identifying gene regulatory elements.

    PubMed

    Liu, Wei; Chen, Hanwu; Chen, Ling

    2013-08-01

    It is one of the most important tasks in bioinformatics to identify the regulatory elements in gene sequences. Most of the existing algorithms for identifying regulatory elements are inclined to converge into a local optimum, and have high time complexity. Ant Colony Optimization (ACO) is a meta-heuristic method based on swarm intelligence and is derived from a model inspired by the collective foraging behavior of real ants. Taking advantage of the ACO in traits such as self-organization and robustness, this paper designs and implements an ACO based algorithm named ACRI (ant-colony-regulatory-identification) for identifying all possible binding sites of transcription factor from the upstream of co-expressed genes. To accelerate the ants' searching process, a strategy of local optimization is presented to adjust the ants' start positions on the searched sequences. By exploiting the powerful optimization ability of ACO, the algorithm ACRI can not only improve precision of the results, but also achieve a very high speed. Experimental results on real world datasets show that ACRI can outperform other traditional algorithms in the respects of speed and quality of solutions. PMID:23746735

  15. [Regulatory elements in the skin epithelium of Saccoglossus mereschkowskii (Enteropneusta, Hemichordata): electron microscopic and immunocytochemical study].

    PubMed

    Stoliarova, M V; Val'kovich, E I

    2013-01-01

    The aim of this investigation was to demonstrate the regulatory elements in the skin epithelium of Enteropneusta which are supposed to be related to the chordate ancestors. Using electron microscopy, it was found that in the skin epithelium of a representative of enteropneusts Saccoglossus mereschkowskii, the basal parts of some epitheliocytes took part in formation of a nerve layer. These cells were considered as receptor ciliated cells. The granular epithelial cells were shown to release secretion according to both exocrine and endocrine mechanism; these cells were characterized as endocrine-like regulatory cells. Fine granular cells possibly represent special receptor-endocrine-like cell type. The immunocytochemical detection of FMRFamid neuropeptide localization in histological sections confirmed the electron microscopic data on the presence of receptor and endocrine-like cells in the epithelium. It is suggested that the skin epithelium of Enteropneusta contains a peculiar neuro-endocrine regulatory system that is represented by receptor cells, receptor-endocrine-like cells of an open type and nerve elements of the nerve layer. PMID:24707736

  16. Distance and Helical Phase Dependence of Synergistic Transcription Activation in cis-Regulatory Module

    PubMed Central

    Huang, Qilai; Gong, Chenguang; Li, Jiahuang; Zhuo, Zhu; Chen, Yuan; Wang, Jin; Hua, Zi-Chun

    2012-01-01

    Deciphering of the spatial and stereospecific constraints on synergistic transcription activation mediated between activators bound to cis-regulatory elements is important for understanding gene regulation and remains largely unknown. It has been commonly believed that two activators will activate transcription most effectively when they are bound on the same face of DNA double helix and within a boundary distance from the transcription initiation complex attached to the TATA box. In this work, we studied the spatial and stereospecific constraints on activation by multiple copies of bound model activators using a series of engineered relative distances and stereospecific orientations. We observed that multiple copies of the activators GAL4-VP16 and ZEBRA bound to engineered promoters activated transcription more effectively when bound on opposite faces of the DNA double helix. This phenomenon was not affected by the spatial relationship between the proximal activator and initiation complex. To explain these results, we proposed the novel concentration field model, which posits the effective concentration of bound activators, and therefore the transcription activation potential, is affected by their stereospecific positioning. These results could be used to understand synergistic transcription activation anew and to aid the development of predictive models for the identification of cis-regulatory elements. PMID:22299056

  17. The structure and function of the regulatory elements of the Escherichia coli uvrB gene.

    PubMed Central

    van den Berg, E; Zwetsloot, J; Noordermeer, I; Pannekoek, H; Dekker, B; Dijkema, R; van Ormondt, H

    1981-01-01

    The construction and properties of recombinant plasmids carrying the Escherichia coli uvrB gene, including its transcriptional- and translational regulatory elements, is reported. The DNA sequence of the region, which governs the expression of the uvrB gene, has been determined. Within this sequence two non-overlapping DNA segments match the model sequence for Escherichia coli promoters (1). The '-10 regions' and the '-35 regions' of the proposed uvrB promoters are, respectively, 5'TAAAAT (P1), 5'TATAAT (P2) and 5'TTGGCA (P1), 5'GTGATG (P2). The existence and the position of these promoters has been established by elimination of one promoter (P2), using molecular cloning procedures, by length measurements of in vitro synthesized 'run-off' transcripts and by protection of the uvrB regulatory region for S1 nuclease digestion using in vivo made RNA. Potential sites of interaction within the uvrB regulatory region with regulatory proteins, such as the LexA protein (2) and the UvrC protein (3) are discussed. Images PMID:6273801

  18. Insect growth regulatory activity of Blechnum chilense.

    PubMed

    Hincapié, Carlos A; Monsalve, Zulma; Parada, Katherine; Lamilla, Claudio; Alarcón, Julio; Céspedes, Carlos L; Seigler, David

    2011-08-01

    The genus Blechnum has 13 species that are common plants, well-distributed in Chile. Here, we report a phytochemical analysis of B. chilense (Kaulf.) Mett., as well as the insecticidal effects of extracts of this plant. From the n-hexane fraction four phytoecdysones were isolated: ecdysone, ponasterone, shidasterone and 2-deoxycrustecdysone. A bioassay with Drosophila melanogaster larvae was used to evaluate insecticidal activity. The EtOAc and n-hexane fractions at 800 ppm caused 66.7 and 50.0% larval mortality, respectively. Treatments with both extracts at 800 ppm caused the greatest larval mortality, whereas treatments with 500 and 200 ppm induced premature pupation compared with the control and the highest adult mortality, probably due to interference with ecdysteroid metabolism and inhibition of ecdysis triggering hormone (ETH). The dead adult flies exhibited malformations. PMID:21922904

  19. Sterol regulatory element-binding proteins are transcriptional regulators of the thyroglobulin gene in thyroid cells.

    PubMed

    Wen, Gaiping; Eder, Klaus; Ringseis, Robert

    2016-08-01

    The genes encoding sodium/iodide symporter (NIS) and thyroid peroxidase (TPO), both of which are essential for thyroid hormone (TH) synthesis, were shown to be regulated by sterol regulatory element-binding proteins (SREBP)-1c and -2. In the present study we tested the hypothesis that transcription of a further gene essential for TH synthesis, the thyroglobulin (TG) gene, is under the control of SREBP. To test this hypothesis, we studied the influence of inhibition of SREBP maturation and SREBP knockdown on TG expression in FRTL-5 thyrocytes and explored transcriptional regulation of the TG promoter by reporter gene experiments in FRTL-5 and HepG2 cells, gel shift assays and chromatin immunoprecipitation. Inhibition of SREBP maturation by 25-hydroxycholesterol and siRNA-mediated knockdown of either SREBP-1c or SREBP-2 decreased mRNA and protein levels of TG in FRTL-5 thyrocytes. Reporter gene assays with wild-type and mutated TG promoter reporter truncation constructs revealed that the rat TG promoter is transcriptionally activated by nSREBP-1c and nSREBP-2. DNA-binding assays and chromatin immunoprecipitation assays showed that both nSREBP-1c and nSREBP-2 bind to a SREBP binding motif with characteristics of an E-box SRE at position -63 in the rat TG promoter. In connection with recent findings that NIS and TPO are regulated by SREBP in thyrocytes the present findings support the view that SREBP are regulators of essential steps of TH synthesis in the thyroid gland such as iodide uptake, iodide oxidation and iodination of tyrosyl residues of TG. This moreover suggests that SREBP may be molecular targets for pharmacological modulation of TH synthesis. PMID:27321819

  20. The Y chromosome as a regulatory element shaping immune cell transcriptomes and susceptibility to autoimmune disease.

    PubMed

    Case, Laure K; Wall, Emma H; Dragon, Julie A; Saligrama, Naresha; Krementsov, Dimitry N; Moussawi, Mohamad; Zachary, James F; Huber, Sally A; Blankenhorn, Elizabeth P; Teuscher, Cory

    2013-09-01

    Understanding the DNA elements that constitute and control the regulatory genome is critical for the appropriate therapeutic management of complex diseases. Here, using chromosome Y (ChrY) consomic mouse strains on the C57BL/6J (B6) background, we show that susceptibility to two diverse animal models of autoimmune disease, experimental allergic encephalomyelitis (EAE) and experimental myocarditis, correlates with the natural variation in copy number of Sly and Rbmy multicopy ChrY genes. On the B6 background, ChrY possesses gene regulatory properties that impact genome-wide gene expression in pathogenic CD4(+) T cells. Using a ChrY consomic strain on the SJL background, we discovered a preference for ChrY-mediated gene regulation in macrophages, the immune cell subset underlying the EAE sexual dimorphism in SJL mice, rather than CD4(+) T cells. Importantly, in both genetic backgrounds, an inverse correlation exists between the number of Sly and Rbmy ChrY gene copies and the number of significantly up-regulated genes in immune cells, thereby supporting a link between copy number variation of Sly and Rbmy with the ChrY genetic element exerting regulatory properties. Additionally, we show that ChrY polymorphism can determine the sexual dimorphism in EAE and myocarditis. In humans, an analysis of the CD4(+) T cell transcriptome from male multiple sclerosis patients versus healthy controls provides further evidence for an evolutionarily conserved mechanism of gene regulation by ChrY. Thus, as in Drosophila, these data establish the mammalian ChrY as a member of the regulatory genome due to its ability to epigenetically regulate genome-wide gene expression in immune cells. PMID:23800453

  1. The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements

    SciTech Connect

    Foley, J.; Ley, C.A.; Parysek, L.M.

    1994-07-15

    The authors determined the complete nucleotide sequence of the coding region of the human peripherin gene (PRPH), as well as 742 bp 5{prime} to the cap site and 584 bp 3{prime} to the stop codon, and compared its structure and sequence to the rat and mouse genes. The overall structure of 9 exons separated by 8 introns is conserved among these three mammalian species. The nucleotide sequences of the human peripherin gene exons were 90% identical to the rat gene sequences, and the predicted human peripherin protein differed from rat peripherin at only 18 of 475 amino acid residues. Comparison of the 5{prime} flanking regions of the human peripherin gene and rodent genes revealed extensive areas of high homology. Additional conserved segments were found in introns 1 and 2. Within the 5{prime} region, potential regulatory sequences, including a nerve growth factor negative regulatory element, a Hox protein binding site, and a heat shock element, were identified in all peripherin genes. The positional conservation of each element suggests that they may be important in the tissue-specific, developmental-specific, and injury-specific expression of the peripherin gene. 24 refs., 2 figs., 1 tab.

  2. Analysis of long-range interactions in primary human cells identifies cooperative CFTR regulatory elements

    PubMed Central

    Moisan, Stéphanie; Berlivet, Soizik; Ka, Chandran; Gac, Gérald Le; Dostie, Josée; Férec, Claude

    2016-01-01

    A mechanism by which control DNA elements regulate transcription over large linear genomic distances is by achieving close physical proximity with genes, and looping of the intervening chromatin paths. Alterations of such regulatory ‘chromatin looping’ systems are likely to play a critical role in human genetic disease at large. Here, we studied the spatial organization of a ≈790 kb locus encompassing the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Dysregulation of CFTR is responsible for cystic fibrosis, which is the most common lethal genetic disorder in Caucasian populations. CFTR is a relatively large gene of 189 kb with a rather complex tissue-specific and temporal expression profile. We used chromatin conformation at the CFTR locus to identify new DNA sequences that regulate its transcription. By comparing 5C chromatin interaction maps of the CFTR locus in expressing and non-expressing human primary cells, we identified several new contact points between the CFTR promoter and its surroundings, in addition to regions featuring previously described regulatory elements. We demonstrate that two of these novel interacting regions cooperatively increase CFTR expression, and suggest that the new enhancer elements located on either side of the gene are brought together through chromatin looping via CTCF. PMID:26615198

  3. Analysis of long-range interactions in primary human cells identifies cooperative CFTR regulatory elements.

    PubMed

    Moisan, Stéphanie; Berlivet, Soizik; Ka, Chandran; Gac, Gérald Le; Dostie, Josée; Férec, Claude

    2016-04-01

    A mechanism by which control DNA elements regulate transcription over large linear genomic distances is by achieving close physical proximity with genes, and looping of the intervening chromatin paths. Alterations of such regulatory 'chromatin looping' systems are likely to play a critical role in human genetic disease at large. Here, we studied the spatial organization of a ≈790 kb locus encompassing the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Dysregulation ofCFTRis responsible for cystic fibrosis, which is the most common lethal genetic disorder in Caucasian populations.CFTRis a relatively large gene of 189 kb with a rather complex tissue-specific and temporal expression profile. We used chromatin conformation at theCFTRlocus to identify new DNA sequences that regulate its transcription. By comparing 5C chromatin interaction maps of theCFTRlocus in expressing and non-expressing human primary cells, we identified several new contact points between theCFTRpromoter and its surroundings, in addition to regions featuring previously described regulatory elements. We demonstrate that two of these novel interacting regions cooperatively increaseCFTRexpression, and suggest that the new enhancer elements located on either side of the gene are brought together through chromatin loopingviaCTCF. PMID:26615198

  4. A new regulatory element modulates homoserine lactone-mediated autoinduction of Ti plasmid conjugal transfer.

    PubMed Central

    Hwang, I; Cook, D M; Farrand, S K

    1995-01-01

    Conjugal transfer of the Agrobacterium tumefaciens nopaline-type Ti plasmid pTiC58 is induced by agrocinopines A and B, opines secreted by crown gall tumors induced by the bacterium. This regulation functions through the transcriptional repressor, AccR. However, actual transcription of the tra genes is regulated by autoinduction through the activator TraR and the substituted homoserine lactone second messenger, Agrobacterium autoinducer (AAI). We have identified a new regulatory element that modulates the response of TraR to AAI. The gene, called traM, suppresses TraR-AAI activation of transcription of tra genes carried on recombinant clones. The suppression could be relieved by increasing the expression of TraR but not by increasing AAI levels. traM is located between traR and traAF on pTiC58 and is transcribed in the clockwise direction. The 306-bp gene encodes an 11.2-kDa protein showing no significant relatedness to other proteins in the databases. Mutations in traM in pTiC58 conferred a transfer-constitutive phenotype, and strains harboring the Ti plasmid produced easily detectable amounts of AAI. These same mutations engineered into the transfer-constitutive Ti plasmid pTiC58 delta accR conferred a hyperconjugal phenotype and very high levels of AAI production. Expression of traM required TraR, indicating that transcription of the gene is regulated by the autoinduction system. TraM had no effect on the expression of traR, demonstrating that the suppressive effect is not due to repression of the gene encoding the activator. These results suggest that TraM is not a direct transcriptional regulator. Since the suppressive effect is demonstrable only when traM is overexpressed with respect to traR, we suggest that TraM functions to sequester TraR from the very small amounts of AAI produced under conditions when the agrocinopines are not present. PMID:7814335

  5. Computational Approaches to Identify Promoters and cis-Regulatory Elements in Plant Genomes1

    PubMed Central

    Rombauts, Stephane; Florquin, Kobe; Lescot, Magali; Marchal, Kathleen; Rouzé, Pierre; Van de Peer, Yves

    2003-01-01

    The identification of promoters and their regulatory elements is one of the major challenges in bioinformatics and integrates comparative, structural, and functional genomics. Many different approaches have been developed to detect conserved motifs in a set of genes that are either coregulated or orthologous. However, although recent approaches seem promising, in general, unambiguous identification of regulatory elements is not straightforward. The delineation of promoters is even harder, due to its complex nature, and in silico promoter prediction is still in its infancy. Here, we review the different approaches that have been developed for identifying promoters and their regulatory elements. We discuss the detection of cis-acting regulatory elements using word-counting or probabilistic methods (so-called “search by signal” methods) and the delineation of promoters by considering both sequence content and structural features (“search by content” methods). As an example of search by content, we explored in greater detail the association of promoters with CpG islands. However, due to differences in sequence content, the parameters used to detect CpG islands in humans and other vertebrates cannot be used for plants. Therefore, a preliminary attempt was made to define parameters that could possibly define CpG and CpNpG islands in Arabidopsis, by exploring the compositional landscape around the transcriptional start site. To this end, a data set of more than 5,000 gene sequences was built, including the promoter region, the 5′-untranslated region, and the first introns and coding exons. Preliminary analysis shows that promoter location based on the detection of potential CpG/CpNpG islands in the Arabidopsis genome is not straightforward. Nevertheless, because the landscape of CpG/CpNpG islands differs considerably between promoters and introns on the one side and exons (whether coding or not) on the other, more sophisticated approaches can probably be

  6. Dietary and nutritional manipulation of the nuclear transcription factors peroxisome proliferator-activated receptor and sterol regulatory element-binding proteins as a tool for reversing the primary diseases of premature death and delaying aging.

    PubMed

    Kurtak, Karen A

    2014-04-01

    Evolution over 2.1 billion years has equipped us with a biochemical pathway that has the power to literally reverse the primary disease etiologies that have become the leading causes of death and aging in the developed world. Activation of the peroxisome proliferator-activated receptor (PPAR) pathway arrests inflammatory signaling throughout the body, reverses damage to tissues, reverses insulin resistance, and can even dissolve beta-amyloid plaque in the brain. It has played a critical role in the evolution of the metazoans and the successful migration of humans to all corners of the Earth. For two decades, various pharmaceuticals have been designed to activate the PPAR pathway but have consistently fallen short of expectations. There is nothing wrong with these drugs. The problem has been the standard "healthy" diet creating mixed signals that render the drugs ineffective. This article explores the ongoing dance between the two primary nuclear receptors that mediate gene regulation of fatty acids. It discusses their interaction with sirtuins and telomerase, optimization of their obligate heterodimers, and why manipulation of dietary and nutritional factors, like the ketogenic diet, is the most effective means of activation. These are effective tools that we can start implementing now to slow, and in some cases reverse, the diseases of aging. PMID:24713058

  7. metagene Profiles Analyses Reveal Regulatory Element's Factor-Specific Recruitment Patterns.

    PubMed

    Joly Beauparlant, Charles; Lamaze, Fabien C; Deschênes, Astrid; Samb, Rawane; Lemaçon, Audrey; Belleau, Pascal; Bilodeau, Steve; Droit, Arnaud

    2016-08-01

    ChIP-Sequencing (ChIP-Seq) provides a vast amount of information regarding the localization of proteins across the genome. The aggregation of ChIP-Seq enrichment signal in a metagene plot is an approach commonly used to summarize data complexity and to obtain a high level visual representation of the general occupancy pattern of a protein. Here we present the R package metagene, the graphical interface Imetagene and the companion package similaRpeak. Together, they provide a framework to integrate, summarize and compare the ChIP-Seq enrichment signal from complex experimental designs. Those packages identify and quantify similarities or dissimilarities in patterns between large numbers of ChIP-Seq profiles. We used metagene to investigate the differential occupancy of regulatory factors at noncoding regulatory regions (promoters and enhancers) in relation to transcriptional activity in GM12878 B-lymphocytes. The relationships between occupancy patterns and transcriptional activity suggest two different mechanisms of action for transcriptional control: i) a "gradient effect" where the regulatory factor occupancy levels follow transcription and ii) a "threshold effect" where the regulatory factor occupancy levels max out prior to reaching maximal transcription. metagene, Imetagene and similaRpeak are implemented in R under the Artistic license 2.0 and are available on Bioconductor. PMID:27538250

  8. Exploiting a precise design of universal synthetic modular regulatory elements to unlock the microbial natural products in Streptomyces

    PubMed Central

    Bai, Chaoxian; Zhang, Yang; Zhao, Xuejin; Hu, Yiling; Xiang, Sihai; Miao, Jin; Lou, Chunbo; Zhang, Lixin

    2015-01-01

    There is a great demand for precisely quantitating the expression of genes of interest in synthetic and systems biotechnology as new and fascinating insights into the genetics of streptomycetes have come to light. Here, we developed, for the first time to our knowledge, a quantitative method based on flow cytometry and a superfolder green fluorescent protein (sfGFP) at single-cell resolution in Streptomyces. Single cells of filamentous bacteria were obtained by releasing the protoplasts from the mycelium, and the dead cells could be distinguished from the viable ones by propidium iodide (PI) staining. With this sophisticated quantitative method, some 200 native or synthetic promoters and 200 ribosomal binding sites (RBSs) were characterized in a high-throughput format. Furthermore, an insulator (RiboJ) was recruited to eliminate the interference between promoters and RBSs and improve the modularity of regulatory elements. Seven synthetic promoters with gradient strength were successfully applied in a proof-of-principle approach to activate and overproduce the cryptic lycopene in a predictable manner in Streptomyces avermitilis. Our work therefore presents a quantitative strategy and universal synthetic modular regulatory elements, which will facilitate the functional optimization of gene clusters and the drug discovery process in Streptomyces. PMID:26374838

  9. Identification of cis-acting repressive sequences within the negative regulatory element of human immunodeficiency virus type 1.

    PubMed Central

    Lu, Y C; Touzjian, N; Stenzel, M; Dorfman, T; Sodroski, J G; Haseltine, W A

    1990-01-01

    The negative regulatory element of human immunodeficiency virus type 1 is a 260-nucleotide-long sequence that decreases the rate of RNA transcription initiation specified by the long terminal repeat. This region has the potential to bind several cellular transcription factors. Here it is shown that sequences which recognize the NFAT-1 and USF cellular transcription factors contribute to this negative regulatory effect. The sequences within the negative regulatory element which resemble the AP-1 site and the URS do not negatively regulate human immunodeficiency virus long terminal repeat transcription initiation. PMID:2398545

  10. The sterol regulatory element binding proteins are essential for the metabolic programming of effector T cells and adaptive immunity

    PubMed Central

    Kidani, Yoko; Elsaesser, Heidi; Hock, M Benjamin; Vergnes, Laurent; Williams, Kevin J; Argus, Joseph P; Marbois, Beth N; Komisopoulou, Evangelia; Wilson, Elizabeth B; Osborne, Timothy F; Graeber, Thomas G; Reue, Karen; Brooks, David G; Bensinger, Steven J

    2013-01-01

    Newly activated CD8+ T cells reprogram their metabolism to meet the extraordinary biosynthetic demands of clonal expansion; however, the signals mediating metabolic reprogramming remain poorly defined. Herein, we demonstrate an essential role for sterol regulatory element binding proteins (SREBPs) in the acquisition of effector cell metabolism. Without SREBP signaling, CD8+ T cells are unable to blast, resulting in markedly attenuated clonal expansion during viral infection. Mechanistic studies indicate that SREBPs are essential to meet the heightened lipid requirements of membrane synthesis during blastogenesis. SREBPs are dispensable for homeostatic proliferation, indicating a context-specific requirement for SREBPs in effector responses. These studies provide insights into the molecular signals underlying metabolic reprogramming of CD8+ T cells during the transition from quiescence to activation. PMID:23563690

  11. Cotyledon nuclear proteins bind to DNA fragments harboring regulatory elements of phytohemagglutinin genes.

    PubMed Central

    Riggs, C D; Voelker, T A; Chrispeels, M J

    1989-01-01

    The effects of deleting DNA sequences upstream from the phytohemagglutinin-L gene of Phaseolus vulgaris have been examined with respect to the level of gene product produced in the seeds of transgenic tobacco. Our studies indicate that several upstream regions quantitatively modulate expression. Between -1000 and -675, a negative regulatory element reduces expression approximately threefold relative to shorter deletion mutants that do not contain this region. Positive regulatory elements lie between -550 and -125 and, compared with constructs containing only 125 base pairs of upstream sequences (-125), the presence of these two regions can be correlated with a 25-fold and a 200-fold enhancement of phytohemagglutinin-L levels. These experiments were complemented by gel retardation assays, which demonstrated that two of the three regions bind cotyledon nuclear proteins from mid-mature seeds. One of the binding sites maps near a DNA sequence that is highly homologous to protein binding domains located upstream from the soybean seed lectin and Kunitz trypsin inhibitor genes. Competition experiments demonstrated that the upstream regions of a bean beta-phaseolin gene, the soybean seed lectin gene, and an oligonucleotide from the upstream region of the trypsin inhibitor gene can compete differentially for factor binding. We suggest that these legume genes may be regulated in part by evolutionarily conserved protein/DNA interactions. PMID:2535513

  12. Environment-induced epigenetic reprogramming in genomic regulatory elements in smoking mothers and their children.

    PubMed

    Bauer, Tobias; Trump, Saskia; Ishaque, Naveed; Thürmann, Loreen; Gu, Lei; Bauer, Mario; Bieg, Matthias; Gu, Zuguang; Weichenhan, Dieter; Mallm, Jan-Philipp; Röder, Stefan; Herberth, Gunda; Takada, Eiko; Mücke, Oliver; Winter, Marcus; Junge, Kristin M; Grützmann, Konrad; Rolle-Kampczyk, Ulrike; Wang, Qi; Lawerenz, Christian; Borte, Michael; Polte, Tobias; Schlesner, Matthias; Schanne, Michaela; Wiemann, Stefan; Geörg, Christina; Stunnenberg, Hendrik G; Plass, Christoph; Rippe, Karsten; Mizuguchi, Junichiro; Herrmann, Carl; Eils, Roland; Lehmann, Irina

    2016-03-01

    Epigenetic mechanisms have emerged as links between prenatal environmental exposure and disease risk later in life. Here, we studied epigenetic changes associated with maternal smoking at base pair resolution by mapping DNA methylation, histone modifications, and transcription in expectant mothers and their newborn children. We found extensive global differential methylation and carefully evaluated these changes to separate environment associated from genotype-related DNA methylation changes. Differential methylation is enriched in enhancer elements and targets in particular "commuting" enhancers having multiple, regulatory interactions with distal genes. Longitudinal whole-genome bisulfite sequencing revealed that DNA methylation changes associated with maternal smoking persist over years of life. Particularly in children prenatal environmental exposure leads to chromatin transitions into a hyperactive state. Combined DNA methylation, histone modification, and gene expression analyses indicate that differential methylation in enhancer regions is more often functionally translated than methylation changes in promoters or non-regulatory elements. Finally, we show that epigenetic deregulation of a commuting enhancer targeting c-Jun N-terminal kinase 2 (JNK2) is linked to impaired lung function in early childhood. PMID:27013061

  13. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    PubMed

    Deb, Arindam; Kundu, Sudip

    2015-01-01

    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  14. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition

    PubMed Central

    Deb, Arindam; Kundu, Sudip

    2015-01-01

    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  15. RNA-Seq of Bacillus licheniformis: active regulatory RNA features expressed within a productive fermentation

    PubMed Central

    2013-01-01

    Background The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. Results A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. Conclusion The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains. PMID:24079885

  16. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    PubMed

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  17. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders

    PubMed Central

    Wakabayashi, Aoi; Ulirsch, Jacob C.; Ludwig, Leif S.; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I.; Sankaran, Vijay G.

    2016-01-01

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptional cis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  18. Genome-Wide Identification of Regulatory Elements and Reconstruction of Gene Regulatory Networks of the Green Alga Chlamydomonas reinhardtii under Carbon Deprivation

    PubMed Central

    Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  19. Distal cis-regulatory elements are required for tissue-specific expression of enamelin (Enam)

    PubMed Central

    Hu, Yuanyuan; Papagerakis, Petros; Ye, Ling; Feng, Jerry Q.; Simmer, James P.; Hu, Jan C-C.

    2009-01-01

    Enamel formation is orchestrated by the sequential expression of genes encoding enamel matrix proteins; however, the mechanisms sustaining the spatio–temporal order of gene transcription during amelogenesis are poorly understood. The aim of this study was to characterize the cis-regulatory sequences necessary for normal expression of enamelin (Enam). Several enamelin transcription regulatory regions, showing high sequence homology among species, were identified. DNA constructs containing 5.2 or 3.9 kb regions upstream of the enamelin translation initiation site were linked to a LacZ reporter and used to generate transgenic mice. Only the 5.2-Enam–LacZ construct was sufficient to recapitulate the endogenous pattern of enamelin tooth-specific expression. The 3.9-Enam–LacZ transgenic lines showed no expression in dental cells, but ectopic β-galactosidase activity was detected in osteoblasts. Potential transcription factor-binding sites were identified that may be important in controlling enamelin basal promoter activity and in conferring enamelin tissue-specific expression. Our study provides new insights into regulatory mechanisms governing enamelin expression. PMID:18353004

  20. Distal apolipoprotein C-III regulatory elements F to J act as a general modular enhancer for proximal promoters that contain hormone response elements. Synergism between hepatic nuclear factor-4 molecules bound to the proximal promoter and distal enhancer sites.

    PubMed

    Kardassis, D; Tzameli, I; Hadzopoulou-Cladaras, M; Talianidis, I; Zannis, V

    1997-01-01

    Transient transfection assays have shown that the distal apoC-III promoter segments that contain the regulatory elements F to J enhance the strength of the tandemly linked proximal apoA-I promoter 5- to 13-fold in hepatic (HepG2) cells. Activation in intestinal (CaCo-2) cells to levels comparable to those obtained in HepG2 cells requires a larger apoA-I promoter sequence that extends to nucleotide -1500 as well as the presence of hepatic nuclear factor-4 (HNF-4). The distal apoC-III regulatory elements can also enhance 4- to 8-fold the strength of the heterologous apoB promoter in HepG2 and CaCo-2 cells. Finally, these elements in the presence of HNF-4 enhance 14.5- to 18.5-fold the strength of the minimal adenovirus major late promoter linked to two copies of the hormone response element (HRE) AID of apoA-I in both HepG2 and CaCo-2 cells. In vitro mutagenesis of the promoter/enhancer cluster established that the enhancer activity is lost by a mutation in the HRE present in the 3' end of the regulatory element I (-736 to -714) and is reduced significantly by point mutations or deletions in one or more of the regulatory elements F to J of the apoC-III enhancer. The enhancer activity also requires the HREs of the proximal apoA-I promoter. The apoC-III enhancer can also restore the activity of the proximal apoA-I and apoB promoters that have been inactivated by mutations in CCAAT/enhancers binding protein binding sites, indicating that C/EBP may not participate in the synergistic activation of the promoter/enhancer cluster. The findings suggest that the regulatory elements F to J of the apoC-III promoter act as a general modular enhancer that can potentiate the strength of proximal promoters that contain HREs. Such potentiation in the HepG2 cells can be accounted for by synergistic interactions between HNF-4 or other nuclear hormone receptors bound to the proximal and distal HREs and SP1 or other factors bound to the apoC-III enhancer. Additional factors may be

  1. Mutation of a transcriptional motif of a distant regulatory element reduces the expression of embryonic and fetal globin genes

    PubMed Central

    Navas, Patrick A.; Swank, Richard A.; Yu, Man; Peterson, Kenneth R.; Stamatoyannopoulos, George

    2010-01-01

    High-level β-globin gene expression is dependent on the presence of the locus control region (LCR), a powerful regulatory element physically characterized by five DNase I-hypersensitive sites (HS), designated HS1–HS5. Of these, HS3 contains seven GT motifs that are essential for its activity. One of the motifs, GT6, has been shown by in vivo footprinting to display the largest difference in signal between fetal and adult globin expressing cells. We assessed the contribution of GT6 on the downstream globin gene expression by mutating this motif in a 248 kb β-globin locus yeast artificial chromosome and measuring the activity of β-globin genes in GT6m β-YAC transgenic mice. Seven transgenic lines were established, three of which contained at least one intact copy of the β-globin locus and were further investigated. The mutation of the GT6 motif reduced the expression of ε- and γ-globin genes during embryonic erythropoiesis. During definitive erythropoiesis, γ-globin gene expression was significantly reduced while β-globin gene expression was virtually indistinguishable from wild-type controls. We conclude that the GT6 motif of hypersensitive site 3 of the LCR is required for normal ε- and γ-globin gene expression during embryonic erythropoiesis and for γ-globin gene expression during definitive erythropoiesis in the fetal liver. Our results provide evidence that mutations of single transcriptional motifs of distant regulatory elements can have profound effects on gene expression. PMID:14506128

  2. Functional conservation of cis-regulatory elements of heat-shock genes over long evolutionary distances.

    PubMed

    He, Zhengying; Eichel, Kelsie; Ruvinsky, Ilya

    2011-01-01

    Transcriptional control of gene regulation is an intricate process that requires precise orchestration of a number of molecular components. Studying its evolution can serve as a useful model for understanding how complex molecular machines evolve. One way to investigate evolution of transcriptional regulation is to test the functions of cis-elements from one species in a distant relative. Previous results suggested that few, if any, tissue-specific promoters from Drosophila are faithfully expressed in C. elegans. Here we show that, in contrast, promoters of fly and human heat-shock genes are upregulated in C. elegans upon exposure to heat. Inducibility under conditions of heat shock may represent a relatively simple "on-off" response, whereas complex expression patterns require integration of multiple signals. Our results suggest that simpler aspects of regulatory logic may be retained over longer periods of evolutionary time, while more complex ones may be diverging more rapidly. PMID:21799932

  3. Crystal Structure of the Lysine Riboswitch Regulatory mRNA Element*S⃞

    PubMed Central

    Garst, Andrew D.; Héroux, Annie; Rambo, Robert P.; Batey, Robert T.

    2008-01-01

    Riboswitches are metabolite-sensitive elements found in mRNAs that control gene expression through a regulatory secondary structural switch. Along with regulation of lysine biosynthetic genes, mutations within the lysine-responsive riboswitch (L-box) play a role in the acquisition of resistance to antimicrobial lysine analogs. To understand the structural basis for lysine binding, we have determined the 2.8Å resolution crystal structure of lysine bound to the Thermotoga maritima asd lysine riboswitch ligand-binding domain. The structure reveals a complex architecture scaffolding a binding pocket completely enveloping lysine. Mutations conferring antimicrobial resistance cluster around this site as well as highly conserved long range interactions, indicating that they disrupt lysine binding or proper folding of the RNA. Comparison of the free and bound forms by x-ray crystallography, small angle x-ray scattering, and chemical probing reveals almost identical structures, indicating that lysine induces only limited and local conformational changes upon binding. PMID:18593706

  4. Crystal structure of the lysine riboswitch regulatory mRNA element.

    PubMed

    Garst, Andrew D; Héroux, Annie; Rambo, Robert P; Batey, Robert T

    2008-08-15

    Riboswitches are metabolite-sensitive elements found in mRNAs that control gene expression through a regulatory secondary structural switch. Along with regulation of lysine biosynthetic genes, mutations within the lysine-responsive riboswitch (L-box) play a role in the acquisition of resistance to antimicrobial lysine analogs. To understand the structural basis for lysine binding, we have determined the 2.8 angstroms resolution crystal structure of lysine bound to the Thermotoga maritima asd lysine riboswitch ligand-binding domain. The structure reveals a complex architecture scaffolding a binding pocket completely enveloping lysine. Mutations conferring antimicrobial resistance cluster around this site as well as highly conserved long range interactions, indicating that they disrupt lysine binding or proper folding of the RNA. Comparison of the free and bound forms by x-ray crystallography, small angle x-ray scattering, and chemical probing reveals almost identical structures, indicating that lysine induces only limited and local conformational changes upon binding. PMID:18593706

  5. Crystal Structure of the Lysine Riboswitch Regulatory mRNA Element

    SciTech Connect

    Garst, A.; Heroux, A; Rambo, R; Batey, R

    2008-01-01

    Riboswitches are metabolite-sensitive elements found in mRNAs that control gene expression through a regulatory secondary structural switch. Along with regulation of lysine biosynthetic genes, mutations within the lysine-responsive riboswitch (L-box) play a role in the acquisition of resistance to antimicrobial lysine analogs. To understand the structural basis for lysine binding, we have determined the 2.8{angstrom} resolution crystal structure of lysine bound to the Thermotoga maritima asd lysine riboswitch ligand-binding domain. The structure reveals a complex architecture scaffolding a binding pocket completely enveloping lysine. Mutations conferring antimicrobial resistance cluster around this site as well as highly conserved long range interactions, indicating that they disrupt lysine binding or proper folding of the RNA. Comparison of the free and bound forms by x-ray crystallography, small angle x-ray scattering, and chemical probing reveals almost identical structures, indicating that lysine induces only limited and local conformational changes upon binding.

  6. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    PubMed Central

    Li, Mingjun

    2014-01-01

    Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs) with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs) associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb) of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes. PMID:25250331

  7. Identification of Regulatory Mutations in SERPINC1 Affecting Vitamin D Response Elements Associated with Antithrombin Deficiency

    PubMed Central

    Toderici, Mara; de la Morena-Barrio, María Eugenia; Padilla, José; Miñano, Antonia; Antón, Ana Isabel; Iniesta, Juan Antonio; Herranz, María Teresa; Fernández, Nuria; Vicente, Vicente; Corral, Javier

    2016-01-01

    Antithrombin is a crucial anticoagulant serpin whose even moderate deficiency significantly increases the risk of thrombosis. Most cases with antithrombin deficiency carried genetic defects affecting exons or flanking regions of SERPINC1.We aimed to identify regulatory mutations inSERPINC1 through sequencing the promoter, intron 1 and 2 of this gene in 23 patients with antithrombin deficiency but without known genetic defects. Three cases with moderate antithrombin deficiency (63–78%) carried potential regulatory mutations. One located 200 bp before the initiation ATG and two in intron 1. These mutations disrupted two out of five potential vitamin D receptor elements (VDRE) identified in SERPINC1 with different software. One genetic defect, c.42-1060_-1057dupTTGA, was a new low prevalent polymorphism (MAF: 0.01) with functional consequences on plasma antithrombin levels. The relevance of the vitamin D pathway on the regulation of SERPINC1 was confirmed in a cell model. Incubation of HepG2 with paricalcitol, a vitamin D analog, increased dose-dependently the levels of SERPINC1transcripts and antithrombin released to the conditioned medium. This study shows further evidence of the transcriptional regulation of SERPINC1 by vitamin D and first describes the functional and pathological relevance of mutations affecting VDRE of this gene. Our study opens new perspectives in the search of new genetic defects involved in antithrombin deficiency and the risk of thrombosis as well as in the design of new antithrombotic treatments. PMID:27003919

  8. Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.

    PubMed

    Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon

    2010-01-15

    Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short. PMID:19895802

  9. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.

    1989-01-01

    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  10. 45 CFR 73a.735-502 - Employees in regulatory activities.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Employees in regulatory activities. 73a.735-502 Section 73a.735-502 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION... regulatory activities. (a) An employee in regulatory activities (“control activity” employee) may...

  11. Regulated tissue-specific alternative splicing of enhanced green fluorescent protein transgenes conferred by alpha-tropomyosin regulatory elements in transgenic mice.

    PubMed

    Ellis, Peter D; Smith, Christopher W J; Kemp, Paul

    2004-08-27

    The mutually exclusive exons 2 and 3 of alpha-tropomyosin (alphaTM) have been used as a model system for strictly regulated alternative splicing. Exon 2 inclusion is only observed at high levels in smooth muscle (SM) tissues, whereas striated muscle and non-muscle cells use predominantly exon 3. Experiments in cell culture have shown that exon 2 selection results from repression of exon 3 and that this repression is mediated by regulatory elements flanking exon 3. We have now tested the cell culture-derived model in transgenic mice. We show that by harnessing the intronic splicing regulatory elements, expression of an enhanced green fluorescent protein transgene with a constitutively active promoter can be restricted to SM cells. Splicing of both endogenous alphaTM and a series of transgenes carrying regulatory element mutations was analyzed by reverse transcriptasePCR. These studies indicated that although SM-rich tissues are equipped to regulate splicing of high levels of endogenous or transgene alphaTM RNA, other non-SM tissues such as spleen, which express lower amounts of alphaTM, also splice significant proportions of exon 2, and this splicing pattern can be recapitulated by transgenes expressed at low levels. We confirm the importance in vivo of the negatively acting regulatory elements for regulated skipping of exon 3. Moreover, we provide evidence that some of the regulatory factors responsible for exon 3 skipping appear to be titratable, with loss of regulated splicing sometimes being associated with high transgene expression levels. PMID:15194683

  12. The medical dictionary for regulatory activities (MedDRA).

    PubMed

    Brown, E G; Wood, L; Wood, S

    1999-02-01

    The International Conference on Harmonisation has agreed upon the structure and content of the Medical Dictionary for Regulatory Activities (MedDRA) version 2.0 which should become available in the early part of 1999. This medical terminology is intended for use in the pre- and postmarketing phases of the medicines regulatory process, covering diagnoses, symptoms and signs, adverse drug reactions and therapeutic indications, the names and qualitative results of investigations, surgical and medical procedures, and medical/social history. It can be used for recording adverse events and medical history in clinical trials, in the analysis and tabulations of data from these trials and in the expedited submission of safety data to government regulatory authorities, as well as in constructing standard product information and documentation for applications for marketing authorisation. After licensing of a medicine, it may be used in pharmacovigilance and is expected to be the preferred terminology for international electronic regulatory communication. MedDRA is a hierarchical terminology with 5 levels and is multiaxial: terms may exist in more than 1 vertical axis, providing specificity of terms for data entry and flexibility in data retrieval. Terms in MedDRA were derived from several sources including the WHO's adverse reaction terminology (WHO-ART), Coding Symbols for a Thesaurus of Adverse Reaction Terms (COSTART), International Classification of Diseases (ICD) 9 and ICD9-CM. It will be maintained, further developed and distributed by a Maintenance Support Services Organisation (MSSO). It is anticipated that using MedDRA will improve the quality of data captured on databases, support effective analysis by providing clinically relevant groupings of terms and facilitate electronic communication of data, although as a new tool, users will need to invest time in gaining expertise in its use. PMID:10082069

  13. FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events

    PubMed Central

    Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J. P.; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

    2015-01-01

    Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain–domain interactions, protein–protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist’s mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop ‘novel’ therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE PMID:26384373

  14. Reconstructing genome-wide regulatory network of E. coli using transcriptome data and predicted transcription factor activities

    PubMed Central

    2011-01-01

    Background Gene regulatory networks play essential roles in living organisms to control growth, keep internal metabolism running and respond to external environmental changes. Understanding the connections and the activity levels of regulators is important for the research of gene regulatory networks. While relevance score based algorithms that reconstruct gene regulatory networks from transcriptome data can infer genome-wide gene regulatory networks, they are unfortunately prone to false positive results. Transcription factor activities (TFAs) quantitatively reflect the ability of the transcription factor to regulate target genes. However, classic relevance score based gene regulatory network reconstruction algorithms use models do not include the TFA layer, thus missing a key regulatory element. Results This work integrates TFA prediction algorithms with relevance score based network reconstruction algorithms to reconstruct gene regulatory networks with improved accuracy over classic relevance score based algorithms. This method is called Gene expression and Transcription factor activity based Relevance Network (GTRNetwork). Different combinations of TFA prediction algorithms and relevance score functions have been applied to find the most efficient combination. When the integrated GTRNetwork method was applied to E. coli data, the reconstructed genome-wide gene regulatory network predicted 381 new regulatory links. This reconstructed gene regulatory network including the predicted new regulatory links show promising biological significances. Many of the new links are verified by known TF binding site information, and many other links can be verified from the literature and databases such as EcoCyc. The reconstructed gene regulatory network is applied to a recent transcriptome analysis of E. coli during isobutanol stress. In addition to the 16 significantly changed TFAs detected in the original paper, another 7 significantly changed TFAs have been detected by

  15. A compact, in vivo screen of all 6-mers reveals drivers of tissue-specific expression and guides synthetic regulatory element design

    PubMed Central

    2013-01-01

    Background Large-scale annotation efforts have improved our ability to coarsely predict regulatory elements throughout vertebrate genomes. However, it is unclear how complex spatiotemporal patterns of gene expression driven by these elements emerge from the activity of short, transcription factor binding sequences. Results We describe a comprehensive promoter extension assay in which the regulatory potential of all 6 base-pair (bp) sequences was tested in the context of a minimal promoter. To enable this large-scale screen, we developed algorithms that use a reverse-complement aware decomposition of the de Bruijn graph to design a library of DNA oligomers incorporating every 6-bp sequence exactly once. Our library multiplexes all 4,096 unique 6-mers into 184 double-stranded 15-bp oligomers, which is sufficiently compact for in vivo testing. We injected each multiplexed construct into zebrafish embryos and scored GFP expression in 15 tissues at two developmental time points. Twenty-seven constructs produced consistent expression patterns, with the majority doing so in only one tissue. Functional sequences are enriched near biologically relevant genes, match motifs for developmental transcription factors, and are required for enhancer activity. By concatenating tissue-specific functional sequences, we generated completely synthetic enhancers for the notochord, epidermis, spinal cord, forebrain and otic lateral line, and show that short regulatory sequences do not always function modularly. Conclusions This work introduces a unique in vivo catalog of short, functional regulatory sequences and demonstrates several important principles of regulatory element organization. Furthermore, we provide resources for designing compact, reverse-complement aware k-mer libraries. PMID:23867016

  16. Identification and characterization of methylation-dependent/independent DNA regulatory elements in the human SLC9B1 gene

    PubMed Central

    Kumar, Priya L.; James, Paul F.

    2015-01-01

    The human NHEDC1 (hNHEDC1) protein is thought to be essential for sperm motility and fertility however the mechanisms regulating its gene expression are largely unknown. In this study we have identified multiple DNA regulatory elements in the 5′ end of the gene encoding hNHEDC1 (SLC9B1) and have explored the role that DNA methylation at these elements plays in the regulation of its expression. We first show that the full-length hNHEDC1 protein is testis-specific for the tissues that we tested and that it localizes to the cells of the seminiferous tubules. In silico analysis of the SLC9B1 gene locus identified two putative promoters (P1 and P2) and two CpG islands - CpGI (overlapping with P1) and CpGII (intragenic) - at the 5′ end of the gene. By deletion analysis of P1, we show that the region from −23bp to +200bp relative to the transcription start site (TSS) is sufficient for optimal promoter activity in a germ cell line. Additionally, in vitro methylation of the P1 (the −500bp to +200bp region relative to the TSS) abolishes its activity in germ cells and somatic cells strongly suggesting that DNA methylation at this promoter could regulate SLC9B1 expression. Furthermore, bisulfite-sequencing analysis of the P1/CpGI uncovered reduced methylation in the testis vs. lung whereas CpGII displayed no differences in methylation between these two tissues. Additionally, treatment of HEK 293 cells with 5-Aza2-Deoxycytidine led to upregulation of NHEDC1 transcript and reduced methylation in the promoter CpGI. Finally, we have uncovered both enhancer and silencer functions of the intragenic SLC9B1 CpGII. In all, our data suggests that SLC9B1 gene expression could be regulated via a concerted action of DNA methylation-dependent and independent mechanisms mediated by these multiple DNA regulatory elements. PMID:25701605

  17. Regulatory elements in the first intron contribute to transcriptional control of the human. cap alpha. 1(I) collagen gene

    SciTech Connect

    Bornstein, P.; McKay, J.; Morishima, J.K.; Devarayalu, S.; Gelinas, R.E.

    1987-12-01

    Several lines of evidence have suggested that the regulation of type I collagen gene transcription is complex and that important regulatory elements reside 5' to, and within, the first intron of the ..cap alpha..1(I) gene. The authors therefore sequenced a 2.3-kilobase HindIII fragment that encompasses 804 base pairs of 5' flanking sequence, the first exon, and most of the first intron of the ..cap alpha..1(I) human collagen gene. A 274-base-pair intronic sequence, flanked by Ava I sites (A274), contained a sequence identical to a high-affinity decanucleotide binding site for transcription factor Sp1 and a viral core enhancer sequence. DNase I protection experiments indicated zones of protection that corresponded to these motifs. When A274 was cloned 5' to the chloramphenicol acetyltransferase (CAT) gene, driven by an ..cap alpha..1(I) collagen promoter sequence, and expression was assessed by transfection, significant orientation-specific inhibition of CAT activity was observed. This effect was most apparent in chicken tendon fibroblasts, which modulate their level of collagen synthesis in culture. They propose that normal regulation of ..cap alpha..1(I) collagen gene transcription results from an interplay of positive and negative elements present in the promoter region and within the first intron.

  18. Identification of Regulatory DNA Elements Using Genome-wide Mapping of DNase I Hypersensitive Sites during Tomato Fruit Development.

    PubMed

    Qiu, Zhengkun; Li, Ren; Zhang, Shuaibin; Wang, Ketao; Xu, Meng; Li, Jiayang; Du, Yongchen; Yu, Hong; Cui, Xia

    2016-08-01

    Development and ripening of tomato fruit are precisely controlled by transcriptional regulation, which depends on the orchestrated accessibility of regulatory proteins to promoters and other cis-regulatory DNA elements. This accessibility and its effect on gene expression play a major role in defining the developmental process. To understand the regulatory mechanism and functional elements modulating morphological and anatomical changes during fruit development, we generated genome-wide high-resolution maps of DNase I hypersensitive sites (DHSs) from the fruit tissues of the tomato cultivar "Moneymaker" at 20 days post anthesis as well as break stage. By exploring variation of DHSs across fruit development stages, we pinpointed the most likely hypersensitive sites related to development-specific genes. By detecting binding motifs on DHSs of these development-specific genes or genes in the ascorbic acid biosynthetic pathway, we revealed the common regulatory elements contributing to coordinating gene transcription of plant ripening and specialized metabolic pathways. Our results contribute to a better understanding of the regulatory dynamics of genes involved in tomato fruit development and ripening. PMID:27250572

  19. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation.

    PubMed

    Hajibeigi, Asghar; Dioum, Elhadji M; Guo, Jianfei; Öz, Orhan K

    2015-09-25

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23 nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the -36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance. PMID:26260319

  20. Cis-Regulatory Elements Determine Germline Specificity and Expression Level of an Isopentenyltransferase Gene in Sperm Cells of Arabidopsis.

    PubMed

    Zhang, Jinghua; Yuan, Tong; Duan, Xiaomeng; Wei, Xiaoping; Shi, Tao; Li, Jia; Russell, Scott D; Gou, Xiaoping

    2016-03-01

    Flowering plant sperm cells transcribe a divergent and complex complement of genes. To examine promoter function, we chose an isopentenyltransferase gene known as PzIPT1. This gene is highly selectively transcribed in one sperm cell morphotype of Plumbago zeylanica, which preferentially fuses with the central cell during fertilization and is thus a founding cell of the primary endosperm. In transgenic Arabidopsis (Arabidopsis thaliana), PzIPT1 promoter displays activity in both sperm cells and upon progressive promoter truncation from the 5'-end results in a progressive decrease in reporter production, consistent with occurrence of multiple enhancer sites. Cytokinin-dependent protein binding motifs are identified in the promoter sequence, which respond with stimulation by cytokinin. Expression of PzIPT1 promoter in sperm cells confers specificity independently of previously reported Germline Restrictive Silencer Factor binding sequence. Instead, a cis-acting regulatory region consisting of two duplicated 6-bp Male Gamete Selective Activation (MGSA) motifs occurs near the site of transcription initiation. Disruption of this sequence-specific site inactivates expression of a GFP reporter gene in sperm cells. Multiple copies of the MGSA motif fused with the minimal CaMV35S promoter elements confer reporter gene expression in sperm cells. Similar duplicated MGSA motifs are also identified from promoter sequences of sperm cell-expressed genes in Arabidopsis, suggesting selective activation is possibly a common mechanism for regulation of gene expression in sperm cells of flowering plants. PMID:26739233

  1. Transcription of T cell receptor beta-chain genes is controlled by a downstream regulatory element.

    PubMed Central

    Krimpenfort, P; de Jong, R; Uematsu, Y; Dembic, Z; Ryser, S; von Boehmer, H; Steinmetz, M; Berns, A

    1988-01-01

    To characterize cis-acting elements controlling the expression of T cell receptor beta-chains we generated a number of transgenic mouse lines harboring a rearranged T cell receptor beta-chain with different extensions of 5' and 3' flanking sequences. Transcriptional analysis of transgenic mice carrying these clones showed that sequences located downstream of the polyadenylation signal of the C beta 2 region are indispensable for expression in transgenic mice. The sequences conferring enhancer activity in this fragment were further defined by transient CAT assays. Strong enhancer activity was found to reside in a 550 bp fragment located 5 kb downstream from C beta 2. The nucleotide sequence of this fragment revealed a number of oligonucleotide motifs characteristic for enhancer elements. Images PMID:3396541

  2. Putative regulatory elements within the non-coding regions of Chrysomelidae Diapause Associated Transcript-1 (DAT-1) orthologs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To develop a more comprehensive understanding of diapause within Chrysomelidae, we are employing phylogenetic foot-printing to isolate and characterize the regulatory elements associated with the diapause-associated gene, DAT-1. Leptinotarsa decemlineata (Colorado potato beetle, CPB) DAT-1 has been ...

  3. Dynamic BRG1 Recruitment during T Helper Differentiation and Activation Reveals Distal Regulatory Elements▿§

    PubMed Central

    De, Supriyo; Wurster, Andrea L.; Precht, Patricia; Wood, William H.; Becker, Kevin G.; Pazin, Michael J.

    2011-01-01

    T helper cell differentiation and activation require specific transcriptional programs accompanied by changes in chromatin structure. However, little is known about the chromatin remodeling enzymes responsible. We performed genome-wide analysis to determine the general principles of BRG1 binding, followed by analysis of specific genes to determine whether these general rules were typical of key T cell genes. We found that binding of the remodeling protein BRG1 was programmed by both lineage and activation signals. BRG1 binding positively correlated with gene activity at protein-coding and microRNA (miRNA) genes. BRG1 binding was found at promoters and distal regions, including both novel and previously validated distal regulatory elements. Distal BRG1 binding correlated with expression, and novel distal sites in the Gata3 locus possessed enhancer-like activity, suggesting a general role for BRG1 in long-distance gene regulation. BRG1 recruitment to distal sites in Gata3 was impaired in cells lacking STAT6, a transcription factor that regulates lineage-specific genes. Together, these findings suggest that BRG1 interprets both differentiation and activation signals and plays a causal role in gene regulation, chromatin structure, and cell fate. Our findings suggest that BRG1 binding is a useful marker for identifying active cis-regulatory regions in protein-coding and miRNA genes. PMID:21262765

  4. Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

    PubMed Central

    2013-01-01

    Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

  5. Control of human PLP1 expression through transcriptional regulatory elements and alternatively spliced exons in intron 1.

    PubMed

    Hamdan, Hamdan; Kockara, Neriman T; Jolly, Lee Ann; Haun, Shirley; Wight, Patricia A

    2015-01-01

    Although the myelin proteolipid protein gene (PLP1) encodes the most abundant protein in central nervous system (CNS) myelin, not much is known about the mechanisms that govern expression of the human gene (hPLP1). Much more is known about the processes that regulate Plp1 gene expression in rodents. From studies with Plp1-lacZ transgenic mice, it was determined that the first intron of mouse Plp1 (mPlp1) is required to attain high levels of expression in brain, concurrent with the active myelination period. Other studies have suggested that within mPlp1 intron 1 (>8 kb) lie several regions with enhancer-like activity. To test whether these sequences (and possibly others) in hPLP1 intron 1 are functional, deletion-transfection analysis was performed with hPLP1-lacZ constructs that contain various portions of the intron, or lack it altogether. Results presented here demonstrate the importance of hPLP1 intron 1 in achieving maximal levels of expression in the immortalized oligodendroglial cell line, Oli-neu. Deletion analysis indicates that the intron contains multiple positive regulatory elements which are active in Oli-neu cells. Some of these elements appear to be functionally conserved between human and mouse, while others are not. Furthermore, our studies demonstrate that multiple splice variants can be formed due to inclusion of extra (supplementary) exons from what is classically thought of as hPLP1 intron 1. Thus, splicing of these novel exons (which are not recognized as such in mPlp1 due to lack of conserved splice sites) must utilize factors common to both human and mouse since Oli-neu cells are of mouse origin. PMID:25694552

  6. Distinct cis-Regulatory Elements from the Dlx1/Dlx2 Locus Mark Different Progenitor Cell Populations in the Ganglionic Eminences and Different Subtypes of Adult Cortical Interneurons

    PubMed Central

    Ghanem, Noël; Yu, Man; Long, Jason; Hatch, Gary; Rubenstein, John L. R.; Ekker, Marc

    2016-01-01

    Distinct subtypes of cortical GABAergic interneurons provide inhibitory signals that are indispensable for neural network function. The Dlx homeobox genes have a central role in regulating their development and function. We have characterized the activity of three cis-regulatory sequences involved in forebrain expression of vertebrate Dlx genes: upstream regulatory element 2 (URE2), I12b, and I56i. The three regulatory elements display regional and temporal differences in their activities within the lateral ganglionic eminence (LGE), medial ganglionic eminence (MGE), and caudal ganglionic eminence (CGE) and label distinct populations of tangentially migrating neurons at embryonic day 12.5 (E12.5) and E13.5. We provide evidence that the dorsomedial and ventral MGE are distinct sources of tangentially migrating neurons during midgestation. In the adult cortex, URE2 and I12b/I56i are differentially expressed in parvalbumin-, calretinin-, neuropeptide Y-, and neuronal nitric oxide synthase-positive interneurons; I12b and I56i were specifically active in somatostatin-, vasoactive intestinal peptide-, and calbindin-positive interneurons. These data suggest that interneuron subtypes use distinct combinations of Dlx1/Dlx2 enhancers from the time they are specified through adulthood. PMID:17494687

  7. Characterization of CYP1A1 regulatory elements in Atlantic tomcod

    SciTech Connect

    Roy, N.; Wirgin, I.; Courtenay, S.

    1995-12-31

    Coplanar PCBs, TCDD, and PAHs induce cytochrome P4501A1 (CYP1A1) mRNA in Atlantic tomcod from the Miramichi River (MR), whereas only PAHs induce gene expression in tomcod from the Hudson River (HR). Relative to the highly industrialized HR, MR is relatively clean. The authors hypothesize that non-inducibility of CYP1A1 mRNA in PCB (TCB) or TCDD treated tomcod from the HR is due to prior exposure to environmentally-borne xenobiotics. To evaluate the mechanisms which selectively inhibit CYP1A1 inducibility, they isolated and characterized 5{tilde O}and intronic CYP1A1 regulatory elements from tomcod genomic DNA. Tomcod 5{tilde O} CYP1A1 contains four motifs with core sequences identical to the aromatic hydrocarbon receptor elements (AhREs) identified in mammals. Electrophoretic mobility shift assays (EMSAs) with nuclear extracts prepared form the livers of B[a]P treated HR tomcod showed protein binding to 142 and 156 bp tomcod DNA fragments each containing two tomcod AhREs. EMSAs with nuclear extracts prepared from DMBA treated rat livers and human MOLT4 cells also showed protein binding to the fish AhREs. Protein binding at individual tomcod AhREs was characterized with hepatic protein extracts prepared from TCB, B[a]P, and vehicle treated tomcod from the HR and MR. Preliminary studies showed a difference in protein binding between HR and MR tomcod i.p. injected with TCB 1d, 5d, or 15d previous, but not B[a]P 6 hr or 24 hr previous. These results suggest that the mechanisms of CYP1A1 transcription are similar tomcod and mammals and that variation in levels of gene inducibility among individual tomcod may be due to differences in inducible protein binding to CYP1A1 AhREs.

  8. Identification of regulatory elements in the AGT1 promoter of ale and lager strains of brewer's yeast.

    PubMed

    Vidgren, Virve; Kankainen, Matti; Londesborough, John; Ruohonen, Laura

    2011-08-01

    Agt1 is an interesting α-glucoside transporter for the brewing industry, as it efficiently transports maltotriose, a sugar often remaining partly unused during beer fermentation. It has been shown that on maltose the expression level of AGT1 is much higher in ale strains than in lager strains, and that glucose represses the expression, particularly in the ale strains. In the present study the regulatory elements of the AGT1 promoter of one ale and two lager strains were identified by computational methods. Promoter regions up to 1.9 kbp upstream of the AGT1 gene were sequenced from the three brewer's yeast strains and the laboratory yeast strain CEN.PK-1D. The promoter sequence of the laboratory strain was identical to the AGT1 promoter of strain S288c of the Saccharomyces Genome Database, whereas the promoter sequences of the industrial strains diverged markedly from the S288c strain. The AGT1 promoter regions of the ale and lager strains were for the most part identical to each other, except for one 22 bp deletion and two 94 and 95 bp insertions in the ale strain. Computational analyses of promoter elements revealed that the promoter sequences contained several Mig1- and MAL-activator binding sites, as was expected. However, some of the Mig1 and MAL-activator binding sites were located on the two insertions of the ale strain, and thus offered a plausible explanation for the different expression pattern of the AGT1 gene in the ale strains. Accordingly, functional analysis of A60 ale and A15 lager strain AGT1 promoters fused to GFP (encoding the green fluorescent protein) showed a significant difference in the ability of these two promoters to drive GFP expression. Under the control of the AGT1 promoter of the ale strain the emergence of GFP was strongly induced by maltose, whereas only a low level of GFP was detected with the construct carrying the AGT1 promoter of the lager strain. Thus, the extra MAL-activator binding element, present in the AGT1 promoter of

  9. Chimeric murine interferon regulatory factor-2 (IRF-2) binds to IRF-E (IRF binding element), VREβ (virus response element) but not to VREα1.

    PubMed

    Prakash, Krishna; Kumar, Pardeep; Mukherjee, Somnath; Rath, P C

    2014-12-01

    Interferon regulatory factor-2 (IRF-2) is a multifunctional transcription factor having gene activation, repression and synergistic effect in conjunction with IRF-1. IRF-2 is also involved in type I IFN signalling by repressing INFβ gene. So far, the molecular mechanism of its DNA binding activity remains elusive. We have carried out molecular sub-cloning, expression and electrophoretically mobility shift assay study of chimeric murine IRF-2. Here, we report expression of chimeric murine IRF-2 as GST-IRF-2 fusion protein in Escherichia coli/BL21 cells and demonstrated DNA binding activity by gel retardation technique using radio (32) P-labelled IRF-E motif (GAAAGT)4 , virus response element (VRE) of human INFβ and IFNα1 gene. We observed five different masses DNA/GST-IRF-2 complexes (1-5) with IRF-E motif, three different masses DNA/GST-IRF-2 complexes (1-3) with VREß , but we could not observe any complex of DNA/GST-IRF-2 with VREα1 . The specific binding on IRF-E motif was confirmed by carrying out 100-X fold cold competition with (32) P-labelled IRF-E motif. In contrast to specific binding on VREß , we used negative control where we observed no binding complex, but we observed complexes with clones IPTG-induced extract. As far as binding on VREα1 is concerned, we could not observe any complex in negative control as well as in IPTG-inducible clones extract. Chimeric IRF-2 binds with IRF-E motif and VREβ but not with VREα1. This study is first of its kind and paves the way to understand the differential DNA binding and molecular mechanism of DNA binding activity of the IRF-2 molecule, which is crucial for its function(s). PMID:25251598

  10. Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4.

    PubMed

    Bondurand, Nadége; Fouquet, Virginie; Baral, Viviane; Lecerf, Laure; Loundon, Natalie; Goossens, Michel; Duriez, Benedicte; Labrune, Philippe; Pingault, Veronique

    2012-09-01

    Waardenburg syndrome type 4 (WS4) is a rare neural crest disorder defined by the combination of Waardenburg syndrome (sensorineural hearing loss and pigmentation defects) and Hirschsprung disease (intestinal aganglionosis). Three genes are known to be involved in this syndrome, that is, EDN3 (endothelin-3), EDNRB (endothelin receptor type B), and SOX10. However, 15-35% of WS4 remains unexplained at the molecular level, suggesting that other genes could be involved and/or that mutations within known genes may have escaped previous screenings. Here, we searched for deletions within recently identified SOX10 regulatory sequences and describe the first characterization of a WS4 patient presenting with a large deletion encompassing three of these enhancers. Analysis of the breakpoint region suggests a complex rearrangement involving three Alu sequences that could be mediated by a FosTes/MMBIR replication mechanism. Taken together with recent reports, our results demonstrate that the disruption of highly conserved non-coding elements located within or at a long distance from the coding sequences of key genes can result in several neurocristopathies. This opens up new routes to the molecular dissection of neural crest disorders. PMID:22378281

  11. DREAM (Downstream Regulatory Element Antagonist Modulator) contributes to synaptic depression and contextual fear memory

    PubMed Central

    2010-01-01

    The downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, binds specifically to DNA and several nucleoproteins regulating gene expression and with proteins outside the nucleus to regulate membrane excitability or calcium homeostasis. DREAM is highly expressed in the central nervous system including the hippocampus and cortex; however, the roles of DREAM in hippocampal synaptic transmission and plasticity have not been investigated. Taking advantage of transgenic mice overexpressing a Ca2+-insensitive DREAM mutant (TgDREAM), we used integrative methods including electrophysiology, biochemistry, immunostaining, and behavior tests to study the function of DREAM in synaptic transmission, long-term plasticity and fear memory in hippocampal CA1 region. We found that NMDA receptor but not AMPA receptor-mediated current was decreased in TgDREAM mice. Moreover, synaptic plasticity, such as long-term depression (LTD) but not long-term potentiation (LTP), was impaired in TgDREAM mice. Biochemical experiments found that DREAM interacts with PSD-95 and may inhibit NMDA receptor function through this interaction. Contextual fear memory was significantly impaired in TgDREAM mice. By contrast, sensory responses to noxious stimuli were not affected. Our results demonstrate that DREAM plays a novel role in postsynaptic modulation of the NMDA receptor, and contributes to synaptic plasticity and behavioral memory. PMID:20205763

  12. DREAM (downstream regulatory element antagonist modulator) contributes to synaptic depression and contextual fear memory.

    PubMed

    Wu, Long-Jun; Mellström, Britt; Wang, Hansen; Ren, Ming; Domingo, Sofia; Kim, Susan S; Li, Xiang-Yao; Chen, Tao; Naranjo, Jose R; Zhuo, Min

    2010-01-01

    The downstream regulatory element antagonist modulator (DREAM), a multifunctional Ca2+-binding protein, binds specifically to DNA and several nucleoproteins regulating gene expression and with proteins outside the nucleus to regulate membrane excitability or calcium homeostasis. DREAM is highly expressed in the central nervous system including the hippocampus and cortex; however, the roles of DREAM in hippocampal synaptic transmission and plasticity have not been investigated. Taking advantage of transgenic mice overexpressing a Ca2+-insensitive DREAM mutant (TgDREAM), we used integrative methods including electrophysiology, biochemistry, immunostaining, and behavior tests to study the function of DREAM in synaptic transmission, long-term plasticity and fear memory in hippocampal CA1 region. We found that NMDA receptor but not AMPA receptor-mediated current was decreased in TgDREAM mice. Moreover, synaptic plasticity, such as long-term depression (LTD) but not long-term potentiation (LTP), was impaired in TgDREAM mice. Biochemical experiments found that DREAM interacts with PSD-95 and may inhibit NMDA receptor function through this interaction. Contextual fear memory was significantly impaired in TgDREAM mice. By contrast, sensory responses to noxious stimuli were not affected. Our results demonstrate that DREAM plays a novel role in postsynaptic modulation of the NMDA receptor, and contributes to synaptic plasticity and behavioral memory. PMID:20205763

  13. Site-specific silencing of regulatory elements as a mechanism of X inactivation.

    PubMed

    Calabrese, J Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E; Magnuson, Terry

    2012-11-21

    The inactive X chromosome's (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequences is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to nontranscribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X inactivation occurred within, and X inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  14. Site-specific silencing of regulatory elements as a mechanism of X-inactivation

    PubMed Central

    Calabrese, J. Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W.; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E.; Magnuson, Terry

    2012-01-01

    The inactive X chromosome’s (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequence is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to non-transcribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X-inactivation occurred within, and X-inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X-inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  15. SeqGL Identifies Context-Dependent Binding Signals in Genome-Wide Regulatory Element Maps

    PubMed Central

    Setty, Manu; Leslie, Christina S.

    2015-01-01

    Genome-wide maps of transcription factor (TF) occupancy and regions of open chromatin implicitly contain DNA sequence signals for multiple factors. We present SeqGL, a novel de novo motif discovery algorithm to identify multiple TF sequence signals from ChIP-, DNase-, and ATAC-seq profiles. SeqGL trains a discriminative model using a k-mer feature representation together with group lasso regularization to extract a collection of sequence signals that distinguish peak sequences from flanking regions. Benchmarked on over 100 ChIP-seq experiments, SeqGL outperformed traditional motif discovery tools in discriminative accuracy. Furthermore, SeqGL can be naturally used with multitask learning to identify genomic and cell-type context determinants of TF binding. SeqGL successfully scales to the large multiplicity of sequence signals in DNase- or ATAC-seq maps. In particular, SeqGL was able to identify a number of ChIP-seq validated sequence signals that were not found by traditional motif discovery algorithms. Thus compared to widely used motif discovery algorithms, SeqGL demonstrates both greater discriminative accuracy and higher sensitivity for detecting the DNA sequence signals underlying regulatory element maps. SeqGL is available at http://cbio.mskcc.org/public/Leslie/SeqGL/. PMID:26016777

  16. FootprintDB: Analysis of Plant Cis-Regulatory Elements, Transcription Factors, and Binding Interfaces.

    PubMed

    Contreras-Moreira, Bruno; Sebastian, Alvaro

    2016-01-01

    FootprintDB is a database and search engine that compiles regulatory sequences from open access libraries of curated DNA cis-elements and motifs, and their associated transcription factors (TFs). It systematically annotates the binding interfaces of the TFs by exploiting protein-DNA complexes deposited in the Protein Data Bank. Each entry in footprintDB is thus a DNA motif linked to the protein sequence of the TF(s) known to recognize it, and in most cases, the set of predicted interface residues involved in specific recognition. This chapter explains step-by-step how to search for DNA motifs and protein sequences in footprintDB and how to focus the search to a particular organism. Two real-world examples are shown where this software was used to analyze transcriptional regulation in plants. Results are described with the aim of guiding users on their interpretation, and special attention is given to the choices users might face when performing similar analyses. PMID:27557773

  17. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences.

    PubMed Central

    Ch'ang, L Y; Yang, W K; Myer, F E; Yang, D M

    1989-01-01

    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenicol acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base-pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-bp inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs of the enhancer segment as well as the upstream LTR sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression. Further analyses using chimeric LTR constructs located the presence of a strong negative regulatory element within the region containing the 5' portion of the enhancer and the immediate upstream sequences in the MuLV-related LTRs. Images PMID:2542587

  18. Synthetic promoter elements obtained by nucleotide sequence variation and selection for activity

    PubMed Central

    Edelman, Gerald M.; Meech, Robyn; Owens, Geoffrey C.; Jones, Frederick S.

    2000-01-01

    Eukaryotic transcriptional regulation in different cells involves large numbers and arrangements of cis and trans elements. To survey the number of cis regulatory elements that are active in different contexts, we have devised a high-throughput selection procedure permitting synthesis of active cis motifs that enhance the activity of a minimal promoter. This synthetic promoter construction method (SPCM) was used to identify >100 DNA sequences that showed increased promoter activity in the neuroblastoma cell line Neuro2A. After determining DNA sequences of selected synthetic promoters, database searches for known elements revealed a predominance of eight motifs: AP2, CEBP, GRE, Ebox, ETS, CREB, AP1, and SP1/MAZ. The most active of the selected synthetic promoters contain composites of a number of these motifs. Assays of DNA binding and promoter activity of three exemplary motifs (ETS, CREB, and SP1/MAZ) were used to prove the effectiveness of SPCM in uncovering active sequences. Up to 10% of 133 selected active sequences had no match in currently available databases, raising the possibility that new motifs and transcriptional regulatory proteins to which they bind may be revealed by SPCM. The method may find uses in constructing databases of active cis motifs, in diagnostics, and in gene therapy. PMID:10725347

  19. CCAAT displacement protein (CDP/cut) binds a negative regulatory element in the human tryptophan hydroxylase gene.

    PubMed

    Teerawatanasuk, N; Skalnik, D G; Carr, L G

    1999-01-01

    Tryptophan hydroxylase (TPH) is the rate-limiting enzyme in the biosynthesis of serotonin, a neurotransmitter that has been implicated in many psychiatric illnesses. The mechanism of transcriptional regulation of the human TPH gene is largely unknown. We have identified a negative regulatory element located between nucleotides -310 and -220 in the human TPH (hTPH) gene. Electromobility shift analyses performed with the -310/-220 hTPH probe and nuclear extract from P815-HTR (a TPH-expressing cell line) revealed two slow migrating protein-DNA complexes, designated I and II. CCAAT displacement protein (CDP/Cut) is involved in complex I formation as shown in electromobility shift analysis, using consensus oligonucleotide competitor and antibody. Mutations in the CDP/Cut binding site not only disrupted the CDP-DNA complex but also disrupted the second complex, suggesting that the core binding sequences of the two proteins are overlapping. The functional importance of these protein-DNA interactions was assessed by transiently transfecting wild-type and mutant pTPH/luciferase reporter constructs into P815-HTR cells. Mutations in the core CDP/Cut site resulted in an approximately fourfold increase in relative luciferase activities. Because CDP/Cut has been shown to repress transcription of many target genes, we speculate that disruption of the CDP/Cut binding was responsible, at least in part, for the activation of hTPH gene. PMID:9886051

  20. Inducer effect on the complex formation between rat liver nuclear proteins and cytochrome P450 2B gene regulatory elements.

    PubMed

    Duzhak, T G; Schwartz, E I; Gulyaeva, L F; Lyakhovich, V V

    2002-09-01

    DNA gel retardation assay has been applied to the investigation of complexes between rat liver nuclear proteins and Barbie box positive regulatory element of cytochrome P450 2B (CYP2B) genes. The intensities of B1 and B2 bands detected in the absence of an inducer increased after 30 min protein incubation with phenobarbital (PB) or triphenyldioxane (TPD), but not with 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOPOB). In addition, a new complex (B3 band) was for the first time detected under induction by PB, TPD, and TCPOPOB. Increase in the incubation time up to 2 h facilitated the formation of other new complexes (B4 and B5 bands), which were detected only in the presence of TPD. The use of [3H]TPD in hybridization experiments revealed that this inducer, capable of binding to Barbie box DNA, is also present in B4 and B5 complexes. It is probable that the investigated compounds activate the same proteins at the initial induction steps, which correlates with the formation of B1, B2, and B3 complexes. The further induction step might be inducer-specific, as indicated by the formation of B4 and B5 complexes in the presence of TPD only. Thus, the present data suggest the possibility of specific gene activation signaling pathways that are dependent on a particular inducer. PMID:12387719

  1. Sterol regulatory element binding protein-1 (SREBP-1)c promoter: Characterization and transcriptional regulation by mature SREBP-1 and liver X receptor α in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Wang, H P; Wang, H; Zhang, T Y; Tian, H B; Yao, D W; Loor, J J

    2016-02-01

    Sterol regulatory element binding protein-1 (SREBP-1) is a key transcription factor that regulates lipogenesis in rodent liver. Two isoforms (SREBP-1a and SREBP-1c) of SREBP-1 are transcribed by an alternative promoter on the same gene (SREBF1), and the isoforms differ only in their first exon. Although the regulatory effects of SREBP-1 on lipid and milk fat synthesis have received much attention in ruminants, SREBP-1c promoter and its regulatory mechanisms have not been characterized in the goat. In the present study, we cloned and sequenced a 2,012-bp fragment of the SREBP-1c 5'-flanking region from goat genomic DNA. A luciferase reporter assay revealed that SREBP-1c is transcriptionally activated by the liver X receptor α (LXRα) agonist T0901317, and is decreased by SREBP-1 small interfering (si)RNA. A 5' deletion analysis revealed a core promoter region located -395 to +1 bp upstream of the transcriptional start site (TSS). Site-directed mutagenesis of LXRα binding elements (LXRE1 and LXRE2) and sterol regulatory elements (SRE1 and SRE2) revealed that the full effects of T 4506585 require the presence of both LXRE and SRE. We also characterized a new SRE (SRE1) and demonstrated a direct role of SREBP-1 (auto-loop regulation) in maintaining its basal transcription activity. Results suggest that goat SREBP-1c gene is transcriptionally regulated by mature SREBP-1 (auto-loop circuit regulation) and LXRα in goat mammary epithelial cells. PMID:26709176

  2. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De

    2015-01-01

    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  3. The Regulatory Role of Activating Transcription Factor 2 in Inflammation

    PubMed Central

    Yu, Tao; Li, Yong Jun; Bian, Ai Hong; Zuo, Hui Bin; Zhu, Ti Wen; Ji, Sheng Xiang; Kong, Fanming; Yin, De Qing; Wang, Chuan Bao; Wang, Zi Fu; Wang, Hong Qun; Yang, Yanyan; Yoo, Byong Chul

    2014-01-01

    Activating transcription factor 2 (ATF2) is a member of the leucine zipper family of DNA-binding proteins and is widely distributed in tissues including the liver, lung, spleen, and kidney. Like c-Jun and c-Fos, ATF2 responds to stress-related stimuli and may thereby influence cell proliferation, inflammation, apoptosis, oncogenesis, neurological development and function, and skeletal remodeling. Recent studies clarify the regulatory role of ATF2 in inflammation and describe potential inhibitors of this protein. In this paper, we summarize the properties and functions of ATF2 and explore potential applications of ATF2 inhibitors as tools for research and for the development of immunosuppressive and anti-inflammatory drugs. PMID:25049453

  4. Encoding Active Device Elements at Nanowire Tips.

    PubMed

    No, You-Shin; Gao, Ruixuan; Mankin, Max N; Day, Robert W; Park, Hong-Gyu; Lieber, Charles M

    2016-07-13

    Semiconductor nanowires and other one-dimensional materials are attractive for highly sensitive and spatially confined electrical and optical signal detection in biological and physical systems, although it has been difficult to localize active electronic or optoelectronic device function at one end of such one-dimensional structures. Here we report a new nanowire structure in which the material and dopant are modulated specifically at only one end of nanowires to encode an active two-terminal device element. We present a general bottom-up synthetic scheme for these tip-modulated nanowires and illustrate this with the synthesis of nanoscale p-n junctions. Electron microscopy imaging verifies the designed p-Si nanowire core with SiO2 insulating inner shell and n-Si outer shell with clean p-Si/n-Si tip junction. Electrical transport measurements with independent contacts to the p-Si core and n-Si shell exhibited a current rectification behavior through the tip and no detectable current through the SiO2 shell. Electrical measurements also exhibited an n-type response in conductance versus water-gate voltage with pulsed gate experiments yielding a temporal resolution of at least 0.1 ms and ∼90% device sensitivity localized to within 0.5 μm from the nanowire p-n tip. In addition, photocurrent experiments showed an open-circuit voltage of 0.75 V at illumination power of ∼28.1 μW, exhibited linear dependence of photocurrent with respect to incident illumination power with an estimated responsivity up to ∼0.22 A/W, and revealed localized photocurrent generation at the nanowire tip. The tip-modulated concept was further extended to a top-down/bottom-up hybrid approach that enabled large-scale production of vertical tip-modulated nanowires with a final synthetic yield of >75% with >4300 nanowires. Vertical tip-modulated nanowires were fabricated into >50 individually addressable nanowire device arrays showing diode-like current-voltage characteristics. These tip

  5. Characterization and identification of cis-regulatory elements in Arabidopsis based on single-nucleotide polymorphism information.

    PubMed

    Korkuc, Paula; Schippers, Jos H M; Walther, Dirk

    2014-01-01

    Identifying regulatory elements and revealing their role in gene expression regulation remains a central goal of plant genome research. We exploited the detailed genomic sequencing information of a large number of Arabidopsis (Arabidopsis thaliana) accessions to characterize known and to identify novel cis-regulatory elements in gene promoter regions of Arabidopsis by relying on conservation as the hallmark signal of functional relevance. Based on the genomic layout and the obtained density profiles of single-nucleotide polymorphisms (SNPs) in sequence regions upstream of transcription start sites, the average length of promoter regions in Arabidopsis could be established at 500 bp. Genes associated with high degrees of variability of their respective upstream regions are preferentially involved in environmental response and signaling processes, while low levels of promoter SNP density are common among housekeeping genes. Known cis-elements were found to exhibit a decreased SNP density than sequence regions not associated with known motifs. For 15 known cis-element motifs, strong positional preferences relative to the transcription start site were detected based on their promoter SNP density profiles. Five novel candidate cis-element motifs were identified as consensus motifs of 17 sequence hexamers exhibiting increased sequence conservation combined with evidence of positional preferences, annotation information, and functional relevance for inducing correlated gene expression. Our study demonstrates that the currently available resolution of SNP data offers novel ways for the identification of functional genomic elements and the characterization of gene promoter sequences. PMID:24204023

  6. Identification of Regulatory Elements That Control Expression of the tbpBA Operon in Neisseria gonorrhoeae

    PubMed Central

    Vélez Acevedo, Rosuany N.; Ronpirin, Chalinee; Kandler, Justin L.; Shafer, William M.

    2014-01-01

    Iron is an essential nutrient for survival and establishment of infection by Neisseria gonorrhoeae. The neisserial transferrin binding proteins (Tbps) comprise a bipartite system for iron acquisition from human transferrin. TbpA is the TonB-dependent transporter that accomplishes iron internalization. TbpB is a surface-exposed lipoprotein that makes the iron uptake process more efficient. Previous studies have shown that the genes encoding these proteins are arranged in a bicistronic operon, with the tbpB gene located upstream of tbpA and separated from it by an inverted repeat. The operon is under the control of the ferric uptake regulator (Fur); however, promoter elements necessary for regulated expression of the genes have not been experimentally defined. In this study, putative regulatory motifs were identified and confirmed by mutagenesis. Further examination of the sequence upstream of these promoter/operator motifs led to the identification of several novel repeats. We hypothesized that these repeats are involved in additional regulation of the operon. Insertional mutagenesis of regions upstream of the characterized promoter region resulted in decreased tbpB and tbpA transcript levels but increased protein levels for both TbpA and TbpB. Using RNA sequencing (RNA-Seq) technology, we determined that a long RNA was produced from the region upstream of tbpB. We localized the 5′ endpoint of this transcript to between the two upstream insertions by qualitative RT-PCR. We propose that expression of this upstream RNA leads to optimized expression of the gene products from within the tbpBA operon. PMID:24837286

  7. Regulation of steroid 5-{alpha} reductase type 2 (Srd5a2) by sterol regulatory element binding proteins and statin

    SciTech Connect

    Seo, Young-Kyo; Zhu, Bing; Jeon, Tae-Il; Osborne, Timothy F.

    2009-11-01

    In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.

  8. Gentiana manshurica Kitagawa reverses acute alcohol-induced liver steatosis through blocking sterol regulatory element-binding protein-1 maturation.

    PubMed

    Lian, Li-Hua; Wu, Yan-Ling; Song, Shun-Zong; Wan, Ying; Xie, Wen-Xue; Li, Xin; Bai, Ting; Ouyang, Bing-Qing; Nan, Ji-Xing

    2010-12-22

    This study was undertaken to investigate the protective effects of Gentiana manshurica Kitagawa (GM) on acute alcohol-induced fatty liver. Mice were treated with ethanol (5 g/kg of body weight) by gavage every 12 h for a total of three doses to induce acute fatty liver. Methanol extract of GM (50, 100, or 200 mg/kg) or silymarin (100 mg/kg) was gavaged simultaneously with ethanol for three doses. GM administration significantly reduced the increases in serum ALT and AST levels, the serum and hepatic triglyceride levels, at 4 h after the last ethanol administration. GM was also found to prevent ethanol-induced hepatic steatosis and necrosis, as indicated by liver histopathological studies. Additionally, GM suppressed the elevation of malondialdehyde (MDA) levels, restored the glutathione (GSH) levels, and enhanced the superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPX) activities. The concurrent administration of GM efficaciously abrogated cytochrome P450 2E1 (CYP2E1) induction. Moreover, GM significantly reduced the nuclear translocation of sterol regulatory element-binding protein-1 (nSREBP-1) in ethanol-treated mice. These data indicated that GM possessed the ability to prevent ethanol-induced acute liver steatosis, possibly through blocking CYP2E1-mediated free radical scavenging effects and SREBP-1-regulated fatty acid synthesis. Especially, GM may be developed as a potential therapeutic candidate for ethanol-induced oxidative damage in liver. PMID:21105651

  9. Sterol Regulatory Element Binding Protein Regulates the Expression and Metabolic Functions of Wild-Type and Oncogenic IDH1.

    PubMed

    Ricoult, Stéphane J H; Dibble, Christian C; Asara, John M; Manning, Brendan D

    2016-09-15

    Sterol regulatory element binding protein (SREBP) is a major transcriptional regulator of the enzymes underlying de novo lipid synthesis. However, little is known about the SREBP-mediated control of processes that indirectly support lipogenesis, for instance, by supplying reducing power in the form of NAPDH or directing carbon flux into lipid precursors. Here, we characterize isocitrate dehydrogenase 1 (IDH1) as a transcriptional target of SREBP across a spectrum of cancer cell lines and human cancers. IDH1 promotes the synthesis of lipids specifically from glutamine-derived carbons. Neomorphic mutations in IDH1 occur frequently in certain cancers, leading to the production of the oncometabolite 2-hydroxyglutarate (2-HG). We found that SREBP induces the expression of oncogenic IDH1 and influences 2-HG production from glucose. Treatment of cells with 25-hydroxycholesterol or statins, which respectively inhibit or activate SREBP, further supports SREBP-mediated regulation of IDH1 and, in cells with oncogenic IDH1, carbon flux into 2-HG. PMID:27354064

  10. Expression of the CDR1 efflux pump in clinical Candida albicans isolates is controlled by a negative regulatory element

    SciTech Connect

    Gaur, Naseem Akhtar; Manoharlal, Raman; Saini, Preeti; Prasad, Tulika; Mukhopadhyay, Gauranga; Hoefer, Milan; Morschhaeuser, Joachim; Prasad, Rajendra . E-mail: rp47@hotmail.com

    2005-06-24

    Resistance to azole antifungal drugs in clinical isolates of the human fungal pathogen Candida albicans is often caused by constitutive overexpression of the CDR1 gene, which encodes a multidrug efflux pump of the ABC transporter superfamily. To understand the relevance of a recently identified negative regulatory element (NRE) in the CDR1 promoter for the control of CDR1 expression in the clinical scenario, we investigated the effect of mutation or deletion of the NRE on CDR1 expression in two matched pairs of azole-sensitive and resistant clinical isolates of C. albicans. Expression of GFP or lacZ reporter genes from the wild type CDR1 promoter was much higher in the azole-resistant C. albicans isolates than in the azole-susceptible isolates, reflecting the known differences in CDR1 expression in these strains. Deletion or mutation of the NRE resulted in enhanced reporter gene expression in azole-sensitive strains, but did not further increase the already high CDR1 promoter activity in the azole-resistant strains. In agreement with these findings, electrophoretic mobility shift assays showed a reduced binding to the NRE of nuclear extracts from the resistant C. albicans isolates as compared with extracts from the sensitive isolates. These results demonstrate that the NRE is involved in maintaining CDR1 expression at basal levels and that this repression is overcome in azole-resistant clinical C. albicans isolates, resulting in constitutive CDR1 overexpression and concomitant drug resistance.

  11. GSEL version 2, an online genome-wide query system of operon organization and regulatory sequence elements of Geobacter sulfurreducens.

    PubMed

    Qu, Yanhua; Brown, Peter; Barbe, Jose F; Puljic, Marko; Merino, Enrique; Adkins, Ronald M; Lovley, Derek R; Krushkal, Julia

    2009-10-01

    Geobacter sulfurreducens is a model organism within the delta-Proteobacterial family Geobacteraceae, members of which can participate in environmental bioremediation of metal and organic waste contaminants and in production of bioenergy. In this report, we describe a new, significantly expanded and updated, version 2 of the GSEL (Geobacter Sequence Elements) database ( http://geobacter.org/research/gsel2/ and http://geobacter.org/refs/gsel2/ ) and its accompanying online query system, which compiles information on operon organization and regulatory sequence elements in the genome of G. sulfurreducens. It incorporates a new online graphical browser, provides novel search capabilities, and includes updated operon predictions along with new information on predicted and experimentally validated genome regulatory sites. The GSEL database and online search system provides a unique and comprehensive tool cataloging information about gene regulation in G. sulfurreducens, aiding in investigation of mechanisms that regulate its ability to generate electric power, bioremediate environmental waste, and adapt to environmental changes. PMID:19792871

  12. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.

    2015-01-01

    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  13. Integrated methylome and transcriptome analysis reveals novel regulatory elements in pediatric acute lymphoblastic leukemia.

    PubMed

    Almamun, Md; Levinson, Benjamin T; van Swaay, Annette C; Johnson, Nathan T; McKay, Stephanie D; Arthur, Gerald L; Davis, J Wade; Taylor, Kristen H

    2015-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer diagnosed in children under the age of 15. In addition to genetic aberrations, epigenetic modifications such as DNA methylation are altered in cancer and impact gene expression. To identify epigenetic alterations in ALL, genome-wide methylation profiles were generated using the methylated CpG island recovery assay followed by next-generation sequencing. More than 25,000 differentially methylated regions (DMR) were observed in ALL patients with ∼ 90% present within intronic or intergenic regions. To determine the regulatory potential of the DMR, whole-transcriptome analysis was performed and integrated with methylation data. Aberrant promoter methylation was associated with the altered expression of genes involved in transcriptional regulation, apoptosis, and proliferation. Novel enhancer-like sequences were identified within intronic and intergenic DMR. Aberrant methylation in these regions was associated with the altered expression of neighboring genes involved in cell cycle processes, lymphocyte activation and apoptosis. These genes include potential epi-driver genes, such as SYNE1, PTPRS, PAWR, HDAC9, RGCC, MCOLN2, LYN, TRAF3, FLT1, and MELK, which may provide a selective advantage to leukemic cells. In addition, the differential expression of epigenetic modifier genes, pseudogenes, and non-coding RNAs was also observed accentuating the role of erroneous epigenetic gene regulation in ALL. PMID:26308964

  14. Integrated methylome and transcriptome analysis reveals novel regulatory elements in pediatric acute lymphoblastic leukemia

    PubMed Central

    Almamun, Md; Levinson, Benjamin T; van Swaay, Annette C; Johnson, Nathan T; McKay, Stephanie D; Arthur, Gerald L; Davis, J Wade; Taylor, Kristen H

    2015-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer diagnosed in children under the age of 15. In addition to genetic aberrations, epigenetic modifications such as DNA methylation are altered in cancer and impact gene expression. To identify epigenetic alterations in ALL, genome-wide methylation profiles were generated using the methylated CpG island recovery assay followed by next-generation sequencing. More than 25,000 differentially methylated regions (DMR) were observed in ALL patients with ∼90% present within intronic or intergenic regions. To determine the regulatory potential of the DMR, whole-transcriptome analysis was performed and integrated with methylation data. Aberrant promoter methylation was associated with the altered expression of genes involved in transcriptional regulation, apoptosis, and proliferation. Novel enhancer-like sequences were identified within intronic and intergenic DMR. Aberrant methylation in these regions was associated with the altered expression of neighboring genes involved in cell cycle processes, lymphocyte activation and apoptosis. These genes include potential epi-driver genes, such as SYNE1, PTPRS, PAWR, HDAC9, RGCC, MCOLN2, LYN, TRAF3, FLT1, and MELK, which may provide a selective advantage to leukemic cells. In addition, the differential expression of epigenetic modifier genes, pseudogenes, and non-coding RNAs was also observed accentuating the role of erroneous epigenetic gene regulation in ALL. PMID:26308964

  15. A novel positive regulatory element for exfoliative toxin A gene expression in Staphylococcus aureus.

    PubMed

    Sakurai, Susumu; Suzuki, Hitoshi; Hata, Toshiaki; Yoshizawa, Yukio; Nakayama, Ritsuko; Machida, Katsuhiko; Masuda, Shogo; Tsukiyama, Takashi

    2004-04-01

    A 1.4 kb positive regulatory element (ETA(exp)) that controls staphylococcal exfoliative toxin A (sETA) transcription was cloned from Staphylococcus aureus. ETA(exp) is located upstream of the cloned 5.8 kb eta gene (etaJ1) obtained from the chomosomal DNA of S. aureus ZM, the standard ETA-producing strain. The cETA prepared from an Escherichia coli transformant into which the recombinant plasmid petaJ1 (5.8 kb eta/pUC9) had been introduced was expressed at high levels in the culture supernatant and the ammonium-sulfate-precipitated culture supernatant fraction as shown by immunoblotting and the single radial immunodiffusion test. However, cETA produced by the recombinant plasmid petaJ3 containing the 1.7 kb eta sequence (etaJ3) with a 1.45 kb ETA(exp)-deficient eta fragment (1.7 kb eta/pUC9) obtained from the 5.8 kb eta sequence by subcloning was not detected in either the culture supernatant or the ammonium-sulfate-precipitated culture supernatant fraction (167-fold concentrate of the culture supernatant) by immunoblotting or the single radial immunodiffusion test. A large amount of cETA was produced by the 1.7 kb eta sequence when it was linked to ETA(exp) amplified by PCR (1.7 kb eta-ETA(exp)/pUC9), regardless of the orientation of ETA(exp) insertion. Northern blot hybridization showed lower levels of the transcripts of the 1.7 kb eta sequence than of the 5.8 kb eta sequence. The rsETA prepared from an S. aureus transformant into which the recombinant plasmid 3.4 kb eta-ETA(exp)/pYT3 (pYT3-etaJ6) had been introduced was expressed at high levels in the culture supernatant fraction as shown by the latex agglutination test. However, the agglutination titre in the culture supernatant fraction of rsETA produced by the recombinant plasmid (1.7 kb eta/pYT3) containing the 1.7 kb eta sequence carrying the 1.4 kb ETA(exp)-deficient eta fragment (pYT3-etaJ3) was 2500-4000 times lower than that of pYT3-etaJ6. PMID:15073304

  16. Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

    DOE PAGESBeta

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-03-26

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

  17. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii.

    PubMed

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-01-01

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  18. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii

    PubMed Central

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-01-01

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  19. The Tightly Controlled Deubiquitination Activity of the Human SAGA Complex Differentially Modifies Distinct Gene Regulatory Elements▿

    PubMed Central

    Lang, Guillaume; Bonnet, Jacques; Umlauf, David; Karmodiya, Krishanpal; Koffler, Jennifer; Stierle, Matthieu; Devys, Didier; Tora, László

    2011-01-01

    The multisubunit SAGA coactivator complex facilitates access of general transcription factors to DNA through histone acetylation mediated by GCN5. USP22 (ubiquitin-specific protease 22) was recently described as a subunit of the human SAGA complex that removes ubiquitin from monoubiquitinated histone H2B and H2A in vitro. Here we demonstrate an allosteric regulation of USP22 through multiple interactions with different domains of other subunits of the SAGA deubiquitination module (ATXN7, ATXN7L3, and ENY2). Downregulation of ATXN7L3 by short hairpin RNA (shRNA) specifically inactivated the SAGA deubiquitination activity, leading to a strong increase of global H2B ubiquitination and a moderate increase of H2A ubiquitination. Thus, SAGA is the major H2Bub deubiquitinase in human cells, and this activity cannot be fully compensated by other deubiquitinases. Here we show that the deubiquitination activity of SAGA is required for full activation of SAGA-dependent inducible genes. Interestingly, the reduction of the SAGA deubiquitination activity and the parallel increase in H2B ubiquitation at inducible target genes before activation do not induce aberrant gene expression. Our data together indicate that different dynamic equilibriums of H2B ubiquitination/deubiquitination are established at different gene regulatory elements and that H2B ubiquitination changes are necessary but not sufficient to trigger parallel activation of gene expression. PMID:21746879

  20. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  1. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    PubMed Central

    Saban, Ricardo; Simpson, Cindy; Vadigepalli, Rajanikanth; Memet, Sylvie; Dozmorov, Igor; Saban, Marcia R

    2007-01-01

    Background Tachykinins (TK), such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs). Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT) and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF) and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2). In the absence of NK1R, the matrix Nkx2

  2. Downstream regulatory elements increase acute and latent herpes simplex virus type 2 latency-associated transcript expression but do not influence recurrence phenotype or establishment of latency.

    PubMed Central

    Yoshikawa, T; Stanberry, L R; Bourne, N; Krause, P R

    1996-01-01

    The role of putative promoter or activator sequences downstream of the herpes simplex virus type 2 latency-associated transcript (LAT) promoter and upstream of the LAT intron was investigated in vivo by constructing and evaluating mutant viruses with deletions in this region. The deletion of LAT promoter sequences upstream of the primary LAT transcript reduced levels of LAT expression during productive infections, compared with the LAT expression level of wild-type virus, and abolished LAT expression during latency. The deletion of the putative downstream regulatory elements reduced but did not eliminate LAT expression during productive and latent infections. The deletion of both regions almost completely eliminated acute LAT transcription, although additional acute LAT-region transcription directed by sequences upstream of either region was detected by reverse transcriptase PCR. The deletion of the downstream elements did not influence the ability of the virus to reactivate from latently infected guinea pigs relative to the ability of the wild-type virus to reactivate; thus, decreased LAT expression did not affect the frequency of recurrence. The deletion of both regions did not affect the ability of the virus to establish latency. We conclude that downstream regulatory elements are necessary for maximal acute LAT expression but do not constitute an independent promoter during latency and do not play an obvious role in the establishment of our reactivation from latency. PMID:8627672

  3. Solution structure of stem-loop α of the hepatitis B virus post-transcriptional regulatory element

    PubMed Central

    Schwalbe, Martin; Ohlenschläger, Oliver; Marchanka, Aliaksandr; Ramachandran, Ramadurai; Häfner, Sabine; Heise, Tilman; Görlach, Matthias

    2008-01-01

    Chronic hepatitis B virus (HBV) infections may lead to severe diseases like liver cirrhosis or hepatocellular carcinoma (HCC). The HBV post-transcriptional regulatory element (HPRE) facilitates the nuclear export of unspliced viral mRNAs, contains a splicing regulatory element and resides in the 3′-region of all viral transcripts. The HPRE consists of three sub-elements α (nucleotides 1151–1346), β1 (nucleotides 1347–1457) and β2 (nucleotides 1458–1582), which confer together full export competence. Here, we present the NMR solution structure (pdb 2JYM) of the stem-loop α (SLα, nucleotides 1292–1321) located in the sub-element α. The SLα contains a CAGGC pentaloop highly conserved in hepatoviruses, which essentially adopts a CUNG-like tetraloop conformation. Furthermore, the SLα harbours a single bulged G residue flanked by A-helical regions. The structure is highly suggestive of serving two functions in the context of export of unspliced viral RNA: binding sterile alpha motif (SAM-) domain containing proteins and/or preventing the utilization of a 3′-splice site contained within SLα. PMID:18263618

  4. Differential contribution of cis-regulatory elements to higher order chromatin structure and expression of the CFTR locus.

    PubMed

    Yang, Rui; Kerschner, Jenny L; Gosalia, Nehal; Neems, Daniel; Gorsic, Lidija K; Safi, Alexias; Crawford, Gregory E; Kosak, Steven T; Leir, Shih-Hsing; Harris, Ann

    2016-04-20

    Higher order chromatin structure establishes domains that organize the genome and coordinate gene expression. However, the molecular mechanisms controlling transcription of individual loci within a topological domain (TAD) are not fully understood. The cystic fibrosis transmembrane conductance regulator (CFTR) gene provides a paradigm for investigating these mechanisms.CFTR occupies a TAD bordered by CTCF/cohesin binding sites within which are cell-type-selective cis-regulatory elements for the locus. We showed previously that intronic and extragenic enhancers, when occupied by specific transcription factors, are recruited to the CFTR promoter by a looping mechanism to drive gene expression. Here we use a combination of CRISPR/Cas9 editing of cis-regulatory elements and siRNA-mediated depletion of architectural proteins to determine the relative contribution of structural elements and enhancers to the higher order structure and expression of the CFTR locus. We found the boundaries of the CFTRTAD are conserved among diverse cell types and are dependent on CTCF and cohesin complex. Removal of an upstream CTCF-binding insulator alters the interaction profile, but has little effect on CFTR expression. Within the TAD, intronic enhancers recruit cell-type selective transcription factors and deletion of a pivotal enhancer element dramatically decreases CFTR expression, but has minor effect on its 3D structure. PMID:26673704

  5. Role of conserved cis-regulatory elements in the post-transcriptional regulation of the human MECP2 gene involved in autism

    PubMed Central

    2013-01-01

    Background The MECP2 gene codes for methyl CpG binding protein 2 which regulates activities of other genes in the early development of the brain. Mutations in this gene have been associated with Rett syndrome, a form of autism. The purpose of this study was to investigate the role of evolutionarily conserved cis-elements in regulating the post-transcriptional expression of the MECP2 gene and to explore their possible correlations with a mutation that is known to cause mental retardation. Results A bioinformatics approach was used to map evolutionarily conserved cis-regulatory elements in the transcribed regions of the human MECP2 gene and its mammalian orthologs. Cis-regulatory motifs including G-quadruplexes, microRNA target sites, and AU-rich elements have gained significant importance because of their role in key biological processes and as therapeutic targets. We discovered in the 5′-UTR (untranslated region) of MECP2 mRNA a highly conserved G-quadruplex which overlapped a known deletion in Rett syndrome patients with decreased levels of MeCP2 protein. We believe that this 5′-UTR G-quadruplex could be involved in regulating MECP2 translation. We mapped additional evolutionarily conserved G-quadruplexes, microRNA target sites, and AU-rich elements in the key sections of both untranslated regions. Our studies suggest the regulation of translation, mRNA turnover, and development-related alternative MECP2 polyadenylation, putatively involving interactions of conserved cis-regulatory elements with their respective trans factors and complex interactions among the trans factors themselves. We discovered highly conserved G-quadruplex motifs that were more prevalent near alternative splice sites as compared to the constitutive sites of the MECP2 gene. We also identified a pair of overlapping G-quadruplexes at an alternative 5′ splice site that could potentially regulate alternative splicing in a negative as well as a positive way in the MECP2 pre

  6. Human papillomavirus 16 E6 oncoprotein binds to interferon regulatory factor-3 and inhibits its transcriptional activity

    PubMed Central

    Ronco, Lucienne V.; Karpova, Alla Y.; Vidal, Marc; Howley, Peter M.

    1998-01-01

    Interferon regulatory factor-3 (IRF-3) was found to specifically interact with HPV16 E6 in a yeast two-hybrid screen. IRF-3 is activated by the presence of double-stranded RNA or by virus infection to form a stable complex with other transcriptional regulators that bind to the regulatory elements of the IFNβ promoter. We show that IRF-3 is a potent transcriptional activator and demonstrate that HPV16 E6 can inhibit its transactivation function. The expression of HPV16 E6 in primary human keratinocytes inhibits the induction of IFNβ mRNA following Sendai virus infection. The binding of HPV16 E6 to IRF-3 does not result in its ubiquitination or degradation. We propose that the interaction of E6 with IRF-3 and the inhibition of IRF-3’s transcriptional activity may provide the virus a means to circumvent the normal antiviral response of an HPV16-infected cell. PMID:9649509

  7. 17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 17 Commodity and Securities Exchanges 1 2014-04-01 2014-04-01 false Activities of self-regulatory... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in § 1.3(ee),...

  8. 17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 17 Commodity and Securities Exchanges 1 2011-04-01 2011-04-01 false Activities of self-regulatory... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission...

  9. 17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 1 2013-04-01 2013-04-01 false Activities of self-regulatory... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in § 1.3(ee),...

  10. 17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 17 Commodity and Securities Exchanges 1 2012-04-01 2012-04-01 false Activities of self-regulatory... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission...

  11. 2015 Summary Report on Industrial and Regulatory Engagement Activities

    SciTech Connect

    Thomas, Kenneth David

    2015-09-01

    activities and future plans were made to Arizona Public Service, Exelon, Duke Energy, Pacific Gas & Electric, SCANA, Southern Nuclear, South Texas Project, STARS Alliance, Tennessee Valley Authority, and Xcel. Discussions were also held on the pathway goals and activities with major industry support organizations during FY 2102, including the Institute of Nuclear Power Operations (INPO), the Nuclear Information Technology Strategic Leadership (NITSL), the Nuclear Energy Institute (NEI), and the Electric Power Research Institute. The Advanced II&C Pathway work was presented at five major industry conferences and Informal discussions were held with key NRC managers at industry conferences. In addition, discussions were held with NRC senior managers on digital regulatory issues through participation on the NEI Digital I&C Working Group. Meetings were held with major industry suppliers and consultants, to explore opportunities for collaboration and to provide a means of pilot project technology transfer. In the international area, discussions were held with Electricite’ de France (EdF) concerning possible collaboration in the area NPP configuration control using intelligent wireless devices.

  12. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    PubMed

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. PMID:26220938

  13. Chromatin Heterogeneity and Distribution of Regulatory Elements in the Late-Replicating Intercalary Heterochromatin Domains of Drosophila melanogaster Chromosomes

    PubMed Central

    Khoroshko, Varvara A.; Levitsky, Viktor G.; Zykova, Tatyana Yu.; Antonenko, Oksana V.; Belyaeva, Elena S.; Zhimulev, Igor F.

    2016-01-01

    Late-replicating domains (intercalary heterochromatin) in the Drosophila genome display a number of features suggesting their organization is quite unique. Typically, they are quite large and encompass clusters of functionally unrelated tissue-specific genes. They correspond to the topologically associating domains and conserved microsynteny blocks. Our study aims at exploring further details of molecular organization of intercalary heterochromatin and has uncovered surprising heterogeneity of chromatin composition in these regions. Using the 4HMM model developed in our group earlier, intercalary heterochromatin regions were found to host chromatin fragments with a particular epigenetic profile. Aquamarine chromatin fragments (spanning 0.67% of late-replicating regions) are characterized as a class of sequences that appear heterogeneous in terms of their decompactization. These fragments are enriched with enhancer sequences and binding sites for insulator proteins. They likely mark the chromatin state that is related to the binding of cis-regulatory proteins. Malachite chromatin fragments (11% of late-replicating regions) appear to function as universal transitional regions between two contrasting chromatin states. Namely, they invariably delimit intercalary heterochromatin regions from the adjacent active chromatin of interbands. Malachite fragments also flank aquamarine fragments embedded in the repressed chromatin of late-replicating regions. Significant enrichment of insulator proteins CP190, SU(HW), and MOD2.2 was observed in malachite chromatin. Neither aquamarine nor malachite chromatin types appear to correlate with the positions of highly conserved non-coding elements (HCNE) that are typically replete in intercalary heterochromatin. Malachite chromatin found on the flanks of intercalary heterochromatin regions tends to replicate earlier than the malachite chromatin embedded in intercalary heterochromatin. In other words, there exists a gradient of

  14. Chromatin Heterogeneity and Distribution of Regulatory Elements in the Late-Replicating Intercalary Heterochromatin Domains of Drosophila melanogaster Chromosomes.

    PubMed

    Khoroshko, Varvara A; Levitsky, Viktor G; Zykova, Tatyana Yu; Antonenko, Oksana V; Belyaeva, Elena S; Zhimulev, Igor F

    2016-01-01

    Late-replicating domains (intercalary heterochromatin) in the Drosophila genome display a number of features suggesting their organization is quite unique. Typically, they are quite large and encompass clusters of functionally unrelated tissue-specific genes. They correspond to the topologically associating domains and conserved microsynteny blocks. Our study aims at exploring further details of molecular organization of intercalary heterochromatin and has uncovered surprising heterogeneity of chromatin composition in these regions. Using the 4HMM model developed in our group earlier, intercalary heterochromatin regions were found to host chromatin fragments with a particular epigenetic profile. Aquamarine chromatin fragments (spanning 0.67% of late-replicating regions) are characterized as a class of sequences that appear heterogeneous in terms of their decompactization. These fragments are enriched with enhancer sequences and binding sites for insulator proteins. They likely mark the chromatin state that is related to the binding of cis-regulatory proteins. Malachite chromatin fragments (11% of late-replicating regions) appear to function as universal transitional regions between two contrasting chromatin states. Namely, they invariably delimit intercalary heterochromatin regions from the adjacent active chromatin of interbands. Malachite fragments also flank aquamarine fragments embedded in the repressed chromatin of late-replicating regions. Significant enrichment of insulator proteins CP190, SU(HW), and MOD2.2 was observed in malachite chromatin. Neither aquamarine nor malachite chromatin types appear to correlate with the positions of highly conserved non-coding elements (HCNE) that are typically replete in intercalary heterochromatin. Malachite chromatin found on the flanks of intercalary heterochromatin regions tends to replicate earlier than the malachite chromatin embedded in intercalary heterochromatin. In other words, there exists a gradient of

  15. Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood

    PubMed Central

    Li, Yue; Xie, Changchun; Murphy, Susan K.; Skaar, David; Nye, Monica; Vidal, Adriana C.; Cecil, Kim M.; Dietrich, Kim N.; Puga, Alvaro; Jirtle, Randy L.; Hoyo, Cathrine

    2015-01-01

    30 to 78 months. Conclusions: Our findings provide evidence that early childhood lead exposure results in sex-dependent and gene-specific DNA methylation differences in the DMRs of PEG3, IGF2/H19, and PLAGL1/HYMAI in adulthood. Citation: Li Y, Xie C, Murphy SK, Skaar D, Nye M, Vidal AC, Cecil KM, Dietrich KN, Puga A, Jirtle RL, Hoyo C. 2016. Lead exposure during early human development and DNA methylation of imprinted gene regulatory elements in adulthood. Environ Health Perspect 124:666–673; http://dx.doi.org/10.1289/ehp.1408577 PMID:26115033

  16. Active pixel sensors with substantially planarized color filtering elements

    NASA Technical Reports Server (NTRS)

    Fossum, Eric R. (Inventor); Kemeny, Sabrina E. (Inventor)

    1999-01-01

    A semiconductor imaging system preferably having an active pixel sensor array compatible with a CMOS fabrication process. Color-filtering elements such as polymer filters and wavelength-converting phosphors can be integrated with the image sensor.

  17. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9

    PubMed Central

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-01-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  18. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.

    PubMed

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-08-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  19. Characterization of "cis"-regulatory elements ("c"RE) associated with mammary gland function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Bos taurus genome assembly has propelled dairy science into a new era; still, most of the information encoded in the genome has not yet been decoded. The human Encyclopedia of DNA Elements (ENCODE) project has spearheaded the identification and annotation of functional genomic elements in the hu...

  20. 76 FR 18165 - Request for Public Comments Concerning Regulatory Cooperation Activities That Would Help...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-01

    ....-Canada Regulatory Cooperation Council. The notice published on March 3, 2011 (76 FR 11760) informed..., 2011. DATES: The comment period for notice published on March 3, 2011 (76 FR 11760), is extended to... International Trade Administration Request for Public Comments Concerning Regulatory Cooperation Activities...

  1. A G/C-rich DNA-regulatory element controls positive expression of the sea urchin Lytechinus pictus aboral ectoderm-specific LpS1 gene.

    PubMed

    Wang, W; Klein, W H

    1996-02-01

    The LpS1 beta gene of Lytechinus pictus is activated at the late cleavage stage about 12 hr after fertilization. LpS1 beta transcripts accumulate exclusively in aboral ectoderm lineages. LpS1 beta is thus a classic example of a gene whose expression is tightly controlled both temporally and spatially during early development. Previous studies on the LpS1 beta promoter identified two G-string DNA elements, one proximal and one distal to the LpS1 beta transcriptional start site, which bind to an ectoderm-enriched nuclear factor. In this report, we show that the ectoderm G-string factor binds to a G/C-rich region larger than the G-string itself and that the binding of the G-string factor requires sequences immediately downstream from the G-string. These downstream sequences are essential for full promoter activity. Two regions of 5'-flanking DNA are required for positive control of LpS1 beta, region I from base pairs -762 to -511, and region II, which includes the G/C-rich element, from base pairs -108 to -61. Region I also contains a mesenchyme cell repressor element. The results indicate that LpS1 beta expression is regulated positively in ectoderm cells and negatively in mesenchyme cells. Similar positive and negative control mechanisms regulate the expression of the related Spec genes of Strongylocentrotus purpuratus, but in this gene family the DNA elements are entirely different. We hypothesize that cis-regulatory elements are evolutionarily dynamic and that many different combinations of DNA elements are capable of given rise to aboral ectoderm-specific expression. PMID:8634141

  2. 3D-Trajectories Adopted by Coding and Regulatory DNA Elements: First-Passage Times for Genomic Interactions

    PubMed Central

    Lucas, Joseph S.; Zhang, Yaojun; Dudko, Olga K.; Murre, Cornelis

    2014-01-01

    SUMMARY During B lymphocyte development, immunoglobulin heavy chain variable (VH), diversity (DH) and joining (JH) segments assemble to generate a diverse antigen receptor repertoire. Here we have marked the distal VH and DH-JH-Eμ regions with Tet-operator binding sites and traced their 3D-trajectories in pro-B cells transduced with a retrovirus encoding Tet-repressor-EGFP. We found that these elements displayed fractional Langevin motion (fLm) due to the viscoelastic hindrance from the surrounding network of proteins and chromatin fibers. Using fractional Langevin dynamics modeling, we found that, with high probability, DHJH elements reach a VH element within minutes. Spatial confinement emerged as the dominant parameter that determined the frequency of such encounters. We propose that the viscoelastic nature of the nuclear environment causes coding elements and regulatory elements to bounce back and forth in a spring-like fashion until specific genomic interactions are established and that spatial confinement of topological domains largely controls first-passage times for genomic interactions. PMID:24998931

  3. Elements of active vibration control for rotating machinery

    NASA Technical Reports Server (NTRS)

    Ulbrich, Heinz

    1990-01-01

    The success or failure of active vibration control is determined by the availability of suitable actuators, modeling of the entire system including all active elements, positioning of the actuators and sensors, and implementation of problem-adapted control concepts. All of these topics are outlined and their special problems are discussed in detail. Special attention is given to efficient modeling of systems, especially for considering the active elements. Finally, design methods for and the application of active vibration control on rotating machinery are demonstrated by several real applications.

  4. A developmentally regulated Caulobacter flagellar promoter is activated by 3' enhancer and IHF binding elements.

    PubMed Central

    Gober, J W; Shapiro, L

    1992-01-01

    The transcription of a group of flagellar genes is temporally and spatially regulated during the Caulobacter crescentus cell cycle. These genes all share the same 5' cis-regulatory elements: a sigma 54 promoter, a binding site for integration host factor (IHF), and an enhancer sequence, known as the ftr element. We have partially purified the ftr-binding proteins, and we show that they require the same enhancer sequences for binding as are required for transcriptional activation. We have also partially purified the Caulobacter homolog of IHF and demonstrate that it can facilitate in vitro integrase-mediated lambda recombination. Using site-directed mutagenesis, we provide the first demonstration that natural enhancer sequences and IHF binding elements that reside 3' to the sigma 54 promoter of a bacterial gene, flaNQ, are required for transcription of the operon, in vivo. The IHF protein and the ftr-binding protein is primarily restricted to the predivisional cell, the cell type in which these promoters are transcribed. flaNQ promoter expression is localized to the swarmer pole of the predivisional cell, as are other flagellar promoters that possess these regulatory sequences 5' to the start site. The requirement for an IHF binding site and an ftr-enhancer element in spatially transcribed flagellar promoters indicates that a common mechanism may be responsible for both temporal and polar transcription. Images PMID:1392079

  5. Scientific and Legal Perspectives on Science Generated for Regulatory Activities

    PubMed Central

    Henry, Carol J.; Conrad, James W.

    2008-01-01

    This article originated from a conference that asked “Should scientific work conducted for purposes of advocacy before regulatory agencies or courts be judged by the same standards as science conducted for other purposes?” In the article, which focuses on the regulatory advocacy context, we argue that it can be and should be. First, we describe a set of standards and practices currently being used to judge the quality of scientific research and testing and explain how these standards and practices assist in judging the quality of research and testing regardless of why the work was conducted. These standards and practices include the federal Information Quality Act, federal Good Laboratory Practice standards, peer review, disclosure of funding sources, and transparency in research policies. The more that scientific information meets these standards and practices, the more likely it is to be of high quality, reliable, reproducible, and credible. We then explore legal issues that may be implicated in any effort to create special rules for science conducted specifically for a regulatory proceeding. Federal administrative law does not provide a basis for treating information in a given proceeding differently depending on its source or the reason for which it was generated. To the contrary, this law positively assures that interested persons have the right to offer their technical expertise toward the solution of regulatory problems. Any proposal to subject scientific information generated for the purpose of a regulatory proceeding to more demanding standards than other scientific information considered in that proceeding would clash with this law and would face significant administrative complexities. In a closely related example, the U.S. Environmental Protection Agency considered but abandoned a program to implement standards aimed at “external” information. PMID:18197313

  6. Germline deletion of Igh 3′ regulatory region elements hs5-7 affects B cell specific regulation, rearrangement and insulation of the Igh locus1

    PubMed Central

    Volpi, Sabrina A.; Verma-Gaur, Jiyoti; Hassan, Rabih; Ju, Zhongliang; Roa, Sergio; Chatterjee, Sanjukta; Werling, Uwe; Hou, Harry; Will, Britta; Steidl, Ulrich; Scharff, Matthew; Edelman, Winfried; Feeney, Ann J.; Birshtein, Barbara K.

    2012-01-01

    Regulatory elements located within a ~28 kb region 3′ of the Igh gene cluster (3′ regulatory region, 3′ RR) are required for class switch recombination and for high levels of IgH expression in plasma cells. We previously defined novel DNase I hypersensitive (hs) sites, i.e. hs5-7, immediately downstream of this region. Hs5-7 contains a high density of binding sites for CTCF, a zinc finger protein associated with mammalian insulator activity and is an anchor for interactions with CTCF sites flanking the DH region. To test the function of hs5-7, we have generated mice with an 8 kb deletion encompassing all three hs elements. B cells from hs5-7 KO mice showed a modest increase in expression of the nearest downstream gene. In addition, Igh alleles in hs5-7 KO mice were in a less contracted configuration compared to WT Igh alleles and showed a two-fold increase in the usage of proximal VH7183 gene families. Hs5-7 KO mice were essentially indistinguishable from wild type mice in B cell development, allelic regulation, class switch recombination, and chromosomal looping. We conclude that hs5-7--a high-density CTCF binding region at the 3′ end of the Igh locus--impacts usage of VH regions as far as 500 kb away. PMID:22345664

  7. Functional characterization of transcriptional regulatory elements in the upstream region and intron 1 of the human S6 ribosomal protein gene.

    PubMed Central

    Antoine, M; Kiefer, P

    1998-01-01

    Expression of housekeeping genes involves regulation at comparable levels in a wide spectrum of cells. To define the cis-regulatory elements in the human S6 ribosomal protein (rpS6) gene, we made a series of deletions of the upstream non-transcribed region, including or excluding exon 1 or intron 1 sequences. The mutated rpS6 gene regulatory regions were fused to the chloramphenicol acetyltransferase reporter gene and transfected into HeLa and COS-1 cells. The results have identified three parts of the rpS6 gene that are required for efficient and specific transcription. The core promoter includes only a 40 bp region upstream of the transcription start site and initiation region. Both upstream and intronic elements enhance transcription from the core promoter. Furthermore, mutation of the splice donor site of intron 1 almost completely abolished the enhancing activity of the intronic transcriptional modulator. We used gel retardation assays to identify sequence-specific binding sites in the upstream region and in the proximal half of intron 1. Both common and different nuclear factors that bind the rpS6 gene promoter were identified in extracts from HeLa and COS-1 cells, suggesting that different transcription factors may bind specifically to the same binding region and might be interchangeable in their function to ensure high-level expression of housekeeping genes independently of the cell type. PMID:9820808

  8. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  9. Regulatory elements necessary for termination of transcription within the immunoglobulin heavy chain gene locus

    SciTech Connect

    Moore, B.B.

    1992-01-01

    Previous experimentation demonstrated that regulation of the IgM only phenotype in both pre-B and immature B cells was primarily at the transcriptional level. Expression of IgD mRNA involves transcription of the entire 29 kilobase rearranged [mu]-[delta] locus. Mature B cells transcribe the [beta] exons at approximately half the level that they transcribe the [delta] gene. Early B cells however, transcribe the [mu] gene with approximately 90% more efficiency than they do the [delta] gene. Specifically, early B cells show a transcription termination event occurring within a 1 kilobase region of the [mu]-[delta] intron. This dissertation analyzes the sequence elements necessary to encode the transcription termination event within the [mu]-[delta] intron. This work shows that the termination motif consists of specific sequences within the [mu]m poly(A) site as well as a region of the [mu]-[delta] intron contained within a 1200 base pair fragment. The 1200 base pair fragment extends from the Pst I site within the intron and ends just prior to the C[delta]1 exon. This fragment contains a 162 base pair unique sequence inverted repeat (USIR). Furthermore, the [mu]m site is specifically required because the [mu]s site was unable to substitute, despite extensive usage. In addition, the USIR-containing intron functions in an orientation-dependent manner. Analysis of this termination motif in a variety of lymphoid and non-lymphoid cells suggests that this motif is an intrinsic polymerase II termination motif. This implies that transcription termination in early B cells is by a default model and that active regulation of this motif involves an anti-termination event in mature B cells.

  10. The Role of Crowding Forces in Juxtaposing β-Globin Gene Domain Remote Regulatory Elements in Mouse Erythroid Cells.

    PubMed

    Golov, Arkadiy K; Gavrilov, Alexey A; Razin, Sergey V

    2015-01-01

    The extremely high concentration of macromolecules in a eukaryotic cell nucleus indicates that the nucleoplasm is a crowded macromolecular solution in which large objects tend to gather together due to crowding forces. It has been shown experimentally that crowding forces support the integrity of various nuclear compartments. However, little is known about their role in control of chromatin dynamics in vivo. Here, we experimentally addressed the possible role of crowding forces in spatial organization of the eukaryotic genome. Using the mouse β-globin domain as a model, we demonstrated that spatial juxtaposition of the remote regulatory elements of this domain in globin-expressing cells may be lost and restored by manipulation of the level of macromolecular crowding. In addition to proving the role of crowding forces in shaping interphase chromatin, our results suggest that the folding of the chromatin fiber is a major determinant in juxtaposing remote genomic elements. PMID:26436546

  11. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

    PubMed

    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

    2016-05-01

    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  12. 17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission regulation... governors of a self-regulatory organization. (3) Committee member means a member, or functional...

  13. Sterol regulatory element binding protein-dependent regulation of lipid synthesis supports cell survival and tumor growth

    PubMed Central

    2013-01-01

    Background Regulation of lipid metabolism via activation of sterol regulatory element binding proteins (SREBPs) has emerged as an important function of the Akt/mTORC1 signaling axis. Although the contribution of dysregulated Akt/mTORC1 signaling to cancer has been investigated extensively and altered lipid metabolism is observed in many tumors, the exact role of SREBPs in the control of biosynthetic processes required for Akt-dependent cell growth and their contribution to tumorigenesis remains unclear. Results We first investigated the effects of loss of SREBP function in non-transformed cells. Combined ablation of SREBP1 and SREBP2 by siRNA-mediated gene silencing or chemical inhibition of SREBP activation induced endoplasmic reticulum (ER)-stress and engaged the unfolded protein response (UPR) pathway, specifically under lipoprotein-deplete conditions in human retinal pigment epithelial cells. Induction of ER-stress led to inhibition of protein synthesis through increased phosphorylation of eIF2α. This demonstrates for the first time the importance of SREBP in the coordination of lipid and protein biosynthesis, two processes that are essential for cell growth and proliferation. SREBP ablation caused major changes in lipid composition characterized by a loss of mono- and poly-unsaturated lipids and induced accumulation of reactive oxygen species (ROS) and apoptosis. Alterations in lipid composition and increased ROS levels, rather than overall changes to lipid synthesis rate, were required for ER-stress induction. Next, we analyzed the effect of SREBP ablation in a panel of cancer cell lines. Importantly, induction of apoptosis following SREBP depletion was restricted to lipoprotein-deplete conditions. U87 glioblastoma cells were highly susceptible to silencing of either SREBP isoform, and apoptosis induced by SREBP1 depletion in these cells was rescued by antioxidants or by restoring the levels of mono-unsaturated fatty acids. Moreover, silencing of SREBP1

  14. Characterization of a Disease-associated Mutation Affecting a Putative Splicing Regulatory Element in Intron 6b of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene*

    PubMed Central

    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A. Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M. Cristina

    2009-01-01

    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as “splicing mutations,” but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002–1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5′- and 3′-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002–1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75. PMID:19759008

  15. Context-dependent function of regulatory elements and a switch in chromatin occupancy between GATA3 and GATA2 regulate Gata2 transcription during trophoblast differentiation.

    PubMed

    Ray, Soma; Dutta, Debasree; Rumi, M A Karim; Kent, Lindsey N; Soares, Michael J; Paul, Soumen

    2009-02-20

    GATA transcription factors are important regulators of tissue-specific gene expression during development. GATA2 and GATA3 have been implicated in the regulation of trophoblast-specific genes. However, the regulatory mechanisms of GATA2 expression in trophoblast cells are poorly understood. In this study, we demonstrate that Gata2 is transcriptionally induced during trophoblast giant cell-specific differentiation. Transcriptional induction is associated with displacement of GATA3-dependent nucleoprotein complexes by GATA2-dependent nucleoprotein complexes at two regulatory regions, the -3.9- and +9.5-kb regions, of the mouse Gata2 locus. Analyses with reporter genes showed that, in trophoblast cells, -3.9- and +9.5-kb regions function as transcriptional enhancers in GATA motif independent and dependent fashions, respectively. We also found that knockdown of GATA3 by RNA interference induces GATA2 in undifferentiated trophoblast cells. Interestingly, three other known GATA motif-dependent Gata2 regulatory elements, the -1.8-, -2.8-, and -77-kb regions, which are important to regulate Gata2 in hematopoietic cells are not occupied by GATA factors in trophoblast cells. These elements do not show any enhancer activity and also possess inaccessible chromatin structure in trophoblast cells indicating a context-dependent function. Our results indicate that GATA3 directly represses Gata2 in undifferentiated trophoblast cells, and a switch in chromatin occupancy between GATA3 and GATA2 (GATA3/GATA2 switch) induces transcription during trophoblast differentiation. We predict that this GATA3/GATA2 switch is an important mechanism for the transcriptional regulation of other trophoblast-specific genes. PMID:19106099

  16. DNA binding and transcription activation by chicken interferon regulatory factor-3 (chIRF-3)

    PubMed Central

    Grant, Caroline E.; May, Donna L.; Deeley, Roger G.

    2000-01-01

    Interferon regulatory factors (IRFs) are a family of transcription factors involved in the cellular response to interferons and viral infection. Previously we isolated an IRF from a chicken embryonic liver cDNA library. Using a PCR-based binding site selection assay, we have characterised the binding specificity of chIRF-3. The optimal binding site (OBS) fits within the consensus interferon-stimulated response element (ISRE) but the specificity of chIRF-3 binding allows less variation in nucleotides outside the core IRF-binding sequence. A comparison of IRF-1 and chIRF-3 binding to ISREs in electrophoretic mobility shift assays confirmed that the binding specificity of chIRF-3 was clearly distinguishable from IRF-1. The selection assay also showed that chIRF-3 is capable of binding an inverted repeat of two half OBSs separated by 10–13 nt. ChIRF-3 appears to bind both the OBS and inverted repeat sites as a dimer with the protein–protein interaction requiring a domain between amino acids 117 and 311. In transfection experiments expression of chIRF-3 strongly activated a promoter containing the OBS. The activation domain was mapped to between amino acids 138 and 221 and a domain inhibitory to activation was also mapped to the C-terminal portion of chIRF-3. PMID:11095692

  17. Conformal optical elements for correcting wavefront distortions in YAG : Nd{sup 3+} active elements

    SciTech Connect

    Korolkov, V P; Nasyrov, R K; Poleshchuk, A G; Arapov, Yu D; Ivanov, A F

    2013-02-28

    Correction of the wavefront is studied for the light beam passing wide-aperture YAG : Nd3+ single-crystal rods, which are used as active elements in high-power solid-state lasers. A nonideal character of the crystal structure is responsible for the deformation of the wavefront of passing radiation. By using the halftone technology we have developed conformal aberration correctors capable of compensating rod nonuniformities and reducing the laser radiation divergence by an order of magnitude. The results obtained make it possible to employ optically nonuniform active elements in laser constructions. (laser optics 2012)

  18. Comparative Analysis of Regulatory Elements between Escherichia coli and Klebsiella pneumoniae by Genome-Wide Transcription Start Site Profiling

    PubMed Central

    Qiu, Yu; Nagarajan, Harish; Seo, Joo-Hyun; Cho, Byung-Kwan; Tsai, Shih-Feng; Palsson, Bernhard Ø.

    2012-01-01

    Genome-wide transcription start site (TSS) profiles of the enterobacteria Escherichia coli and Klebsiella pneumoniae were experimentally determined through modified 5′ RACE followed by deep sequencing of intact primary mRNA. This identified 3,746 and 3,143 TSSs for E. coli and K. pneumoniae, respectively. Experimentally determined TSSs were then used to define promoter regions and 5′ UTRs upstream of coding genes. Comparative analysis of these regulatory elements revealed the use of multiple TSSs, identical sequence motifs of promoter and Shine-Dalgarno sequence, reflecting conserved gene expression apparatuses between the two species. In both species, over 70% of primary transcripts were expressed from operons having orthologous genes during exponential growth. However, expressed orthologous genes in E. coli and K. pneumoniae showed a strikingly different organization of upstream regulatory regions with only 20% identical promoters with TSSs in both species. Over 40% of promoters had TSSs identified in only one species, despite conserved promoter sequences existing in the other species. 662 conserved promoters having TSSs in both species resulted in the same number of comparable 5′ UTR pairs, and that regulatory element was found to be the most variant region in sequence among promoter, 5′ UTR, and ORF. In K. pneumoniae, 48 sRNAs were predicted and 36 of them were expressed during exponential growth. Among them, 34 orthologous sRNAs between two species were analyzed in depth, and the analysis showed that many sRNAs of K. pneumoniae, including pleiotropic sRNAs such as rprA, arcZ, and sgrS, may work in the same way as in E. coli. These results reveal a new dimension of comparative genomics such that a comparison of two genomes needs to be comprehensive over all levels of genome organization. PMID:22912590

  19. CRISPR-Cas9 Genome Editing of a Single Regulatory Element Nearly Abolishes Target Gene Expression in Mice

    PubMed Central

    Han, Yu; Slivano, Orazio J.; Christie, Christine K.; Cheng, Albert W.; Miano, Joseph M.

    2014-01-01

    Objective To ascertain the importance of a single regulatory element in the control of Cnn1 expression using CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) genome editing. Approach and Results The CRISPR/Cas9 system was used to produce 3/18 founder mice carrying point mutations in an intronic CArG box of the smooth muscle cell (SMC)-restricted Cnn1 gene. Each founder was bred for germ line transmission of the mutant CArG box and littermate interbreeding to generate homozygous mutant (Cnn1ΔCArG/ΔCArG) mice. Quantitative RT-PCR, Western blotting, and confocal immunofluorescence microscopy showed dramatic reductions in Cnn1 mRNA and CNN1 protein expression in Cnn1ΔCArG/ΔCArG mice with no change in other SMC-restricted genes and little evidence of off-target edits elsewhere in the genome. In vivo chromatin immunoprecipitation assay revealed a sharp decrease in binding of SRF to the mutant CArG box. Loss of CNN1 expression was coincident with an increase in Ki-67 positive cells in the normal vessel wall. Conclusion CRISPR/Cas9 genome editing of a single CArG box nearly abolishes Cnn1 expression in vivo and evokes increases in SMC DNA synthesis. This facile genome editing system paves the way for a new generation of studies designed to test the importance of individual regulatory elements in living animals, including regulatory variants in conserved sequence blocks linked to human disease. PMID:25538209

  20. Iron Deprivation in Synechocystis: Inference of Pathways, Non-coding RNAs, and Regulatory Elements from Comprehensive Expression Profiling

    PubMed Central

    Hernández-Prieto, Miguel A.; Schön, Verena; Georg, Jens; Barreira, Luísa; Varela, João; Hess, Wolfgang R.; Futschik, Matthias E.

    2012-01-01

    Iron is an essential cofactor in many metabolic reactions. Mechanisms controlling iron homeostasis need to respond rapidly to changes in extracellular conditions, but they must also keep the concentration of intracellular iron under strict control to avoid the generation of damaging reactive oxygen species. Due to its role as a redox carrier in photosynthesis, the iron quota in cyanobacteria is about 10 times higher than in model enterobacteria. The molecular details of how such a high quota is regulated are obscure. Here we present experiments that shed light on the iron regulatory system in cyanobacteria. We measured time-resolved changes in gene expression after iron depletion in the cyanobacterium Synechocystis sp. PCC 6803 using a comprehensive microarray platform, monitoring both protein-coding and non-coding transcripts. In total, less than a fifth of all protein-coding genes were differentially expressed during the first 72 hr. Many of these proteins are associated with iron transport, photosynthesis, or ATP synthesis. Comparing our data with three previous studies, we identified a core set of 28 genes involved in iron stress response. Among them were genes important for assimilation of inorganic carbon, suggesting a link between the carbon and iron regulatory networks. Nine of the 28 genes have unknown functions and constitute key targets for further functional analysis. Statistical and clustering analyses identified 10 small RNAs, 62 antisense RNAs, four 5′UTRs, and seven intragenic elements as potential novel components of the iron regulatory network in Synechocystis. Hence, our genome-wide expression profiling indicates an unprecedented complexity in the iron regulatory network of cyanobacteria. PMID:23275872

  1. Multiple regulatory domains control IRF-7 activity in response to virus infection.

    PubMed

    Lin, R; Mamane, Y; Hiscott, J

    2000-11-01

    Recent studies implicate the interferon regulatory factors (IRF), IRF-3 and IRF-7, as key activators of Type 1 interferon genes, as well as the RANTES (regulated on activation normal T cell expressed) chemokine gene. Both IRF-3 and IRF-7 are regulated in part by virus-induced C-terminal phosphorylation, leading to nuclear translocation, stimulation of DNA binding, and transcriptional activities. Structure-function studies with IRF-7 suggested a complex organization of the C-terminal region, with a constitutive activation domain located between amino acids 150-246, an accessory inducibility region at the very end of IRF-7 between amino acids 467 and 503, and an inhibitory region (amino acids 341-467) adjacent to the C-terminal end that interferes with transactivation. Furthermore, an element that increases basal and virus-inducible activity is located between amino acids 278 and 305. A transcriptionally active form of IRF-7 was also generated by substitution of Ser-477 and Ser-479 residues with the phosphomimetic Asp. IRF-7, particularly IRF-7(S477D/S479D), was a strong transactivator of type I interferon and RANTES chemokine gene expression. Unlike wild type IRF-3, IRF-7 overexpression was able to stimulate inteferon gene expression in the absence of virus infection. Using tagged versions of IRF-7 and IRF-3, the formation of homo- and heterodimers was detected by co-immunoprecipitation. These results demonstrate that IRF-3 and IRF-7 transcription factors possess distinct structural characteristics that impart complementary rather than redundant functional roles in cytokine gene activation. PMID:10893229

  2. Insights into the Interferon Regulatory Factor Activation from the Crystal Structure of Dimeric IRF5

    SciTech Connect

    Chen, W.; Lam, S; Srinath, H; Jiang, Z; Correia, J; Schiffer, C; Fitzgerald, K; Lin, K; Royer, Jr., W

    2008-01-01

    The interferon regulatory factors (IRFs) are involved in the innate immune response and are activated by phosphorylation. The structure of a pseudophosphorylated IRF5 activation domain now reveals structural changes in the activated form that would turn an autoinhibitory region into a dimerization interface. In vivo analysis supports the relevance of such a dimer to transcriptional activation.

  3. An Ssn6-Tup1-dependent negative regulatory element controls sporulation-specific expression of DIT1 and DIT2 in Saccharomyces cerevisiae.

    PubMed Central

    Friesen, H; Hepworth, S R; Segall, J

    1997-01-01

    Sporulation of the yeast Saccharomyces cerevisiae is a process of cellular differentiation that occurs in MATa/MAT alpha diploid cells in response to starvation. The sporulation-specific genes DIT1 and DIT2, which are required for spore wall formation, are activated midway through the sporulation program, with maximal transcript accumulation occurring at the time of prospore enclosure. In this study, we have identified a negative regulatory element, termed NREDIT, that is located between the start sites of transcription of these divergently transcribed genes. This element, which prevents expression of the DIT1 and DIT2 genes during vegetative growth, reduces expression of a CYC1-lacZ reporter gene more than 1,000-fold and acts in an orientation- and position-independent manner. We found that the ability of NREDIT to turn of expression of the reporter gene and the chromosomal DIT1 and DIT2 genes in vegetative cells requires the Ssn6-Tup1 repression complex. Interestingly, NREDIT-mediated repression of the reporter gene is maintained during sporulation. Derepression during sporulation requires complex interactions among several cis-acting elements. These are present on an approximately 350-bp DNA fragment extending from NREDIT to the TATA box and an approximately 125-bp fragment spanning the TATA box of DIT1. Additionally, a region of NREDIT which is very similar in sequence to UASSPS4, an element that activates gene expression midway through sporulation, contributes both to vegetative repression and to sporulation-specific induction of DIT1. We propose a model to explain the requirement for multiple elements in overcoming NREDIT-mediated repression during sporulation. PMID:8972192

  4. The Responses of Arabidopsis Early Light-Induced Protein2 to Ultraviolet B, High Light, and Cold Stress Are Regulated by a Transcriptional Regulatory Unit Composed of Two Elements1[OPEN

    PubMed Central

    Hayami, Natsuki; Sakai, Yusaku; Kimura, Mitsuhiro; Saito, Tatsunori; Tokizawa, Mutsutomo; Iuchi, Satoshi; Kurihara, Yukio; Matsui, Minami; Nomoto, Mika; Tada, Yasuomi; Yamamoto, Yoshiharu Y.

    2015-01-01

    The Arabidopsis (Arabidopsis thaliana) Early Light-Induced Protein (ELIP) is thought to act as a photoprotectant, reducing the damaging effects of high light (HL). Expression of ELIP2 is activated by multiple environmental stresses related to photoinhibition. We have identified putative regulatory elements in an ELIP2 promoter using an octamer-based frequency comparison method, analyzed the role of these elements using synthetic promoters, and revealed a key transcriptional regulatory unit for ultraviolet B (UV-B) radiation, HL, and cold stress responses. The unit is composed of two elements, designated as Elements A (TACACACC) and B (GGCCACGCCA), and shows functionality only when paired. Our genome-wide correlation analysis between possession of these elements in the promoter region and expression profiles in response to UV-B, HL, and cold suggests that Element B receives and integrates these multiple stress signals. In vitro protein-DNA binding assays revealed that LONG HYPOCOTYL5 (HY5), a basic domain-Leucine zipper transcription factor, directly binds to Element B. In addition, mutant analysis of HY5 showed partial involvement in the UV-B and HL responses but not in the cold stress response. These results suggest that signals for UV-B, HL, and cold stress join at Element B, which recognizes the signals of multiple transcription factors, including HY5. PMID:26175515

  5. The Responses of Arabidopsis Early Light-Induced Protein2 to Ultraviolet B, High Light, and Cold Stress Are Regulated by a Transcriptional Regulatory Unit Composed of Two Elements.

    PubMed

    Hayami, Natsuki; Sakai, Yusaku; Kimura, Mitsuhiro; Saito, Tatsunori; Tokizawa, Mutsutomo; Iuchi, Satoshi; Kurihara, Yukio; Matsui, Minami; Nomoto, Mika; Tada, Yasuomi; Yamamoto, Yoshiharu Y

    2015-09-01

    The Arabidopsis (Arabidopsis thaliana) Early Light-Induced Protein (ELIP) is thought to act as a photoprotectant, reducing the damaging effects of high light (HL). Expression of ELIP2 is activated by multiple environmental stresses related to photoinhibition. We have identified putative regulatory elements in an ELIP2 promoter using an octamer-based frequency comparison method, analyzed the role of these elements using synthetic promoters, and revealed a key transcriptional regulatory unit for ultraviolet B (UV-B) radiation, HL, and cold stress responses. The unit is composed of two elements, designated as Elements A (TACACACC) and B (GGCCACGCCA), and shows functionality only when paired. Our genome-wide correlation analysis between possession of these elements in the promoter region and expression profiles in response to UV-B, HL, and cold suggests that Element B receives and integrates these multiple stress signals. In vitro protein-DNA binding assays revealed that LONG HYPOCOTYL5 (HY5), a basic domain-Leucine zipper transcription factor, directly binds to Element B. In addition, mutant analysis of HY5 showed partial involvement in the UV-B and HL responses but not in the cold stress response. These results suggest that signals for UV-B, HL, and cold stress join at Element B, which recognizes the signals of multiple transcription factors, including HY5. PMID:26175515

  6. A multistep bioinformatic approach detects putative regulatory elements in gene promoters

    PubMed Central

    Bortoluzzi, Stefania; Coppe, Alessandro; Bisognin, Andrea; Pizzi, Cinzia; Danieli, Gian Antonio

    2005-01-01

    Background Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences. Genomic sequences of 1 Kb upstream of 91 genes differentially expressed and/or encoding proteins with relevant function in adult human retina were analyzed. Methodology and results were tested by analysing 1,000 groups of putatively unrelated sequences, randomly selected among 17,156 human gene promoters. When applied to a sample of human promoters, the method identified 279 putative motifs frequently occurring in retina promoters sequences. Most of them are localized in the proximal portion of promoters, less variable in central region than in lateral regions and similar to known regulatory sequences. COOP software and reference manual are freely available upon request to the Authors. Conclusion The approach described in this paper seems effective for identifying a tractable number of sequence motifs with putative regulatory role. PMID:15904489

  7. Regulatory T cells actively infiltrate metastatic brain tumors.

    PubMed

    Sugihara, Adam Quasar; Rolle, Cleo E; Lesniak, Maciej S

    2009-06-01

    Regulatory T cells (CD4+CD25+FoxP3+, Treg) have been shown to play a major role in suppression of the immune response to malignant gliomas. In this study, we investigated the kinetics of Treg infiltration in metastatic brain tumor models, including melanoma, breast and colon cancers. Our data indicate that both CD4+ and Treg infiltration are significantly increased throughout the time of metastatic tumor progression. These findings were recapitulated in human CNS tumor samples of metastatic melanoma and non-small cell lung carcinoma. Collectively, these data support investigating immunotherapeutic strategies targeting Treg in metastatic CNS tumors. PMID:19424570

  8. Hepatitis B virus nuclear export elements: RNA stem-loop α and β, key parts of the HBV post-transcriptional regulatory element.

    PubMed

    Lim, Chun Shen; Brown, Chris M

    2016-09-01

    Many viruses contain RNA elements that modulate splicing and/or promote nuclear export of their RNAs. The RNAs of the major human pathogen, hepatitis B virus (HBV) contain a large (~600 bases) composite cis-acting 'post-transcriptional regulatory element' (PRE). This element promotes expression from these naturally intronless transcripts. Indeed, the related woodchuck hepadnavirus PRE (WPRE) is used to enhance expression in gene therapy and other expression vectors. These PRE are likely to act through a combination of mechanisms, including promotion of RNA nuclear export. Functional components of both the HBV PRE and WPRE are 2 conserved RNA cis-acting stem-loop (SL) structures, SLα and SLβ. They are within the coding regions of polymerase (P) gene, and both P and X genes, respectively. Based on previous studies using mutagenesis and/or nuclear magnetic resonance (NMR), here we propose 2 covariance models for SLα and SLβ. The model for the 30-nucleotide SLα contains a G-bulge and a CNGG(U) apical loop of which the first and the fourth loop residues form a CG pair and the fifth loop residue is bulged out, as observed in the NMR structure. The model for the 23-nucleotide SLβ contains a 7-base-pair stem and a 9-nucleotide loop. Comparison of the models with other RNA structural elements, as well as similarity searches of human transcriptome and viral genomes demonstrate that SLα and SLβ are specific to HBV transcripts. However, they are well conserved among the hepadnaviruses of non-human primates, the woodchuck and ground squirrel. PMID:27031749

  9. Evolutionary active transposable elements in the genome of the coelacanth.

    PubMed

    Chalopin, Domitille; Fan, Shaohua; Simakov, Oleg; Meyer, Axel; Schartl, Manfred; Volff, Jean-Nicolas

    2014-09-01

    The apparent morphological stasis in the lineage of the coelacanth, which has been called a "living fossil" by many, has been suggested to be causally related to a slow evolution of its genome, with strongly reduced activity of transposable elements (TEs). Analysis of the African coelacanth showed that at least 25% of its genome is constituted of transposable elements including retrotransposons, endogenous retroviruses and DNA transposons, with a strong predominance of non-Long Terminal Repeat (non-LTR) retrotransposons. The coelacanth genome has been shaped by four major general bursts of transposition during evolution, with major contributions of LINE1, LINE2, CR1, and Deu non-LTR retrotransposons. Many transposable elements are expressed in different tissues and might be active. The number of TE families in coelacanth, but also in lungfish, is lower than in teleost fish, but is higher than in chicken and human. This observation is in agreement with the hypothesis of a sequential elimination of many TE families in the sarcopterygian lineage during evolution. Taken together, our analysis indicates that the coelacanth contains more TE families than birds and mammals, and that these elements have been active during the evolution of the coelacanth lineage. Hence, at the level of transposable element activity, the coelacanth genome does not appear to evolve particularly slowly. PMID:23908136

  10. Current and future applications of PRA in regulatory activities

    SciTech Connect

    Speis, T.P.; Murphy, J.A.; Cunningham, M.A.

    1995-04-01

    Probabilistic Risk Assessments (PRAs) have proven valuable in providing the regulators, the nuclear plant operators, and the reactor designers insights into plant safety, reliability, design and operation. Both the NRC Commissioners and the staff have grown to appreciate the valuable contributions PRAs can have in the regulatory arena, though I will admit the existence of some tendencies for strict adherence to the deterministic approach within the agency and the public at large. Any call for change, particularly one involving a major adjustment in approach to the regulation of nuclear power, will meet with a certain degree of resistance and retrenchment. Change can appear threatening and can cause some to question whether the safety mission is being fulfilled. This skepticism is completely appropriate and is, in fact, essential to a proper transition towards risk and performance-based approaches. Our task in the Office of Nuclear Regulatory Research is to increase the PRA knowledge base within the agency and develop appropriate guidance and methods needed to support the transitioning process.

  11. Dual Masking of Specific Negative Splicing Regulatory Elements Resulted in Maximal Exon 7 Inclusion of SMN2 Gene

    PubMed Central

    Pao, Peng Wen; Wee, Keng Boon; Yee, Woon Chee; DwiPramono, Zacharias Aloysius

    2014-01-01

    Spinal muscular atrophy (SMA) is a fatal autosomal recessive disease caused by survival motor neuron (SMN) protein insufficiency due to SMN1 mutations. Boosting SMN2 expression is a potential therapy for SMA. SMN2 has identical coding sequence as SMN1 except for a silent C-to-T transition at the 6th nucleotide of exon 7, converting a splicing enhancer to a silencer motif. Consequently, most SMN2 transcripts lack exon 7. More than ten putative splicing regulatory elements (SREs) were reported to regulate exon 7 splicing. To investigate the relative strength of each negative SRE in inhibiting exon 7 inclusion, antisense oligonucleotides (AONs) were used to mask each element, and the fold increase of full-length SMN transcripts containing exon 7 were compared. The most potent negative SREs are at intron 7 (in descending order): ISS-N1, 3′ splice site of exon 8 (ex8 3′ss) and ISS+100. Dual-targeting AONs were subsequently used to mask two nonadjacent SREs simultaneously. Notably, masking of both ISS-N1 and ex8 3′ss induced the highest fold increase of full-length SMN transcripts and proteins. Therefore, efforts should be directed towards the two elements simultaneously for the development of optimal AONs for SMA therapy. PMID:24317636

  12. Finite-element model of the active organ of Corti.

    PubMed

    Ni, Guangjian; Elliott, Stephen J; Baumgart, Johannes

    2016-02-01

    The cochlear amplifier that provides our hearing with its extraordinary sensitivity and selectivity is thought to be the result of an active biomechanical process within the sensory auditory organ, the organ of Corti. Although imaging techniques are developing rapidly, it is not currently possible, in a fully active cochlea, to obtain detailed measurements of the motion of individual elements within a cross section of the organ of Corti. This motion is predicted using a two-dimensional finite-element model. The various solid components are modelled using elastic elements, the outer hair cells (OHCs) as piezoelectric elements and the perilymph and endolymph as viscous and nearly incompressible fluid elements. The model is validated by comparison with existing measurements of the motions within the passive organ of Corti, calculated when it is driven either acoustically, by the fluid pressure or electrically, by excitation of the OHCs. The transverse basilar membrane (BM) motion and the shearing motion between the tectorial membrane and the reticular lamina are calculated for these two excitation modes. The fully active response of the BM to acoustic excitation is predicted using a linear superposition of the calculated responses and an assumed frequency response for the OHC feedback. PMID:26888950

  13. The developmental activation of the chicken lysozyme locus in transgenic mice requires the interaction of a subset of enhancer elements with the promoter.

    PubMed Central

    Huber, M C; Jägle, U; Krüger, G; Bonifer, C

    1997-01-01

    The complete chicken lysozyme locus is expressed in a position independent fashion in macrophages of transgenic mice and forms the identical chromatin structure as observed with the endogenous gene in chicken cells. Individual lysozyme cis -regulatory elements reorganize their chromatin structure at different developmental stages. Accordingly, their activities are developmentally regulated, indicating a differential role of these elements in locus activation. We have shown previously that a subset of enhancer elements and the promoter are sufficient to activate transcription of the chicken lysozyme gene at the correct developmental stage. Here, we analyzed to which grade the developmentally controlled chromatin reorganizing capacity of cis -regulatory elements in the 5'-region of the chicken lysozyme locus is dependent on promoter elements, and we examined whether the lysozyme locus carries a dominant chromatin reorganizing element. To this end we generated transgenic mouse lines carrying constructs with a deletion of the lysozyme promoter. Expression of the transgene in macrophages is abolished, however, the chromatin reorganizing ability of the cis -regulatory elements is differentially impaired. Some cis -elements require the interaction with the promoter to stabilize transcription factor complexes detectable as DNase I hypersensitive sites in chromatin, whereas other elements reorganize their chromatin structure autonomously. PMID:9224598

  14. Synthetic Plant Promoters Containing Defined Regulatory Elements Provide Novel Insights into Pathogen- and Wound-Induced Signaling

    PubMed Central

    Rushton, Paul J.; Reinstädler, Anja; Lipka, Volker; Lippok, Bernadette; Somssich, Imre E.

    2002-01-01

    Pathogen-inducible plant promoters contain multiple cis-acting elements, only some of which may contribute to pathogen inducibility. Therefore, we made defined synthetic promoters containing tetramers of only a single type of element and present evidence that a range of cis-acting elements (boxes W1, W2, GCC, JERE, S, Gst1, and D) can mediate local gene expression in planta after pathogen attack. The expression patterns of the promoters were monitored during interactions with a number of pathogens, including compatible, incompatible, and nonhost interactions. Interestingly, there were major differences in the inducibilities of the various promoters with the pathogens tested as well as differences in the speed of induction and in the basal expression levels. We also show that defense signaling is largely conserved across species boundaries at the cis-acting element level. Many of these promoters also direct local wound-induced expression, and this provides evidence for the convergence of resistance gene, nonhost, and wound responses at the level of the promoter elements. We have used these cis-acting elements to construct improved synthetic promoters and show the effects of varying the number, order, and spacing of such elements. These promoters are valuable additions to the study of signaling and transcriptional activation during plant–pathogen interactions. PMID:11971132

  15. In vivo promoter analysis on refeeding response of hepatic sterol regulatory element-binding protein-1c expression

    SciTech Connect

    Takeuchi, Yoshinori; Yahagi, Naoya; Nakagawa, Yoshimi; Matsuzaka, Takashi; Shimizu, Ritsuko; Sekiya, Motohiro; Iizuka, Yoko; Ohashi, Ken; Gotoda, Takanari; Yamamoto, Masayuki; Nagai, Ryozo; Kadowaki, Takashi; Yamada, Nobuhiro; Osuga, Jun-ichi; Shimano, Hitoshi

    2007-11-16

    Sterol regulatory element-binding protein (SREBP)-1c is the master regulator of lipogenic gene expression in liver. The mRNA abundance of SREBP-1c is markedly induced when animals are refed after starvation, although the regulatory mechanism is so far unknown. To investigate the mechanism of refeeding response of SREBP-1c gene expression in vivo, we generated a transgenic mouse model that carries 2.2 kb promoter region fused to the luciferase reporter gene. These transgenic mice exhibited refeeding responses of the reporter in liver and adipose tissues with extents essentially identical to those of endogenous SREBP-1c mRNA. The same results were obtained from experiments using adenovirus-mediated SREBP-1c-promoter-luciferase fusion gene transduction to liver. These data demonstrate that the regulation of SREBP-1c gene expression is at the transcription level, and that the 2.2 kb 5'-flanking region is sufficient for this regulation. Moreover, when these transgenic or adenovirus-infected mice were placed on insulin-depleted state by streptozotocin treatment, the reporter expression was upregulated as strongly as in control mice, demonstrating that this regulation is not dominated by serum insulin level. These mice are the first models to provide the mechanistic insight into the transcriptional regulation of SREBP-1c gene in vivo.

  16. Global identification of the genetic networks and cis-regulatory elements of the cold response in zebrafish

    PubMed Central

    Hu, Peng; Liu, Mingli; Zhang, Dong; Wang, Jinfeng; Niu, Hongbo; Liu, Yimeng; Wu, Zhichao; Han, Bingshe; Zhai, Wanying; Shen, Yu; Chen, Liangbiao

    2015-01-01

    The transcriptional programs of ectothermic teleosts are directly influenced by water temperature. However, the cis- and trans-factors governing cold responses are not well characterized. We profiled transcriptional changes in eight zebrafish tissues exposed to mildly and severely cold temperatures using RNA-Seq. A total of 1943 differentially expressed genes (DEGs) were identified, from which 34 clusters representing distinct tissue and temperature response expression patterns were derived using the k-means fuzzy clustering algorithm. The promoter regions of the clustered DEGs that demonstrated strong co-regulation were analysed for enriched cis-regulatory elements with a motif discovery program, DREME. Seventeen motifs, ten known and seven novel, were identified, which covered 23% of the DEGs. Two motifs predicted to be the binding sites for the transcription factors Bcl6 and Jun, respectively, were chosen for experimental verification, and they demonstrated the expected cold-induced and cold-repressed patterns of gene regulation. Protein interaction modeling of the network components followed by experimental validation suggested that Jun physically interacts with Bcl6 and might be a hub factor that orchestrates the cold response in zebrafish. Thus, the methodology used and the regulatory networks uncovered in this study provide a foundation for exploring the mechanisms of cold adaptation in teleosts. PMID:26227973

  17. Inferring regulatory element landscapes and transcription factor networks from cancer methylomes.

    PubMed

    Yao, Lijing; Shen, Hui; Laird, Peter W; Farnham, Peggy J; Berman, Benjamin P

    2015-01-01

    Recent studies indicate that DNA methylation can be used to identify transcriptional enhancers, but no systematic approach has been developed for genome-wide identification and analysis of enhancers based on DNA methylation. We describe ELMER (Enhancer Linking by Methylation/Expression Relationships), an R-based tool that uses DNA methylation to identify enhancers and correlates enhancer state with expression of nearby genes to identify transcriptional targets. Transcription factor motif analysis of enhancers is coupled with expression analysis of transcription factors to infer upstream regulators. Using ELMER, we investigated more than 2,000 tumor samples from The Cancer Genome Atlas. We identified networks regulated by known cancer drivers such as GATA3 and FOXA1 (breast cancer), SOX17 and FOXA2 (endometrial cancer), and NFE2L2, SOX2, and TP63 (squamous cell lung cancer). We also identified novel networks with prognostic associations, including RUNX1 in kidney cancer. We propose ELMER as a powerful new paradigm for understanding the cis-regulatory interface between cancer-associated transcription factors and their functional target genes. PMID:25994056

  18. Distinct Functional Constraints Partition Sequence Conservation in a cis-Regulatory Element

    PubMed Central

    Ruvinsky, Ilya

    2011-01-01

    Different functional constraints contribute to different evolutionary rates across genomes. To understand why some sequences evolve faster than others in a single cis-regulatory locus, we investigated function and evolutionary dynamics of the promoter of the Caenorhabditis elegans unc-47 gene. We found that this promoter consists of two distinct domains. The proximal promoter is conserved and is largely sufficient to direct appropriate spatial expression. The distal promoter displays little if any conservation between several closely related nematodes. Despite this divergence, sequences from all species confer robustness of expression, arguing that this function does not require substantial sequence conservation. We showed that even unrelated sequences have the ability to promote robust expression. A prominent feature shared by all of these robustness-promoting sequences is an AT-enriched nucleotide composition consistent with nucleosome depletion. Because general sequence composition can be maintained despite sequence turnover, our results explain how different functional constraints can lead to vastly disparate rates of sequence divergence within a promoter. PMID:21655084

  19. A MAPT mutation in a regulatory element upstream of exon 10 causes frontotemporal dementia.

    PubMed

    Malkani, Roneil; D'Souza, Ian; Gwinn-Hardy, Katrina; Schellenberg, Gerard D; Hardy, John; Momeni, Parastoo

    2006-05-01

    We report here the genetic analysis of a newly ascertained kindred in which frontotemporal dementia occurs in an apparent autosomal dominant fashion, and in which a novel MAPT gene mutation co-segregates with disease. Sequencing the MAPT gene in affected individuals revealed a change in intron 9. This finding supports earlier studies on the effect of a splice-accepting element in inclusion of exon 10 in the MAPT transcript. This mutation sheds light on a novel mechanism by which over-expression of 4-repeat tau leads to disease. Based on our current findings, we propose a novel mechanism by which intronic mutations can lead to frontotemporal dementia. PMID:16503405

  20. Impact of Age at Administration, Lysosomal Storage, and Transgene Regulatory Elements on AAV2/8-Mediated Rat Liver Transduction

    PubMed Central

    Cotugno, Gabriella; Annunziata, Patrizia; Barone, Maria Vittoria; Karali, Marianthi; Banfi, Sandro; Auricchio, Alberto

    2012-01-01

    Liver-directed gene transfer is being investigated for the treatment of systemic or liver-specific diseases. Recombinant vectors based on adeno-associated virus serotype 8 (AAV2/8) efficiently transduce liver cells allowing long term transgene expression after a single administration in animal models and in patients. We evaluated the impact on AAV2/8-mediated rat liver transduction of the following variables: i) age at vector administration, ii) presence of lysosomal storage in liver cells, and iii) regulatory elements included in the transgene expression cassette. We found that systemic administration of AAV2/8 to newborn rats results in vector genome dilution and reduced transduction efficacy when compared to adult injected animals, presumably due to hepatocyte proliferation. Accumulation of glycosaminoglycans in lysosomes does not impact on levels and distribution of AAV2/8-mediated liver transduction. Transgene expression occurs in hepatocytes but not in Kupffer or liver endothelial cells when the liver-specific thyroxine-binding-globulin promoter is used. However, extra-hepatic transduction is observed in the spleen and kidney of animals injected at birth. The use of target sequences for the hematopoietic-specific microRNA miR142-3p does not improve liver transduction efficacy neither reduce immune responses to the lysosomal enzyme arylsulfatase B. The inclusion of a variant of the Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE-m) decreases AAV2/8-mediated liver transduction levels. As AAV2/8-mediated liver gene transfer is entering in the clinical arena, these data will provide relevant information to the design of efficient AAV2/8-based therapeutic strategies. PMID:22428010

  1. HIRF: a novel nuclear factor that binds to the human T-cell leukemia virus type I internal regulatory element (HIRE).

    PubMed

    Ariumi, Y; Copeland, T D; Nosaka, T; Hatanaka, M

    1997-04-01

    The transcription of human T-cell leukemia virus type I (HTLV-I) provirus starts from a promoter located in the 5' long terminal repeat (LTR). We have identified a second promoter at the 3' end of the pol gene. This internal promoter expresses the Tax transactivator protein, but does not require Tax for its activity. Furthermore, we have found the novel enhancer motif AGTTCTGCCC, which are located near the initiation site. We have named the sequence HIRE (HTLV-I internal regulatory element). The HIRE binding protein is a ubiquitous protein. We purified this protein from the HTLV-I producing cell line MT-2 cells by DNA affinity chromatography. SDS-PAGE analysis revealed four major bands (70, 85, 115 and more than 200 kDa) and some minor bands on the gel. We renatured each major protein and showed the 70 and 115 kDa proteins bind to DNA, although the 115 kDa protein seemed to bind nonspecifically. We have designated these components as HIRF (HTLV-I internal regulatory factor). PMID:9209287

  2. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs.

    PubMed

    Glinsky, Gennadi V

    2015-06-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals' genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions

  3. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.

    2015-01-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions

  4. Ubiquitous and neuronal DNA-binding proteins interact with a negative regulatory element of the human hypoxanthine phosphoribosyltransferase gene.

    PubMed Central

    Rincón-Limas, D E; Amaya-Manzanares, F; Niño-Rosales, M L; Yu, Y; Yang, T P; Patel, P I

    1995-01-01

    The hypoxanthine phosphoribosyltransferase (HPRT) gene is constitutively expressed at low levels in all tissues but at higher levels in the brain; the significance and mechanism of this differential expression are unknown. We previously identified a 182-bp element (hHPRT-NE) within the 5'-flanking region of the human HPRT (hHPRT) gene, which is involved not only in conferring neuronal specificity but also in repressing gene expression in nonneuronal tissues. Here we report that this element interacts with different nuclear proteins, some of which are present specifically in neuronal cells (complex I) and others of which are present in cells showing constitutive expression of the gene (complex II). In addition, we found that complex I factors are expressed in human NT2/D1 cells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation. We also mapped the binding sites for both complexes to a 60-bp region (Ff; positions -510 to -451) which, when analyzed in transfection assays, functioned as a repressor element analogous to the full-length hHPRT-NE sequence. Methylation interference footprintings revealed a minimal unique DNA motif, 5'-GGAAGCC-3', as the binding site for nuclear proteins from both neuronal and nonneuronal sources. However, site-directed mutagenesis of the footprinted region indicated that different nucleotides are essential for the associations of these two complexes. Moreover, UV cross-linking experiments showed that both complexes are formed by the association of several different proteins. Taken together, these data suggest that differential interaction of DNA-binding factors with this regulatory element plays a crucial role in the brain-preferential expression of the gene, and they should lead to the isolation of transcriptional regulators important in neuronal expression of the HPRT gene. PMID:8524221

  5. Organization of multiple regulatory elements in the control region of the adenovirus type 2-specific VARNA1 gene: fine mapping with linker-scanning mutants.

    PubMed

    Railey, J F; Wu, G J

    1988-03-01

    The adenovirus type 2-specific virus-associated RNA 1 (VARNA1) gene is transcribed by eucaryotic RNA polymerase III. Previous studies using deletion mutants for transcription have shown that the VARNA1 gene has a large control region which is composed of several regulatory elements. Twenty-five exact linker-scanning mutations in the control region, from -33 to +77, of this gene were used for definition of the number and boundaries of these elements. The effects of these mutations on transcription and competition for transcription factors in human KB cell extracts revealed five positive regulatory elements. The essential element, which coincided with the B block, was absolutely required for both transcription and formation of stable complexes. A second element, which included the A block, was also required for both transcription and formation of stable complexes. Although this element is not as essential as the B-block element, together with the B-block element it may be necessary for formation of the most basal form of transcription machinery. Therefore, these two elements are the promoter elements in this gene. In addition, one possible element in the interblock region and two elements in the 5' flanking region were also required for efficient transcription, but they were moderately required for formation of stable complexes. Transcription of these mutants and the wild-type gene using an extract of 293 cells was stimulated at least threefold over that with the KB cell extract, as expected. Similar regulatory elements of this gene were revealed, however, when the 293 cell extract was used for transcription of these mutants, suggesting that the E1A-mediated specific transcription factors act on the transcription machinery in a sequence-nonspecific manner. PMID:3367906

  6. Organization of multiple regulatory elements in the control region of the adenovirus type 2-specific VARNA1 gene: fine mapping with linker-scanning mutants.

    PubMed Central

    Railey, J F; Wu, G J

    1988-01-01

    The adenovirus type 2-specific virus-associated RNA 1 (VARNA1) gene is transcribed by eucaryotic RNA polymerase III. Previous studies using deletion mutants for transcription have shown that the VARNA1 gene has a large control region which is composed of several regulatory elements. Twenty-five exact linker-scanning mutations in the control region, from -33 to +77, of this gene were used for definition of the number and boundaries of these elements. The effects of these mutations on transcription and competition for transcription factors in human KB cell extracts revealed five positive regulatory elements. The essential element, which coincided with the B block, was absolutely required for both transcription and formation of stable complexes. A second element, which included the A block, was also required for both transcription and formation of stable complexes. Although this element is not as essential as the B-block element, together with the B-block element it may be necessary for formation of the most basal form of transcription machinery. Therefore, these two elements are the promoter elements in this gene. In addition, one possible element in the interblock region and two elements in the 5' flanking region were also required for efficient transcription, but they were moderately required for formation of stable complexes. Transcription of these mutants and the wild-type gene using an extract of 293 cells was stimulated at least threefold over that with the KB cell extract, as expected. Similar regulatory elements of this gene were revealed, however, when the 293 cell extract was used for transcription of these mutants, suggesting that the E1A-mediated specific transcription factors act on the transcription machinery in a sequence-nonspecific manner. Images PMID:3367906

  7. Organization of multiple regulatory elements in the control region of the adenovirus type 2-specific VARNA1 gene: Fine mapping with linker-scanning mutants

    SciTech Connect

    Railey, J.F.; Wu, G.J.

    1988-03-01

    The adenovirus type 2-specific virus-associated RNA 1 (VARNA1) gene is transcribed by eucaryotic RNA polymerase III. Previous studies using deletion mutants for transcription have shown that the VARNA1 gene has a large control region which is composed of several regulatory elements. Twenty-five exact linker-scanning mutations in the control region, from -33 to +77, of this gene were used for definition of the number and boundaries of these elements. The effects of these mutations on transcription and competition for transcription factors in human KB cell extracts revealed five positive regulatory elements. The essential element, which coincided with the B block, was absolutely required for both transcription and formation of stable complexes. A second element, which included the A block, was also required for both transcription and formation of stable complexes. Although this element is not as essential as the B-block element, together with the B-block element it may be necessary for formation of the most basal form of transcription machinery. Therefore, these two elements are the promoter elements in this gene. In addition, one possible element in the interblock region and two elements in the 5' flanking region were also required for efficient transcription, but they were moderately required for formation of stable complexes. Transcription of these mutants and the wild-type genes using an extract of 293 cells was stimulated at least threefold over that with the KB cell extract, as expected. Similar regulatory elements of this gene were revealed, however, when the 292 cell extract was used for transcription of these mutants, suggesting that the E1A-mediated specific transcription factors act on the transcription machinery in a sequence-nonspecific manner.

  8. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes.

    PubMed

    Mahmood, Khalid; Mathiassen, Solvejg K; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  9. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  10. The ubiquitous yybP-ykoY riboswitch is a manganese-responsive regulatory element

    PubMed Central

    Updegrove, Taylor B.; Anantharaman, Vivek; Aravind, L.; Waters, Lauren S.; Storz, Gisela

    2015-01-01

    SUMMARY The highly-structured, cis-encoded RNA elements known as riboswitches modify gene expression upon binding a wide range of molecules. The yybP-ykoY motif was one of the most broadly distributed and numerous bacterial riboswitch whose cognate ligand was unknown. Using a combination of in vivo reporter and in vitro expression assays, equilibrium dialysis and northern analysis, we show that the yybP-ykoY motif responds directly to manganese ions in both Escherichia coli and Bacillus subtilis. The identification of the yybP-ykoY motif as a manganese ion sensor suggests the genes that are preceded by this motif, and encode a diverse set of poorly characterized membrane proteins, have roles in metal homeostasis. PMID:25794618

  11. Mesoscale Modeling Reveals Hierarchical Looping of Chromatin Fibers Near Gene Regulatory Elements.

    PubMed

    Bascom, Gavin D; Sanbonmatsu, Karissa Y; Schlick, Tamar

    2016-08-25

    While it is well-recognized that chromatin loops play an important role in gene regulation, structural details regarding higher order chromatin loops are only emerging. Here we present a systematic study of restrained chromatin loops ranging from 25 to 427 nucleosomes (fibers of 5-80 Kb DNA in length), mimicking gene elements studied by 3C contact data. We find that hierarchical looping represents a stable configuration that can effectively bring distant regions of the GATA-4 gene together, satisfying connections reported by 3C experiments. Additionally, we find that restrained chromatin fibers larger than 100 nucleosomes (∼20Kb) form closed plectonemes, whereas fibers shorter than 100 nucleosomes form simple hairpin loops. By studying the dependence of loop structures on internal parameters, we show that loop features are sensitive to linker histone concentration, loop length, divalent ions, and DNA linker length. Specifically, increasing loop length, linker histone concentration, and divalent ion concentration are associated with increased persistence length (or decreased bending), while varying DNA linker length in a manner similar to experimentally observed "nucleosome free regions" (found near transcription start sites) disrupts intertwining and leads to loop opening and increased persistence length in linker histone depleted (-LH) fibers. Chromatin fiber structure sensitivity to these parameters, all of which vary throughout the cell cycle, tissue type, and species, suggests that caution is warranted when using uniform polymer models to fit chromatin conformation capture genome-wide data. Furthermore, the folding geometry we observe near the transcription initiation site of the GATA-4 gene suggests that hierarchical looping provides a structural mechanism for gene inhibition, and offers tunable parameters for design of gene regulation elements. PMID:27218881

  12. Notch1 regulated autophagy controls survival and suppressor activity of activated murine T-regulatory cells

    PubMed Central

    Marcel, Nimi; Sarin, Apurva

    2016-01-01

    Cell survival is one of several processes regulated by the Notch pathway in mammalian cells. Here we report functional outcomes of non-nuclear Notch signaling to activate autophagy, a conserved cellular response to nutrient stress, regulating survival in murine natural T-regulatory cells (Tregs), an immune subset controlling tolerance and inflammation. Induction of autophagy required ligand-dependent, Notch intracellular domain (NIC) activity, which controlled mitochondrial organization and survival of activated Tregs. Consistently, NIC immune-precipitated Beclin and Atg14, constituents of the autophagy initiation complex. Further, ectopic expression of an effector of autophagy (Atg3) or recombinant NIC tagged to a nuclear export signal (NIC-NES), restored autophagy and suppressor function in Notch1-/- Tregs. Furthermore, Notch1 deficiency in the Treg lineage resulted in immune hyperactivity, implicating Notch activity in Treg homeostasis. Notch1 integration with autophagy, revealed in these experiments, holds implications for Notch regulated cell-fate decisions governing differentiation. DOI: http://dx.doi.org/10.7554/eLife.14023.001 PMID:27267497

  13. Preventing Phosphorylation of Sterol Regulatory Element-Binding Protein 1a by MAP-Kinases Protects Mice from Fatty Liver and Visceral Obesity

    PubMed Central

    Haas, Jutta; Kremer, Lorena; Jacob, Sylvia; Hartwig, Sonja; Nitzgen, Ulrike; Muller–Wieland, Dirk

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP–1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP–1a mice the phosphorylation–deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo. PMID:22384276

  14. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids

    PubMed Central

    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent

    2015-01-01

    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica. PMID:26347724

  15. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    PubMed Central

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen

    2016-01-01

    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  16. Binding of TFIIIC to SINE Elements Controls the Relocation of Activity-Dependent Neuronal Genes to Transcription Factories

    PubMed Central

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T.; Jongbloets, Bart C.; Down, Thomas A.; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes. PMID:23966877

  17. Ubiquitous heterogeneity and asymmetry of the chromatin environment at regulatory elements.

    PubMed

    Kundaje, Anshul; Kyriazopoulou-Panagiotopoulou, Sofia; Libbrecht, Max; Smith, Cheryl L; Raha, Debasish; Winters, Elliott E; Johnson, Steven M; Snyder, Michael; Batzoglou, Serafim; Sidow, Arend

    2012-09-01

    Gene regulation at functional elements (e.g., enhancers, promoters, insulators) is governed by an interplay of nucleosome remodeling, histone modifications, and transcription factor binding. To enhance our understanding of gene regulation, the ENCODE Consortium has generated a wealth of ChIP-seq data on DNA-binding proteins and histone modifications. We additionally generated nucleosome positioning data on two cell lines, K562 and GM12878, by MNase digestion and high-depth sequencing. Here we relate 14 chromatin signals (12 histone marks, DNase, and nucleosome positioning) to the binding sites of 119 DNA-binding proteins across a large number of cell lines. We developed a new method for unsupervised pattern discovery, the Clustered AGgregation Tool (CAGT), which accounts for the inherent heterogeneity in signal magnitude, shape, and implicit strand orientation of chromatin marks. We applied CAGT on a total of 5084 data set pairs to obtain an exhaustive catalog of high-resolution patterns of histone modifications and nucleosome positioning signals around bound transcription factors. Our analyses reveal extensive heterogeneity in how histone modifications are deposited, and how nucleosomes are positioned around binding sites. With the exception of the CTCF/cohesin complex, asymmetry of nucleosome positioning is predominant. Asymmetry of histone modifications is also widespread, for all types of chromatin marks examined, including promoter, enhancer, elongation, and repressive marks. The fine-resolution signal shapes discovered by CAGT unveiled novel correlation patterns between chromatin marks, nucleosome positioning, and sequence content. Meta-analyses of the signal profiles revealed a common vocabulary of chromatin signals shared across multiple cell lines and binding proteins. PMID:22955985

  18. Regulatory elements of the EKLF gene that direct erythroid cell-specific expression during mammalian development.

    PubMed

    Xue, Li; Chen, Xiaoyong; Chang, Yanjie; Bieker, James J

    2004-06-01

    Erythroid Krüppel-like factor (EKLF) plays an essential role in enabling beta-globin expression during erythroid ontogeny. It is first expressed in the extraembryonic mesoderm of the yolk sac within the morphologically unique cells that give rise to the blood islands, and then later within the hepatic primordia. The BMP4/Smad pathway plays a critical role in the induction of EKLF, and transient transfection analyses demonstrate that sequences located within less than 1 kb of its transcription initiation site are sufficient for high-level erythroid-specific transcription. We have used transgenic analyses to verify that 950 bp located adjacent to the EKLF start site of transcription is sufficient to generate lacZ expression within the blood islands as well as the fetal liver during embryonic development. Of particular importance are 3 regions, 2 of which overlap endogenous erythroid-specific DNase hypersensitive sites, and 1 of which includes the proximal promoter region. The onset of transgene expression mimics that of endogenous EKLF as it begins by day 7.5 (d7.5) to d8.0. In addition, it exhibits a strict hematopoietic specificity, localized only to these cells and not to the adjacent vasculature at all stages examined. Finally, expression is heterocellular, implying that although these elements are sufficient for tissue-specific expression, they do not shield against the position effects of adjacent chromatin. These analyses demonstrate that a surprisingly small DNA segment contains all the information needed to target a linked gene to the hematopoietic compartment at both early and later stages of development, and may be a useful cassette for this purpose. PMID:14764531

  19. Hormone stimulation of androgen receptor mediates dynamic changes in DNA methylation patterns at regulatory elements

    PubMed Central

    Dhiman, Vineet K.; Attwood, Kristopher; Campbell, Moray J.; Smiraglia, Dominic J.

    2015-01-01

    DNA methylation is an epigenetic modification that contributes to stable gene silencing by interfering with the ability of transcriptional regulators to bind to DNA. Recent findings have revealed that hormone stimulation of certain nuclear receptors induces rapid, dynamic changes in DNA methylation patterns alongside transcriptional responses at a subset of target loci, over time. However, the ability of androgen receptor (AR) to dynamically regulate gene transcription is relatively under-studied and its role in the regulation of DNA methylation patterns remains to be elucidated. Here we demonstrate in normal prostate cells that hormone stimulated AR activity results in dynamic changes in the transcription rate and DNA methylation patterns at the AR target genes, TIPARP and SGK1. Time-resolved chromatin immunoprecipitation experiments on the SGK1 locus reveals dynamic recruitment of AR and RNA Polymerase II, as well as the recruitment of proteins involved in the DNA demethylation process, TET1 and TDG. Furthermore, the presence of DNA methylation at dynamic regions inhibits protein binding and transcriptional activity of SGK1. These findings establish AR activity as a contributing factor to the dynamic regulation of DNA methylation patterns at target genes in prostate biology and infer further complexity involved in nuclear receptor mediation of transcriptional regulation. PMID:26646795

  20. Regulatory crosstalk by protein kinases on CFTR trafficking and activity

    NASA Astrophysics Data System (ADS)

    Farinha, Carlos Miguel; Swiatecka-Urban, Agnieszka; Brautigan, David; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e. channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease.

  1. Regulatory Crosstalk by Protein Kinases on CFTR Trafficking and Activity

    PubMed Central

    Farinha, Carlos M.; Swiatecka-Urban, Agnieszka; Brautigan, David L.; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e., channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease. PMID:26835446

  2. Disruption of a novel regulatory element in the erythroid-specific promoter of the human PKLR gene causes severe pyruvate kinase deficiency.

    PubMed

    van Wijk, Richard; van Solinge, Wouter W; Nerlov, Claus; Beutler, Ernest; Gelbart, Terri; Rijksen, Gert; Nielsen, Finn C

    2003-02-15

    We established the molecular basis for pyruvate kinase (PK) deficiency in a white male patient with severe nonspherocytic hemolytic anemia. The paternal allele exhibited the common PKLR cDNA sequence (c.) 1529G>A mutation, known to be associated with PK deficiency. On the maternal allele, 3 in cis mutations were identified in the erythroid-specific promoter region of the gene: one deletion of thymine -248 and 2 single nucleotide substitutions, nucleotide (nt) -324T>A and nt -83G>C. Analysis of the patient's RNA demonstrated the presence of only the 1529A allele, indicating severely reduced transcription from the allele linked to the mutated promoter region. Transfection of promoter constructs into erythroleukemic K562 cells showed that the most upstream -324T>A and -248delT mutations were nonfunctional polymorphisms. In contrast, the -83G>C mutation strongly reduced promoter activity. Site-directed mutagenesis of the promoter region revealed the presence of a putative regulatory element (PKR-RE1) whose core binding motif, CTCTG, is located between nt -87 and nt -83. Electrophoretic mobility shift assay using K562 nuclear extracts indicated binding of an as-yet-unidentified trans-acting factor. This novel element mediates the effects of factors necessary for regulation of pyruvate kinase gene expression during red cell differentiation and maturation. PMID:12393511

  3. The regulatory cascade that activates the Hrp regulon in Erwinia herbicola pv. gypsophilae.

    PubMed

    Nizan-Koren, R; Manulis, S; Mor, H; Iraki, N M; Barash, I

    2003-03-01

    The pathogenicity of Erwinia herbicola pv. gypsophilae (Ehg) is dependent on a plasmid (pPATH(Ehg)) that harbors the hrp gene cluster and additional virulence genes. The hrp regulatory cascade of Ehg comprises an hrpXY operon encoding a two-component system; hrpS encoding a transcriptional factor of the NtrC family and hrpL encoding an alternative sigma factor. Results obtained suggest the following signal transduction model for activating the Hrp regulon: phosphorylated HrpY activates hrpS, HrpS activates hrpL, and HrpL activates genes containing "hrp box" promoter. This model was supported by studies on the effects of mutations in the regulatory genes on pathogenicity and complementation analysis. Nonpolar mutations in hrpX did not affect virulence or transcription of downstream genes. Site-directed mutagenesis of the conserved aspartate 57 in HrpY suggested that its phosphorylation is crucial for activating the hrp regulatory cascade. Studies on the effects of mutations in the hrp regulatory genes on transcriptional activity of downstream genes or of their isolated promoters in planta showed dependency of hrpS expression on active HrpY, of hrpL expression on active HrpS, and of hrpN or hrpJ expression on active HrpL. These results were also partially supported by overexpression of regulatory genes under in vitro conditions. The hrpXY is constitutively expressed with high basal levels under repressive conditions, in contrast to hrpS and hrpL, which exhibit low basal expression levels and are environmentally regulated. PMID:12650456

  4. BET-independent MLV-based Vectors Target Away From Promoters and Regulatory Elements

    PubMed Central

    El Ashkar, Sara; De Rijck, Jan; Demeulemeester, Jonas; Vets, Sofie; Madlala, Paradise; Cermakova, Katerina; Debyser, Zeger; Gijsbers, Rik

    2014-01-01

    Stable integration in the host genome renders murine leukemia virus (MLV)-derived vectors attractive tools for gene therapy. Adverse events in otherwise successful clinical trials caused by proto-oncogene activation due to vector integration hamper their application. MLV and MLV-based vectors integrate near strong enhancers, active promoters, and transcription start sites (TSS) through specific interaction of MLV integrase (IN) with the bromodomain and extra-terminal (BET) family of proteins, accounting for insertional mutagenesis. We identified a BET-interaction motif in the C-terminal tail of MLV IN conserved among gammaretroviruses. By deletion of this motif or a single point mutation (INW390A), BET-independent MLV (BinMLV) were engineered. BinMLV vectors carrying INW390A integrate at wild-type efficiency, with an integration profile that no longer correlates with BET chromatin distribution nor with the traditional markers of MLV integration. In particular, BinMLV vector integration associated less with oncogene TSS compared to the MLV vectors currently used in clinical trials. Together, these findings open perspectives to increase the biosafety of gammaretroviral vectors for gene therapy. PMID:25072693

  5. Cis-Regulatory Elements Determine Germline Specificity and Expression Level of an Isopentenyltransferase Gene in Sperm Cells of Arabidopsis1[OPEN

    PubMed Central

    Yuan, Tong; Duan, Xiaomeng; Wei, Xiaoping; Li, Jia

    2016-01-01

    Flowering plant sperm cells transcribe a divergent and complex complement of genes. To examine promoter function, we chose an isopentenyltransferase gene known as PzIPT1. This gene is highly selectively transcribed in one sperm cell morphotype of Plumbago zeylanica, which preferentially fuses with the central cell during fertilization and is thus a founding cell of the primary endosperm. In transgenic Arabidopsis (Arabidopsis thaliana), PzIPT1 promoter displays activity in both sperm cells and upon progressive promoter truncation from the 5′-end results in a progressive decrease in reporter production, consistent with occurrence of multiple enhancer sites. Cytokinin-dependent protein binding motifs are identified in the promoter sequence, which respond with stimulation by cytokinin. Expression of PzIPT1 promoter in sperm cells confers specificity independently of previously reported Germline Restrictive Silencer Factor binding sequence. Instead, a cis-acting regulatory region consisting of two duplicated 6-bp Male Gamete Selective Activation (MGSA) motifs occurs near the site of transcription initiation. Disruption of this sequence-specific site inactivates expression of a GFP reporter gene in sperm cells. Multiple copies of the MGSA motif fused with the minimal CaMV35S promoter elements confer reporter gene expression in sperm cells. Similar duplicated MGSA motifs are also identified from promoter sequences of sperm cell-expressed genes in Arabidopsis, suggesting selective activation is possibly a common mechanism for regulation of gene expression in sperm cells of flowering plants. PMID:26739233

  6. Renoprotective effect of myricetin restrains dyslipidemia and renal mesangial cell proliferation by the suppression of sterol regulatory element binding proteins in an experimental model of diabetic nephropathy.

    PubMed

    Kandasamy, Neelamegam; Ashokkumar, Natarajan

    2014-11-15

    Myricetin is a natural flavonoid used in various health management systems. In this present study myricetin tested to evaluate the effect on lipids and lipid metabolism enzymes in normal and streptozotocin (STZ) with cadmium (Cd) induced diabetic nephrotoxic rats. Diabetic nephrotoxic rats were significantly (P<0.05) increased the levels of urinary albumin and lipid profiles: total cholesterol (TC), triglycerides (TGs), free fatty acids (FFAs), phospholipids (PLs), low density lipoprotein (LDL), very low-density lipoproteins (VLDL), and decreased in the levels of high-density lipoproteins (HDL). In addition, the activity of lipoprotein lipase (LPL) and lecithin cholesterol acyl transferase (LCAT) were decreased significantly, whereas the 3-hydroxy 3-methylglutaryl coenzyme A (HmgCoA) reductase activity was increased. The upregulation of sterol regulatory element binding protein-1a (SREBP-1a), SREBP-1c, SREBP-2, transforming growth factor-β1 (TGF-β1), vascular endothelial growth factor (VEGF) and downregulation peroxisome proliferator-activated receptor alpha (PPAR-α) proteins expression levels were noticed. An administration of myricetin (1.0 mg/kg body weight (b/w)) for 12 weeks was brought the above parameters towards normal level. Histopathological study of kidney samples showed that extracellular mesangial matrix expansion, glomerulosclerosis and interstitial fibrosis in diabetic nephrotoxic rats was suppressed by myricetin treatment. Further our results indicate that administration of myricetin afforded remarkable protection against STZ-Cd induced alterations in lipid metabolism and thereby reduced the diabetic nephropathy in experimental rats. PMID:25240712

  7. An impairment of long distance SOX10 regulatory elements underlies isolated Hirschsprung disease.

    PubMed

    Lecerf, Laure; Kavo, Anthula; Ruiz-Ferrer, Macarena; Baral, Viviane; Watanabe, Yuli; Chaoui, Asma; Pingault, Veronique; Borrego, Salud; Bondurand, Nadege

    2014-03-01

    A deletion encompassing several SOX10 enhancers was recently identified in a patient presenting with Waardenburg syndrome type 4 (WS4), which is defined as a combination of Hirschsprung disease (HSCR, intestinal aganglionosis) and WS (deafness and pigmentation defects). The expression patterns of some of the known SOX10 enhancers in animal models led to the speculation that endophenotypes of WS4 may be linked to mutations within some of these sequences. The present study investigated deletions and point mutations within four SOX10 enhancers in 144 unexplained isolated HSCR cases. One deletion and two point mutations affecting binding sites for known neural crest transcription factors were identified. In vitro functional analysis revealed that the first point mutation disrupts autoregulation by SOX10, whereas the second affects AP2a and SOX10 synergistic activity. The present findings suggest that the mutations within SOX10 enhancers contribute to isolated HSCR. PMID:24357527

  8. Ring finger protein20 regulates hepatic lipid metabolism through protein kinase A-dependent sterol regulatory element binding protein1c degradation

    PubMed Central

    Lee, Jae Ho; Lee, Gha Young; Jang, Hagoon; Choe, Sung Sik; Koo, Seung-Hoi; Kim, Jae Bum

    2014-01-01

    Sterol regulatory element binding protein1c (SREBP1c) is a key transcription factor for de novo lipogenesis during the postprandial state. During nutritional deprivation, hepatic SREBP1c is rapidly suppressed by fasting signals to prevent lipogenic pathways. However, the molecular mechanisms that control SREBP1c turnover in response to fasting status are not thoroughly understood. To elucidate which factors are involved in the inactivation of SREBP1c, we attempted to identify SREBP1c-interacting proteins by mass spectrometry analysis. Since we observed that ring finger protein20 (RNF20) ubiquitin ligase was identified as one of SREBP1c-interacting proteins, we hypothesized that fasting signaling would promote SREBP1c degradation in an RNF20-dependent manner. In this work, we demonstrate that RNF20 physically interacts with SREBP1c, leading to degradation of SREBP1c via ubiquitination. In accordance with these findings, RNF20 represses the transcriptional activity of SREBP1c and turns off the expression of lipogenic genes that are targets of SREBP1c. In contrast, knockdown of RNF20 stimulates the expression of SREBP1c and lipogenic genes and induces lipogenic activity in primary hepatocytes. Furthermore, activation of protein kinase A (PKA) with glucagon or forskolin enhances the expression of RNF20 and potentiates the ubiquitination of SREBP1c via RNF20. In wild-type and db/db mice, adenoviral overexpression of RNF20 markedly suppresses FASN promoter activity and reduces the level of hepatic triglycerides, accompanied by a decrease in the hepatic lipogenic program. Here, we reveal that RNF20-induced SREBP1c ubiquitination down-regulates hepatic lipogenic activity upon PKA activation. Conclusion: RNF20 acts as a negative regulator of hepatic fatty acid metabolism through degradation of SREBP1c upon PKA activation. Knowledge regarding this process enhances our understanding of how SREBP1c is able to turn off hepatic lipid metabolism during nutritional deprivation

  9. Identification of conserved regulatory elements in upstream promoter regions of mammals at relaxed thresholds by comparative genomics - a case study using PEPCK

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background Comparative genomics is the primary method to discover regulatory elements by identifying conserved sequences due to evolutionary constraints by cross-species genome comparison. Except for the most conserved and prominent transcription factor binding sites (TFBS), there is a general lack ...

  10. csrT Represents a New Class of csrA-Like Regulatory Genes Associated with Integrative Conjugative Elements of Legionella pneumophila

    PubMed Central

    Abbott, Zachary D.; Flynn, Kaitlin J.; Byrne, Brenda G.; Mukherjee, Sampriti; Kearns, Daniel B.

    2015-01-01

    ABSTRACT Bacterial evolution is accelerated by mobile genetic elements. To spread horizontally and to benefit the recipient bacteria, genes encoded on these elements must be properly regulated. Among the legionellae are multiple integrative conjugative elements (ICEs) that each encode a paralog of the broadly conserved regulator csrA. Using bioinformatic analyses, we deduced that specific csrA paralogs are coinherited with particular lineages of the type IV secretion system that mediates horizontal spread of its ICE, suggesting a conserved regulatory interaction. As a first step to investigate the contribution of csrA regulators to this class of mobile genetic elements, we analyzed here the activity of the csrA paralog encoded on Legionella pneumophila ICE-βox. Deletion of this gene, which we name csrT, had no observed effect under laboratory conditions. However, ectopic expression of csrT abrogated the protection to hydrogen peroxide and macrophage degradation that ICE-βox confers to L. pneumophila. When ectopically expressed, csrT also repressed L. pneumophila flagellin production and motility, a function similar to the core genome's canonical csrA. Moreover, csrT restored the repression of motility to csrA mutants of Bacillus subtilis, a finding consistent with the predicted function of CsrT as an mRNA binding protein. Since all known ICEs of legionellae encode coinherited csrA-type IV secretion system pairs, we postulate that CsrA superfamily proteins regulate ICE activity to increase their horizontal spread, thereby expanding L. pneumophila versatility. IMPORTANCE ICEs are mobile DNA elements whose type IV secretion machineries mediate spread among bacterial populations. All surveyed ICEs within the Legionella genus also carry paralogs of the essential life cycle regulator csrA. It is striking that the csrA loci could be classified into distinct families based on either their sequence or the subtype of the adjacent type IV secretion system locus. To

  11. THE INITIAL PHASE OF AN IMMUNE RESPONSE FUNCTIONS TO ACTIVATE REGULATORY T CELLS

    PubMed Central

    O’Gorman, William E.; Dooms, Hans; Thorne, Steve H.; Kuswanto, Wilson F.; Simonds, Erin F.; Krutzik, Peter O.; Nolan, Garry P.; Abbas, Abul K.

    2009-01-01

    An early reaction of CD4+ T lymphocytes to antigen is the production of cytokines, notably IL-2. In order to detect cytokine dependent responses, naive antigen-specific T cells were stimulated in vivo and the presence of phosphorylated STAT5 molecules was used to identify the cell populations responding to IL-2. Within hours of T-cell priming, IL-2-dependent STAT5 phosphorylation occurred primarily in Foxp3+ regulatory T cells. In contrast, the antigen-specific T cells received STAT5 signals only after repeated antigen exposure or memory differentiation. Regulatory T cells receiving IL-2 signals proliferated and developed enhanced suppressive activity. These results indicate that one of the earliest events in a T cell response is the activation of endogenous regulatory cells, potentially to prevent autoimmunity. PMID:19542444

  12. Innate immune activity conditions the effect of regulatory variants upon monocyte gene expression.

    PubMed

    Fairfax, Benjamin P; Humburg, Peter; Makino, Seiko; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C

    2014-03-01

    To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor-modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants. PMID:24604202

  13. Innate Immune Activity Conditions the Effect of Regulatory Variants upon Monocyte Gene Expression

    PubMed Central

    Fairfax, Benjamin P.; Naranbhai, Vivek; Wong, Daniel; Lau, Evelyn; Jostins, Luke; Plant, Katharine; Andrews, Robert; McGee, Chris; Knight, Julian C.

    2014-01-01

    To systematically investigate the impact of immune stimulation upon regulatory variant activity, we exposed primary monocytes from 432 healthy Europeans to interferon-γ (IFN-γ) or differing durations of lipopolysaccharide and mapped expression quantitative trait loci (eQTLs). More than half of cis-eQTLs identified, involving hundreds of genes and associated pathways, are detected specifically in stimulated monocytes. Induced innate immune activity reveals multiple master regulatory trans-eQTLs including the major histocompatibility complex (MHC), coding variants altering enzyme and receptor function, an IFN-β cytokine network showing temporal specificity, and an interferon regulatory factor 2 (IRF2) transcription factor–modulated network. Induced eQTL are significantly enriched for genome-wide association study loci, identifying context-specific associations to putative causal genes including CARD9, ATM, and IRF8. Thus, applying pathophysiologically relevant immune stimuli assists resolution of functional genetic variants. PMID:24604202

  14. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    SciTech Connect

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas

    2011-09-27

    A sequence around the start codon of the mRNA of human thymidylate synthase (TS) folds into a secondary-structure motif in which the initiation site is sequestered in a metastable hairpin. Binding of the protein to its own mRNA at the hairpin prevents the production of TS through a translation-repression feedback mechanism. Stabilization of the mRNA hairpin by other ligands has been proposed as a strategy to reduce TS levels in anticancer therapy. Rapidly proliferating cells require high TS activity to maintain the production of thymidine as a building block for DNA synthesis. The crystal structure of a model oligonucleotide (TS1) that represents the TS-binding site of the mRNA has been determined. While fluorescence studies showed that the TS1 RNA preferentially adopts a hairpin structure in solution, even at high RNA concentrations, an asymmetric dimer of two hybridized TS1 strands was obtained in the crystal. The TS1 dimer contains an unusual S-turn motif that also occurs in the 'off' state of the human ribosomal decoding site RNA.

  15. Identification of a non-canonical E-box motif as a regulatory element in the proximal promoter region of the apolipoprotein E gene.

    PubMed Central

    Salero, Enrique; Giménez, Cecilio; Zafra, Francisco

    2003-01-01

    We have used the yeast one-hybrid system to identify transcription factors with binding capability to specific sequences in proximal regions of the apolipoprotein E gene ( APOE ) promoter. The sequence between -113 and -80 nt, which contains regulatory elements in various cell types, was used as a bait to screen a human brain cDNA library. Four cDNA clones that encoded portions of the human upstream-stimulatory-factor (USF) transcription factor were isolated. Electrophoretic-mobility-shift assays ('EMSAs') using nuclear extracts from various human cell lines as well as from rat brain and liver revealed the formation of two DNA-protein complexes within the sequence CACCTCGTGAC (region -101/-91 of the APOE promoter) that show similarity to the E-box element. The retarded complexes contained USF1, as deduced from competition and supershift assays. Functional experiments using different APOE promoter-luciferase reporter constructs transiently transfected into U87, HepG2 or HeLa cell lines showed that mutations that precluded the formation of complexes decreased the basal activity of the promoter by about 50%. Overexpression of USF1 in U87 glioblastoma cells led to an increased activity of the promoter that was partially mediated by the atypical E-box. The stimulatory effect of USF1 was cell-type specific, as it was not observed in hepatoma HepG2 cells. Similarly, overexpression of a USF1 dominant-negative mutant decreased the basal activity of the promoter in glioblastoma, but not in hepatoma, cells. These data indicated that USF, and probably other related transcription factors, might be involved in the basal transcriptional machinery of APOE by binding to a non-canonical E-box motif within the proximal promoter. PMID:12444925

  16. Germ line and embryonic expression of Fex, a member of the Drosophila F-element retrotransposon family, is mediated by an internal cis-regulatory control region.

    PubMed Central

    Kerber, B; Fellert, S; Taubert, H; Hoch, M

    1996-01-01

    The F elements of Drosophila melanogaster belong to the superfamily of long interspersed nucleotide element retrotransposons. To date, F-element transcription has not been detected in flies. Here we describe the isolation of a member of the F-element family, termed Fex, which is transcribed in specific cells of the female and male germ lines and in various tissues during embryogenesis of D. melanogaster. Sequence analysis revealed that this element contains two complete open reading frames coding for a putative nucleic acid-binding protein and a putative reverse transcriptase. Functional analysis of the 5' region, using germ line transformation of Fex-lacZ reporter gene constructs, demonstrates that major aspects of tissue-specific Fex expression are controlled by internal cis-acting elements that lie in the putative coding region of open reading frame 1. These sequences mediate dynamic gene expression in eight expression domains during embryonic and germ line development. The capacity of the cis-regulatory region of the Fex element to mediate such complex expression patterns is unique among members of the long interspersed nucleotide element superfamily of retrotransposons and is reminiscent of regulatory regions of developmental control genes. PMID:8649411

  17. VISUAL ELEMENTS OF SUBJECTIVE PREFERENCE MODULATE AMYGDALA ACTIVATION

    PubMed Central

    Bar, Moshe; Neta, Maital

    2010-01-01

    What are the basic visual cues that determine our preference towards mundane everyday objects? We previously showed that a highly potent cue is the nature of the object’s contour: people generally like objects with a curved contour compared with objects that have pointed features and a sharp-angled contour. This bias is hypothesized here to stem from an implicit perception of potential threat conveyed by sharp elements. Using human neuroimaging to test this hypothesis, we report that the amygdala, a brain structure that is involved in fear processing and has been shown to exhibit activation level that is proportional to arousal in general, is significantly more active for everyday sharp objects (e.g., a sofa with sharp corners) compared with their curved-contour counterparts. Therefore, our results indicate that a preference bias towards a visual object can be induced by low-level perceptual properties, independent of semantic meaning, via visual elements that on some level could be associated with threat. We further present behavioral results that provide initial support for the link between the sharpness of the contour and threat perception. Our brains might be organized to extract these basic contour elements rapidly for deriving an early warning signal in the presence of potential danger. PMID:17462678

  18. Allowance trading activity and state regulatory rulings: Evidence from the US Acid Rain Program

    SciTech Connect

    Bailey, E.M.

    1997-12-31

    The US Acid Rain Program is one of the first, and by far the most extensive, applications of a market based approach to pollution control. From the beginning, there has been concern whether utilities would participate in allowance trading, and whether regulatory activity at the state level would further complicate utilities` decision to trade allowances. This paper finds that public utility commission regulation has encouraged allowance trading activity in states with regulatory rulings, but that allowance trading activity has not been limited to states issuing regulations. Until there is evidence suggesting that significant additional cost savings could have been obtained if additional allowance trading activity had occurred in states without regulations or that utilities in states with regulations are still not taking advantage of all cost saving trading opportunities, this analysis suggests that there is little reason to believe that allowance trading activity is impeded by public utility commission regulations.

  19. Transition Metals Catalyzed Element-Cyano Bonds Activations

    PubMed Central

    Wang, Rui; Falck, John R.

    2014-01-01

    Cyano group as a versatile functionalized intermediate has been explored for several decades, as it readily transfers to many useful functionalization groups such as amine, amide, acid, etc., which make it possess high popularization and use value in organic synthesis. Reactions involved with element-cyano bond cleavage can provide not only a new cyano group but also a freshly functionalized skeleton in one-pot, consequently making it of high importance. The highlights reviewed herein include H-CN, Si-CN, C-CN, B-CN, Sn-CN, Ge-CN, S-CN, Halo-CN, N-CN, and O-CN bonds cleavages and will summarize progress in such an important research area. This review article will focus on transition metal catalyzed reactions involving element-cyano bond activation. PMID:25558119

  20. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki

    2005-01-01

    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  1. Combining Hi-C data with phylogenetic correlation to predict the target genes of distal regulatory elements in human genome

    PubMed Central

    Lu, Yulan; Zhou, Yuanpeng; Tian, Weidong

    2013-01-01

    Defining the target genes of distal regulatory elements (DREs), such as enhancer, repressors and insulators, is a challenging task. The recently developed Hi-C technology is designed to capture chromosome conformation structure by high-throughput sequencing, and can be potentially used to determine the target genes of DREs. However, Hi-C data are noisy, making it difficult to directly use Hi-C data to identify DRE–target gene relationships. In this study, we show that DREs–gene pairs that are confirmed by Hi-C data are strongly phylogenetic correlated, and have thus developed a method that combines Hi-C read counts with phylogenetic correlation to predict long-range DRE–target gene relationships. Analysis of predicted DRE–target gene pairs shows that genes regulated by large number of DREs tend to have essential functions, and genes regulated by the same DREs tend to be functionally related and co-expressed. In addition, we show with a couple of examples that the predicted target genes of DREs can help explain the causal roles of disease-associated single-nucleotide polymorphisms located in the DREs. As such, these predictions will be of importance not only for our understanding of the function of DREs but also for elucidating the causal roles of disease-associated noncoding single-nucleotide polymorphisms. PMID:24003029

  2. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode-inducible synthetic promoters.

    PubMed

    Liu, Wusheng; Mazarei, Mitra; Peng, Yanhui; Fethe, Michael H; Rudis, Mary R; Lin, Jingyu; Millwood, Reginald J; Arelli, Prakash R; Stewart, Charles Neal

    2014-10-01

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co-expressed soybean genes that were selected from six reported microarray studies involving a compatible soybean-SCN interaction. A total of 116 overlapping motif regions (OMRs) were discovered bioinformatically that were identified by at least four out of seven bioinformatic tools. Using synthetic promoters, the inducibility of each OMR or motif itself was evaluated by co-localization of gain of function of an orange fluorescent protein reporter and the presence of SCN in transgenic soybean hairy roots. Among 16 OMRs detected from two experimentally confirmed SCN-inducible promoters, 11 OMRs (i.e. 68.75%) were experimentally confirmed to be SCN-inducible, leading to the discovery of 23 core motifs of 5- to 7-bp length, of which 14 are novel in plants. We found that a combination of the three best tools (i.e. SCOPE, W-AlignACE and Weeder) could detect all 23 core motifs. Thus, this strategy is a high-throughput approach for de novo motif discovery in soybean and offers great potential for novel motif discovery and synthetic promoter engineering for any plant and trait in crop biotechnology. PMID:24893752

  3. Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element

    PubMed Central

    Wang, Lizheng; Wang, Zixuan; Zhang, Fangfang; Zhu, Rui; Bi, Jinpeng; Wu, Jiaxin; Zhang, Haihong; Wu, Hui; Kong, Wei; Yu, Bin; Yu, Xianghui

    2016-01-01

    Adeno-associated virus (AAV) vectors have been utilized extensively in gene therapy and gene function studies, as strong transgene expression is a prerequisite for positive outcomes. AAV8 was reported as the most efficient AAV serotype for transduction of the liver, brain and muscle compared with other serotypes. However, AAV8-mediated transduction of human hepatocytes is rather poor with approximately 20-fold lower efficiency compared with that of mouse hepatocytes. Therefore, we applied the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) to enhance AAV8-mediated transgene expression driven by a combination promoter (CAG promoter) with a CMV-IE enhancer and chicken beta-actin promoter for a more efficient viral vector. Transgene expression from recombinant AAV8 (rAAV8) vectors harboring a red fluorescent protein (RFP) reporter gene with or without WPRE were evaluated in vitro and in vivo. The results demonstrated that WPRE improved AAV8-mediated RFP expression in different cell lines with clear increases of transgene expression in the liver, brain or muscle of animals. The findings of this study will help to substantially reduce the quantity of viral particles that must be injected in order to reach a therapeutic level of transgene expression in gene therapy. Consequently, such dose reductions may lessen the potential risks associated with high doses of viral vectors. PMID:27076785

  4. EPA ACTIVITIES TO PREPARE FOR REGULATORY AND RISK ASSESSMENT APPLICATIONS OF GENOMICS INFORMATION

    EPA Science Inventory

    Genomics will have significant implications for risk assessment and regulatory decision making. Since 2002, the U.S. EPA has undertaken a number of cross-Agency activities to further prepare itself to receive,interpret and apply genomics information for risk assessment and regul...

  5. Matching Element Symbols with State Abbreviations: A Fun Activity for Browsing the Periodic Table of Chemical Elements

    ERIC Educational Resources Information Center

    Woelk, Klaus

    2009-01-01

    A classroom activity is presented in which students are challenged to find matches between the United States two-letter postal abbreviations for states and chemical element symbols. The activity aims to lessen negative apprehensions students might have when the periodic table of the elements with its more than 100 combinations of letters is first…

  6. A chimeric tyrosine/tryptophan hydroxylase. The tyrosine hydroxylase regulatory domain serves to stabilize enzyme activity.

    PubMed

    Mockus, S M; Kumer, S C; Vrana, K E

    1997-08-01

    The neurotransmitter biosynthetic enzymes, tyrosine hydroxylase (TH), and tryptophan hydroxylase (TPH) are each composed of an amino-terminal regulatory domain and a carboxyl-terminal catalytic domain. A chimeric hydroxylase was generated by coupling the regulatory domain of TH (TH-R) to the catalytic domain of TPH (TPH-C) and expressing the recombinant enzyme in bacteria. The chimeric junction was created at proline 165 in TH and proline 106 in TPH because this residue is within a conserved five amino-acid span (ValProTrpPhePro) that defines the beginning of the highly homologous catalytic domains of TH and TPH. Radioenzymatic activity assays demonstrated that the TH-R/TPH-C chimera hydroxylates tryptophan, but not tyrosine. Therefore, the regulatory domain does not confer substrate specificity. Although the TH-R/TPH-C enzyme did serve as a substrate for protein kinase (PKA), activation was not observed following phosphorylation. Phosphorylation studies in combination with kinetic data provided evidence that TH-R does not exert a dominant influence on TPH-C. Stability assays revealed that, whereas TH exhibited a t1/2 of 84 min at 37 degrees C, TPH was much less stable (t1/2 = 28.3 min). The stability profile of TH-R/TPH-C, however, was superimposable on that of TH. Removal of the regulatory domain (a deletion of 165 amino acids from the N-terminus) of TH rendered the catalytic domain highly unstable, as demonstrated by a t1/2 of 14 min. The authors conclude that the regulatory domain of TH functions as a stabilizer of enzyme activity. As a corollary, the well-characterized instability of TPH may be attributed to the inability of its regulatory domain to stabilize the catalytic domain. PMID:9356925

  7. Governing effect of regulatory proteins for Cl(-)/HCO3(-) exchanger 2 activity.

    PubMed

    Jeong, Yon Soo; Hong, Jeong Hee

    2016-05-01

    Anion exchanger 2 (AE2) has a critical role in epithelial cells and is involved in the ionic homeostasis such as Cl(-) uptake and HCO3(-) secretion. However, little is known about the regulatory mechanism of AE2. The main goal of the present study was to investigate potential regulators, such as spinophilin (SPL), inositol-1,4,5-trisphosphate [IP3] receptors binding protein released with IP3 (IRBIT), STE20/SPS1-related proline/alanine-rich kinase (SPAK) kinase, and carbonic anhydrase XII (CA XII). We found that SPL binds to AE2 and markedly increased the Cl(-)/HCO3(-) exchange activity of AE2. Especially SPL 1-480 domain is required for enhancing AE2 activity. For other regulatory components that affect the fidelity of fluid and HCO3(-) secretion, IRBIT and SPAK had no effect on the activity of AE2 and no protein-protein interaction with AE2. It has been proposed that CA activity is closely associated with AE activity. In this study, we provide evidence that the basolateral membrane-associated CA isoform CA XII significantly increased the activity of AE2 and co-localized with AE2 to the plasma membrane. Collectively, SPL and CA XII enhanced the Cl(-)/HCO3(-) exchange activity of AE2. The modulating action of these regulatory proteins could serve as potential therapeutic targets for secretory diseases mediated by AE2. PMID:26716707

  8. Bacterial Manipulation of NK Cell Regulatory Activity Increases Susceptibility to Listeria monocytogenes Infection

    PubMed Central

    Guthrie, Brandon S.; Schmidt, Rebecca L.; Jamieson, Amanda; Merkel, Patricia; Knight, Vijaya; Cole, Caroline M.; Raulet, David H.; Lenz, Laurel L.

    2016-01-01

    Natural killer (NK) cells produce interferon (IFN)-γ and thus have been suggested to promote type I immunity during bacterial infections. Yet, Listeria monocytogenes (Lm) and some other pathogens encode proteins that cause increased NK cell activation. Here, we show that stimulation of NK cell activation increases susceptibility during Lm infection despite and independent from robust NK cell production of IFNγ. The increased susceptibility correlated with IL-10 production by responding NK cells. NK cells produced IL-10 as their IFNγ production waned and the Lm virulence protein p60 promoted induction of IL-10 production by mouse and human NK cells. NK cells consequently exerted regulatory effects to suppress accumulation and activation of inflammatory myeloid cells. Our results reveal new dimensions of the role played by NK cells during Lm infection and demonstrate the ability of this bacterial pathogen to exploit the induction of regulatory NK cell activity to increase host susceptibility. PMID:27295349

  9. Bacterial Manipulation of NK Cell Regulatory Activity Increases Susceptibility to Listeria monocytogenes Infection.

    PubMed

    Clark, Sarah E; Filak, Holly C; Guthrie, Brandon S; Schmidt, Rebecca L; Jamieson, Amanda; Merkel, Patricia; Knight, Vijaya; Cole, Caroline M; Raulet, David H; Lenz, Laurel L

    2016-06-01

    Natural killer (NK) cells produce interferon (IFN)-γ and thus have been suggested to promote type I immunity during bacterial infections. Yet, Listeria monocytogenes (Lm) and some other pathogens encode proteins that cause increased NK cell activation. Here, we show that stimulation of NK cell activation increases susceptibility during Lm infection despite and independent from robust NK cell production of IFNγ. The increased susceptibility correlated with IL-10 production by responding NK cells. NK cells produced IL-10 as their IFNγ production waned and the Lm virulence protein p60 promoted induction of IL-10 production by mouse and human NK cells. NK cells consequently exerted regulatory effects to suppress accumulation and activation of inflammatory myeloid cells. Our results reveal new dimensions of the role played by NK cells during Lm infection and demonstrate the ability of this bacterial pathogen to exploit the induction of regulatory NK cell activity to increase host susceptibility. PMID:27295349

  10. Active control of multi-element rotor blade airfoils

    NASA Technical Reports Server (NTRS)

    Torok, Michael S. (Inventor); Moffitt, Robert C. (Inventor); Bagai, Ashish (Inventor)

    2005-01-01

    A multi-element rotor blade includes an individually controllable main element and fixed aerodynamic surface in an aerodynamically efficient location relative to the main element. The main element is controlled to locate the fixed aerodynamic surface in a position to increase lift and/or reduce drag upon the main element at various azimuthal positions during rotation.

  11. Hoxa5 gene regulation: A gradient of binding activity to a brachial spinal cord element.

    PubMed

    Nowling, T; Zhou, W; Krieger, K E; Larochelle, C; Nguyen-Huu, M C; Jeannotte, L; Tuggle, C K

    1999-04-01

    The Hox genes cooperate in providing positional information needed for spatial and temporal patterning of the vertebrate body axis. However, the biological mechanisms behind spatial Hox expression are largely unknown. In transgenic mice, gene fusions between Hoxa5 (previously called Hox-1.3) 5' flanking regions and the lacZ reporter gene show tissue- and time-specific expression in the brachial spinal cord in day 11-13 embryos. A 604-bp regulatory region with enhancer properties directs this spatially specific expression. Fine-detail mapping of the enhancer has identified several elements involved in region-specific expression, including an element required for expression in the brachial spinal cord. Factors in embryonic day 12.5 nuclear extracts bind this element in electrophoretic mobility shift assays (EMSA) and protect three regions from DNase digestion. All three sites contain an AAATAA sequence and mutations at these sites reduce or abolish binding. Furthermore, this element binds specific individual embryonic proteins on a protein blot. The binding activity appears as a gradient along the anterior-posterior axis with two- to threefold higher levels observed in extracts from anterior regions than from posterior regions. In parallel with the EMSA, the proteins on the protein blot also show reduced binding to probes with mutations at the AAATAA sites. Most importantly, transgenic mice carrying Hoxa5/lacZ fusions with the three AAATAA sites mutated either do not express the transgene or have altered transgene expression. The brachial spinal cord element and its binding proteins are likely to be involved in spatial expression of Hoxa5 during development. PMID:10075847

  12. Nuclear Thermal Rocket Element Environmental Simulator (NTREES) Upgrade Activities

    NASA Technical Reports Server (NTRS)

    Emrich, William J., Jr.

    2014-01-01

    Over the past year the Nuclear Thermal Rocket Element Environmental Simulator (NTREES) has been undergoing a significant upgrade beyond its initial configuration. The NTREES facility is designed to perform realistic non-nuclear testing of nuclear thermal rocket (NTR) fuel elements and fuel materials. Although the NTREES facility cannot mimic the neutron and gamma environment of an operating NTR, it can simulate the thermal hydraulic environment within an NTR fuel element to provide critical information on material performance and compatibility. The first phase of the upgrade activities which was completed in 2012 in part consisted of an extensive modification to the hydrogen system to permit computer controlled operations outside the building through the use of pneumatically operated variable position valves. This setup also allows the hydrogen flow rate to be increased to over 200 g/sec and reduced the operation complexity of the system. The second stage of modifications to NTREES which has just been completed expands the capabilities of the facility significantly. In particular, the previous 50 kW induction power supply has been replaced with a 1.2 MW unit which should allow more prototypical fuel element temperatures to be reached. The water cooling system was also upgraded to so as to be capable of removing 100% of the heat generated during. This new setup required that the NTREES vessel be raised onto a platform along with most of its associated gas and vent lines. In this arrangement, the induction heater and water systems are now located underneath the platform. In this new configuration, the 1.2 MW NTREES induction heater will be capable of testing fuel elements and fuel materials in flowing hydrogen at pressures up to 1000 psi at temperatures up to and beyond 3000 K and at near-prototypic reactor channel power densities. NTREES is also capable of testing potential fuel elements with a variety of propellants, including hydrogen with additives to inhibit

  13. Protein phosphatase 2A regulatory subunit B56α limits phosphatase activity in the heart.

    PubMed

    Little, Sean C; Curran, Jerry; Makara, Michael A; Kline, Crystal F; Ho, Hsiang-Ting; Xu, Zhaobin; Wu, Xiangqiong; Polina, Iuliia; Musa, Hassan; Meadows, Allison M; Carnes, Cynthia A; Biesiadecki, Brandon J; Davis, Jonathan P; Weisleder, Noah; Györke, Sandor; Wehrens, Xander H; Hund, Thomas J; Mohler, Peter J

    2015-07-21

    Protein phosphatase 2A (PP2A) is a serine/threonine-selective holoenzyme composed of a catalytic, scaffolding, and regulatory subunit. In the heart, PP2A activity is requisite for cardiac excitation-contraction coupling and central in adrenergic signaling. We found that mice deficient in the PP2A regulatory subunit B56α (1 of 13 regulatory subunits) had altered PP2A signaling in the heart that was associated with changes in cardiac physiology, suggesting that the B56α regulatory subunit had an autoinhibitory role that suppressed excess PP2A activity. The increase in PP2A activity in the mice with reduced B56α expression resulted in slower heart rates and increased heart rate variability, conduction defects, and increased sensitivity of heart rate to parasympathetic agonists. Increased PP2A activity in B56α(+/-) myocytes resulted in reduced Ca(2+) waves and sparks, which was associated with decreased phosphorylation (and thus decreased activation) of the ryanodine receptor RyR2, an ion channel on intracellular membranes that is involved in Ca(2+) regulation in cardiomyocytes. In line with an autoinhibitory role for B56α, in vivo expression of B56α in the absence of altered abundance of other PP2A subunits decreased basal phosphatase activity. Consequently, in vivo expression of B56α suppressed parasympathetic regulation of heart rate and increased RyR2 phosphorylation in cardiomyocytes. These data show that an integral component of the PP2A holoenzyme has an important inhibitory role in controlling PP2A enzyme activity in the heart. PMID:26198358

  14. Aluminum: a requirement for activation of the regulatory component of adenylate cyclase by fluoride.

    PubMed Central

    Sternweis, P C; Gilman, A G

    1982-01-01

    Activation of the purified guanine nucleotide-binding regulatory component (G/F) of adenylate cyclase by F- requires the presence of Mg2+ and another factor. This factor, which contaminates commercial preparations of various nucleotides and disposable glass test tubes, has been identified as Al3+. In the presence of 10 mM Mg2+ and 5 mM F-, AlCl3 causes activation of G/F with an apparent activation constant of approximately 1-5 muM. The requirement for Al3+ is highly specific; of 28 other metals tested, only Be2+ promoted activation of G/F by F-. PMID:6289322

  15. Tempo and Mode of Transposable Element Activity in Drosophila

    PubMed Central

    Kofler, Robert; Nolte, Viola; Schlötterer, Christian

    2015-01-01

    The evolutionary dynamics of transposable element (TE) insertions have been of continued interest since TE activity has important implications for genome evolution and adaptation. Here, we infer the transposition dynamics of TEs by comparing their abundance in natural D. melanogaster and D. simulans populations. Sequencing pools of more than 550 South African flies to at least 320-fold coverage, we determined the genome wide TE insertion frequencies in both species. We suggest that the predominance of low frequency insertions in the two species (>80% of the insertions have a frequency <0.2) is probably due to a high activity of more than 58 families in both species. We provide evidence for 50% of the TE families having temporally heterogenous transposition rates with different TE families being affected in the two species. While in D. melanogaster retrotransposons were more active, DNA transposons showed higher activity levels in D. simulans. Moreover, we suggest that LTR insertions are mostly of recent origin in both species, while DNA and non-LTR insertions are older and more frequently vertically transmitted since the split of D. melanogaster and D. simulans. We propose that the high TE activity is of recent origin in both species and a consequence of the demographic history, with habitat expansion triggering a period of rapid evolution. PMID:26186437

  16. Cellular localization of the embryo-specific hybrid PRP from Zea mays, and characterization of promoter regulatory elements of its gene.

    PubMed

    Jose-Estanyol, M; Puigdomènech, P

    2012-10-01

    The expression, regulation and cellular localization of ZmHyPRP, a gene marker of embryo differentiation whose expression declines after ABA induction, was studied. ZmHyPRP is a proline-rich protein with a C-terminal domain having eight cysteines in a CM8 pattern. Transient expression in onion epidermal cells, transformed with a 2x35S::ZmHyPRP-GFP construction, indicated the protein is present in vesicles lining the membrane of the cell. The ZmHyPRP gene expression is under the control of classic promoter seed-specific regulatory elements such as Sph/RY and G-boxes, suggesting regulation by B3 and b-ZIP transcription factors. Promoter deletion analysis, by particle-bombardment transient transformation of maize immature embryos with serial deletions of the promoter fused to GUS, showed the presence of two negative regulatory elements, NE1 (-2070 to -1280) and NE2 (-232 to -178), in the ZmHyPRP promoter. By selective deletion or mutation of ZmHyPRP regulatory promoter elements we conclude that the promoter expression is attenuated by the NE2 element as well as by the G-box2 and the Sph1-2 box together with the G-box2. PMID:22915319

  17. Stable inhibitory activity of regulatory T cells requires the transcription factor Helios.

    PubMed

    Kim, Hye-Jung; Barnitz, R Anthony; Kreslavsky, Taras; Brown, Flavian D; Moffett, Howell; Lemieux, Madeleine E; Kaygusuz, Yasemin; Meissner, Torsten; Holderried, Tobias A W; Chan, Susan; Kastner, Philippe; Haining, W Nicholas; Cantor, Harvey

    2015-10-16

    The maintenance of immune homeostasis requires regulatory T cells (T(regs)). Given their intrinsic self-reactivity, T(regs) must stably maintain a suppressive phenotype to avoid autoimmunity. We report that impaired expression of the transcription factor (TF) Helios by FoxP3(+) CD4 and Qa-1-restricted CD8 T(regs) results in defective regulatory activity and autoimmunity in mice. Helios-deficient T(regs) develop an unstable phenotype during inflammatory responses characterized by reduced FoxP3 expression and increased effector cytokine expression secondary to diminished activation of the STAT5 pathway. CD8 T(regs) also require Helios-dependent STAT5 activation for survival and to prevent terminal T cell differentiation. The definition of Helios as a key transcription factor that stabilizes T(regs) in the face of inflammatory responses provides a genetic explanation for a core property of T(regs). PMID:26472910

  18. The splicing regulatory element, UGCAUG, is phylogenetically and spatially conserved in introns that flank tissue-specific alternative exons

    PubMed Central

    Minovitsky, Simon; Gee, Sherry L.; Schokrpur, Shiruyeh; Dubchak, Inna; Conboy, John G.

    2005-01-01

    Previous studies have identified UGCAUG as an intron splicing enhancer that is frequently located adjacent to tissue-specific alternative exons in the human genome. Here, we show that UGCAUG is phylogenetically and spatially conserved in introns that flank brain-enriched alternative exons from fish to man. Analysis of sequence from the mouse, rat, dog, chicken and pufferfish genomes revealed a strongly statistically significant association of UGCAUG with the proximal intron region downstream of brain-enriched alternative exons. The number, position and sequence context of intronic UGCAUG elements were highly conserved among mammals and in chicken, but more divergent in fish. Control datasets, including constitutive exons and non-tissue-specific alternative exons, exhibited a much lower incidence of closely linked UGCAUG elements. We propose that the high sequence specificity of the UGCAUG element, and its unique association with tissue-specific alternative exons, mark it as a critical component of splicing switch mechanism(s) designed to activate a limited repertoire of splicing events in cell type-specific patterns. We further speculate that highly conserved UGCAUG-binding protein(s) related to the recently described Fox-1 splicing factor play a critical role in mediating this specificity. PMID:15691898

  19. Epstein-Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression.

    PubMed

    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G; Sinclair, Alison J

    2015-04-20

    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  20. Bisphenol A activates the Nrf1/2-antioxidant response element pathway in HEK 293 cells.

    PubMed

    Chepelev, Nikolai L; Enikanolaiye, Mutiat I; Chepelev, Leonid L; Almohaisen, Abdulrahman; Chen, Qixuan; Scoggan, Kylie A; Coughlan, Melanie C; Cao, Xu-Liang; Jin, Xiaolei; Willmore, William G

    2013-03-18

    Bisphenol A (BPA) is used in the production of polycarbonate plastics and epoxy resins for baby bottles, liners of canned food, and many other consumer products. Previously, BPA has been shown to reduce the activity of several antioxidant enzymes, which may contribute to oxidative stress. However, the underlying mechanism of the BPA-mediated effect upon antioxidant enzyme activity is unknown. Antioxidant and phase II metabolizing enzymes protect cells from oxidative stress and are transcriptionally activated by Nrf1 and Nrf2 factors through their cis-regulatory antioxidant response elements (AREs). In this work, we have assessed the effect of BPA on the Nrf1/2-ARE pathway in cultured human embryonic kidney (HEK) 293 cells. Surprisingly, glutathione and reactive oxygen species (ROS) assays revealed that BPA application created a more reduced intracellular environment in cultured HEK 293 cells. Furthermore, BPA increased the transactivation activity of ectopic Nrf1 and Nrf2 and increased the expression of ARE-target genes ho-1 and nqo1 at high (100-200 μM) BPA concentrations only. Our study suggests that BPA activates the Nrf1/2-ARE pathway at high (>10 μM) micromolar concentrations. PMID:23360430

  1. Aspects of the regulatory mechanisms of PPAR functions: analysis of a bidirectional response element and regulation by sumoylation.

    PubMed

    Shimizu, Makoto; Yamashita, Daisuke; Yamaguchi, Tomohiro; Hirose, Fumiko; Osumi, Takashi

    2006-06-01

    Peroxisome proliferator-activated receptors (PPARs) constitute a subfamily of nuclear receptor superfamily. A wide variety of compounds including hypolipidemic agents, antidiabetic drugs, and long-chain fatty acids are the potential ligands of PPARs. To approach the regulatory mechanisms of PPARs, we studied on two subjects in this work. First, we identified a functional PPAR-binding site in the spacer region between the PEX11alpha and perilipin genes, which are arranged in tandem on the mouse genome. By gene reporter assays and in vivo as well as in vitro binding assays, we show that these genes are regulated tissue-selectively through this common binding site: The PEX11alpha gene is activated by PPARalpha in the liver, whereas the perilipin gene by PPARgamma in the adipose tissue. As the second subject, we found that PPARgamma2 is conjugated with small ubiquitin-related modifier (SUMO) at a specific lysine residue in the amino-terminal region. By site-directed mutagenesis combined with gene reporter assays and sumoylation analyses, we show that sumoylation represses the ligand-independent transactivating function carried by this region, and hence negatively regulates the whole transactivating competence of PPARgamma2. In addition, phosphorylation at a specific site in the amino-terminal region represses the transactivation by PPARgamma2 possibly through enhancing sumoylation. PMID:16534556

  2. REACTIN: Regulatory activity inference of transcription factors underlying human diseases with application to breast cancer

    PubMed Central

    2013-01-01

    Background Genetic alterations of transcription factors (TFs) have been implicated in the tumorigenesis of cancers. In many cancers, alteration of TFs results in aberrant activity of them without changing their gene expression level. Gene expression data from microarray or RNA-seq experiments can capture the expression change of genes, however, it is still challenge to reveal the activity change of TFs. Results Here we propose a method, called REACTIN (REgulatory ACTivity INference), which integrates TF binding data with gene expression data to identify TFs with significantly differential activity between disease and normal samples. REACTIN successfully detect differential activity of estrogen receptor (ER) between ER+ and ER- samples in 10 breast cancer datasets. When applied to compare tumor and normal breast samples, it reveals TFs that are critical for carcinogenesis of breast cancer. Moreover, Reaction can be utilized to identify transcriptional programs that are predictive to patient survival time of breast cancer patients. Conclusions REACTIN provides a useful tool to investigate regulatory programs underlying a biological process providing the related case and control gene expression data. Considering the enormous amount of cancer gene expression data and the increasingly accumulating ChIP-seq data, we expect wide application of REACTIN for revealing the regulatory mechanisms of various diseases. PMID:23885756

  3. A G-string positive cis-regulatory element in the LpS1 promoter binds two distinct nuclear factors distributed non-uniformly in Lytechinus pictus embryos.

    PubMed

    Xiang, M; Lu, S Y; Musso, M; Karsenty, G; Klein, W H

    1991-12-01

    The LpS1 alpha and beta genes of Lytechinus pictus are activated at the late cleavage stage of embryogenesis, with LpS1 mRNAs accumulating only in lineages contributing to aboral ectoderm. We had shown previously that 762 bp of 5' flanking DNA from the LpS1 beta gene was sufficient for proper temporal and aboral ectoderm specific expression. In the present study, we identified a strong positive cis-regulatory element at -70 bp to -75 bp in the LpS1 beta promoter with the sequence (G)6 and a similar, more distal cis-element at -721 bp to -726 bp. The proximal 'G-string' element interacted with two nuclear factors, one specific to ectoderm and one to endoderm/mesoderm nuclear extracts, whereas the distal G-string element interacted only with the ectoderm factor. The ectoderm and endoderm/mesoderm G-string factors were distinct based on their migratory behavior in electrophoretic mobility shift assays, binding site specificities, salt optima and EDTA sensitivity. The proximal G-string element shared homology with a binding site for the mammalian transcription factor IF1, a protein that binds to negative cis-regulatory elements in the mouse alpha 1(I) and alpha 2(I) collagen gene promoters. Competition experiments using wild-type and mutant oligonucleotides indicated that the ectoderm G-string factor and IF1 have similar recognition sites. Partially purified IF1 specifically bound to an oligonucleotide containing the proximal G-string of LpS1 beta. From our results, we suggest that the ectoderm G-string factor, a member of the G-rich DNA-binding protein family, activates the LpS1 gene in aboral ectoderm cells by binding to the LpS1 promoter at the proximal G-string site. PMID:1811948

  4. Real-time transposable element activity in individual live cells

    PubMed Central

    Lee, Gloria; Martini, K. Michael

    2016-01-01

    The excision and reintegration of transposable elements (TEs) restructure their host genomes, generating cellular diversity involved in evolution, development, and the etiology of human diseases. Our current knowledge of TE behavior primarily results from bulk techniques that generate time and cell ensemble averages, but cannot capture cell-to-cell variation or local environmental and temporal variability. We have developed an experimental system based on the bacterial TE IS608 that uses fluorescent reporters to directly observe single TE excision events in individual cells in real time. We find that TE activity depends upon the TE’s orientation in the genome and the amount of transposase protein in the cell. We also find that TE activity is highly variable throughout the lifetime of the cell. Upon entering stationary phase, TE activity increases in cells hereditarily predisposed to TE activity. These direct observations demonstrate that real-time live-cell imaging of evolution at the molecular and individual event level is a powerful tool for the exploration of genome plasticity in stressed cells. PMID:27298350

  5. Real-time transposable element activity in individual live cells.

    PubMed

    Kim, Neil H; Lee, Gloria; Sherer, Nicholas A; Martini, K Michael; Goldenfeld, Nigel; Kuhlman, Thomas E

    2016-06-28

    The excision and reintegration of transposable elements (TEs) restructure their host genomes, generating cellular diversity involved in evolution, development, and the etiology of human diseases. Our current knowledge of TE behavior primarily results from bulk techniques that generate time and cell ensemble averages, but cannot capture cell-to-cell variation or local environmental and temporal variability. We have developed an experimental system based on the bacterial TE IS608 that uses fluorescent reporters to directly observe single TE excision events in individual cells in real time. We find that TE activity depends upon the TE's orientation in the genome and the amount of transposase protein in the cell. We also find that TE activity is highly variable throughout the lifetime of the cell. Upon entering stationary phase, TE activity increases in cells hereditarily predisposed to TE activity. These direct observations demonstrate that real-time live-cell imaging of evolution at the molecular and individual event level is a powerful tool for the exploration of genome plasticity in stressed cells. PMID:27298350

  6. A genome-wide analysis of open chromatin in human epididymis epithelial cells reveals candidate regulatory elements for genes coordinating epididymal function.

    PubMed

    Bischof, Jared M; Gillen, Austin E; Song, Lingyun; Gosalia, Nehal; London, Darin; Furey, Terrence S; Crawford, Gregory E; Harris, Ann

    2013-10-01

    The epithelium lining the epididymis has a pivotal role in ensuring a luminal environment that can support normal sperm maturation. Many of the individual genes that encode proteins involved in establishing the epididymal luminal fluid are well characterized. They include ion channels, ion exchangers, transporters, and solute carriers. However, the molecular mechanisms that coordinate expression of these genes and modulate their activities in response to biological stimuli are less well understood. To identify cis-regulatory elements for genes expressed in human epididymis epithelial cells, we generated genome-wide maps of open chromatin by DNase-seq. This analysis identified 33,542 epididymis-selective DNase I hypersensitive sites (DHS), which were not evident in five cell types of different lineages. Identification of genes with epididymis-selective DHS at their promoters revealed gene pathways that are active in immature epididymis epithelial cells. These include processes correlating with epithelial function and also others with specific roles in the epididymis, including retinol metabolism and ascorbate and aldarate metabolism. Peaks of epididymis-selective chromatin were seen in the androgen receptor gene and the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which has a critical role in regulating ion transport across the epididymis epithelium. In silico prediction of transcription factor binding sites that were overrepresented in epididymis-selective DHS identified epithelial transcription factors, including ELF5 and ELF3, the androgen receptor, Pax2, and Sox9, as components of epididymis transcriptional networks. Active genes, which are targets of each transcription factor, reveal important biological processes in the epididymis epithelium. PMID:24006278

  7. Sequential activation and distinct functions for distal and proximal modules within the IgH 3′ regulatory region

    PubMed Central

    Garot, Armand; Marquet, Marie; Saintamand, Alexis; Bender, Sébastien; Le Noir, Sandrine; Rouaud, Pauline; Carrion, Claire; Oruc, Zéliha; Bébin, Anne-Gaëlle; Moreau, Jeanne; Lebrigand, Kevin; Denizot, Yves; Alt, Frederick W.; Cogné, Michel; Pinaud, Eric

    2016-01-01

    As a master regulator of functional Ig heavy chain (IgH) expression, the IgH 3′ regulatory region (3′RR) controls multiple transcription events at various stages of B-cell ontogeny, from newly formed B cells until the ultimate plasma cell stage. The IgH 3′RR plays a pivotal role in early B-cell receptor expression, germ-line transcription preceding class switch recombination, interactions between targeted switch (S) regions, variable region transcription before somatic hypermutation, and antibody heavy chain production, but the functional ranking of its different elements is still inaccurate, especially that of its evolutionarily conserved quasi-palindromic structure. By comparing relevant previous knockout (KO) mouse models (3′RR KO and hs3b-4 KO) to a novel mutant devoid of the 3′RR quasi-palindromic region (3′PAL KO), we pinpointed common features and differences that specify two distinct regulatory entities acting sequentially during B-cell ontogeny. Independently of exogenous antigens, the 3′RR distal part, including hs4, fine-tuned B-cell receptor expression in newly formed and naïve B-cell subsets. At mature stages, the 3′RR portion including the quasi-palindrome dictated antigen-dependent locus remodeling (global somatic hypermutation and class switch recombination to major isotypes) in activated B cells and antibody production in plasma cells. PMID:26831080

  8. Multiple single-stranded cis elements are associated with activated chromatin of the human c-myc gene in vivo.

    PubMed Central

    Michelotti, G A; Michelotti, E F; Pullner, A; Duncan, R C; Eick, D; Levens, D

    1996-01-01

    Transcription activation and repression of eukaryotic genes are associated with conformational and topological changes of the DNA and chromatin, altering the spectrum of proteins associated with an active gene. Segments of the human c-myc gene possessing non-B structure in vivo located with enzymatic and chemical probes. Sites hypertensive to cleavage with single-strand-specific S1 nuclease or the single-strand-selective agent potassium permanganate included the major promoters P1 and P2 as well as the far upstream sequence element (FUSE) and CT elements, which bind, respectively, the single-strand-specific factors FUSE-binding protein and heterogeneous nuclear ribonucleoprotein K in vitro. Active and inactive c-myc genes yielded different patterns of S1 nuclease and permanganate sensitivity, indicating alternative chromatin configurations of active and silent genes. The melting of specific cis elements of active c-myc genes in vivo suggested that transcriptionally associated torsional strain might assist strand separation and facilitate factor binding. Therefore, the interaction of FUSE-binding protein and heterogeneous nuclear ribonucleoprotein K with supercoiled DNA was studied. Remarkably, both proteins recognize their respective elements torsionally strained but not as liner duplexes. Single-strand- or supercoil-dependent gene regulatory proteins may directly link alterations in DNA conformation and topology with changes in gene expression. PMID:8649373

  9. A Hyperactive Transposase of the Maize Transposable Element Activator (Ac)

    PubMed Central

    Lazarow, Katina; Du, My-Linh; Weimer, Ruth; Kunze, Reinhard

    2012-01-01

    Activator/Dissociation (Ac/Ds) transposable elements from maize are widely used as insertional mutagenesis and gene isolation tools in plants and more recently also in medaka and zebrafish. They are particularly valuable for plant species that are transformation-recalcitrant and have long generation cycles or large genomes with low gene densities. Ac/Ds transposition frequencies vary widely, however, and in some species they are too low for large-scale mutagenesis. We discovered a hyperactive Ac transposase derivative, AcTPase4x, that catalyzes in the yeast Saccharomyces cerevisiae 100-fold more frequent Ds excisions than the wild-type transposase, whereas the reintegration frequency of excised Ds elements is unchanged (57%). Comparable to the wild-type transposase in plants, AcTPase4x catalyzes Ds insertion preferentially into coding regions and to genetically linked sites, but the mutant protein apparently has lost the weak bias of the wild-type protein for insertion sites with elevated guanine–cytosine content and nonrandom protein-DNA twist. AcTPase4x exhibits hyperactivity also in Arabidopsis thaliana where it effects a more than sixfold increase in Ds excision relative to wild-type AcTPase and thus may be useful to facilitate Ac/Ds-based insertion mutagenesis approaches. PMID:22562933

  10. A synonymous mutation in SPINK5 exon 11 causes Netherton syndrome by altering exonic splicing regulatory elements.

    PubMed

    Fortugno, Paola; Grosso, Fabiana; Zambruno, Giovanna; Pastore, Serena; Faletra, Flavio; Castiglia, Daniele

    2012-05-01

    Netherton syndrome (NS) is a rare, life-threatening ichthyosiform syndrome caused by recessive loss-of-function mutations in SPINK5 gene encoding lymphoepithelial Kazal-type-related inhibitor (LEKTI), a serine protease inhibitor expressed in the most differentiated epidermal layers and crucial for skin barrier function. We report the functional characterization of a previously unrecognized synonymous variant, c.891C>T (p.Cys297Cys), identified in the SPINK5 exon 11 of an NS patient. We demonstrated that the c.891C>T mutation is associated with abnormal pre-mRNA splicing and residual LEKTI expression in the patient's keratinocytes. Subsequent minigene splicing assays and in silico predictions confirmed the direct role of the synonymous mutation in inhibiting exon 11 inclusion by a mechanism that involves the activity of exonic regulatory sequences, namely splicing enhancer and silencer. However, this deleterious effect was not complete and a residual amount of normal mRNA and LEKTI protein could be detected, correlating with the relatively mild patient's phenotype. Our study represents the first identification of a disease-causing SPINK5 mutation that alters splicing without affecting canonical splice sites. PMID:22377713

  11. Neutron activation analysis; A sensitive test for trace elements

    SciTech Connect

    Hossain, T.Z. . Ward Lab.)

    1992-01-01

    This paper discusses neutron activation analysis (NAA), an extremely sensitive technique for determining the elemental constituents of an unknown specimen. Currently, there are some twenty-five moderate-power TRIGA reactors scattered across the United States (fourteen of them at universities), and one of their principal uses is for NAA. NAA is procedurally simple. A small amount of the material to be tested (typically between one and one hundred milligrams) is irradiated for a period that varies from a few minutes to several hours in a neutron flux of around 10{sup 12} neutrons per square centimeter per second. A tiny fraction of the nuclei present (about 10{sup {minus}8}) is transmuted by nuclear reactions into radioactive forms. Subsequently, the nuclei decay, and the energy and intensity of the gamma rays that they emit can be measured in a gamma-ray spectrometer.

  12. Current California legislative and regulatory activity impacting geothermal hydrothermal commercialization: a monitoring report. Report No. 1017

    SciTech Connect

    Not Available

    1980-01-20

    Four key geothermal-impacting bills presently before the California legislature are described. Two deal with state financial backing for geothermal projects. The third relates to the use of the state's share of the BLM geothermal revenues and the fourth to the protection of sensitive hot springs. The current regulatory activities of the California Energy Commission, the California Division of Oil and Gas, and the counties are discussed. (MHR)

  13. Regulatory guidance document

    SciTech Connect

    1994-05-01

    The Office of Civilian Radioactive Waste Management (OCRWM) Program Management System Manual requires preparation of the OCRWM Regulatory Guidance Document (RGD) that addresses licensing, environmental compliance, and safety and health compliance. The document provides: regulatory compliance policy; guidance to OCRWM organizational elements to ensure a consistent approach when complying with regulatory requirements; strategies to achieve policy objectives; organizational responsibilities for regulatory compliance; guidance with regard to Program compliance oversight; and guidance on the contents of a project-level Regulatory Compliance Plan. The scope of the RGD includes site suitability evaluation, licensing, environmental compliance, and safety and health compliance, in accordance with the direction provided by Section 4.6.3 of the PMS Manual. Site suitability evaluation and regulatory compliance during site characterization are significant activities, particularly with regard to the YW MSA. OCRWM`s evaluation of whether the Yucca Mountain site is suitable for repository development must precede its submittal of a license application to the Nuclear Regulatory Commission (NRC). Accordingly, site suitability evaluation is discussed in Chapter 4, and the general statements of policy regarding site suitability evaluation are discussed in Section 2.1. Although much of the data and analyses may initially be similar, the licensing process is discussed separately in Chapter 5. Environmental compliance is discussed in Chapter 6. Safety and Health compliance is discussed in Chapter 7.

  14. Interaction between Major Nitrogen Regulatory Protein NIT2 and Pathway-Specific Regulatory Factor NIT4 Is Required for Their Synergistic Activation of Gene Expression in Neurospora crassa

    PubMed Central

    Feng, Bo; Marzluf, George A.

    1998-01-01

    In Neurospora crassa, the major nitrogen regulatory protein, NIT2, a member of the GATA family of transcription factors, controls positively the expression of numerous genes which specify nitrogen catabolic enzymes. Expression of the highly regulated structural gene nit-3, which encodes nitrate reductase, is dependent upon a synergistic interaction of NIT2 with a pathway-specific control protein, NIT4, a member of the GAL4 family of fungal regulatory factors. The NIT2 and NIT4 proteins both bind at specific recognition elements in the nit-3 promoter, but, in addition, we show that a direct protein-protein interaction between NIT2 and NIT4 is essential for optimal expression of the nit-3 structural gene. Neurospora possesses at least five different GATA factors which control different areas of cellular function, but which have a similar DNA binding specificity. Significantly, only NIT2, of the several Neurospora GATA factors examined, interacts with NIT4. We propose that protein-protein interactions of the individual GATA factors with additional pathway-specific regulatory factors determine each of their specific regulatory functions. PMID:9632783

  15. Structured RNA upstream of insect cap distal iron responsive elements enhances iron regulatory protein-mediated control of translation.

    PubMed

    Nichol, Helen; Winzerling, Joy

    2002-12-01

    Iron regulatory protein (IRP) blocks ribosomal assembly by binding to an iron responsive element (IRE) located proximal (<60 nts) to the mRNA cap, thereby repressing translation. Constructs with IREs located 60-100 nts from the cap permit ribosomal assembly but the ribosomes pause at IRE/IRP complexes resulting in partial repression of translation. However, insect ferritin mRNAs have cap-distal IREs located 90-156 nts from the cap. Because iron can be toxic, it seems unlikely that insects would be unable to fully regulate ferritin synthesis at the level of translation. Calpodes ferritin consists of two subunits, S and G. In vitro translation of Calpodes ferritin and IRP1 from fat body mRNA yields only G subunits suggesting that IRP1 more efficiently represses translation of the S subunit than the G. When repression is removed by the addition of IRE competitor RNA, the synthesis of both subunits is greatly increased. S and G ferritin mRNAs have identical IREs in similar far cap-distal positions. While both ferritin mRNAs are predicted to have stem-loops between the IRE and the RNA cap, in general insect S mRNAs have more cap-proximal RNA structure than G mRNAs. Therefore, we examined the effect of upstream secondary structure on ribosomal assembly onto S ferritin mRNA constructs using sucrose gradient analysis of translation initiation complexes. We found no evidence for ribosomal assembly on wild type Calpodes S ferritin mRNA in the presence of IRP1 while constructs lacking the wild type secondary structure showed ribosomal pausing. Constructs with wild type secondary structure preceded by an unstructured upstream leader assemble ribosomes in the presence or absence of IRP1. Sequence and RNA folding analyses of other insect ferritins with cap-distal IREs failed to identify any common sequences or IRE-like structures that might bind to IRP1 with lower affinity or to another RNA binding protein. We propose that stem-loops upstream from the IRE act like pleats that

  16. The Amino Acid Specificity for Activation of Phenylalanine Hydroxylase Matches the Specificity for Stabilization of Regulatory Domain Dimers

    PubMed Central

    2016-01-01

    Liver phenylalanine hydroxylase is allosterically activated by phenylalanine. The structural changes that accompany activation have not been identified, but recent studies of the effects of phenylalanine on the isolated regulatory domain of the enzyme support a model in which phenylalanine binding promotes regulatory domain dimerization. Such a model predicts that compounds that stabilize the regulatory domain dimer will also activate the enzyme. Nuclear magnetic resonance spectroscopy and analytical ultracentrifugation were used to determine the ability of different amino acids and phenylalanine analogues to stabilize the regulatory domain dimer. The abilities of these compounds to activate the enzyme were analyzed by measuring their effects on the fluorescence change that accompanies activation and on the activity directly. At concentrations of 10–50 mM, d-phenylalanine, l-methionine, l-norleucine, and (S)-2-amino-3-phenyl-1-propanol were able to activate the enzyme to the same extent as 1 mM l-phenylalanine. Lower levels of activation were seen with l-4-aminophenylalanine, l-leucine, l-isoleucine, and 3-phenylpropionate. The ability of these compounds to stabilize the regulatory domain dimer agreed with their ability to activate the enzyme. These results support a model in which allosteric activation of phenylalanine hydroxylase is linked to dimerization of regulatory domains. PMID:26252467

  17. 78 FR 57668 - U.S. Nuclear Regulatory Commission Planned for Monitoring Activities for the Saltstone Disposal...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-19

    .... Department of Energy at the Savannah River Site Saltstone Disposal Facility in Accordance With the National... COMMISSION U.S. Nuclear Regulatory Commission Planned for Monitoring Activities for the Saltstone Disposal Facility at the Savannah River Site, Revision 1 AGENCY: Nuclear Regulatory Commission. ACTION: Notice...

  18. A genome-wide cis-regulatory element discovery method based on promoter sequences and gene co-expression networks

    PubMed Central

    2013-01-01

    Background Deciphering cis-regulatory networks has become an attractive yet challenging task. This paper presents a simple method for cis-regulatory network discovery which aims to avoid some of the common problems of previous approaches. Results Using promoter sequences and gene expression profiles as input, rather than clustering the genes by the expression data, our method utilizes co-expression neighborhood information for each individual gene, thereby overcoming the disadvantages of current clustering based models which may miss specific information for individual genes. In addition, rather than using a motif database as an input, it implements a simple motif count table for each enumerated k-mer for each gene promoter sequence. Thus, it can be used for species where previous knowledge of cis-regulatory motifs is unknown and has the potential to discover new transcription factor binding sites. Applications on Saccharomyces cerevisiae and Arabidopsis have shown that our method has a good prediction accuracy and outperforms a phylogenetic footprinting approach. Furthermore, the top ranked gene-motif regulatory clusters are evidently functionally co-regulated, and the regulatory relationships between the motifs and the enriched biological functions can often be confirmed by literature. Conclusions Since this method is simple and gene-specific, it can be readily utilized for insufficiently studied species or flexibly used as an additional step or data source for previous transcription regulatory networks discovery models. PMID:23368633

  19. Transposable Elements Contribute to Activation of Maize Genes in Response to Abiotic Stress

    PubMed Central

    Makarevitch, Irina; Waters, Amanda J.; West, Patrick T.; Stitzer, Michelle; Hirsch, Candice N.; Ross-Ibarra, Jeffrey; Springer, Nathan M.

    2015-01-01

    Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as “junk” DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize. PMID:25569788

  20. Melanoma cells express ICOS ligand to promote the activation and expansion of T-regulatory cells

    PubMed Central

    Martin-Orozco, Natalia; Li, Yufeng; Wang, Yijun; Liu, Shijuan; Hwu, Patrick; Liu, Yong-Jun; Dong, Chen; Radvanyi, Laszlo

    2010-01-01

    CD4+CD25+Foxp3+ T-regulatory cells (Tregs) accumulate in tumors, however little is known about how the tumor environment influences this process. Here we show that human melanomas express ICOS-ligand (ICOS-L/B7H) that can provide costimulation through ICOS for the expansion of activated Tregs maintaining high Foxp3 and CD25 expression as well as suppressive function. Thus, ICOS-L expression by melanoma tumor cells may directly drive Treg activation and expansion in the tumor microenvironment as another mechanism of immune evasion. PMID:21098714

  1. Characterization of a cell-type-restricted negative regulatory activity of the human granulocyte-macrophage colony-stimulating factor gene.

    PubMed Central

    Fraser, J K; Guerra, J J; Nguyen, C Y; Indes, J E; Gasson, J C; Nimer, S D

    1994-01-01

    Human granulocyte-macrophage colony-stimulating factor (GM-CSF) stimulates the proliferation and maturation of normal myeloid progenitor cells and can also stimulate the growth of acute myelogenous leukemia (AML) blasts. GM-CSF is not normally produced by resting cells but is expressed by a variety of activated cells including T lymphocytes, macrophages, and certain cytokine-stimulated fibroblasts and endothelial cells. Production of GM-CSF by cultured AML cells has been demonstrated, and GM-CSF expression by normal myeloid progenitors has been postulated to play a role in myelopoiesis. We have investigated the regulation of expression of GM-CSF in AML cell lines, and our results demonstrate the presence of a strong constitutive promoter element contained within 53 bp upstream of the cap site. We have also identified a negative regulatory element located immediately upstream of the positive regulatory element (within 69 bp of the cap site) that is active in AML cell lines but not T cells or K562 CML cells. Competition transfection and mobility shift studies demonstrate that this activity correlates with binding of a 45-kDa protein. Images PMID:8114751

  2. Assessment of nose protector for sport activities: finite element analysis.

    PubMed

    Coto, Neide Pena; Meira, Josete Barbosa Cruz; Brito e Dias, Reinaldo; Driemeier, Larissa; de Oliveira Roveri, Guilherme; Noritomi, Pedro Yoshito

    2012-04-01

    There has been a significant increase in the number of facial fractures stemming from sport activities in recent years, with the nasal bone one of the most affected structures. Researchers recommend the use of a nose protector, but there is no standardization regarding the material employed. Clinical experience has demonstrated that a combination of a flexible and rigid layer of ethylene vinyl acetate (EVA) offers both comfort and safety to practitioners of sports. The aim of the present study was the investigation into the stresses generated by the impact of a rigid body on the nasal bone on models with and without an EVA protector. For such, finite element analysis was employed. A craniofacial model was constructed from images obtained through computed tomography. The nose protector was modeled with two layers of EVA (1 mm of rigid EVA over 2 mm of flexible EVA), following the geometry of the soft tissue. Finite element analysis was performed using the LS Dyna program. The bone and rigid EVA were represented as elastic linear material, whereas the soft tissues and flexible EVA were represented as hyperelastic material. The impact from a rigid sphere on the frontal region of the face was simulated with a constant velocity of 20 m s(-1) for 9.1 μs. The model without the protector served as the control. The distribution of maximal stress of the facial bones was recorded. The maximal stress on the nasal bone surpassed the breaking limit of 0.13-0.34 MPa on the model without a protector, while remaining below this limit on the model with the protector. Thus, the nose protector made from both flexible and rigid EVA proved effective at protecting the nasal bones under high-impact conditions. PMID:21790992

  3. ARMADA: Using motif activity dynamics to infer gene regulatory networks from gene expression data.

    PubMed

    Pemberton-Ross, Peter J; Pachkov, Mikhail; van Nimwegen, Erik

    2015-09-01

    Analysis of gene expression data remains one of the most promising avenues toward reconstructing genome-wide gene regulatory networks. However, the large dimensionality of the problem prohibits the fitting of explicit dynamical models of gene regulatory networks, whereas machine learning methods for dimensionality reduction such as clustering or principal component analysis typically fail to provide mechanistic interpretations of the reduced descriptions. To address this, we recently developed a general methodology called motif activity response analysis (MARA) that, by modeling gene expression patterns in terms of the activities of concrete regulators, accomplishes dramatic dimensionality reduction while retaining mechanistic biological interpretations of its predictions (Balwierz, 2014). Here we extend MARA by presenting ARMADA, which models the activity dynamics of regulators across a time course, and infers the causal interactions between the regulators that drive the dynamics of their activities across time. We have implemented ARMADA as part of our ISMARA webserver, ismara.unibas.ch, allowing any researcher to automatically apply it to any gene expression time course. To illustrate the method, we apply ARMADA to a time course of human umbilical vein endothelial cells treated with TNF. Remarkably, ARMADA is able to reproduce the complex observed motif activity dynamics using a relatively small set of interactions between the key regulators in this system. In addition, we show that ARMADA successfully infers many of the key regulatory interactions known to drive this inflammatory response and discuss several novel interactions that ARMADA predicts. In combination with ISMARA, ARMADA provides a powerful approach to generating plausible hypotheses for the key interactions between regulators that control gene expression in any system for which time course measurements are available. PMID:26164700

  4. Interferon Regulatory Factor 6 promotes differentiation of the periderm by activating expression of Grainyhead-like 3

    PubMed Central

    de la Garza, Gabriel; Schleiffarth, Jack Robert; Dunnwald, Martine; Mankad, Anuj; Weirather, Jason L.; Bonde, Gregory; Butcher, Stephen; Mansour, Tamer A.; Kousa, Youssef A.; Fukazawa, Cindy F.; Houston, Douglas W.; Manak, J. Robert; Schutte, Brian C.; Wagner, Daniel; Cornell, Robert A.

    2012-01-01

    Interferon Regulatory Factor 6 (IRF6) is a transcription factor that, in mammals, is required for the differentiation of skin, breast epithelium, and oral epithelium. However, the transcriptional targets that mediate these effects are currently unknown. In zebrafish and frog embryos Irf6 is necessary for differentiation of the embryonic superficial epithelium, or periderm. Here we use microarrays to identify genes that are expressed in the zebrafish periderm and whose expression is inhibited by a dominant-negative variant of Irf6 (dnIrf6). These methods identify Grhl3, an ancient regulator of the epidermal permeability barrier, as acting downstream of Irf6. In human keratinocytes, IRF6 binds conserved elements near the GHRL3 promoter. We show that one of these elements has enhancer activity in human keratinocytes and zebrafish periderm, suggesting that Irf6 directly stimulates Grhl3 expression in these tissues. Simultaneous inhibition of grhl1 and grhl3 disrupts periderm differentiation in zebrafish, and, intriguingly, forced grhl3 expression restores periderm markers in both zebrafish injected with dnIrf6 and frog embryos depleted of Irf6. Finally, in Irf6 deficient mouse embryos, Grhl3 expression in the periderm and oral epithelium is virtually absent. These results indicate that Grhl3 is a key effector of Irf6 in periderm differentiation. PMID:22931925

  5. An ultraconserved Hox–Pbx responsive element resides in the coding sequence of Hoxa2 and is active in rhombomere 4

    PubMed Central

    Lampe, Xavier; Samad, Omar Abdel; Guiguen, Allan; Matis, Christelle; Remacle, Sophie; Picard, Jacques J.; Rezsohazy, René

    2008-01-01

    The Hoxa2 gene has a fundamental role in vertebrate craniofacial and hindbrain patterning. Segmental control of Hoxa2 expression is crucial to its function and several studies have highlighted transcriptional regulatory elements governing its activity in distinct rhombomeres. Here, we identify a putative Hox–Pbx responsive cis-regulatory sequence, which resides in the coding sequence of Hoxa2 and is an important component of Hoxa2 regulation in rhombomere (r) 4. By using cell transfection and chromatin immunoprecipitation (ChIP) assays, we show that this regulatory sequence is responsive to paralogue group 1 and 2 Hox proteins and to their Pbx co-factors. Importantly, we also show that the Hox–Pbx element cooperates with a previously reported Hoxa2 r4 intronic enhancer and that its integrity is required to drive specific reporter gene expression in r4 upon electroporation in the chick embryo hindbrain. Thus, both intronic as well as exonic regulatory sequences are involved in Hoxa2 segmental regulation in the developing r4. Finally, we found that the Hox–Pbx exonic element is embedded in a larger 205-bp long ultraconserved genomic element (UCE) shared by all vertebrate genomes. In this respect, our data further support the idea that extreme conservation of UCE sequences may be the result of multiple superposed functional and evolutionary constraints. PMID:18417536

  6. NF-κB and BRG1 bind a distal regulatory element in the IL-3/GM-CSF locus

    PubMed Central

    Wurster, Andrea L.; Precht, Patricia; Pazin, Michael J.

    2011-01-01

    We investigated gene regulation at the IL-3/GM-CSF gene cluster. We found BRG1, a SWI/SNF remodeling ATPase, bound a distal element, CNSa. BRG1 binding was strongest in differentiated, stimulated T helper cells, paralleling IL-3 and GM-CSF expression. Depletion of BRG1 reduced IL-3 and GM-CSF transcription. BAF-specific SWI/SNF subunits bound to this locus and regulated IL-3 expression. CNSa was in closed chromatin in fibroblasts, open chromatin in differentiated T helper cells, and moderately open chromatin in naïve (undifferentiated) T helper cells; BRG1 was required for the most open state. CNSa increased transcription of a reporter in an episomal expression system, in a BRG1-dependent manner. The NF-κB subunit RelA/p65 bound CNSa in activated T helper cells. Inhibition of NF-κB blocked BRG1 binding to CNSa, chromatin opening at CNSa, and activation of IL-3 and GM-CSF. Together, these findings suggest CNSa is a distal enhancer that binds BRG1 and NF-κB. PMID:21831442

  7. LRE2, an active human L1 element, has low level transcriptional activity and extremely low reverse transcriptase activity

    SciTech Connect

    Holmes, S.E.; Dombroski, B.A.; Sassaman, D.M.

    1994-09-01

    Previously, we found a 2 kb insertion containing a rearranged L1 element plus a unique sequence component (USC) within exon 48 of the dystrophin gene of a patient with muscular dystrophy. We used the USC to clone the precursor of this insertion, the second known {open_quotes}active{close_quotes} human L1 element. The locus LRE2 (L1 Retrotransposable Element 2) has an allele derived from the patient which matches the insertion sequence exactly. LRE2 has a perfect 13-15 bp target site duplication, 2 open reading frames (ORFs), and an unusual 21 bp truncation of the 5{prime} end in a region known to be important for L1 transcription. The truncated LRE2 promoter has about 20% of the transcriptional activity of a previously studied L1 promoter after transfection into NTera2D1 cells of a construct in which the L1 promoter drives the expression of a lacZ gene. In addition, the reverse transcriptase (RT) encoded by LRE2 is active in an in vivo pseudogene assay in yeast and an in vitro assay. However, in both assays the RT of LRE2 is 1-5% as active as that of LRE1. These data demonstrate that multiple {open_quotes}active{close_quotes} L1 elements exist in the human genome, and that active elements can have highly variable rates of transcription and reverse transcriptase activity. That the RT of LRE2 has extremely low activity suggests the possibility that retrotransposition of an L1 element may in some cases involve an RT encoded by another L1 element.

  8. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

    2016-01-01

    Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to

  9. Separate elements of the TERMINAL FLOWER 1 cis-regulatory region integrate pathways to control flowering time and shoot meristem identity.

    PubMed

    Serrano-Mislata, Antonio; Fernández-Nohales, Pedro; Doménech, María J; Hanzawa, Yoshie; Bradley, Desmond; Madueño, Francisco

    2016-09-15

    TERMINAL FLOWER 1 (TFL1) is a key regulator of Arabidopsis plant architecture that responds to developmental and environmental signals to control flowering time and the fate of shoot meristems. TFL1 expression is dynamic, being found in all shoot meristems, but not in floral meristems, with the level and distribution changing throughout development. Using a variety of experimental approaches we have analysed the TFL1 promoter to elucidate its functional structure. TFL1 expression is based on distinct cis-regulatory regions, the most important being located 3' of the coding sequence. Our results indicate that TFL1 expression in the shoot apical versus lateral inflorescence meristems is controlled through distinct cis-regulatory elements, suggesting that different signals control expression in these meristem types. Moreover, we identified a cis-regulatory region necessary for TFL1 expression in the vegetative shoot and required for a wild-type flowering time, supporting that TFL1 expression in the vegetative meristem controls flowering time. Our study provides a model for the functional organisation of TFL1 cis-regulatory regions, contributing to our understanding of how developmental pathways are integrated at the genomic level of a key regulator to control plant architecture. PMID:27385013

  10. A bidirectional promoter reporter vector for the analysis of the p53/WDR79 dual regulatory element.

    PubMed

    Polson, Amanda; Durrett, Emily; Reisman, David

    2011-09-01

    Analysis of numerous genomes has identified a class of regulatory regions that contain a head-to-head arrangement (5' to 5') on opposite strands of DNA. Often these regulatory regions have fewer than 1000 base pairs separating their corresponding transcription start sites and have been termed as being "bidirectional". This bidirectional arrangement and the divergent gene pairs under the control of these regulatory regions appear to be a common feature within genomes. Establishing methods to study these bidirectional transcriptional promoters, and understanding how they are regulated will allow researchers to gain more insight into the roles that divergent transcription plays in the expression and maintenance of protein coding genes. Recently, the p53 tumor suppressor gene was shown to have a bidirectional gene partner, WDR79. The transcription start sites (TSSs) of human and murine p53 and WDR79 genes are separated by approximately 800 and 930bp, respectively, in a head-to-head fashion, and fit the criteria of what is designated to be a putative bidirectional regulatory region. However, further testing is needed to demonstrate that the region between these genes contains a functional bidirectional promoter. Here, we have developed a bidirectional reporter vector, termed pLucRLuc, to study the transcriptional output of each promoter. This bidirectional reporter vector will allow researchers to determine the output of transcripts mediated by the bidirectional promoters. By focusing our studies on the transcriptional regulation of p53 and its bidirectional gene partner, WDR79, we hope to elucidate key factors that can control and regulate the expression of the p53 and WDR79 genes. Here, we demonstrate that pLucRLuc is a vector capable of expressing reporter genes under the control of bidirectional promoters in multiple human and murine cell lines and that the regulatory region upstream of the p53 and WDR79 TSSs is a bidirectional promoter controlled by common

  11. Beta-adrenergic stimulation of cFOS via protein kinase A is mediated by cAMP regulatory element binding protein (CREB)-dependent and tissue-specific CREB-independent mechanisms in corticotrope cells.

    PubMed

    Boutillier, A L; Barthel, F; Roberts, J L; Loeffler, J P

    1992-11-25

    Catecholamines stimulate proopiomelanocortin (POMC) gene expression in corticotrope cells, but the molecular mechanisms of these effects are not known. While beta-adrenergic receptors stimulate the protein kinase A (PKA) system, the POMC promoter does not have classical cAMP-response elements (CREs). Therefore, we investigated the induction of the c-fos protooncogen, previously shown to increase POMC transcription in AtT20 cells. In this corticotrope-derived cell line, we show that activation of beta-receptors with isoprenaline (Iso) induces a transient rise in c-fos mRNA levels. Gel mobility shift assays with a labeled AP1 consensus sequence (TGACTCA) showed induction of specific binding activity after Iso treatment. Cotransfection experiments with dominant inhibitory PKA mutants and reporter genes containing c-fos promoter sequences showed that c-fos induction by Iso is entirely dependent on a functional PKA activity. Furthermore, we show that beta-receptor induction of c-fos in corticotrophs is mediated by at least two distinct cAMP-responsive sequences. cAMP regulatory element binding (CREB)-dependent induction is observed on the CRE located at -60 bp on the c-fos promoter. A region located in the vicinity of the dyad symetry element (-290) is also found to mediate tissue-specific cAMP induction. Transcriptional activation by this site, although sensitive to PKA antagonism, is not blocked by CREB mutants. PMID:1331087

  12. Steroidogenic Acute Regulatory Protein Overexpression Correlates with Protein Kinase A Activation in Adrenocortical Adenoma.

    PubMed

    Zhou, Weiwei; Wu, Luming; Xie, Jing; Su, Tingwei; Jiang, Lei; Jiang, Yiran; Cao, Yanan; Liu, Jianmin; Ning, Guang; Wang, Weiqing

    2016-01-01

    The association of pathological features of cortisol-producing adrenocortical adenomas (ACAs) with somatic driver mutations and their molecular classification remain unclear. In this study, we explored the association between steroidogenic acute regulatory protein (StAR) expression and the driver mutations activating cyclic adenosine monophosphate (cAMP)/protein kinase A (PKA) signaling to identify the pathological markers of ACAs. Immunohistochemical staining for StAR and mutations in the protein kinase cAMP-activated catalytic subunit alpha (PRKACA), protein kinase cAMP-dependent type I regulatory subunit alpha (PRKAR1A) and guanine nucleotide binding protein, alpha stimulating (GNAS) genes were examined in 97 ACAs. The association of StAR expression with the clinical and mutational features of the ACAs was analyzed. ACAs with mutations in PRKACA, GNAS, and PRKAR1A showed strong immunopositive staining for StAR. The concordance between high StAR expression and mutations activating cAMP/PKA signaling in the ACAs was 99.0%. ACAs with high expression of StAR had significantly smaller tumor volume (P < 0.001) and higher urinary cortisol per tumor volume (P = 0.032) than those with low expression of StAR. Our findings suggest that immunohistochemical staining for StAR is a reliable pathological approach for the diagnosis and classification of ACAs with cAMP/PKA signaling-activating mutations. PMID:27606678

  13. Tissue-specific regulation of BiP genes: a cis-acting regulatory domain is required for BiP promoter activity in plant meristems.

    PubMed

    Buzeli, Reginaldo A A; Cascardo, Júlio C M; Rodrigues, Leonardo A Z; Andrade, Maxuel O; Almeida, Raul S; Loureiro, Marcelo E; Otoni, Wagner C; Fontes, Elizabeth P B

    2002-11-01

    The binding protein BiP is an endoplasmic reticulum (ER)-resident member of the HSP70 stress-related protein family, which is essential for the constitutive function of the ER. In addition to responding to a variety of environmental stimuli, plant BiP exhibits a tissue-specific regulation. We have isolated two soybean BiP genomic clones, designated gsBiP6 and gsBiP9, and different extensions of their 5' flanking sequences were fused to beta-glucuronidase (GUS) reporter gene and introduced into Nicotiana tabacum by Agrobacterium tumefaciens-mediated transformation. Transgenic plants displayed prominent GUS activity in the vascular bundles of roots and shoots as well as in regions of intense cell division, such as procambial region and apical meristems. Promoter deletion analyses identified two cis-regulatory functional domains that are important for the spatially-regulated activation of BiP expression under normal plant development. While an AT-rich enhancer-like sequence, designated cis-acting regulatory domain 1, CRD1 (-358 to -211, on gsBiP6), activated expression of the BiP minimal promoter in all organs analyzed, BiP promoter activity in meristematic tissues and phloem cells required the presence of a second activating domain, CRD2 (-211 to -80). Apparently, the CRD2 sequence also harbors negative cis-acting elements, because removal of this region caused activation of gsBiP6 promoter in parenchymatic xylem rays. These results suggest that the tissue-specific control of BiP gene expression requires a complex integration of multiple cis-acting regulatory elements on the promoter. PMID:12374306

  14. Regulatory T cells suppress systemic and mucosal immune activation to control intestinal inflammation.

    PubMed

    Izcue, Ana; Coombes, Janine L; Powrie, Fiona

    2006-08-01

    The gastrointestinal (GI) tract is the main interface where the body encounters exogenous antigens. It is crucial that the local response here is tightly regulated to avoid an immune reaction against dietary antigens and commensal flora while still mounting an efficient defense against pathogens. Faults in establishing intestinal tolerance can lead to disease, inducing local and often also systemic inflammation. Studies in human as well as in animal models suggest a role for regulatory T cells (Tregs) in maintaining intestinal homeostasis. Transfer of Tregs can not only prevent the development of colitis in animal models but also cure established disease, acting both systemically and at the site of inflammation. In this review, we discuss the major regulatory pathways, including transforming growth factor-beta (TGF-beta), interleukin-10 (IL-10), and cytotoxic T-lymphocyte antigen-4 (CTLA-4), and their role in Treg-mediated control of systemic and mucosal responses. In addition, we give an overview of the known mechanisms of lymphocyte migration to the intestine and discuss how CD103 expression can influence the balance between regulatory and effector T cells. Further understanding of the factors that control the activity of Tregs in different immune compartments may facilitate the design of strategies to target regulation in a tissue-specific way. PMID:16903919

  15. Germinal and Somatic Activity of the Maize Element Activator (Ac) in Arabidopsis

    PubMed Central

    Keller, J.; Lim, E.; James-Jr., D. W.; Dooner, H. K.

    1992-01-01

    We have investigated the germinal and somatic activity of the maize Activator (Ac) element in Arabidopsis with the objective of developing an efficient transposon-based system for gene isolation in that plant. Transposition activity was assayed with a chimeric marker that consists of the cauliflower mosaic virus 35S promoter and a bacterial streptomycin phosphotransferase gene (SPT). Somatic activity was detected in seedlings germinated on plates containing streptomycin as green-resistant sectors against a background of white-sensitive cells. Germinal excisions resulted in fully green seedlings. The transposition frequency was extremely low when a single copy of the transposon was present, but appeared to increase with an increase in Ac copy number. Plants that were selected as variegated produced an increased number of green progeny. The methylation state of the Ac elements in lines with either low or high levels of excision was assessed by restriction analysis. No difference was found between these lines, indicating that the degree of methylation did not contribute to the level of Ac activity. Germinal excision events were analyzed molecularly and shown to carry reinserted transposons in about 50% of the cases. In several instances, streptomycin-resistant siblings carried the same transposed Ac element, indicating that excision had occurred prior to meiosis in the parent. We discuss parameters that need to be considered to optimize the use of Ac as a transposon tag in Arabidopsis. PMID:1322854

  16. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  17. The Zinc Finger Protein ZNF658 Regulates the Transcription of Genes Involved in Zinc Homeostasis and Affects Ribosome Biogenesis through the Zinc Transcriptional Regulatory Element

    PubMed Central

    Ogo, Ogo A.; Tyson, John; Cockell, Simon J.; Howard, Alison; Valentine, Ruth A.

    2015-01-01

    We previously identified the ZTRE (zinc transcriptional regulatory element) in genes involved in zinc homeostasis and showed that it mediates transcriptional repression in response to zinc. We now report that ZNF658 acts at the ZTRE. ZNF658 was identified by matrix-assisted laser desorption ionization–time of flight mass spectrometry of a band excised after electrophoretic mobility shift assay using a ZTRE probe. The protein contains a KRAB domain and 21 zinc fingers. It has similarity with ZAP1 from Saccharomyces cerevisiae, which regulates the response to zinc restriction, including a conserved DNA binding region we show to be functional also in ZNF658. Small interfering RNA (siRNA) targeted to ZNF658 abrogated the zinc-induced, ZTRE-dependent reduction in SLC30A5 (ZnT5 gene), SLC30A10 (ZnT10 gene), and CBWD transcripts in human Caco-2 cells and the ability of zinc to repress reporter gene expression from corresponding promoter-reporter constructs. Microarray analysis of the effect of reducing ZNF658 expression by siRNA uncovered a large decrease in rRNA. We find that ZTREs are clustered within the 45S rRNA precursor. We also saw effects on expression of multiple ribosomal proteins. ZNF658 thus links zinc homeostasis with ribosome biogenesis, the most active transcriptional, and hence zinc-demanding, process in the cell. ZNF658 is thus a novel transcriptional regulator that plays a fundamental role in the orchestrated cellular response to zinc availability. PMID:25582195

  18. Emergy of the Global Biogeochemical Cycles of Biologically Active Elements

    EPA Science Inventory

    Accurate estimates of the emergy of elemental flows are needed to accurately evaluate the far field effects of anthropogenic wastes. The transformity and specific emergy of the elements and of their different chemical species is also needed to quantify the inputs to many producti...

  19. Chronic Low Level Complement Activation within the Eye Is Controlled by Intraocular Complement Regulatory Proteins

    PubMed Central

    Sohn, Jeong-Hyeon; Kaplan, Henry J.; Suk, Hye-Jung; Bora, Puran S.; Bora, Nalini S.

    2007-01-01

    Purpose To explore the role of the complement system and complement regulatory proteins in an immune-privileged organ, the eye. Methods Eyes of normal Lewis rats were analyzed for the expression of complement regulatory proteins, membrane cofactor protein (MCP), decay-acceleration factor (DAF), membrane inhibitor of reactive lysis (MIRL, CD59), and cell surface regulator of complement (Crry), using immunohistochemistry, Western blot analysis, and reverse transcription–polymerase chain reaction (RT-PCR). Zymosan, a known activator of the alternative pathway of complement system was injected into the anterior chamber of the eye of Lewis rats. Animals were also injected intracamerally with 5 μl (25 μg) of neutralizing monoclonal antibody (mAb) against rat Crry (5I2) or CD59 (6D1) in an attempt to develop antibody induced anterior uveitis; control animals received 5 μl of sterile phosphate-buffered saline (PBS), OX-18 (25 μg), G-16-510E3 (25 μg), or MOPC-21 (25 μg). The role of complement system in antibody-induced uveitis was explored by intraperitoneal injection of 35 U cobra venom factor (CVF), 24 hours before antibody injection. Immunohistochemical staining and sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) with Western blot analysis were used to detect the presence of membrane attack complex (MAC) and C3 activation products, respectively, in normal and antibody-injected rat eyes. Results Complement activation product MAC was present in the normal rat eye, and intraocular injection of zymosan induced severe anterior uveitis. The complement regulatory proteins, MCP, DAF, CD59, and Crry, were identified in the normal rat eye. Soluble forms of Crry and CD59 were also detected in normal rat aqueous humor. Severe anterior uveitis developed in Lewis rats injected with a neutralizing mAb against Crry, with increased formation of C3 split products. Systemic complement depletion by CVF prevented the induction of anterior uveitis by anti

  20. Regulatory T Cell Responses to High-Dose Methylprednisolone in Active Systemic Lupus Erythematosus

    PubMed Central

    Chader, Driss; Cohen-Aubart, Fleur; Haroche, Julien; Fadlallah, Jehane; Claër, Laetitia; Musset, Lucile; Gorochov, Guy; Amoura, Zahir; Miyara, Makoto

    2015-01-01

    Background/Purpose A slight increase in the proportion of circulating regulatory T (Treg) cells has been reported in systemic lupus erythematosus (SLE) patients taking oral prednisone. The effects of intravenous (IV) high dose methylprednisolone (MP) on Tregs have not yet been described, especially in active SLE. Methods We prospectively analyzed the proportion of circulating CD4+ Treg cell subsets defined as follows: (1) naïve Treg (nTreg) FoxP3lowCD45RA+ cells; (2) effector Treg (eTreg) FoxP3highCD45RA− cells; and (3) non-suppressive FoxP3lowCD45RA− cells (non-regulatory Foxp3low T cells). Peripheral blood mononuclear cells of patients with active SLE were analyzed before the first infusion of IV high dose MP (day 0) and the following days (day 1, day 2, ±day 3 and ±day 8). The activity of SLE was assessed by the SLEDAI score. Results Seventeen patients were included. Following MP infusions, the median (range) percentage of eTregs significantly increased from 1.62% (0.53–8.43) at day 0 to 2.80% (0.83–14.60) at day 1 (p = 0.003 versus day 0), 4.64% (0.50–12.40) at day 2 (p = 0.06 versus day 1) and 7.50% (1.02–20.70) at day 3 (p = 0.008 versus day 2), and declined to baseline values at day 8. Expanding eTreg cells were actively proliferating, as they expressed Ki-67. The frequency of non-regulatory FoxP3low T cells decreased from 6.39% (3.20–17.70) at day 0 to 4.74% (1.03–9.72) at day 2 (p = 0.005); nTreg frequency did not change. All patients clinically improved immediately after MP pulses. The absence of flare after one year of follow up was associated with a higher frequency of eTregs at day 2. Conclusion IV high dose MP induces a rapid, dramatic and transient increase in circulating regulatory T cells. This increase may participate in the preventive effect of MP on subsequent flares in SLE. PMID:26629828

  1. cis-Acting elements that control expression of the master virulence regulatory gene atxA in Bacillus anthracis.

    PubMed

    Dale, Jennifer L; Raynor, Malik J; Dwivedi, Prabhat; Koehler, Theresa M

    2012-08-01

    Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule is positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In culture, multiple signals impact atxA transcript levels, and the timing and steady-state level of atxA expression are critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to interact directly with the atxA promoter. Here we employ 5' and 3' deletion analysis and site-directed mutagenesis of the atxA control region to demonstrate that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA and an A+T-rich upstream element for RNA polymerase. We also show that an additional trans-acting protein(s) binds specifically to atxA promoter sequences located between -13 and +36 relative to P1 and negatively impacts transcription. Deletion of this region increases promoter activity up to 15-fold. Site-directed mutagenesis of a 9-bp palindromic sequence within the region prevents binding of the trans-acting protein(s), increasing promoter activity 7-fold and resulting in a corresponding increase in AtxA and anthrax toxin production. Notably, an atxA promoter mutant that produced elevated levels of AtxA and toxin proteins during culture was unaffected for virulence in a murine model for anthrax. PMID:22636778

  2. Redefining the transcriptional regulatory dynamics of classically and alternatively activated macrophages by deepCAGE transcriptomics

    PubMed Central

    Roy, Sugata; Schmeier, Sebastian; Arner, Erik; Alam, Tanvir; Parihar, Suraj P.; Ozturk, Mumin; Tamgue, Ousman; Kawaji, Hideya; de Hoon, Michiel J. L.; Itoh, Masayoshi; Lassmann, Timo; Carninci, Piero; Hayashizaki, Yoshihide; Forrest, Alistair R. R.; Bajic, Vladimir B.; Guler, Reto; Consortium, FANTOM; Brombacher, Frank; Suzuki, Harukazu

    2015-01-01

    Classically or alternatively activated macrophages (M1 and M2, respectively) play distinct and important roles for microbiocidal activity, regulation of inflammation and tissue homeostasis. Despite this, their transcriptional regulatory dynamics are poorly understood. Using promoter-level expression profiling by non-biased deepCAGE we have studied the transcriptional dynamics of classically and alternatively activated macrophages. Transcription factor (TF) binding motif activity analysis revealed four motifs, NFKB1_REL_RELA, IRF1,2, IRF7 and TBP that are commonly activated but have distinct activity dynamics in M1 and M2 activation. We observe matching changes in the expression profiles of the corresponding TFs and show that only a restricted set of TFs change expression. There is an overall drastic and transient up-regulation in M1 and a weaker and more sustainable up-regulation in M2. Novel TFs, such as Thap6, Maff, (M1) and Hivep1, Nfil3, Prdm1, (M2) among others, were suggested to be involved in the activation processes. Additionally, 52 (M1) and 67 (M2) novel differentially expressed genes and, for the first time, several differentially expressed long non-coding RNA (lncRNA) transcriptome markers were identified. In conclusion, the finding of novel motifs, TFs and protein-coding and lncRNA genes is an important step forward to fully understand the transcriptional machinery of macrophage activation. PMID:26117544

  3. Phenotype Specific Analyses Reveal Distinct Regulatory Mechanism for Chronically Activated p53

    PubMed Central

    Cairns, Jonathan M.; Menon, Suraj; Pérez-Mancera, Pedro A.; Tomimatsu, Kosuke; Bermejo-Rodriguez, Camino; Ito, Yoko; Chandra, Tamir; Narita, Masako; Lyons, Scott K.; Lynch, Andy G.; Kimura, Hiroshi; Ohbayashi, Tetsuya; Tavaré, Simon; Narita, Masashi

    2015-01-01

    The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage) and chronically activated (in senescent or pro-apoptotic conditions) p53. Compared to the classical ‘acute’ p53 binding profile, ‘chronic’ p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory ‘p53 hubs’ where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the ‘lipogenic phenotype’, a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms. PMID:25790137

  4. Testosterone activates mitogen-activated protein kinase and the cAMP response element binding protein transcription factor in Sertoli cells

    PubMed Central

    Fix, Charity; Jordan, Cynthia; Cano, Patricia; Walker, William H.

    2004-01-01

    The androgen testosterone is essential for the Sertoli cell to support the maturation of male germ cells and the production of spermatozoa (spermatogenesis). In the classical view of androgen action, binding of androgen to the intracellular androgen receptor (AR) produces a conformational change in AR such that the receptor–steroid complex has high affinity for specific DNA regulatory elements and is able to stimulate gene transcription. Here, we demonstrate that testosterone can act by means of an alternative, rapid, and sustainable mechanism in Sertoli cells that is independent of AR–DNA interactions. Specifically, the addition of physiological levels of testosterone to Sertoli cells stimulates the mitogen-activated protein kinase signaling pathway and causes phosphorylation of the cAMP response element binding protein transcription factor on serine 133, a modification known to be required for Sertoli cells to support spermatogenesis. Androgen-mediated activation of mitogen-activated protein kinase and cAMP response element binding protein occurs within 1 min, extends for at least 12 h and requires AR. Furthermore, androgen induces endogenous cAMP response element binding protein-mediated transcription in Sertoli cells. These newly identified mechanisms of androgen action in Sertoli cells suggest new targets for developing male contraceptive agents. PMID:15263086

  5. Adenovirus vaccine vectors expressing hepatitis B surface antigen: importance of regulatory elements in the adenovirus major late intron.

    PubMed

    Mason, B B; Davis, A R; Bhat, B M; Chengalvala, M; Lubeck, M D; Zandle, G; Kostek, B; Cholodofsky, S; Dheer, S; Molnar-Kimber, K

    1990-08-01

    Adenovirus types 4 and 7 are currently used as live oral vaccines for prevention of acute respiratory disease caused by these adenovirus serotypes. To investigate the concept of producing live recombinant vaccines using these serotypes, adenovirus types 4 (Ad4) and 7 (Ad7) were constructed that produce HBsAg upon infection of cell cultures. Ad4 recombinants were constructed that express HBsAg from a cassette inserted 135 bp from the right-hand terminus of the viral genome. The cassette contained the Ad4 major late promoter followed by leader 1 of the tripartite leader, the first intervening sequence between leaders 1 and 2, leaders 2 and 3, the HBsAg gene, and tandem polyadenylation signals from the Ad4 E3B and hexon genes. Using this same cassette, a series of Ad4 recombinants expressing HBsAg were constructed with deletions in the intervening sequence between leaders 1 and 2 to evaluate the contribution of the downstream control elements more precisely. Inclusion of regions located between +82 and +148 as well as +148 and +232 resulted in increases in expression levels of HBsAg in A549-infected cells by 22-fold and 44-fold, respectively, over the levels attained by an adenovirus recombinant retaining only sequences from +1 to +82, showing the importance of these elements in the activation of the major late promoter during the course of a natural Ad4 viral infection. Parallel increases were also observed in steady-state levels of cytoplasmic HBsAg-specific mRNA. When similar Ad7 recombinant viruses were constructed, these viruses also expressed 20-fold more HBsAg due to the presence of the intron. All Ad4 and Ad7 recombinants produced HBsAg particles containing gp27 and p24 which were secreted in the medium. When dogs were immunized intratracheally with one of these Ad7 recombinants, they seroconverted to both Ad7 and HBsAg to a high level. PMID:2371766

  6. Trace element analysis of coal by neutron activation

    NASA Technical Reports Server (NTRS)

    Sheibley, D. W.

    1973-01-01

    The irradiation, counting, and data reduction scheme is described for an analysis capability of 1000 samples per year. Up to 56 elements are reported on each sample. The precision and accuracy of the method are shown for 25 elements designated as hazardous by the Environmental Protection Agency (EPA). The interference corrections for selenium and ytterbium on mercury and ytterbium on selenium are described. The effect of bromine and antimony on the determination of arsenic is also mentioned. The use of factorial design techniques to evaluate interferences in the determination of mercury, selenium, and arsenic is shown. Some typical trace element results for coal, fly ash, and bottom ash are given.

  7. Trace element analysis of coal by neutron activation.

    NASA Technical Reports Server (NTRS)

    Sheibley, D. W.

    1973-01-01

    The irradiation, counting, and data reduction scheme is described for an analysis capability of 1000 samples per year. Up to 56 elements are reported on each sample. The precision and accuracy of the method are shown for 25 elements designated as hazardous by the Environmental Protection Agency (EPA). The interference corrections for selenium and ytterbium on mercury and ytterbium on selenium are described. The effect of bromine and antimony on the determination of arsenic is also mentioned. The use of factorial design techniques to evaluate interferences in the determination of mercury, selenium, and arsenic is shown. Some typical trace element results for coal, fly ash, and bottom ash are given.

  8. Interferon regulatory factor 7 is activated by a viral oncoprotein through RIP-dependent ubiquitination.

    PubMed

    Huye, Leslie E; Ning, Shunbin; Kelliher, Michelle; Pagano, Joseph S

    2007-04-01

    As a key mediator of type I interferon (IFN) (IFN-alpha/beta) responses, IFN regulatory factor 7 (IRF7) is essential to host immune defenses. Activation of IRF7 generally requires virus-induced C-terminal phosphorylation, which leads to its nuclear accumulation and activation of target genes. Here we use the Epstein-Barr virus (EBV) oncoprotein LMP1, which activates IRF7, to identify factors involved in IRF7 activation. We demonstrate for the first time that RIP activates IRF7 and that RIP and IRF7 interact under physiological conditions in EBV-positive Burkitt's lymphoma cells. We provide evidence that both RIP and IRF7 are ubiquitinated in these cells and that IRF7 preferentially interacts with ubiquitinated RIP. RIP is required for full activation of IRF7 by LMP1, with LMP1 stimulating the ubiquitination of RIP and its interaction with IRF7. Moreover, LMP1 stimulates RIP-dependent K63-linked ubiquitination of IRF7, which regulates protein function rather than proteasomal degradation of proteins. We suggest that RIP may serve as a general activator of IRF7, responding to and transmitting the signals from various stimuli, and that ubiquitination may be a general mechanism for enhancing the activity of IRF7. PMID:17296724

  9. Highly recurring sequence elements identified in eukaryotic DNAs by computer analysis are often homologous to regulatory sequences or protein binding sites.

    PubMed Central

    Bodnar, J W; Ward, D C

    1987-01-01

    We have used computer assisted dot matrix and oligonucleotide frequency analyses to identify highly recurring sequence elements of 7-11 base pairs in eukaryotic genes and viral DNAs. Such elements are found much more frequently than expected, often with an average spacing of a few hundred base pairs. Furthermore, the most abundant repetitive elements observed in the ovalbumin locus, the beta-globin gene cluster, the metallothionein gene and the viral genomes of SV40, polyoma, Herpes simplex-1 and Mouse Mammary Tumor Virus were sequences shown previously to be protein binding sites or sequences important for regulating gene expression. These sequences were present in both exons and introns as well as promoter regions. These observations suggest that such sequences are often highly overrepresented within the specific gene segments with which they are associated. Computer analysis of other genetic units, including viral genomes and oncogenes, has identified a number of highly recurring sequence elements that could serve similar regulatory or protein-binding functions. A model for the role of such reiterated sequence elements in DNA organization and function is presented. PMID:3822840

  10. Mangiferin inhibits macrophage classical activation via downregulating interferon regulatory factor 5 expression.

    PubMed

    Wei, Zhiquan; Yan, Li; Chen, Yixin; Bao, Chuanhong; Deng, Jing; Deng, Jiagang

    2016-08-01

    Mangiferin is a natural polyphenol and the predominant effective component of Mangifera indica Linn. leaves. For hundreds of years, Mangifera indica Linn. leaf has been used as an ingredient in numerous traditional Chinese medicine preparations for the treatment of bronchitis. However, the pharmacological mechanism of mangiferin in the treatment of bronchitis remains to be elucidated. Macrophage classical activation is important role in the process of bronchial airway inflammation, and interferon regulatory factor 5 (IRF5) has been identified as a key regulatory factor for macrophage classical activation. The present study used the THP‑1 human monocyte cell line to investigate whether mangiferin inhibits macrophage classical activation via suppressing IRF5 expression in vitro. THP‑1 cells were differentiated to macrophages by phorbol 12‑myristate 13‑acetate. Macrophages were polarized to M1 macrophages following stimulation with lipopolysaccharide (LPS)/interferon‑γ (IFN‑γ). Flow cytometric analysis was conducted to detect the M1 macrophages. Reverse transcription‑quantitative polymerase chain reaction was used to investigate cellular IRF5 gene expression. Levels of proinflammatory cytokines and IRF5 were assessed following cell culture and cellular homogenization using enzyme‑linked immunosorbent assay. IRF5 protein and nuclei co‑localization was performed in macrophages with laser scanning confocal microscope immunofluorescence analysis. The results of the present study demonstrated that mangiferin significantly inhibits LPS/IFN‑γ stimulation‑induced classical activation of macrophages in vitro and markedly decreases proinflammatory cytokine release. In addition, cellular IRF5 expression was markedly downregulated. These results suggest that the inhibitory effect of mangiferin on classical activation of macrophages may be exerted via downregulation of cellular IRF5 expression levels. PMID:27277156

  11. Mangiferin inhibits macrophage classical activation via downregulating interferon regulatory factor 5 expression

    PubMed Central

    Wei, Zhiquan; Yan, Li; Chen, Yixin; Bao, Chuanhong; Deng, Jing; Deng, Jiagang

    2016-01-01

    Mangiferin is a natural polyphenol and the predominant effective component of Mangifera indica Linn. leaves. For hundreds of years, Mangifera indica Linn. leaf has been used as an ingredient in numerous traditional Chinese medicine preparations for the treatment of bronchitis. However, the pharmacological mechanism of mangiferin in the treatment of bronchitis remains to be elucidated. Macrophage classical activation is important role in the process of bronchial airway inflammation, and interferon regulatory factor 5 (IRF5) has been identified as a key regulatory factor for macrophage classical activation. The present study used the THP-1 human monocyte cell line to investigate whether mangiferin inhibits macrophage classical activation via suppressing IRF5 expression in vitro. THP-1 cells were differentiated to macrophages by phorbol 12-myristate 13-acetate. Macrophages were polarized to M1 macrophages following stimulation with lipopolysaccharide (LPS)/interferon-γ (IFN-γ). Flow cytometric analysis was conducted to detect the M1 macrophages. Reverse transcription-quantitative polymerase chain reaction was used to investigate cellular IRF5 gene expression. Levels of proinflammatory cytokines and IRF5 were assessed following cell culture and cellular homogenization using enzyme-linked immunosorbent assay. IRF5 protein and nuclei co-localization was performed in macrophages with laser scanning confocal microscope immunofluorescence analysis. The results of the present study demonstrated that mangiferin significantly inhibits LPS/IFN-γ stimulation-induced classical activation of macrophages in vitro and markedly decreases proinflammatory cytokine release. In addition, cellular IRF5 expression was markedly downregulated. These results suggest that the inhibitory effect of mangiferin on classical activation of macrophages may be exerted via downregulation of cellular IRF5 expression levels. PMID:27277156

  12. Structural Insights into Proteasome Activation by the 19S Regulatory Particle

    PubMed Central

    Ehlinger, Aaron; Walters, Kylie J.

    2013-01-01

    Since its discovery in the late 1970s, the ubiquitin-proteasome system (UPS) has become recognized as the major pathway for regulated cellular proteolysis. Processes ranging from cell cycle control, pathogen resistance, and protein quality control rely on selective protein degradation at the proteasome for homeostatic function. Perhaps as a consequence of the importance of this pathway, and the genesis of severe diseases upon its dysregulation, protein degradation by the UPS is highly controlled from the level of substrate recognition to proteolysis. Technological advances over the last decade have created an explosion of structural and mechanistic information that has underscored the complexity of the proteasome and its upstream regulatory factors. Significant insights have come from study of the 19S proteasome regulatory particle (RP) responsible for recognition and processing of ubiquitinated substrates destined for proteolysis. Established as a highly dynamic proteasome activator, a large number of both permanent and transient RP components with specialized functional roles are critical for proteasome function. In this review, we highlight recent mechanistic developments in the study of proteasome activation by the RP and how they provide context to our current understanding of the UPS. PMID:23672618

  13. An NF-κB and Slug Regulatory Loop Active in Early Vertebrate Mesoderm

    PubMed Central

    Zhang, Chi; Carl, Timothy F.; Trudeau, Evan D.; Simmet, Thomas; Klymkowsky, Michael W.

    2006-01-01

    Background In both Drosophila and the mouse, the zinc finger transcription factor Snail is required for mesoderm formation; its vertebrate paralog Slug (Snai2) appears to be required for neural crest formation in the chick and the clawed frog Xenopus laevis. Both Slug and Snail act to induce epithelial to mesenchymal transition (EMT) and to suppress apoptosis. Methodology & Principle Findings Morpholino-based loss of function studies indicate that Slug is required for the normal expression of both mesodermal and neural crest markers in X. laevis. Both phenotypes are rescued by injection of RNA encoding the anti-apoptotic protein Bcl-xL; Bcl-xL's effects are dependent upon IκB kinase-mediated activation of the bipartite transcription factor NF-κB. NF-κB, in turn, directly up-regulates levels of Slug and Snail RNAs. Slug indirectly up-regulates levels of RNAs encoding the NF-κB subunit proteins RelA, Rel2, and Rel3, and directly down-regulates levels of the pro-apopotic Caspase-9 RNA. Conclusions/Significance These studies reveal a Slug/Snail–NF-κB regulatory circuit, analogous to that present in the early Drosophila embryo, active during mesodermal formation in Xenopus. This is a regulatory interaction of significance both in development and in the course of inflammatory and metastatic disease. PMID:17205110

  14. Activation of IFN-beta element by IRF-1 requires a posttranslational event in addition to IRF-1 synthesis.

    PubMed Central

    Watanabe, N; Sakakibara, J; Hovanessian, A G; Taniguchi, T; Fujita, T

    1991-01-01

    Expression of the Type I IFN (i.e., IFN-alpha s and IFN-beta) genes is efficiently induced by viruses at the transcriptional level. This induction is mediated by at least two types of positive regulatory elements located in the human IFN-beta gene promoter: (1) the repeated elements which bind both the transcriptional activator IRF-1 and the repressor IRF-2 (IRF-elements; IRF-Es), and (2) the kappa B element (kappa B-E), which binds NF kappa B and is located between the IRF-Es and the TATA box. In this study we demonstrate that a promoter containing synthetic IRF-E, which displays high affinity for the IRFs can be efficiently activated by Newcastle disease virus (NDV). In contrast, such activation was either very weak or nil when cells were treated by IFN-beta or tumor necrosis factor-alpha (TNF-alpha), despite the fact they both efficiently induce de novo synthesis of the short-lived IRF-1 in L929 cells. In fact, efficient activation of the IRF-E apparently requires an event in addition to de novo IRF-1 induction, which can be elicited by NDV even in the presence of protein synthesis inhibitor, cycloheximide. Moreover, efficient activation of the IRF-E by NDV is specifically inhibited by the protein kinase inhibitor, Staurosporin. Hence our results suggest the importance of IRF-1 synthesis and post-translational modification event(s), possibly phosphorylation for the efficient activation of IRF-Es, which are otherwise under negative regulation by IRF-2. Images PMID:1886766

  15. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome

    PubMed Central

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A.

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. PMID:25324314

  16. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.

    PubMed

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. PMID:25324314

  17. Unexpected T cell regulatory activity of anti-histone H1 autoantibody: Its mode of action in regulatory T cell-dependent and -independent manners

    SciTech Connect

    Takaoka, Yuki; Kawamoto, Seiji; Katayama, Akiko; Nakano, Toshiaki; Yamanaka, Yasushi; Takahashi, Miki; Shimada, Yayoi; Chiang, Kuei-Chen; Ohmori, Naoya; Aki, Tsunehiro; Goto, Takeshi; Sato, Shuji; Goto, Shigeru; Chen, Chao-Long; Ono, Kazuhisa

    2013-02-08

    Highlights: ► Anti-histone H1 autoantibody (anti-H1) acts on T cells to inhibit their activation. ► Anti-H1 suppresses T cell activation in Treg cell-dependent and -independent manners. ► Suboptimal dose of anti-H1 enhances suppressor function of Treg cells. ► High dose of anti-H1 directly inhibits T cell receptor signaling. -- Abstract: Induction of anti-nuclear antibodies against DNA or histones is a hallmark of autoimmune disorders, but their actual contribution to disease predisposition remains to be clarified. We have previously reported that autoantibodies against histone H1 work as a critical graft survival factor in a rat model of tolerogeneic liver transplantation. Here we show that an immunosuppressive anti-histone H1 monoclonal antibody (anti-H1 mAb) acts directly on T cells to inhibit their activation in response to T cell receptor (TCR) ligation. Intriguingly, the T cell activation inhibitory activity of anti-H1 mAb under suboptimal dosages required regulatory T (Treg) cells, while high dose stimulation with anti-H1 mAb triggered a Treg cell-independent, direct negative regulation of T cell activation upon TCR cross-linking. In the Treg cell-dependent mode of immunosuppressive action, anti-H1 mAb did not induce the expansion of CD4{sup +}Foxp3{sup +} Treg cells, but rather potentiated their regulatory capacity. These results reveal a previously unappreciated T cell regulatory role of anti-H1 autoantibody, whose overproduction is generally thought to be pathogenic in the autoimmune settings.

  18. Changes in FDA enforcement activities following changes in federal administration: the case of regulatory letters released to pharmaceutical companies

    PubMed Central

    2013-01-01

    Background The United States (US) Food and Drug Administration (FDA) is responsible for the protection of the public health by assuring the safety, effectiveness and security of human drugs and biological products through the enforcement of the Federal Food, Drug and Cosmetic Act (FDCA) and related regulations. These enforcement activities include regulatory letters (i.e. warning letters and notice of violation) to pharmaceutical companies. A regulatory letter represents the FDA’s first official notification to a pharmaceutical company that the FDA has discovered a product or activity in violation of the FDCA. This study analyzed trends in the pharmaceutical-related regulatory letters released by the FDA during the period 1997–2011 and assessed differences in the average number and type of regulatory letters released during the last four federal administrations. Methods Data derived from the FDA webpage. Information about the FDA office releasing the letter, date, company, and drug-related violation was collected. Regulatory letters were classified by federal administration. Descriptive statistics were performed for the analysis. Results Between 1997 and 2011 the FDA released 2,467 regulatory letters related to pharmaceuticals. FDA headquarters offices released 50.6% and district offices 49.4% of the regulatory letters. The Office of Prescription Drug Promotion released the largest number of regulatory letters (850; 34.5% of the total), followed by the Office of Scientific Investigations (131; 5.3%), and the Office of Compliance (105; 4.3%). During the 2nd Clinton Administration (1997–2000) the average number of regulatory letters per year was 242.8 ± 45.6, during the Bush Administration (2001–2008) it was 120.4 ± 33.7, and during the first three years of the Obama administration (2009–2011) it was 177.7.0 ± 17.0. The average number of regulatory letters released by the Office of Prescription Drug Promotion also varied by administration

  19. Continuous Activation of Autoreactive CD4+ CD25+ Regulatory T Cells in the Steady State

    PubMed Central

    Fisson, Sylvain; Darrasse-Jèze, Guillaume; Litvinova, Elena; Septier, Franck; Klatzmann, David; Liblau, Roland; Salomon, Benoît L.

    2003-01-01

    Despite a growing interest in CD4+ CD25+ regulatory T cells (Treg) that play a major role in self-tolerance and immunoregulation, fundamental parameters of the biology and homeostasis of these cells are poorly known. Here, we show that this population is composed of two Treg subsets that have distinct phenotypes and homeostasis in normal unmanipulated mice. In the steady state, some Treg remain quiescent and have a long lifespan, in the order of months, whereas the other Treg are dividing extensively and express multiple activation markers. After adoptive transfer, tissue-specific Treg rapidly divide and expand preferentially in lymph nodes draining their target self-antigens. These results reveal the existence of a cycling Treg subset composed of autoreactive Treg that are continuously activated by tissue self-antigens. PMID:12939344

  20. Effects of self-regulatory strength depletion on muscular performance and EMG activation.

    PubMed

    Bray, Steven R; Martin Ginis, Kathleen A; Hicks, Audrey L; Woodgate, Jennifer

    2008-03-01

    The purpose of the present study was to examine the effects of a self-regulatory strength depletion manipulation on performance of a physical endurance (isometric handgrip) task. In addition, the effect of depletion on EMG activity in the working forearm muscles during the endurance task was explored. Sedentary undergraduates (N=49) were randomly assigned to either a cognitive depletion condition (modified Stroop task) or a control (color word) group and completed two maximal isometric exercise endurance trials separated by the cognitive task. Participants in the depletion group showed significant (p<.05) degradations in performance and exhibited higher EMG activation on the second endurance trial (p<.05) compared to controls. Results are consistent with the limited strength model of self-regulation and are interpreted in light of the central fatigue hypothesis. PMID:17995906

  1. LWRS II&C Industry and Regulatory Engagement Activities for FY 11

    SciTech Connect

    Ken Thomas

    2011-09-01

    To ensure broad industry support and coordination for the Advanced Instrumentation, Information, and Controls (II&C) Systems Technologies research pathway, an engagement process will be continually pursued with nuclear asset owners, vendors, and suppliers, Nuclear Regulatory Commission (NRC), and the major industry support organizations of Electric Power Research Institute (EPRI), Institute of Nuclear Power Operations (INPO), and Nuclear Energy Institute (NEI). Nuclear asset owner engagement is a necessary and enabling activity to obtain data and accurate characterization of long-term operational challenges, assess the suitability of proposed research for addressing long-term needs, and gain access to data and representative infrastructure and expertise needed to ensure success of the proposed research and development (R&D) activities. Engagement with vendors and suppliers will ensure that vendor expectations and needs can be translated into requirements that can be met through technology commercialization.

  2. Optimization of codon composition and regulatory elements for expression of human insulin like growth factor-1 in transgenic chloroplasts and evaluation of structural identity and function

    PubMed Central

    Daniell, Henry; Ruiz, Gricel; Denes, Bela; Sandberg, Laurence; Langridge, William

    2009-01-01

    Background Transgenic chloroplasts are potential bioreactors for recombinant protein production, especially for achievement of high levels of protein expression and proper folding. Production of therapeutic proteins in leaves provides transgene containment by elimination of reproductive structures. Therefore, in this study, human Insulin like Growth Factor-1 is expressed in transgenic chloroplasts for evaluation of structural identity and function. Results Expression of the synthetic Insulin like Growth Factor 1 gene (IGF-1s, 60% AT) was observed in transformed E. coli. However, no native IGF-1 gene (IGF-1n, 41% AT) product was detected in the western blots in E. coli. Site-specific integration of the transgenes into the tobacco chloroplast genome was confirmed after transformation using PCR. Southern blot analysis confirmed that the transgenic lines were homoplasmic. The transgenic plant lines had IGF-1s expression levels of 11.3% of total soluble protein (TSP). The IGF-1n plants contained 9.5% TSP as IGF-1n, suggesting that the chloroplast translation machinery is more flexible than E. coli in codon preference and usage. The expression of IGF-1 was increased up to 32% TSP under continuous illumination by the chloroplast light regulatory elements. IgG-Sepharose affinity column chromatographic separation of Z domain containing chloroplast derived IGF-1 protein, single and two dimensional electrophoresis methods and mass spectrometer analysis confirmed the identity of human IGF-1 in transgenic chloroplasts. Two spots analyzed from 2-D focusing/phoresis acrylamide gel showed the correct amino acid sequence of human IGF-1 and the S. aureus Z-tag. Cell proliferation assays in human HU-3 cells demonstrated the biological activity of chloroplast derived IGF-1 even in the presence of the S. aureus Z tag. Conclusion This study demonstrates that the human Insulin like Growth Factor-1 expressed in transgenic chloroplasts is identical to the native protein and is fully

  3. Identification of Rhizobium-specific intergenic mosaic elements within an essential two-component regulatory system of Rhizobium species.

    PubMed Central

    Osterås, M; Stanley, J; Finan, T M

    1995-01-01

    Analysis of the DNA regions upstream of the phosphoenolpyruvate carboxykinase gene (pckA) in Rhizobium meliloti and Rhizobium sp. strain NGR234 identified an open reading frame which was highly homologous to the Agrobacterium tumefaciens chromosomal virulence gene product ChvI. A second gene product, 500 bp downstream of the chvI-like gene in R. meliloti, was homologous to the A. tumefaciens ChvG protein. The homology between the R. meliloti and A. tumefaciens genes was confirmed, because the R. meliloti chvI and chvG genes complemented A. tumefaciens chvI and chvG mutants for growth on complex media. We were unable to construct chvI or chvG insertion mutants of R. meliloti, whereas mutants carrying insertions outside of these genes were readily obtained. A 108-bp repeat element characterized by two large palindromes was identified in the chvI and chvG intergenic regions of both Rhizobium species. This element was duplicated in Rhizobium sp. strain NGR234. Another structurally similar element with a size of 109 bp was present in R. meliloti but not in Rhizobium sp. strain NGR234. These elements were named rhizobium-specific intergenic mosaic elements (RIMEs), because their distribution seems to be limited to members of the family Rhizobiaceae. A homology search in GenBank detected six more copies of the first element (RIME1), all in Rhizobium species, and three extra copies of the second element (RIME2), only in R. meliloti. Southern blot analysis with a probe specific to RIME1 showed the presence of several copies of the element in the genome of R. meliloti, Rhizobium sp. strain NGR234, Rhizobium leguminosarum, and Agrobacterium rhizogenes, but none was present in A. tumefaciens and Bradyrhizobium japonicum. PMID:7559334

  4. Nuclear Thermal Rocket Element Environmental Simulator (NTREES) Upgrade Activities

    NASA Technical Reports Server (NTRS)

    Emrich, William J. Jr.; Moran, Robert P.; Pearson, J. Boise

    2012-01-01

    To support the on-going nuclear thermal propulsion effort, a state-of-the-art non nuclear experimental test setup has been constructed to evaluate the performance characteristics of candidate fuel element materials and geometries in representative environments. The facility to perform this testing is referred to as the Nuclear Thermal Rocket Element Environment Simulator (NTREES). This device can simulate the environmental conditions (minus the radiation) to which nuclear rocket fuel components will be subjected during reactor operation. Test articles mounted in the simulator are inductively heated in such a manner so as to accurately reproduce the temperatures and heat fluxes which would normally occur as a result of nuclear fission and would be exposed to flowing hydrogen. Initial testing of a somewhat prototypical fuel element has been successfully performed in NTREES and the facility has now been shutdown to allow for an extensive reconfiguration of the facility which will result in a significant upgrade in its capabilities

  5. Trace elements by instrumental neutron activation analysis for pollution monitoring

    NASA Technical Reports Server (NTRS)

    Sheibley, D. W.

    1975-01-01

    Methods and technology were developed to analyze 1000 samples/yr of coal and other pollution-related samples. The complete trace element analysis of 20-24 samples/wk averaged 3-3.5 man-hours/sample. The computerized data reduction scheme could identify and report data on as many as 56 elements. In addition to coal, samples of fly ash, bottom ash, crude oil, fuel oil, residual oil, gasoline, jet fuel, kerosene, filtered air particulates, ore, stack scrubber water, clam tissue, crab shells, river sediment and water, and corn were analyzed. Precision of the method was plus or minus 25% based on all elements reported in coal and other sample matrices. Overall accuracy was estimated at 50%.

  6. Interferon regulatory factors and TFIIB cooperatively regulate interferon-responsive promoter activity in vivo and in vitro.

    PubMed Central

    Wang, I M; Blanco, J C; Tsai, S Y; Tsai, M J; Ozato, K

    1996-01-01

    Interferon regulatory factors (IRFs) bind to the interferon-stimulated response element (ISRE) and regulate interferon- and virus-mediated gene expression. IRF-1 acts as a transcriptional activator, while IRF-2 acts as a repressor. Here we show that IRF-1 and IRF-2 bind to both cellular TFIIB, a component of the basal transcription machinery, and recombinant TFIIB (rTFIIB) and that this protein-protein interaction facilitates binding of IRFs to the ISRE. A functional interaction between TFIIB and IRF was assessed by a newly established in vitro transcription assay in which recombinant IRF-1 (rIRF-1) stimulated transcription specifically from an ISRE-containing template. With this assay we show that rIRF-1 and rTFIIB cooperatively enhance the ISRE promoter in vitro. We found that the activity of an ISRE-containing promoter was cooperatively enhanced upon cotransfection of TFIIB and IRF-1 cDNAs into P19 embryonal carcinoma cells, further demonstrating functional interactions in vivo. The cooperative enhancement by TFIIB and IRF-1 was independent of the TATA sequence in the ISRE promoter but dependent on the initiator sequence (Inr) and was abolished when P19 cells were induced to differentiate by retinoic acid treatment. In contrast, cotransfection of TFIIB and IRF-1 into NIH 3T3 cells resulted in a dose-dependent repression of promoter activation which occurred in a TATA-dependent manner. Our results indicate the presence of a cell type-specific factor that mediates the functional interaction between IRFs and TFIIB and that acts in conjunction with the requirement of TATA and Inr for promoter activation. PMID:8887661

  7. Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

    PubMed Central

    Haidar, M A; Henning, D; Busch, H

    1991-01-01

    Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription. Images PMID:1754393

  8. Examining cooperative binding of Sox2 on DC5 regulatory element upon complex formation with Pax6 through excess electron transfer assay.

    PubMed

    Saha, Abhijit; Kizaki, Seiichiro; De, Debojyoti; Endo, Masayuki; Kim, Kyeong Kyu; Sugiyama, Hiroshi

    2016-08-19

    Functional cooperativity among transcription factors on regulatory genetic elements is pivotal for milestone decision-making in various cellular processes including mammalian development. However, their molecular interaction during the cooperative binding cannot be precisely understood due to lack of efficient tools for the analyses of protein-DNA interaction in the transcription complex. Here, we demonstrate that photoinduced excess electron transfer assay can be used for analysing cooperativity of proteins in transcription complex using cooperative binding of Pax6 to Sox2 on the regulatory DNA element (DC5 enhancer) as an example. In this assay, (Br)U-labelled DC5 was introduced for the efficient detection of transferred electrons from Sox2 and Pax6 to the DNA, and guanine base in the complementary strand was replaced with hypoxanthine (I) to block intra-strand electron transfer at the Sox2-binding site. By examining DNA cleavage occurred as a result of the electron transfer process, from tryptophan residues of Sox2 and Pax6 to DNA after irradiation at 280 nm, we not only confirmed their binding to DNA but also observed their increased occupancy on DC5 with respect to that of Sox2 and Pax6 alone as a result of their cooperative interaction. PMID:27229137

  9. Constitutive transcription of the osteocalcin gene in osteosarcoma cells is reflected by altered protein-DNA interactions at promoter regulatory elements.

    PubMed Central

    Bortell, R; Owen, T A; Shalhoub, V; Heinrichs, A; Aronow, M A; Rochette-Egly, C; Lutz, Y; Stein, J L; Lian, J B; Stein, G S

    1993-01-01

    The bone-specific osteocalcin (OC) gene is transcribed only after completion of proliferation in normal diploid calvarial-derived osteoblasts during extracellular matrix mineralization. In contrast, the OC gene is expressed constitutively in both proliferating and nonproliferating ROS 17/2.8 osteosarcoma cells. To address molecular mechanisms associated with these tumor-related modifications in transcriptional control, we examined sequence-specific interactions of transactivation factors at key basal and hormone-responsive elements in the OC gene promoter. In ROS 17/2.8 cells compared to normal diploid osteoblasts, the absence of a stringent requirement for cessation of proliferation to support both induction of OC transcription and steroid hormone-mediated transcriptional modulation is reflected by modifications in transcription factor binding at (i) the two primary basal regulatory elements, the OC box (which contains a CCAAT motif as a central core) and the TATA/glucocorticoid-responsive element domain, and (ii) the vitamin D-responsive element. Particularly striking are two forms of the vitamin D receptor complex that are present in proliferating osteoblasts and osteosarcoma cells. Both forms of the complex are sensitive to vitamin D receptor antibody and retinoic X receptor antibody. After the down-regulation of proliferation, only the lower molecular weight complex is found in normal diploid osteoblasts. Both forms of the complex are present in nonproliferating ROS 17/2.8 cells with increased representation of the complex exhibiting reduced electrophoretic mobility that is phosphorylation-dependent. Images Fig. 3 Fig. 5 Fig. 6 PMID:8460137

  10. A discrete element 3' of human immunodeficiency virus 1 (HIV-1) and HIV-2 mRNA initiation sites mediates transcriptional activation by an HIV trans activator

    SciTech Connect

    Jakobovits, A.; Smith, D.H.; Jakobovits, E.B.; Capon, D.J.

    1988-06-01

    An important point of regulation in the reproductive growth and latency of the human and simian immunodeficiency viruses (HIV and SIV, respectively) is provided by virally encoded trans-activators (tat), proteins capable of dramatically increasing viral gene expression. The mechanism of this autostimulatory pathway has remained unclear, however, with substantial effects having been reported at the level of either mRNA accumulation, translational efficiency, or both. The authors' previous findings indicated that trans-activation results primarily from induction of RNA levels but could not distinguish between the roles of transcriptional rate, RNA stabilization, and RNA transport in this event. In addition, the boundaries of tat-responding elements, which would be valuable in elucidating the mode of tat action, are not precisely known. In this study, HIV-1 and HIV-2 long terminal repeat-directed expression was characterized by using in an vitro nuclear transcription assay to clarify this mechanism, and a detailed mutational analysis was undertaken to localize precisely the sequences participating in this process. Two key findings were revealed: an increased transcription rate was the primary event in tat-mediated activation of HIV-1 and HIV-2, and trans-activation was impaired by mutations in two regions, the TATA box and sequences between +19 to +42, a region lacking enhancer activity. These results implicate a discrete 3' regulatory element in the transcriptional activation of the HIVs.

  11. Finite Element Learning Modules as Active Learning Tools

    ERIC Educational Resources Information Center

    Brown, Ashland O.; Jensen, Daniel; Rencis, Joseph; Wood, Kristin; Wood, John; White, Christina; Raaberg, Kristen Kaufman; Coffman, Josh

    2012-01-01

    The purpose of active learning is to solicit participation by students beyond the passive mode of traditional classroom lectures. Reading, writing, participating in discussions, hands-on activities, engaging in active problem solving, and collaborative learning can all be involved. The skills acquired during active learning tend to go above and…

  12. Trace elements removal from water using modified activated carbon.

    PubMed

    Campos, V; Buchler, P M

    2008-02-01

    This paper present the possible alternative options for the remove of trace elements from drinking water supplies in the trace. Arsenic and chromium are two of the most toxic pollutants, introduced into natural waters from a variety of sources and causing various adverse effects on living bodies. The performance of three filter bed methods was evaluated in the laboratory. Experiments were conducted to investigate the sorption of arsenic and chromium on carbon steel and removal of trace elements from drinking water with a household filtration process. The affinity of the arsenic and chromium species for Fe/Fe3C (iron/iron carbide) sites is the key factor controlling the removal of the elements. The method is based on the use of powdered block carbon, powder carbon steel and ceramic spheres in the ion-sorption columns as a cleaning process. The modified powdered block carbon is a satisfactory and economical sorbent for trace elements (arsenite and chromate) dissolved in water due to its low unit cost of about $23 and compatibility with the traditional household filtration system. PMID:18613611

  13. ELEMENTAL MERCURY ADSORPTION BY ACTIVATED CARBON TREATED WITH SULFURIC ACID

    EPA Science Inventory

    The paper gives results of a study of the adsorption of elemental mercury at 125 C by a sulfuric-acid (H2S04, 50% w/w/ solution)-treated carbon for the removal of mercury from flue gas. The pore structure of the sample was characterized by nitrogen (N2) at -196 C and the t-plot m...

  14. Six homeoproteins directly activate Myod expression in the gene regulatory networks that control early myogenesis.

    PubMed

    Relaix, Frédéric; Demignon, Josiane; Laclef, Christine; Pujol, Julien; Santolini, Marc; Niro, Claire; Lagha, Mounia; Rocancourt, Didier; Buckingham, Margaret; Maire, Pascal

    2013-04-01

    In mammals, several genetic pathways have been characterized that govern engagement of multipotent embryonic progenitors into the myogenic program through the control of the key myogenic regulatory gene Myod. Here we demonstrate the involvement of Six homeoproteins. We first targeted into a Pax3 allele a sequence encoding a negative form of Six4 that binds DNA but cannot interact with essential Eya co-factors. The resulting embryos present hypoplasic skeletal muscles and impaired Myod activation in the trunk in the absence of Myf5/Mrf4. At the axial level, we further show that Myod is still expressed in compound Six1/Six4:Pax3 but not in Six1/Six4:Myf5 triple mutant embryos, demonstrating that Six1/4 participates in the Pax3-Myod genetic pathway. Myod expression and head myogenesis is preserved in Six1/Six4:Myf5 triple mutant embryos, illustrating that upstream regulators of Myod in different embryonic territories are distinct. We show that Myod regulatory regions are directly controlled by Six proteins and that, in the absence of Six1 and Six4, Six2 can compensate. PMID:23637613

  15. Gluconacetobacter diazotrophicus PAL5 possesses an active quorum sensing regulatory system.

    PubMed

    Bertini, Elisa V; Nieto Peñalver, Carlos G; Leguina, Ana C; Irazusta, Verónica P; de Figueroa, Lucía I C

    2014-09-01

    The endophytic bacterium Gluconacetobacter diazotrophicus colonizes a broad range of host plants. Its plant growth-promoting capability is related to the capacity to perform biological nitrogen fixation, the biosynthesis of siderophores, antimicrobial substances and the solubilization of mineral nutrients. Colonization of and survival in these endophytic niche requires a complex regulatory network. Among these, quorum sensing systems (QS) are signaling mechanisms involved in the control of several genes related to microbial interactions, host colonization and stress survival. G. diazotrophicus PAL5 possesses a QS composed of a luxR and a luxI homolog, and produces eight molecules from the AHL family as QS signals. In this report data are provided showing that glucose concentration modifies the relative levels of these signal molecules. The activity of G. diazotrophicus PAL5 QS is also altered in presence of other carbon sources and under saline stress conditions. Inactivation of the QS system of G. diazotrophicus PAL5 by means of a quorum quenching strategy allowed the identification of extracellular and intracellular proteins under the control of this regulatory mechanism. PMID:24974195

  16. GITR ligand-costimulation activates effector and regulatory functions of CD4{sup +} T cells

    SciTech Connect

    Igarashi, Hanna; Cao, Yujia; Iwai, Hideyuki; Piao, Jinhua; Kamimura, Yosuke; Hashiguchi, Masaaki; Amagasa, Teruo; Azuma, Miyuki

    2008-05-16

    Engagement of glucocorticoid-induced TNFR-related protein (GITR) enables the costimulation of both CD25{sup -}CD4{sup +} effector (Teff) and CD25{sup +}CD4{sup +} regulatory (Treg) cells; however, the effects of GITR-costimulation on Treg function remain controversial. In this study, we examined the effects of GITR ligand (GITRL) binding on the respective functions of CD4{sup +} T cells. GITRL-P815 transfectants efficiently augmented anti-CD3-induced proliferation and cytokine production by Teff cells. Proliferation and IL-10 production in Treg were also enhanced by GITRL transfectants when exogenous IL-2 and stronger CD3 stimulation was provided. Concomitant GITRL-costimulation of Teff and Treg converted the anergic state of Treg into a proliferating state, maintaining and augmenting their function. Thus, GITRL-costimulation augments both effector and regulatory functions of CD4{sup +} T cells. Our results suggest that highly activated and increased ratios of Treg reverse the immune-enhancing effects of GITRL-costimulation in Teff, which may be problematic for therapeutic applications using strong GITR agonists.

  17. Regulatory T cells and chronic immune activation in human immunodeficiency virus 1 (HIV-1)-infected children

    PubMed Central

    Freguja, R; Gianesin, K; Mosconi, I; Zanchetta, M; Carmona, F; Rampon, O; Giaquinto, C; De Rossi, A

    2011-01-01

    The function of CD4+ T cells with regulatory activity (Tregs) is the down-regulation of immune responses. This suppressive activity may limit the magnitude of effector responses, resulting in failure to control human immunodeficiency virus 1 (HIV-1) infection, but may also suppress chronic immune activation, a characteristic feature of HIV-1 disease. We evaluated the correlation between viral load, immune activation and Tregs in HIV-1-infected children. Eighty-nine HIV-1-infected children (aged 6–14 years) were included in the study and analysed for HIV-1 plasmaviraemia, HIV-1 DNA load, CD4 and CD8 cell subsets. Treg cells [CD4+ CD25highCD127lowforkhead box P3 (FoxP3high)] and CD8-activated T cells (CD8+CD38+) were determined by flow cytometry. Results showed that the number of activated CD8+CD38+ T cells increased in relation to HIV-1 RNA plasmaviraemia (r = 0·403, P < 0·0001). The proportion of Tregs also correlated positively with HIV-1 plasmaviraemia (r = 0·323, P = 0·002), but correlated inversely with CD4+ cells (r = −0·312, P = 0·004), thus suggesting a selective expansion along with increased viraemia and CD4+ depletion. Interestingly, a positive correlation was found between the levels of Tregs and CD8+CD38+ T cells (r = 0·305, P = 0·005), and the percentage of Tregs tended to correlate with HIV-1 DNA load (r = 0·224, P = 0·062). Overall, these findings suggest that immune activation contributes to the expansion of Treg cells. In turn, the suppressive activity of Tregs may impair effector responses against HIV-1, but appears to be ineffective in limiting immune activation. PMID:21438872

  18. Preparing for physical activity: pedometer acquisition as a self-regulatory strategy.

    PubMed

    Koring, Milena; Parschau, Linda; Lange, Daniela; Fleig, Lena; Knoll, Nina; Schwarzer, Ralf

    2013-03-01

    When people intend and plan to perform higher levels of physical activity, they do not start on impulse without preparing. Thus, preparation is a behavioral construct positioned between planning and target behavior. This may be reflected by the acquisition of sports equipment as well as monitoring devices such as pedometers. The research questions are who takes such preparatory action, whether picking up a complimentary pedometer can be predicted by self-efficacy and outcome expectancies, and whether this kind of preparatory action facilitates subsequent physical activity. A longitudinal physical activity survey was conducted with 143 university students who were offered a complimentary pedometer. Collecting this free gift served as indicator of preparatory behavior. Outcome expectancies and self-efficacy beliefs were specified as predictors of this behavior. Two weeks later, physical activity differences between the groups were determined. Collecting the pedometer was associated with higher levels of physical activity at follow-up. Outcome expectancies failed to predict the pedometer collection, but self-efficacy did. An interaction between these two factors indicated that self-efficacy compensated for low outcome expectancies. Pedometer acquisition signifies a preparatory action that is facilitated by self-efficacy. Positioned between planning and target behavior, they constitute a proximal self-regulatory step towards health behavior change. PMID:23457088

  19. APC Activation Restores Functional CD4+CD25+ Regulatory T Cells in NOD Mice that Can Prevent Diabetes Development

    PubMed Central

    Manirarora, Jean N.; Kosiewicz, Michele M.; Parnell, Sarah A.; Alard, Pascale

    2008-01-01

    Background Defects in APC and regulatory cells are associated with diabetes development in NOD mice. We have shown previously that NOD APC are not effective at stimulating CD4+CD25+ regulatory cell function in vitro. We hypothesize that failure of NOD APC to properly activate CD4+CD25+ regulatory cells in vivo could compromise their ability to control pathogenic cells, and activation of NOD APC could restore this defect, thereby preventing disease. Methodology/Principal Findings To test these hypotheses, we used the well-documented ability of complete Freund's adjuvant (CFA), an APC activator, to prevent disease in NOD mice. Phenotype and function of CD4+CD25+ regulatory cells from untreated and CFA-treated NOD mice were determined by FACS, and in vitro and in vivo assays. APC from these mice were also evaluated for their ability to activate regulatory cells in vitro. We have found that sick NOD CD4+CD25+ cells expressed Foxp3 at the same percentages, but decreased levels per cell, compared to young NOD or non-NOD controls. Treatment with CFA increased Foxp3 expression in NOD cells, and also increased the percentages of CD4+CD25+Foxp3+ cells infiltrating the pancreas compared to untreated NOD mice. Moreover, CD4+CD25+ cells from pancreatic LN of CFA-treated, but not untreated, NOD mice transferred protection from diabetes. Finally, APC isolated from CFA-treated mice increased Foxp3 and granzyme B expression as well as regulatory function by NOD CD4+CD25+ cells in vitro compared to APC from untreated NOD mice. Conclusions/Significance These data suggest that regulatory T cell function and ability to control pathogenic cells can be enhanced in NOD mice by activating NOD APC. PMID:19011680

  20. Dynamic Transcription Factor Activity Profiles Reveal Key Regulatory Interactions During Megakaryocytic and Erythroid Differentiation

    PubMed Central

    Duncan, Mark T.; Shin, Seungjin; Wu, Jia J.; Mays, Zachary; Weng, Stanley; Bagheri, Neda; Miller, William M.; Shea, Lonnie D.

    2014-01-01

    The directed differentiation toward erythroid (E) or megakaryocytic (MK) lineages by the MK-E progenitor (MEP) could enhance the ex vivo generation of red blood cells and platelets for therapeutic transfusions. The lineage choice at the MEP bifurcation is controlled in large part by activity within the intracellular signal transduction network, the output of which determines the activity of transcription factors (TFs) and ultimately gene expression. Although many TFs have been implicated, E or MK differentiation is a complex process requiring multiple days, and the dynamics of TF activities during commitment and terminal maturation are relatively unexplored. Herein, we applied a living cell array for the large-scale, dynamic quantification of TF activities during MEP bifurcation. A panel of hematopoietic TFs (GATA-1, GATA-2, SCL/TAL1, FLI-1, NF-E2, PU.1, c-Myb) was characterized during E and MK differentiation of bipotent K562 cells. Dynamic TF activity profiles associated with differentiation towards each lineage were identified, and validated with previous reports. From these activity profiles, we show that GATA-1 is an important hub during early hemin- and PMA-induced differentiation, and reveal several characteristic TF interactions for E and MK differentiation that confirm regulatory mechanisms documented in the literature. Additionally, we highlight several novel TF interactions at various stages of E and MK differentiation. Furthermore, we investigated the mechanism by which nicotinamide (NIC) promoted terminal MK maturation using an MK-committed cell line, CHRF-288-11 (CHRF). Concomitant with its enhancement of ploidy, NIC strongly enhanced the activity of three TFs with known involvement in terminal MK maturation: FLI-1, NF-E2, and p53. Dynamic profiling of TF activity represents a novel tool to complement traditional assays focused on mRNA and protein expression levels to understand progenitor cell differentiation. PMID:24853077

  1. Dynamic transcription factor activity profiles reveal key regulatory interactions during megakaryocytic and erythroid differentiation.

    PubMed

    Duncan, Mark T; Shin, Seungjin; Wu, Jia J; Mays, Zachary; Weng, Stanley; Bagheri, Neda; Miller, William M; Shea, Lonnie D

    2014-10-01

    The directed differentiation toward erythroid (E) or megakaryocytic (MK) lineages by the MK-E progenitor (MEP) could enhance the ex vivo generation of red blood cells and platelets for therapeutic transfusions. The lineage choice at the MEP bifurcation is controlled in large part by activity within the intracellular signal transduction network, the output of which determines the activity of transcription factors (TFs) and ultimately gene expression. Although many TFs have been implicated, E or MK differentiation is a complex process requiring multiple days, and the dynamics of TF activities during commitment and terminal maturation are relatively unexplored. Herein, we applied a living cell array for the large-scale, dynamic quantification of TF activities during MEP bifurcation. A panel of hematopoietic TFs (GATA-1, GATA-2, SCL/TAL1, FLI-1, NF-E2, PU.1, c-Myb) was characterized during E and MK differentiation of bipotent K562 cells. Dynamic TF activity profiles associated with differentiation towards each lineage were identified, and validated with previous reports. From these activity profiles, we show that GATA-1 is an important hub during early hemin- and PMA-induced differentiation, and reveal several characteristic TF interactions for E and MK differentiation that confirm regulatory mechanisms documented in the literature. Additionally, we highlight several novel TF interactions at various stages of E and MK differentiation. Furthermore, we investigated the mechanism by which nicotinamide (NIC) promoted terminal MK maturation using an MK-committed cell line, CHRF-288-11 (CHRF). Concomitant with its enhancement of ploidy, NIC strongly enhanced the activity of three TFs with known involvement in terminal MK maturation: FLI-1, NF-E2, and p53. Dynamic profiling of TF activity represents a novel tool to complement traditional assays focused on mRNA and protein expression levels to understand progenitor cell differentiation. PMID:24853077

  2. The Ebola Virus VP35 Protein Inhibits Activation of Interferon Regulatory Factor 3

    PubMed Central

    Basler, Christopher F.; Mikulasova, Andrea; Martinez-Sobrido, Luis; Paragas, Jason; Mühlberger, Elke; Bray, Mike; Klenk, Hans-Dieter; Palese, Peter; García-Sastre, Adolfo

    2003-01-01

    The Ebola virus VP35 protein was previously found to act as an interferon (IFN) antagonist which could complement growth of influenza delNS1 virus, a mutant influenza virus lacking the influenza virus IFN antagonist protein, NS1. The Ebola virus VP35 could also prevent the virus- or double-stranded RNA-mediated transcriptional activation of both the beta IFN (IFN-β) promoter and the IFN-stimulated ISG54 promoter (C. Basler et al., Proc. Natl. Acad. Sci. USA 97:12289-12294, 2000). We now show that VP35 inhibits virus infection-induced transcriptional activation of IFN regulatory factor 3 (IRF-3)-responsive mammalian promoters and that VP35 does not block signaling from the IFN-α/β receptor. The ability of VP35 to inhibit this virus-induced transcription correlates with its ability to block activation of IRF-3, a cellular transcription factor of central importance in initiating the host cell IFN response. We demonstrate that VP35 blocks the Sendai virus-induced activation of two promoters which can be directly activated by IRF-3, namely, the ISG54 promoter and the ISG56 promoter. Further, expression of VP35 prevents the IRF-3-dependent activation of the IFN-α4 promoter in response to viral infection. The inhibition of IRF-3 appears to occur through an inhibition of IRF-3 phosphorylation. VP35 blocks virus-induced IRF-3 phosphorylation and subsequent IRF-3 dimerization and nuclear translocation. Consistent with these observations, Ebola virus infection of Vero cells activated neither transcription from the ISG54 promoter nor nuclear accumulation of IRF-3. These data suggest that in Ebola virus-infected cells, VP35 inhibits the induction of antiviral genes, including the IFN-β gene, by blocking IRF-3 activation. PMID:12829834

  3. Physical Activity in the Transition to University: The Role of Past Behavior and Concurrent Self-Regulatory Efficacy

    ERIC Educational Resources Information Center

    Crozier, Alyson J.; Gierc, Madelaine S. H.; Locke, Sean R.; Brawley, Lawrence R.

    2015-01-01

    Objective: Two studies were conducted to examine the relationship between past physical activity, concurrent self-regulatory efficacy (CSRE), and current physical activity during the transition to university. Participants: Study 1 included 110 first-year undergraduate students recruited during October/November of 2012. Study 2 involved 86…

  4. 78 FR 13712 - U.S. Nuclear Regulatory Commission Planned Monitoring Activities for F-Area Tank Farm at the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-28

    ... COMMISSION U.S. Nuclear Regulatory Commission Planned Monitoring Activities for F-Area Tank Farm at the... Savannah River Site F-Area Tank Farm Facility in Accordance with the National Defense Authorization Act for... DOE's waste disposal activities at the F-Area Tank Farm at the Savannah River Site, in accordance...

  5. Microevolution of cis-regulatory elements: an example from the pair-rule segmentation gene fushi tarazu in the Drosophila melanogaster subgroup.

    PubMed

    Bakkali, Mohammed

    2011-01-01

    The importance of non-coding DNAs that control transcription is ever noticeable, but the characterization and analysis of the evolution of such DNAs presents challenges not found in the analysis of coding sequences. In this study of the cis-regulatory elements of the pair rule segmentation gene fushi tarazu (ftz) I report the DNA sequences of ftz's zebra element (promoter) and a region containing the proximal enhancer from a total of 45 fly lines belonging to several populations of the species Drosophila melanogaster, D. simulans, D. sechellia, D. mauritiana, D. yakuba, D. teissieri, D. orena and D. erecta. Both elements evolve at slower rate than ftz synonymous sites, thus reflecting their functional importance. The promoter evolves more slowly than the average for ftz's coding sequence while, on average, the enhancer evolves more rapidly, suggesting more functional constraint and effective purifying selection on the former. Comparative analysis of the number and nature of base substitutions failed to detect significant evidence for positive/adaptive selection in transcription-factor-binding sites. These seem to evolve at similar rates to regions not known to bind transcription factors. Although this result reflects the evolutionary flexibility of the transcription factor binding sites, it also suggests a complex and still not completely understood nature of even the characterized cis-regulatory sequences. The latter seem to contain more functional parts than those currently identified, some of which probably transcription factor binding. This study illustrates ways in which functional assignments of sequences within cis-acting sequences can be used in the search for adaptive evolution, but also highlights difficulties in how such functional assignment and analysis can be carried out. PMID:22073317

  6. Nuclear Thermal Rocket Element Environmental Simulator (NTREES) Upgrade Activities

    NASA Technical Reports Server (NTRS)

    Emrich, William

    2013-01-01

    A key technology element in Nuclear Thermal Propulsion is the development of fuel materials and components which can withstand extremely high temperatures while being exposed to flowing hydrogen. NTREES provides a cost effective method for rapidly screening of candidate fuel components with regard to their viability for use in NTR systems. The NTREES is designed to mimic the conditions (minus the radiation) to which nuclear rocket fuel elements and other components would be subjected to during reactor operation. The NTREES consists of a water cooled ASME code stamped pressure vessel and its associated control hardware and instrumentation coupled with inductive heaters to simulate the heat provided by the fission process. The NTREES has been designed to safely allow hydrogen gas to be injected into internal flow passages of an inductively heated test article mounted in the chamber.

  7. Transcriptional Activity, Chromosomal Distribution and Expression Effects of Transposable Elements in Coffea Genomes

    PubMed Central

    da Silva, Carlos R. M.; Andrade, Alan C.; Marraccini, Pierre; Teixeira, João B.; Carazzolle, Marcelo F.; Pereira, Gonçalo A. G.; Pereira, Luiz Filipe P.; Vanzela, André L. L.; Wang, Lu; Jordan, I. King; Carareto, Claudia M. A.

    2013-01-01

    Plant genomes are massively invaded by transposable elements (TEs), many of which are located near host genes and can thus impact gene expression. In flowering plants, TE expression can be activated (de-repressed) under certain stressful conditions, both biotic and abiotic, as well as by genome stress caused by hybridization. In this study, we examined the effects of these stress agents on TE expression in two diploid species of coffee, Coffea canephora and C. eugenioides, and their allotetraploid hybrid C. arabica. We also explored the relationship of TE repression mechanisms to host gene regulation via the effects of exonized TE sequences. Similar to what has been seen for other plants, overall TE expression levels are low in Coffea plant cultivars, consistent with the existence of effective TE repression mechanisms. TE expression patterns are highly dynamic across the species and conditions assayed here are unrelated to their classification at the level of TE class or family. In contrast to previous results, cell culture conditions per se do not lead to the de-repression of TE expression in C. arabica. Results obtained here indicate that differing plant drought stress levels relate strongly to TE repression mechanisms. TEs tend to be expressed at significantly higher levels in non-irrigated samples for the drought tolerant cultivars but in drought sensitive cultivars the opposite pattern was shown with irrigated samples showing significantly higher TE expression. Thus, TE genome repression mechanisms may be finely tuned to the ideal growth and/or regulatory conditions of the specific plant cultivars in which they are active. Analysis of TE expression levels in cell culture conditions underscored the importance of nonsense-mediated mRNA decay (NMD) pathways in the repression of Coffea TEs. These same NMD mechanisms can also regulate plant host gene expression via the repression of genes that bear exonized TE sequences. PMID:24244387

  8. Transformation mapping of the regulatory elements of the ecdysone-inducible P1 gene of Drosophila melanogaster

    SciTech Connect

    Maschat, F.; Dubertret, M.L.; Lepesant, J.A. )

    1991-05-01

    The transcription of the P1 gene is induced by 20-hydroxyecdysone in fat bodies of third-instar larvae. Germ line transformation showed that sequences between {minus}138 to +276 contain elements required for a qualitatively correct developmental and hormonal regulation of P1 transcription. Sequences from {minus}138 to {minus}68 are essential for this expression.

  9. Transcriptional read-through is not sufficient to induce an epigenetic switch in the silencing activity of Polycomb response elements

    PubMed Central

    Erokhin, Maksim; Elizar’ev, Pavel; Parshikov, Aleksander; Schedl, Paul; Georgiev, Pavel; Chetverina, Darya

    2015-01-01

    In Drosophila, Polycomb (PcG) and Trithorax (TrxG) group proteins are assembled on Polycomb response elements (PREs) to maintain tissue and stage-specific patterns of gene expression. Critical to coordinating gene expression with the process of differentiation, the activity of PREs can be switched “on” and “off.” When on, the PRE imposes a silenced state on the genes in the same domain that is stably inherited through multiple rounds of cell division. When the PRE is switched off, the domain is in a state permissive for gene expression that can be stably inherited. Previous studies have suggested that a burst of transcription through a PRE sequence displaces PcG proteins and provides a universal mechanism for inducing a heritable switch in PRE activity from on to off; however, the evidence favoring this model is indirect. Here, we have directly tested the transcriptional read-through mechanism. Contrary to previous suggestions, we show that transcription through the PRE is not sufficient for inducing an epigenetic switch in PRE activity. In fact, even high levels of continuous transcription through a PRE fails to dislodge the PcG proteins, nor does it remove repressive histone marks. Our results indicate that other mechanisms involving adjacent DNA regulatory elements must be implicated in heritable switch of PRE activity. PMID:26504232

  10. An essential regulatory role for macrophage migration inhibitory factor in T-cell activation.

    PubMed Central

    Bacher, M; Metz, C N; Calandra, T; Mayer, K; Chesney, J; Lohoff, M; Gemsa, D; Donnelly, T; Bucala, R

    1996-01-01

    The protein known as macrophage migration inhibitory factor (MIF) was one of the first cytokines to be discovered and was described 30 years ago to be a T-cell-derived factor that inhibited the random migration of macrophages in vitro. A much broader role for MIF has emerged recently as a result of studies that have demonstrated it to be released from the anterior pituitary gland in vivo. MIF also is the first protein that has been identified to be secreted from monocytes/macrophages upon glucocorticoid stimulation. Once released, MIF acts to "override" or counter-regulate the suppressive effects of glucocorticoids on macrophage cytokine production. We report herein that MIF plays an important regulatory role in the activation of T cells induced by mitogenic or antigenic stimuli. Activated T cells produce MIF and neutralizing anti-MIF antibodies inhibit T-cell proliferation and interleukin 2 production in vitro, and suppress antigen-driven T-cell activation and antibody production in vivo. T cells also release MIF in response to glucocorticoid stimulation and MIF acts to override glucocorticoid inhibition of T-cell proliferation and interleukin 2 and interferon gamma production. These studies indicate that MIF acts in concert with glucocorticoids to control T-cell activation and assign a previously unsuspected but critical role for MIF in antigen-specific immune responses. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8755565

  11. Enterococcus faecalis reconfigures its gene regulatory network activation under copper exposure

    PubMed Central

    Latorre, Mauricio; Galloway-Peña, Jessica; Roh, Jung Hyeob; Budinich, Marko; Reyes-Jara, Angélica; Murray, Barbara E.; Maass, Alejandro; González, Mauricio

    2014-01-01

    A gene regulatory network was generated in the bacterium Enterococcus faecalis in order to understand how this organism can activate its expression under different copper concentrations. The topological evaluation of the network showed common patterns described in other organisms. Integrating microarray experiments allowed the identification of sub-networks activated under low (0.05 mM CuSO4) and high (0.5 mM CuSO4) copper concentrations. The analysis indicates the presence of specific functionally activated modules induced by copper, highlighting the regulons LysR, ArgR as global regulators and CopY, Fur and LexA as local regulators. Taking advantage of the fact that E. faecalis presented a homeostatic module isolated, we produced an in vivo intervention removing this system from the cell without affecting the connectivity of the global transcriptional network. This strategy led us to find that this bacterium can reconfigure its gene expression to maintain cellular homeostasis, activating new modules principally related to glucose metabolism and transcriptional processes. Finally, these results position E. faecalis as the organism having the most complete and controllable systemic model of copper homeostasis available to date. PMID:24382465

  12. IκB Kinase ε Targets Interferon Regulatory Factor 1 in Activated T Lymphocytes

    PubMed Central

    Sgarbanti, Marco; Marsili, Giulia; Remoli, Anna Lisa; Stellacci, Emilia; Mai, Antonello; Rotili, Dante; Perrotti, Edvige; Acchioni, Chiara; Orsatti, Roberto; Iraci, Nunzio; Ferrari, Mathieu; Borsetti, Alessandra

    2014-01-01

    IκB kinase ε (IKK-ε) has an essential role as a regulator of innate immunity, functioning downstream of pattern recognition receptors to modulate NF-κB and interferon (IFN) signaling. In the present study, we investigated IKK-ε activation following T cell receptor (TCR)/CD28 stimulation of primary CD4+ T cells and its role in the stimulation of a type I IFN response. IKK-ε was activated following TCR/CD28 stimulation of primary CD4+ T cells; however, in T cells treated with poly(I·C), TCR/CD28 costimulation blocked induction of IFN-β transcription. We demonstrated that IKK-ε phosphorylated the transcription factor IFN regulatory factor 1 (IRF-1) at amino acid (aa) 215/219/221 in primary CD4+ T cells and blocked its transcriptional activity. At the mechanistic level, IRF-1 phosphorylation impaired the physical interaction between IRF-1 and the NF-κB RelA subunit and interfered with PCAF-mediated acetylation of NF-κB RelA. These results demonstrate that TCR/CD28 stimulation of primary T cells stimulates IKK-ε activation, which in turn contributes to suppression of IFN-β production. PMID:24396068

  13. Ikkepsilon regulates viral-induced interferon regulatory factor-3 activation via a redox-sensitive pathway

    SciTech Connect

    Indukuri, Hemalatha; Castro, Shawn M.; Liao, S.-M.; Feeney, Lee Ann; Dorsch, Marion; Coyle, Anthony J.; Garofalo, Roberto P.; Brasier, Allan R.; Casola, Antonella . E-mail: ancasola@utmb.edu

    2006-09-15

    Respiratory syncytial virus (RSV)-induced chemokine gene expression occurs through the activation of a subset of transcription factors, including Interferon Regulatory Factor (IRF)-3. In this study, we have investigated the signaling pathway leading to RSV-induced IRF-3 activation and whether it is mediated by intracellular reactive oxygen species (ROS) generation. Our results show that RSV infection induces expression and catalytic activity of IKK{epsilon}, a noncanonical IKK-like kinase. Expression of a kinase-inactive IKK{epsilon} blocks RSV-induced IRF-3 serine phosphorylation, nuclear translocation and DNA-binding, leading to inhibition of RANTES gene transcription, mRNA expression and protein synthesis. Treatment of alveolar epithelial cells with antioxidants or with NAD(P)H oxidase inhibitors abrogates RSV-induced chemokine secretion, IRF-3 phosphorylation and IKK{epsilon} induction, indicating that ROS generation plays a fundamental role in the signaling pathway leading to IRF-3 activation, therefore, identifying a novel molecular target for the development of strategies aimed to modify the inflammatory response associated with RSV infection of the lung.

  14. Activation of Interferon Regulatory Factor 3 Is Inhibited by the Influenza A Virus NS1 Protein

    PubMed Central

    Talon, Julie; Horvath, Curt M.; Polley, Rosalind; Basler, Christopher F.; Muster, Thomas; Palese, Peter; García-Sastre, Adolfo

    2000-01-01

    We present a novel mechanism by which viruses may inhibit the alpha/beta interferon (IFN-α/β) cascade. The double-stranded RNA (dsRNA) binding protein NS1 of influenza virus is shown to prevent the potent antiviral interferon response by inhibiting the activation of interferon regulatory factor 3 (IRF-3), a key regulator of IFN-α/β gene expression. IRF-3 activation and, as a consequence, IFN-β mRNA induction are inhibited in wild-type (PR8) influenza virus-infected cells but not in cells infected with an isogenic virus lacking the NS1 gene (delNS1 virus). Furthermore, NS1 is shown to be a general inhibitor of the interferon signaling pathway. Inhibition of IRF-3 activation can be achieved by the expression of wild-type NS1 in trans, not only in delNS1 virus-infected cells but also in cells infected with a heterologous RNA virus (Newcastle disease virus). We propose that inhibition of IRF-3 activation by a dsRNA binding protein significantly contributes to the virulence of influenza A viruses and possibly to that of other viruses. PMID:10933707

  15. Early kinetic window of target T cell susceptibility to CD25+ regulatory T cell activity.

    PubMed

    Sojka, Dorothy K; Hughson, Angela; Sukiennicki, Teresa L; Fowell, Deborah J

    2005-12-01

    Peripheral tolerance is maintained in part by thymically derived CD25+CD4+ T cells (regulatory T cells (Tregs)). Their mechanism of action has not been well characterized. Therefore, to get a better understanding of Treg action, we investigated the kinetics of murine Treg activity in vitro. Tregs were suppressive within a surprisingly narrow kinetic window: necessary and sufficient only in the first 6-10 h of culture. Visualization of this time frame, using a sensitive single-cell assay for IL-2, revealed the early elaboration of target cell IL-2 producers in the first 6 h despite the presence of CD25+CD4+ Tregs. However, after 6 h, a rapid rise in the number of IL-2 producers in the absence of Tregs was dramatically abrogated by the presence of Tregs. Importantly, the timing of suppression was dictated by the kinetics of target T cell activation suggesting that early target T cell signals may alter susceptibility to suppression. Modulating target T cell activation signals with provision of CD28, IL-2, or high Ag dose all abrogated suppression of proliferation late in culture. However, only CD28 signals enabled target T cells to resist the early Treg-induced down-regulation of IL-2. Therefore the quality of early target T cell activation signals, in particular engagement of CD28, represents an important control point in the balance between vulnerability and resistance to Treg suppression. PMID:16301632

  16. Growth factor-induced activation of a kinase activity which causes regulatory phosphorylation of p42/microtubule-associated protein kinase.

    PubMed Central

    L'Allemain, G; Her, J H; Wu, J; Sturgill, T W; Weber, M J

    1992-01-01

    p42/microtubule-associated protein kinase (p42mapk) is activated by tyrosine and threonine phosphorylation, and its regulatory phosphorylation is likely to be important in signalling pathways involved in growth control, secretion, and differentiation. Here we show that treatment of quiescent 3T3 cells with diverse agonists results in the appearance of an activity capable of causing the in vitro phosphorylation of p42mapk on the regulatory tyrosine and to a lesser extent on the regulatory threonine, resulting in enzymatic activation of the p42mapk. This p42mapk-activating activity is capable of phosphorylating a kinase-defective p42mapk mutant, thus confirming its activity as a kinase. Images PMID:1314951

  17. Systematic identification of regulatory proteins critical for T-cell activation

    PubMed Central

    Chu, Peter; Pardo, Jorge; Zhao, Haoran; Li, Connie C; Pali, Erlina; Shen, Mary M; Qu, Kunbin; Yu, Simon X; Huang, Betty CB; Yu, Peiwen; Masuda, Esteban S; Molineaux, Susan M; Kolbinger, Frank; Aversa, Gregorio; de Vries, Jan; Payan, Donald G; Liao, X Charlene

    2003-01-01

    Background The activation of T cells, mediated by the T-cell receptor (TCR), activates a battery of specific membrane-associated, cytosolic and nuclear proteins. Identifying the signaling proteins downstream of TCR activation will help us to understand the regulation of immune responses and will contribute to developing therapeutic agents that target immune regulation. Results In an effort to identify novel signaling molecules specific for T-cell activation we undertook a large-scale dominant effector genetic screen using retroviral technology. We cloned and characterized 33 distinct genes from over 2,800 clones obtained in a screen of 7 × 108 Jurkat T cells on the basis of a reduction in TCR-activation-induced CD69 expression after expressing retrovirally derived cDNA libraries. We identified known signaling molecules such as Lck, ZAP70, Syk, PLCγ1 and SHP-1 (PTP1C) as truncation mutants with dominant-negative or constitutively active functions. We also discovered molecules not previously known to have functions in this pathway, including a novel protein with a RING domain (found in a class of ubiquitin ligases; we call this protein TRAC-1), transmembrane molecules (EDG1, IL-10Rα and integrin α2), cytoplasmic enzymes and adaptors (PAK2, A-Raf-1, TCPTP, Grb7, SH2-B and GG2-1), and cytoskeletal molecules (moesin and vimentin). Furthermore, using truncated Lck, PLCγ1, EDG1 and PAK2 mutants as examples, we showed that these dominant immune-regulatory molecules interfere with IL-2 production in human primary lymphocytes. Conclusions This study identified important signal regulators in T-cell activation. It also demonstrated a highly efficient strategy for discovering many components of signal transduction p