Science.gov

Sample records for active regulatory elements

  1. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin

    PubMed Central

    Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.

    2007-01-01

    DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217

  2. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

    PubMed Central

    Giresi, Paul G.; Lieb, Jason D.

    2009-01-01

    The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

  3. Cis-regulatory RNA elements that regulate specialized ribosome activity

    PubMed Central

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5′UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution. PMID:26327194

  4. Identification of active transcriptional regulatory elements with GRO-seq

    PubMed Central

    Danko, Charles G.; Hyland, Stephanie L.; Core, Leighton J.; Martins, Andre L.; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G.; Kraus, W. Lee; Lis, John T.; Siepel, Adam

    2015-01-01

    Transcriptional regulatory elements (TREs), including enhancers and promoters, determine the transcription levels of associated genes. We have recently shown that global run-on and sequencing (GRO-seq) with enrichment for 5'-capped RNAs reveals active TREs with high accuracy. Here, we demonstrate that active TREs can be identified by applying sensitive machine-learning methods to standard GRO-seq data. This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Our prediction method, called discriminative Regulatory Element detection from GRO-seq (dREG), summarizes GRO-seq read counts at multiple scales and uses support vector regression to identify active TREs. The predicted TREs are more strongly enriched for several marks of transcriptional activation, including eQTL, GWAS-associated SNPs, H3K27ac, and transcription factor binding than those identified by alternative functional assays. Using dREG, we survey TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  5. Idefix insulator activity can be modulated by nearby regulatory elements.

    PubMed

    Brasset, E; Bantignies, F; Court, F; Cheresiz, S; Conte, C; Vaury, C

    2007-01-01

    Insulators play important roles in controlling gene activity and maintaining regulatory independence between neighbouring genes. In this article, we show that the enhancer-blocking activity of the insulator present within the LTR retrotransposon Idefix can be abolished if two copies of the region containing the insulator--specifically, the long terminal repeat (LTR)--are fused to the retrotransposon's 5' untranslated region (5' UTR). The presence of this combination of two [LTR-5' UTR] modules is a prerequisite for the loss of enhancer-blocking activity. We further show that the 5' UTR causes flanking genomic sequences to be displaced to the nuclear periphery, which is not observed when two insulators are present by themselves. This study thus provides a functional link between insulators and independent genomic modules, which may cooperate to allow the specific regulation of defined genomic loci via nuclear repositioning. It further illustrates the complexity of genomic regulation within a chromatic environment with multiple functional elements.

  6. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  7. Using FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) to isolate active regulatory DNA

    PubMed Central

    Simon, Jeremy M.; Giresi, Paul G.; Davis, Ian J.; Lieb, Jason D.

    2013-01-01

    Eviction or destabilization of nucleosomes from chromatin is a hallmark of functional regulatory elements of the eukaryotic genome. Historically identified by nuclease hypersensitivity, these regulatory elements are typically bound by transcription factors or other regulatory proteins. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) is an alternative approach to identify these genomic regions and has proven successful in a multitude of eukaryotic cell and tissue types. Cells or dissociated tissues are crosslinked briefly with formaldehyde, lysed, and sonicated. Sheared chromatin is subjected to phenol-chloroform extraction and the isolated DNA, typically encompassing 1–3% of the human genome, is purified. We provide guidelines for quantitative analysis by PCR, microarrays, or next-generation sequencing. Regulatory elements enriched by FAIRE display high concordance with those identified by nuclease hypersensitivity or ChIP, and the entire procedure can be completed in three days. FAIRE exhibits low technical variability, which allows its use in large-scale studies of chromatin from normal or diseased tissues. PMID:22262007

  8. Dissection of a Ciona regulatory element reveals complexity of cross-species enhancer activity

    PubMed Central

    Chen, Wei-Chung; Pauls, Stefan; Bacha, Jamil; Elgar, Greg; Loose, Matthew; Shimeld, Sebastian M.

    2014-01-01

    Vertebrate genomes share numerous conserved non-coding elements, many of which function as enhancer elements and are hypothesised to be under evolutionary constraint due to a need to be bound by combinations of sequence-specific transcription factors. In contrast, few such conserved elements can be detected between vertebrates and their closest invertebrate relatives. Despite this lack of sequence identity, cross-species transgenesis has identified some cases where non-coding DNA from invertebrates drives reporter gene expression in transgenic vertebrates in patterns reminiscent of the expression of vertebrate orthologues. Such instances are presumed to reflect the presence of conserved suites of binding sites in the regulatory regions of invertebrate and vertebrate orthologues, such that both regulatory elements can correctly interpret the trans-activating environment. Shuffling of binding sites has been suggested to lie behind loss of sequence conservation; however this has not been experimentally tested. Here we examine the underlying basis of enhancer activity for the Ciona intestinalis βγ-crystallin gene, which drives expression in the lens of transgenic vertebrates despite the Ciona lineage predating the evolution of the lens. We construct an interactive gene regulatory network (GRN) for vertebrate lens development, allowing network interactions to be robustly catalogued and conserved network components and features to be identified. We show that a small number of binding motifs are necessary for Ciona βγ-crystallin expression, and narrow down the likely factors that bind to these motifs. Several of these overlap with the conserved core of the vertebrate lens GRN, implicating these sites in cross species function. However when we test these motifs in a transgenic vertebrate they prove to be dispensable for reporter expression in the lens. These results show that current models depicting cross species enhancer function as dependent on conserved binding

  9. Tissue-specific SMARCA4 binding at active and repressed regulatory elements during embryogenesis.

    PubMed

    Attanasio, Catia; Nord, Alex S; Zhu, Yiwen; Blow, Matthew J; Biddie, Simon C; Mendenhall, Eric M; Dixon, Jesse; Wright, Crystal; Hosseini, Roya; Akiyama, Jennifer A; Holt, Amy; Plajzer-Frick, Ingrid; Shoukry, Malak; Afzal, Veena; Ren, Bing; Bernstein, Bradley E; Rubin, Edward M; Visel, Axel; Pennacchio, Len A

    2014-06-01

    The SMARCA4 (also known as BRG1 in humans) chromatin remodeling factor is critical for establishing lineage-specific chromatin states during early mammalian development. However, the role of SMARCA4 in tissue-specific gene regulation during embryogenesis remains poorly defined. To investigate the genome-wide binding landscape of SMARCA4 in differentiating tissues, we engineered a Smarca4(FLAG) knock-in mouse line. Using ChIP-seq, we identified ∼51,000 SMARCA4-associated regions across six embryonic mouse tissues (forebrain, hindbrain, neural tube, heart, limb, and face) at mid-gestation (E11.5). The majority of these regions was distal from promoters and showed dynamic occupancy, with most distal SMARCA4 sites (73%) confined to a single or limited subset of tissues. To further characterize these regions, we profiled active and repressive histone marks in the same tissues and examined the intersection of informative chromatin states and SMARCA4 binding. This revealed distinct classes of distal SMARCA4-associated elements characterized by activating and repressive chromatin signatures that were associated with tissue-specific up- or down-regulation of gene expression and relevant active/repressed biological pathways. We further demonstrate the predicted active regulatory properties of SMARCA4-associated elements by retrospective analysis of tissue-specific enhancers and direct testing of SMARCA4-bound regions in transgenic mouse assays. Our results indicate a dual active/repressive function of SMARCA4 at distal regulatory sequences in vivo and support its role in tissue-specific gene regulation during embryonic development.

  10. OTX2 Activity at Distal Regulatory Elements Shapes the Chromatin Landscape of Group 3 Medulloblastoma.

    PubMed

    Boulay, Gaylor; Awad, Mary E; Riggi, Nicolo; Archer, Tenley C; Iyer, Sowmya; Boonseng, Wannaporn E; Rossetti, Nikki E; Naigles, Beverly; Rengarajan, Shruthi; Volorio, Angela; Kim, James C; Mesirov, Jill P; Tamayo, Pablo; Pomeroy, Scott L; Aryee, Martin J; Rivera, Miguel N

    2017-02-17

    Medulloblastoma is the most frequent malignant pediatric brain tumor and is divided into at least four subgroups known as WNT, SHH, Group 3, and Group 4. Here, we characterized gene regulation mechanisms in the most aggressive subtype, Group 3 tumors, through genome-wide chromatin and expression profiling. Our results show that most active distal sites in these tumors are occupied by the transcription factor OTX2. Highly active OTX2-bound enhancers are often arranged as clusters of adjacent peaks and are also bound by the transcription factor NEUROD1. These sites are responsive to OTX2 and NEUROD1 knockdown and could also be generated de novo upon ectopic OTX2 expression in primary cells, showing that OTX2 cooperates with NEUROD1 and plays a major role in maintaining and possibly establishing regulatory elements as a pioneer factor. Among OTX2 target genes, we identified the kinase NEK2, whose knockdown and pharmacologic inhibition decreased cell viability. Our studies thus show that OTX2 controls the regulatory landscape of Group 3 medulloblastoma through cooperative activity at enhancer elements and contributes to the expression of critical target genes.SIGNIFICANCE: The gene regulation mechanisms that drive medulloblastoma are not well understood. Using chromatin profiling, we find that the transcription factor OTX2 acts as a pioneer factor and, in cooperation with NEUROD1, controls the Group 3 medulloblastoma active enhancer landscape. OTX2 itself or its target genes, including the mitotic kinase NEK2, represent attractive targets for future therapies. Cancer Discov; 7(3); 1-14. ©2017 AACR.

  11. Drosophila gypsy insulator and yellow enhancers regulate activity of yellow promoter through the same regulatory element.

    PubMed

    Melnikova, Larisa; Kostuchenko, Margarita; Silicheva, Margarita; Georgiev, Pavel

    2008-04-01

    There is ample evidence that the enhancers of a promoterless yellow locus in one homologous chromosome can activate the yellow promoter in the other chromosome where the enhancers are inactive or deleted, which is indicative of a high specificity of the enhancer-promoter interaction in yellow. In this paper, we have found that the yellow sequence from -100 to -69 is essential for stimulation of the heterologous eve (TATA-containing) and white (TATA-less) promoters by the yellow enhancers from a distance. However, the presence of this sequence is not required when the yellow enhancers are directly fused to the heterologous promoters or are activated by the yeast GAL4 activator. Unexpectedly, the same promoter proximal region defines previously described promoter-specific, long-distance repression of the yellow promoter by the gypsy insulator on the mod(mdg4) ( u1 ) background. These finding suggest that proteins bound to the -100 to -69 sequence are essential for communication between the yellow promoter and upstream regulatory elements.

  12. Effect of Regulatory Element DNA Methylation on Tissue-Type Plasminogen Activator Gene Expression

    PubMed Central

    Rivier-Cordey, Anne-Sophie; Caetano, Carlos; Fish, Richard J.; Kruithof, Egbert K. O.

    2016-01-01

    Expression of the tissue-type plasminogen activator gene (t-PA; gene name PLAT) is regulated, in part, by epigenetic mechanisms. We investigated the relationship between PLAT methylation and PLAT expression in five primary human cell types and six transformed cell lines. CpG methylation was analyzed in the proximal PLAT gene promoter and near the multihormone responsive enhancer (MHRE) -7.3 kilobase pairs upstream of the PLAT transcriptional start site (TSS, -7.3 kb). In Bowes melanoma cells, the PLAT promoter and the MHRE were fully unmethylated and t-PA secretion was extremely high. In other cell types the region from -647 to -366 was fully methylated, whereas an unmethylated stretch of DNA from -121 to +94 was required but not sufficient for detectable t-PA mRNA and t-PA secretion. DNA methylation near the MHRE was not correlated with t-PA secretion. Specific methylation of the PLAT promoter region -151 to +151, inserted into a firefly luciferase reporter gene, abolished reporter gene activity. The region -121 to + 94 contains two well-described regulatory elements, a PMA-responsive element (CRE) near -106 and a GC-rich region containing an Sp1 binding site near +59. Methylation of double-stranded DNA oligonucleotides containing the CRE or the GC-rich region had little or no effect on transcription factor binding. Methylated CpGs may attract co-repressor complexes that contain histone deacetylases (HDAC). However, reporter gene activity of methylated plasmids was not restored by the HDAC inhibitor trichostatin. In conclusion, efficient PLAT gene expression requires a short stretch of unmethylated CpG sites in the proximal promoter. PMID:27973546

  13. Cruciform-extruding regulatory element controls cell-specific activity of the tyrosine hydroxylase gene promoter.

    PubMed Central

    Kim, E L; Peng, H; Esparza, F M; Maltchenko, S Z; Stachowiak, M K

    1998-01-01

    Tyrosine hydroxylase (TH) is expressed specifically in catecholaminergic cells. We have identified a novel regulatory sequence in the upstream region of the bovine TH gene promoter formed by a dyad symmetry element (DSE1;-352/-307 bp). DSE1 supports TH promoter activity in TH-expressing bovine adrenal medulla chromaffin (BAMC) cells and inhibits promoter activity in non-expressing TE671 cells. DNase I footprinting of relaxed TH promoter DNA showed weak binding of nuclear BAMC cell proteins to a short sequence in the right DSE1 arm. In BAMC cells, deletion of the right arm markedly reduced the expression of luciferase from the TH promoter. However, deletion of the left DSE1 arm or its reversed orientation (RevL) also inactivated the TH promoter. In supercoiled TH promoter, DSE1 assumes a cruciform-like conformation i.e., it binds cruciform-specific 2D3 antibody, and S1 nuclease-cleavage and OsO4-modification assays have identified an imperfect cruciform extruded by the DSE1. DNase I footprinting of supercoiled plasmid showed that cruciformed DSE1 is targeted by nuclear proteins more efficiently than the linear duplex isomer and that the protected site encompasses the left arm and center of DSE1. Our results suggest that the disruption of intrastrand base-pairing preventing cruciform formation and protein binding to DSE1 is responsible for its inactivation in DSE1 mutants. DSE1 cruciform may act as a target site for activator (BAMC cells) and repressor (TE671) proteins. Its extrusion emerges as a novel mechanism that controls cell-specific promoter activity. PMID:9512554

  14. Activation of Sterol Regulatory Element Binding Factors by Fenofibrate and Gemfibrozil Stimulates Myelination in Zebrafish

    PubMed Central

    Ashikawa, Yoshifumi; Nishimura, Yuhei; Okabe, Shiko; Sasagawa, Shota; Murakami, Soichiro; Yuge, Mizuki; Kawaguchi, Koki; Kawase, Reiko; Tanaka, Toshio

    2016-01-01

    Oligodendrocytes are major myelin-producing cells and play essential roles in the function of a healthy nervous system. However, they are also one of the most vulnerable neural cell types in the central nervous system (CNS), and myelin abnormalities in the CNS are found in a wide variety of neurological disorders, including multiple sclerosis, adrenoleukodystrophy, and schizophrenia. There is an urgent need to identify small molecular weight compounds that can stimulate myelination. In this study, we performed comparative transcriptome analysis to identify pharmacodynamic effects common to miconazole and clobetasol, which have been shown to stimulate myelination by mouse oligodendrocyte progenitor cells (OPCs). Of the genes differentially expressed in both miconazole- and clobetasol-treated mouse OPCs compared with untreated cells, we identified differentially expressed genes (DEGs) common to both drug treatments. Gene ontology analysis revealed that these DEGs are significantly associated with the sterol biosynthetic pathway, and further bioinformatics analysis suggested that sterol regulatory element binding factors (SREBFs) might be key upstream regulators of the DEGs. In silico screening of a public database for chemicals associated with SREBF activation identified fenofibrate, a peroxisome proliferator-activated receptor α (PPARα) agonist, as a drug that increases the expression of known SREBF targets, raising the possibility that fenofibrate may also stimulate myelination. To test this, we performed in vivo imaging of zebrafish expressing a fluorescent reporter protein under the control of the myelin basic protein (mbp) promoter. Treatment of zebrafish with fenofibrate significantly increased expression of the fluorescent reporter compared with untreated zebrafish. This increase was attenuated by co-treatment with fatostatin, a specific inhibitor of SREBFs, confirming that the fenofibrate effect was mediated via SREBFs. Furthermore, incubation of zebrafish

  15. Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection

    PubMed Central

    Fedrigo, Olivier; Babbitt, Courtney C.; Wortham, Matthew; Tewari, Alok K.; London, Darin; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Parker, Stephen C. J.; Margulies, Elliott H.; Wray, Gregory A.; Furey, Terrence S.; Crawford, Gregory E.

    2012-01-01

    Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS) sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species. PMID:22761590

  16. Modular Utilization of Distal cis-Regulatory Elements Controls Ifng Gene Expression in T Cells Activated by Distinct Stimuli

    PubMed Central

    Balasubramani, Anand; Shibata, Yoichiro; Crawford, Gregory E.; Baldwin, Albert S.; Hatton, Robin D.; Weaver, Casey T.

    2010-01-01

    SUMMARY Distal cis-regulatory elements play essential roles in the T lineage-specific expression of cytokine genes. We have mapped interactions of three transacting factors – NF-κB, STAT4 and T-bet – with cis elements in the Ifng locus. We find that RelA is critical for optimal Ifng expression and is differentially recruited to multiple elements contingent upon T cell receptor (TCR) or interleukin-12 (IL-12) plus IL-18 signaling. RelA recruitment to at least four elements is dependent on T-bet-dependent remodeling of the Ifng locus and co-recruitment of STAT4. STAT4 and NF-κB therefore cooperate at multiple cis elements to enable NF-κB–dependent enhancement of Ifng expression. RelA recruitment to distal elements was similar in Th1 and Tc1 effector cells, although T-bet was dispensable in CD8 effectors. These results support a model of Ifng regulation in which distal cis-regulatory elements differentially recruit key transcription factors in a modular fashion to initiate gene transcription induced by distinct activation signals. PMID:20643337

  17. Diverse activities of viral cis-acting RNA regulatory elements revealed using multicolor, long-term, single-cell imaging.

    PubMed

    Pocock, Ginger M; Zimdars, Laraine L; Yuan, Ming; Eliceiri, Kevin W; Ahlquist, Paul; Sherer, Nathan M

    2017-02-01

    Cis-acting RNA structural elements govern crucial aspects of viral gene expression. How these structures and other posttranscriptional signals affect RNA trafficking and translation in the context of single cells is poorly understood. Herein we describe a multicolor, long-term (>24 h) imaging strategy for measuring integrated aspects of viral RNA regulatory control in individual cells. We apply this strategy to demonstrate differential mRNA trafficking behaviors governed by RNA elements derived from three retroviruses (HIV-1, murine leukemia virus, and Mason-Pfizer monkey virus), two hepadnaviruses (hepatitis B virus and woodchuck hepatitis virus), and an intron-retaining transcript encoded by the cellular NXF1 gene. Striking behaviors include "burst" RNA nuclear export dynamics regulated by HIV-1's Rev response element and the viral Rev protein; transient aggregations of RNAs into discrete foci at or near the nuclear membrane triggered by multiple elements; and a novel, pulsiform RNA export activity regulated by the hepadnaviral posttranscriptional regulatory element. We incorporate single-cell tracking and a data-mining algorithm into our approach to obtain RNA element-specific, high-resolution gene expression signatures. Together these imaging assays constitute a tractable, systems-based platform for studying otherwise difficult to access spatiotemporal features of viral and cellular gene regulation.

  18. c/EBPbeta is a major regulatory element driving transcriptional activation of the CXCL12 promoter.

    PubMed

    Calonge, E; Alonso-Lobo, J M; Escandón, C; González, N; Bermejo, M; Santiago, B; Mestre, L; Pablos, J L; Caruz, A; Alcamí, J

    2010-02-26

    CXCL12 is considered a constitutively expressed chemokine with homeostatic functions. However, induction of CXCL12 expression and its potential role in several pathologic conditions have been reported, suggesting that CXCL12 gene expression can be induced by different stimuli. To elucidate the molecular mechanisms involved in the regulation of CXCL12 gene expression, we aim to define the molecular factors that operate at the transcriptional level. Basal, constitutive expression of CXCL12 was dependent on basic helix-loop-helix factors. Transcriptional up-regulation of the CXCL12 gene was induced by cellular confluence or inflammatory stimuli such as interleukin-1 and interleukin-6, in a CCAAT/enhancer binding protein beta (c/EBPbeta)-dependent manner. Chromatin immunoprecipitation assays confirmed c/EBPbeta binding to a specific response element located at -1171 of the promoter region of CXCL12. Our data show that c/EBPbeta is a major regulatory element driving transcription of the CXCL12 gene in response to cytokines and cell confluence.

  19. Transcriptional Regulatory Elements in Fungal Secondary Metabolism

    PubMed Central

    Yin, Wenbing; Keller, Nancy P.

    2013-01-01

    Filamentous fungi produce a variety of secondary metabolites of diverse beneficial and detrimental activities to humankind. The genes encoding the enzymatic machinery required to make these metabolites are typically clustered in fungal genomes. There is considerable evidence that secondary metabolite gene regulation is, in part, by transcriptional control through hierarchical levels of transcriptional regulatory elements involved in secondary metabolite cluster regulation. Identification of secondary metabolism regulatory elements could potentially provide a means of increasing production of beneficial metabolites, decreasing production of detrimental metabolites, aid in the identification of ‘silent’ natural products and also contribute to a broader understanding of molecular mechanisms by which secondary metabolites are produced. This review summarizes regulation of secondary metabolism associated on transcriptional regulatory elements from a broad view as well as tremendous advances in discovery of cryptic or novel secondary metabolites by genomic mining in the basis of this knowledge. PMID:21717315

  20. Regulatory elements involved in the bidirectional activity of an immunoglobulin promoter.

    PubMed Central

    Doyen, N; Dreyfus, M; Rougeon, F

    1989-01-01

    We show that the promoter from the mouse VH441 heavy-chain immunoglobulin gene, when present on plasmids transiently introduced into myeloma cells, promotes transcription bidirectionally, due to the presence on both strands of TATA-like sequences bracketing the highly conserved decanucleotide element. The two divergent promoters compete for the transcriptional machinery, their relative strength ultimately reflecting the likeness of the two TATA boxes to the consensus sequence. Moreover, their relative activity is also strongly influenced by certain point mutations within the distally located heavy-chain enhancer. The bearing of these results on current concepts of promoter function is discussed. Images PMID:2494644

  1. Phosphorylation of sterol regulatory element binding protein-1a by protein kinase A (PKA) regulates transcriptional activity.

    PubMed

    Dong, Qingming; Giorgianni, Francesco; Deng, Xiong; Beranova-Giorgianni, Sarka; Bridges, Dave; Park, Edwards A; Raghow, Rajendra; Elam, Marshall B

    2014-07-11

    The counter-regulatory hormone glucagon inhibits lipogenesis via downregulation of sterol regulatory element binding protein 1 (SREBP-1). The effect of glucagon is mediated via protein kinase A (PKA). To determine if SREBP-1 is a direct phosphorylation target of PKA, we conducted mass spectrometry analysis of recombinant n-terminal SREBP-1a following PKA treatment in vitro. This analysis identified serines 331/332 as bona-fide phosphorylation targets of PKA. To determine the functional consequences of phosphorylation at these sites, we constructed mammalian expression vector for both nSREBP-1a and 1c isoforms in which the candidate PKA phosphorylation sites were mutated to active phosphomimetic or non-phosphorylatable amino acids. The transcriptional activity of SREBP was reduced by the phosphomimetic mutation of S332 of nSREBP-1a and the corresponding serine (S308) of nSREBP-1c. This site is a strong candidate for mediating the negative regulatory effect of glucagon on SREBP-1 and lipogenesis.

  2. Active learning: effects of core training design elements on self-regulatory processes, learning, and adaptability.

    PubMed

    Bell, Bradford S; Kozlowski, Steve W J

    2008-03-01

    This article describes a comprehensive examination of the cognitive, motivational, and emotional processes underlying active learning approaches; their effects on learning and transfer; and the core training design elements (exploration, training frame, emotion control) and individual differences (cognitive ability, trait goal orientation, trait anxiety) that shape these processes. Participants (N = 350) were trained to operate a complex, computer-based simulation. Exploratory learning and error-encouragement framing had a positive effect on adaptive transfer performance and interacted with cognitive ability and dispositional goal orientation to influence trainees' metacognition and state goal orientation. Trainees who received the emotion-control strategy had lower levels of state anxiety. Implications for development of an integrated theory of active learning, learner-centered design, and research extensions are discussed.

  3. Rounding up active cis-elements in the triple C corral: combining conservation, cleavage and conformation capture for the analysis of regulatory gene domains.

    PubMed

    McBride, David J; Kleinjan, Dirk A

    2004-11-01

    Identification and functional analysis of potential cis-regulatory elements is a laborious process that often depends on removing putative elements from their natural context to study their activity. While such methods provide valuable information about the isolated element, they disregard the potential role of an element's interaction(s) with other regulatory sequences and the three-dimensional structure of an active gene locus. Here, two novel methods are discussed--chromosome conformation capture (3C) and RNA-TRAP--that can be used to detect interactions between distal regulatory sites and which thus indicate the chromosomal conformation that is adopted by a gene locus in various states of transcriptional activity. Combined with comparative genomics and traditional DNase I hypersensitive site mapping, these methods form a powerful approach for the study of the mechanisms of long-range transcriptional regulation.

  4. Modular arrangement of regulatory RNA elements

    PubMed Central

    Roßmanith, Johanna; Narberhaus, Franz

    2017-01-01

    ABSTRACT Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed. PMID:28010165

  5. Modular arrangement of regulatory RNA elements.

    PubMed

    Roßmanith, Johanna; Narberhaus, Franz

    2017-03-04

    Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed.

  6. Shared Enhancer Activity in the Limbs and Phallus and Functional Divergence of a Limb-Genital cis-Regulatory Element in Snakes.

    PubMed

    Infante, Carlos R; Mihala, Alexandra G; Park, Sungdae; Wang, Jialiang S; Johnson, Kenji K; Lauderdale, James D; Menke, Douglas B

    2015-10-12

    The amniote phallus and limbs differ dramatically in their morphologies but share patterns of signaling and gene expression in early development. Thus far, the extent to which genital and limb transcriptional networks also share cis-regulatory elements has remained unexplored. We show that many limb enhancers are retained in snake genomes, suggesting that these elements may function in non-limb tissues. Consistent with this, our analysis of cis-regulatory activity in mice and Anolis lizards reveals that patterns of enhancer activity in embryonic limbs and genitalia overlap heavily. In mice, deletion of HLEB, an enhancer of Tbx4, produces defects in hindlimbs and genitalia, establishing the importance of this limb-genital enhancer for development of these different appendages. Further analyses demonstrate that the HLEB of snakes has lost hindlimb enhancer function while retaining genital activity. Our findings identify roles for Tbx4 in genital development and highlight deep similarities in cis-regulatory activity between limbs and genitalia.

  7. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation.

    PubMed

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2015-08-14

    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome.

  8. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation*

    PubMed Central

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2015-01-01

    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome. PMID:26140926

  9. Identifying Synonymous Regulatory Elements in Vertebrate Genomes

    SciTech Connect

    Ovcharenko, I; Nobrega, M A

    2005-02-07

    Synonymous gene regulation, defined as driving shared temporal and/or spatial expression of groups of genes, is likely predicated on genomic elements that contain similar modules of certain transcription factor binding sites (TFBS). We have developed a method to scan vertebrate genomes for evolutionary conserved modules of TFBS in a predefined configuration, and created a tool, named SynoR that identify synonymous regulatory elements (SREs) in vertebrate genomes. SynoR performs de novo identification of SREs utilizing known patterns of TFBS in active regulatory elements (REs) as seeds for genome scans. Layers of multiple-species conservation allow the use of differential phylogenetic sequence conservation filters in the search of SREs and the results are displayed as to provide an extensive annotation of genes containing detected REs. Gene Ontology categories are utilized to further functionally classify the identified genes, and integrated GNF Expression Atlas 2 data allow the cataloging of tissue-specificities of the predicted SREs. We illustrate how this new tool can be used to establish a linkage between human diseases and noncoding genomic content. SynoR is publicly available at http://synor.dcode.org.

  10. High constitutive activity of a broad panel of housekeeping and tissue-specific cis-regulatory elements depends on a subset of ETS proteins.

    PubMed

    Curina, Alessia; Termanini, Alberto; Barozzi, Iros; Prosperini, Elena; Simonatto, Marta; Polletti, Sara; Silvola, Alessio; Soldi, Monica; Austenaa, Liv; Bonaldi, Tiziana; Ghisletti, Serena; Natoli, Gioacchino

    2017-02-15

    Enhancers and promoters that control the transcriptional output of terminally differentiated cells include cell type-specific and broadly active housekeeping elements. Whether the high constitutive activity of these two groups of cis-regulatory elements relies on entirely distinct or instead also on shared regulators is unknown. By dissecting the cis-regulatory repertoire of macrophages, we found that the ELF subfamily of ETS proteins selectively bound within 60 base pairs (bp) from the transcription start sites of highly active housekeeping genes. ELFs also bound constitutively active, but not poised, macrophage-specific enhancers and promoters. The role of ELFs in promoting high-level constitutive transcription was suggested by multiple evidence: ELF sites enabled robust transcriptional activation by endogenous and minimal synthetic promoters, ELF recruitment was stabilized by the transcriptional machinery, and ELF proteins mediated recruitment of transcriptional and chromatin regulators to core promoters. These data suggest that the co-optation of a limited number of highly active transcription factors represents a broadly adopted strategy to equip both cell type-specific and housekeeping cis-regulatory elements with the ability to efficiently promote transcription.

  11. Information capacity of genetic regulatory elements

    NASA Astrophysics Data System (ADS)

    Tkačik, Gašper; Callan, Curtis G., Jr.; Bialek, William

    2008-07-01

    Changes in a cell’s external or internal conditions are usually reflected in the concentrations of the relevant transcription factors. These proteins in turn modulate the expression levels of the genes under their control and sometimes need to perform nontrivial computations that integrate several inputs and affect multiple genes. At the same time, the activities of the regulated genes would fluctuate even if the inputs were held fixed, as a consequence of the intrinsic noise in the system, and such noise must fundamentally limit the reliability of any genetic computation. Here we use information theory to formalize the notion of information transmission in simple genetic regulatory elements in the presence of physically realistic noise sources. The dependence of this “channel capacity” on noise parameters, cooperativity and cost of making signaling molecules is explored systematically. We find that, in the range of parameters probed by recent in vivo measurements, capacities higher than one bit should be achievable. It is of course generally accepted that gene regulatory elements must, in order to function properly, have a capacity of at least one bit. The central point of our analysis is the demonstration that simple physical models of noisy gene transcription, with realistic parameters, can indeed achieve this capacity: it was not self-evident that this should be so. We also demonstrate that capacities significantly greater than one bit are possible, so that transcriptional regulation need not be limited to simple “on-off” components. The question whether real systems actually exploit this richer possibility is beyond the scope of this investigation.

  12. Rationales for regulatory activity

    SciTech Connect

    Perhac, R.M.

    1997-02-01

    The author provides an outline which touches on the types of concerns about risk evaluation which are addressed in the process of establishing regulatory guides. Broadly he says regulatory activity serves three broad constituents: (1) Paternalism (private risk); (2) Promotion of social welfare (public risks); (3) Protection of individual rights (public risks). He then discusses some of the major issues encountered in reaching a decision on what is an acceptable level of risk within each of these areas, and how one establishes such a level.

  13. Activation of sterol regulatory element-binding protein 1c and fatty acid synthase transcription by hepatitis C virus non-structural protein 2.

    PubMed

    Oem, Jae-Ku; Jackel-Cram, Candice; Li, Yi-Ping; Zhou, Yan; Zhong, Jin; Shimano, Hitoshi; Babiuk, Lorne A; Liu, Qiang

    2008-05-01

    Transcriptional factor sterol regulatory element-binding protein 1c (SREBP-1c) activates the transcription of lipogenic genes, including fatty acid synthase (FAS). Hepatitis C virus (HCV) infection is often associated with lipid accumulation within the liver, known as steatosis in the clinic. The molecular mechanisms of HCV-associated steatosis are not well characterized. Here, we showed that HCV non-structural protein 2 (NS2) activated SREBP-1c transcription in human hepatic Huh-7 cells as measured by using a human SREBP-1c promoter-luciferase reporter plasmid. We further showed that sterol regulatory element (SRE) and liver X receptor element (LXRE) in the SREBP-1c promoter were involved in SREBP-1c activation by HCV NS2. Furthermore, expression of HCV NS2 resulted in the upregulation of FAS transcription. We also showed that FAS upregulation by HCV NS2 was SREBP-1-dependent since deleting the SRE sequence in a FAS promoter and expressing a dominant-negative SREBP-1 abrogated FAS promoter upregulation by HCV NS2. Taken together, our results suggest that HCV NS2 can upregulate the transcription of SREBP-1c and FAS, and thus is probably a contributing factor for HCV-associated steatosis.

  14. An internal regulatory element controls troponin I gene expression

    SciTech Connect

    Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F. . Dept. of Biological Sciences)

    1989-04-01

    During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.

  15. Distant cis Regulatory Elements in Human Skeletal Muscle Differentiation

    PubMed Central

    McCord, Rachel Patton; Zhou, Vicky W.; Yuh, Tiffany; Bulyk, Martha L.

    2011-01-01

    Identifying gene regulatory elements and their target genes in human cells remains a significant challenge. Despite increasing evidence of physical interactions between distant regulatory elements and gene promoters in mammalian cells, many studies consider only promoter-proximal regulatory regions. We identify putative cis-regulatory modules (CRMs) in human skeletal muscle differentiation by combining myogenic TF binding data before and after differentiation with histone modification data in myoblasts. CRMs that are distant (>20 kb) from muscle gene promoters are common and are more likely than proximal promoter regions to show differentiation-specific changes in myogenic TF binding. We find that two of these distant CRMs, known to activate transcription in differentiating myoblasts, interact physically with gene promoters (PDLIM3 and ACTA1) during differentiation. Our results highlight the importance of considering distal CRMs in investigations of mammalian gene regulation and support the hypothesis that distant CRM-promoter looping contacts are a general mechanism of gene regulation. PMID:21907276

  16. Docosahexaenoic acid inhibits proteolytic processing of sterol regulatory element-binding protein-1c (SREBP-1c) via activation of AMP-activated kinase.

    PubMed

    Deng, Xiong; Dong, Qingming; Bridges, Dave; Raghow, Rajendra; Park, Edwards A; Elam, Marshall B

    2015-12-01

    In hyperinsulinemic states including obesity and T2DM, overproduction of fatty acid and triglyceride contributes to steatosis of the liver, hyperlipidemia and hepatic insulin resistance. This effect is mediated in part by the transcriptional regulator sterol responsive element binding protein-1c (SREBP-1c), which stimulates the expression of genes involved in hepatic fatty acid and triglyceride synthesis. SREBP-1c is up regulated by insulin both via increased transcription of nascent full-length SREBP-1c and by enhanced proteolytic processing of the endoplasmic reticulum (ER)-bound precursor to yield the transcriptionally active n-terminal form, nSREBP-1c. Polyunsaturated fatty acids of marine origin (n-3 PUFA) prevent induction of SREBP-1c by insulin thereby reducing plasma and hepatic triglycerides. Despite widespread use of n-3 PUFA supplements to reduce triglycerides in clinical practice, the exact mechanisms underlying their hypotriglyceridemic effect remain elusive. Here we demonstrate that the n-3 PUFA docosahexaenoic acid (DHA; 22:5 n-3) reduces nSREBP-1c by inhibiting regulated intramembrane proteolysis (RIP) of the nascent SREBP-1c. We further show that this effect of DHA is mediated both via activation of AMP-activated protein kinase (AMPK) and by inhibition of mechanistic target of rapamycin complex 1 (mTORC1). The inhibitory effect of AMPK on SREBP-1c processing is linked to phosphorylation of serine 365 of SREBP-1c in the rat. We have defined a novel regulatory mechanism by which n-3 PUFA inhibit induction of SREBP-1c by insulin. These findings identify AMPK as an important negative regulator of hepatic lipid synthesis and as a potential therapeutic target for hyperlipidemia in obesity and T2DM.

  17. Latent Regulatory Potential of Human-Specific Repetitive Elements

    PubMed Central

    Ward, Michelle C.; Wilson, Michael D.; Barbosa-Morais, Nuno L.; Schmidt, Dominic; Stark, Rory; Pan, Qun; Schwalie, Petra C.; Menon, Suraj; Lukk, Margus; Watt, Stephen; Thybert, David; Kutter, Claudia; Kirschner, Kristina; Flicek, Paul; Blencowe, Benjamin J.; Odom, Duncan T.

    2013-01-01

    Summary At least half of the human genome is derived from repetitive elements, which are often lineage specific and silenced by a variety of genetic and epigenetic mechanisms. Using a transchromosomic mouse strain that transmits an almost complete single copy of human chromosome 21 via the female germline, we show that a heterologous regulatory environment can transcriptionally activate transposon-derived human regulatory regions. In the mouse nucleus, hundreds of locations on human chromosome 21 newly associate with activating histone modifications in both somatic and germline tissues, and influence the gene expression of nearby transcripts. These regions are enriched with primate and human lineage-specific transposable elements, and their activation corresponds to changes in DNA methylation at CpG dinucleotides. This study reveals the latent regulatory potential of the repetitive human genome and illustrates the species specificity of mechanisms that control it. PMID:23246434

  18. Prediction of cis-regulatory elements for drug-activated transcription factors in the regulation of drug-metabolising enzymes and drug transporters.

    PubMed

    Podvinec, Michael; Meyer, Urs A

    2006-06-01

    The expression of drug-metabolising enzymes is affected by many endogenous and exogenous factors, including sex, age, diet and exposure to xenobiotics and drugs. To understand fully how the organism metabolises a drug, these alterations in gene expression must be taken into account. The central process, the definition of likely regulatory elements in the genes coding for enzymes and transporters involved in drug disposition, can be vastly accelerated using existing and emerging bioinformatics methods to unravel the regulatory networks causing drug-mediated induction of genes. Here, various approaches to predict transcription factor interactions with regulatory DNA elements are reviewed.

  19. Multigenome DNA sequence conservation identifies Hox cis-regulatory elements

    PubMed Central

    Kuntz, Steven G.; Schwarz, Erich M.; DeModena, John A.; De Buysscher, Tristan; Trout, Diane; Shizuya, Hiroaki; Sternberg, Paul W.; Wold, Barbara J.

    2008-01-01

    To learn how well ungapped sequence comparisons of multiple species can predict cis-regulatory elements in Caenorhabditis elegans, we made such predictions across the large, complex ceh-13/lin-39 locus and tested them transgenically. We also examined how prediction quality varied with different genomes and parameters in our comparisons. Specifically, we sequenced ∼0.5% of the C. brenneri and C. sp. 3 PS1010 genomes, and compared five Caenorhabditis genomes (C. elegans, C. briggsae, C. brenneri, C. remanei, and C. sp. 3 PS1010) to find regulatory elements in 22.8 kb of noncoding sequence from the ceh-13/lin-39 Hox subcluster. We developed the MUSSA program to find ungapped DNA sequences with N-way transitive conservation, applied it to the ceh-13/lin-39 locus, and transgenically assayed 21 regions with both high and low degrees of conservation. This identified 10 functional regulatory elements whose activities matched known ceh-13/lin-39 expression, with 100% specificity and a 77% recovery rate. One element was so well conserved that a similar mouse Hox cluster sequence recapitulated the native nematode expression pattern when tested in worms. Our findings suggest that ungapped sequence comparisons can predict regulatory elements genome-wide. PMID:18981268

  20. Sterol Regulatory Element-binding Protein (SREBP) Cleavage Regulates Golgi-to-Endoplasmic Reticulum Recycling of SREBP Cleavage-activating Protein (SCAP)*

    PubMed Central

    Shao, Wei; Espenshade, Peter J.

    2014-01-01

    Sterol regulatory element-binding protein (SREBP) transcription factors are central regulators of cellular lipogenesis. Release of membrane-bound SREBP requires SREBP cleavage-activating protein (SCAP) to escort SREBP from the endoplasmic reticulum (ER) to the Golgi for cleavage by site-1 and site-2 proteases. SCAP then recycles to the ER for additional rounds of SREBP binding and transport. Mechanisms regulating ER-to-Golgi transport of SCAP-SREBP are understood in molecular detail, but little is known about SCAP recycling. Here, we have demonstrated that SCAP Golgi-to-ER transport requires cleavage of SREBP at site-1. Reductions in SREBP cleavage lead to SCAP degradation in lysosomes, providing additional negative feedback control to the SREBP pathway. Current models suggest that SREBP plays a passive role prior to cleavage. However, we show that SREBP actively prevents premature recycling of SCAP-SREBP until initiation of SREBP cleavage. SREBP regulates SCAP in human cells and yeast, indicating that this is an ancient regulatory mechanism. PMID:24478315

  1. The Hepatitis C Virus-induced NLRP3 Inflammasome Activates the Sterol Regulatory Element-binding Protein (SREBP) and Regulates Lipid Metabolism*

    PubMed Central

    McRae, Steven; Iqbal, Jawed; Sarkar-Dutta, Mehuli; Lane, Samantha; Nagaraj, Abhiram; Ali, Naushad; Waris, Gulam

    2016-01-01

    Hepatitis C virus (HCV) relies on host lipids and lipid droplets for replication and morphogenesis. The accumulation of lipid droplets in infected hepatocytes manifests as hepatosteatosis, a common pathology observed in chronic hepatitis C patients. One way by which HCV promotes the accumulation of intracellular lipids is through enhancing de novo lipogenesis by activating the sterol regulatory element-binding proteins (SREBPs). In general, activation of SREBPs occurs during cholesterol depletion. Interestingly, during HCV infection, the activation of SREBPs occurs under normal cholesterol levels, but the underlying mechanisms are still elusive. Our previous study has demonstrated the activation of the inflammasome complex in HCV-infected human hepatoma cells. In this study, we elucidate the potential link between chronic hepatitis C-associated inflammation and alteration of lipid homeostasis in infected cells. Our results reveal that the HCV-activated NLRP3 inflammasome is required for the up-regulation of lipogenic genes such as 3-hydroxy-3-methylglutaryl-coenzyme A synthase, fatty acid synthase, and stearoyl-CoA desaturase. Using pharmacological inhibitors and siRNA against the inflammasome components (NLRP3, apoptosis-associated speck-like protein containing a CARD, and caspase-1), we further show that the activation of the NLRP3 inflammasome plays a critical role in lipid droplet formation. NLRP3 inflammasome activation in HCV-infected cells enables caspase-1-mediated degradation of insulin-induced gene proteins. This subsequently leads to the transport of the SREBP cleavage-activating protein·SREBP complex from the endoplasmic reticulum to the Golgi, followed by proteolytic activation of SREBPs by S1P and S2P in the Golgi. Typically, inflammasome activation leads to viral clearance. Paradoxically, here we demonstrate how HCV exploits the NLRP3 inflammasome to activate SREBPs and host lipid metabolism, leading to liver disease pathogenesis associated with

  2. Neuronal Activity-Induced Sterol Regulatory Element Binding Protein-1 (SREBP1) is Disrupted in Dysbindin-Null Mice-Potential Link to Cognitive Impairment in Schizophrenia.

    PubMed

    Chen, Yong; Bang, Sookhee; McMullen, Mary F; Kazi, Hala; Talbot, Konrad; Ho, Mei-Xuan; Carlson, Greg; Arnold, Steven E; Ong, Wei-Yi; Kim, Sangwon F

    2017-04-01

    Schizophrenia is a chronic debilitating neuropsychiatric disorder that affects about 1 % of the population. Dystrobrevin-binding protein 1 (DTNBP1 or dysbindin) is one of the Research Domain Constructs (RDoC) associated with cognition and is significantly reduced in the brain of schizophrenia patients. To further understand the molecular underpinnings of pathogenesis of schizophrenia, we have performed microarray analyses of the hippocampi from dysbindin knockout mice, and found that genes involved in the lipogenic pathway are suppressed. Moreover, we discovered that maturation of a master transcriptional regulator for lipid synthesis, sterol regulatory element binding protein-1 (SREBP1) is induced by neuronal activity, and is required for induction of the immediate early gene ARC (activity-regulated cytoskeleton-associated protein), necessary for synaptic plasticity and memory. We found that nuclear SREBP1 is dramatically reduced in dysbindin-1 knockout mice and postmortem brain tissues from human patients with schizophrenia. Furthermore, activity-dependent maturation of SREBP1 as well as ARC expression were attenuated in dysbindin-1 knockout mice, and these deficits were restored by an atypical antipsychotic drug, clozapine. Together, results indicate an important role of dysbindin-1 in neuronal activity induced SREBP1 and ARC, which could be related to cognitive deficits in schizophrenia.

  3. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    SciTech Connect

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  4. Effects of retinoic acid and hydrogen peroxide on sterol regulatory element-binding protein-1a activation during adipogenic differentiation of 3T3-L1 cells.

    PubMed

    Abd Eldaim, Mabrouk A; Okamatsu-Ogura, Yuko; Terao, Akira; Kimura, Kazuhiro

    2010-11-01

    Both retinoic acid (RA) and oxidative stress (H2O2) increased transcription and cleavage of membrane-bound sterol regulatory element-binding protein (SREBP)-1, leading to enhanced transcription of fatty acid synthase (FAS) in hepatoma cells. On the other hand, RA and H2O2 decreased and increased lipogenesis in adipocytes, respectively, although roles of SREBP-1 activation in these effects remain to be elucidated. To elucidate its involvement, we examined the activation of SREBP-la, expression of FAS genes and lipid accumulation in 3T3-L1 cells in the presence of RA and/or H2O2. RA (1 microM) treatment suppressed expression of SREBP-1a and FAS genes and lipid accumulation. H2O2 (2 microM) treatment induced increased cleavage of SREBP-1a, without affecting amounts of SREBP-1a mRNA and precursor protein, and enhanced expression of FAS gene and lipid accumulation. Increased cleavage of SREBP-1a by H2O2 was also observed even in the presence of RA. These results suggest that H2O2, enhances a cleavage of SREBP-1a precursor protein, which independently occurs with the RA suppression of SREBP-1a gene expression, and that RA itself has no role in the SREBP-1a activation in adipocytes.

  5. Heat Shock Protein 90 Modulates Lipid Homeostasis by Regulating the Stability and Function of Sterol Regulatory Element-binding Protein (SREBP) and SREBP Cleavage-activating Protein.

    PubMed

    Kuan, Yen-Chou; Hashidume, Tsutomu; Shibata, Takahiro; Uchida, Koji; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2017-02-17

    Sterol regulatory element-binding proteins (SREBPs) are the key transcription factors that modulate lipid biosynthesis. SREBPs are synthesized as endoplasmic reticulum-bound precursors that require proteolytic activation in the Golgi apparatus. The stability and maturation of precursor SREBPs depend on their binding to SREBP cleavage-activating protein (SCAP), which escorts the SCAP-SREBP complex to the Golgi apparatus. In this study, we identified heat shock protein (HSP) 90 as a novel SREBP regulator that binds to and stabilizes SCAP-SREBP. In HepG2 cells, HSP90 inhibition led to proteasome-dependent degradation of SCAP-SREBP, which resulted in the down-regulation of SREBP target genes and the reduction in intracellular triglyceride and cholesterol levels. We also demonstrated in vivo that HSP90 inhibition decreased SCAP-SREBP protein, down-regulated SREBP target genes, and reduced lipids levels in mouse livers. We propose that HSP90 plays an indispensable role in SREBP regulation by stabilizing the SCAP-SREBP complex, facilitating the activation of SREBP to maintain lipids homeostasis.

  6. The activity of the HIV-1 IRES is stimulated by oxidative stress and controlled by a negative regulatory element

    PubMed Central

    Gendron, Karine; Ferbeyre, Gerardo; Heveker, Nikolaus; Brakier-Gingras, Léa

    2011-01-01

    Initiation of translation of the full-length messenger RNA of HIV-1, which generates the viral structural proteins and enzymes, is cap-dependent but can also use an internal ribosome entry site (IRES) located in the 5′ untranslated region. Our aim was to define, through a mutational analysis, regions of HIV-1 IRES that are important for its activity. A dual-luciferase reporter construct where the Renilla luciferase (Rluc) translation is cap-dependent while the firefly luciferase (Fluc) translation depends on HIV-1 IRES was used. The Fluc/Rluc ratio was measured in lysates of Jurkat T cells transfected with the dual-luciferase plasmid bearing either the wild-type or a mutated IRES. Deletions or mutations in three regions decreased the IRES activity but deletion or mutations of a stem-loop preceding the primer binding site increased the IRES activity. The wild-type IRES activity, but not that of an IRES with a mutated stem-loop, was increased when cells were treated with agents that induce oxidative stress. Such stress is known to be caused by HIV-1 infection and we propose that this stem-loop is involved in a switch that stimulates the IRES activity in cells infected with HIV-1, supporting the suggestion that the IRES activity is up-regulated in the course of HIV-1 replication cycle. PMID:20935056

  7. Maturation and Activity of Sterol Regulatory Element Binding Protein 1 Is Inhibited by Acyl-CoA Binding Domain Containing 3

    PubMed Central

    Chen, Yong; Patel, Vishala; Bang, Sookhee; Cohen, Natalie; Millar, John; Kim, Sangwon F.

    2012-01-01

    Imbalance of lipid metabolism has been linked with pathogenesis of a variety of human pathological conditions such as diabetes, obesity, cancer and neurodegeneration. Sterol regulatory element binding proteins (SREBPs) are the master transcription factors controlling the homeostasis of fatty acids and cholesterol in the body. Transcription, expression, and activity of SREBPs are regulated by various nutritional, hormonal or stressful stimuli, yet the molecular and cellular mechanisms involved in these adaptative responses remains elusive. In the present study, we found that overexpressed acyl-CoA binding domain containing 3 (ACBD3), a Golgi-associated protein, dramatically inhibited SREBP1-sensitive promoter activity of fatty acid synthase (FASN). Moreover, lipid deprivation-stimulated SREBP1 maturation was significantly attenuated by ACBD3. With cell fractionation, gene knockdown and immunoprecipitation assays, it was showed that ACBD3 blocked intracellular maturation of SREBP1 probably through directly binding with the lipid regulator rather than disrupted SREBP1-SCAP-Insig1 interaction. Further investigation revealed that acyl-CoA domain-containing N-terminal sequence of ACBD3 contributed to its inhibitory effects on the production of nuclear SREBP1. In addition, mRNA and protein levels of FASN and de novo palmitate biosynthesis were remarkably reduced in cells overexpressed with ACBD3. These findings suggest that ACBD3 plays an essential role in maintaining lipid homeostasis via regulating SREBP1's processing pathway and thus impacting cellular lipogenesis. PMID:23166793

  8. U18666A, an Activator of Sterol Regulatory Element Binding Protein (SREBP) Pathway Modulates Presynaptic Dopaminergic Phenotype of SH-SY5Y Neuroblastoma Cells.

    PubMed

    Schmitt, Mathieu; Dehay, Benjamin; Bezard, Erwan; Garcia-Ladona, F Javier

    2017-04-13

    The therapeutic use of statins has been associated to a reduced risk of Parkinson's disease (PD) and may hold neuroprotective potential by counteracting the degeneration of dopaminergic neurons. Transcriptional activation of the sterol regulatory element-binding protein (SREBP) is one of the major downstream signalling pathways triggered by the cholesterol-lowering effect of statins. In a previous study in neuroblastoma cells, we have shown that statins consistently induce the up-regulation of presynaptic dopaminergic proteins as well as changes of their function and these effects were accompanied by downstream activation of SREBP. In current study, we aimed to determine the direct role of SREBP pathway in the modulation of dopaminergic phenotype. We demonstrate that treatment of SH-SY5Y cells with U18666A, a SREBP activator, increases the translocation of SREBPs into the nucleus, increases expression of SREBP-1, SREBP-2 and of the presynaptic dopaminergic markers such as vesicular monoamine transporter 2, synaptic vesicle glycoprotein 2A and 2C, synaptogyrin-3 and tyrosine hydroxylase. The addition of SREBP inhibitor, PF-429242, blocks the increase of U18666A-induced expression of SREBPs and of presynaptic markers. Our results, in line with previously reported effects of statins, demonstrate that direct stimulation of SREBP translocation is associated to differentiation towards a dopaminergic-like phenotype and suggest that SREBP-mediated transcriptional activity may lead to the restoration of the presynaptic dopamine markers and may contribute to neuroprotection of dopaminergic neurons. These findings further support the potential protective role of statin in PD and shed light upon SREBP as a potential new target for developing disease-modifying treatment in PD. This article is protected by copyright. All rights reserved.

  9. Tlr4-mutant mice are resistant to acute alcohol-induced sterol-regulatory element binding protein activation and hepatic lipid accumulation.

    PubMed

    Zhang, Zhi-Hui; Liu, Xiao-Qian; Zhang, Cheng; He, Wei; Wang, Hua; Chen, Yuan-Hua; Liu, Xiao-Jing; Chen, Xi; Xu, De-Xiang

    2016-09-15

    Previous studies demonstrated that acute alcohol intoxication caused hepatic lipid accumulation. The present study showed that acute alcohol intoxication caused hepatic lipid accumulation in Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic sterol-regulatory element binding protein (SREBP)-1, a transcription factor regulating fatty acid and triglyceride (TG) synthesis, was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic Fas, Acc, Scd-1 and Dgat-2, the key genes for fatty acid and TG synthesis, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Additional experiment showed that hepatic MyD88 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic NF-κB was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Moreover, hepatic GSH content was reduced and hepatic MDA level was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic CYP2E1 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic p67phox and gp91phox, two NADPH oxidase subunits, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Alpha-phenyl-N-t-butylnitrone (PBN), a free radical spin-trapping agent, protected against alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation. In conclusion, Tlr4-mutant mice are resistant to acute alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation.

  10. Tlr4-mutant mice are resistant to acute alcohol-induced sterol-regulatory element binding protein activation and hepatic lipid accumulation

    PubMed Central

    Zhang, Zhi-Hui; Liu, Xiao-Qian; Zhang, Cheng; He, Wei; Wang, Hua; Chen, Yuan-Hua; Liu, Xiao-Jing; Chen, Xi; Xu, De-Xiang

    2016-01-01

    Previous studies demonstrated that acute alcohol intoxication caused hepatic lipid accumulation. The present study showed that acute alcohol intoxication caused hepatic lipid accumulation in Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic sterol-regulatory element binding protein (SREBP)-1, a transcription factor regulating fatty acid and triglyceride (TG) synthesis, was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic Fas, Acc, Scd-1 and Dgat-2, the key genes for fatty acid and TG synthesis, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Additional experiment showed that hepatic MyD88 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic NF-κB was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Moreover, hepatic GSH content was reduced and hepatic MDA level was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic CYP2E1 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic p67phox and gp91phox, two NADPH oxidase subunits, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Alpha-phenyl-N-t-butylnitrone (PBN), a free radical spin-trapping agent, protected against alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation. In conclusion, Tlr4-mutant mice are resistant to acute alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation. PMID:27627966

  11. Sterol Regulatory Element-Binding Protein-1c Regulates Inflammasome Activation in Gingival Fibroblasts Infected with High-Glucose-Treated Porphyromonas gingivalis

    PubMed Central

    Kuo, Hsing-Chun; Chang, Li-Ching; Chen, Te-Chuan; Lee, Ko-Chao; Lee, Kam-Fai; Chen, Cheng-Nan; Yu, Hong-Ren

    2016-01-01

    Background: Porphyromonas gingivalis is a major bacterial species implicated in the progression of periodontal disease, which is recognized as a common complication of diabetes. The interleukin (IL)-1β, processed by the NLR family pyrin domain containing 3 (NLRP3) inflammasome, has been identified as a target for pathogenic infection of the inflammatory response. However, the effect of P. gingivalis in a high-glucose situation in the modulation of inflammasome activation in human gingival fibroblasts (HGFs) is not well-understood. Methods: P. gingivalis strain CCUG25226 was used to study the mechanisms underlying the regulation of HGF NLRP3 expression by the infection of high-glucose-treated P. gingivalis (HGPg). Results: HGF infection with HGPg increases the expression of IL-1β and NLRP3. We further demonstrated that the upregulation of sterol regulatory element-binding protein (SREBP)-1c by activation of the Akt and p70S6K pathways is critical for HGPg-induced NLRP3 expression. We showed that the inhibition of Janus kinase 2 (JAK2) blocks the Akt- and p70S6K-mediated SREBP-1c, NLRP3, and IL-1β expression. The effect of HGPg on HGF signaling and NLRP3 expression is mediated by β1 integrin. In addition, gingival tissues from diabetic patients with periodontal disease exhibited higher NLRP3 and SREBP-1c expression. Conclusions: Our findings identify the molecular pathways underlying HGPg-dependent NLRP3 inflammasome expression in HGFs, providing insight into the effect of P. gingivalis invasion in HGFs. PMID:28083517

  12. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  13. Computational identification of transcriptional regulatory elements in DNA sequence

    PubMed Central

    GuhaThakurta, Debraj

    2006-01-01

    Identification and annotation of all the functional elements in the genome, including genes and the regulatory sequences, is a fundamental challenge in genomics and computational biology. Since regulatory elements are frequently short and variable, their identification and discovery using computational algorithms is difficult. However, significant advances have been made in the computational methods for modeling and detection of DNA regulatory elements. The availability of complete genome sequence from multiple organisms, as well as mRNA profiling and high-throughput experimental methods for mapping protein-binding sites in DNA, have contributed to the development of methods that utilize these auxiliary data to inform the detection of transcriptional regulatory elements. Progress is also being made in the identification of cis-regulatory modules and higher order structures of the regulatory sequences, which is essential to the understanding of transcription regulation in the metazoan genomes. This article reviews the computational approaches for modeling and identification of genomic regulatory elements, with an emphasis on the recent developments, and current challenges. PMID:16855295

  14. Regulatory elements of the Staphylococcus aureus protein A (Spa) promoter.

    PubMed

    Gao, Jinxin; Stewart, George C

    2004-06-01

    Staphylococcal protein A (Spa) is an important virulence factor of Staphylococcus aureus. Transcription of the spa determinant occurs during the exponential growth phase and is repressed when the cells enter the postexponential growth phase. Regulation of spa expression has been found to be complicated, with regulation involving multiple factors, including Agr, SarA, SarS, SarT, Rot, and MgrA. Our understanding of how these factors work on the spa promoter to regulate spa expression is incomplete. To identify regulatory sites within the spa promoter, analysis of deletion derivatives of the promoter in host strains deficient in one or more of the regulatory factors was undertaken, and several critical features of spa regulation were revealed. The transcriptional start sites of spa were determined by primer extension. The spa promoter sequences were subcloned in front of a promoterless chloramphenicol acetyltransferase reporter gene. Various lengths of spa truncations with the same 3' end were constructed, and the resultant plasmids were transduced into strains with different regulatory genetic backgrounds. Our results identified upstream promoter sequences necessary for Agr system regulation of spa expression. The cis elements for SarS activity, an activator of spa expression, and for SarA activity, a repressor of spa expression, were identified. The well-characterized SarA consensus sequence on the spa promoter was found to be insufficient for SarA repression of the spa promoter. Full repression required the presence of a second consensus site adjacent to the SarS binding site. Sequences directly upstream of the core promoter sequence were found to stimulate transcription.

  15. Evolutionary conservation of regulatory elements in vertebrate Hox gene clusters.

    PubMed

    Santini, Simona; Boore, Jeffrey L; Meyer, Axel

    2003-06-01

    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aalpha or Abeta duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes.

  16. Negative transcriptional regulatory element that functions in embryonal carcinoma cells.

    PubMed Central

    Ariizumi, K; Takahashi, H; Nakamura, M; Ariga, H

    1989-01-01

    We have cloned the polyomavirus mutant fPyF9, which persists in an episomal state in F9 embryonal carcinoma cells (K. Ariizumi and H. Ariga, Mol. Cell. Biol. 6:3920-3927, 1986). fPyF9 carries three copies of exogenous sequences, the prototype of which is a 21-base-pair repeat (box DNA), in the region of the enhancer B domain of wild-type polyomavirus DNA. The consensus sequence, GCATTCCATTGTT, is 13 base pairs long. The box DNA inserted into fPyF9 appeared to come from a cellular sequence and was present in many kinds of DNAs, including F9 chromosomal DNA. The biological function of box DNA was analyzed by chloramphenicol acetyltransferase expression assays, using chimeric plasmids containing box DNA conjugated with simian virus 40 promoter elements. The results showed that box DNA repressed the activities both of the simian virus 40 promoter and enhancer only in transfected undifferentiated F9 cells and not in differentiated LTK- cells. Box DNA functioned independently of orientation and position with respect to the promoter in an enhancerlike manner, although the effect of box DNA was opposite that of the enhancer. The XhoI linker insertion into the consensus sequences of box DNA abolished the repression activity, and the protein(s) recognizing the consensus sequences was identified only in F9 cells, not in L cells. These analyses suggest that box DNA may be a negative regulatory element that functions in undifferentiated cells. Images PMID:2550812

  17. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  18. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  19. Cell-specific activity of cis-acting regulatory elements in the promoter of the mouse multidrug resistance gene mdr1.

    PubMed

    Raymond, M; Gros, P

    1990-11-01

    To define cis-acting elements implicated in transcriptional regulation of the mouse multidrug resistance gene mdr1, we have cloned and characterized the 5' end of the gene. Nucleotide sequence analysis identified TATA, GGGCGG, and CCAAT consensus sequence elements at positions -27, -47, and -83, respectively. The transcriptional activities of 5' deletion fragments from the promoter linked to a reporter gene were tested in mouse cell lines of different tissue origins shown to express different levels of endogenous mdr1 RNA. Sequences located between nucleotides -93 and +84 were able to confer basal promoter activity and cell specificity to the reporter gene. The addition to the basal promoter of sequences upstream of position -141 was found to up or down regulate the basal level of expression of the reporter gene in a cell-specific manner.

  20. Isolation of a non-genomic origin fluoroquinolone responsive regulatory element using a combinatorial bioengineering approach.

    PubMed

    Srivastava, Santosh Kumar; Iyer, V Rajesh; Ghosh, Tamoghna; Lambadi, Paramesh Ramulu; Pathania, Ranjana; Navani, Naveen Kumar

    2016-03-18

    Advances in chemical biology have led to selection of synthetic functional nucleic acids for in vivo applications. Discovery of synthetic nucleic acid regulatory elements has been a long-standing goal of chemical biologists. Availability of vast genome level genetic resources has motivated efforts for discovery and understanding of inducible synthetic genetic regulatory elements. Such elements can lead to custom-design of switches and sensors, oscillators, digital logic evaluators and cell-cell communicators. Here, we describe a simple, robust and universally applicable module for discovery of inducible gene regulatory elements. The distinguishing feature is the use of a toxic peptide as a reporter to suppress the background of unwanted bacterial recombinants. Using this strategy, we show that it is possible to isolate genetic elements of non-genomic origin which specifically get activated in the presence of DNA gyrase A inhibitors belonging to fluoroquinolone (FQ) group of chemicals. Further, using a system level genetic resource, we prove that the genetic regulation is exerted through histone-like nucleoid structuring (H-NS) repressor protein. Till date, there are no reports of in vivo selection of non-genomic origin inducible regulatory promoter like elements. Our strategy opens an uncharted route to discover inducible synthetic regulatory elements from biologically-inspired nucleic acid sequences.

  1. Identification of germline transcriptional regulatory elements in Aedes aegypti

    NASA Astrophysics Data System (ADS)

    Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

    2014-02-01

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  2. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements

    PubMed Central

    Schoenfelder, Stefan; Furlan-Magaril, Mayra; Mifsud, Borbala; Tavares-Cadete, Filipe; Sugar, Robert; Javierre, Biola-Maria; Nagano, Takashi; Katsman, Yulia; Sakthidevi, Moorthy; Wingett, Steven W.; Dimitrova, Emilia; Dimond, Andrew; Edelman, Lucas B.; Elderkin, Sarah; Tabbada, Kristina; Darbo, Elodie; Andrews, Simon; Herman, Bram; Higgs, Andy; LeProust, Emily; Osborne, Cameron S.; Mitchell, Jennifer A.

    2015-01-01

    The mammalian genome harbors up to one million regulatory elements often located at great distances from their target genes. Long-range elements control genes through physical contact with promoters and can be recognized by the presence of specific histone modifications and transcription factor binding. Linking regulatory elements to specific promoters genome-wide is currently impeded by the limited resolution of high-throughput chromatin interaction assays. Here we apply a sequence capture approach to enrich Hi-C libraries for >22,000 annotated mouse promoters to identify statistically significant, long-range interactions at restriction fragment resolution, assigning long-range interacting elements to their target genes genome-wide in embryonic stem cells and fetal liver cells. The distal sites contacting active genes are enriched in active histone modifications and transcription factor occupancy, whereas inactive genes contact distal sites with repressive histone marks, demonstrating the regulatory potential of the distal elements identified. Furthermore, we find that coregulated genes cluster nonrandomly in spatial interaction networks correlated with their biological function and expression level. Interestingly, we find the strongest gene clustering in ES cells between transcription factor genes that control key developmental processes in embryogenesis. The results provide the first genome-wide catalog linking gene promoters to their long-range interacting elements and highlight the complex spatial regulatory circuitry controlling mammalian gene expression. PMID:25752748

  3. Identifying splicing regulatory elements with de Bruijn graphs.

    PubMed

    Badr, Eman; Heath, Lenwood S

    2014-12-01

    Splicing regulatory elements (SREs) are short, degenerate sequences on pre-mRNA molecules that enhance or inhibit the splicing process via the binding of splicing factors, proteins that regulate the functioning of the spliceosome. Existing methods for identifying SREs in a genome are either experimental or computational. Here, we propose a formalism based on de Bruijn graphs that combines genomic structure, word count enrichment analysis, and experimental evidence to identify SREs found in exons. In our approach, SREs are not restricted to a fixed length (i.e., k-mers, for a fixed k). As a result, we identify 2001 putative exonic enhancers and 3080 putative exonic silencers for human genes, with lengths varying from 6 to 15 nucleotides. Many of the predicted SREs overlap with experimentally verified binding sites. Our model provides a novel method to predict variable length putative regulatory elements computationally for further experimental investigation.

  4. [Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

    PubMed

    Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

    2016-01-01

    In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

  5. Transcriptionally active MuDR, the regulatory element of the mutator transposable element family of Zea mays, is present in some accessions of the Mexican land race Zapalote chico.

    PubMed Central

    de la Luz Gutiérrez-Nava, M; Warren, C A; León, P; Walbot, V

    1998-01-01

    To date, mobile Mu transposons and their autonomous regulator MuDR have been found only in the two known Mutator lines of maize and their immediate descendants. To gain insight into the origin, organization, and regulation of Mutator elements, we surveyed exotic maize and related species for cross-hybridization to MuDR. Some accessions of the mexican land race Zapalote chico contain one to several copies of full-length, unmethylated, and transcriptionally active MuDR-like elements plus non-autonomous Mu elements. The sequenced 5.0-kb MuDR-Zc element is 94.6% identical to MuDR, with only 20 amino acid changes in the 93-kD predicted protein encoded by mudrA and ten amino acid changes in the 23-kD predicted protein of mudrB. The terminal inverted repeat (TIR) A of MuDR-Zc is identical to standard MuDR; TIRB is 11.2% divergent from TIRA. In Zapalote chico, mudrA transcripts are very rare, while mudrB transcripts are as abundant as in Mutator lines with a few copies of MuDR. Zapalote chico lines with MuDR-like elements can trans-activate reporter alleles in inactive Mutator backgrounds; they match the characteristic increased forward mutation frequency of standard Mutator lines, but only after outcrossing to another line. Zapalote chico accessions that lack MuDR-like elements and the single copy MuDR a1-mum2 line produce few mutations. New mutants recovered from Zapalote chico are somatically stable. PMID:9584107

  6. Constitutive androstane receptor transcriptionally activates human CYP1A1 and CYP1A2 genes through a common regulatory element in the 5'-flanking region.

    PubMed

    Yoshinari, Kouichi; Yoda, Noriaki; Toriyabe, Takayoshi; Yamazoe, Yasushi

    2010-01-15

    Phenobarbital has long been known to increase cellular levels of CYP1A1 and CYP1A2 possibly through a pathway(s) independent of aryl hydrocarbon receptor. We have investigated the role of constitutive androstane receptor (CAR), a xenobiotic-responsive nuclear receptor, in the transactivation of human CYP1A1 and CYP1A2. These genes are located in a head-to-head orientation, sharing a 5'-flanking region. Reporter assays were thus performed with dual-reporter constructs, containing the whole or partially deleted human CYP1A promoter between two different reporter genes. In this system, human CAR (hCAR) enhanced the transcription of both genes through common promoter regions from -461 to -554 and from -18089 to -21975 of CYP1A1. With reporter assays using additional deleted and mutated constructs, electrophoresis mobility shift assays and chromatin immunoprecipitation assays, an ER8 motif (everted repeat separated by eight nucleotides), located at around -520 of CYP1A1, was identified as an hCAR-responsive element and a binding motif of hCAR/human retinoid X receptor alpha heterodimer. hCAR enhanced the transcription of both genes also in the presence of an aryl hydrocarbon receptor ligand. Finally, hCAR activation increased CYP1A1 and CYP1A2 mRNA levels in cultured human hepatocytes. Our results indicate that CAR transactivates human CYP1A1 and CYP1A2 in human hepatocytes through the common cis-element ER8. Interestingly, the ER8 motif is highly conserved in the CYP1A1 proximal promoter sequences of various species, suggesting a fundamental role of CAR in the xenobiotic-induced expression of CYP1A1 and CYP1A2 independent of aryl hydrocarbon receptor.

  7. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.

    PubMed

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R

    2016-09-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa.

  8. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.

    2016-01-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  9. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  10. Ginsenoside F2 reduces hair loss by controlling apoptosis through the sterol regulatory element-binding protein cleavage activating protein and transforming growth factor-β pathways in a dihydrotestosterone-induced mouse model.

    PubMed

    Shin, Heon-Sub; Park, Sang-Yong; Hwang, Eun-Son; Lee, Don-Gil; Mavlonov, Gafurjon Turdalievich; Yi, Tae-Hoo

    2014-01-01

    This study was conducted to test whether ginsenoside F2 can reduce hair loss by influencing sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP) and the transforming growth factor beta (TGF-β) pathway of apoptosis in dihydrotestosterone (DHT)-treated hair cells and in a DHT-induced hair loss model in mice. Results for ginsenoside F2 were compared with finasteride. DHT inhibits proliferation of hair cells and induces androgenetic alopecia and was shown to activate an apoptosis signal pathway both in vitro and in vivo. The cell-based 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay showed that the proliferation rates of DHT-treated human hair dermal papilla cells (HHDPCs) and HaCaTs increased by 48% in the ginsenoside F2-treated group and by 12% in the finasteride-treated group. Western blot analysis showed that ginsenoside F2 decreased expression of TGF-β2 related factors involved in hair loss. The present study suggested a hair loss related pathway by changing SCAP related apoptosis pathway, which has been known to control cholesterol metabolism. SCAP, sterol regulatory element-binding protein (SREBP) and caspase-12 expression in the ginsenoside F2-treated group were decreased compared to the DHT and finasteride-treated group. C57BL/6 mice were also prepared by injection with DHT and then treated with ginsenoside F2 or finasteride. Hair growth rate, density, thickness measurements and tissue histotological analysis in these groups suggested that ginsenoside F2 suppressed hair cell apoptosis and premature entry to catagen more effectively than finasteride. Our results indicated that ginsenoside F2 decreased the expression of TGF-β2 and SCAP proteins, which have been suggested to be involved in apoptosis and entry into catagen. This study provides evidence those factors in the SCAP pathway could be targets for hair loss prevention drugs.

  11. Regulatory fit messages and physical activity motivation.

    PubMed

    Pfeffer, Ines

    2013-04-01

    Targeted communication about health behaviors seems to be more effective than mass communication in which undifferentiated audiences receive identical messages. Regulatory focus is psychological variable that can be used to build two target groups: promotion-focused or prevention-focused people. It is hypothesized that targeting messages to an individual's regulatory focus creates regulatory fit and is more successful to promote a physically active lifestyle than nonfit messages. Two different print messages promoting a physically active lifestyle derived from regulatory focus theory (promotion message vs. prevention message) were randomly assigned to N = 98 participants after measuring their regulatory focus. It was examined whether regulatory fit between the regulatory focus and the assigned print message would lead to more positive evaluations in the dependent variables inclination toward the message (preference for the message), intention to perform the behavior, prospective and retrospective feelings associated with the behavior (positive and negative), and perceived value of the behavior directly after reading the message. Hierarchical linear regression analyses revealed that regulatory fit led to stronger intentions in the prevention-message condition and more prospective positive and retrospective positive feelings associated with the behavior in the promotion-message condition in contrast to the nonfit conditions. Prospective positive feelings associated with the behavior mediated the effect of regulatory fit on intention. The results partly provided support for the regulatory fit concept. Matching print messages to the regulatory focus of individuals seems to be a useful approach to enhance physical activity motivation. Future studies should include an objective measure of physical activity behavior.

  12. Recurrent modification of a conserved cis-regulatory element underlies fruit fly pigmentation diversity.

    PubMed

    Rogers, William A; Salomone, Joseph R; Tacy, David J; Camino, Eric M; Davis, Kristen A; Rebeiz, Mark; Williams, Thomas M

    2013-08-01

    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages.

  13. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    SciTech Connect

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  14. Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula.

    PubMed

    Bucsenez, M; Rüping, B; Behrens, S; Twyman, R M; Noll, G A; Prüfer, D

    2012-09-01

    The sieve element occlusion (SEO) gene family includes several members that are expressed specifically in immature sieve elements (SEs) in the developing phloem of dicotyledonous plants. To determine how this restricted expression profile is achieved, we analysed the SE-specific Medicago truncatula SEO-F1 promoter (PMtSEO-F1) by constructing deletion, substitution and hybrid constructs and testing them in transgenic tobacco plants using green fluorescent protein as a reporter. This revealed four promoter regions, each containing cis-regulatory elements that activate transcription in SEs. One of these segments also contained sufficient information to suppress PMtSEO-F1 transcription in the phloem companion cells (CCs). Subsequent in silico analysis revealed several candidate cis-regulatory elements that PMtSEO-F1 shares with other SEO promoters. These putative sieve element boxes (PSE boxes) are promising candidates for cis-regulatory elements controlling the SE-specific expression of PMtSEO-F1.

  15. Binding of estrogen receptors to switch sites and regulatory elements in the immunoglobulin heavy chain locus of activated B cells suggests a direct influence of estrogen on antibody expression.

    PubMed

    Jones, Bart G; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Neale, Geoff; Gearhart, Patricia J; Hurwitz, Julia L

    2016-09-01

    Females and males differ in antibody isotype expression patterns and in immune responses to foreign- and self-antigens. For example, systemic lupus erythematosus is a condition that associates with the production of isotype-skewed anti-self antibodies, and exhibits a 9:1 female:male disease ratio. To explain differences between B cell responses in males and females, we sought to identify direct interactions of the estrogen receptor (ER) with the immunoglobulin heavy chain locus. This effort was encouraged by our previous identification of estrogen response elements (ERE) in heavy chain switch (S) regions. We conducted a full-genome chromatin immunoprecipitation analysis (ChIP-seq) using DNA from LPS-activated B cells and an ERα-specific antibody. Results revealed ER binding to a wide region of DNA, spanning sequences from the JH cluster to Cδ, with peaks in Eμ and Sμ sites. Additional peaks of ERα binding were coincident with hs1,2 and hs4 sites in the 3' regulatory region (3'RR) of the heavy chain locus. This first demonstration of direct binding of ER to key regulatory elements in the immunoglobulin locus supports our hypothesis that estrogen and other nuclear hormone receptors and ligands may directly influence antibody expression and class switch recombination (CSR). Our hypothesis encourages the conduct of new experiments to evaluate the consequences of ER binding. A better understanding of ER:DNA interactions in the immunoglobulin heavy chain locus, and respective mechanisms, may ultimately translate to better control of antibody expression, better protection against pathogens, and prevention of pathologies caused by auto-immune disease.

  16. Epistatic Interactions in the Arabinose Cis-Regulatory Element.

    PubMed

    Lagator, Mato; Igler, Claudia; Moreno, Anaísa B; Guet, Călin C; Bollback, Jonathan P

    2016-03-01

    Changes in gene expression are an important mode of evolution; however, the proximate mechanism of these changes is poorly understood. In particular, little is known about the effects of mutations within cis binding sites for transcription factors, or the nature of epistatic interactions between these mutations. Here, we tested the effects of single and double mutants in two cis binding sites involved in the transcriptional regulation of the Escherichia coli araBAD operon, a component of arabinose metabolism, using a synthetic system. This system decouples transcriptional control from any posttranslational effects on fitness, allowing a precise estimate of the effect of single and double mutations, and hence epistasis, on gene expression. We found that epistatic interactions between mutations in the araBAD cis-regulatory element are common, and that the predominant form of epistasis is negative. The magnitude of the interactions depended on whether the mutations are located in the same or in different operator sites. Importantly, these epistatic interactions were dependent on the presence of arabinose, a native inducer of the araBAD operon in vivo, with some interactions changing in sign (e.g., from negative to positive) in its presence. This study thus reveals that mutations in even relatively simple cis-regulatory elements interact in complex ways such that selection on the level of gene expression in one environment might perturb regulation in the other environment in an unpredictable and uncorrelated manner.

  17. Discovery of regulatory elements is improved by a discriminatory approach.

    PubMed

    Valen, Eivind; Sandelin, Albin; Winther, Ole; Krogh, Anders

    2009-11-01

    A major goal in post-genome biology is the complete mapping of the gene regulatory networks for every organism. Identification of regulatory elements is a prerequisite for realizing this ambitious goal. A common problem is finding regulatory patterns in promoters of a group of co-expressed genes, but contemporary methods are challenged by the size and diversity of regulatory regions in higher metazoans. Two key issues are the small amount of information contained in a pattern compared to the large promoter regions and the repetitive characteristics of genomic DNA, which both lead to "pattern drowning". We present a new computational method for identifying transcription factor binding sites in promoters using a discriminatory approach with a large negative set encompassing a significant sample of the promoters from the relevant genome. The sequences are described by a probabilistic model and the most discriminatory motifs are identified by maximizing the probability of the sets given the motif model and prior probabilities of motif occurrences in both sets. Due to the large number of promoters in the negative set, an enhanced suffix array is used to improve speed and performance. Using our method, we demonstrate higher accuracy than the best of contemporary methods, high robustness when extending the length of the input sequences and a strong correlation between our objective function and the correct solution. Using a large background set of real promoters instead of a simplified model leads to higher discriminatory power and markedly reduces the need for repeat masking; a common pre-processing step for other pattern finders.

  18. Functional interaction of hepatic nuclear factor-4 and peroxisome proliferator-activated receptor-gamma coactivator 1alpha in CYP7A1 regulation is inhibited by a key lipogenic activator, sterol regulatory element-binding protein-1c.

    PubMed

    Ponugoti, Bhaskar; Fang, Sungsoon; Kemper, Jongsook Kim

    2007-11-01

    Insulin inhibits transcription of cholesterol 7alpha-hydroxylase (Cyp7a1), a key gene in bile acid synthesis, and the hepatic nuclear factor-4 (HNF-4) site in the promoter was identified as a negative insulin response sequence. Using a fasting/feeding protocol in mice and insulin treatment in HepG2 cells, we explored the inhibition mechanisms. Expression of sterol regulatory element-binding protein-1c (SREBP-1c), an insulin-induced lipogenic factor, inversely correlated with Cyp7a1 expression in mouse liver. Interaction of HNF-4 with its coactivator, peroxisome proliferator-activated receptor-gamma coactivator 1alpha (PGC-1alpha), was observed in livers of fasted mice and was reduced after feeding. Conversely, HNF-4 interaction with SREBP-1c was increased after feeding. In vitro studies suggested that SREBP-1c competed with PGC-1alpha for direct interaction with the AF2 domain of HNF-4. Reporter assays showed that SREBP-1c, but not of a SREBP-1c mutant lacking the HNF-4 interacting domain, inhibited HNF-4/PGC-1alpha transactivation of Cyp7a1. SREBP-1c also inhibited PGC-1alpha-coactivation of estrogen receptor, constitutive androstane receptor, pregnane X receptor, and farnesoid X receptor, implying inhibition of HNF-4 by SREBP-1c could extend to other nuclear receptors. In chromatin immunoprecipitation studies, HNF-4 binding to the promoter was not altered, but PGC-1alpha was dissociated, SREBP-1c and histone deacetylase-2 (HDAC2) were recruited, and acetylation of histone H3 was decreased upon feeding. Adenovirus-mediated expression of a SREBP-1c dominant-negative mutant, which blocks the interaction of SREBP-1c and HNF-4, partially but significantly reversed the inhibition of Cyp7a1 after feeding. Our data show that SREBP-1c functions as a non-DNA-binding inhibitor and mediates, in part, suppression of Cyp7a1 by blocking functional interaction of HNF-4 and PGC-1alpha. This mechanism may be relevant to known repression of many other HNF-4 target genes upon

  19. Identification of functional elements and regulatory circuits by Drosophila modENCODE.

    PubMed

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis

    2010-12-24

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

  20. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    PubMed

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  1. Downstream Regulatory Element Antagonist Modulator (DREAM), a target for anti-thrombotic agents.

    PubMed

    Cho, Jaehyung

    2017-03-01

    Circulating platelets participate in the process of numerous diseases including thrombosis, inflammation, and cancer. Thus, it is of great importance to understand the underlying mechanisms mediating platelet activation under disease conditions. Emerging evidence indicates that despite the lack of a nucleus, platelets possess molecules that are involved in gene transcription in nucleated cells. This review will summarize downstream regulatory element antagonist modulator (DREAM), a transcriptional repressor, and highlight recent findings suggesting its novel non-transcriptional role in hemostasis and thrombosis.

  2. Efficiently finding regulatory elements using correlation with gene expression.

    PubMed

    Bannai, Hideo; Inenaga, Shunsuke; Shinohara, Ayumi; Takeda, Masayuki; Miyano, Satoru

    2004-06-01

    We present an efficient algorithm for detecting putative regulatory elements in the upstream DNA sequences of genes, using gene expression information obtained from microarray experiments. Based on a generalized suffix tree, our algorithm looks for motif patterns whose appearance in the upstream region is most correlated with the expression levels of the genes. We are able to find the optimal pattern, in time linear in the total length of the upstream sequences. We implement and apply our algorithm to publicly available microarray gene expression data, and show that our method is able to discover biologically significant motifs, including various motifs which have been reported previously using the same data set. We further discuss applications for which the efficiency of the method is essential, as well as possible extensions to our algorithm.

  3. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

    PubMed Central

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

    2015-01-01

    Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Contact: Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

  4. SREBP2 Activation Induces Hepatic Long-chain Acyl-CoA Synthetase 1 (ACSL1) Expression in Vivo and in Vitro through a Sterol Regulatory Element (SRE) Motif of the ACSL1 C-promoter.

    PubMed

    Singh, Amar Bahadur; Kan, Chin Fung Kelvin; Dong, Bin; Liu, Jingwen

    2016-03-04

    Long-chain acyl-CoA synthetase 1 (ACSL1) plays a key role in fatty acid metabolism. To identify novel transcriptional modulators of ACSL1, we examined ACSL1 expression in liver tissues of hamsters fed a normal diet, a high fat diet, or a high cholesterol and high fat diet (HCHFD). Feeding hamsters HCHFD markedly reduced hepatic Acsl1 mRNA and protein levels as well as acyl-CoA synthetase activity. Decreases in Acsl1 expression strongly correlated with reductions in hepatic Srebp2 mRNA level and mature Srebp2 protein abundance. Conversely, administration of rosuvastatin (RSV) to hamsters increased hepatic Acsl1 expression. These new findings were reproduced in mice treated with RSV or fed the HCHFD. Furthermore, the RSV induction of acyl-CoA activity in mouse liver resulted in increases in plasma and hepatic cholesterol ester concentrations and reductions in free cholesterol amounts. Investigations on different ACSL1 transcript variants in HepG2 cells revealed that the mRNA expression of C-ACSL1 was specifically regulated by the sterol regulatory element (SRE)-binding protein (SREBP) pathway, and RSV treatment increased the C-ACSL1 abundance from a minor mRNA species to an abundant transcript. We analyzed 5'-flanking sequence of exon 1C of the human ACSL1 gene and identified one putative SRE site. By performing a promoter activity assay and DNA binding assays, we firmly demonstrated the key role of this SRE motif in SREBP2-mediated activation of C-ACSL1 gene transcription. Finally, we demonstrated that knockdown of endogenous SREBP2 in HepG2 cells lowered ACSL1 mRNA and protein levels. Altogether, this work discovered an unprecedented link between ACSL1 and SREBP2 via the specific regulation of the C-ACSL1 transcript.

  5. SREBP2 Activation Induces Hepatic Long-chain Acyl-CoA Synthetase 1 (ACSL1) Expression in Vivo and in Vitro through a Sterol Regulatory Element (SRE) Motif of the ACSL1 C-promoter*

    PubMed Central

    Singh, Amar Bahadur; Kan, Chin Fung Kelvin; Dong, Bin; Liu, Jingwen

    2016-01-01

    Long-chain acyl-CoA synthetase 1 (ACSL1) plays a key role in fatty acid metabolism. To identify novel transcriptional modulators of ACSL1, we examined ACSL1 expression in liver tissues of hamsters fed a normal diet, a high fat diet, or a high cholesterol and high fat diet (HCHFD). Feeding hamsters HCHFD markedly reduced hepatic Acsl1 mRNA and protein levels as well as acyl-CoA synthetase activity. Decreases in Acsl1 expression strongly correlated with reductions in hepatic Srebp2 mRNA level and mature Srebp2 protein abundance. Conversely, administration of rosuvastatin (RSV) to hamsters increased hepatic Acsl1 expression. These new findings were reproduced in mice treated with RSV or fed the HCHFD. Furthermore, the RSV induction of acyl-CoA activity in mouse liver resulted in increases in plasma and hepatic cholesterol ester concentrations and reductions in free cholesterol amounts. Investigations on different ACSL1 transcript variants in HepG2 cells revealed that the mRNA expression of C-ACSL1 was specifically regulated by the sterol regulatory element (SRE)-binding protein (SREBP) pathway, and RSV treatment increased the C-ACSL1 abundance from a minor mRNA species to an abundant transcript. We analyzed 5′-flanking sequence of exon 1C of the human ACSL1 gene and identified one putative SRE site. By performing a promoter activity assay and DNA binding assays, we firmly demonstrated the key role of this SRE motif in SREBP2-mediated activation of C-ACSL1 gene transcription. Finally, we demonstrated that knockdown of endogenous SREBP2 in HepG2 cells lowered ACSL1 mRNA and protein levels. Altogether, this work discovered an unprecedented link between ACSL1 and SREBP2 via the specific regulation of the C-ACSL1 transcript. PMID:26728456

  6. Recurrent Modification of a Conserved Cis-Regulatory Element Underlies Fruit Fly Pigmentation Diversity

    PubMed Central

    Rogers, William A.; Salomone, Joseph R.; Tacy, David J.; Camino, Eric M.; Davis, Kristen A.; Rebeiz, Mark; Williams, Thomas M.

    2013-01-01

    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages. PMID:24009528

  7. Covariation among glucocorticoid regulatory elements varies seasonally in house sparrows.

    PubMed

    Liebl, Andrea L; Shimizu, Toru; Martin, Lynn B

    2013-03-01

    Glucocorticoids (GCs) help individuals cope with changes throughout life; one such change is the seasonal transition through life-history stages. Previous research shows that many animals exhibit seasonal variation in baseline GCs and GC responses to stressors, but the effects of season on other aspects of GC regulation have been less studied. Moreover, whether elements of GC regulation covary within individuals and whether covariation changes seasonally has been not been investigated. Evolutionarily, strong linkages among GC regulatory elements is predicted to enhance system efficiency and regulation, however may reduce the plasticity necessary to ensure appropriate responses under varying conditions. Here, we measured corticosterone (CORT), the major avian GC, at baseline, after exposure to a restraint stressor, and in response to dexamethasone (to assess negative feedback capacity) in wild house sparrows (Passer domesticus) during the breeding and molting seasons. We also measured hippocampal mRNA expression of the two receptors primarily responsible for CORT regulation: the mineralocorticoid and glucocorticoid receptors (MR and GR, respectively). Consistent with previous studies, restraint-induced CORT was lower during molt than breeding, but negative-feedback was not influenced by season. Receptor gene expression was affected by season, however, as during breeding, the ratio of MR to GR expression was significantly lower than during molt. Furthermore, MR expression was negatively correlated with CORT released in response to a stressor, but only during molt. We found that individuals that most strongly up-regulated CORT in response to restraint were also most effective at reducing CORT via negative feedback; although these relationships were independent of season, they were stronger during molt.

  8. Berberine-improved visceral white adipose tissue insulin resistance associated with altered sterol regulatory element-binding proteins, liver x receptors, and peroxisome proliferator-activated receptors transcriptional programs in diabetic hamsters.

    PubMed

    Li, Guo-Sheng; Liu, Xu-Han; Zhu, Hua; Huang, Lan; Liu, Ya-Li; Ma, Chun-Mei; Qin, Chuan

    2011-01-01

    The diabetic "lipotoxicity" hypothesis presents that fat-induced visceral white adipose tissue insulin resistance plays a central role in the pathogenesis of type 2 diabetes. Berberine, a hypolipidemic agent, has been reported to have antidiabetic activities. The molecular mechanisms for this property are, however, not well clarified. Therefore in this study type 2 diabetic hamsters were induced by high-fat diet with low-dose streptozotocin. Then, we investigated the gene expression alterations and explored the molecular mechanisms underlying the therapeutic effect of berberine on fat-induced visceral white adipose tissue insulin resistance in diabetic hamsters by microarray analysis followed by real-time reverse transcription-polymerase chain reaction (RT-PCR) confirmation. Type 2 diabetic hamsters exhibited hyperglycemia and relative hyperinsulinemia, glucose intolerance, insulin resistance, intra-adipocyte lipid accumulation, significant increase in body weight and visceral white adipose tissue weight, abnormal serum adipokines levels, and deleterious dyslipidemia. Furthermore, they had increased sterol regulatory element-binding proteins (SREBPs) expression and decreased liver X receptors (LXRs) and peroxisome proliferator-activated receptors (PPARs) expression in visceral white adipose tissue. After 9-week berberine treatment, fat-induced insulin resistance and diabetic phenotype in type 2 diabetic hamsters were significantly improved. Compared with diabetic hamsters, expression of LXRs and PPARs significantly increased and SREBPs significantly decreased in visceral white adipose tissue from berberine-treated diabetic hamsters. These results suggest that altered visceral white adipose tissue LXRs, PPARs, and SREBPs transcriptional programs are involved in the therapeutic mechanisms of berberine on fat-induced visceral white adipose tissue insulin resistance in type 2 diabetic hamsters.

  9. Cis-regulatory elements are harbored in Intron5 of the RUNX1 gene

    PubMed Central

    2014-01-01

    Background Human RUNX1 gene is one of the most frequent target for chromosomal translocations associated with acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL). The highest prevalence in AML is noted with (8; 21) translocation; which represents 12 to 15% of all AML cases. Interestingly, all the breakpoints mapped to date in t(8;21) are clustered in intron 5 of the RUNX1 gene and intron 1 of the ETO gene. No homologous sequences have been found at the recombination regions; but DNase I hypersensitive sites (DHS) have been mapped to the areas of the genes involved in t(8;21). Presence of DHS sites is commonly associated with regulatory elements such as promoters, enhancers and silencers, among others. Results In this study we used a combination of comparative genomics, cloning and transfection assays to evaluate potential regulatory elements located in intron 5 of the RUNX1 gene. Our genomic analysis identified nine conserved non-coding sequences that are evolutionarily conserved among rat, mouse and human. We cloned two of these regions in pGL-3 Promoter plasmid in order to analyze their transcriptional regulatory activity. Our results demonstrate that the identified regions can indeed regulate transcription of a reporter gene in a distance and position independent manner; moreover, their transcriptional effect is cell type specific. Conclusions We have identified nine conserved non coding sequence that are harbored in intron 5 of the RUNX1 gene. We have also demonstrated that two of these regions can regulate transcriptional activity in vitro. Taken together our results suggest that intron 5 of the RUNX1 gene contains multiple potential cis-regulatory elements. PMID:24655352

  10. Regulatory Elements in Vectors for Efficient Generation of Cell Lines Producing Target Proteins

    PubMed Central

    Maksimenko, O.; Gasanov, N. B.; Georgiev, P.

    2015-01-01

    To date, there has been an increasing number of drugs produced in mammalian cell cultures. In order to enhance the expression level and stability of target recombinant proteins in cell cultures, various regulatory elements with poorly studied mechanisms of action are used. In this review, we summarize and discuss the potential mechanisms of action of such regulatory elements. PMID:26483956

  11. Dysregulation of sterol regulatory element binding protein-1c in livers of morbidly obese women is associated with altered suppressor of cytokine signaling-3 and signal transducer and activator of transcription-1 signaling.

    PubMed

    Elam, Marshall B; Yellaturu, Chandrahasa; Howell, George E; Deng, Xiong; Cowan, George S; Kumar, Poonam; Park, Edwards A; Hiler, M Lloyd; Wilcox, Henry G; Hughes, Thomas A; Cook, George A; Raghow, Rajendra

    2010-04-01

    We compared hepatic expression of genes that regulate lipid biosynthesis and metabolic signaling in liver biopsy specimens from women who were undergoing gastric bypass surgery (GBP) for morbid obesity with that in women undergoing ventral hernia repair who had experienced massive weight loss (MWL) after prior GBP. Comprehensive metabolic profiles of morbidly obese (MO) (22 subjects) and MWL (9 subjects) were also compared. Analyses of gene expression in liver biopsies from MO and MWL were accomplished by Affymetrix microarray, real-time polymerase chain reaction, and Western blotting techniques. After GBP, MWL subjects had lost on average 102 lb as compared with MO subjects. This was accompanied by effective reversal of the dyslipidemia and insulin resistance that were present in MO. As compared with MWL, livers of MO subjects exhibited increased expression of sterol regulatory element binding protein (SREBP)-1c and its downstream lipogenic targets, fatty acid synthase and acetyl-coenzyme A-carboxylase-1. Livers of MO subjects also exhibited enhanced expression of suppressor of cytokine signaling-3 protein and attenuated Janus kinase signal transducer and activator of transcription (JAK/STAT) signaling. Consistent with these findings, we found that the human SREBP-1c promoter was positively regulated by insulin and negatively regulated by STAT3. These data support the hypothesis that suppressor of cytokine signaling-3-mediated attenuation of the STAT signaling pathway and resulting enhanced expression of SREBP-1c, a key regulator of de novo lipid biosynthesis, are mechanistically related to the development of hepatic insulin resistance and dyslipidemia in MO women.

  12. Sterol Regulatory Element Binding Protein Is a Principal Regulator of Anaerobic Gene Expression in Fission Yeast†

    PubMed Central

    Todd, Bridget L.; Stewart, Emerson V.; Burg, John S.; Hughes, Adam L.; Espenshade, Peter J.

    2006-01-01

    Fission yeast sterol regulatory element binding protein (SREBP), called Sre1p, functions in an oxygen-sensing pathway to allow adaptation to fluctuating oxygen concentrations. The Sre1p-Scp1p complex responds to oxygen-dependent sterol synthesis as an indirect measure of oxygen availability. To examine the role of Sre1p in anaerobic gene expression in Schizosaccharomyces pombe, we performed transcriptional profiling experiments after a shift to anaerobic conditions for 1.5 h. Of the 4,940 genes analyzed, expression levels of 521 (10.5%) and 686 (13.9%) genes were significantly increased and decreased, respectively, under anaerobic conditions. Sre1p controlled 68% of genes induced ≥2-fold. Oxygen-requiring biosynthetic pathways for ergosterol, heme, sphingolipid, and ubiquinone were primary targets of Sre1p. Induction of glycolytic genes and repression of mitochondrial oxidative phosphorylation genes largely did not require Sre1p. Using chromatin immunoprecipitation, we demonstrated that Sre1p acts directly at target gene promoters and stimulates its own transcription under anaerobic conditions. sre1+ promoter analysis identified two DNA elements that are both necessary and sufficient for oxygen-dependent, Sre1p-dependent transcription. Interestingly, these elements are homologous to sterol regulatory elements bound by mammalian SREBP, highlighting the evolutionary conservation between Sre1p and SREBP. We conclude that Sre1p is a principal activator of anaerobic gene expression, upregulating genes required for nonrespiratory oxygen consumption. PMID:16537923

  13. Structural property of regulatory elements in human promoters

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2008-04-01

    The capacity of transcription factors to activate gene expression is encoded in the promoter sequences, which are composed of short regulatory motifs that function as transcription factor binding sites (TFBSs) for specific proteins. To the best of our knowledge, the structural property of TFBSs that controls transcription is still poorly understood. Rigidity is one of the important structural properties of DNA, and plays an important role in guiding DNA-binding proteins to the target sites efficiently. After analyzing the rigidity of 2897 TFBSs in 1871 human promoters, we show that TFBSs are generally more flexible than other genomic regions such as exons, introns, 3' untranslated regions, and TFBS-poor promoter regions. Furthermore, we find that the density of TFBSs is consistent with the average rigidity profile of human promoters upstream of the transcription start site, which implies that TFBSs directly influence the promoter structure. We also examine the local rigid regions probably caused by specific TFBSs such as the DNA sequence TATA(A/T)A(A/T) box, which may inhibit nucleosomes and thereby facilitate the access of transcription factors bound nearby. Our results suggest that the structural property of TFBSs accounts for the promoter structure as well as promoter activity.

  14. Positive and negative regulatory elements mediating transcription from the Drosophila melanogaster actin 5C distal promoter.

    PubMed Central

    Chung, Y T; Keller, E B

    1990-01-01

    The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the distal one of which controls synthesis of actin in a tissue- and developmental stage-specific manner. This very strong promoter has widely been used for expression of heterologous genes in cultured cells. To locate functional regulatory elements in this distal promoter, mutants of the promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. The results showed that the upstream end of the promoter extends to 522 bp from the transcription start site. In addition, there are two remote activating regions about 2 kb upstream. Between -522 and -379 are two regions that exert a strong negative effect. Downstream from these negative regions are at least six positive regions and a TATA element. The strongest positive determinant of the promoter was identified at -320 as AAAATGTG by footprinting and by a replacement experiment. When the relevant region was replaced by a synthetic sequence containing this element in a random context, the transient expression activity was restored. The sequence TGTATG located at -355 was also identified as a positive element by a similar replacement approach. Apparently the very high activity of this promoter is the result of the combined activities of multiple factors. Images PMID:2123290

  15. Exaptation of Transposable Elements into Novel Cis-Regulatory Elements: Is the Evidence Always Strong?

    PubMed Central

    de Souza, Flávio S.J.; Franchini, Lucía F.; Rubinstein, Marcelo

    2013-01-01

    Transposable elements (TEs) are mobile genetic sequences that can jump around the genome from one location to another, behaving as genomic parasites. TEs have been particularly effective in colonizing mammalian genomes, and such heavy TE load is expected to have conditioned genome evolution. Indeed, studies conducted both at the gene and genome levels have uncovered TE insertions that seem to have been co-opted—or exapted—by providing transcription factor binding sites (TFBSs) that serve as promoters and enhancers, leading to the hypothesis that TE exaptation is a major factor in the evolution of gene regulation. Here, we critically review the evidence for exaptation of TE-derived sequences as TFBSs, promoters, enhancers, and silencers/insulators both at the gene and genome levels. We classify the functional impact attributed to TE insertions into four categories of increasing complexity and argue that so far very few studies have conclusively demonstrated exaptation of TEs as transcriptional regulatory regions. We also contend that many genome-wide studies dealing with TE exaptation in recent lineages of mammals are still inconclusive and that the hypothesis of rapid transcriptional regulatory rewiring mediated by TE mobilization must be taken with caution. Finally, we suggest experimental approaches that may help attributing higher-order functions to candidate exapted TEs. PMID:23486611

  16. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  17. A steganalysis-based approach to comprehensive identification and characterization of functional regulatory elements

    PubMed Central

    Wang, Guandong; Zhang, Weixiong

    2006-01-01

    The comprehensive identification of cis-regulatory elements on a genome scale is a challenging problem. We develop a novel, steganalysis-based approach for genome-wide motif finding, called WordSpy, by viewing regulatory regions as a stegoscript with cis-elements embedded in 'background' sequences. We apply WordSpy to the promoters of cell-cycle-related genes of Saccharomyces cerevisiae and Arabidopsis thaliana, identifying all known cell-cycle motifs with high ranking. WordSpy can discover a complete set of cis-elements and facilitate the systematic study of regulatory networks. PMID:16787547

  18. Functional characterisation of cis-regulatory elements governing dynamic Eomes expression in the early mouse embryo.

    PubMed

    Simon, Claire S; Downes, Damien J; Gosden, Matthew E; Telenius, Jelena; Higgs, Douglas R; Hughes, Jim R; Costello, Ita; Bikoff, Elizabeth K; Robertson, Elizabeth J

    2017-02-07

    The T-box transcription factor (TF) Eomes is a key regulator of cell fate decisions during early mouse development. The cis-acting regulatory elements that direct expression in the anterior visceral endoderm (AVE), primitive streak (PS) and definitive endoderm (DE) have yet to be defined. Here, we identified three gene-proximal enhancer-like sequences (PSE_a, PSE_b and VPE) that faithfully activate tissue specific expression in transgenic embryos. However, targeted deletion experiments demonstrate that PSE_a and PSE_b are dispensable and only the VPE is required for optimal Eomes expression in vivo Embryos lacking this enhancer display variably penetrant defects in anterior-posterior axis orientation and DE formation. Chromosome conformation capture experiments reveal VPE-promoter interactions embryonic stem cells (ESC), prior to gene activation. The locus resides in a large (500kb) pre-formed compartment in ESC and activation during DE differentiation occurs in the absence of 3D structural changes. ATAC-seq analysis reveals that VPE, PSE_a, and four additional putative enhancers display increased chromatin accessibility in DE associated with Smad2/3 binding coincident with transcriptional activation. In contrast, activation of the Eomes target genes Foxa2 and Lhx1 is associated with higher order chromatin reorganisation. Thus diverse regulatory mechanisms govern activation of lineage specifying TFs during early development.

  19. Synthetic muscle promoters: activities exceeding naturally occurring regulatory sequences

    NASA Technical Reports Server (NTRS)

    Li, X.; Eastman, E. M.; Schwartz, R. J.; Draghia-Akli, R.

    1999-01-01

    Relatively low levels of expression from naturally occurring promoters have limited the use of muscle as a gene therapy target. Myogenic restricted gene promoters display complex organization usually involving combinations of several myogenic regulatory elements. By random assembly of E-box, MEF-2, TEF-1, and SRE sites into synthetic promoter recombinant libraries, and screening of hundreds of individual clones for transcriptional activity in vitro and in vivo, several artificial promoters were isolated whose transcriptional potencies greatly exceed those of natural myogenic and viral gene promoters.

  20. Transcription factor MITF and remodeller BRG1 define chromatin organisation at regulatory elements in melanoma cells.

    PubMed

    Laurette, Patrick; Strub, Thomas; Koludrovic, Dana; Keime, Céline; Le Gras, Stéphanie; Seberg, Hannah; Van Otterloo, Eric; Imrichova, Hana; Siddaway, Robert; Aerts, Stein; Cornell, Robert A; Mengus, Gabrielle; Davidson, Irwin

    2015-03-24

    Microphthalmia-associated transcription factor (MITF) is the master regulator of the melanocyte lineage. To understand how MITF regulates transcription, we used tandem affinity purification and mass spectrometry to define a comprehensive MITF interactome identifying novel cofactors involved in transcription, DNA replication and repair, and chromatin organisation. We show that MITF interacts with a PBAF chromatin remodelling complex comprising BRG1 and CHD7. BRG1 is essential for melanoma cell proliferation in vitro and for normal melanocyte development in vivo. MITF and SOX10 actively recruit BRG1 to a set of MITF-associated regulatory elements (MAREs) at active enhancers. Combinations of MITF, SOX10, TFAP2A, and YY1 bind between two BRG1-occupied nucleosomes thus defining both a signature of transcription factors essential for the melanocyte lineage and a specific chromatin organisation of the regulatory elements they occupy. BRG1 also regulates the dynamics of MITF genomic occupancy. MITF-BRG1 interplay thus plays an essential role in transcription regulation in melanoma.

  1. Control of mRNA decapping by positive and negative regulatory elements in the Dcp2 C-terminal domain

    PubMed Central

    He, Feng; Jacobson, Allan

    2015-01-01

    Decapping commits an mRNA to complete degradation and promotes general 5′ to 3′ decay, nonsense-mediated decay (NMD), and transcript-specific degradation. In Saccharomyces cerevisiae, a single decapping enzyme composed of a regulatory subunit (Dcp1) and a catalytic subunit (Dcp2) targets thousands of distinct substrate mRNAs. However, the mechanisms controlling this enzyme's in vivo activity and substrate specificity remain elusive. Here, using a genetic approach, we show that the large C-terminal domain of Dcp2 includes a set of conserved negative and positive regulatory elements. A single negative element inhibits enzymatic activity and controls the downstream functions of several positive elements. The positive elements recruit the specific decapping activators Edc3, Pat1, and Upf1 to form distinct decapping complexes and control the enzyme's substrate specificity and final activation. Our results reveal unforeseen regulatory mechanisms that control decapping enzyme activity and function in vivo, and define roles for several decapping activators in the regulation of mRNA decapping. PMID:26184073

  2. Identification of two regulatory elements controlling Fucosyltransferase 7 transcription in murine CD4+ T cells.

    PubMed

    Pink, Matthias; Ratsch, Boris A; Mardahl, Maibritt; Schröter, Micha F; Engelbert, Dirk; Triebus, Julia; Hamann, Alf; Syrbe, Uta

    2014-11-01

    Fucosyltransferase VII encoded by the gene Fut7 is essential in CD4(+) T cells for the generation of E- and P-selectin ligands (E- and P-lig) which facilitate recruitment of lymphocytes into inflamed tissues and into the skin. This study aimed to identify regulatory elements controlling the inducible Fut7 expression in CD4(+) T cells that occurs upon activation and differentiation of naive T cells into effector cells. Comparative analysis of the histone modification pattern in non-hematopoetic cells and CD4(+) T cell subsets revealed a differential histone modification pattern within the Fut7 locus including a conserved non-coding sequence (CNS) identified by cross-species conservation comparison suggesting that regulatory elements are confined to this region. Cloning of the CNS located about 500 bp upstream of the Fut7 locus, into a luciferase reporter vector elicited reporter activity after transfection of the αβ-WT T cell line, but not after transfection of primary murine CD4(+) Th1 cells. As quantification of different Fut7 transcripts revealed a predominance of transcripts lacking the first exons in primary Th1 cells we searched for an alternative promoter. Cloning of an intragenic region spanning a 1kb region upstream of exon 4 into an enhancer-containing vector indeed elicited promoter activity. Interestingly, also the CNS enhanced activity of this intragenic minimal promoter in reporter assays in primary Th1 cells suggesting that both elements interact in primary CD4(+) T cells to induce Fut7 transcription.

  3. Identification and characterization of promoters and cis-regulatory elements of genes involved in secondary metabolites production in hop (Humulus lupulus. L).

    PubMed

    Duraisamy, Ganesh Selvaraj; Mishra, Ajay Kumar; Kocabek, Tomas; Matoušek, Jaroslav

    2016-10-01

    Molecular and biochemical studies have shown that gene contains single or combination of different cis-acting regulatory elements are actively controlling the transcriptional regulation of associated genes, downstream effects of these result in the modulation of various biological pathways such as biotic/abiotic stress responses, hormonal responses to growth and development processes and secondary metabolite production. Therefore, the identification of promoters and their cis-regulatory elements is one of intriguing area to study the dynamic complex regulatory network of genes activities by integrating computational, comparative, structural and functional genomics. Several bioinformatics servers or database have been established to predict the cis-acting elements present in the promoter region of target gene and their association with the expression profiles in the TFs. The aim of this study is to predict possible cis-acting regulatory elements that have putative role in the transcriptional regulation of a dynamic network of metabolite gene activities controlling prenylflavonoid and bitter acids biosynthesis in hop (Humulus lupulus). Recent release of hop draft genome enabled us to predict the possible cis-acting regulatory elements by extracting 2kbp of 5' regulatory regions of genes important for lupulin metabolome biosynthesis, using Plant CARE, PLACE and Genomatix Matinspector professional databases. The result reveals the plausible role of cis-acting regulatory elements in the regulation of gene expression primarily involved in lupulin metabolome biosynthesis including under various stress conditions.

  4. Target activation by regulatory RNAs in bacteria

    PubMed Central

    Papenfort, Kai; Vanderpool, Carin K.

    2015-01-01

    Bacterial small regulatory RNAs (sRNAs) are commonly known to repress gene expression by base pairing to target mRNAs. In many cases, sRNAs base pair with and sequester mRNA ribosome-binding sites, resulting in translational repression and accelerated transcript decay. In contrast, a growing number of examples of translational activation and mRNA stabilization by sRNAs have now been documented. A given sRNA often employs a conserved region to interact with and regulate both repressed and activated targets. However, the mechanisms underlying activation differ substantially from repression. Base pairing resulting in target activation can involve sRNA interactions with the 5′ untranslated region (UTR), the coding sequence or the 3′ UTR of the target mRNAs. Frequently, the activities of protein factors such as cellular ribonucleases and the RNA chaperone Hfq are required for activation. Bacterial sRNAs, including those that function as activators, frequently control stress response pathways or virulence-associated functions required for immediate responses to changing environments. This review aims to summarize recent advances in knowledge regarding target mRNA activation by bacterial sRNAs, highlighting the molecular mechanisms and biological relevance of regulation. PMID:25934124

  5. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    NASA Technical Reports Server (NTRS)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1995-01-01

    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  6. MicroRNAs as regulatory elements in psoriasis

    PubMed Central

    Liu, Yuan

    2016-01-01

    Abstract Psoriasis is a chronic, autoimmune, and complex genetic disorder that affects 23% of the European population. The symptoms of Psoriatic skin are inflammation, raised and scaly lesions. microRNA, which is short, nonprotein-coding, regulatory RNAs, plays critical roles in psoriasis. microRNA participates in nearly all biological processes, such as cell differentiation, development and metabolism. Recent researches reveal that multitudinous novel microRNAs have been identified in skin. Some of these substantial novel microRNAs play as a class of posttranscriptional gene regulator in skin disease, such as psoriasis. In order to insight into microRNAs biological functions and verify microRNAs biomarker, we review diverse references about characterization, profiling and subtype of microRNAs. Here we will share our opinions about how and which microRNAs are as regulatory in psoriasis.

  7. Structure of Proximal and Distant Regulatory Elements in the Human Genome

    NASA Astrophysics Data System (ADS)

    Ovcharenko, Ivan

    Clustering of multiple transcription factor binding sites (TFBSs) for the same transcription factor (TF) is a common feature of cis-regulatory modules in invertebrate animals, but the occurrence of such homotypic clusters of TFBSs (HCTs) in the human genome has remained largely unknown. To explore whether HCTs are also common in human and other vertebrates, we used known binding motifs for vertebrate TFs and a hidden Markov model-based approach to detect HCTs in the human, mouse, chicken, and fugu genomes, and examined their association with cis-regulatory modules. We found that evolutionarily conserved HCTs occupy nearly 2% of the human genome, with experimental evidence for individual TFs supporting their binding to predicted HCTs. More than half of promoters of human genes contain HCTs, with a distribution around the transcription start site in agreement with the experimental data from the ENCODE project. In addition, almost half of 487 experimentally validated developmental enhancers contain them as well - a number more than 25-fold larger than expected by chance. We also found evidence of negative selection acting on TFBSs within HCTs, as the conservation of TFBSs is stronger than the conservation of sequences separating them. The important role of HCTs as components of developmental enhancers is additionally supported by a strong correlation between HCTs and the binding of the enhancer-associated co-activator protein p300. Experimental validation of HCT-containing elements in both zebrafish and mouse suggest that HCTs could be used to predict both the presence of enhancers and their tissue specificity, and are thus a feature that can be effectively used in deciphering the gene regulatory code. In conclusion, our results indicate that HCTs are a pervasive feature of human cis-regulatory modules and suggest that they play an important role in gene regulation in the human and other vertebrate genomes.

  8. Pitx1 Broadly Associates with Limb Enhancers and is Enriched on Hindlimb cis-Regulatory Elements

    PubMed Central

    Infante, Carlos R.; Park, Sungdae; Mihala, Alexandra; Kingsley, David M.; Menke, Douglas B.

    2013-01-01

    Extensive functional analyses have demonstrated that the pituitary homeodomain transcription factor Pitx1 plays a critical role in specifying hindlimb morphology in vertebrates. However, much less is known regarding the target genes and cis-regulatory elements through which Pitx1 acts. Earlier studies suggested that the hindlimb transcription factors Tbx4, HoxC10, and HoxC11 might be transcriptional targets of Pitx1, but definitive evidence for direct regulatory interactions has been lacking. Using ChIP-Seq on embryonic mouse hindlimbs, we have pinpointed the genome-wide location of Pitx1 binding sites during mouse hindlimb development and identified potential gene targets for Pitx1. We determined that Pitx1 binding is significantly enriched near genes involved in limb morphogenesis, including Tbx4, HoxC10, and HoxC11. Notably, Pitx1 is bound to the previously identified HLEA and HLEB hindlimb enhancers of the Tbx4 gene and to a newly identified Tbx2 hindlimb enhancer. Moreover, Pitx1 binding is significantly enriched on hindlimb relative to forelimb-specific cis-regulatory features that are differentially marked by H3K27ac. However, our analysis revealed that Pitx1 also strongly associates with many functionally verified limb enhancers that exhibit similar levels of activity in the embryonic mesenchyme of forelimbs and hindlimbs. We speculate that Pitx1 influences hindlimb morphology both through the activation of hindlimb specific enhancers as well as through the hindlimb-specific modulation of enhancers that are active in both sets of limbs. PMID:23201014

  9. The 3' untranslated region of human Cyclin-Dependent Kinase 5 Regulatory subunit 1 contains regulatory elements affecting transcript stability

    PubMed Central

    Moncini, Silvia; Bevilacqua, Annamaria; Venturin, Marco; Fallini, Claudia; Ratti, Antonia; Nicolin, Angelo; Riva, Paola

    2007-01-01

    Background CDK5R1 plays a central role in neuronal migration and differentiation during central nervous system development. CDK5R1 has been implicated in neurodegenerative disorders and proposed as a candidate gene for mental retardation. The remarkable size of CDK5R1 3'-untranslated region (3'-UTR) suggests a role in post-transcriptional regulation of CDK5R1 expression. Results The bioinformatic study shows a high conservation degree in mammals and predicts several AU-Rich Elements (AREs). The insertion of CDK5R1 3'-UTR into luciferase 3'-UTR causes a decreased luciferase activity in four transfected cell lines. We identified 3'-UTR subregions which tend to reduce the reporter gene expression, sometimes in a cell line-dependent manner. In most cases the quantitative analysis of luciferase mRNA suggests that CDK5R1 3'-UTR affects mRNA stability. A region, leading to a very strong mRNA destabilization, showed a significantly low half-life, indicating an accelerated mRNA degradation. The 3' end of the transcript, containing a class I ARE, specifically displays a stabilizing effect in neuroblastoma cell lines. We also observed the interaction of the stabilizing neuronal RNA-binding proteins ELAV with the CDK5R1 transcript in SH-SY5Y cells and identified three 3'-UTR sub-regions showing affinity for ELAV proteins. Conclusion Our findings evince the presence of both destabilizing and stabilizing regulatory elements in CDK5R1 3'-UTR and support the hypothesis that CDK5R1 gene expression is post-transcriptionally controlled in neurons by ELAV-mediated mechanisms. This is the first evidence of the involvement of 3'-UTR in the modulation of CDK5R1 expression. The fine tuning of CDK5R1 expression by 3'-UTR may have a role in central nervous system development and functioning, with potential implications in neurodegenerative and cognitive disorders. PMID:18053171

  10. An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian

    PubMed Central

    2010-01-01

    Background An increasing number of publications demonstrate conservation of function of cis-regulatory elements without sequence similarity. In invertebrates such functional conservation has only been shown for closely related species. Here we demonstrate the existence of an ancient arthropod regulatory element that functions during the selection of neural precursors. The activity of genes of the achaete-scute (ac-sc) family endows cells with neural potential. An essential, conserved characteristic of proneural genes is their ability to restrict their own activity to single or a small number of progenitor cells from their initially broad domains of expression. This is achieved through a process called lateral inhibition. A regulatory element, the sensory organ precursor enhancer (SOPE), is required for this process. First identified in Drosophila, the SOPE contains discrete binding sites for four regulatory factors. The SOPE of the Drosophila asense gene is situated in the 5' UTR. Results Through a manual comparison of consensus binding site sequences we have been able to identify a SOPE in UTR sequences of asense-like genes in species belonging to all four arthropod groups (Crustacea, Myriapoda, Chelicerata and Insecta). The SOPEs of the spider Cupiennius salei and the insect Tribolium castaneum are shown to be functional in transgenic Drosophila. This would place the origin of this regulatory sequence as far back as the last common ancestor of the Arthropoda, that is, in the Cambrian, 550 million years ago. Conclusions The SOPE is not detectable by inter-specific sequence comparison, raising the possibility that other ancient regulatory modules in invertebrates might have escaped detection. PMID:20868489

  11. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element

    SciTech Connect

    Mao, Grace; Brody, James P.

    2007-11-09

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16 bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16 bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014 s{sup -1}. We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase.

  12. Do pharmacological approaches that prevent opioid tolerance target different elements in the same regulatory machinery?

    PubMed

    Garzón, Javier; Rodríguez-Muñoz, María; Sánchez-Blázquez, Pilar

    2008-06-01

    In the nervous system, the interaction of opioids like heroin and morphine with the G protein-coupled Mu-opioid receptor (MOR) provokes the development of tolerance to these opioids, as well as physical dependence. Tolerance implies that higher doses of these drugs must be consumed in order to obtain an equivalent sensation, a situation that contributes notably to the social problems surrounding recreational opioid abuse. The mechanisms that promote opioid tolerance involve a series of adaptive changes in the MOR and in the post-receptor signalling elements. Pharmacological studies have consistently identified a number of signalling proteins relevant to morphine-induced tolerance, including the delta-opioid receptor (DOR), protein kinase C (PKC), protein kinase A (PKA), calcium/calmodulin-dependent kinase II (CaMKII), nitric oxide synthase (NOS), N-methyl-D-aspartate acid glutamate receptors (NMDAR), and regulators of G-signalling (RGS) proteins. Thus, it is feasible that these treatments which diminish morphine tolerance target distinct elements within the same regulatory machinery. In this scheme, the signals originated at the agonist-activated MORs would be recognised by elements such as the NMDARs, which in turn exert a negative feedback on MOR-evoked signalling. This process involves DOR regulation of MORs, MOR-induced activation of NMDARs (probably via the regulation of Src, recruiting PKC and Galpha subunits) and the NMDAR-mediated activation of CaMKII. The active CaMKII promotes the sequestering of morphine-activated Gbetagamma dimers by phosducin-like proteins (PhLP) and of Galpha subunits by RGS proteins and tolerance to opioids like morphine develops. Future efforts to study these phenomena should focus on fitting additional pieces into this puzzle in order to fully define the mechanism underlying the desensitization of MORs in neural cells.

  13. An Intronic cis-Regulatory Element Is Crucial for the Alpha Tubulin Pl-Tuba1a Gene Activation in the Ciliary Band and Animal Pole Neurogenic Domains during Sea Urchin Development

    PubMed Central

    Cuttitta, Angela; Gianguzza, Fabrizio; Ragusa, Maria Antonietta

    2017-01-01

    In sea urchin development, structures derived from neurogenic territory control the swimming and feeding responses of the pluteus as well as the process of metamorphosis. We have previously isolated an alpha tubulin family member of Paracentrotus lividus (Pl-Tuba1a, formerly known as Pl-Talpha2) that is specifically expressed in the ciliary band and animal pole neurogenic domains of the sea urchin embryo. In order to identify cis-regulatory elements controlling its spatio-temporal expression, we conducted gene transfer experiments, transgene deletions and site specific mutagenesis. Thus, a genomic region of about 2.6 Kb of Pl-Tuba1a, containing four Interspecifically Conserved Regions (ICRs), was identified as responsible for proper gene expression. An enhancer role was ascribed to ICR1 and ICR2, while ICR3 exerted a pivotal role in basal expression, restricting Tuba1a expression to the proper territories of the embryo. Additionally, the mutation of the forkhead box consensus sequence binding site in ICR3 prevented Pl-Tuba1a expression. PMID:28141828

  14. Functional conservation of Pax6 regulatory elements in humans and mice demonstrated with a novel transgenic reporter mouse

    PubMed Central

    Tyas, David A; Simpson, T Ian; Carr, Catherine B; Kleinjan, Dirk A; van Heyningen, Veronica; Mason, John O; Price, David J

    2006-01-01

    Background The Pax6 transcription factor is expressed during development in the eyes and in specific CNS regions, where it is essential for normal cell proliferation and differentiation. Mice lacking one or both copies of the Pax6 gene model closely humans with loss-of-function mutations in the PAX6 locus. The sequence of the Pax6/PAX6 protein is identical in mice and humans and previous studies have shown structural conservation of the gene's regulatory regions. Results We generated a transgenic mouse expressing green fluorescent protein (GFP) and neomycin resistance under the control of the entire complement of human PAX6 regulatory elements using a modified yeast artificial chromosome (YAC). Expression of GFP was studied in embryos from 9.5 days on and was confined to cells known to express Pax6. GFP expression was sufficiently strong that expressing cells could be distinguished from non-expressing cells using flow cytometry. Conclusion This work demonstrates the functional conservation of the regulatory elements controlling Pax6/PAX6 expression in mice and humans. The transgene provides an excellent tool for studying the functions of different Pax6/PAX6 regulatory elements in controlling Pax6 expression in animals that are otherwise normal. It will allow the analysis and isolation of cells in which Pax6 is activated, irrespective of the status of the endogenous locus. PMID:16674807

  15. Regulatory effects of fisetin on microglial activation.

    PubMed

    Chuang, Jing-Yuan; Chang, Pei-Chun; Shen, Yi-Chun; Lin, Chingju; Tsai, Cheng-Fang; Chen, Jia-Hong; Yeh, Wei-Lan; Wu, Ling-Hsuan; Lin, Hsiao-Yun; Liu, Yu-Shu; Lu, Dah-Yuu

    2014-06-26

    Increasing evidence suggests that inflammatory processes in the central nervous system that are mediated by microglial activation play a key role in neurodegeneration. Fisetin, a plant flavonol commonly found in fruits and vegetables, is frequently added to nutritional supplements due to its antioxidant properties. In the present study, treatment with fisetin inhibited microglial cell migration and ROS (reactive oxygen species) production. Treatment with fisetin also effectively inhibited LPS plus IFN-γ-induced nitric oxide (NO) production, and inducible nitric oxide synthase (iNOS) expression in microglial cells. Furthermore, fisetin also reduced expressions of iNOS and NO by stimulation of peptidoglycan, the major component of the Gram-positive bacterium cell wall. Fisetin also inhibited the enhancement of LPS/IFN-γ- or peptidoglycan-induced inflammatory mediator IL (interlukin)-1 β expression. Besides the antioxidative and anti-inflammatory effects of fisetin, our study also elucidates the manner in fisetin-induced an endogenous anti-oxidative enzyme HO (heme oxygenase)-1 expression. Moreover, the regulatory molecular mechanism of fisetin-induced HO-1 expression operates through the PI-3 kinase/AKT and p38 signaling pathways in microglia. Notably, fisetin also significantly attenuated inflammation-related microglial activation and coordination deficit in mice in vivo. These findings suggest that fisetin may be a candidate agent for the development of therapies for inflammation-related neurodegenerative diseases.

  16. The contribution of transposable elements to the evolution of regulatory networks

    PubMed Central

    Feschotte, Cédric

    2008-01-01

    Preface The control and coordination of eukaryotic gene expression rely on transcriptional and post-transcriptional regulatory networks. Although progress has been made in mapping the components and deciphering the function of these networks, the mechanisms by which such intricate circuits originate and evolve remain poorly understood. Here I revisit and expand earlier models proposing that genomic repeats, and in particular transposable elements, have been a rich source of material for the assembly and tinkering of eukaryotic gene regulatory systems. PMID:18368054

  17. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences

    PubMed Central

    Hughes, Jim R.; Cheng, Jan-Fang; Ventress, Nicki; Prabhakar, Shyam; Clark, Kevin; Anguita, Eduardo; De Gobbi, Marco; de Jong, Pieter; Rubin, Eddy; Higgs, Douglas R.

    2005-01-01

    An important step toward improving the annotation of the human genome is to identify cis-acting regulatory elements from primary DNA sequence. One approach is to compare sequences from multiple, divergent species. This approach distinguishes multispecies conserved sequences (MCS) in noncoding regions from more rapidly evolving neutral DNA. Here, we have analyzed a region of ≈238kb containing the human α globin cluster that was sequenced and/or annotated across the syntenic region in 22 species spanning 500 million years of evolution. Using a variety of bioinformatic approaches and correlating the results with many aspects of chromosome structure and function in this region, we were able to identify and evaluate the importance of 24 individual MCSs. This approach sensitively and accurately identified previously characterized regulatory elements but also discovered unidentified promoters, exons, splicing, and transcriptional regulatory elements. Together, these studies demonstrate an integrated approach by which to identify, subclassify, and predict the potential importance of MCSs. PMID:15998734

  18. The Interplay of cis-Regulatory Elements Rules Circadian Rhythms in Mouse Liver

    PubMed Central

    Korenčič, Anja; Bordyugov, Grigory; Košir, Rok; Rozman, Damjana; Goličnik, Marko; Herzel, Hanspeter

    2012-01-01

    The mammalian circadian clock is driven by cell-autonomous transcriptional feedback loops that involve E-boxes, D-boxes, and ROR-elements. In peripheral organs, circadian rhythms are additionally affected by systemic factors. We show that intrinsic combinatorial gene regulation governs the liver clock. With a temporal resolution of 2 h, we measured the expression of 21 clock genes in mouse liver under constant darkness and equinoctial light-dark cycles. Based on these data and known transcription factor binding sites, we develop a six-variable gene regulatory network. The transcriptional feedback loops are represented by equations with time-delayed variables, which substantially simplifies modelling of intermediate protein dynamics. Our model accurately reproduces measured phases, amplitudes, and waveforms of clock genes. Analysis of the network reveals properties of the clock: overcritical delays generate oscillations; synergy of inhibition and activation enhances amplitudes; and combinatorial modulation of transcription controls the phases. The agreement of measurements and simulations suggests that the intrinsic gene regulatory network primarily determines the circadian clock in liver, whereas systemic cues such as light-dark cycles serve to fine-tune the rhythms. PMID:23144788

  19. Genetic Analysis of Transvection Effects Involving Cis-Regulatory Elements of the Drosophila Ultrabithorax Gene

    PubMed Central

    Micol, J. L.; Castelli-Gair, J. E.; Garcia-Bellido, A.

    1990-01-01

    The Ultrabithorax (Ubx) gene of Drosophila melanogaster contains two functionally distinguishable regions: the protein-coding Ubx transcription unit and, upstream of it, the transcribed but non-protein-coding bxd region. Numerous recessive, partial loss-of-function mutations which appear to be regulatory mutations map within the bxd region and within the introns of the Ubx transcription unit. In addition, mutations within the Ubx unit exons are known and most of these behave as null alleles. Ubx(1) is one such allele. We have confirmed that, although the Ubx(1) allele does not produce detectable Ubx proteins (UBX), it does retain other genetic functions detectable by their effects on the expression of a paired, homologous Ubx allele, i.e., by transvection. We have extended previous analyses made by E. B. Lewis by mapping the critical elements of the Ubx gene which participate in transvection effects. Our results show that the Ubx(1) allele retains wild-type functions whose effectiveness can be reduced (1) by additional cis mutations in the bxd region or in introns of the Ubx transcription unit, as well as (2) by rearrangements disturbing pairing between homologous Ubx genes. Our results suggest that those remnant functions in Ubx(1) are able to modulate the activity of the allele located in the homologous chromosome. We discuss the normal cis regulatory role of these functions involved in trans interactions between homologous Ubx genes, as well as the implications of our results for the current models on transvection. PMID:2123161

  20. Human polyomavirus JCV late leader peptide region contains important regulatory elements

    SciTech Connect

    Akan, Ilhan; Sariyer, Ilker Kudret; Biffi, Renato; Palermo, Victoria; Woolridge, Stefanie; White, Martyn K.; Amini, Shohreh |; Khalili, Kamel; Safak, Mahmut . E-mail: msafak@temple.edu

    2006-05-25

    Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader

  1. Widespread contribution of transposable elements to the innovation of gene regulatory networks

    PubMed Central

    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter

    2014-01-01

    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF–TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution. PMID:25319995

  2. EMERGE: a flexible modelling framework to predict genomic regulatory elements from genomic signatures

    PubMed Central

    van Duijvenboden, Karel; de Boer, Bouke A.; Capon, Nicolas; Ruijter, Jan M.; Christoffels, Vincent M.

    2016-01-01

    Regulatory DNA elements, short genomic segments that regulate gene expression, have been implicated in developmental disorders and human disease. Despite this clinical urgency, only a small fraction of the regulatory DNA repertoire has been confirmed through reporter gene assays. The overall success rate of functional validation of candidate regulatory elements is low. Moreover, the number and diversity of datasets from which putative regulatory elements can be identified is large and rapidly increasing. We generated a flexible and user-friendly tool to integrate the information from different types of genomic datasets, e.g. ATAC-seq, ChIP-seq, conservation, aiming to increase the ease and success rate of functional prediction. To this end, we developed the EMERGE program that merges all datasets that the user considers informative and uses a logistic regression framework, based on validated functional elements, to set optimal weights to these datasets. ROC curve analysis shows that a combination of datasets leads to improved prediction of tissue-specific enhancers in human, mouse and Drosophila genomes. Functional assays based on this prediction can be expected to have substantially higher success rates. The resulting integrated signal for prediction of functional elements can be plotted in a build-in genome browser or exported for further analysis. PMID:26531828

  3. BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter.

    PubMed

    Reichenstein, Moshe; German, Tania; Barash, Itamar

    2005-04-11

    beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.

  4. DBTGR: a database of tunicate promoters and their regulatory elements.

    PubMed

    Sierro, Nicolas; Kusakabe, Takehiro; Park, Keun-Joon; Yamashita, Riu; Kinoshita, Kengo; Nakai, Kenta

    2006-01-01

    The high similarity of tunicates and vertebrates during their development coupled with the transparency of tunicate larvae, their well-studied cell lineages and the availability of simple and efficient transgenesis methods makes of this subphylum an ideal system for the investigation of vertebrate physiological and developmental processes. Recently, the sequencing of two different Ciona genomes has lead to the identification of numerous genes. In order to better understand the regulation of these genes, a database was created containing information on regulation of tunicate genes collected from literature. It includes for instance information regarding the minimal promoter length, the transcription factors involved and their binding sites, as well as the localization of the gene expression. Additionally, binding sites for characterized transcription factors were predicted based on published in vitro recognition sites. Comparison of the promoters of homologous genes in different species is also provided to allow identification of conserved cis elements. At the time of writing, information about 184 promoters, containing 73 identified binding sites and >2000 newly predicted binding sites is available. This database is accessible at http://dbtgr.hgc.jp.

  5. The identification of cis-regulatory elements: A review from a machine learning perspective.

    PubMed

    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

    2015-12-01

    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field.

  6. Regulatory xenobiotic responsive elements in the distal 5'-flanking region of the mouse Cyp1a2 gene required for transcriptional activation by 3-methylcholanthrene and 2,3,7,8-tetrachlorodibenzo-p-dioxin.

    PubMed

    Kawasaki, Yuki; Sakuma, Tsutomu; Goto, Yuma; Nemoto, Nobuo

    2010-10-01

    We examined the xenobiotic responsive element (XRE) responsible for induction of the mouse Cyp1a2 gene by 3-methylcholanthrene (3MC) and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) using a reporter gene assay in mouse hepatocytes in primary culture. Although, the 5'-flanking region up to -9.5 kilobase pairs did not show a significant increase in transcriptional activity after treatment with 3MC or TCDD, a further distal 5'-flanking region from -13,958 to -12,520 containing 12 putative XREs (5'-GCGTG-3') demonstrated distinctive transcriptional activity after treatment with 3MC or TCDD. When a mutation was introduced into XRE14 at -12,972, the activation was decreased, and concurrent mutations in XRE14, XRE13, and XRE15 completely abolished it. However, mutations in XRE13, XRE15, XRE16, or XRE17 did not affect the inducible transcriptional activation of the mouse Cyp1a2 gene. These results suggest that XRE14 is important and that XRE13 at -12,897 and/or XRE15 at -13,061 are cooperative to the inducible transcriptional activation of the mouse Cyp1a2 gene by ligands of the aryl hydrocarbon receptor.

  7. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    SciTech Connect

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

    2010-12-22

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  8. Visible-light-active elemental photocatalysts.

    PubMed

    Liu, Gang; Niu, Ping; Cheng, Hui-Ming

    2013-04-02

    Seeking visible-light-active photocatalysts for efficient solar-energy conversion has become an intensifying endeavor worldwide. In this concept paper, general requirements for finding new visible-light-active photocatalysts are briefly introduced, and recent progress in exploring elemental photocatalysts for clean-energy generation and environmental remediation are reviewed. Finally, opportunities and challenges facing elemental photocatalysts are discussed.

  9. Heat shock regulatory elements are present in telomeric repeats of Chironomus thummi.

    PubMed

    Martinez, J L; Sanchez-Elsner, T; Morcillo, G; Diez, J L

    2001-11-15

    As in other Diptera, the telomeres of Chironomus thummi lack canonical short telomerase-specified repeats and instead contain complex sequences. They react to heat shock and other stress treatments by forming giant puffs at some chromosome termini, which are visible in polytene cells. All telomeres, except the telocentric end of chromosome four (4L), consist of large blocks of repeats, 176 bp in length. Three subfamilies of telomeric sequences have been found to show different distribution patterns between chromosome ends. TsA and TsC are characteristic of telomeres 3R and 4R, respectively, whereas TsB is present in the other non-telocentric telomeres. Heat shock transcription regulatory elements have been identified in the telomeric sequences, appearing differentially represented in the three subfamilies, but otherwise rather similar in size and sequence. Interestingly, TsA and TsB repeats share the well-conserved heat shock element (HSE) and GAGA motif, while the TATA box is only present in the former. Neither a HSE nor a TATA box appear in TsC repeats. Moreover, experimental data indicate that the HSE is functionally active in binding heat shock transcription factor (HSF). These results provide, for the first time, a molecular basis for the effect of heat shock on C.thummi telomeres and might also explain the different behaviour they show. A positive correlation between the presence of HSE and telomeric puffing and transcription under heat shock was demonstrated. This was also confirmed in the sibling species Chironomus piger. The significance of heat shock activation of telomeric repeats in relation to telomeric function is unknown at present, but it might be compared to the behaviour of other non-heat shock protein coding sequences, such as SINE-like and LINE-like retroelements, which have been reported to be activated by stress.

  10. Two regulatory RNA elements affect TisB-dependent depolarization and persister formation.

    PubMed

    Berghoff, Bork A; Hoekzema, Mirthe; Aulbach, Lena; Wagner, E Gerhart H

    2017-03-01

    Bacterial survival strategies involve phenotypic diversity which is generated by regulatory factors and noisy expression of effector proteins. The question of how bacteria exploit regulatory RNAs to make decisions between phenotypes is central to a general understanding of these universal regulators. We investigated the TisB/IstR-1 toxin-antitoxin system of Escherichia coli to appreciate the role of the RNA antitoxin IstR-1 in TisB-dependent depolarization of the inner membrane and persister formation. Persisters are phenotypic variants that have become transiently drug-tolerant by arresting growth. The RNA antitoxin IstR-1 sets a threshold for TisB-dependent depolarization under DNA-damaging conditions, resulting in two sub-populations: polarized and depolarized cells. Furthermore, our data indicate that an inhibitory 5' UTR structure in the tisB mRNA serves as a regulatory RNA element that delays TisB translation to avoid inappropriate depolarization when DNA damage is low. Investigation of the persister sub-population further revealed that both regulatory RNA elements affect persister levels as well as persistence time. This work provides an intriguing example of how bacteria exploit regulatory RNAs to control phenotypic heterogeneity.

  11. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  12. Computational identification of new structured cis-regulatory elements in the 3'-untranslated region of human protein coding genes.

    PubMed

    Chen, Xiaowei Sylvia; Brown, Chris M

    2012-10-01

    Messenger ribonucleic acids (RNAs) contain a large number of cis-regulatory RNA elements that function in many types of post-transcriptional regulation. These cis-regulatory elements are often characterized by conserved structures and/or sequences. Although some classes are well known, given the wide range of RNA-interacting proteins in eukaryotes, it is likely that many new classes of cis-regulatory elements are yet to be discovered. An approach to this is to use computational methods that have the advantage of analysing genomic data, particularly comparative data on a large scale. In this study, a set of structural discovery algorithms was applied followed by support vector machine (SVM) classification. We trained a new classification model (CisRNA-SVM) on a set of known structured cis-regulatory elements from 3'-untranslated regions (UTRs) and successfully distinguished these and groups of cis-regulatory elements not been strained on from control genomic and shuffled sequences. The new method outperformed previous methods in classification of cis-regulatory RNA elements. This model was then used to predict new elements from cross-species conserved regions of human 3'-UTRs. Clustering of these elements identified new classes of potential cis-regulatory elements. The model, training and testing sets and novel human predictions are available at: http://mRNA.otago.ac.nz/CisRNA-SVM.

  13. Screening in silico predicted remotely acting NF1 gene regulatory elements for mutations in patients with neurofibromatosis type 1.

    PubMed

    Hamby, Stephen E; Reviriego, Pablo; Cooper, David N; Upadhyaya, Meena; Chuzhanova, Nadia

    2013-08-15

    Neurofibromatosis type 1 (NF1), a neuroectodermal disorder, is caused by germline mutations in the NF1 gene. NF1 affects approximately 1/3,000 individuals worldwide, with about 50% of cases representing de novo mutations. Although the NF1 gene was identified in 1990, the underlying gene mutations still remain undetected in a small but obdurate minority of NF1 patients. We postulated that in these patients, hitherto undetected pathogenic mutations might occur in regulatory elements far upstream of the NF1 gene. In an attempt to identify such remotely acting regulatory elements, we reasoned that some of them might reside within DNA sequences that (1) have the potential to interact at distance with the NF1 gene and (2) lie within a histone H3K27ac-enriched region, a characteristic of active enhancers. Combining Hi-C data, obtained by means of the chromosome conformation capture technique, with data on the location and level of histone H3K27ac enrichment upstream of the NF1 gene, we predicted in silico the presence of two remotely acting regulatory regions, located, respectively, approximately 600 kb and approximately 42 kb upstream of the NF1 gene. These regions were then sequenced in 47 NF1 patients in whom no mutations had been found in either the NF1 or SPRED1 gene regions. Five patients were found to harbour DNA sequence variants in the distal H3K27ac-enriched region. Although these variants are of uncertain pathological significance and still remain to be functionally characterized, this approach promises to be of general utility for the detection of mutations underlying other inherited disorders that may be caused by mutations in remotely acting regulatory elements.

  14. Mutagenesis of GATA motifs controlling the endoderm regulator elt-2 reveals distinct dominant and secondary cis-regulatory elements.

    PubMed

    Du, Lawrence; Tracy, Sharon; Rifkin, Scott A

    2016-04-01

    Cis-regulatory elements (CREs) are crucial links in developmental gene regulatory networks, but in many cases, it can be difficult to discern whether similar CREs are functionally equivalent. We found that despite similar conservation and binding capability to upstream activators, different GATA cis-regulatory motifs within the promoter of the C. elegans endoderm regulator elt-2 play distinctive roles in activating and modulating gene expression throughout development. We fused wild-type and mutant versions of the elt-2 promoter to a gfp reporter and inserted these constructs as single copies into the C. elegans genome. We then counted early embryonic gfp transcripts using single-molecule RNA FISH (smFISH) and quantified gut GFP fluorescence. We determined that a single primary dominant GATA motif located 527bp upstream of the elt-2 start codon was necessary for both embryonic activation and later maintenance of transcription, while nearby secondary GATA motifs played largely subtle roles in modulating postembryonic levels of elt-2. Mutation of the primary activating site increased low-level spatiotemporally ectopic stochastic transcription, indicating that this site acts repressively in non-endoderm cells. Our results reveal that CREs with similar GATA factor binding affinities in close proximity can play very divergent context-dependent roles in regulating the expression of a developmentally critical gene in vivo.

  15. Improved regulatory element prediction based on tissue-specific local epigenomic signatures

    PubMed Central

    He, Yupeng; Gorkin, David U.; Dickel, Diane E.; Nery, Joseph R.; Castanon, Rosa G.; Lee, Ah Young; Shen, Yin; Visel, Axel; Pennacchio, Len A.; Ren, Bing; Ecker, Joseph R.

    2017-01-01

    Accurate enhancer identification is critical for understanding the spatiotemporal transcriptional regulation during development as well as the functional impact of disease-related noncoding genetic variants. Computational methods have been developed to predict the genomic locations of active enhancers based on histone modifications, but the accuracy and resolution of these methods remain limited. Here, we present an algorithm, regulatory element prediction based on tissue-specific local epigenetic marks (REPTILE), which integrates histone modification and whole-genome cytosine DNA methylation profiles to identify the precise location of enhancers. We tested the ability of REPTILE to identify enhancers previously validated in reporter assays. Compared with existing methods, REPTILE shows consistently superior performance across diverse cell and tissue types, and the enhancer locations are significantly more refined. We show that, by incorporating base-resolution methylation data, REPTILE greatly improves upon current methods for annotation of enhancers across a variety of cell and tissue types. REPTILE is available at https://github.com/yupenghe/REPTILE/. PMID:28193886

  16. Microsatellite Tandem Repeats Are Abundant in Human Promoters and Are Associated with Regulatory Elements

    PubMed Central

    Sawaya, Sterling; Bagshaw, Andrew; Buschiazzo, Emmanuel; Kumar, Pankaj; Chowdhury, Shantanu; Black, Michael A.; Gemmell, Neil

    2013-01-01

    Tandem repeats are genomic elements that are prone to changes in repeat number and are thus often polymorphic. These sequences are found at a high density at the start of human genes, in the gene’s promoter. Increasing empirical evidence suggests that length variation in these tandem repeats can affect gene regulation. One class of tandem repeats, known as microsatellites, rapidly alter in repeat number. Some of the genetic variation induced by microsatellites is known to result in phenotypic variation. Recently, our group developed a novel method for measuring the evolutionary conservation of microsatellites, and with it we discovered that human microsatellites near transcription start sites are often highly conserved. In this study, we examined the properties of microsatellites found in promoters. We found a high density of microsatellites at the start of genes. We showed that microsatellites are statistically associated with promoters using a wavelet analysis, which allowed us to test for associations on multiple scales and to control for other promoter related elements. Because promoter microsatellites tend to be G/C rich, we hypothesized that G/C rich regulatory elements may drive the association between microsatellites and promoters. Our results indicate that CpG islands, G-quadruplexes (G4) and untranslated regulatory regions have highly significant associations with microsatellites, but controlling for these elements in the analysis does not remove the association between microsatellites and promoters. Due to their intrinsic lability and their overlap with predicted functional elements, these results suggest that many promoter microsatellites have the potential to affect human phenotypes by generating mutations in regulatory elements, which may ultimately result in disease. We discuss the potential functions of human promoter microsatellites in this context. PMID:23405090

  17. Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach

    PubMed Central

    Elemento, Olivier; Tavazoie, Saeed

    2005-01-01

    We describe a powerful new approach for discovering globally conserved regulatory elements between two genomes. The method is fast, simple and comprehensive, without requiring alignments. Its application to pairs of yeasts, worms, flies and mammals yields a large number of known and novel putative regulatory elements. Many of these are validated by independent biological observations, have spatial and/or orientation biases, are co-conserved with other elements and show surprising conservation across large phylogenetic distances. PMID:15693947

  18. Cell-type-specific enrichment of risk-associated regulatory elements at ovarian cancer susceptibility loci

    PubMed Central

    Coetzee, Simon G.; Shen, Howard C.; Hazelett, Dennis J.; Lawrenson, Kate; Kuchenbaecker, Karoline; Tyrer, Jonathan; Rhie, Suhn K.; Levanon, Keren; Karst, Alison; Drapkin, Ronny; Ramus, Susan J.; Couch, Fergus J.; Offit, Kenneth; Chenevix-Trench, Georgia; Monteiro, Alvaro N.A.; Antoniou, Antonis; Freedman, Matthew; Coetzee, Gerhard A.; Pharoah, Paul D.P.; Noushmehr, Houtan; Gayther, Simon A.

    2015-01-01

    Understanding the regulatory landscape of the human genome is a central question in complex trait genetics. Most single-nucleotide polymorphisms (SNPs) associated with cancer risk lie in non-protein-coding regions, implicating regulatory DNA elements as functional targets of susceptibility variants. Here, we describe genome-wide annotation of regions of open chromatin and histone modification in fallopian tube and ovarian surface epithelial cells (FTSECs, OSECs), the debated cellular origins of high-grade serous ovarian cancers (HGSOCs) and in endometriosis epithelial cells (EECs), the likely precursor of clear cell ovarian carcinomas (CCOCs). The regulatory architecture of these cell types was compared with normal human mammary epithelial cells and LNCaP prostate cancer cells. We observed similar positional patterns of global enhancer signatures across the three different ovarian cancer precursor cell types, and evidence of tissue-specific regulatory signatures compared to non-gynecological cell types. We found significant enrichment for risk-associated SNPs intersecting regulatory biofeatures at 17 known HGSOC susceptibility loci in FTSECs (P = 3.8 × 10−30), OSECs (P = 2.4 × 10−23) and HMECs (P = 6.7 × 10−15) but not for EECs (P = 0.45) or LNCaP cells (P = 0.88). Hierarchical clustering of risk SNPs conditioned on the six different cell types indicates FTSECs and OSECs are highly related (96% of samples using multi-scale bootstrapping) suggesting both cell types may be precursors of HGSOC. These data represent the first description of regulatory catalogues of normal precursor cells for different ovarian cancer subtypes, and provide unique insights into the tissue specific regulatory variation with respect to the likely functional targets of germline genetic susceptibility variants for ovarian cancer. PMID:25804953

  19. Nucleotide-specific recognition of iron-responsive elements by iron regulatory protein 1.

    PubMed

    Selezneva, Anna I; Walden, William E; Volz, Karl W

    2013-09-23

    IRP1 [iron regulatory protein (IRP) 1] is a bifunctional protein with mutually exclusive end-states. In one mode of operation, IRP1 binds iron-responsive element (IRE) stem-loops in messenger RNAs encoding proteins of iron metabolism to control their rate of translation. In its other mode, IRP1 serves as cytoplasmic aconitase to correlate iron availability with the energy and oxidative stress status of the cell. IRP1/IRE binding occurs through two separate interfaces, which together contribute about two-dozen hydrogen bonds. Five amino acids make base-specific contacts and are expected to contribute significantly to binding affinity and specificity of this protein:RNA interaction. In this mutagenesis study, each of the five base-specific amino acids was changed to alter binding at each site. Analysis of IRE binding affinity and translational repression activity of the resulting IRP1 mutants showed that four of the five contact points contribute uniquely to the overall binding affinity of the IRP1:IRE interaction, while one site was found to be unimportant. The stronger-than-expected effect on binding affinity of mutations at Lys379 and Ser681, residues that make contact with the conserved nucleotides G16 and C8, respectively, identified them as particularly critical for providing specificity and stability to IRP1:IRE complex formation. We also show that even though the base-specific RNA-binding residues are not part of the aconitase active site, their substitutions can affect the aconitase activity of holo-IRP1, positively or negatively.

  20. Role of Conserved Non-Coding Regulatory Elements in LMW Glutenin Gene Expression

    PubMed Central

    Juhász, Angéla; Makai, Szabolcs; Sebestyén, Endre; Tamás, László; Balázs, Ervin

    2011-01-01

    Transcriptional regulation of LMW glutenin genes were investigated in-silico, using publicly available gene sequences and expression data. Genes were grouped into different LMW glutenin types and their promoter profiles were determined using cis-acting regulatory elements databases and published results. The various cis-acting elements belong to some conserved non-coding regulatory regions (CREs) and might act in two different ways. There are elements, such as GCN4 motifs found in the long endosperm box that could serve as key factors in tissue-specific expression. Some other elements, such as the AACA/TA motifs or the individual prolamin box variants, might modulate the level of expression. Based on the promoter sequences and expression characteristic LMW glutenin genes might be transcribed following two different mechanisms. Most of the s- and i-type genes show a continuously increasing expression pattern. The m-type genes, however, demonstrate normal distribution in their expression profiles. Differences observed in their expression could be related to the differences found in their promoter sequences. Polymorphisms in the number and combination of cis-acting elements in their promoter regions can be of crucial importance in the diverse levels of production of single LMW glutenin gene types. PMID:22242127

  1. Detection and characterization of regulatory elements using probabilistic conditional random field and hidden Markov models.

    PubMed

    Wang, Hongyan; Zhou, Xiaobo

    2013-04-01

    By altering the electrostatic charge of histones or providing binding sites to protein recognition molecules, Chromatin marks have been proposed to regulate gene expression, a property that has motivated researchers to link these marks to cis-regulatory elements. With the help of next generation sequencing technologies, we can now correlate one specific chromatin mark with regulatory elements (e.g. enhancers or promoters) and also build tools, such as hidden Markov models, to gain insight into mark combinations. However, hidden Markov models have limitation for their character of generative models and assume that a current observation depends only on a current hidden state in the chain. Here, we employed two graphical probabilistic models, namely the linear conditional random field model and multivariate hidden Markov model, to mark gene regions with different states based on recurrent and spatially coherent character of these eight marks. Both models revealed chromatin states that may correspond to enhancers and promoters, transcribed regions, transcriptional elongation, and low-signal regions. We also found that the linear conditional random field model was more effective than the hidden Markov model in recognizing regulatory elements, such as promoter-, enhancer-, and transcriptional elongation-associated regions, which gives us a better choice.

  2. Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.

    PubMed

    Winck, Flavia Vischi; Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  3. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  4. Overview of regulatory strategies and molecular elements in metabolic engineering of bacteria.

    PubMed

    Wang, Tianwen; Ma, Xingyuan; Du, Guocheng; Chen, Jian

    2012-11-01

    From a viewpoint of biotechnology, metabolic engineering mainly aims to change the natural status of a pathway in a microorganism towards the overproduction of certain bioproducts. The biochemical nature of a pathway implies us that changed pathway is often the collective results of altered behavior of the metabolic enzymes encoded by corresponding genes. By finely modulating the expression of these genes or the properties of the enzyme, we can gain efficient control on the pathway. In this article, we reviewed the typical methods that have been applied to regulate the expression of genes in metabolic engineering. These methods are grouped according to the operation targets in a typical gene. The transcription of a gene is controlled by an indispensable promoter. By utilizing promoters with different strengths, expected levels of expression can be easily achieved, and screening a promoter library may find suitable mutant promoters that can provide tunable expression of a gene. Auto-responsive promoter (quorum sensing (QS)-based or oxygen-inducible) simplifies the induction process by driving the expression of a gene in an automated manner. Light responsive promoter enables reversible and noninvasive control on gene activity, providing a promising method in controlling gene expression with time and space resolution in metabolic engineering involving complicated genetic circuits. Through directed evolution and/or rational design, the encoding sequences of a gene can be altered, leading to the possibly most profound changes in properties of a metabolic enzyme. Introducing an engineered riboswitch in mRNA can make it a regulatory molecule at the same time; ribosomal binding site is commonly engineered to be more attractive for a ribosome through design. Terminator of a gene will affect the stability of an mRNA, and intergenic region will influence the expression of many related genes. Improving the performance of these elements are generally the main activities in

  5. The Function of the Conserved Regulatory Element within the Second Intron of the Mammalian Csf1r Locus

    PubMed Central

    O’Neal, Julie; Sester, David P.; Tagoh, Hiromi; Ingram, Richard M.; Pridans, Clare; Bonifer, Constanze; Hume, David A.

    2013-01-01

    The gene encoding the receptor for macrophage colony-stimulating factor (CSF-1R) is expressed exclusively in cells of the myeloid lineages as well as trophoblasts. A conserved element in the second intron, Fms-Intronic Regulatory Element (FIRE), is essential for macrophage-specific transcription of the gene. However, the molecular details of how FIRE activity is regulated and how it impacts the Csf1r promoter have not been characterised. Here we show that agents that down-modulate Csf1r mRNA transcription regulated promoter activity altered the occupancy of key FIRE cis-acting elements including RUNX1, AP1, and Sp1 binding sites. We demonstrate that FIRE acts as an anti-sense promoter in macrophages and reversal of FIRE orientation within its native context greatly reduced enhancer activity in macrophages. Mutation of transcription initiation sites within FIRE also reduced transcription. These results demonstrate that FIRE is an orientation-specific transcribed enhancer element. PMID:23383005

  6. Mammary Cancer and Activation of Transposable Elements

    DTIC Science & Technology

    2014-09-01

    AD_________________ AWARD NUMBER: W81XWH-11-1-0401 TITLE: Mammary Cancer and Activation of Transposable Elements PRINCIPAL INVESTIGATOR...way as transcripts from the regular gene promoter. Transcriptional activation of retrotransposons is strongly linked with their CpG DNA methylation

  7. Mammary Cancer and Activation of Transposable Elements

    DTIC Science & Technology

    2014-09-01

    AD_________________ Award Number: W81XWH-11-1-0402 TITLE: Mammary Cancer and Activation...TYPE Annual 3. DATES COVERED 1 Sep 2013 – 31 Aug 2014 4. TITLE AND SUBTITLE Mammary Cancer and Activation of Transposable Elements 5a. CONTRACT...investigate molecular events occurring in the preclinical stages of mammary cancer. Specifically, the project investigates the intersection between the

  8. Kinetics of transcription initiation directed by multiple cis-regulatory elements on the glnAp2 promoter

    PubMed Central

    Wang, Yaolai; Liu, Feng; Wang, Wei

    2016-01-01

    Transcription initiation is orchestrated by dynamic molecular interactions, with kinetic steps difficult to detect. Utilizing a hybrid method, we aim to unravel essential kinetic steps of transcriptional regulation on the glnAp2 promoter, whose regulatory region includes two enhancers (sites I and II) and three low-affinity sequences (sites III-V), to which the transcriptional activator NtrC binds. By structure reconstruction, we analyze all possible organization architectures of the transcription apparatus (TA). The main regulatory mode involves two NtrC hexamers: one at enhancer II transiently associates with site V such that the other at enhancer I can rapidly approach and catalyze the σ54-RNA polymerase holoenzyme. We build a kinetic model characterizing essential steps of the TA operation; with the known kinetics of the holoenzyme interacting with DNA, this model enables the kinetics beyond technical detection to be determined by fitting the input-output function of the wild-type promoter. The model further quantitatively reproduces transcriptional activities of various mutated promoters. These results reveal different roles played by two enhancers and interpret why the low-affinity elements conditionally enhance or repress transcription. This work presents an integrated dynamic picture of regulated transcription initiation and suggests an evolutionarily conserved characteristic guaranteeing reliable transcriptional response to regulatory signals. PMID:27899598

  9. MicroRNA and Transcription Factor Gene Regulatory Network Analysis Reveals Key Regulatory Elements Associated with Prostate Cancer Progression

    PubMed Central

    Sadeghi, Mehdi; Ranjbar, Bijan; Ganjalikhany, Mohamad Reza; M. Khan, Faiz; Schmitz, Ulf; Wolkenhauer, Olaf; Gupta, Shailendra K.

    2016-01-01

    Technological and methodological advances in multi-omics data generation and integration approaches help elucidate genetic features of complex biological traits and diseases such as prostate cancer. Due to its heterogeneity, the identification of key functional components involved in the regulation and progression of prostate cancer is a methodological challenge. In this study, we identified key regulatory interactions responsible for primary to metastasis transitions in prostate cancer using network inference approaches by integrating patient derived transcriptomic and miRomics data into gene/miRNA/transcription factor regulatory networks. One such network was derived for each of the clinical states of prostate cancer based on differentially expressed and significantly correlated gene, miRNA and TF pairs from the patient data. We identified key elements of each network using a network analysis approach and validated our results using patient survival analysis. We observed that HOXD10, BCL2 and PGR are the most important factors affected in primary prostate samples, whereas, in the metastatic state, STAT3, JUN and JUNB are playing a central role. Benefiting integrative networks our analysis suggests that some of these molecules were targeted by several overexpressed miRNAs which may have a major effect on the dysregulation of these molecules. For example, in the metastatic tumors five miRNAs (miR-671-5p, miR-665, miR-663, miR-512-3p and miR-371-5p) are mainly responsible for the dysregulation of STAT3 and hence can provide an opportunity for early detection of metastasis and development of alternative therapeutic approaches. Our findings deliver new details on key functional components in prostate cancer progression and provide opportunities for the development of alternative therapeutic approaches. PMID:28005952

  10. Identification of positive and negative transcriptional regulatory elements of the rabbit angiotensin-converting enzyme gene.

    PubMed Central

    Goraya, T Y; Kessler, S P; Kumar, R S; Douglas, J; Sen, G C

    1994-01-01

    The two tissue-specific mRNAs encoding the isozymes of rabbit angiotensin-converting enzyme (ACE) are generated from the same gene by alternative choice of two transcription initiation sites 5.7 kb apart. In the current study, we have characterized the regulatory sites controlling the transcription of the larger pulmonary isozyme mRNA. For this purpose, reporter genes driven by varying lengths of upstream region of the ACE gene were transfected into ACE-producing cells. Our results demonstrated that the transcription of this gene is primarily driven by positive elements within the first 274 bp DNA upstream of the transcription initiation site. The reporter gene driven by this region was expressed in two ACE-producing cells but not in two ACE-non-producing cells thereby establishing its tissue specificity. Our experiments also revealed the existence of a strong negative element located between -692 and -610 positions. This element suppressed the expression of the reporter gene in a dose-dependent and position and orientation-independent fashion thus suggesting that it is a true silencer element. It could also repress the expression of a reporter gene driven by the heterologous strong promoter of the beta-actin gene. The repressing effects of the negative element could be partially overcome by cotransfecting the isolated negative element along with the reporter gene containing the negative element. This result was possibly due to the functional removal of a limiting trans-acting factor which binds to this element. Electrophoretic mobility shift assays revealed that the negative element can form several complexes with proteins present in the nuclear extract of an ACE-producing cell line. At least part of the negative element is strongly conserved in the upstream regions of the human and mouse ACE genes. Images PMID:8165133

  11. Transcriptional activity of transposable elements in coelacanth.

    PubMed

    Forconi, Mariko; Chalopin, Domitille; Barucca, Marco; Biscotti, Maria Assunta; De Moro, Gianluca; Galiana, Delphine; Gerdol, Marco; Pallavicini, Alberto; Canapa, Adriana; Olmo, Ettore; Volff, Jean-Nicolas

    2014-09-01

    The morphological stasis of coelacanths has long suggested a slow evolutionary rate. General genomic stasis might also imply a decrease of transposable elements activity. To evaluate the potential activity of transposable elements (TEs) in "living fossil" species, transcriptomic data of Latimeria chalumnae and its Indonesian congener Latimeria menadoensis were compared through the RNA-sequencing mapping procedures in three different organs (liver, testis, and muscle). The analysis of coelacanth transcriptomes highlights a significant percentage of transcribed TEs in both species. Major contributors are LINE retrotransposons, especially from the CR1 family. Furthermore, some particular elements such as a LF-SINE and a LINE2 sequences seem to be more expressed than other elements. The amount of TEs expressed in testis suggests possible transposition burst in incoming generations. Moreover, significant amount of TEs in liver and muscle transcriptomes were also observed. Analyses of elements displaying marked organ-specific expression gave us the opportunity to highlight exaptation cases, that is, the recruitment of TEs as new cellular genes, but also to identify a new Latimeria-specific family of Short Interspersed Nuclear Elements called CoeG-SINEs. Overall, transcriptome results do not seem to be in line with a slow-evolving genome with poor TE activity.

  12. [Regulatory elements in the skin epithelium of Saccoglossus mereschkowskii (Enteropneusta, Hemichordata): electron microscopic and immunocytochemical study].

    PubMed

    Stoliarova, M V; Val'kovich, E I

    2013-01-01

    The aim of this investigation was to demonstrate the regulatory elements in the skin epithelium of Enteropneusta which are supposed to be related to the chordate ancestors. Using electron microscopy, it was found that in the skin epithelium of a representative of enteropneusts Saccoglossus mereschkowskii, the basal parts of some epitheliocytes took part in formation of a nerve layer. These cells were considered as receptor ciliated cells. The granular epithelial cells were shown to release secretion according to both exocrine and endocrine mechanism; these cells were characterized as endocrine-like regulatory cells. Fine granular cells possibly represent special receptor-endocrine-like cell type. The immunocytochemical detection of FMRFamid neuropeptide localization in histological sections confirmed the electron microscopic data on the presence of receptor and endocrine-like cells in the epithelium. It is suggested that the skin epithelium of Enteropneusta contains a peculiar neuro-endocrine regulatory system that is represented by receptor cells, receptor-endocrine-like cells of an open type and nerve elements of the nerve layer.

  13. Global vision systems regulatory and standard setting activities

    NASA Astrophysics Data System (ADS)

    Tiana, Carlo; Münsterer, Thomas

    2016-05-01

    A number of committees globally, and the Regulatory Agencies they support, are active delivering and updating performance standards for vision system: Enhanced, Synthetic and Combined, as they apply to both Fixed Wing and, more recently, Rotorcraft operations in low visibility. We provide an overview of each committee's present and past work, as well as an update of recent activities and future goals.

  14. Genome-scale high-resolution mapping of activating and repressive nucleotides in regulatory regions

    PubMed Central

    Ernst, Jason; Melnikov, Alexandre; Zhang, Xiaolan; Wang, Li; Rogov, Peter; Mikkelsen, Tarjei S.; Kellis, Manolis

    2016-01-01

    Massively parallel reporter assays (MPRA) enable nucleotide-resolution dissection of transcriptional regulatory regions, such as enhancers, but only few regions at a time. Here, we present a combined experimental and computational approach, Sharpr-MPRA, that allows high-resolution analysis of thousands of regions simultaneously. Sharpr-MPRA combines dense tiling of overlapping MPRA constructs with a probabilistic graphical model to recognize functional regulatory nucleotides, and to distinguish activating and repressive nucleotides, using their inferred contribution to reporter gene expression. We use Sharpr-MPRA to test 4.6 million nucleotides spanning 15,000 putative regulatory regions tiled at 5-nucleotide resolution in two human cell types. Our results recover known cell type-specific regulatory motifs and evolutionarily-conserved nucleotides, and distinguish known activating and repressive motifs. Our results also show that endogenous chromatin state and DNA accessibility are both predictive of regulatory function in reporter assays, identify retroviral elements with activating roles, and uncover ‘attenuator’ motifs with repressive roles in active chromatin. PMID:27701403

  15. Statistically significant strings are related to regulatory elements in the promoter regions of Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Hu, Rui; Wang, Bin

    2001-02-01

    Finding out statistically significant words in DNA and protein sequences forms the basis for many genetic studies. By applying the maximal entropy principle, we give one systematic way to study the nonrandom occurrence of words in DNA or protein sequences. Through comparison with experimental results, it was shown that patterns of regulatory binding sites in Saccharomyces cerevisiae ( yeast) genomes tend to occur significantly in the promoter regions. We studied two correlated gene families of yeast. The method successfully extracts the binding sites verified by experiments in each family. Many putative regulatory sites in the upstream regions are proposed. The study also suggested that some regulatory sites are active in both directions, while others show directional preference.

  16. The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements

    SciTech Connect

    Foley, J.; Ley, C.A.; Parysek, L.M.

    1994-07-15

    The authors determined the complete nucleotide sequence of the coding region of the human peripherin gene (PRPH), as well as 742 bp 5{prime} to the cap site and 584 bp 3{prime} to the stop codon, and compared its structure and sequence to the rat and mouse genes. The overall structure of 9 exons separated by 8 introns is conserved among these three mammalian species. The nucleotide sequences of the human peripherin gene exons were 90% identical to the rat gene sequences, and the predicted human peripherin protein differed from rat peripherin at only 18 of 475 amino acid residues. Comparison of the 5{prime} flanking regions of the human peripherin gene and rodent genes revealed extensive areas of high homology. Additional conserved segments were found in introns 1 and 2. Within the 5{prime} region, potential regulatory sequences, including a nerve growth factor negative regulatory element, a Hox protein binding site, and a heat shock element, were identified in all peripherin genes. The positional conservation of each element suggests that they may be important in the tissue-specific, developmental-specific, and injury-specific expression of the peripherin gene. 24 refs., 2 figs., 1 tab.

  17. Analysis of long-range interactions in primary human cells identifies cooperative CFTR regulatory elements

    PubMed Central

    Moisan, Stéphanie; Berlivet, Soizik; Ka, Chandran; Gac, Gérald Le; Dostie, Josée; Férec, Claude

    2016-01-01

    A mechanism by which control DNA elements regulate transcription over large linear genomic distances is by achieving close physical proximity with genes, and looping of the intervening chromatin paths. Alterations of such regulatory ‘chromatin looping’ systems are likely to play a critical role in human genetic disease at large. Here, we studied the spatial organization of a ≈790 kb locus encompassing the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Dysregulation of CFTR is responsible for cystic fibrosis, which is the most common lethal genetic disorder in Caucasian populations. CFTR is a relatively large gene of 189 kb with a rather complex tissue-specific and temporal expression profile. We used chromatin conformation at the CFTR locus to identify new DNA sequences that regulate its transcription. By comparing 5C chromatin interaction maps of the CFTR locus in expressing and non-expressing human primary cells, we identified several new contact points between the CFTR promoter and its surroundings, in addition to regions featuring previously described regulatory elements. We demonstrate that two of these novel interacting regions cooperatively increase CFTR expression, and suggest that the new enhancer elements located on either side of the gene are brought together through chromatin looping via CTCF. PMID:26615198

  18. Analysis of long-range interactions in primary human cells identifies cooperative CFTR regulatory elements.

    PubMed

    Moisan, Stéphanie; Berlivet, Soizik; Ka, Chandran; Le Gac, Gérald; Dostie, Josée; Férec, Claude

    2016-04-07

    A mechanism by which control DNA elements regulate transcription over large linear genomic distances is by achieving close physical proximity with genes, and looping of the intervening chromatin paths. Alterations of such regulatory 'chromatin looping' systems are likely to play a critical role in human genetic disease at large. Here, we studied the spatial organization of a ≈790 kb locus encompassing the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Dysregulation of CFTR is responsible for cystic fibrosis, which is the most common lethal genetic disorder in Caucasian populations. CFTR is a relatively large gene of 189 kb with a rather complex tissue-specific and temporal expression profile. We used chromatin conformation at the CFTR locus to identify new DNA sequences that regulate its transcription. By comparing 5C chromatin interaction maps of the CFTR locus in expressing and non-expressing human primary cells, we identified several new contact points between the CFTR promoter and its surroundings, in addition to regions featuring previously described regulatory elements. We demonstrate that two of these novel interacting regions cooperatively increase CFTR expression, and suggest that the new enhancer elements located on either side of the gene are brought together through chromatin looping via CTCF.

  19. A General Approach for Identifying Distant Regulatory Elements Applied to the Gdf6 Gene

    PubMed Central

    Mortlock, Douglas P.; Guenther, Catherine; Kingsley, David M.

    2003-01-01

    Regulatory sequences in higher genomes can map large distances from gene coding regions, and cannot yet be identified by simple inspection of primary DNA sequence information. Here we describe an efficient method of surveying large genomic regions for gene regulatory information, and subdividing complex sets of distant regulatory elements into smaller intervals for detailed study. The mouse Gdf6 gene is expressed in a number of distinct embryonic locations that are involved in the patterning of skeletal and soft tissues. To identify sequences responsible for Gdf6 regulation, we first isolated a series of overlapping bacterial artificial chromosomes (BACs) that extend varying distances upstream and downstream of the gene. A LacZ reporter cassette was integrated into the Gdf6 transcription unit of each BAC using homologous recombination in bacteria. Each modified BAC was injected into fertilized mouse eggs, and founder transgenic embryos were analyzed for LacZ expression mid-gestation. The overlapping segments defined by the BAC clones revealed five separate regulatory regions that drive LacZ expression in 11 distinct anatomical locations. To further localize sequences that control expression in developing skeletal joints, we created a series of BAC constructs with precise deletions across a putative joint-control region. This approach further narrowed the critical control region to an area containing several stretches of sequence that are highly conserved between mice and humans. A distant 2.9-kilobase fragment containing the highly conserved regions is able to direct very specific expression of a minimal promoter/LacZ reporter in proximal limb joints. These results demonstrate that even distant, complex regulatory sequences can be identified using a combination of BAC scanning, BAC deletion, and comparative sequencing approaches. PMID:12915490

  20. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    SciTech Connect

    Gindhart, J.G. Jr.; Kaufman, T.C.

    1995-02-01

    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products. When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.

  1. Distal regulatory element of the STAT1 gene potentially mediates positive feedback control of STAT1 expression.

    PubMed

    Yuasa, Katsutoshi; Hijikata, Takao

    2016-01-01

    We previously identified a distal regulatory element located approximately 5.5-kb upstream of the signal transducer and activator of transcription 1 (STAT1) gene, thereafter designating it as 5.5-kb upstream regulatory region (5.5URR). In this study, we investigated the functional roles of 5.5URR in the transcriptional regulation of STAT1 gene. A chromosome conformation capture assay indicated physical interaction of 5.5URR with the STAT1 core promoter. In luciferase reporter assays, 5.5URR-combined STAT1 core promoter exhibited significant increase in reporter activity enhanced by forced STAT1 expression or interferon (IFN) treatment, but STAT1 core promoter alone did not. The 5.5URR contained IFN-stimulated response element and GAS sites, which bound STAT1 complexes in electrophoretic mobility shift assays. Consistently, chromatin immunoprecipitation (ChIP) assays of HEK293 cells with Halo-tagged STAT1 expression indicated the association of Halo-tagged STAT1 with 5.5URR. ChIP assays with IFN treatment demonstrated that IFNs promoted the recruitment of Halo-tagged STAT1 to 5.5URR. Forced STAT1 expression or IFN treatment increased the expression of endogenous STAT1 and other IFN signaling pathway components, such as STAT2, IRF9 and IRF1, besides IFN-responsive genes. Collectively, the results suggest that 5.5URR may provide a regulatory platform for positive feedback control of STAT1 expression possibly to amplify or sustain the intracellular IFN signals.

  2. metagene Profiles Analyses Reveal Regulatory Element's Factor-Specific Recruitment Patterns.

    PubMed

    Joly Beauparlant, Charles; Lamaze, Fabien C; Deschênes, Astrid; Samb, Rawane; Lemaçon, Audrey; Belleau, Pascal; Bilodeau, Steve; Droit, Arnaud

    2016-08-01

    ChIP-Sequencing (ChIP-Seq) provides a vast amount of information regarding the localization of proteins across the genome. The aggregation of ChIP-Seq enrichment signal in a metagene plot is an approach commonly used to summarize data complexity and to obtain a high level visual representation of the general occupancy pattern of a protein. Here we present the R package metagene, the graphical interface Imetagene and the companion package similaRpeak. Together, they provide a framework to integrate, summarize and compare the ChIP-Seq enrichment signal from complex experimental designs. Those packages identify and quantify similarities or dissimilarities in patterns between large numbers of ChIP-Seq profiles. We used metagene to investigate the differential occupancy of regulatory factors at noncoding regulatory regions (promoters and enhancers) in relation to transcriptional activity in GM12878 B-lymphocytes. The relationships between occupancy patterns and transcriptional activity suggest two different mechanisms of action for transcriptional control: i) a "gradient effect" where the regulatory factor occupancy levels follow transcription and ii) a "threshold effect" where the regulatory factor occupancy levels max out prior to reaching maximal transcription. metagene, Imetagene and similaRpeak are implemented in R under the Artistic license 2.0 and are available on Bioconductor.

  3. Exploiting a precise design of universal synthetic modular regulatory elements to unlock the microbial natural products in Streptomyces.

    PubMed

    Bai, Chaoxian; Zhang, Yang; Zhao, Xuejin; Hu, Yiling; Xiang, Sihai; Miao, Jin; Lou, Chunbo; Zhang, Lixin

    2015-09-29

    There is a great demand for precisely quantitating the expression of genes of interest in synthetic and systems biotechnology as new and fascinating insights into the genetics of streptomycetes have come to light. Here, we developed, for the first time to our knowledge, a quantitative method based on flow cytometry and a superfolder green fluorescent protein (sfGFP) at single-cell resolution in Streptomyces. Single cells of filamentous bacteria were obtained by releasing the protoplasts from the mycelium, and the dead cells could be distinguished from the viable ones by propidium iodide (PI) staining. With this sophisticated quantitative method, some 200 native or synthetic promoters and 200 ribosomal binding sites (RBSs) were characterized in a high-throughput format. Furthermore, an insulator (RiboJ) was recruited to eliminate the interference between promoters and RBSs and improve the modularity of regulatory elements. Seven synthetic promoters with gradient strength were successfully applied in a proof-of-principle approach to activate and overproduce the cryptic lycopene in a predictable manner in Streptomyces avermitilis. Our work therefore presents a quantitative strategy and universal synthetic modular regulatory elements, which will facilitate the functional optimization of gene clusters and the drug discovery process in Streptomyces.

  4. Who owns Australia's water--elements of an effective regulatory model.

    PubMed

    McKay, J

    2003-01-01

    This paper identifies and describes a number of global trends in regulatory theory and legal scholarship. It points out the huge level of complexity demanded by globalisation and the unfortunate complication of this is that there is legal indeterminacy. The legal indeterminacy springs from the desire to amend and alter existing models. That has been the thrust of the Council of Australian Governments changes to adapt and add huge amounts of complexity to a flawed system. This paper argues that an effective water regulatory model requires a fundamental re-examination of the concept of water ownership and a capturing by the State of the right to allocate rainfall. This foundation is effective and the way forward to deal with the key issues in this transition phase. The second key element to an effective regulatory model is the concept of performance-based assessment. This requires information and schemes to be set up to work out ways to monitor and evaluate the performance of the utility on selected criteria. For Australia at present there is a dire lack of agreed criteria on these key issues and these have the potential to pull apart the whole process. The key issues are indigenous rights, governance issues, public participation, alteration of pre-existing rights and incorporation of environmental requirements.

  5. Negative regulatory elements upstream of a novel exon of the neuronal nicotinic acetylcholine receptor alpha 2 subunit gene.

    PubMed Central

    Bessis, A; Savatier, N; Devillers-Thiéry, A; Bejanin, S; Changeux, J P

    1993-01-01

    The expression of the nicotinic acetylcholine receptor alpha 2 subunit gene is highly restricted to the Spiriform lateralis nucleus of the Chick diencephalon. As a first step toward understanding the molecular mechanism underlying this regulation, we have investigated the structural and regulatory properties of the 5' sequence of this gene. A strategy based on the ligation of an oligonucleotide to the first strand of the cDNA (SLIC) followed by PCR amplification was used. A new exon was found approximately 3kb upstream from the first coding exon, and multiple transcription start sites of the gene were mapped. Analysis of the flanking region shows many consensus sequences for the binding of nuclear proteins, suggesting that the 1 kb flanking region contains at least a portion of the promoter of the gene. We have analysed the negative regulatory elements present within this region and found that a silencer region located between nucleotide -144 and +76 is active in fibroblasts as well as in neurons. This silencer is composed of six tandem repeat Oct-like motifs (CCCCATGCAAT), but does not bind any member of the Oct family. Moreover these motifs were found to act as a silencer only when they were tandemly repeated. When two, four or five motifs were deleted, the silencer activity of the motifs unexpectedly became an enhancer activity in all cells we have tested. Images PMID:8502560

  6. Variation in sequence and organization of splicing regulatory elements in vertebrate genes

    PubMed Central

    Yeo, Gene; Hoon, Shawn; Venkatesh, Byrappa; Burge, Christopher B.

    2004-01-01

    Although core mechanisms and machinery of premRNA splicing are conserved from yeast to human, the details of intron recognition often differ, even between closely related organisms. For example, genes from the pufferfish Fugu rubripes generally contain one or more introns that are not properly spliced in mouse cells. Exploiting available genome sequence data, a battery of sequence analysis techniques was used to reach several conclusions about the organization and evolution of splicing regulatory elements in vertebrate genes. The classical splice site and putative branch site signals are completely conserved across the vertebrates studied (human, mouse, pufferfish, and zebrafish), and exonic splicing enhancers also appear broadly conserved in vertebrates. However, another class of splicing regulatory elements, the intronic splicing enhancers, appears to differ substantially between mammals and fish, with G triples (GGG) very abundant in mammalian introns but comparatively rare in fish. Conversely, short repeats of AC and GT are predicted to function as intronic splicing enhancers in fish but are not enriched in mammalian introns. Consistent with this pattern, exonic splicing enhancer-binding SR proteins are highly conserved across all vertebrates, whereas heterogeneous nuclear ribonucleoproteins, which bind many intronic sequences, vary in domain structure and even presence/absence between mammals and fish. Exploiting differences in intronic sequence composition, a statistical model was developed to predict the splicing phenotype of Fugu introns in mammalian systems and was used to engineer the spliceability of a Fugu intron in human cells by insertion of specific sequences, thereby rescuing splicing in human cells. PMID:15505203

  7. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition

    PubMed Central

    Deb, Arindam; Kundu, Sudip

    2015-01-01

    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  8. [Modulators of the regulatory protein activity acting at microdoses].

    PubMed

    Iamskova, V P; Krasnov, M S; Skripnikova, V S; Moliavka, A A; Il'ina, A P; Margasiuk, D V; Borisenko, A V; Berezin, B B; Iamskov, I A

    2009-01-01

    New, previously not studied bioregulators active in the ultra low doses corresponding of 10(-8) - 10(-17) mg/ml have been isolated from vitreoretinal tissue of eye. It has been shown that these bioregulators comprise some regulatory peptides-modulators represented by proteins with molecular weights 15-70 KDa one of which is bovine serum albumin. Correlation between the nanosize of bioregulators and their ability to show activity in ultra low doses is established.

  9. CpG methylation at GATA elements in the regulatory region of CCR3 positively correlates with CCR3 transcription.

    PubMed

    Uhm, Tae Gi; Lee, Seol Kyung; Kim, Byung Soo; Kang, Jin Hyun; Park, Choon Sik; Rhim, Tai Youn; Chang, Hun Soo; Kim, Do Jin; Chung, Il Yup

    2012-04-30

    DNA methylation may regulate gene expression by restricting the access of transcription factors. We have previously demonstrated that GATA-1 regulates the transcription of the CCR3 gene by dynamically interacting with both positively and negatively acting GATA elements of high affinity binding in the proximal promoter region including exon 1. Exon 1 has three CpG sites, two of which are positioned at the negatively acting GATA elements. We hypothesized that the methylation of these two CpGs sites might preclude GATA-1 binding to the negatively acting GATA elements and, as a result, increase the availability of GATA-1 to the positively acting GATA element, thereby contributing to an increase in GATA-1-mediated transcription of the gene. To this end, we determined the methylation of the three CpG sites by bisulfate pyrosequencing in peripheral blood eosinophils, cord blood (CB)-derived eosinophils, PBMCs, and cell lines that vary in CCR3 mRNA expression. Our results demonstrated that methylation of CpG sites at the negatively acting GATA elements severely reduced GATA-1 binding and augmented transcription activity in vitro. In agreement, methylation of these CpG sites positively correlated with CCR3 mRNA expression in the primary cells and cell lines examined. Interestingly, methylation patterns of these three CpG sites in CB-derived eosinophils mostly resembled those in peripheral blood eosinophils. These results suggest that methylation of CpG sites at the GATA elements in the regulatory regions fine-tunes CCR3 transcription.

  10. Genome-Wide Identification of Regulatory Elements and Reconstruction of Gene Regulatory Networks of the Green Alga Chlamydomonas reinhardtii under Carbon Deprivation

    PubMed Central

    Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  11. Distal cis-regulatory elements are required for tissue-specific expression of enamelin (Enam)

    PubMed Central

    Hu, Yuanyuan; Papagerakis, Petros; Ye, Ling; Feng, Jerry Q.; Simmer, James P.; Hu, Jan C-C.

    2009-01-01

    Enamel formation is orchestrated by the sequential expression of genes encoding enamel matrix proteins; however, the mechanisms sustaining the spatio–temporal order of gene transcription during amelogenesis are poorly understood. The aim of this study was to characterize the cis-regulatory sequences necessary for normal expression of enamelin (Enam). Several enamelin transcription regulatory regions, showing high sequence homology among species, were identified. DNA constructs containing 5.2 or 3.9 kb regions upstream of the enamelin translation initiation site were linked to a LacZ reporter and used to generate transgenic mice. Only the 5.2-Enam–LacZ construct was sufficient to recapitulate the endogenous pattern of enamelin tooth-specific expression. The 3.9-Enam–LacZ transgenic lines showed no expression in dental cells, but ectopic β-galactosidase activity was detected in osteoblasts. Potential transcription factor-binding sites were identified that may be important in controlling enamelin basal promoter activity and in conferring enamelin tissue-specific expression. Our study provides new insights into regulatory mechanisms governing enamelin expression. PMID:18353004

  12. Renal Anemia Model Mouse Established by Transgenic Rescue with an Erythropoietin Gene Lacking Kidney-Specific Regulatory Elements.

    PubMed

    Hirano, Ikuo; Suzuki, Norio; Yamazaki, Shun; Sekine, Hiroki; Minegishi, Naoko; Shimizu, Ritsuko; Yamamoto, Masayuki

    2017-02-15

    The erythropoietin (Epo) gene is under tissue-specific inducible regulation. Because the kidney is the primary EPO-producing tissue in adults, impaired EPO production in chronic kidney disorders results in serious renal anemia. The Epo gene contains a liver-specific enhancer in the 3' region, but the kidney-specific enhancer for gene expression in renal EPO-producing (REP) cells remains elusive. Here, we examined a conserved upstream element for renal Epo regulation (CURE) region that spans 17.4 kb to 3.6 kb upstream of the Epo gene and harbors several phylogenetically conserved elements. We prepared various Epo gene-reporter constructs utilizing a bacterial artificial chromosome and generated a number of transgenic-mouse lines. We observed that deletion of the CURE region (δCURE) abrogated Epo gene expression in REP cells. Although transgenic expression of the δCURE construct rescued Epo-deficient mice from embryonic lethality, the rescued mice had severe EPO-dependent anemia. These mouse lines serve as an elaborate model for the search for erythroid stimulatory activity and are referred to as AnRED (anemic model with renal EPO deficiency) mice. We also dissected the CURE region by exploiting a minigene harboring four phylogenetically conserved elements in reporter transgenic-mouse analyses. Our analyses revealed that Epo gene regulation in REP cells is a complex process that utilizes multiple regulatory influences.

  13. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    PubMed

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders.

  14. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders

    PubMed Central

    Wakabayashi, Aoi; Ulirsch, Jacob C.; Ludwig, Leif S.; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I.; Sankaran, Vijay G.

    2016-01-01

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptional cis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  15. Dissection of Regulatory Elements During Direct Conversion of Somatic Cells into Neurons.

    PubMed

    Soleimani, Tahereh; Falsafi, Nafiseh; Fallahi, Hossein

    2017-02-23

    A revolutionary approach that involves direct conversion of somatic cells into almost any other types of cells showed promising results for regenerative medicine. Currently, producing valuable cell types including neurons, cardiomyocytes and hepatocytes through direct conversion of somatic cells appear to be a feasible option for regenerative medicine. The process involves inducing the cells by chemical cocktails or by expression of different types of transcription factors. In this concept, in vitro neurogenesis considered to be able to produce neuron cells to replace damaged neurons especially in Alzheimer and Parkinson disease. However, early successful experiments followed by major drawbacks such as low differentiation efficiency in producing neurons and detection of various undesirable types of cells in the culture. Therefore, there is not a single optimized common protocol for producing high quality neurons in vitro so far. This is partly due to the lack of our understanding about the precise cellular, genetic, and molecular mechanisms underlying neurogenesis via direct conversion. In the current work, we have employed meta-analysis tools and extensive gene regulatory network analysis on the high through put gene expression data obtained from previous reprogramming protocols to identify central gene regulatory components involved in direct conversion of fibroblasts into neurons. Our results identified miR-9, miR-30 as the most important miRNA and TP53, MYC, JUN, SP1 and SMAD2 considered to be the most important transcription factors. These findings would be useful for direct targeting these hub regulatory elements in order to increase the efficacy and specificity of the conversion protocols. This article is protected by copyright. All rights reserved.

  16. A mathematical model of the sterol regulatory element binding protein 2 cholesterol biosynthesis pathway.

    PubMed

    Bhattacharya, Bonhi S; Sweby, Peter K; Minihane, Anne-Marie; Jackson, Kim G; Tindall, Marcus J

    2014-05-21

    Cholesterol is one of the key constituents for maintaining the cellular membrane and thus the integrity of the cell itself. In contrast high levels of cholesterol in the blood are known to be a major risk factor in the development of cardiovascular disease. We formulate a deterministic nonlinear ordinary differential equation model of the sterol regulatory element binding protein 2 (SREBP-2) cholesterol genetic regulatory pathway in a hepatocyte. The mathematical model includes a description of genetic transcription by SREBP-2 which is subsequently translated to mRNA leading to the formation of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), a main regulator of cholesterol synthesis. Cholesterol synthesis subsequently leads to the regulation of SREBP-2 via a negative feedback formulation. Parameterised with data from the literature, the model is used to understand how SREBP-2 transcription and regulation affects cellular cholesterol concentration. Model stability analysis shows that the only positive steady-state of the system exhibits purely oscillatory, damped oscillatory or monotic behaviour under certain parameter conditions. In light of our findings we postulate how cholesterol homeostasis is maintained within the cell and the advantages of our model formulation are discussed with respect to other models of genetic regulation within the literature.

  17. Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.

    PubMed

    Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon

    2010-01-15

    Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short.

  18. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.

    1989-01-01

    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  19. A mathematical model of the sterol regulatory element binding protein 2 cholesterol biosynthesis pathway

    PubMed Central

    Bhattacharya, Bonhi S.; Sweby, Peter K.; Minihane, Anne-Marie; Jackson, Kim G.; Tindall, Marcus J.

    2014-01-01

    Cholesterol is one of the key constituents for maintaining the cellular membrane and thus the integrity of the cell itself. In contrast high levels of cholesterol in the blood are known to be a major risk factor in the development of cardiovascular disease. We formulate a deterministic nonlinear ordinary differential equation model of the sterol regulatory element binding protein 2 (SREBP-2) cholesterol genetic regulatory pathway in a hepatocyte. The mathematical model includes a description of genetic transcription by SREBP-2 which is subsequently translated to mRNA leading to the formation of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), a main regulator of cholesterol synthesis. Cholesterol synthesis subsequently leads to the regulation of SREBP-2 via a negative feedback formulation. Parameterised with data from the literature, the model is used to understand how SREBP-2 transcription and regulation affects cellular cholesterol concentration. Model stability analysis shows that the only positive steady-state of the system exhibits purely oscillatory, damped oscillatory or monotic behaviour under certain parameter conditions. In light of our findings we postulate how cholesterol homeostasis is maintained within the cell and the advantages of our model formulation are discussed with respect to other models of genetic regulation within the literature. PMID:24444765

  20. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro

    2017-01-01

    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  1. Putative cis-regulatory elements in genes highly expressed in rice sperm cells

    PubMed Central

    2011-01-01

    Background The male germ line in flowering plants is initiated within developing pollen grains via asymmetric division. The smaller cell then becomes totally encased within a much larger vegetative cell, forming a unique "cell within a cell structure". The generative cell subsequently divides to give rise to two non-motile diminutive sperm cells, which take part in double fertilization and lead to the seed set. Sperm cells are difficult to investigate because of their presence within the confines of the larger vegetative cell. However, recently developed techniques for the isolation of rice sperm cells and the fully annotated rice genome sequence have allowed for the characterization of the transcriptional repertoire of sperm cells. Microarray gene expression data has identified a subset of rice genes that show unique or highly preferential expression in sperm cells. This information has led to the identification of cis-regulatory elements (CREs), which are conserved in sperm-expressed genes and are putatively associated with the control of cell-specific expression. Findings We aimed to identify the CREs associated with rice sperm cell-specific gene expression data using in silico prediction tools. We analyzed 1-kb upstream regions of the top 40 sperm cell co-expressed genes for over-represented conserved and novel motifs. Analysis of upstream regions with the SIGNALSCAN program with the PLACE database, MEME and the Mclip tool helped to find combinatorial sets of known transcriptional factor-binding sites along with two novel motifs putatively associated with the co-expression of sperm cell-specific genes. Conclusions Our data shows the occurrence of novel motifs, which are putative CREs and are likely targets of transcriptional factors regulating sperm cell gene expression. These motifs can be used to design the experimental verification of regulatory elements and the identification of transcriptional factors that regulate sperm cell-specific gene expression. PMID

  2. The Regulatory Properties of Autonomous Subtelomeric P Elements Are Sensitive to a Suppressor of Variegation in Drosophila Melanogaster

    PubMed Central

    Ronsseray, S.; Lehmann, M.; Nouaud, D.; Anxolabehere, D.

    1996-01-01

    Genetic recombination was used in Drosophila melanogaster to isolate P elements, inserted at the telomeres of X chromosomes (cytological site 1A) from natural populations, in a genetic background devoid of other P elements. We show that complete maternally inherited P repression in the germline (P cytotype) can be elicited by only two autonomous P elements at 1A and that a single element at this site has partial regulatory properties. The analysis of the surrounding chromosomal regions of the P elements at 1A shows that in all cases these elements are flanked by Telomeric Associated Sequences, tandemly repetitive noncoding sequences that have properties of heterochromatin. In addition, we show that the regulatory properties of P elements at 1A can be inhibited by some of the mutant alleles of the Su(var)205 gene and by a deficiency of this gene. However, the regulatory properties of reference P strains (Harwich and Texas 007) are not impaired by Su(var)205 mutations. Su(var)205 encodes Heterochromatin Protein 1 (HP1). These results suggest that the HP1 dosage effect on the P element properties is site-dependent and could involve the structure of the chromatin. PMID:8844154

  3. The mouse albumin enhancer contains a negative regulatory element that interacts with a novel DNA-binding protein.

    PubMed Central

    Herbst, R S; Boczko, E M; Darnell, J E; Babiss, L E

    1990-01-01

    The far-upstream mouse albumin enhancer (-10.5 to -8.43 kilobases) has both positive and negative regulatory domains which contribute to the rate and tissue specificity of albumin gene transcription. (R. S. Herbst, N. Friedman, J. E. Darnell, Jr., and L. E. Babiss, Proc. Natl. Acad. Sci. USA 86:1553-1557). In this work, the negative regulatory region has been functionally localized to sequences -8.7 to -8.43 kilobases upstream of the albumin gene cap site. In the absence of the albumin-modulating region (in which there are binding sites for the transcription factor C/EBP), the negative region can suppress a neighboring positive-acting element, thereby interfering with albumin enhancer function. The negative region is also capable of negating the positive action of the heterologous transthyretin enhancer in an orientation-independent fashion. Within this negative-acting region we can detect two DNA-binding sites, both of which are recognized by a protein present in all cell types tested. This DNA-binding activity is not competed for by any of a series of known DNA-binding sites, and hence this new protein is a candidate for a role in suppressing the albumin gene in nonhepatic cells. Images PMID:2370857

  4. 77 FR 70846 - Regulatory Guide 1.182, “Assessing and Managing Risk Before Maintenance Activities at Nuclear...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-27

    ... Chief, Regulatory Guide Development Branch, Division of Engineering, Office of Nuclear Regulatory... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Regulatory Guide 1.182, ``Assessing and Managing Risk Before Maintenance Activities at...

  5. microRNA Decay: Refining microRNA Regulatory Activity.

    PubMed

    Pepin, Genevieve; Gantier, Michael P

    2016-01-01

    MicroRNAs (miRNAs) are short 19-25 nucleotide RNA molecules that impact on most biological processes by regulating the efficiency of messenger RNA (mRNA) translation. To date, most research activities have been focused on the control of miRNA expression and its functional consequences. Nonetheless, much remains unknown about the mechanisms affecting the level of specific miRNAs in the cell, a critical feature impacting their regulatory activity. This review focuses on the factors that regulate the abundance of miRNAs, including synthesis, post-transcriptional modifications, nucleases, target binding, and secretion.

  6. Identification of distal cis-regulatory elements at mouse mitoferrin loci using zebrafish transgenesis.

    PubMed

    Amigo, Julio D; Yu, Ming; Troadec, Marie-Berengere; Gwynn, Babette; Cooney, Jeffrey D; Lambert, Amy J; Chi, Neil C; Weiss, Mitchell J; Peters, Luanne L; Kaplan, Jerry; Cantor, Alan B; Paw, Barry H

    2011-04-01

    Mitoferrin 1 (Mfrn1; Slc25a37) and mitoferrin 2 (Mfrn2; Slc25a28) function as essential mitochondrial iron importers for heme and Fe/S cluster biogenesis. A genetic deficiency of Mfrn1 results in a profound hypochromic anemia in vertebrate species. To map the cis-regulatory modules (CRMs) that control expression of the Mfrn genes, we utilized genome-wide chromatin immunoprecipitation (ChIP) datasets for the major erythroid transcription factor GATA-1. We identified the CRMs that faithfully drive the expression of Mfrn1 during blood and heart development and Mfrn2 ubiquitously. Through in vivo analyses of the Mfrn-CRMs in zebrafish and mouse, we demonstrate their functional and evolutionary conservation. Using knockdowns with morpholinos and cell sorting analysis in transgenic zebrafish embryos, we show that GATA-1 directly regulates the expression of Mfrn1. Mutagenesis of individual GATA-1 binding cis elements (GBE) demonstrated that at least two of the three GBE within this CRM are functionally required for GATA-mediated transcription of Mfrn1. Furthermore, ChIP assays demonstrate switching from GATA-2 to GATA-1 at these elements during erythroid maturation. Our results provide new insights into the genetic regulation of mitochondrial function and iron homeostasis and, more generally, illustrate the utility of genome-wide ChIP analysis combined with zebrafish transgenesis for identifying long-range transcriptional enhancers that regulate tissue development.

  7. An Altered State of a Specific EN Regulatory Element Induced in a Maize Tiller

    PubMed Central

    Fowler, Robert G.; Peterson, Peter A.

    1978-01-01

    There are numerous states of the regulatory element, Enhancer (En). With specific receptor alleles, such as a2m(r-pa-pu) or a2m(r), specific mutability patterns are expressed. One specific derivative En allele, En-v (En-variable), was originally identified with a coarse pattern of mutability with the a2m(r-pa-pu) allele and giving progeny with varied En expression (standard to reduced within an ear progeny). Derivatives of En-v were subsequently found on numerous occasions to give only a very reduced expression (fewer mutant spots) with the a2m(r-pa-pu) allele in the ears derived from the main stalk of the corn plant. When a comparison is made of the effect of this changed En-v state between tiller ears and main stalk ears of the same plant, the tiller ears show an increased level of En-v expression (coarse pattern), while the main-stalk ears continue to show the very reduced level of En-v expression (low frequency of very late variegation). This increased level of mutability of the tiller ears is maintained when transmitted through the main-stalk ear in the subsequent generation. These results indicate that heritable alterations of controlling elements can be produced by endogenous environmental factors present during normal plant development. PMID:17248873

  8. FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.

    PubMed

    Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

    2015-01-01

    Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE.

  9. A Novel Pregnane X Receptor-mediated and Sterol Regulatory Element-binding Protein-independent Lipogenic Pathway*

    PubMed Central

    Zhou, Jie; Zhai, Yonggong; Mu, Ying; Gong, Haibiao; Uppal, Hirdesh; Toma, David; Ren, Songrong; Evans, Ronald M.; Xie, Wen

    2014-01-01

    The pregnane X receptor (PXR) was isolated as a xenosensor regulating xenobiotic responses. In this study, we show that PXR plays an endobiotic role by impacting lipid homeostasis. Expression of an activated PXR in the livers of transgenic mice resulted in an increased hepatic deposit of triglycerides. This PXR-mediated lipid accumulation was independent of the activation of the lipogenic transcriptional factor SREBP-1c (sterol regulatory element-binding protein 1c) and its primary lipogenic target enzymes, including fatty-acid synthase (FAS) and acetyl-CoA carboxylase 1 (ACC-1). Instead, the lipid accumulation in transgenic mice was associated with an increased expression of the free fatty acid transporter CD36 and several accessory lipogenic enzymes, such as stearoyl-CoA desaturase-1 (SCD-1) and long chain free fatty acid elongase. Studies using transgenic and knock-out mice showed that PXR is both necessary and sufficient for Cd36 activation. Promoter analyses revealed a DR-3-type of PXR-response element in the mouse Cd36 promoter, establishing Cd36 as a direct transcriptional target of PXR. The hepatic lipid accumulation and Cd36 induction were also seen in the hPXR “humanized” mice treated with the hPXR agonist rifampicin. The activation of PXR was also associated with an inhibition of pro-β-oxidative genes, such as peroxisome proliferator-activated receptor α (PPARα) and thiolase, and an up-regulation of PPARγ, a positive regulator of CD36. The cross-regulation of CD36 by PXR and PPARγ suggests that this fatty acid transporter may function as a common target of orphan nuclear receptors in their regulation of lipid homeostasis. PMID:16556603

  10. Reconstructing genome-wide regulatory network of E. coli using transcriptome data and predicted transcription factor activities

    PubMed Central

    2011-01-01

    Background Gene regulatory networks play essential roles in living organisms to control growth, keep internal metabolism running and respond to external environmental changes. Understanding the connections and the activity levels of regulators is important for the research of gene regulatory networks. While relevance score based algorithms that reconstruct gene regulatory networks from transcriptome data can infer genome-wide gene regulatory networks, they are unfortunately prone to false positive results. Transcription factor activities (TFAs) quantitatively reflect the ability of the transcription factor to regulate target genes. However, classic relevance score based gene regulatory network reconstruction algorithms use models do not include the TFA layer, thus missing a key regulatory element. Results This work integrates TFA prediction algorithms with relevance score based network reconstruction algorithms to reconstruct gene regulatory networks with improved accuracy over classic relevance score based algorithms. This method is called Gene expression and Transcription factor activity based Relevance Network (GTRNetwork). Different combinations of TFA prediction algorithms and relevance score functions have been applied to find the most efficient combination. When the integrated GTRNetwork method was applied to E. coli data, the reconstructed genome-wide gene regulatory network predicted 381 new regulatory links. This reconstructed gene regulatory network including the predicted new regulatory links show promising biological significances. Many of the new links are verified by known TF binding site information, and many other links can be verified from the literature and databases such as EcoCyc. The reconstructed gene regulatory network is applied to a recent transcriptome analysis of E. coli during isobutanol stress. In addition to the 16 significantly changed TFAs detected in the original paper, another 7 significantly changed TFAs have been detected by

  11. Regulatory elements in the first intron contribute to transcriptional regulation of the beta 3 tubulin gene by 20-hydroxyecdysone in Drosophila Kc cells.

    PubMed Central

    Bruhat, A; Tourmente, S; Chapel, S; Sobrier, M L; Couderc, J L; Dastugue, B

    1990-01-01

    We have studied the transcriptional regulation of the beta 3 tubulin gene by the steroid hormone 20-hydroxyecdysone (20-OH-E) in Drosophila Kc cells. A series of hybrid genes with varying tubulin gene lengths driving the bacterial chloramphenicol acetyl transferase (CAT) gene were constructed. The promoter activity was assayed after transient expression in Kc cells, in the presence or absence of 20-OH-E. We find that 0.91Kb upstream from the transcription start site contain one or several hormone independent positive cis-acting elements, responsible for the constitutive expression of the beta 3 tubulin gene. In the large (4.5 Kb) first intron of this gene, we identified additional hormone dependent negative and positive regulatory elements, which can act in both directions and in a position-independence manner. Then, the negative intron element(s), which repress the transcription in the absence of 20-OH-E has characteristics of silencer. Images PMID:2349088

  12. Evaluation of phylogenetic footprint discovery for predicting bacterial cis-regulatory elements and revealing their evolution

    PubMed Central

    Janky, Rekin's; van Helden, Jacques

    2008-01-01

    Background The detection of conserved motifs in promoters of orthologous genes (phylogenetic footprints) has become a common strategy to predict cis-acting regulatory elements. Several software tools are routinely used to raise hypotheses about regulation. However, these tools are generally used as black boxes, with default parameters. A systematic evaluation of optimal parameters for a footprint discovery strategy can bring a sizeable improvement to the predictions. Results We evaluate the performances of a footprint discovery approach based on the detection of over-represented spaced motifs. This method is particularly suitable for (but not restricted to) Bacteria, since such motifs are typically bound by factors containing a Helix-Turn-Helix domain. We evaluated footprint discovery in 368 Escherichia coli K12 genes with annotated sites, under 40 different combinations of parameters (taxonomical level, background model, organism-specific filtering, operon inference). Motifs are assessed both at the levels of correctness and significance. We further report a detailed analysis of 181 bacterial orthologs of the LexA repressor. Distinct motifs are detected at various taxonomical levels, including the 7 previously characterized taxon-specific motifs. In addition, we highlight a significantly stronger conservation of half-motifs in Actinobacteria, relative to Firmicutes, suggesting an intermediate state in specificity switching between the two Gram-positive phyla, and thereby revealing the on-going evolution of LexA auto-regulation. Conclusion The footprint discovery method proposed here shows excellent results with E. coli and can readily be extended to predict cis-acting regulatory signals and propose testable hypotheses in bacterial genomes for which nothing is known about regulation. PMID:18215291

  13. The medical dictionary for regulatory activities (MedDRA).

    PubMed

    Brown, E G; Wood, L; Wood, S

    1999-02-01

    The International Conference on Harmonisation has agreed upon the structure and content of the Medical Dictionary for Regulatory Activities (MedDRA) version 2.0 which should become available in the early part of 1999. This medical terminology is intended for use in the pre- and postmarketing phases of the medicines regulatory process, covering diagnoses, symptoms and signs, adverse drug reactions and therapeutic indications, the names and qualitative results of investigations, surgical and medical procedures, and medical/social history. It can be used for recording adverse events and medical history in clinical trials, in the analysis and tabulations of data from these trials and in the expedited submission of safety data to government regulatory authorities, as well as in constructing standard product information and documentation for applications for marketing authorisation. After licensing of a medicine, it may be used in pharmacovigilance and is expected to be the preferred terminology for international electronic regulatory communication. MedDRA is a hierarchical terminology with 5 levels and is multiaxial: terms may exist in more than 1 vertical axis, providing specificity of terms for data entry and flexibility in data retrieval. Terms in MedDRA were derived from several sources including the WHO's adverse reaction terminology (WHO-ART), Coding Symbols for a Thesaurus of Adverse Reaction Terms (COSTART), International Classification of Diseases (ICD) 9 and ICD9-CM. It will be maintained, further developed and distributed by a Maintenance Support Services Organisation (MSSO). It is anticipated that using MedDRA will improve the quality of data captured on databases, support effective analysis by providing clinically relevant groupings of terms and facilitate electronic communication of data, although as a new tool, users will need to invest time in gaining expertise in its use.

  14. Detection and Visualization of Compositionally Similar cis-Regulatory Element Clusters in Orthologous and Coordinately Controlled Genes

    PubMed Central

    Jegga, Anil G.; Sherwood, Shawn P.; Carman, James W.; Pinski, Andrew T.; Phillips, Jerry L.; Pestian, John P.; Aronow, Bruce J.

    2002-01-01

    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) (http://trafac.chmcc.org). We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions. PMID:12213778

  15. Detection and visualization of compositionally similar cis-regulatory element clusters in orthologous and coordinately controlled genes.

    PubMed

    Jegga, Anil G; Sherwood, Shawn P; Carman, James W; Pinski, Andrew T; Phillips, Jerry L; Pestian, John P; Aronow, Bruce J

    2002-09-01

    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) (http://trafac.chmcc.org). We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions.

  16. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation*

    PubMed Central

    Guo, Jianfei; Öz, Orhan K.

    2015-01-01

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the −36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance. PMID:26260319

  17. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation.

    PubMed

    Hajibeigi, Asghar; Dioum, Elhadji M; Guo, Jianfei; Öz, Orhan K

    2015-09-25

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23 nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the -36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance.

  18. Putative regulatory elements within the non-coding regions of Chrysomelidae Diapause Associated Transcript-1 (DAT-1) orthologs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To develop a more comprehensive understanding of diapause within Chrysomelidae, we are employing phylogenetic foot-printing to isolate and characterize the regulatory elements associated with the diapause-associated gene, DAT-1. Leptinotarsa decemlineata (Colorado potato beetle, CPB) DAT-1 has been ...

  19. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode inducible synthetic promoters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co...

  20. Characterization of an upstream regulatory element of adenovirus L1 poly (A) site.

    PubMed

    Liu, Li

    2005-06-20

    The transition from early to late stage infection by adenovirus involves a change in mRNA expression from the adenovirus major late transcription unit (AdMLTU). This early to late switch centers around alternative selection of one of five poly (A) sites (L1-L5) that code for the major structural proteins of Adenovirus. During the early stage of infection, steady state mRNA is primarily derived from the L1 poly (A) site. During the late stage of infection, each of the MLTU poly (A) sites is represented in the steady state mRNA pool (Falck-Pedersen, E., Logan, J., 1989. Regulation of poly(A) site selection in adenovirus. J. Virol. 63 (2), 532-541.). Using transient transfection of a plasmid expressing Chloramphenicol Acetyl Transferase with a tandem poly (A) minigene system (L13) (DeZazzo, J.D., Falck-Pedersen, E., Imperiale, M.J., 1991. Sequences regulating temporal poly(A) site switching in the adenovirus major late transcription unit. Mol. Cell. Biol. 11 (12), 5977-5984; Prescott, J., Falck-Pedersen, E., 1994. Sequence elements upstream of the 3' cleavage site confer substrate strength to the adenovirus L1 and L3 polyadenylation sites. Mol. Cell. Biol. 14 (7), 4682-4693.), it has been demonstrated that the promoter-proximal L1 poly (A) site which is poorly recognized by the 3' end processing machinery, contains an upstream repressor element (URE) that influences steady state levels of mRNA (Prescott, J.C., Liu, L., Falck-Pedersen, E., 1997. Sequence-mediated regulation of adenovirus gene expression by repression of mRNA accumulation. Mol. Cell. Biol. 17 (4), 2207-2216.). In this study, we have further characterized the elements that mediate L1URE function. These studies indicate that the L1 upstream regulatory element (L1 URE) contains a complex RNA architecture that serves to repress gene expression through multiple sub-effectors. The L1URE functions when located upstream of a heterologous poly (A) site, and is able to strongly suppress steady state m

  1. Candidate regulatory sequence elements for cell cycle-dependent transcription in Saccharomyces cerevisiae.

    PubMed

    Wolfsberg, T G; Gabrielian, A E; Campbell, M J; Cho, R J; Spouge, J L; Landsman, D

    1999-08-01

    Recent developments in genome-wide transcript monitoring have led to a rapid accumulation of data from gene expression studies. Such projects highlight the need for methods to predict the molecular basis of transcriptional coregulation. A microarray project identified the 420 yeast transcripts whose synthesis displays cell cycle-dependent periodicity. We present here a statistical technique we developed to identify the sequence elements that may be responsible for this cell cycle regulation. Because most gene regulatory sites contain a short string of highly conserved nucleotides, any such strings that are involved in gene regulation will occur frequently in the upstream regions of the genes that they regulate, and rarely in the upstream regions of other genes. Our strategy therefore utilizes statistical procedures to identify short oligomers, five or six nucleotides in length, that are over-represented in upstream regions of genes whose expression peaks at the same phase of the cell cycle. We report, with a high level of confidence, that 9 hexamers and 12 pentamers are over-represented in the upstream regions of genes whose expression peaks at the early G(1), late G(1), S, G(2), or M phase of the cell cycle. Some of these sequence elements show a preference for a particular orientation, and others, through a separate statistical test, for a particular position upstream of the ATG start codon. The finding that the majority of the statistically significant sequence elements are located in late G(1) upstream regions correlates with other experiments that identified the late G(1)/early S boundary as a vital cell cycle control point. Our results highlight the importance of MCB, an element implicated previously in late G(1)/early S gene regulation, as most of the late G(1) oligomers contain the MCB sequence or variations thereof. It is striking that most MCB-like sequences localize to a specific region upstream of the ATG start codon. Additional sequences that we have

  2. Control of Human PLP1 Expression Through Transcriptional Regulatory Elements and Alternatively Spliced Exons in Intron 1

    PubMed Central

    Hamdan, Hamdan; Kockara, Neriman T.; Jolly, Lee Ann; Haun, Shirley

    2015-01-01

    *These authors contributed equally to this work.Although the myelin proteolipid protein gene (PLP1) encodes the most abundant protein in central nervous system (CNS) myelin, not much is known about the mechanisms that govern expression of the human gene (hPLP1). Much more is known about the processes that regulate Plp1 gene expression in rodents. From studies with Plp1-lacZ transgenic mice, it was determined that the first intron of mouse Plp1 (mPlp1) is required to attain high levels of expression in brain, concurrent with the active myelination period. Other studies have suggested that within mPlp1 intron 1 (>8 kb) lie several regions with enhancer-like activity. To test whether these sequences (and possibly others) in hPLP1 intron 1 are functional, deletion-transfection analysis was performed with hPLP1-lacZ constructs that contain various portions of the intron, or lack it altogether. Results presented here demonstrate the importance of hPLP1 intron 1 in achieving maximal levels of expression in the immortalized oligodendroglial cell line, Oli-neu. Deletion analysis indicates that the intron contains multiple positive regulatory elements which are active in Oli-neu cells. Some of these elements appear to be functionally conserved between human and mouse, while others are not. Furthermore, our studies demonstrate that multiple splice variants can be formed due to inclusion of extra (supplementary) exons from what is classically thought of as hPLP1 intron 1. Thus, splicing of these novel exons (which are not recognized as such in mPlp1 due to lack of conserved splice sites) must utilize factors common to both human and mouse since Oli-neu cells are of mouse origin. PMID:25694552

  3. SeqGL Identifies Context-Dependent Binding Signals in Genome-Wide Regulatory Element Maps.

    PubMed

    Setty, Manu; Leslie, Christina S

    2015-05-01

    Genome-wide maps of transcription factor (TF) occupancy and regions of open chromatin implicitly contain DNA sequence signals for multiple factors. We present SeqGL, a novel de novo motif discovery algorithm to identify multiple TF sequence signals from ChIP-, DNase-, and ATAC-seq profiles. SeqGL trains a discriminative model using a k-mer feature representation together with group lasso regularization to extract a collection of sequence signals that distinguish peak sequences from flanking regions. Benchmarked on over 100 ChIP-seq experiments, SeqGL outperformed traditional motif discovery tools in discriminative accuracy. Furthermore, SeqGL can be naturally used with multitask learning to identify genomic and cell-type context determinants of TF binding. SeqGL successfully scales to the large multiplicity of sequence signals in DNase- or ATAC-seq maps. In particular, SeqGL was able to identify a number of ChIP-seq validated sequence signals that were not found by traditional motif discovery algorithms. Thus compared to widely used motif discovery algorithms, SeqGL demonstrates both greater discriminative accuracy and higher sensitivity for detecting the DNA sequence signals underlying regulatory element maps. SeqGL is available at http://cbio.mskcc.org/public/Leslie/SeqGL/.

  4. MicroRNA-33 regulates sterol regulatory element-binding protein 1 expression in mice

    PubMed Central

    Horie, Takahiro; Nishino, Tomohiro; Baba, Osamu; Kuwabara, Yasuhide; Nakao, Tetsushi; Nishiga, Masataka; Usami, Shunsuke; Izuhara, Masayasu; Sowa, Naoya; Yahagi, Naoya; Shimano, Hitoshi; Matsumura, Shigenobu; Inoue, Kazuo; Marusawa, Hiroyuki; Nakamura, Tomoyuki; Hasegawa, Koji; Kume, Noriaki; Yokode, Masayuki; Kita, Toru; Kimura, Takeshi; Ono, Koh

    2013-01-01

    MicroRNAs (miRs) are small non-protein-coding RNAs that bind to specific mRNAs and inhibit translation or promote mRNA degradation. Recent reports have indicated that miR-33, which is located within the intron of sterol regulatory element-binding protein (SREBP) 2, controls cholesterol homoeostasis and may be a potential therapeutic target for the treatment of atherosclerosis. Here we show that deletion of miR-33 results in marked worsening of high-fat diet-induced obesity and liver steatosis. Using miR-33−/−Srebf1+/− mice, we demonstrate that SREBP-1 is a target of miR-33 and that the mechanisms leading to obesity and liver steatosis in miR-33−/− mice involve enhanced expression of SREBP-1. These results elucidate a novel interaction between SREBP-1 and SREBP-2 mediated by miR-33 in vivo. PMID:24300912

  5. Posttranslational regulatory system for nitrogenase activity in Azospirillum spp.

    PubMed Central

    Fu, H A; Hartmann, A; Lowery, R G; Fitzmaurice, W P; Roberts, G P; Burris, R H

    1989-01-01

    The mechanism for "NH4+ switch-off/on" of nitrogenase activity in Azospirillum brasilense and A. lipoferum was investigated. A correlation was established between the in vivo regulation of nitrogenase activity by NH4Cl or glutamine and the reversible covalent modification of dinitrogenase reductase. Dinitrogenase reductase ADP-ribosyltransferase (DRAT) activity was detected in extracts of A. brasilense with NAD as the donor molecule. Dinitrogenase reductase-activating glycohydrolase (DRAG) activity was present in extracts of both A. brasilense and A. lipoferum. The DRAG activity in A. lipoferum was membrane associated, and it catalyzed the activation of inactive nitrogenase (by covalent modification of dinitrogenase reductase) from both A. lipoferum and Rhodospirillum rubrum. A region homologous to R. rubrum draT and draG was identified in the genomic DNA of A. brasilense as a 12-kilobase EcoRI fragment and in A. lipoferum as a 7-kilobase EcoRI fragment. It is concluded that a posttranslational regulatory system for nitrogenase activity is present in A. brasilense and A. lipoferum and that it operates via ADP-ribosylation of dinitrogenase reductase as it does in R. rubrum. Images PMID:2504694

  6. microRNAs and Alu elements in the p53-Mdm2-Mdm4 regulatory network.

    PubMed

    Hoffman, Yonit; Pilpel, Yitzhak; Oren, Moshe

    2014-06-01

    p53 is a transcription factor that governs numerous stress response pathways within the cell. Maintaining the right levels of p53 is crucial for cell survival and proper cellular homeostasis. The tight regulation of p53 involves many cellular components, most notably its major negative regulators Mdm2 and Mdm4, which maintain p53 protein amount and activity in tight check. microRNAs (miRNAs) are small non-coding RNAs that target specific mRNAs to translational arrest and degradation. miRNAs are also key components of the normal p53 pathway, joining forces with Mdm2 and Mdm4 to maintain proper p53 activity. Here we review the current knowledge of miRNAs targeting Mdm2 and Mdm4, and their importance in different tissues and in pathological states such as cancer. In addition, we address the role of Alu sequences-highly abundant retroelements spread throughout the human genome, and their impact on gene regulation via the miRNA machinery. Alus occupy a significant portion of genes' 3'UTR, and as such they have the potential to impact mRNA regulation. Since Alus are primate-specific, they introduce a new regulatory layer into primate genomes. Alus can influence and alter gene regulation, creating primate-specific cancer-preventive regulatory mechanisms to sustain the transition to longer life span in primates. We review the possible influence of Alu sequences on miRNA functionality in general and specifically within the p53 network.

  7. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De

    2015-01-01

    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  8. Identification of a novel distal regulatory element of the human Neuroglobin gene by the chromosome conformation capture approach.

    PubMed

    Tam, Kin Tung; Chan, Ping Kei; Zhang, Wei; Law, Pui Pik; Tian, Zhipeng; Fung Chan, Godfrey Chi; Philipsen, Sjaak; Festenstein, Richard; Tan-Un, Kian Cheng

    2017-01-09

    Neuroglobin (NGB) is predominantly expressed in the brain and retina. Studies suggest that NGB exerts protective effects to neuronal cells and is implicated in reducing the severity of stroke and Alzheimer's disease. However, little is known about the mechanisms which regulate the cell type-specific expression of the gene. In this study, we hypothesized that distal regulatory elements (DREs) are involved in optimal expression of the NGB gene. By chromosome conformation capture we identified two novel DREs located -70 kb upstream and +100 kb downstream from the NGB gene. ENCODE database showed the presence of DNaseI hypersensitive and transcription factors binding sites in these regions. Further analyses using luciferase reporters and chromatin immunoprecipitation suggested that the -70 kb region upstream of the NGB gene contained a neuronal-specific enhancer and GATA transcription factor binding sites. Knockdown of GATA-2 caused NGB expression to drop dramatically, indicating GATA-2 as an essential transcription factor for the activation of NGB expression. The crucial role of the DRE in NGB expression activation was further confirmed by the drop in NGB level after CRISPR-mediated deletion of the DRE. Taken together, we show that the NGB gene is regulated by a cell type-specific loop formed between its promoter and the novel DRE.

  9. Identification of a novel distal regulatory element of the human Neuroglobin gene by the chromosome conformation capture approach

    PubMed Central

    Tam, Kin Tung; Chan, Ping Kei; Zhang, Wei; Law, Pui Pik; Tian, Zhipeng; Fung Chan, Godfrey Chi; Philipsen, Sjaak; Festenstein, Richard; Tan-Un, Kian Cheng

    2017-01-01

    Neuroglobin (NGB) is predominantly expressed in the brain and retina. Studies suggest that NGB exerts protective effects to neuronal cells and is implicated in reducing the severity of stroke and Alzheimer's disease. However, little is known about the mechanisms which regulate the cell type-specific expression of the gene. In this study, we hypothesized that distal regulatory elements (DREs) are involved in optimal expression of the NGB gene. By chromosome conformation capture we identified two novel DREs located −70 kb upstream and +100 kb downstream from the NGB gene. ENCODE database showed the presence of DNaseI hypersensitive and transcription factors binding sites in these regions. Further analyses using luciferase reporters and chromatin immunoprecipitation suggested that the −70 kb region upstream of the NGB gene contained a neuronal-specific enhancer and GATA transcription factor binding sites. Knockdown of GATA-2 caused NGB expression to drop dramatically, indicating GATA-2 as an essential transcription factor for the activation of NGB expression. The crucial role of the DRE in NGB expression activation was further confirmed by the drop in NGB level after CRISPR-mediated deletion of the DRE. Taken together, we show that the NGB gene is regulated by a cell type-specific loop formed between its promoter and the novel DRE. PMID:27651453

  10. Transpositionally active episomal hAT elements

    PubMed Central

    2009-01-01

    Background hAT elements and V(D)J recombination may have evolved from a common ancestral transposable element system. Extrachromosomal, circular forms of transposable elements (referred to here as episomal forms) have been reported yet their biological significance remains unknown. V(D)J signal joints, which resemble episomal transposable elements, have been considered non-recombinogenic products of V(D)J recombination and a safe way to dispose of excised chromosomal sequences. V(D)J signal joints can, however, participate in recombination reactions and the purpose of this study was to determine if hobo and Hermes episomal elements are also recombinogenic. Results Up to 50% of hobo/Hermes episomes contained two intact, inverted-terminal repeats and 86% of these contained from 1-1000 bp of intercalary DNA. Episomal hobo/Hermes elements were recovered from Musca domestica (a natural host of Hermes), Drosophila melanogaster (a natural host of hobo) and transgenic Drosophila melanogaster and Aedes aegypti (with autonomous Hermes elements). Episomal Hermes elements were recovered from unfertilized eggs of M. domestica and D. melanogaster demonstrating their potential for extrachromosomal, maternal transmission. Reintegration of episomal Hermes elements was observed in vitro and in vivo and the presence of Hermes episomes resulted in lower rates of canonical Hermes transposition in vivo. Conclusion Episomal hobo/Hermes elements are common products of element excision and can be maternally transmitted. Episomal forms of Hermes are capable of integration and also of influencing the transposition of canonical elements suggesting biological roles for these extrachromosomal elements in element transmission and regulation. PMID:20003420

  11. The identification of hematopoietic-specific regulatory elements for WASp gene expression

    PubMed Central

    Zhan, Jun; Johnson, Irudayam Maria; Wielgosz, Matthew; Nienhuis, Arthur W

    2016-01-01

    Chromosome Conformation Capture (3C) technology was used to identify physical interactions between the proximal Wiskott-Aldrich Syndrome protein (WASp) promoter and its distant DNA segments in Jurkat-T cells. We found that two hematopoietic specific DNase I hypersensitive (DHS) sites (proximal DHS-A, and distal DHS-B) which had high interaction frequencies with the proximal WASp promoter indicating potential regulatory activity for these DHS sites. Subsequently, we cloned several DNA fragments around the proximal DHS-A site into a luciferase reporter vector. Interestingly, no fragments showed enhancer activity, but two fragments exhibited strong silencing activity in Jurkat-T cells. After aligning the chromatin state profiling for hematopoietic and nonhematopoietic cells using the human genome browser (UCSC), we found a 5 kb putative hematopoietic specific enhancer region located 250 kb downstream of the WAS gene. This putative enhancer region contains two hematopoietic cell specific DHS sites. Subsequently, the hematopoietic specific DHS sites enhanced luciferase expression from the proximal WASp promoter in all hematopoietic cells we tested. Finally, using a lentiviral vector stable expression system, the hematopoietic specific-enhancer(s) increased GFP reporter gene expression in hematopoietic cells, and increased WASp gene expression in WASp deficient cells. This enhancer may have the potential to be used in gene therapy for hematological diseases. PMID:28035317

  12. Trace element inhibition of phytase activity.

    PubMed

    Santos, T; Connolly, C; Murphy, R

    2015-02-01

    Nowadays, 70 % of global monogastric feeds contains an exogenous phytase. Phytase supplementation has enabled a more efficient utilisation of phytate phosphorous (P) and reduction of P pollution. Trace minerals, such as iron (Fe), zinc (Zn), copper (Cu) and manganese (Mn) are essential for maintaining health and immunity as well as being involved in animal growth, production and reproduction. Exogenous sources of phytase and trace elements are regularly supplemented to monogastric diets and usually combined in a premix. However, the possibility for negative interaction between individual components within the premix is high and is often overlooked. Therefore, this initial study focused on assessing the potential in vitro interaction between inorganic and organic chelated sources of Fe, Zn, Cu and Mn with three commercially available phytase preparations. Additionally, this study has investigated if the degree of enzyme inhibition was dependent of the type of chelated sources. A highly significant relationship between phytase inhibition, trace mineral type as well as mineral source and concentration, p < 0.001 was verified. The proteinate sources of OTMs were consistently and significantly less inhibitory than the majority of the other sources, p < 0.05. This was verified for Escherichia coli and Peniophora lycii phytases for Fe and Zn, as well as for Cu with E. coli and Aspergillus niger phytases. Different chelate trace mineral sources demonstrated diversifying abilities to inhibit exogenous phytase activity.

  13. Identification of regulatory elements that control expression of the tbpBA operon in Neisseria gonorrhoeae.

    PubMed

    Vélez Acevedo, Rosuany N; Ronpirin, Chalinee; Kandler, Justin L; Shafer, William M; Cornelissen, Cynthia Nau

    2014-08-01

    Iron is an essential nutrient for survival and establishment of infection by Neisseria gonorrhoeae. The neisserial transferrin binding proteins (Tbps) comprise a bipartite system for iron acquisition from human transferrin. TbpA is the TonB-dependent transporter that accomplishes iron internalization. TbpB is a surface-exposed lipoprotein that makes the iron uptake process more efficient. Previous studies have shown that the genes encoding these proteins are arranged in a bicistronic operon, with the tbpB gene located upstream of tbpA and separated from it by an inverted repeat. The operon is under the control of the ferric uptake regulator (Fur); however, promoter elements necessary for regulated expression of the genes have not been experimentally defined. In this study, putative regulatory motifs were identified and confirmed by mutagenesis. Further examination of the sequence upstream of these promoter/operator motifs led to the identification of several novel repeats. We hypothesized that these repeats are involved in additional regulation of the operon. Insertional mutagenesis of regions upstream of the characterized promoter region resulted in decreased tbpB and tbpA transcript levels but increased protein levels for both TbpA and TbpB. Using RNA sequencing (RNA-Seq) technology, we determined that a long RNA was produced from the region upstream of tbpB. We localized the 5' endpoint of this transcript to between the two upstream insertions by qualitative RT-PCR. We propose that expression of this upstream RNA leads to optimized expression of the gene products from within the tbpBA operon.

  14. The alr-groEL1 operon in Mycobacterium tuberculosis: an interplay of multiple regulatory elements

    PubMed Central

    Bhat, Aadil H.; Pathak, Deepika; Rao, Alka

    2017-01-01

    Threonylcarbamoyladenosine is a universally conserved essential modification of tRNA that ensures translational fidelity in cellular milieu. TsaD, TsaB and TsaE are identified as tRNA-A37-threonylcarbamoyl (t6A)-transferase enzymes that have been reconstituted in vitro, in few bacteria recently. However, transcriptional organization and regulation of these genes are not known in any of these organisms. This study describes the intricate architecture of a complex multicistronic alr-groEL1 operon, harboring essential genes, namely tsaD, tsaB, tsaE, groES, groEL1, and alr (required for cell wall synthesis), and rimI encoding an N-α- acetyltransferase in Mycobacterium tuberculosis. Using northern blotting, RT-PCR and in vivo fluorescence assays, genes alr to groEL1 were found to constitute an ~6.3 kb heptacistronic operon with multiple internal promoters and an I-shaped intrinsic hairpin-like cis-regulatory element. A strong promoter PtsaD within the coding sequence of rimI gene is identified in M. tuberculosis, in addition. The study further proposes an amendment in the known bicistronic groESL1 operon annotation by providing evidence that groESL1 is co-transcribed as sub-operon of alr-groEL1 operon. The architecture of alr-groEL1 operon, conservation of the genetic context and a mosaic transcriptional profile displayed under various stress conditions convincingly suggest the involvement of this operon in stress adaptation in M. tuberculosis. PMID:28256563

  15. Proteome-wide Structural Analysis of PTM Hotspots Reveals Regulatory Elements Predicted to Impact Biological Function and Disease*

    PubMed Central

    Dewhurst, Henry; Sundararaman, Niveda

    2016-01-01

    Post-translational modifications (PTMs) regulate protein behavior through modulation of protein-protein interactions, enzymatic activity, and protein stability essential in the translation of genotype to phenotype in eukaryotes. Currently, less than 4% of all eukaryotic PTMs are reported to have biological function - a statistic that continues to decrease with an increasing rate of PTM detection. Previously, we developed SAPH-ire (Structural Analysis of PTM Hotspots) - a method for the prioritization of PTM function potential that has been used effectively to reveal novel PTM regulatory elements in discrete protein families (Dewhurst et al., 2015). Here, we apply SAPH-ire to the set of eukaryotic protein families containing experimental PTM and 3D structure data - capturing 1,325 protein families with 50,839 unique PTM sites organized into 31,747 modified alignment positions (MAPs), of which 2010 (∼6%) possess known biological function. Here, we show that using an artificial neural network model (SAPH-ire NN) trained to identify MAP hotspots with biological function results in prediction outcomes that far surpass the use of single hotspot features, including nearest neighbor PTM clustering methods. We find the greatest enhancement in prediction for positions with PTM counts of five or less, which represent 98% of all MAPs in the eukaryotic proteome and 90% of all MAPs found to have biological function. Analysis of the top 1092 MAP hotspots revealed 267 of truly unknown function (containing 5443 distinct PTMs). Of these, 165 hotspots could be mapped to human KEGG pathways for normal and/or disease physiology. Many high-ranking hotspots were also found to be disease-associated pathogenic sites of amino acid substitution despite the lack of observable PTM in the human protein family member. Taken together, these experiments demonstrate that the functional relevance of a PTM can be predicted very effectively by neural network models, revealing a large but testable

  16. The Schizosaccharomyces pombe inv1+ regulatory region is unusually large and contains redundant cis-acting elements that function in a SAGA- and Swi/Snf-dependent fashion.

    PubMed

    Ahn, Sejin; Spatt, Dan; Winston, Fred

    2012-08-01

    The Schizosaccharomyces pombe inv1(+) gene encodes invertase, the enzyme required for hydrolysis of sucrose and raffinose. Transcription of inv1(+) is regulated by glucose levels, with transcription tightly repressed in high glucose and strongly induced in low glucose. To understand this regulation, we have analyzed the inv1(+) cis-regulatory region and the requirement for the trans-acting coactivators SAGA and Swi/Snf. Surprisingly, deletion of the entire 1-kilobase intergenic region between the inv1(+) TATA element and the upstream open reading frame SPCC191.10 does not significantly alter regulation of inv1(+) transcription. However, a longer deletion that extends through SPCC191.10 abolishes inv1(+) induction in low glucose. Additional analysis demonstrates that there are multiple, redundant regulatory regions spread over 1.5 kb 5' of inv1(+), including within SPCC191.10, that can confer glucose-mediated transcriptional regulation to inv1(+). Furthermore, SPCC191.10 can regulate inv1(+) transcription in an orientation-independent fashion and from a distance as great as 3 kb. With respect to trans-acting factors, both SAGA and Swi/Snf are recruited to SPCC191.10 and to other locations in the large inv1(+) regulatory region in a glucose-dependent fashion, and both are required for inv1(+) derepression. Taken together, these results demonstrate that inv1(+) regulation in S. pombe occurs via the use of multiple regulatory elements and that activation can occur over a great distance, even from elements within other open reading frames.

  17. Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

    PubMed Central

    Singh, K K; Samson, L

    1995-01-01

    Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7761422

  18. Regulation of steroid 5-{alpha} reductase type 2 (Srd5a2) by sterol regulatory element binding proteins and statin

    SciTech Connect

    Seo, Young-Kyo; Zhu, Bing; Jeon, Tae-Il; Osborne, Timothy F.

    2009-11-01

    In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.

  19. Gentiana manshurica Kitagawa reverses acute alcohol-induced liver steatosis through blocking sterol regulatory element-binding protein-1 maturation.

    PubMed

    Lian, Li-Hua; Wu, Yan-Ling; Song, Shun-Zong; Wan, Ying; Xie, Wen-Xue; Li, Xin; Bai, Ting; Ouyang, Bing-Qing; Nan, Ji-Xing

    2010-12-22

    This study was undertaken to investigate the protective effects of Gentiana manshurica Kitagawa (GM) on acute alcohol-induced fatty liver. Mice were treated with ethanol (5 g/kg of body weight) by gavage every 12 h for a total of three doses to induce acute fatty liver. Methanol extract of GM (50, 100, or 200 mg/kg) or silymarin (100 mg/kg) was gavaged simultaneously with ethanol for three doses. GM administration significantly reduced the increases in serum ALT and AST levels, the serum and hepatic triglyceride levels, at 4 h after the last ethanol administration. GM was also found to prevent ethanol-induced hepatic steatosis and necrosis, as indicated by liver histopathological studies. Additionally, GM suppressed the elevation of malondialdehyde (MDA) levels, restored the glutathione (GSH) levels, and enhanced the superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPX) activities. The concurrent administration of GM efficaciously abrogated cytochrome P450 2E1 (CYP2E1) induction. Moreover, GM significantly reduced the nuclear translocation of sterol regulatory element-binding protein-1 (nSREBP-1) in ethanol-treated mice. These data indicated that GM possessed the ability to prevent ethanol-induced acute liver steatosis, possibly through blocking CYP2E1-mediated free radical scavenging effects and SREBP-1-regulated fatty acid synthesis. Especially, GM may be developed as a potential therapeutic candidate for ethanol-induced oxidative damage in liver.

  20. Expression of the CDR1 efflux pump in clinical Candida albicans isolates is controlled by a negative regulatory element

    SciTech Connect

    Gaur, Naseem Akhtar; Manoharlal, Raman; Saini, Preeti; Prasad, Tulika; Mukhopadhyay, Gauranga; Hoefer, Milan; Morschhaeuser, Joachim; Prasad, Rajendra . E-mail: rp47@hotmail.com

    2005-06-24

    Resistance to azole antifungal drugs in clinical isolates of the human fungal pathogen Candida albicans is often caused by constitutive overexpression of the CDR1 gene, which encodes a multidrug efflux pump of the ABC transporter superfamily. To understand the relevance of a recently identified negative regulatory element (NRE) in the CDR1 promoter for the control of CDR1 expression in the clinical scenario, we investigated the effect of mutation or deletion of the NRE on CDR1 expression in two matched pairs of azole-sensitive and resistant clinical isolates of C. albicans. Expression of GFP or lacZ reporter genes from the wild type CDR1 promoter was much higher in the azole-resistant C. albicans isolates than in the azole-susceptible isolates, reflecting the known differences in CDR1 expression in these strains. Deletion or mutation of the NRE resulted in enhanced reporter gene expression in azole-sensitive strains, but did not further increase the already high CDR1 promoter activity in the azole-resistant strains. In agreement with these findings, electrophoretic mobility shift assays showed a reduced binding to the NRE of nuclear extracts from the resistant C. albicans isolates as compared with extracts from the sensitive isolates. These results demonstrate that the NRE is involved in maintaining CDR1 expression at basal levels and that this repression is overcome in azole-resistant clinical C. albicans isolates, resulting in constitutive CDR1 overexpression and concomitant drug resistance.

  1. Forkhead transcription factor 1 inhibits endometrial cancer cell proliferation via sterol regulatory element-binding protein 1

    PubMed Central

    Zhang, Yifang; Zhang, Lili; Sun, Hengzi; Lv, Qingtao; Qiu, Chunping; Che, Xiaoxia; Liu, Zhiming; Jiang, Jie

    2017-01-01

    The morbidity and mortality associated with endometrial cancer (EC) has increased in recent years. Regarded as a tumor suppressor, forkhead transcription factor 1 (FOXO1) has various biological activities and participates in cell cycle progression, apoptosis and differentiation. Notably, FOXO1 also functions in the regulation of lipogenesis and energy metabolism. Lipogenesis is a feature of cancer and is upregulated in EC. Sterol regulatory element-binding protein 1 (SREBP1) is a transcription factor that is also able to regulate lipogenesis. Increased expression of SREBP1 is directly correlated with malignant transformation of tumors. A previous study demonstrated that SREBP1 was highly expressed in EC and directly resulted in tumorigenesis. However, the association between FOXO1 and SREBP1 in EC is not clear. In the present study, lentiviruses overexpressing FOXO1 were used in cell transfection and transduction. Cell viability assays demonstrated that the overexpression of FOXO1 was able to suppress cell proliferation significantly in Ishikawa and AN3 CA cell lines. In addition, FOXO1 overexpression significantly inhibited cell migration and invasion ability in vitro. In xenograft models, overexpression of FOXO1 suppressed cell tumorigenesis, and western blot analysis demonstrated that SREBP1 expression was markedly reduced in the FOXO1-overexpressing cells. It may therefore be concluded that FOXO1 is able to inhibit the proliferative capacity of cells in vitro and in vivo, in addition to the migratory and invasive capacities in vitro by directly targeting SREBP1. PMID:28356952

  2. MAP kinases Erk1/2 phosphorylate sterol regulatory element-binding protein (SREBP)-1a at serine 117 in vitro.

    PubMed

    Roth, G; Kotzka, J; Kremer, L; Lehr, S; Lohaus, C; Meyer, H E; Krone, W; Müller-Wieland, D

    2000-10-27

    Sterol regulatory element-binding protein (SREBP)-1a is a transcription factor sensing cellular cholesterol levels and integrating gene regulatory signals mediated by MAP kinase cascades. Here we report the identification of serine 117 in SREBP-1a as the major phosphorylation site of the MAP kinases Erk1/2. This site was identified by nanoelectrospray mass spectrometry and peptide sequencing of recombinant fusion proteins phosphorylated by Erk1/2 in vitro. Serine 117 was verified as the major phosphorylation site by in vitro mutagenesis. Mutation of serine 117 to alanine abolished Erk2-mediated phosphorylation in vitro and the MAP kinase-related transcriptional activation of SREBP-1a by insulin and platelet-derived growth factor in vivo. Our data indicate that the MAP kinase-mediated effects on SREBP-1a-regulated target genes are linked to this phosphorylation site.

  3. cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice.

    PubMed

    Sharif, K A; Li, C; Gudas, L J

    2001-05-01

    The LAMB1 gene encodes the laminin beta1 subunit of laminin, an extracellular matrix protein. Using several transgenic mouse lines containing various lengths of the LAMB1 promoter driving lacZ reporter gene expression, regions of LAMB1 promoter that contain cis-acting DNA regulatory element(s) have been identified. The 3.9LAMB1betagal transgene is expressed in various tissues during development. LAMB1 transgene expression is observed in a selective set of nephrons of the neonatal and adult kidneys. The cis-acting DNA regulatory elements responsible for LAMB1 transgene expression in ovaries and in juvenile kidneys are present between -'1.4 and -0.7 kb relative to the transcription start site, while those of adult kidneys are located between -2.5 and -1.4 kb. The LAMB1 transgene is also expressed in the epididymis of 1 week old transgenic mice. Mutation of the retinoic acid response element (RARE) in the context of the 3.9LAMB1betagal transgene results in loss of LAMB1 transgene expression in all tissues. Thus, sequences between -2.5 and -0.7 kb plus the RARE are required for appropriate expression of the LAMB1 transgene in mice.

  4. Characterization of a disease-associated mutation affecting a putative splicing regulatory element in intron 6b of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.

    PubMed

    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M Cristina

    2009-10-30

    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as "splicing mutations," but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002-1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5'- and 3'-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002-1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75.

  5. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.

    1995-10-10

    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  6. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.

    2015-01-01

    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  7. Integrated methylome and transcriptome analysis reveals novel regulatory elements in pediatric acute lymphoblastic leukemia

    PubMed Central

    Almamun, Md; Levinson, Benjamin T; van Swaay, Annette C; Johnson, Nathan T; McKay, Stephanie D; Arthur, Gerald L; Davis, J Wade; Taylor, Kristen H

    2015-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer diagnosed in children under the age of 15. In addition to genetic aberrations, epigenetic modifications such as DNA methylation are altered in cancer and impact gene expression. To identify epigenetic alterations in ALL, genome-wide methylation profiles were generated using the methylated CpG island recovery assay followed by next-generation sequencing. More than 25,000 differentially methylated regions (DMR) were observed in ALL patients with ∼90% present within intronic or intergenic regions. To determine the regulatory potential of the DMR, whole-transcriptome analysis was performed and integrated with methylation data. Aberrant promoter methylation was associated with the altered expression of genes involved in transcriptional regulation, apoptosis, and proliferation. Novel enhancer-like sequences were identified within intronic and intergenic DMR. Aberrant methylation in these regions was associated with the altered expression of neighboring genes involved in cell cycle processes, lymphocyte activation and apoptosis. These genes include potential epi-driver genes, such as SYNE1, PTPRS, PAWR, HDAC9, RGCC, MCOLN2, LYN, TRAF3, FLT1, and MELK, which may provide a selective advantage to leukemic cells. In addition, the differential expression of epigenetic modifier genes, pseudogenes, and non-coding RNAs was also observed accentuating the role of erroneous epigenetic gene regulation in ALL. PMID:26308964

  8. BOX DNA: a novel regulatory element related to embryonal carcinoma cell differentiation.

    PubMed Central

    Kihara-Negishi, F; Tsujita, R; Negishi, Y; Ariga, H

    1993-01-01

    BOX DNA was previously isolated from the DNA sequence inserted in the enhancer B domain of mutant polyomavirus (fPyF9) DNA. We also reported that BOX DNA functioned negatively on DNA replication and transcription of another polyomavirus mutant (PyhrN2) in F9-28 cells, a subclone of mouse F9 embryonal carcinoma (EC) cells expressing the polyomavirus large T antigen. In this study, we demonstrate that BOX DNA enhances transcription from the thymidine kinase (TK) promoter in various EC cells. One or three copies of BOX DNA, linked to the bacterial chloramphenicol acetyltransferase gene under the control of the herpes simplex virus TK promoter, activated promoter activity in F9, P19, and ECA2 cells. Band shift assays using BOX DNA as a probe revealed that specific binding proteins were present in all EC cells examined; the patterns of BOX DNA-protein complexes were the same among them. A mutation introduced within BOX DNA abolished enhancer activity as well as the formation of specific DNA-protein complexes. In non-EC cells, including L and BALB/3T3 cells, the enhancer activity of BOX DNA on the TK promoter was not observed, although binding proteins specific to the sequence exist. In band shift assays, the patterns of the DNA-protein complexes of either L or BALB/3T3 cells were different from those of EC cells. Furthermore, the enhancer activity of BOX DNA decreased upon differentiation induction in all EC cells examined, of different origins and distinct differentiation ability. In parallel with the loss of enhancer activity, the binding proteins specific for BOX DNA decreased in these cells. Moreover, we cloned a genomic DNA of F9, termed BOXF1, containing BOX DNA sequence approximately 400 bp upstream from the RNA start site of the gene. BOXF1, containing a TATA-like motif and the binding elements for Sp1 and Oct in addition to BOX DNA, possessed promoter activity deduced by a BOXF1-chloramphenicol acetyltransferase construct. Deletion analyses of the construct

  9. Wnt-mediated activation of NeuroD1 and retro-elements during adult neurogenesis.

    PubMed

    Kuwabara, Tomoko; Hsieh, Jenny; Muotri, Alysson; Yeo, Gene; Warashina, Masaki; Lie, Dieter Chichung; Moore, Lynne; Nakashima, Kinichi; Asashima, Makoto; Gage, Fred H

    2009-09-01

    In adult hippocampus, new neurons are continuously generated from neural stem cells (NSCs), but the molecular mechanisms regulating adult neurogenesis remain elusive. We found that Wnt signaling, together with the removal of Sox2, triggered the expression of NeuroD1 in mice. This transcriptional regulatory mechanism was dependent on a DNA element containing overlapping Sox2 and T-cell factor/lymphoid enhancer factor (TCF/LEF)-binding sites (Sox/LEF) in the promoter. Notably, Sox/LEF sites were also found in long interspersed nuclear element 1 (LINE-1) elements, consistent with their critical roles in the transition of NSCs to proliferating neuronal progenitors. Our results describe a previously unknown Wnt-mediated regulatory mechanism that simultaneously coordinates activation of NeuroD1 and LINE-1, which is important for adult neurogenesis and survival of neuronal progenitors. Moreover, the discovery that LINE-1 retro-elements embedded in the mammalian genome can function as bi-directional promoters suggests that Sox/LEF regulatory sites may represent a general mechanism, at least in part, for relaying environmental signals to other nearby loci to promote adult hippocampal neurogenesis.

  10. Polarized regulatory landscape and Wnt responsiveness underlie Hox activation in embryos

    PubMed Central

    Amin, Shilu; van Rooijen, Carina; Tan, Sander; Creyghton, Menno P.; de Laat, Wouter; Deschamps, Jacqueline

    2016-01-01

    Sequential 3′-to-5′ activation of the Hox gene clusters in early embryos is a most fascinating issue in developmental biology. Neither the trigger nor the regulatory elements involved in the transcriptional initiation of the 3′-most Hox genes have been unraveled in any organism. We demonstrate that a series of enhancers, some of which are Wnt-dependent, is located within a HoxA 3′ subtopologically associated domain (subTAD). This subTAD forms the structural basis for multiple layers of 3′-polarized features, including DNA accessibility and enhancer activation. Deletion of the cassette of Wnt-dependent enhancers proves its crucial role in initial transcription of HoxA at the 3′ side of the cluster. PMID:27633012

  11. Polarized regulatory landscape and Wnt responsiveness underlie Hox activation in embryos.

    PubMed

    Neijts, Roel; Amin, Shilu; van Rooijen, Carina; Tan, Sander; Creyghton, Menno P; de Laat, Wouter; Deschamps, Jacqueline

    2016-09-01

    Sequential 3'-to-5' activation of the Hox gene clusters in early embryos is a most fascinating issue in developmental biology. Neither the trigger nor the regulatory elements involved in the transcriptional initiation of the 3'-most Hox genes have been unraveled in any organism. We demonstrate that a series of enhancers, some of which are Wnt-dependent, is located within a HoxA 3' subtopologically associated domain (subTAD). This subTAD forms the structural basis for multiple layers of 3'-polarized features, including DNA accessibility and enhancer activation. Deletion of the cassette of Wnt-dependent enhancers proves its crucial role in initial transcription of HoxA at the 3' side of the cluster.

  12. 76 FR 18165 - Request for Public Comments Concerning Regulatory Cooperation Activities That Would Help...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-01

    ... International Trade Administration Request for Public Comments Concerning Regulatory Cooperation Activities That... notice on regulatory cooperation activities in North America. The comment period is extended to April 18... cooperation activities to undertake which will support the President's National Export Initiative and serve...

  13. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1.

    PubMed Central

    Van Lint, C; Ghysdael, J; Paras, P; Burny, A; Verdin, E

    1994-01-01

    Analysis of the chromatin organization of the integrated human immunodeficiency virus type 1 (HIV-1) genome has previously revealed a major constitutive DNase I-hypersensitive site associated with the pol gene (E. Verdin, J. Virol. 65:6790-6799, 1991). In the present report, high-resolution mapping of this site with DNase I and micrococcal nuclease identified a nucleosome-free region centered around nucleotides (nt) 4490 to 4766. A 500-bp fragment encompassing this hypersensitive site (nt 4481 to 4982) exhibited transcription-enhancing activity (two- to threefold) when it was cloned in its natural position with respect to the HIV-1 promoter after transient transfection in U937 and CEM cells. Using in vitro footprinting and gel shift assays, we have identified four distinct binding sites for nuclear proteins within this positive regulatory element. Site B (nt 4519 to 4545) specifically bound four distinct nuclear protein complexes: a ubiquitous factor, a T-cell-specific factor, a B-cell-specific factor, and the monocyte/macrophage- and B-cell-specific transcription factor PU.1/Spi-1. In most HIV-1 isolates in which this PU box was not conserved, it was replaced by a binding site for the related factor Ets1. Factors binding to site C (nt 4681 to 4701) had a DNA-binding specificity similar to that of factors binding to site B, except for PU.1/Spi-1. A GC box containing a binding site for Sp1 was identified (nt 4623 to 4631). Site D (nt 4816 to 4851) specifically bound a ubiquitously expressed factor. These results identify a transcriptional regulatory element associated with a nuclease-hypersensitive site in the pol gene of HIV-1 and suggest that its activity may be controlled by a complex interplay of cis-regulatory elements. Images PMID:8139041

  14. A novel positive regulatory element for exfoliative toxin A gene expression in Staphylococcus aureus.

    PubMed

    Sakurai, Susumu; Suzuki, Hitoshi; Hata, Toshiaki; Yoshizawa, Yukio; Nakayama, Ritsuko; Machida, Katsuhiko; Masuda, Shogo; Tsukiyama, Takashi

    2004-04-01

    A 1.4 kb positive regulatory element (ETA(exp)) that controls staphylococcal exfoliative toxin A (sETA) transcription was cloned from Staphylococcus aureus. ETA(exp) is located upstream of the cloned 5.8 kb eta gene (etaJ1) obtained from the chomosomal DNA of S. aureus ZM, the standard ETA-producing strain. The cETA prepared from an Escherichia coli transformant into which the recombinant plasmid petaJ1 (5.8 kb eta/pUC9) had been introduced was expressed at high levels in the culture supernatant and the ammonium-sulfate-precipitated culture supernatant fraction as shown by immunoblotting and the single radial immunodiffusion test. However, cETA produced by the recombinant plasmid petaJ3 containing the 1.7 kb eta sequence (etaJ3) with a 1.45 kb ETA(exp)-deficient eta fragment (1.7 kb eta/pUC9) obtained from the 5.8 kb eta sequence by subcloning was not detected in either the culture supernatant or the ammonium-sulfate-precipitated culture supernatant fraction (167-fold concentrate of the culture supernatant) by immunoblotting or the single radial immunodiffusion test. A large amount of cETA was produced by the 1.7 kb eta sequence when it was linked to ETA(exp) amplified by PCR (1.7 kb eta-ETA(exp)/pUC9), regardless of the orientation of ETA(exp) insertion. Northern blot hybridization showed lower levels of the transcripts of the 1.7 kb eta sequence than of the 5.8 kb eta sequence. The rsETA prepared from an S. aureus transformant into which the recombinant plasmid 3.4 kb eta-ETA(exp)/pYT3 (pYT3-etaJ6) had been introduced was expressed at high levels in the culture supernatant fraction as shown by the latex agglutination test. However, the agglutination titre in the culture supernatant fraction of rsETA produced by the recombinant plasmid (1.7 kb eta/pYT3) containing the 1.7 kb eta sequence carrying the 1.4 kb ETA(exp)-deficient eta fragment (pYT3-etaJ3) was 2500-4000 times lower than that of pYT3-etaJ6.

  15. Integration of distinct intracellular signaling pathways at distal regulatory elements directs T-bet expression in human CD4+ T cells.

    PubMed

    Placek, Katarzyna; Gasparian, Sona; Coffre, Maryaline; Maiella, Sylvie; Sechet, Emmanuel; Bianchi, Elisabetta; Rogge, Lars

    2009-12-15

    T-bet is a key regulator controlling Th1 cell development. This factor is not expressed in naive CD4(+) T cells, and the mechanisms controlling expression of T-bet are incompletely understood. In this study, we defined regulatory elements at the human T-bet locus and determined how signals originating at the TCR and at cytokine receptors are integrated to induce chromatin modifications and expression of this gene during human Th1 cell differentiation. We found that T cell activation induced two strong DNase I-hypersensitive sites (HS) and rapid histone acetylation at these elements in CD4(+) T cells. Histone acetylation and T-bet expression were strongly inhibited by cyclosporine A, and we detected binding of NF-AT to a HS in vivo. IL-12 and IFN-gamma signaling alone were not sufficient to induce T-bet expression in naive CD4(+) T cells, but enhanced T-bet expression in TCR/CD28-stimulated cells. We detected a third HS 12 kb upstream of the mRNA start site only in developing Th1 cells, which was bound by IL-12-induced STAT4. Our data suggest that T-bet locus remodeling and gene expression are initiated by TCR-induced NF-AT recruitment and amplified by IL-12-mediated STAT4 binding to distinct distal regulatory elements during human Th1 cell differentiation.

  16. Gene-specific factors determine mitotic expression and bookmarking via alternate regulatory elements

    PubMed Central

    Arampatzi, Panagiota; Gialitakis, Manolis; Makatounakis, Takis; Papamatheakis, Joseph

    2013-01-01

    Transcriptional silencing during mitosis is caused by inactivation of critical transcriptional regulators and/or chromatin condensation. Inheritance of gene expression patterns through cell division involves various bookmarking mechanisms. In this report, we have examined the mitotic and post-mitotic expression of the DRA major histocompatibility class II (MHCII) gene in different cell types. During mitosis the constitutively MHCII-expressing B lymphoblastoid cells showed sustained occupancy of the proximal promoter by the cognate enhanceosome and general transcription factors. In contrast, although mitotic epithelial cells were depleted of these proteins irrespectively of their MHCII transcriptional activity, a distal enhancer selectively recruited the PP2A phosphatase via NFY and maintained chromatin accessibility. Based on our data, we propose a novel chromatin anti-condensation role for this element in mitotic bookmarking and timing of post-mitotic transcriptional reactivation. PMID:23303784

  17. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii

    PubMed Central

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-01-01

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  18. Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

    DOE PAGES

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...

    2016-03-26

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

  19. Differential contribution of cis-regulatory elements to higher order chromatin structure and expression of the CFTR locus

    PubMed Central

    Yang, Rui; Kerschner, Jenny L.; Gosalia, Nehal; Neems, Daniel; Gorsic, Lidija K.; Safi, Alexias; Crawford, Gregory E.; Kosak, Steven T.; Leir, Shih-Hsing; Harris, Ann

    2016-01-01

    Higher order chromatin structure establishes domains that organize the genome and coordinate gene expression. However, the molecular mechanisms controlling transcription of individual loci within a topological domain (TAD) are not fully understood. The cystic fibrosis transmembrane conductance regulator (CFTR) gene provides a paradigm for investigating these mechanisms. CFTR occupies a TAD bordered by CTCF/cohesin binding sites within which are cell-type-selective cis-regulatory elements for the locus. We showed previously that intronic and extragenic enhancers, when occupied by specific transcription factors, are recruited to the CFTR promoter by a looping mechanism to drive gene expression. Here we use a combination of CRISPR/Cas9 editing of cis-regulatory elements and siRNA-mediated depletion of architectural proteins to determine the relative contribution of structural elements and enhancers to the higher order structure and expression of the CFTR locus. We found the boundaries of the CFTR TAD are conserved among diverse cell types and are dependent on CTCF and cohesin complex. Removal of an upstream CTCF-binding insulator alters the interaction profile, but has little effect on CFTR expression. Within the TAD, intronic enhancers recruit cell-type selective transcription factors and deletion of a pivotal enhancer element dramatically decreases CFTR expression, but has minor effect on its 3D structure. PMID:26673704

  20. Identification of gene co-regulatory modules and associated cis-elements involved in degenerative heart disease

    PubMed Central

    2009-01-01

    Background Cardiomyopathies, degenerative diseases of cardiac muscle, are among the leading causes of death in the developed world. Microarray studies of cardiomyopathies have identified up to several hundred genes that significantly alter their expression patterns as the disease progresses. However, the regulatory mechanisms driving these changes, in particular the networks of transcription factors involved, remain poorly understood. Our goals are (A) to identify modules of co-regulated genes that undergo similar changes in expression in various types of cardiomyopathies, and (B) to reveal the specific pattern of transcription factor binding sites, cis-elements, in the proximal promoter region of genes comprising such modules. Methods We analyzed 149 microarray samples from human hypertrophic and dilated cardiomyopathies of various etiologies. Hierarchical clustering and Gene Ontology annotations were applied to identify modules enriched in genes with highly correlated expression and a similar physiological function. To discover motifs that may underly changes in expression, we used the promoter regions for genes in three of the most interesting modules as input to motif discovery algorithms. The resulting motifs were used to construct a probabilistic model predictive of changes in expression across different cardiomyopathies. Results We found that three modules with the highest degree of functional enrichment contain genes involved in myocardial contraction (n = 9), energy generation (n = 20), or protein translation (n = 20). Using motif discovery tools revealed that genes in the contractile module were found to contain a TATA-box followed by a CACC-box, and are depleted in other GC-rich motifs; whereas genes in the translation module contain a pyrimidine-rich initiator, Elk-1, SP-1, and a novel motif with a GCGC core. Using a naïve Bayes classifier revealed that patterns of motifs are statistically predictive of expression patterns, with odds ratios of 2

  1. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    PubMed

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan.

  2. Segregation of cardiac and skeletal muscle-specific regulatory elements of the beta-myosin heavy chain gene.

    PubMed Central

    Rindt, H; Knotts, S; Robbins, J

    1995-01-01

    The beta-myosin heavy chain (beta-MyHC) gene is expressed in cardiac and slow skeletal muscles. To examine the regulatory sequences that are required for the gene's expression in the two compartments in vivo, we analyzed the expression pattern of a transgene consisting of the beta-MyHC gene 5' upstream region linked to the chloramphenicol acetyltransferase reporter gene. By using 5600 bp of 5' upstream region, the transgene was expressed at high levels in the slow skeletal muscles. Decreased levels of thyroid hormone led to the up-regulation of the transgene in both cardiac and skeletal muscles, mimicking the behavior of the endogenous beta-MyHC gene. After deleting the distal 5000 bp, the level of reporter gene expression was strongly reduced. However, decreased levels of thyroid hormone led to an 80-fold skeletal muscle-specific increase in transgene expression, even upon the ablation of a conserved cis-regulatory element termed MCAT, which under normal (euthyroid) conditions abolishes muscle-specific expression. In contrast, cardiac-specific induction was not detected with the deletion construct. These observations indicate that the cardiac and skeletal muscle regulatory elements can be functionally segregated on the beta-MyHC gene promoter. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7878016

  3. Segregation of cardiac and skeletal muscle-specific regulatory elements of the beta-myosin heavy chain gene.

    PubMed

    Rindt, H; Knotts, S; Robbins, J

    1995-02-28

    The beta-myosin heavy chain (beta-MyHC) gene is expressed in cardiac and slow skeletal muscles. To examine the regulatory sequences that are required for the gene's expression in the two compartments in vivo, we analyzed the expression pattern of a transgene consisting of the beta-MyHC gene 5' upstream region linked to the chloramphenicol acetyltransferase reporter gene. By using 5600 bp of 5' upstream region, the transgene was expressed at high levels in the slow skeletal muscles. Decreased levels of thyroid hormone led to the up-regulation of the transgene in both cardiac and skeletal muscles, mimicking the behavior of the endogenous beta-MyHC gene. After deleting the distal 5000 bp, the level of reporter gene expression was strongly reduced. However, decreased levels of thyroid hormone led to an 80-fold skeletal muscle-specific increase in transgene expression, even upon the ablation of a conserved cis-regulatory element termed MCAT, which under normal (euthyroid) conditions abolishes muscle-specific expression. In contrast, cardiac-specific induction was not detected with the deletion construct. These observations indicate that the cardiac and skeletal muscle regulatory elements can be functionally segregated on the beta-MyHC gene promoter.

  4. Origins of Cdx1 regulatory elements suggest roles in vertebrate evolution.

    PubMed

    Gaunt, Stephen J; Paul, Yu-Lee

    2011-01-01

    Cdx1, an upstream regulator of Hox genes, is best characterized for its homeotic effects upon the developing axial skeleton, particularly in the neck. It responds to retinoic acid (RA) in both mouse embryos and embryonal carcinoma (EC) cells. By use of beta-galactosidase chemiluminescence, we show that a mouse Cdx1/lacZ reporter expressed in P19 EC cells responds to RA by the combined activities of an intron retinoic acid response element (RARE) and an upstream RARE. In contrast, a chicken Cdx1/lacZ reporter responds only by activity of the intron RARE. Database analyses upon Cdx1 from twenty three vertebrate species reveal that the intron RARE is structurally conserved in amniotes (eutherian mammals, marsupials, birds and Anole lizard), but not in Xenopus or fish. The upstream RARE is structurally conserved only in eutherian mammals. We conclude that the intron RARE originated at around the amphibian/amniote division, and the upstream RARE appeared around the marsupial/eutherian mammal division. In view of the site of action of Cdx1, we propose that acquisition of the intron RARE may have facilitated the substantial changes that occurred in the neck and anterior thorax at the advent of the amniotes. We present evidence that Cdx1 is also a developmental regulator of the female urogenital system, and we suggest that acquisition of the upstream RARE may have contributed to morphological divergence of marsupial and eutherian mammals.

  5. Long-range DNase I hypersensitivity mapping reveals the imprinted Igf2r and Air promoters share cis-regulatory elements

    PubMed Central

    Pauler, Florian M.; Stricker, Stefan H.; Warczok, Katarzyna E.; Barlow, Denise P.

    2005-01-01

    Epigenetic mechanisms restrict the expression of imprinted genes to one parental allele in diploid cells. At the Igf2r/Air imprinted cluster on mouse chromosome 17, paternal-specific expression of the Air noncoding RNA has been shown to silence three genes in cis: Igf2r, Slc22a2, and Slc22a3. By an unbiased mapping of DNase I hypersensitive sites (DHS) in a 192-kb region flanking Igf2r and Air, we identified 21 DHS, of which nine mapped to evolutionarily conserved sequences. Based on the hypothesis that silencing effects of Air would be directed towards cis regulatory elements used to activate genes, DHS are potential key players in the control of imprinted expression. However, in this 192-kb region only the two DHS mapping to the Igf2r and Air promoters show parental specificity. The remaining 19 DHS were present on both parental alleles and, thus, have the potential to activate Igf2r on the maternal allele and Air on the paternal allele. The possibility that the Igf2r and Air promoters share the same cis-acting regulatory elements, albeit on opposite parental chromosomes, was supported by the similar expression profiles of Igf2r and Air in vivo. These results refine our understanding of the onset of imprinted silencing at this cluster and indicate the Air noncoding RNA may specifically target silencing to the Igf2r promoter. PMID:16204191

  6. Identification of positive and negative regulatory elements involved in the retinoic acid/cAMP induction of Fgf-3 transcription in F9 cells.

    PubMed Central

    Murakami, A; Grinberg, D; Thurlow, J; Dickson, C

    1993-01-01

    The proto-oncogene Fgf-3 has been implicated as an important signalling molecule in vertebrate development. In the mouse, it is expressed for a limited time at a multitude of sites from embryonic day 7 to birth. Transcription of Fgf-3 initiates at three promoter regions resulting in the generation of various mRNAs which nevertheless all encode the same protein products. A 1.7kb DNA fragment which encompasses these regions was joined to the CAT reporter gene and shown to function as a promoter in embryonal carcinoma cells. In stable transfectants the promoter retains its retinoic acid inducibility, initiating transcription at the same cap-sites as the endogenous gene. In differentiated F9 cells, transient transfection of progressive and targeted deletion mutants of the promoter region has revealed at least two positive and three negative regulatory elements. With one exception, loss of these elements was shown to dramatically affect promoter activity in stable transfectants of F9 cells. However the promoter remained inducible by retinoic acid to differing degrees, apart from deletions encompassing PS-4A which essentially abolished promoter activity in both undifferentiated and differentiated cells. The sequences of these potential regulatory regions were further defined using DNase-I footprinting, revealing some similarities to consensus binding sites for known transcription factors. Images PMID:8265348

  7. Oncogenes Activate an Autonomous Transcriptional Regulatory Circuit That Drives Glioblastoma.

    PubMed

    Singh, Dinesh K; Kollipara, Rahul K; Vemireddy, Vamsidara; Yang, Xiao-Li; Sun, Yuxiao; Regmi, Nanda; Klingler, Stefan; Hatanpaa, Kimmo J; Raisanen, Jack; Cho, Steve K; Sirasanagandla, Shyam; Nannepaga, Suraj; Piccirillo, Sara; Mashimo, Tomoyuki; Wang, Shan; Humphries, Caroline G; Mickey, Bruce; Maher, Elizabeth A; Zheng, Hongwu; Kim, Ryung S; Kittler, Ralf; Bachoo, Robert M

    2017-01-24

    Efforts to identify and target glioblastoma (GBM) drivers have primarily focused on receptor tyrosine kinases (RTKs). Clinical benefits, however, have been elusive. Here, we identify an SRY-related box 2 (SOX2) transcriptional regulatory network that is independent of upstream RTKs and capable of driving glioma-initiating cells. We identified oligodendrocyte lineage transcription factor 2 (OLIG2) and zinc-finger E-box binding homeobox 1 (ZEB1), which are frequently co-expressed irrespective of driver mutations, as potential SOX2 targets. In murine glioma models, we show that different combinations of tumor suppressor and oncogene mutations can activate Sox2, Olig2, and Zeb1 expression. We demonstrate that ectopic co-expression of the three transcription factors can transform tumor-suppressor-deficient astrocytes into glioma-initiating cells in the absence of an upstream RTK oncogene. Finally, we demonstrate that the transcriptional inhibitor mithramycin downregulates SOX2 and its target genes, resulting in markedly reduced proliferation of GBM cells in vivo.

  8. A Regulatory Model of Governmental Coordinating Activities in the Higher Education Sector.

    ERIC Educational Resources Information Center

    Thompson, Fred; Zumeta, William

    1981-01-01

    Compares governmental coordinating activities in the higher education sector with regulatory governmental activities in other industries. Findings indicated that a great percentage of regulatory policies in higher education are based on industrial organization theory-based prescriptive models. The inappropriateness of these policies for higher…

  9. Chromatin Heterogeneity and Distribution of Regulatory Elements in the Late-Replicating Intercalary Heterochromatin Domains of Drosophila melanogaster Chromosomes

    PubMed Central

    Khoroshko, Varvara A.; Levitsky, Viktor G.; Zykova, Tatyana Yu.; Antonenko, Oksana V.; Belyaeva, Elena S.; Zhimulev, Igor F.

    2016-01-01

    Late-replicating domains (intercalary heterochromatin) in the Drosophila genome display a number of features suggesting their organization is quite unique. Typically, they are quite large and encompass clusters of functionally unrelated tissue-specific genes. They correspond to the topologically associating domains and conserved microsynteny blocks. Our study aims at exploring further details of molecular organization of intercalary heterochromatin and has uncovered surprising heterogeneity of chromatin composition in these regions. Using the 4HMM model developed in our group earlier, intercalary heterochromatin regions were found to host chromatin fragments with a particular epigenetic profile. Aquamarine chromatin fragments (spanning 0.67% of late-replicating regions) are characterized as a class of sequences that appear heterogeneous in terms of their decompactization. These fragments are enriched with enhancer sequences and binding sites for insulator proteins. They likely mark the chromatin state that is related to the binding of cis-regulatory proteins. Malachite chromatin fragments (11% of late-replicating regions) appear to function as universal transitional regions between two contrasting chromatin states. Namely, they invariably delimit intercalary heterochromatin regions from the adjacent active chromatin of interbands. Malachite fragments also flank aquamarine fragments embedded in the repressed chromatin of late-replicating regions. Significant enrichment of insulator proteins CP190, SU(HW), and MOD2.2 was observed in malachite chromatin. Neither aquamarine nor malachite chromatin types appear to correlate with the positions of highly conserved non-coding elements (HCNE) that are typically replete in intercalary heterochromatin. Malachite chromatin found on the flanks of intercalary heterochromatin regions tends to replicate earlier than the malachite chromatin embedded in intercalary heterochromatin. In other words, there exists a gradient of

  10. 17 CFR 1.59 - Activities of self-regulatory organization employees, governing board members, committee members...

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 17 Commodity and Securities Exchanges 1 2011-04-01 2011-04-01 false Activities of self-regulatory... COMMODITY EXCHANGE ACT Miscellaneous § 1.59 Activities of self-regulatory organization employees, governing...) Self-regulatory organization means “self-regulatory organization,” as defined in Commission...

  11. Arenavirus nucleoprotein targets interferon regulatory factor-activating kinase IKKε.

    PubMed

    Pythoud, Christelle; Rodrigo, W W Shanaka I; Pasqual, Giulia; Rothenberger, Sylvia; Martínez-Sobrido, Luis; de la Torre, Juan Carlos; Kunz, Stefan

    2012-08-01

    Arenaviruses perturb innate antiviral defense by blocking induction of type I interferon (IFN) production. Accordingly, the arenavirus nucleoprotein (NP) was shown to block activation and nuclear translocation of interferon regulatory factor 3 (IRF3) in response to virus infection. Here, we sought to identify cellular factors involved in innate antiviral signaling targeted by arenavirus NP. Consistent with previous studies, infection with the prototypic arenavirus lymphocytic choriomeningitis virus (LCMV) prevented phosphorylation of IRF3 in response to infection with Sendai virus, a strong inducer of the retinoic acid-inducible gene I (RIG-I)/mitochondrial antiviral signaling (MAVS) pathway of innate antiviral signaling. Using a combination of coimmunoprecipitation and confocal microscopy, we found that LCMV NP associates with the IκB kinase (IKK)-related kinase IKKε but that, rather unexpectedly, LCMV NP did not bind to the closely related TANK-binding kinase 1 (TBK-1). The NP-IKKε interaction was highly conserved among arenaviruses from different clades. In LCMV-infected cells, IKKε colocalized with NP but not with MAVS located on the outer membrane of mitochondria. LCMV NP bound the kinase domain (KD) of IKKε (IKBKE) and blocked its autocatalytic activity and its ability to phosphorylate IRF3, without undergoing phosphorylation. Together, our data identify IKKε as a novel target of arenavirus NP. Engagement of NP seems to sequester IKKε in an inactive complex. Considering the important functions of IKKε in innate antiviral immunity and other cellular processes, the NP-IKKε interaction likely plays a crucial role in arenavirus-host interaction.

  12. Mutations in the hormone regulatory element of mouse mammary tumor virus differentially affect the response to progestins, androgens, and glucocorticoids.

    PubMed Central

    Gowland, P L; Buetti, E

    1989-01-01

    Transcription of the mouse mammary tumor virus DNA is known to be induced by several steroid hormones. Using chimeric MMTV plasmids containing mutations within the hormone regulatory element, we have previously studied the regions required for the glucocorticoid response in mouse fibroblasts. Here we report the characterization of elements essential for the stimulation by progestins and androgens as compared with glucocorticoids. The same set of mutant plasmids was transfected into the human mammary tumor cell line T47D, and the specific transcripts were analyzed by an S1 nuclease protection assay. Androgen-mediated stimulation, although weak, showed an extended sensitivity to mutations, with a slight preference for the proximal region. The results with progestin suggest that sequences within all the described sites protected by the receptor in vitro are required and that the promoter-proximal region (-128 to -78 from the RNA start site) is more important than the distal one (-190 to -160). Moreover, a binding site for nuclear factor I was not required for the progestin response, whereas it was required for glucocorticoids. Thus, the various steroid receptors play a role in the differential regulation of mouse mammary tumor virus transcription by recognizing distinct sequence differences in the hormone regulatory element and interacting with different factors bound to the promoter. Images PMID:2550809

  13. Scavenger receptor A gene regulatory elements target gene expression to macrophages and to foam cells of atherosclerotic lesions.

    PubMed Central

    Horvai, A; Palinski, W; Wu, H; Moulton, K S; Kalla, K; Glass, C K

    1995-01-01

    Transcription of the macrophage scavenger receptor A gene is markedly upregulated during monocyte to macrophage differentiation. In these studies, we demonstrate that 291 bp of the proximal scavenger receptor promoter, in concert with a 400-bp upstream enhancer element, is sufficient to direct macrophage-specific expression of a human growth hormone reporter in transgenic mice. These regulatory elements, which contain binding sites for PU.1, AP-1, and cooperating ets-domain transcription factors, are also sufficient to mediate regulation of transgene expression during the in vitro differentiation of bone marrow progenitor cells in response to macrophage colony-stimulating factor. Mutation of the PU.1 binding site within the scavenger receptor promoter severely impairs transgene expression, consistent with a crucial role of PU.1 in regulating the expression of the scavenger receptor gene. The ability of the scavenger receptor promoter and enhancer to target gene expression to macrophages in vivo, including foam cells of atherosclerotic lesions, suggests that these regulatory elements will be of general utility in the study of macrophage differentiation and function by permitting specific modifications of macrophage gene expression. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7777517

  14. Epithelial Expression of Human ABO Blood Group Genes Is Dependent upon a Downstream Regulatory Element Functioning through an Epithelial Cell-specific Transcription Factor, Elf5.

    PubMed

    Sano, Rie; Nakajima, Tamiko; Takahashi, Yoichiro; Kubo, Rieko; Kobayashi, Momoko; Takahashi, Keiko; Takeshita, Haruo; Ogasawara, Kenichi; Kominato, Yoshihiko

    2016-10-21

    The human ABO blood group system is of great importance in blood transfusion and organ transplantation. The ABO system is composed of complex carbohydrate structures that are biosynthesized by A- and B-transferases encoded by the ABO gene. However, the mechanisms regulating ABO gene expression in epithelial cells remain obscure. On the basis of DNase I-hypersensitive sites in and around ABO in epithelial cells, we prepared reporter plasmid constructs including these sites. Subsequent luciferase assays and histone modifications indicated a novel positive regulatory element, designated the +22.6-kb site, downstream from ABO, and this was shown to enhance ABO promoter activity in an epithelial cell-specific manner. Expression of ABO and B-antigen was reduced in gastric cancer KATOIII cells by biallelic deletion of the +22.6-kb site using the CRISPR/Cas9 system. Electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that the site bound to an epithelial cell-specific transcription factor, Elf5. Mutation of the Ets binding motifs to abrogate binding of this factor reduced the regulatory activity of the +22.6-kb site. Furthermore, ELF5 knockdown with shRNA reduced both endogenous transcription from ABO and B-antigen expression in KATOIII cells. Thus, Elf5 appeared to be involved in the enhancer potential of the +22.6-kb site. These results support the contention that ABO expression is dependent upon a downstream positive regulatory element functioning through a tissue-restricted transcription factor, Elf5, in epithelial cells.

  15. Expression of the rat sterol regulatory element-binding protein-1c gene in response to insulin is mediated by increased transactivating capacity of specificity protein 1 (Sp1).

    PubMed

    Deng, Xiong; Yellaturu, Chandrahasa; Cagen, Lauren; Wilcox, Henry G; Park, Edwards A; Raghow, Rajendra; Elam, Marshall B

    2007-06-15

    The induction of genes involved in lipid biosynthesis by insulin is mediated in part by the sterol regulatory element-binding protein-1c (SREBP-1c). SREBP-1c is directly regulated by insulin by transcriptional and post-transcriptional mechanisms. Previously, we have demonstrated that the insulin-responsive cis-acting unit of the rat SREBP-1c promoter is composed of several elements that include a sterol regulatory element, two liver X receptor elements, and a number of conserved GC boxes. Here we systematically dissected the role of these GC boxes and report that five bona fide Sp1-binding elements of the SREBP-1c promoter determine its basal and insulin-induced activation. Luciferase expression driven by the rat SREBP-1c promoter was accelerated by ectopic expression of Sp1, and insulin further enhanced the transactivation potential of Sp1. Introduction of a small interfering RNA against Sp1 reduced both basal and insulin-induced activation of the SREBP-1c promoter. We also found that Sp1 interacted with both SREBP-1c and LXRalpha proteins and that insulin promoted these interactions. Chromatin immunoprecipitation studies revealed that insulin facilitated the recruitment of the steroid receptor coactivator-1 to the SREBP-1c promoter. These studies identify a novel mechanism by which maximal activation of the rat SREBP-1c gene expression by insulin is mediated by Sp1 and its enhanced ability to interact with other transcriptional regulatory proteins.

  16. Identification of Cis-regulatory elements in the mouse Pax9/Nkx2-9 genomic region: implication for evolutionary conserved synteny.

    PubMed Central

    Santagati, Fabio; Abe, Kuniya; Schmidt, Volker; Schmitt-John, Thomas; Suzuki, Misao; Yamamura, Ken-Ichi; Imai, Kenji

    2003-01-01

    We previously reported close physical linkage between Pax9 and Nkx2-9 in the human, mouse, and pufferfish (Fugu rubripes) genomes. In this study, we analyzed cis-regulatory elements of the two genes by comparative sequencing in the three species and by transgenesis in the mouse. We identified two regions including conserved noncoding sequences that possessed specific enhancer activities for expression of Pax9 in the medial nasal process and of Nkx2-9 in the ventral neural tube. Remarkably, the latter contained the consensus Gli-binding motif. Interestingly, the identified Pax9 cis-regulatory sequences were located in an intron of the neighboring gene Slc25a21. Close examination of an extended genomic interval around Pax9 revealed the presence of strong synteny conservation in the human, mouse, and Fugu genomes. We propose such an intersecting organization of cis-regulatory sequences in multigenic regions as a possible mechanism that maintains evolutionary conserved synteny. PMID:14504231

  17. 2015 Summary Report on Industrial and Regulatory Engagement Activities

    SciTech Connect

    Thomas, Kenneth David

    2015-09-01

    activities and future plans were made to Arizona Public Service, Exelon, Duke Energy, Pacific Gas & Electric, SCANA, Southern Nuclear, South Texas Project, STARS Alliance, Tennessee Valley Authority, and Xcel. Discussions were also held on the pathway goals and activities with major industry support organizations during FY 2102, including the Institute of Nuclear Power Operations (INPO), the Nuclear Information Technology Strategic Leadership (NITSL), the Nuclear Energy Institute (NEI), and the Electric Power Research Institute. The Advanced II&C Pathway work was presented at five major industry conferences and Informal discussions were held with key NRC managers at industry conferences. In addition, discussions were held with NRC senior managers on digital regulatory issues through participation on the NEI Digital I&C Working Group. Meetings were held with major industry suppliers and consultants, to explore opportunities for collaboration and to provide a means of pilot project technology transfer. In the international area, discussions were held with Electricite’ de France (EdF) concerning possible collaboration in the area NPP configuration control using intelligent wireless devices.

  18. Characterization of "cis"-regulatory elements ("c"RE) associated with mammary gland function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Bos taurus genome assembly has propelled dairy science into a new era; still, most of the information encoded in the genome has not yet been decoded. The human Encyclopedia of DNA Elements (ENCODE) project has spearheaded the identification and annotation of functional genomic elements in the hu...

  19. Germline deletion of Igh 3′ regulatory region elements hs5-7 affects B cell specific regulation, rearrangement and insulation of the Igh locus1

    PubMed Central

    Volpi, Sabrina A.; Verma-Gaur, Jiyoti; Hassan, Rabih; Ju, Zhongliang; Roa, Sergio; Chatterjee, Sanjukta; Werling, Uwe; Hou, Harry; Will, Britta; Steidl, Ulrich; Scharff, Matthew; Edelman, Winfried; Feeney, Ann J.; Birshtein, Barbara K.

    2012-01-01

    Regulatory elements located within a ~28 kb region 3′ of the Igh gene cluster (3′ regulatory region, 3′ RR) are required for class switch recombination and for high levels of IgH expression in plasma cells. We previously defined novel DNase I hypersensitive (hs) sites, i.e. hs5-7, immediately downstream of this region. Hs5-7 contains a high density of binding sites for CTCF, a zinc finger protein associated with mammalian insulator activity and is an anchor for interactions with CTCF sites flanking the DH region. To test the function of hs5-7, we have generated mice with an 8 kb deletion encompassing all three hs elements. B cells from hs5-7 KO mice showed a modest increase in expression of the nearest downstream gene. In addition, Igh alleles in hs5-7 KO mice were in a less contracted configuration compared to WT Igh alleles and showed a two-fold increase in the usage of proximal VH7183 gene families. Hs5-7 KO mice were essentially indistinguishable from wild type mice in B cell development, allelic regulation, class switch recombination, and chromosomal looping. We conclude that hs5-7--a high-density CTCF binding region at the 3′ end of the Igh locus--impacts usage of VH regions as far as 500 kb away. PMID:22345664

  20. A novel regulatory element (E77) isolated from CHO‐K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells

    PubMed Central

    Kang, Shin‐Young; Kim, Yeon‐Gu; Kang, Seunghee; Lee, Hong Weon

    2016-01-01

    Abstract Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO‐K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO‐K1 genomic DNA fragments with a CMV promoter‐driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  1. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

    PubMed

    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

    2016-05-01

    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study.

  2. Yeast sterol regulatory element-binding protein (SREBP) cleavage requires Cdc48 and Dsc5, a ubiquitin regulatory X domain-containing subunit of the Golgi Dsc E3 ligase.

    PubMed

    Stewart, Emerson V; Lloyd, S Julie-Ann; Burg, John S; Nwosu, Christine C; Lintner, Robert E; Daza, Riza; Russ, Carsten; Ponchner, Karen; Nusbaum, Chad; Espenshade, Peter J

    2012-01-02

    Schizosaccharomyces pombe Sre1 is a membrane-bound transcription factor that controls adaptation to hypoxia. Like its mammalian homolog, sterol regulatory element-binding protein (SREBP), Sre1 activation requires release from the membrane. However, in fission yeast, this release occurs through a strikingly different mechanism that requires the Golgi Dsc E3 ubiquitin ligase complex and the proteasome. The mechanistic details of Sre1 cleavage, including the link between the Dsc E3 ligase complex and proteasome, are not well understood. Here, we present results of a genetic selection designed to identify additional components required for Sre1 cleavage. From the selection, we identified two new components of the fission yeast SREBP pathway: Dsc5 and Cdc48. The AAA (ATPase associated with diverse cellular activities) ATPase Cdc48 and Dsc5, a ubiquitin regulatory X domain-containing protein, interact with known Dsc complex components and are required for SREBP cleavage. These findings provide a mechanistic link between the Dsc E3 ligase complex and the proteasome in SREBP cleavage and add to a growing list of similarities between the Dsc E3 ligase and membrane E3 ligases involved in endoplasmic reticulum-associated degradation.

  3. Functional properties and regulatory complexity of a minimal RBCS light-responsive unit activated by phytochrome, cryptochrome, and plastid signals.

    PubMed

    Martínez-Hernández, Aída; López-Ochoa, Luisa; Argüello-Astorga, Gerardo; Herrera-Estrella, Luis

    2002-04-01

    Light-inducible promoters are able to respond to a wide spectrum of light through multiple photoreceptor systems. Several cis-acting elements have been identified as components of light-responsive promoter elements; however, none of these regulatory elements by itself appears to be sufficient to confer light responsiveness; rather, the combination of at least two elements seems to be required. Using phylogenetic structural analysis, we have identified conserved DNA modular arrays (CMAs) associated with light-responsive promoter regions that have been conserved throughout the evolutionary radiation of angiosperms. Here, we report the functional characterization of CMA5, a native 52-bp fragment of the Nicotiana plumbaginifolia rbcS 8B promoter, which contains an I- and a G-box cis-element. CMA5 behaves as a light-responsive minimal unit capable of activating a heterologous minimal promoter in a phytochrome-, cryptochrome-, and plastid-dependent manner. We also show that CMA5 light induction requires HY5 and that downstream negative regulators COP (constitutive photomorphogenic)/DET (de-etiolated) regulate its activity. Our results show that the simplest light-responsive promoter element from photosynthesis-associated genes described to date is the common target for different signals involved in light regulation. The possible mechanism involved in light-transcriptional regulation and tissue specificity of combinatorial elements units is discussed.

  4. Mutational analysis of the lac regulatory region: second-site changes that activate mutant promoters.

    PubMed Central

    Rothmel, R K; LeClerc, J E

    1989-01-01

    Second-site mutations that restored activity to severe lacP1 down-promoter mutants were isolated. This was accomplished by using a bacteriophage f1 vector containing a fusion of the mutant E. coli lac promoters with the structural gene for chloramphenicol acetyltransferase (CAT), so that a system was provided for selecting phage revertants (or pseudorevertants) that conferred resistance of phage-infected cells to chloramphenicol. Among the second-site changes that relieved defects in mutant lac promoters, the only one that restored lacP1 activity was a T----G substitution at position -14, a weakly conserved site in E. coli promoters. Three other sequence changes, G----A at -2, A----T at +1, and C----A at +10, activated nascent promoters in the lac regulatory region. The nascent promoters conformed to the consensus rule, that activity is gained by sequence changes toward homology with consensus sequences at the -35 and -10 regions of the promoter. However, the relative activities of some promoters cannot be explained solely by consideration of their conserved sequence elements. Images PMID:2660105

  5. The Role of Crowding Forces in Juxtaposing β-Globin Gene Domain Remote Regulatory Elements in Mouse Erythroid Cells

    PubMed Central

    Golov, Arkadiy K.; Gavrilov, Alexey A.; Razin, Sergey V.

    2015-01-01

    The extremely high concentration of macromolecules in a eukaryotic cell nucleus indicates that the nucleoplasm is a crowded macromolecular solution in which large objects tend to gather together due to crowding forces. It has been shown experimentally that crowding forces support the integrity of various nuclear compartments. However, little is known about their role in control of chromatin dynamics in vivo. Here, we experimentally addressed the possible role of crowding forces in spatial organization of the eukaryotic genome. Using the mouse β-globin domain as a model, we demonstrated that spatial juxtaposition of the remote regulatory elements of this domain in globin-expressing cells may be lost and restored by manipulation of the level of macromolecular crowding. In addition to proving the role of crowding forces in shaping interphase chromatin, our results suggest that the folding of the chromatin fiber is a major determinant in juxtaposing remote genomic elements. PMID:26436546

  6. Variant-aware saturating mutagenesis using multiple Cas9 nucleases identifies regulatory elements at trait-associated loci.

    PubMed

    Canver, Matthew C; Lessard, Samuel; Pinello, Luca; Wu, Yuxuan; Ilboudo, Yann; Stern, Emily N; Needleman, Austen J; Galactéros, Frédéric; Brugnara, Carlo; Kutlar, Abdullah; McKenzie, Colin; Reid, Marvin; Chen, Diane D; Das, Partha Pratim; A Cole, Mitchel; Zeng, Jing; Kurita, Ryo; Nakamura, Yukio; Yuan, Guo-Cheng; Lettre, Guillaume; Bauer, Daniel E; Orkin, Stuart H

    2017-02-20

    Cas9-mediated, high-throughput, saturating in situ mutagenesis permits fine-mapping of function across genomic segments. Disease- and trait-associated variants identified in genome-wide association studies largely cluster at regulatory loci. Here we demonstrate the use of multiple designer nucleases and variant-aware library design to interrogate trait-associated regulatory DNA at high resolution. We developed a computational tool for the creation of saturating-mutagenesis libraries with single or multiple nucleases with incorporation of variants. We applied this methodology to the HBS1L-MYB intergenic region, which is associated with red-blood-cell traits, including fetal hemoglobin levels. This approach identified putative regulatory elements that control MYB expression. Analysis of genomic copy number highlighted potential false-positive regions, thus emphasizing the importance of off-target analysis in the design of saturating-mutagenesis experiments. Together, these data establish a widely applicable high-throughput and high-resolution methodology to identify minimal functional sequences within large disease- and trait-associated regions.

  7. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    PubMed

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals.

  8. Deformed protein binding sites and cofactor binding sites are required for the function of a small segment-specific regulatory element in Drosophila embryos.

    PubMed Central

    Zeng, C; Pinsonneault, J; Gellon, G; McGinnis, N; McGinnis, W

    1994-01-01

    How each of the homeotic selector proteins can regulate distinct sets of DNA target elements in embryos is not understood. Here we describe a detailed functional dissection of a small element that is specifically regulated by the Deformed homeotic protein. This 120 bp element (module E) is part of a larger 2.7 kb autoregulatory enhancer that maintains Deformed (Dfd) transcription in the epidermis of the maxillary and mandibular segments of Drosophila embryos. In vitro binding assays show that module E contains only one Dfd protein binding site. Mutations in the Dfd binding site that increase or decrease its in vitro affinity for Dfd protein generate parallel changes in the regulatory activity of module E in transgenic embryos, strong evidence that the in vitro-defined binding site is a direct target of Dfd protein in embryos. However, a monomer or multimer of the Dfd binding region alone is not sufficient to supply Dfd-dependent, segment-specific reporter gene expression. An analysis of a systematic series of clustered point mutations in module E revealed that an additional region containing an imperfect inverted repeat sequence is also required for the function of this homeotic protein response element. The Dfd binding site and the putative cofactor binding site(s) in the region of the inverted repeat are both necessary and in combination sufficient for the function of module E. Images PMID:7910795

  9. Regulatory elements necessary for termination of transcription within the immunoglobulin heavy chain gene locus

    SciTech Connect

    Moore, B.B.

    1992-01-01

    Previous experimentation demonstrated that regulation of the IgM only phenotype in both pre-B and immature B cells was primarily at the transcriptional level. Expression of IgD mRNA involves transcription of the entire 29 kilobase rearranged [mu]-[delta] locus. Mature B cells transcribe the [beta] exons at approximately half the level that they transcribe the [delta] gene. Early B cells however, transcribe the [mu] gene with approximately 90% more efficiency than they do the [delta] gene. Specifically, early B cells show a transcription termination event occurring within a 1 kilobase region of the [mu]-[delta] intron. This dissertation analyzes the sequence elements necessary to encode the transcription termination event within the [mu]-[delta] intron. This work shows that the termination motif consists of specific sequences within the [mu]m poly(A) site as well as a region of the [mu]-[delta] intron contained within a 1200 base pair fragment. The 1200 base pair fragment extends from the Pst I site within the intron and ends just prior to the C[delta]1 exon. This fragment contains a 162 base pair unique sequence inverted repeat (USIR). Furthermore, the [mu]m site is specifically required because the [mu]s site was unable to substitute, despite extensive usage. In addition, the USIR-containing intron functions in an orientation-dependent manner. Analysis of this termination motif in a variety of lymphoid and non-lymphoid cells suggests that this motif is an intrinsic polymerase II termination motif. This implies that transcription termination in early B cells is by a default model and that active regulation of this motif involves an anti-termination event in mature B cells.

  10. A comparative analysis of the evolution, expression, and cis-regulatory element of polygalacturonase genes in grasses and dicots.

    PubMed

    Liang, Ying; Yu, Youjian; Cui, Jinlong; Lyu, Meiling; Xu, Liai; Cao, Jiashu

    2016-11-01

    Cell walls are a distinguishing characteristic of plants essential to their survival. The pectin content of primary cell walls in grasses and dicots is distinctly different. Polygalacturonases (PGs) can degrade pectins and participate in multiple developmental processes of plants. This study comprehensively compared the evolution, expression, and cis-regulatory element of PGs in grasses and dicots. A total of 577 PGs identified from five grasses and five dicots fell into seven clades. Evolutionary analysis demonstrated the distinct differences between grasses and dicots in patterns of gene duplication and loss, and evolutionary rates. Grasses generally contained much fewer clade C and F members than dicots. We found that this disparity was the result of less duplication and more gene losses in grasses. More duplications occurred in clades D and E, and expression analysis showed that most of clade E members were expressed ubiquitously at a high overall level and clade D members were closely related to male reproduction in both grasses and dicots, suggesting their biological functions were highly conserved across species. In addition to the general role in reproductive development, PGs of clades C and F specifically played roles in root development in dicots, shedding light on organ differentiation between the two groups of plants. A regulatory element analysis of clade C and F members implied that possible functions of PGs in specific biological responses contributed to their expansion and preservation. This work can improve the knowledge of PGs in plants generally and in grasses specifically and is beneficial to functional studies.

  11. Retinal Expression of the Drosophila eyes absent Gene Is Controlled by Several Cooperatively Acting Cis-regulatory Elements

    PubMed Central

    Neuman, Sarah D.; Bashirullah, Arash; Kumar, Justin P.

    2016-01-01

    The eyes absent (eya) gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so) mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis. PMID:27930646

  12. Elemental analysis of combustion products by neutron activation

    SciTech Connect

    Heft, R.E.; Koszykowski, R.F.

    1980-01-01

    This paper gives a brief description of the neutron activation analysis method, which is being used to determine the elemental profile of combustion products from coal-fired power plants, oil shale retorting, and underground coal gasification. (DLC)

  13. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp.

    PubMed

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-10-13

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5'-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism.

  14. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  15. The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening.

    PubMed

    Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin

    2017-04-01

    Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network.

  16. Scientific and legal perspectives on science generated for regulatory activities.

    PubMed

    Henry, Carol J; Conrad, James W

    2008-01-01

    This article originated from a conference that asked "Should scientific work conducted for purposes of advocacy before regulatory agencies or courts be judged by the same standards as science conducted for other purposes?" In the article, which focuses on the regulatory advocacy context, we argue that it can be and should be. First, we describe a set of standards and practices currently being used to judge the quality of scientific research and testing and explain how these standards and practices assist in judging the quality of research and testing regardless of why the work was conducted. These standards and practices include the federal Information Quality Act, federal Good Laboratory Practice standards, peer review, disclosure of funding sources, and transparency in research policies. The more that scientific information meets these standards and practices, the more likely it is to be of high quality, reliable, reproducible, and credible. We then explore legal issues that may be implicated in any effort to create special rules for science conducted specifically for a regulatory proceeding. Federal administrative law does not provide a basis for treating information in a given proceeding differently depending on its source or the reason for which it was generated. To the contrary, this law positively assures that interested persons have the right to offer their technical expertise toward the solution of regulatory problems. Any proposal to subject scientific information generated for the purpose of a regulatory proceeding to more demanding standards than other scientific information considered in that proceeding would clash with this law and would face significant administrative complexities. In a closely related example, the U.S. Environmental Protection Agency considered but abandoned a program to implement standards aimed at "external" information.

  17. Identification of a melanocyte-specific, microphthalmia-associated transcription factor-dependent regulatory element in the intronic duplication causing hair greying and melanoma in horses.

    PubMed

    Sundström, Elisabeth; Komisarczuk, Anna Z; Jiang, Lin; Golovko, Anna; Navratilova, Pavla; Rinkwitz, Silke; Becker, Thomas S; Andersson, Leif

    2012-01-01

    Greying with age in horses is an autosomal dominant trait, characterized by hair greying, high incidence of melanoma and vitiligo-like depigmentation. Previous studies have revealed that the causative mutation for this phenotype is a 4.6-kb intronic duplication in STX17 (Syntaxin 17). By using reporter constructs in transgenic zebrafish, we show that a construct containing two copies of the duplicated sequence acts as a strong enhancer in neural crest cells and has subsequent melanophore-specific activity during zebrafish embryonic development whereas a single copy of the duplicated sequence acts as a weak enhancer, consistent with the phenotypic manifestation of the mutation in horses. We further used luciferase assays to investigate regulatory regions in the duplication, to reveal tissue-specific activities of these elements. One region upregulated the reporter gene expression in a melanocyte-specific manner and contained two microphthalmia-associated transcription factor (MITF) binding sites, essential for the activity. Microphthalmia-associated transcription factor regulates melanocyte development, and these binding sites are outstanding candidates for mediating the melanocyte-specific activity of the element. These results provide strong support for the causative nature of the duplication and constitute an explanation for the melanocyte-specific effects of the Grey allele.

  18. The Responses of Arabidopsis Early Light-Induced Protein2 to Ultraviolet B, High Light, and Cold Stress Are Regulated by a Transcriptional Regulatory Unit Composed of Two Elements1[OPEN

    PubMed Central

    Hayami, Natsuki; Sakai, Yusaku; Kimura, Mitsuhiro; Saito, Tatsunori; Tokizawa, Mutsutomo; Iuchi, Satoshi; Kurihara, Yukio; Matsui, Minami; Nomoto, Mika; Tada, Yasuomi; Yamamoto, Yoshiharu Y.

    2015-01-01

    The Arabidopsis (Arabidopsis thaliana) Early Light-Induced Protein (ELIP) is thought to act as a photoprotectant, reducing the damaging effects of high light (HL). Expression of ELIP2 is activated by multiple environmental stresses related to photoinhibition. We have identified putative regulatory elements in an ELIP2 promoter using an octamer-based frequency comparison method, analyzed the role of these elements using synthetic promoters, and revealed a key transcriptional regulatory unit for ultraviolet B (UV-B) radiation, HL, and cold stress responses. The unit is composed of two elements, designated as Elements A (TACACACC) and B (GGCCACGCCA), and shows functionality only when paired. Our genome-wide correlation analysis between possession of these elements in the promoter region and expression profiles in response to UV-B, HL, and cold suggests that Element B receives and integrates these multiple stress signals. In vitro protein-DNA binding assays revealed that LONG HYPOCOTYL5 (HY5), a basic domain-Leucine zipper transcription factor, directly binds to Element B. In addition, mutant analysis of HY5 showed partial involvement in the UV-B and HL responses but not in the cold stress response. These results suggest that signals for UV-B, HL, and cold stress join at Element B, which recognizes the signals of multiple transcription factors, including HY5. PMID:26175515

  19. Elements of active vibration control for rotating machinery

    NASA Technical Reports Server (NTRS)

    Ulbrich, Heinz

    1990-01-01

    The success or failure of active vibration control is determined by the availability of suitable actuators, modeling of the entire system including all active elements, positioning of the actuators and sensors, and implementation of problem-adapted control concepts. All of these topics are outlined and their special problems are discussed in detail. Special attention is given to efficient modeling of systems, especially for considering the active elements. Finally, design methods for and the application of active vibration control on rotating machinery are demonstrated by several real applications.

  20. Antiviral Activity of Porcine Interferon Regulatory Factor 1 against Swine Viruses in Cell Culture.

    PubMed

    Li, Yongtao; Chang, Hongtao; Yang, Xia; Zhao, Yongxiang; Chen, Lu; Wang, Xinwei; Liu, Hongying; Wang, Chuanqing; Zhao, Jun

    2015-11-17

    Interferon regulatory factor 1 (IRF1), as an important transcription factor, is abundantly induced upon virus infections and participates in host antiviral immune responses. However, the roles of porcine IRF1 (poIRF1) in host antiviral defense remain poorly understood. In this study, we determined that poIRF1 was upregulated upon infection with viruses and distributed in nucleus in porcine PK-15 cells. Subsequently, we tested the antiviral activities of poIRF1 against several swine viruses in cells. Overexpression of poIRF1 can efficiently suppress the replication of viruses, and knockdown of poIRF1 promotes moderately viral replication. Interestingly, overexpression of poIRF1 enhances dsRNA-induced IFN-β and IFN-stimulated response element (ISRE) promoter activation, whereas knockdown of poIRF1 cannot significantly affect the activation of IFN-β promoter induced by RNA viruses. This study suggests that poIRF1 plays a significant role in cellular antiviral response against swine viruses, but might be dispensable for IFN-β induction triggered by RNA viruses in PK-15 cells. Given these results, poIRF1 plays potential roles in cellular antiviral responses against swine viruses.

  1. Targeting a Regulatory Element in Human Thymidylate Synthase mRNA

    PubMed Central

    Brunn, Nicholas D.; Sega, Emily Garcia; Kao, Melody B.

    2013-01-01

    Thymidylate synthase (TS) is a key enzyme in the biosynthesis of thymidine. TS inhibitors, which are used in cancer chemotherapy, suffer from resistance development in tumors through upregulation of TS expression. Autoregulatory translation control has been implicated with TS overexpression. TS binding at its own mRNA, which leads to sequestration of the start codon, is abolished when the enzyme forms an inhibitor complex, thereby relieving translation suppression. We have used the protein binding site from the TS mRNA in the context of a bicistronic expression system to validate targeting the regulatory motif with stabilizing ligands that prevent ribosomal initiation. Stabilization of the RNA by mutations, which were studied as surrogates of ligand binding, suppresses translation of the TS protein. Compounds that stabilize the TS binding RNA motif and thereby inhibit ribosomal initiation might be used in combination with existing TS enzyme-targeting drugs to overcome resistance development during chemotherapy. PMID:23143777

  2. Genomic matrix attachment region and chromosome conformation capture quantitative real time PCR assays identify novel putative regulatory elements at the imprinted Dlk1/Gtl2 locus.

    PubMed

    Braem, Caroline; Recolin, Bénédicte; Rancourt, Rebecca C; Angiolini, Christopher; Barthès, Pauline; Branchu, Priscillia; Court, Franck; Cathala, Guy; Ferguson-Smith, Anne C; Forné, Thierry

    2008-07-04

    We previously showed that genomic imprinting regulates matrix attachment region activities at the mouse Igf2 (insulin-like growth factor 2) locus and that these activities are functionally linked to neighboring differentially methylated regions (DMRs). Here, we investigate the similarly structured Dlk1/Gtl2 imprinted domain and show that in the mouse liver, the G/C-rich intergenic germ line-derived DMR, a sequence involved in domain-wide imprinting, is highly retained within the nuclear matrix fraction exclusively on the methylated paternal copy, reflecting its differential function on that chromosome. Therefore, not only "classical" A/T-rich matrix attachment region (MAR) sequences but also other important regulatory DNA elements (such as DMRs) can be recovered from genomic MAR assays following a high salt treatment. Interestingly, the recovery of one A/T-rich sequence (MAR4) from the "nuclear matrix" fraction is strongly correlated with gene expression. We show that this element possesses an intrinsic activity that favors transcription, and using chromosome conformation capture quantitative real time PCR assays, we demonstrate that the MAR4 interacts with the intergenic germ line-derived DMR specifically on the paternal allele but not with the Dlk1/Gtl2 promoters. Altogether, our findings shed a new light on gene regulation at this locus.

  3. Conformal optical elements for correcting wavefront distortions in YAG : Nd{sup 3+} active elements

    SciTech Connect

    Korolkov, V P; Nasyrov, R K; Poleshchuk, A G; Arapov, Yu D; Ivanov, A F

    2013-02-28

    Correction of the wavefront is studied for the light beam passing wide-aperture YAG : Nd3+ single-crystal rods, which are used as active elements in high-power solid-state lasers. A nonideal character of the crystal structure is responsible for the deformation of the wavefront of passing radiation. By using the halftone technology we have developed conformal aberration correctors capable of compensating rod nonuniformities and reducing the laser radiation divergence by an order of magnitude. The results obtained make it possible to employ optically nonuniform active elements in laser constructions. (laser optics 2012)

  4. Early and late periodic patterns of even skipped expression are controlled by distinct regulatory elements that respond to different spatial cues.

    PubMed

    Goto, T; Macdonald, P; Maniatis, T

    1989-05-05

    We have identified the regulatory sequences required for the periodic expression of the Drosophila pair rule gene even skipped (eve). We find that the gradually changing pattern of periodic eve expression during early embryogenesis is directed by two distinct regulatory programs. Initially, eve expression in individual stripes is established by different regulatory elements, each of which responds to nonperiodic spatial cues provided, at least in part, by the gap genes. Later, coordinate expression of eve in all seven stripes is directed by a single regulatory region that responds to periodic cues provided by primary pair rule genes, including eve itself. As a consequence of this two-step regulatory program, eve functions both in the establishment of the periodic pattern of gene expression and in the subsequent specification of parasegmental boundaries.

  5. Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation

    PubMed Central

    Zhu, Zhixin; Wang, Hailong; Wang, Yiting; Guan, Shan; Wang, Fang; Tang, Jingyu; Zhang, Ruijuan; Xie, Lulu; Lu, Yingqing

    2015-01-01

    Cellular activities such as compound synthesis often require the transcriptional activation of an entire pathway; however, the molecular mechanisms underlying pathway activation have rarely been explained. Here, the cis regulatory architecture of the anthocyanin pathway genes targeted by the transcription factor (TF) complex including MYB, bHLH, and WDR was systematically analysed in one species and the findings extended to others. In Ipomoea purpurea, the IpMYB1-IpbHLH2-IpWDR1 (IpMBW) complex was found to be orthologous to the PAP1-GL3-TTG1 (AtPGT) complex of Arabidopsis thaliana, and interacted with a 7-bp MYB-recognizing element (MRE) and a 6-bp bHLH-recognizing element (BRE) at the proximal promoter region of the pathway genes. There was little transcription of the gene in the absence of the MRE or BRE. The cis elements identified experimentally converged on two syntaxes, ANCNNCC for MREs and CACN(A/C/T)(G/T) for BREs, and our bioinformatic analysis showed that these were present within anthocyanin gene promoters in at least 35 species, including both gymnosperms and angiosperms. For the anthocyanin pathway, IpMBW and AtPGT recognized the interspecific promoters of both early and later genes. In A. thaliana, the seed-specific TF complex (TT2, TT8, and TTG1) may regulate all the anthocyanin pathway genes, in addition to the proanthocyanidin-specific BAN. When multiple TF complexes in the anthocyanin pathway were compared, the cis architecture played a role larger than the TF complex in determining the variation in promoter activity. Collectively, a cis logic common to the pathway gene promoters was found, and this logic is essential for the trans factors to regulate the pathway. PMID:25911741

  6. Global identification of the genetic networks and cis-regulatory elements of the cold response in zebrafish

    PubMed Central

    Hu, Peng; Liu, Mingli; Zhang, Dong; Wang, Jinfeng; Niu, Hongbo; Liu, Yimeng; Wu, Zhichao; Han, Bingshe; Zhai, Wanying; Shen, Yu; Chen, Liangbiao

    2015-01-01

    The transcriptional programs of ectothermic teleosts are directly influenced by water temperature. However, the cis- and trans-factors governing cold responses are not well characterized. We profiled transcriptional changes in eight zebrafish tissues exposed to mildly and severely cold temperatures using RNA-Seq. A total of 1943 differentially expressed genes (DEGs) were identified, from which 34 clusters representing distinct tissue and temperature response expression patterns were derived using the k-means fuzzy clustering algorithm. The promoter regions of the clustered DEGs that demonstrated strong co-regulation were analysed for enriched cis-regulatory elements with a motif discovery program, DREME. Seventeen motifs, ten known and seven novel, were identified, which covered 23% of the DEGs. Two motifs predicted to be the binding sites for the transcription factors Bcl6 and Jun, respectively, were chosen for experimental verification, and they demonstrated the expected cold-induced and cold-repressed patterns of gene regulation. Protein interaction modeling of the network components followed by experimental validation suggested that Jun physically interacts with Bcl6 and might be a hub factor that orchestrates the cold response in zebrafish. Thus, the methodology used and the regulatory networks uncovered in this study provide a foundation for exploring the mechanisms of cold adaptation in teleosts. PMID:26227973

  7. Functional roles of Aves class-specific cis-regulatory elements on macroevolution of bird-specific features.

    PubMed

    Seki, Ryohei; Li, Cai; Fang, Qi; Hayashi, Shinichi; Egawa, Shiro; Hu, Jiang; Xu, Luohao; Pan, Hailin; Kondo, Mao; Sato, Tomohiko; Matsubara, Haruka; Kamiyama, Namiko; Kitajima, Keiichi; Saito, Daisuke; Liu, Yang; Gilbert, M Thomas P; Zhou, Qi; Xu, Xing; Shiroishi, Toshihiko; Irie, Naoki; Tamura, Koji; Zhang, Guojie

    2017-02-06

    Unlike microevolutionary processes, little is known about the genetic basis of macroevolutionary processes. One of these magnificent examples is the transition from non-avian dinosaurs to birds that has created numerous evolutionary innovations such as self-powered flight and its associated wings with flight feathers. By analysing 48 bird genomes, we identified millions of avian-specific highly conserved elements (ASHCEs) that predominantly (>99%) reside in non-coding regions. Many ASHCEs show differential histone modifications that may participate in regulation of limb development. Comparative embryonic gene expression analyses across tetrapod species suggest ASHCE-associated genes have unique roles in developing avian limbs. In particular, we demonstrate how the ASHCE driven avian-specific expression of gene Sim1 driven by ASHCE may be associated with the evolution and development of flight feathers. Together, these findings demonstrate regulatory roles of ASHCEs in the creation of avian-specific traits, and further highlight the importance of cis-regulatory rewiring during macroevolutionary changes.

  8. Sterol Regulatory Element Binding Protein (Srb1) Is Required for Hypoxic Adaptation and Virulence in the Dimorphic Fungus Histoplasma capsulatum

    PubMed Central

    DuBois, Juwen C.; Smulian, A. George

    2016-01-01

    The Histoplasma capsulatum sterol regulatory element binding protein (SREBP), Srb1 is a member of the basic helix-loop-helix (bHLH), leucine zipper DNA binding protein family of transcription factors that possess a unique tyrosine (Y) residue instead of an arginine (R) residue in the bHLH region. We have determined that Srb1 message levels increase in a time dependent manner during growth under oxygen deprivation (hypoxia). To further understand the role of Srb1 during infection and hypoxia, we silenced the gene encoding Srb1 using RNA interference (RNAi); characterized the resulting phenotype, determined its response to hypoxia, and its ability to cause disease within an infected host. Silencing of Srb1 resulted in a strain of H. capsulatum that is incapable of surviving in vitro hypoxia. We found that without complete Srb1 expression, H. capsulatum is killed by murine macrophages and avirulent in mice given a lethal dose of yeasts. Additionally, silencing Srb1 inhibited the hypoxic upregulation of other known H. capsulatum hypoxia-responsive genes (HRG), and genes that encode ergosterol biosynthetic enzymes. Consistent with these regulatory functions, Srb1 silenced H. capsulatum cells were hypersensitive to the antifungal azole drug itraconazole. These data support the theory that the H. capsulatum SREBP is critical for hypoxic adaptation and is required for H. capsulatum virulence. PMID:27711233

  9. Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data

    PubMed Central

    Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S.

    2016-01-01

    Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers. PMID:27861625

  10. In vivo promoter analysis on refeeding response of hepatic sterol regulatory element-binding protein-1c expression

    SciTech Connect

    Takeuchi, Yoshinori; Yahagi, Naoya; Nakagawa, Yoshimi; Matsuzaka, Takashi; Shimizu, Ritsuko; Sekiya, Motohiro; Iizuka, Yoko; Ohashi, Ken; Gotoda, Takanari; Yamamoto, Masayuki; Nagai, Ryozo; Kadowaki, Takashi; Yamada, Nobuhiro; Osuga, Jun-ichi; Shimano, Hitoshi

    2007-11-16

    Sterol regulatory element-binding protein (SREBP)-1c is the master regulator of lipogenic gene expression in liver. The mRNA abundance of SREBP-1c is markedly induced when animals are refed after starvation, although the regulatory mechanism is so far unknown. To investigate the mechanism of refeeding response of SREBP-1c gene expression in vivo, we generated a transgenic mouse model that carries 2.2 kb promoter region fused to the luciferase reporter gene. These transgenic mice exhibited refeeding responses of the reporter in liver and adipose tissues with extents essentially identical to those of endogenous SREBP-1c mRNA. The same results were obtained from experiments using adenovirus-mediated SREBP-1c-promoter-luciferase fusion gene transduction to liver. These data demonstrate that the regulation of SREBP-1c gene expression is at the transcription level, and that the 2.2 kb 5'-flanking region is sufficient for this regulation. Moreover, when these transgenic or adenovirus-infected mice were placed on insulin-depleted state by streptozotocin treatment, the reporter expression was upregulated as strongly as in control mice, demonstrating that this regulation is not dominated by serum insulin level. These mice are the first models to provide the mechanistic insight into the transcriptional regulation of SREBP-1c gene in vivo.

  11. A positive regulatory element is involved in the induction of the beta-galactosidase gene from Kluyveromyces lactis.

    PubMed Central

    Das, S; Breunig, K D; Hollenberg, C P

    1985-01-01

    The regulation of the LAC4 gene encoding beta-galactosidase in the yeast Kluyveromyces lactis has been studied. The expression of cloned LAC4 gene present on autonomously replicating plasmids was normally regulated by lactose or galactose as inducers. The LAC4 transcription initiation sites were mapped on two plasmids, PTY75-LAC4 and pKL2. The sites were found to be dependent on the level of gene expression and on the plasmid used. Under induced conditions, the normal cluster of initiation sites was used on both plasmids, whereas under non-induced conditions LAC4 on pKL2 showed additional sites. Deletion mapping of the 5' regulatory region of the LAC4 gene revealed a DNA element required for induction, presumably for the binding of a positive regulator. Images Fig. 2. Fig. 3. Fig. 6. PMID:3924596

  12. [The expression of tPA directed by the bovine BLG regulatory elements in the mammary gland of transgenic mice].

    PubMed

    Chen, H X; Chen, X; Yang, X; Deng, J X; Su, G F; Huang, P T

    2001-03-01

    In order to get the regulatory elements which are essential for generating mammary gland bioreactors, the whole 8.4 kb bovine BLG gene was obtained by PCR amplification. The 1.6 kb chicken lysozyme matrix attachment region (MAR) was used to overcome position effects. The bovine BLG-tPA expression vector was constructed and the BLG-tPA fusion gene was introduced into fertilized eggs of mice by microinjection to generate transgenic mouse. 170 offsprings were obtained, of which 9 were proved to be transgenic mice based on PCR and Southern-blot analysis. The tPA expression level amounted to 12 micrograms/mL in the milk of mice. The bovine BLG-tPA fusion gene integrated in the founders was inheritable.

  13. Current and future applications of PRA in regulatory activities

    SciTech Connect

    Speis, T.P.; Murphy, J.A.; Cunningham, M.A.

    1995-04-01

    Probabilistic Risk Assessments (PRAs) have proven valuable in providing the regulators, the nuclear plant operators, and the reactor designers insights into plant safety, reliability, design and operation. Both the NRC Commissioners and the staff have grown to appreciate the valuable contributions PRAs can have in the regulatory arena, though I will admit the existence of some tendencies for strict adherence to the deterministic approach within the agency and the public at large. Any call for change, particularly one involving a major adjustment in approach to the regulation of nuclear power, will meet with a certain degree of resistance and retrenchment. Change can appear threatening and can cause some to question whether the safety mission is being fulfilled. This skepticism is completely appropriate and is, in fact, essential to a proper transition towards risk and performance-based approaches. Our task in the Office of Nuclear Regulatory Research is to increase the PRA knowledge base within the agency and develop appropriate guidance and methods needed to support the transitioning process.

  14. Evolutionary active transposable elements in the genome of the coelacanth.

    PubMed

    Chalopin, Domitille; Fan, Shaohua; Simakov, Oleg; Meyer, Axel; Schartl, Manfred; Volff, Jean-Nicolas

    2014-09-01

    The apparent morphological stasis in the lineage of the coelacanth, which has been called a "living fossil" by many, has been suggested to be causally related to a slow evolution of its genome, with strongly reduced activity of transposable elements (TEs). Analysis of the African coelacanth showed that at least 25% of its genome is constituted of transposable elements including retrotransposons, endogenous retroviruses and DNA transposons, with a strong predominance of non-Long Terminal Repeat (non-LTR) retrotransposons. The coelacanth genome has been shaped by four major general bursts of transposition during evolution, with major contributions of LINE1, LINE2, CR1, and Deu non-LTR retrotransposons. Many transposable elements are expressed in different tissues and might be active. The number of TE families in coelacanth, but also in lungfish, is lower than in teleost fish, but is higher than in chicken and human. This observation is in agreement with the hypothesis of a sequential elimination of many TE families in the sarcopterygian lineage during evolution. Taken together, our analysis indicates that the coelacanth contains more TE families than birds and mammals, and that these elements have been active during the evolution of the coelacanth lineage. Hence, at the level of transposable element activity, the coelacanth genome does not appear to evolve particularly slowly.

  15. Identification and characterization of hepatocyte-specific regulatory regions of the rat pyruvate kinase L gene. The synergistic effect of multiple elements.

    PubMed

    Yamada, K; Noguchi, T; Matsuda, T; Takenaka, M; Monaci, P; Nicosia, A; Tanaka, T

    1990-11-15

    The rat pyruvate kinase L (PKL) gene produces the L- and R-type isozymes by alternative transcription that is regulated in a tissue-specific manner. To investigate which DNA elements are involved in hepatocyte-specific expression of the L-type isozyme, we performed transient DNA transfer experiments with PKL/chloramphenicol acetyltransferase fusion genes. We found three positive regulatory regions required for expression of the L-type isozyme in adult rat hepatocytes by functional analyses of a series of 5' and internal deletion constructs of the fusion genes. These regions, designated as PKL-I, PKL-II, and PKL-III, were located between nucleotides -76 and -94, -126 and -149, and -150 and -170, respectively. PKL-I showed enhancer-like activity alone, whereas PKL-II and PKL-III did not have any independent effect. Combinations of L-I + L-II and L-II + L-III, but not of L-I + L-III, showed synergistic enhancer activities when oriented in the same direction. The inclusion of all three elements oriented in the same direction had the maximum synergistic effect, indicating that these elements function as a unit. This unit enhanced expression from heterologous as well as homologous promoters in a manner that was independent of its orientation and position relative to the cap site. The activity of the unit was not detected in HeLa cells or K562 erythroleukemia cells, suggesting that this unit possessed cell-type specificity. PKL-I consists of a palindrome sequence 5'-CTGGTTATACTTTAACCAG-3', which contain a sequence homologous to the LF-B1-binding site. PKL-II contains the sequence 5'-TTCCTGGACTCTGGCCCCCAGTGT-3', which is similar to that of the LF-A1-binding site. PKL-III contains a palindrome sequence 5'-CCACGGGGCACTCCCGTGG-3', which include a sequence homologous to the binding site of the adenovirus major late transcription factor. Gel retardation assay indicated that the different trans-acting factors interacted with three elements and that the transacting protein bound

  16. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  17. Marsupial anti-Mullerian hormone gene structure, regulatory elements, and expression.

    PubMed

    Pask, Andrew J; Whitworth, Deanne J; Mao, Chai-An; Wei, Ke-Jun; Sankovic, Natasha; Graves, Jennifer A M; Shaw, Geoffrey; Renfree, Marilyn B; Behringer, Richard R

    2004-01-01

    During male sexual development in reptiles, birds, and mammals, anti-Müllerian hormone (AMH) induces the regression of the Müllerian ducts that normally form the primordia of the female reproductive tract. Whereas Müllerian duct regression occurs during fetal development in eutherian mammals, in marsupial mammals this process occurs after birth. To investigate AMH in a marsupial, we isolated an orthologue from the tammar wallaby (Macropus eugenii) and characterized its expression in the testes and ovaries during development. The wallaby AMH gene is highly conserved with the eutherian orthologues that have been studied, particularly within the encoded C-terminal mature domain. The N-terminus of marsupial AMH is divergent and larger than that of eutherian species. It is located on chromosome 3/4, consistent with its autosomal localization in other species. The wallaby 5' regulatory region, like eutherian AMH genes, contains binding sites for SF1, SOX9, and GATA factors but also contains a putative SRY-binding site. AMH expression in the developing testis begins at the time of seminiferous cord formation at 2 days post partum, and Müllerian duct regression begins shortly afterward. In the developing testis, AMH is localized in the cytoplasm of the Sertoli cells but is lost by adulthood. In the developing ovary, there is no detectable AMH expression, but in adults it is produced by the granulosa cells of primary and secondary follicles. It is not detectable in atretic follicles. Collectively, these studies suggest that AMH expression has been conserved during mammalian evolution and is intimately linked to upstream sex determination mechanisms.

  18. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.).

    PubMed

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei

    2009-01-01

    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  19. An ensemble of regulatory elements controls Runx3 spatiotemporal expression in subsets of dorsal root ganglia proprioceptive neurons

    PubMed Central

    Appel, Elena; Weissmann, Sarit; Salzberg, Yehuda; Orlovsky, Kira; Negreanu, Varda; Tsoory, Michael; Raanan, Calanit; Feldmesser, Ester; Bernstein, Yael; Wolstein, Orit; Levanon, Ditsa; Groner, Yoram

    2016-01-01

    The Runx3 transcription factor is essential for development and diversification of the dorsal root ganglia (DRGs) TrkC sensory neurons. In Runx3-deficient mice, developing TrkC neurons fail to extend central and peripheral afferents, leading to cell death and disruption of the stretch reflex circuit, resulting in severe limb ataxia. Despite its central role, the mechanisms underlying the spatiotemporal expression specificities of Runx3 in TrkC neurons were largely unknown. Here we first defined the genomic transcription unit encompassing regulatory elements (REs) that mediate the tissue-specific expression of Runx3. Using transgenic mice expressing BAC reporters spanning the Runx3 locus, we discovered three REs—dubbed R1, R2, and R3—that cross-talk with promoter-2 (P2) to drive TrkC neuron-specific Runx3 transcription. Deletion of single or multiple elements either in the BAC transgenics or by CRISPR/Cas9-mediated endogenous ablation established the REs’ ability to promote and/or repress Runx3 expression in developing sensory neurons. Our analysis reveals that an intricate combinatorial interplay among the three REs governs Runx3 expression in distinct subtypes of TrkC neurons while concomitantly extinguishing its expression in non-TrkC neurons. These findings provide insights into the mechanism regulating cell type-specific expression and subtype diversification of TrkC neurons in developing DRGs. PMID:28007784

  20. An ensemble of regulatory elements controls Runx3 spatiotemporal expression in subsets of dorsal root ganglia proprioceptive neurons.

    PubMed

    Appel, Elena; Weissmann, Sarit; Salzberg, Yehuda; Orlovsky, Kira; Negreanu, Varda; Tsoory, Michael; Raanan, Calanit; Feldmesser, Ester; Bernstein, Yael; Wolstein, Orit; Levanon, Ditsa; Groner, Yoram

    2016-12-01

    The Runx3 transcription factor is essential for development and diversification of the dorsal root ganglia (DRGs) TrkC sensory neurons. In Runx3-deficient mice, developing TrkC neurons fail to extend central and peripheral afferents, leading to cell death and disruption of the stretch reflex circuit, resulting in severe limb ataxia. Despite its central role, the mechanisms underlying the spatiotemporal expression specificities of Runx3 in TrkC neurons were largely unknown. Here we first defined the genomic transcription unit encompassing regulatory elements (REs) that mediate the tissue-specific expression of Runx3. Using transgenic mice expressing BAC reporters spanning the Runx3 locus, we discovered three REs-dubbed R1, R2, and R3-that cross-talk with promoter-2 (P2) to drive TrkC neuron-specific Runx3 transcription. Deletion of single or multiple elements either in the BAC transgenics or by CRISPR/Cas9-mediated endogenous ablation established the REs' ability to promote and/or repress Runx3 expression in developing sensory neurons. Our analysis reveals that an intricate combinatorial interplay among the three REs governs Runx3 expression in distinct subtypes of TrkC neurons while concomitantly extinguishing its expression in non-TrkC neurons. These findings provide insights into the mechanism regulating cell type-specific expression and subtype diversification of TrkC neurons in developing DRGs.

  1. In situ detection of a heat-shock regulatory element binding protein using a soluble synthetic enhancer sequence.

    PubMed Central

    Harel-Bellan, A; Brini, A T; Ferris, D K; Robin, P; Farrar, W L

    1989-01-01

    In various studies, enhancer binding proteins have been successfully absorbed out by competing sequences inserted into plasmids, resulting in the inhibition of the plasmid expression. Theoretically, such a result could be achieved using synthetic enhancer sequences not inserted into plasmids. In this study, a double stranded DNA sequence corresponding to the human heat shock regulatory element was chemically synthesized. By in vitro retardation assays, the synthetic sequence was shown to bind specifically a protein in extracts from the human T cell line Jurkat. When the synthetic enhancer was electroporated into Jurkat cells, not only the enhancer was shown to remain undegraded into the cells for up to 2 days, but also it was shown to bind intracellularly a protein. The binding was specific and was modulated upon heat shock. Furthermore, the binding protein was shown to be of the expected molecular weight by UV crosslinking. However, when the synthetic enhancer element was co-electroporated with an HSP 70-CAT reporter construct, the expression of the reporter plasmid was consistently enhanced in the presence of the exogenous synthetic enhancer. Images PMID:2740211

  2. Finite-element model of the active organ of Corti

    PubMed Central

    Elliott, Stephen J.; Baumgart, Johannes

    2016-01-01

    The cochlear amplifier that provides our hearing with its extraordinary sensitivity and selectivity is thought to be the result of an active biomechanical process within the sensory auditory organ, the organ of Corti. Although imaging techniques are developing rapidly, it is not currently possible, in a fully active cochlea, to obtain detailed measurements of the motion of individual elements within a cross section of the organ of Corti. This motion is predicted using a two-dimensional finite-element model. The various solid components are modelled using elastic elements, the outer hair cells (OHCs) as piezoelectric elements and the perilymph and endolymph as viscous and nearly incompressible fluid elements. The model is validated by comparison with existing measurements of the motions within the passive organ of Corti, calculated when it is driven either acoustically, by the fluid pressure or electrically, by excitation of the OHCs. The transverse basilar membrane (BM) motion and the shearing motion between the tectorial membrane and the reticular lamina are calculated for these two excitation modes. The fully active response of the BM to acoustic excitation is predicted using a linear superposition of the calculated responses and an assumed frequency response for the OHC feedback. PMID:26888950

  3. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    PubMed

    Kotzka, Jorg; Knebel, Birgit; Haas, Jutta; Kremer, Lorena; Jacob, Sylvia; Hartwig, Sonja; Nitzgen, Ulrike; Muller-Wieland, Dirk

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  4. A novel peroxisome proliferator response element modulates hepatic low-density lipoprotein receptor gene transcription in response to PPARδ activation.

    PubMed

    Shende, Vikram R; Singh, Amar Bahadur; Liu, Jingwen

    2015-12-15

    The hepatic expression of low-density lipoprotein (LDL) receptor (LDLR) gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative peroxisome proliferator-activated receptor (PPAR)-response element (PPRE) sequence motif located at -768 to -752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin (RSV)-mediated transactivation. EMSA and ChIP assay further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression.

  5. Myosin regulatory elements as vectors for gene transfer by intramuscular injection.

    PubMed

    Skarli, M; Kiri, A; Vrbova, G; Lee, C A; Goldspink, G

    1998-04-01

    Intramuscular injection of plasmid constructs promises to be an effective way of carrying out gene therapy for muscle disorders as well as using muscle as an in vivo expression system for disorders that involve the gene product being secreted into the bloodstream. The effectiveness of this method depends on the design of the cassette used for the expression of the cDNA of the introduced gene. We tested the levels of expression achieved by a number of muscle-specific promoters and a myosin light chain enhancer when spliced to the reporter gene chloramphenicol acetyltransferase (CAT), in vitro and in vivo by injection into fast and slow muscles of the mouse. The results show that the highest levels of expression are achieved by a combination of a truncated myosin heavy chain promoter and the enhancer, and that a whole range of expression levels is obtained with the other combinations tested. The data show that a cassette based on these elements should provide efficient vectors for the introduction and expression of genes following intramuscular injection of naked DNA.

  6. ELEMENTAL MERCURY CAPTURE BY ACTIVATED CARBON IN A FLOW REACTOR

    EPA Science Inventory


    The paper gives results of bench-scale experiments in a flow reactor to simulate the entrained-flow capture of elemental mercury (Hgo) using solid sorbents. Adsorption of Hgo by a lignite-based activated carbon (Calgon FGD) was examined at different carbon/mercury (C/Hg) rat...

  7. Incorporation of Active Elements into the Articulated Total Body Model.

    DTIC Science & Technology

    1985-06-30

    the elbow , shoulder, hip and knee joints, 20. OISTRIBUTION/AVAILABILITY OF ABSTRACT 21. ABSTRACT SECURITY CLASSIFICATION UNCLASSIFIED/UNLIMITED X SAME...Active Elements into the Articulated Total Body Model Block 19 continued. Several validation studies were performed. One simulated elbow flexion with...29 V. PHASE III- MODELLING THE GENERAL MUSCULATURE .... ........ ... 31 """. iii A. Elbow Joint

  8. Metal chlorides loaded on activated carbon to capture elemental mercury.

    PubMed

    Shen, Zhemin; Ma, Jing; Mei, Zhijian; Zhang, Jianda

    2010-01-01

    Activated carbon (AC) was considered to be an effective sorbent to control mercury in combustion systems. However, its capture capacity was low and it required a high carbon-to-mercury mass ratio. AC loaded with catalyst showed a high elemental mercury (Hg0) capture capacity due to large surface area of AC and high oxidization ability of catalyst. In this study, several metal chlorides and metal oxides were used to promote the sorption capacity of AC. As a result, metal chlorides were better than metal oxides loaded on AC to remove gaseous mercury. X-ray diffractometer (XRD), thermogravimetric analyzer (TGA) and specific surface area by Brunauer-Emmett-Teller method (BET) analysis showed the main mechanisms: first, AC had an enormous surface area for loading enough MClx; second, Cl and MxOy were generated during pyrogenation of MClx; finally, there were lots of active elements such as Cl and MxOy which could react with elemental mercury and convert it to mercury oxide and mercury chloride. The HgO and HgCl2 might be released from AC's porous structure by thermo regeneration. A catalytic chemisorption mechanism predominates the sorption process of elemental mercury. As Co and Mn were valence variable metal elements, their catalytic effect on Hg0 oxidization may accelerate both oxidation and halogenation of Hg0. The sorbents loaded with metal chlorides possessed a synergistic function of catalytic effect of valence variable metal and chlorine oxidation.

  9. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.

    PubMed

    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent

    2015-01-01

    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

  10. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids

    PubMed Central

    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent

    2015-01-01

    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica. PMID:26347724

  11. Hormone stimulation of androgen receptor mediates dynamic changes in DNA methylation patterns at regulatory elements

    PubMed Central

    Dhiman, Vineet K.; Attwood, Kristopher; Campbell, Moray J.; Smiraglia, Dominic J.

    2015-01-01

    DNA methylation is an epigenetic modification that contributes to stable gene silencing by interfering with the ability of transcriptional regulators to bind to DNA. Recent findings have revealed that hormone stimulation of certain nuclear receptors induces rapid, dynamic changes in DNA methylation patterns alongside transcriptional responses at a subset of target loci, over time. However, the ability of androgen receptor (AR) to dynamically regulate gene transcription is relatively under-studied and its role in the regulation of DNA methylation patterns remains to be elucidated. Here we demonstrate in normal prostate cells that hormone stimulated AR activity results in dynamic changes in the transcription rate and DNA methylation patterns at the AR target genes, TIPARP and SGK1. Time-resolved chromatin immunoprecipitation experiments on the SGK1 locus reveals dynamic recruitment of AR and RNA Polymerase II, as well as the recruitment of proteins involved in the DNA demethylation process, TET1 and TDG. Furthermore, the presence of DNA methylation at dynamic regions inhibits protein binding and transcriptional activity of SGK1. These findings establish AR activity as a contributing factor to the dynamic regulation of DNA methylation patterns at target genes in prostate biology and infer further complexity involved in nuclear receptor mediation of transcriptional regulation. PMID:26646795

  12. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    PubMed Central

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen

    2016-01-01

    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  13. The LA loop as an important regulatory element of the HtrA (DegP) protease from Escherichia coli: structural and functional studies.

    PubMed

    Figaj, Donata; Gieldon, Artur; Polit, Agnieszka; Sobiecka-Szkatula, Anna; Koper, Tomasz; Denkiewicz, Milena; Banecki, Bogdan; Lesner, Adam; Ciarkowski, Jerzy; Lipinska, Barbara; Skorko-Glonek, Joanna

    2014-05-30

    Bacterial HtrAs are serine proteases engaged in extracytoplasmic protein quality control and are required for the virulence of several pathogenic species. The proteolytic activity of HtrA (DegP) from Escherichia coli, a model prokaryotic HtrA, is stimulated by stressful conditions; the regulation of this process is mediated by the LA, LD, L1, L2, and L3 loops. The precise mechanism of action of the LA loop is not known due to a lack of data concerning its three-dimensional structure as well as its mode of interaction with other regulatory elements. To address these issues we generated a theoretical model of the three-dimensional structure of the LA loop as per the resting state of HtrA and subsequently verified its correctness experimentally. We identified intra- and intersubunit contacts that formed with the LA loops; these played an important role in maintaining HtrA in its inactive conformation. The most significant proved to be the hydrophobic interactions connecting the LA loops of the hexamer and polar contacts between the LA' (the LA loop on an opposite subunit) and L1 loops on opposite subunits. Disturbance of these interactions caused the stimulation of HtrA proteolytic activity. We also demonstrated that LA loops contribute to the preservation of the integrity of the HtrA oligomer and to the stability of the monomer. The model presented in this work explains the regulatory role of the LA loop well; it should also be applicable to numerous Enterobacteriaceae pathogenic species as the amino acid sequences of the members of this bacterial family are highly conserved.

  14. Prolactin Regulatory Element Binding Protein Is Involved in Hepatitis C Virus Replication by Interaction with NS4B

    PubMed Central

    Kong, Lingbao; Fujimoto, Akira; Nakamura, Mariko; Aoyagi, Haruyo; Matsuda, Mami; Watashi, Koichi; Suzuki, Ryosuke; Arita, Minetaro; Yamagoe, Satoshi; Dohmae, Naoshi; Suzuki, Takehiro; Sakamaki, Yuriko; Ichinose, Shizuko; Suzuki, Tetsuro; Wakita, Takaji

    2016-01-01

    ABSTRACT It has been proposed that the hepatitis C virus (HCV) NS4B protein triggers the membranous HCV replication compartment, but the underlying molecular mechanism is not fully understood. Here, we screened for NS4B-associated membrane proteins by tandem affinity purification and proteome analysis and identified 202 host proteins. Subsequent screening of replicon cells with small interfering RNA identified prolactin regulatory element binding (PREB) to be a novel HCV host cofactor. The interaction between PREB and NS4B was confirmed by immunoprecipitation, immunofluorescence, and proximity ligation assays. PREB colocalized with double-stranded RNA and the newly synthesized HCV RNA labeled with bromouridine triphosphate in HCV replicon cells. Furthermore, PREB shifted to detergent-resistant membranes (DRMs), where HCV replication complexes reside, in the presence of NS4B expression in Huh7 cells. However, a PREB mutant lacking the NS4B-binding region (PREBd3) could not colocalize with double-stranded RNA and did not shift to the DRM in the presence of NS4B. These results indicate that PREB locates at the HCV replication complex by interacting with NS4B. PREB silencing inhibited the formation of the membranous HCV replication compartment and increased the protease and nuclease sensitivity of HCV replicase proteins and RNA in DRMs, respectively. Collectively, these data indicate that PREB promotes HCV RNA replication by participating in the formation of the membranous replication compartment and by maintaining its proper structure by interacting with NS4B. Furthermore, PREB was induced by HCV infection in vitro and in vivo. Our findings provide new insights into HCV host cofactors. IMPORTANCE The hepatitis C virus (HCV) protein NS4B can induce alteration of the endoplasmic reticulum and the formation of a membranous web structure, which provides a platform for the HCV replication complex. The molecular mechanism by which NS4B induces the membranous HCV replication

  15. Binding of TFIIIC to SINE Elements Controls the Relocation of Activity-Dependent Neuronal Genes to Transcription Factories

    PubMed Central

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T.; Jongbloets, Bart C.; Down, Thomas A.; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes. PMID:23966877

  16. Structure of an RNA dimer of a regulatory element from human thymidylate synthase mRNA

    SciTech Connect

    Dibrov, Sergey; McLean, Jaime; Hermann, Thomas

    2011-09-27

    A sequence around the start codon of the mRNA of human thymidylate synthase (TS) folds into a secondary-structure motif in which the initiation site is sequestered in a metastable hairpin. Binding of the protein to its own mRNA at the hairpin prevents the production of TS through a translation-repression feedback mechanism. Stabilization of the mRNA hairpin by other ligands has been proposed as a strategy to reduce TS levels in anticancer therapy. Rapidly proliferating cells require high TS activity to maintain the production of thymidine as a building block for DNA synthesis. The crystal structure of a model oligonucleotide (TS1) that represents the TS-binding site of the mRNA has been determined. While fluorescence studies showed that the TS1 RNA preferentially adopts a hairpin structure in solution, even at high RNA concentrations, an asymmetric dimer of two hybridized TS1 strands was obtained in the crystal. The TS1 dimer contains an unusual S-turn motif that also occurs in the 'off' state of the human ribosomal decoding site RNA.

  17. A recent evolutionary change affects a regulatory element in the human FOXP2 gene.

    PubMed

    Maricic, Tomislav; Günther, Viola; Georgiev, Oleg; Gehre, Sabine; Curlin, Marija; Schreiweis, Christiane; Naumann, Ronald; Burbano, Hernán A; Meyer, Matthias; Lalueza-Fox, Carles; de la Rasilla, Marco; Rosas, Antonio; Gajovic, Srecko; Kelso, Janet; Enard, Wolfgang; Schaffner, Walter; Pääbo, Svante

    2013-04-01

    The FOXP2 gene is required for normal development of speech and language. By isolating and sequencing FOXP2 genomic DNA fragments from a 49,000-year-old Iberian Neandertal and 50 present-day humans, we have identified substitutions in the gene shared by all or nearly all present-day humans but absent or polymorphic in Neandertals. One such substitution is localized in intron 8 and affects a binding site for the transcription factor POU3F2, which is highly conserved among vertebrates. We find that the derived allele of this site is less efficient than the ancestral allele in activating transcription from a reporter construct. The derived allele also binds less POU3F2 dimers than POU3F2 monomers compared with the ancestral allele. Because the substitution in the POU3F2 binding site is likely to alter the regulation of FOXP2 expression, and because it is localized in a region of the gene associated with a previously described signal of positive selection, it is a plausible candidate for having caused a recent selective sweep in the FOXP2 gene.

  18. Identification of a non-canonical E-box motif as a regulatory element in the proximal promoter region of the apolipoprotein E gene.

    PubMed Central

    Salero, Enrique; Giménez, Cecilio; Zafra, Francisco

    2003-01-01

    We have used the yeast one-hybrid system to identify transcription factors with binding capability to specific sequences in proximal regions of the apolipoprotein E gene ( APOE ) promoter. The sequence between -113 and -80 nt, which contains regulatory elements in various cell types, was used as a bait to screen a human brain cDNA library. Four cDNA clones that encoded portions of the human upstream-stimulatory-factor (USF) transcription factor were isolated. Electrophoretic-mobility-shift assays ('EMSAs') using nuclear extracts from various human cell lines as well as from rat brain and liver revealed the formation of two DNA-protein complexes within the sequence CACCTCGTGAC (region -101/-91 of the APOE promoter) that show similarity to the E-box element. The retarded complexes contained USF1, as deduced from competition and supershift assays. Functional experiments using different APOE promoter-luciferase reporter constructs transiently transfected into U87, HepG2 or HeLa cell lines showed that mutations that precluded the formation of complexes decreased the basal activity of the promoter by about 50%. Overexpression of USF1 in U87 glioblastoma cells led to an increased activity of the promoter that was partially mediated by the atypical E-box. The stimulatory effect of USF1 was cell-type specific, as it was not observed in hepatoma HepG2 cells. Similarly, overexpression of a USF1 dominant-negative mutant decreased the basal activity of the promoter in glioblastoma, but not in hepatoma, cells. These data indicated that USF, and probably other related transcription factors, might be involved in the basal transcriptional machinery of APOE by binding to a non-canonical E-box motif within the proximal promoter. PMID:12444925

  19. Control of tissue size and development by a regulatory element in the yorkie 3’UTR

    PubMed Central

    Umegawachi, Takanari; Yoshida, Hideki; Koshida, Hiromu; Yamada, Momoko; Ohkawa, Yasuyuki; Sato, Tetsuya; Suyama, Mikita; Krause, Henry M; Yamaguchi, Masamitsu

    2017-01-01

    Regulation of the Hippo pathway via phosphorylation of Yorkie (Yki), the Drosophila homolog of human Yes-associated protein 1, is conserved from Drosophila to humans. Overexpression of a non-phosphorylatable form of Yki induces severe overgrowth in adult fly eyes. Here, we show that yki mRNA associates with microsomal fractions and forms foci that partially colocalize to processing bodies in the vicinity of endoplasmic reticulum. This localization is dependent on a stem-loop (SL) structure in the 3’ untranslated region of yki. Surprisingly, expression of SL deleted yki in eye imaginal discs also results in severe overgrowth phenotypes. When the structure of the SL is disrupted, Yki protein levels increase without a significant effect on RNA levels. When the SL is completely removed, protein levels drastically increase, but in this case, due to increased RNA stability. In the latter case, we show that the increased RNA accumulation is due to removal of a putative miR-8 seed sequence in the SL. These data demonstrate the function of two novel regulatory mechanisms, both controlled by the yki SL element, that are essential for proper Hippo pathway mediated growth regulation.

  20. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki

    2005-01-01

    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  1. Combining Hi-C data with phylogenetic correlation to predict the target genes of distal regulatory elements in human genome.

    PubMed

    Lu, Yulan; Zhou, Yuanpeng; Tian, Weidong

    2013-12-01

    Defining the target genes of distal regulatory elements (DREs), such as enhancer, repressors and insulators, is a challenging task. The recently developed Hi-C technology is designed to capture chromosome conformation structure by high-throughput sequencing, and can be potentially used to determine the target genes of DREs. However, Hi-C data are noisy, making it difficult to directly use Hi-C data to identify DRE-target gene relationships. In this study, we show that DREs-gene pairs that are confirmed by Hi-C data are strongly phylogenetic correlated, and have thus developed a method that combines Hi-C read counts with phylogenetic correlation to predict long-range DRE-target gene relationships. Analysis of predicted DRE-target gene pairs shows that genes regulated by large number of DREs tend to have essential functions, and genes regulated by the same DREs tend to be functionally related and co-expressed. In addition, we show with a couple of examples that the predicted target genes of DREs can help explain the causal roles of disease-associated single-nucleotide polymorphisms located in the DREs. As such, these predictions will be of importance not only for our understanding of the function of DREs but also for elucidating the causal roles of disease-associated noncoding single-nucleotide polymorphisms.

  2. Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element

    PubMed Central

    Wang, Lizheng; Wang, Zixuan; Zhang, Fangfang; Zhu, Rui; Bi, Jinpeng; Wu, Jiaxin; Zhang, Haihong; Wu, Hui; Kong, Wei; Yu, Bin; Yu, Xianghui

    2016-01-01

    Adeno-associated virus (AAV) vectors have been utilized extensively in gene therapy and gene function studies, as strong transgene expression is a prerequisite for positive outcomes. AAV8 was reported as the most efficient AAV serotype for transduction of the liver, brain and muscle compared with other serotypes. However, AAV8-mediated transduction of human hepatocytes is rather poor with approximately 20-fold lower efficiency compared with that of mouse hepatocytes. Therefore, we applied the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) to enhance AAV8-mediated transgene expression driven by a combination promoter (CAG promoter) with a CMV-IE enhancer and chicken beta-actin promoter for a more efficient viral vector. Transgene expression from recombinant AAV8 (rAAV8) vectors harboring a red fluorescent protein (RFP) reporter gene with or without WPRE were evaluated in vitro and in vivo. The results demonstrated that WPRE improved AAV8-mediated RFP expression in different cell lines with clear increases of transgene expression in the liver, brain or muscle of animals. The findings of this study will help to substantially reduce the quantity of viral particles that must be injected in order to reach a therapeutic level of transgene expression in gene therapy. Consequently, such dose reductions may lessen the potential risks associated with high doses of viral vectors. PMID:27076785

  3. Regulatory Crosstalk by Protein Kinases on CFTR Trafficking and Activity

    PubMed Central

    Farinha, Carlos M.; Swiatecka-Urban, Agnieszka; Brautigan, David L.; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e., channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease. PMID:26835446

  4. Regulatory crosstalk by protein kinases on CFTR trafficking and activity

    NASA Astrophysics Data System (ADS)

    Farinha, Carlos Miguel; Swiatecka-Urban, Agnieszka; Brautigan, David; Jordan, Peter

    2016-01-01

    Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a member of the ATP binding cassette (ABC) transporter superfamily that functions as a cAMP-activated chloride ion channel in fluid-transporting epithelia. There is abundant evidence that CFTR activity (i.e. channel opening and closing) is regulated by protein kinases and phosphatases via phosphorylation and dephosphorylation. Here, we review recent evidence for the role of protein kinases in regulation of CFTR delivery to and retention in the plasma membrane. We review this information in a broader context of regulation of other transporters by protein kinases because the overall functional output of transporters involves the integrated control of both their number at the plasma membrane and their specific activity. While many details of the regulation of intracellular distribution of CFTR and other transporters remain to be elucidated, we hope that this review will motivate research providing new insights into how protein kinases control membrane transport to impact health and disease.

  5. Active and regulatory sites of cytosolic 5'-nucleotidase.

    PubMed

    Pesi, Rossana; Allegrini, Simone; Careddu, Maria Giovanna; Filoni, Daniela Nicole; Camici, Marcella; Tozzi, Maria Grazia

    2010-12-01

    Cytosolic 5'-nucleotidase (cN-II), which acts preferentially on 6-hydroxypurine nucleotides, is essential for the survival of several cell types. cN-II catalyses both the hydrolysis of nucleotides and transfer of their phosphate moiety to a nucleoside acceptor through formation of a covalent phospho-intermediate. Both activities are regulated by a number of phosphorylated compounds, such as diadenosine tetraphosphate (Ap₄A), ADP, ATP, 2,3-bisphosphoglycerate (BPG) and phosphate. On the basis of a partial crystal structure of cN-II, we mutated two residues located in the active site, Y55 and T56. We ascertained that the ability to catalyse the transfer of phosphate depends on the presence of a bulky residue in the active site very close to the aspartate residue that forms the covalent phospho-intermediate. The molecular model indicates two possible sites at which adenylic compounds may interact. We mutated three residues that mediate interaction in the first activation site (R144, N154, I152) and three in the second (F127, M436 and H428), and found that Ap₄A and ADP interact with the same site, but the sites for ATP and BPG remain uncertain. The structural model indicates that cN-II is a homotetrameric protein that results from interaction through a specific interface B of two identical dimers that have arisen from interaction of two identical subunits through interface A. Point mutations in the two interfaces and gel-filtration experiments indicated that the dimer is the smallest active oligomerization state. Finally, gel-filtration and light-scattering experiments demonstrated that the native enzyme exists as a tetramer, and no further oligomerization is required for enzyme activation.

  6. Distribution of the trehalase activation response and the regulatory trehalase gene among yeast species.

    PubMed

    Soto, T; Fernández, J; Cansado, J; Vicente, J; Gacto, M

    1997-12-01

    In Saccharomyces cerevisiae and other yeasts the activity of regulatory trehalases increases in response to the addition of glucose and to thermal changes in the extracellular medium. We have performed an screening on the extent of this response among different representative yeast species and the results show that this ability is displayed only by a few members of the Saccharomycetaceae family. However, all yeasts examined contain a gene related to that coding for regulatory trehalase in S. cerevisiae. This finding reveals that the operational distinction between regulatory and nonregulatory trehalase in yeasts is not a property of the enzyme by itself but relays on the expression of accompanying mechanisms able to modulate trehalase activity.

  7. THE INITIAL PHASE OF AN IMMUNE RESPONSE FUNCTIONS TO ACTIVATE REGULATORY T CELLS

    PubMed Central

    O’Gorman, William E.; Dooms, Hans; Thorne, Steve H.; Kuswanto, Wilson F.; Simonds, Erin F.; Krutzik, Peter O.; Nolan, Garry P.; Abbas, Abul K.

    2009-01-01

    An early reaction of CD4+ T lymphocytes to antigen is the production of cytokines, notably IL-2. In order to detect cytokine dependent responses, naive antigen-specific T cells were stimulated in vivo and the presence of phosphorylated STAT5 molecules was used to identify the cell populations responding to IL-2. Within hours of T-cell priming, IL-2-dependent STAT5 phosphorylation occurred primarily in Foxp3+ regulatory T cells. In contrast, the antigen-specific T cells received STAT5 signals only after repeated antigen exposure or memory differentiation. Regulatory T cells receiving IL-2 signals proliferated and developed enhanced suppressive activity. These results indicate that one of the earliest events in a T cell response is the activation of endogenous regulatory cells, potentially to prevent autoimmunity. PMID:19542444

  8. The regulatory elements of araBAD operon, contrary to lac-based expression systems, afford hypersynthesis of murine, and human interferons in Escherichia coli.

    PubMed

    Stefan, Alessandra; Alfarano, Pietro; Merulla, Davide; Mattana, Paolo; Rolli, Eleonora; Mangino, Pierluigi; Masotti, Lanfranco; Hochkoeppler, Alejandro

    2009-01-01

    The overexpression of four different interferons, i.e., murine interferon alpha1 and human interferons alpha1, alpha 8, and alpha 21 was challenged in Escherichia coli. Synthetic genes coding for these interferons were designed, assembled, and cloned into the vector pET9a (using the NdeI and BamHI sites), placing interferon expression under the control of phage T7 promoter. Despite an intensive screening for optimal culture conditions, no interferon synthesis was observed using overexpression systems based on the regulatory elements of lac operon (e.g., in E. coli BL21DE3). On the contrary, high levels of interferon expression were detected in E. coli BL21AI, which chromosome contains the gene coding for phage T7 RNA polymerase under the control of the araBAD promoter. To analyze the reasons of this striking difference, the molecular events associated with the lack of interferon expression in E. coli BL21DE3 were studied, and murine interferon alpha1 was chosen as a model system. Surprisingly, it was observed that this interferon represses the synthesis of T7 RNA polymerase in E. coli BL21DE3 and, in particular, the expression of lac operon. In fact, by determining beta-galactosidase activity in E. coli BL21AI, a significantly lower LacZ activity was observed in cells induced to interferon synthesis.

  9. A distinct regulatory region of the Bmp5 locus activates gene expression following adult bone fracture or soft tissue injury.

    PubMed

    Guenther, Catherine A; Wang, Zhen; Li, Emma; Tran, Misha C; Logan, Catriona Y; Nusse, Roel; Pantalena-Filho, Luiz; Yang, George P; Kingsley, David M

    2015-08-01

    Bone morphogenetic proteins (BMPs) are key signaling molecules required for normal development of bones and other tissues. Previous studies have shown that null mutations in the mouse Bmp5 gene alter the size, shape and number of multiple bone and cartilage structures during development. Bmp5 mutations also delay healing of rib fractures in adult mutants, suggesting that the same signals used to pattern embryonic bone and cartilage are also reused during skeletal regeneration and repair. Despite intense interest in BMPs as agents for stimulating bone formation in clinical applications, little is known about the regulatory elements that control developmental or injury-induced BMP expression. To compare the DNA sequences that activate gene expression during embryonic bone formation and following acute injuries in adult animals, we assayed regions surrounding the Bmp5 gene for their ability to stimulate lacZ reporter gene expression in transgenic mice. Multiple genomic fragments, distributed across the Bmp5 locus, collectively coordinate expression in discrete anatomic domains during normal development, including in embryonic ribs. In contrast, a distinct regulatory region activated expression following rib fracture in adult animals. The same injury control region triggered gene expression in mesenchymal cells following tibia fracture, in migrating keratinocytes following dorsal skin wounding, and in regenerating epithelial cells following lung injury. The Bmp5 gene thus contains an "injury response" control region that is distinct from embryonic enhancers, and that is activated by multiple types of injury in adult animals.

  10. Multiple positive and negative 5' regulatory elements control the cell-type-specific expression of the embryonic skeletal myosin heavy-chain gene.

    PubMed Central

    Bouvagnet, P F; Strehler, E E; White, G E; Strehler-Page, M A; Nadal-Ginard, B; Mahdavi, V

    1987-01-01

    To identify the DNA sequences that regulate the expression of the sarcomeric myosin heavy-chain (MHC) genes in muscle cells, a series of deletion constructs of the rat embryonic MHC gene was assayed for transient expression after introduction into myogenic and nonmyogenic cells. The sequences in 1.4 kilobases of 5'-flanking DNA were found to be sufficient to direct expression of the MHC gene constructs in a tissue-specific manner (i.e., in differentiated muscle cells but not in undifferentiated muscle and nonmuscle cells). Three main distinct regulatory domains have been identified: (i) the upstream sequences from positions -1413 to -174, which determine the level of expression of the MHC gene and are constituted of three positive regulatory elements and two negative ones; (ii) a muscle-specific regulatory element from positions -173 to -142, which restricts the expression of the MHC gene to muscle cells; and (iii) the promoter region, downstream from position -102, which directs transcription initiation. Introduction of the simian virus 40 enhancer into constructs where subportions of or all of the upstream sequences are deleted (up to position -173) strongly increases the level of expression of such truncated constructs but without changing their muscle specificity. These upstream sequences, which can be substituted for by the simian virus 40 enhancer, function in an orientation-, position-, and promoter-dependent fashion. The muscle-specific element is also promoter specific but does not support efficient expression of the MHC gene. The MHC promoter in itself is not muscle specific. These results underline the importance of the concerted action of multiple regulatory elements that are likely to represent targets for DNA-binding-regulatory proteins. Images PMID:2830491

  11. Analysis of a DNase I-hypersensitive site in transgenic Drosophila reveals a key regulatory element of Sgs3.

    PubMed Central

    Ramain, P; Giangrande, A; Richards, G; Bellard, M

    1988-01-01

    We have undertaken chromatin studies on transformed Drosophila strains carrying DNA sequences modified in the region of the DNase I (EC 3.1.4.5)-hypersensitive sites -750 and -600 base pairs upstream from the Sgs3 start site. Although both sites are developmentally specific, modifications in the -750 site have little or no effect on Sgs3-encoded transcript levels, whereas either deletion or replacement of sequences at the -600 site causes an important reduction in transcript levels. The element associated with the -600 site enhances Sgs3 transcription when displaced with respect to the start site. This combined approach has defined sequence elements necessary both for normal transcript levels as well as the chromatin structure characteristic of Sgs3 activity in vivo. Images PMID:3128796

  12. Allowance trading activity and state regulatory rulings: Evidence from the US Acid Rain Program

    SciTech Connect

    Bailey, E.M.

    1997-12-31

    The US Acid Rain Program is one of the first, and by far the most extensive, applications of a market based approach to pollution control. From the beginning, there has been concern whether utilities would participate in allowance trading, and whether regulatory activity at the state level would further complicate utilities` decision to trade allowances. This paper finds that public utility commission regulation has encouraged allowance trading activity in states with regulatory rulings, but that allowance trading activity has not been limited to states issuing regulations. Until there is evidence suggesting that significant additional cost savings could have been obtained if additional allowance trading activity had occurred in states without regulations or that utilities in states with regulations are still not taking advantage of all cost saving trading opportunities, this analysis suggests that there is little reason to believe that allowance trading activity is impeded by public utility commission regulations.

  13. Coordinated activities of human dicer domains in regulatory RNA processing.

    PubMed

    Ma, Enbo; Zhou, Kaihong; Kidwell, Mary Anne; Doudna, Jennifer A

    2012-09-28

    The conserved ribonuclease Dicer generates microRNAs and short-interfering RNAs that guide gene silencing in eukaryotes. The specific contributions of human Dicer's structural domains to RNA product length and substrate preference are incompletely understood, due in part to the difficulties of Dicer purification. Here, we show that active forms of human Dicer can be assembled from recombinant polypeptides expressed in bacteria. Using this system, we find that three distinct modes of RNA recognition give rise to Dicer's fidelity and product length specificity. The first involves anchoring one end of a double-stranded RNA helix within the PAZ domain, which can assemble in trans with Dicer's catalytic domains to reconstitute an accurate but non-substrate-selective dicing activity. The second entails nonspecific RNA binding by the double-stranded RNA binding domain, an interaction that is essential for substrate recruitment in the absence of the PAZ domain. The third mode of recognition involves hairpin RNA loop recognition by the helicase domain, which ensures efficient processing of specific substrates. These results reveal distinct interactions of each Dicer domain with different RNA structural features and provide a facile system for investigating the molecular mechanisms of human microRNA biogenesis.

  14. EPA ACTIVITIES TO PREPARE FOR REGULATORY AND RISK ASSESSMENT APPLICATIONS OF GENOMICS INFORMATION

    EPA Science Inventory

    Genomics will have significant implications for risk assessment and regulatory decision making. Since 2002, the U.S. EPA has undertaken a number of cross-Agency activities to further prepare itself to receive,interpret and apply genomics information for risk assessment and regul...

  15. Cellular localization of the embryo-specific hybrid PRP from Zea mays, and characterization of promoter regulatory elements of its gene.

    PubMed

    Jose-Estanyol, M; Puigdomènech, P

    2012-10-01

    The expression, regulation and cellular localization of ZmHyPRP, a gene marker of embryo differentiation whose expression declines after ABA induction, was studied. ZmHyPRP is a proline-rich protein with a C-terminal domain having eight cysteines in a CM8 pattern. Transient expression in onion epidermal cells, transformed with a 2x35S::ZmHyPRP-GFP construction, indicated the protein is present in vesicles lining the membrane of the cell. The ZmHyPRP gene expression is under the control of classic promoter seed-specific regulatory elements such as Sph/RY and G-boxes, suggesting regulation by B3 and b-ZIP transcription factors. Promoter deletion analysis, by particle-bombardment transient transformation of maize immature embryos with serial deletions of the promoter fused to GUS, showed the presence of two negative regulatory elements, NE1 (-2070 to -1280) and NE2 (-232 to -178), in the ZmHyPRP promoter. By selective deletion or mutation of ZmHyPRP regulatory promoter elements we conclude that the promoter expression is attenuated by the NE2 element as well as by the G-box2 and the Sph1-2 box together with the G-box2.

  16. Detection of a novel active transposable element in Caldicellulosiruptor hydrothermalis and a new search for elements in this genus.

    PubMed

    Chung, Daehwan; Farkas, Joel; Westpheling, Janet

    2013-05-01

    We show that a previously annotated hypothetical protein is the transposase of a new and active IS element, ISCahy1, widespread in Caldicellulosiruptor species. Transposition generated an 11-bp direct repeat at the insertion site in Caldicellulosiruptor hydrothermalis, suggesting a cut-and-paste mechanism. The discovery of an active insertion sequence in Caldicellulosiruptor species led to a survey of potential IS elements in the genome sequences of eight Caldicellulosiruptor species that identified several new elements, including one novel to this genus.

  17. Matching Element Symbols with State Abbreviations: A Fun Activity for Browsing the Periodic Table of Chemical Elements

    ERIC Educational Resources Information Center

    Woelk, Klaus

    2009-01-01

    A classroom activity is presented in which students are challenged to find matches between the United States two-letter postal abbreviations for states and chemical element symbols. The activity aims to lessen negative apprehensions students might have when the periodic table of the elements with its more than 100 combinations of letters is first…

  18. Transition Metals Catalyzed Element-Cyano Bonds Activations

    PubMed Central

    Wang, Rui; Falck, John R.

    2014-01-01

    Cyano group as a versatile functionalized intermediate has been explored for several decades, as it readily transfers to many useful functionalization groups such as amine, amide, acid, etc., which make it possess high popularization and use value in organic synthesis. Reactions involved with element-cyano bond cleavage can provide not only a new cyano group but also a freshly functionalized skeleton in one-pot, consequently making it of high importance. The highlights reviewed herein include H-CN, Si-CN, C-CN, B-CN, Sn-CN, Ge-CN, S-CN, Halo-CN, N-CN, and O-CN bonds cleavages and will summarize progress in such an important research area. This review article will focus on transition metal catalyzed reactions involving element-cyano bond activation. PMID:25558119

  19. Bacterial Manipulation of NK Cell Regulatory Activity Increases Susceptibility to Listeria monocytogenes Infection

    PubMed Central

    Guthrie, Brandon S.; Schmidt, Rebecca L.; Jamieson, Amanda; Merkel, Patricia; Knight, Vijaya; Cole, Caroline M.; Raulet, David H.; Lenz, Laurel L.

    2016-01-01

    Natural killer (NK) cells produce interferon (IFN)-γ and thus have been suggested to promote type I immunity during bacterial infections. Yet, Listeria monocytogenes (Lm) and some other pathogens encode proteins that cause increased NK cell activation. Here, we show that stimulation of NK cell activation increases susceptibility during Lm infection despite and independent from robust NK cell production of IFNγ. The increased susceptibility correlated with IL-10 production by responding NK cells. NK cells produced IL-10 as their IFNγ production waned and the Lm virulence protein p60 promoted induction of IL-10 production by mouse and human NK cells. NK cells consequently exerted regulatory effects to suppress accumulation and activation of inflammatory myeloid cells. Our results reveal new dimensions of the role played by NK cells during Lm infection and demonstrate the ability of this bacterial pathogen to exploit the induction of regulatory NK cell activity to increase host susceptibility. PMID:27295349

  20. Intersubunit capture of regulatory segments is a component of cooperative CaMKII activation.

    PubMed

    Chao, Luke H; Pellicena, Patricia; Deindl, Sebastian; Barclay, Lauren A; Schulman, Howard; Kuriyan, John

    2010-03-01

    The dodecameric holoenzyme of calcium-calmodulin-dependent protein kinase II (CaMKII) responds to high-frequency Ca(2+) pulses to become Ca(2+) independent. A simple coincidence-detector model for Ca(2+)-frequency dependency assumes noncooperative activation of kinase domains. We show that activation of CaMKII by Ca(2+)-calmodulin is cooperative, with a Hill coefficient of approximately 3.0, implying sequential kinase-domain activation beyond dimeric units. We present data for a model in which cooperative activation includes the intersubunit 'capture' of regulatory segments. Such a capture interaction is seen in a crystal structure that shows extensive contacts between the regulatory segment of one kinase and the catalytic domain of another. These interactions are mimicked by a natural inhibitor of CaMKII. Our results show that a simple coincidence-detection model cannot be operative and point to the importance of kinetic dissection of the frequency-response mechanism in future experiments.

  1. Epstein–Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression

    PubMed Central

    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B.; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G.; Sinclair, Alison J.

    2015-01-01

    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  2. Blue eye color in humans may be caused by a perfectly associated founder mutation in a regulatory element located within the HERC2 gene inhibiting OCA2 expression.

    PubMed

    Eiberg, Hans; Troelsen, Jesper; Nielsen, Mette; Mikkelsen, Annemette; Mengel-From, Jonas; Kjaer, Klaus W; Hansen, Lars

    2008-03-01

    The human eye color is a quantitative trait displaying multifactorial inheritance. Several studies have shown that the OCA2 locus is the major contributor to the human eye color variation. By linkage analysis of a large Danish family, we finemapped the blue eye color locus to a 166 Kbp region within the HERC2 gene. By association analyses, we identified two SNPs within this region that were perfectly associated with the blue and brown eye colors: rs12913832 and rs1129038. Of these, rs12913832 is located 21.152 bp upstream from the OCA2 promoter in a highly conserved sequence in intron 86 of HERC2. The brown eye color allele of rs12913832 is highly conserved throughout a number of species. As shown by a Luciferase assays in cell cultures, the element significantly reduces the activity of the OCA2 promoter and electrophoretic mobility shift assays demonstrate that the two alleles bind different subsets of nuclear extracts. One single haplotype, represented by six polymorphic SNPs covering half of the 3' end of the HERC2 gene, was found in 155 blue-eyed individuals from Denmark, and in 5 and 2 blue-eyed individuals from Turkey and Jordan, respectively. Hence, our data suggest a common founder mutation in an OCA2 inhibiting regulatory element as the cause of blue eye color in humans. In addition, an LOD score of Z = 4.21 between hair color and D14S72 was obtained in the large family, indicating that RABGGTA is a candidate gene for hair color.

  3. Active control of multi-element rotor blade airfoils

    NASA Technical Reports Server (NTRS)

    Torok, Michael S. (Inventor); Moffitt, Robert C. (Inventor); Bagai, Ashish (Inventor)

    2005-01-01

    A multi-element rotor blade includes an individually controllable main element and fixed aerodynamic surface in an aerodynamically efficient location relative to the main element. The main element is controlled to locate the fixed aerodynamic surface in a position to increase lift and/or reduce drag upon the main element at various azimuthal positions during rotation.

  4. Negative regulatory element associated with potentially functional promoter and enhancer elements in the long terminal repeats of endogenous murine leukemia virus-related proviral sequences

    SciTech Connect

    Ch'ang, L.Y.; Yang, W.K.; Myer, F.E.; Yang, D.M.

    1989-06-01

    Three series of recombinant DNA clones were constructed, with the bacterial chloramphenical acetyltransferase (CAT) gene as a quantitative indicator, to examine the activities of promoter and enhancer sequence elements in the 5' long terminal repeat (LTR) of murine leukemia virus (MuLV)-related proviral sequences isolated from the mouse genome. Transient CAT expression was determined in mouse NIH 3T3, human HT1080, and mink CCL64 cultured cells transfected with the LTR-CAT constructs. The 700-base pair (bp) LTRs of three polytropic MuLV-related proviral clones and the 750-bp LTRs of four modified polytropic proviral clones, in complete structures either with or without the adjacent downstream sequences, all showed very little or negligible activities for CAT expression, while ecotropic MuLV LTRs were highly active. The MuLV-related LTRs were divided into three portions and examined separately. The 3' portion of the MuLV-related LTRs that contains the CCAAC and TATAA boxes was found to be a functional promoter, being about one-half to one-third as active as the corresponding portion of the ecotropic MuLV LTRs. A MboI-Bg/II fragment, representing the distinct 190- to 200-pb inserted segment in the middle, was found to be a potential enhancer, especially when examined in combination with the simian virus 40 promoter in CCL64 cells. A PstI-MboI fragment of the 5' portion, which contains the protein-binding motifs on the enhancer segment as well as the upstream LTF sequences, showed moderate enhancer activities in CCL6 cells but was virtually inactive in NIH 3T3 cells and HT1080 cells; addition of this fragment to the ecotropic LTR-CAT constructs depressed CAT expression.

  5. Regulatory guidance document

    SciTech Connect

    1994-05-01

    The Office of Civilian Radioactive Waste Management (OCRWM) Program Management System Manual requires preparation of the OCRWM Regulatory Guidance Document (RGD) that addresses licensing, environmental compliance, and safety and health compliance. The document provides: regulatory compliance policy; guidance to OCRWM organizational elements to ensure a consistent approach when complying with regulatory requirements; strategies to achieve policy objectives; organizational responsibilities for regulatory compliance; guidance with regard to Program compliance oversight; and guidance on the contents of a project-level Regulatory Compliance Plan. The scope of the RGD includes site suitability evaluation, licensing, environmental compliance, and safety and health compliance, in accordance with the direction provided by Section 4.6.3 of the PMS Manual. Site suitability evaluation and regulatory compliance during site characterization are significant activities, particularly with regard to the YW MSA. OCRWM`s evaluation of whether the Yucca Mountain site is suitable for repository development must precede its submittal of a license application to the Nuclear Regulatory Commission (NRC). Accordingly, site suitability evaluation is discussed in Chapter 4, and the general statements of policy regarding site suitability evaluation are discussed in Section 2.1. Although much of the data and analyses may initially be similar, the licensing process is discussed separately in Chapter 5. Environmental compliance is discussed in Chapter 6. Safety and Health compliance is discussed in Chapter 7.

  6. Vertebrate mRNAs with a 5'-terminal pyrimidine tract are candidates for translational repression in quiescent cells: characterization of the translational cis-regulatory element.

    PubMed Central

    Avni, D; Shama, S; Loreni, F; Meyuhas, O

    1994-01-01

    The translation of mammalian ribosomal protein (rp) mRNAs is selectively repressed in nongrowing cells. This response is mediated through a regulatory element residing in the 5' untranslated region of these mRNAs and includes a 5' terminal oligopyrimidine tract (5' TOP). To further characterize the translational cis-regulatory element, we monitored the translational behavior of various endogenous and heterologous mRNAs or hybrid transcripts derived from transfected chimeric genes. The translational efficiency of these mRNAs was assessed in cells that either were growing normally or were growth arrested under various physiological conditions. Our experiments have yielded the following results: (i) the translation of mammalian rp mRNAs is properly regulated in amphibian cells, and likewise, amphibian rp mRNA is regulated in mammalian cells, indicating that all of the elements required for translation control of rp mRNAs are conserved among vertebrate classes; (ii) selective translational control is not confined to rp mRNAs, as mRNAs encoding the naturally occurring ubiquitin-rp fusion protein and elongation factor 1 alpha, which contain a 5' TOP, also conform this mode of regulation; (iii) rat rpP2 mRNA contains only five pyrimidines in its 5' TOP, yet this mRNA is translationally controlled in the same fashion as other rp mRNAs with a 5' TOP of eight or more pyrimidines; (iv) full manifestation of this mode of regulation seems to require both the 5' TOP and sequences immediately downstream; and (v) an intact translational regulatory element from rpL32 mRNA fails to exert its regulatory properties even when preceded by a single A residue. Images PMID:8196625

  7. Nuclear Thermal Rocket Element Environmental Simulator (NTREES) Upgrade Activities

    NASA Technical Reports Server (NTRS)

    Emrich, William J., Jr.

    2014-01-01

    Over the past year the Nuclear Thermal Rocket Element Environmental Simulator (NTREES) has been undergoing a significant upgrade beyond its initial configuration. The NTREES facility is designed to perform realistic non-nuclear testing of nuclear thermal rocket (NTR) fuel elements and fuel materials. Although the NTREES facility cannot mimic the neutron and gamma environment of an operating NTR, it can simulate the thermal hydraulic environment within an NTR fuel element to provide critical information on material performance and compatibility. The first phase of the upgrade activities which was completed in 2012 in part consisted of an extensive modification to the hydrogen system to permit computer controlled operations outside the building through the use of pneumatically operated variable position valves. This setup also allows the hydrogen flow rate to be increased to over 200 g/sec and reduced the operation complexity of the system. The second stage of modifications to NTREES which has just been completed expands the capabilities of the facility significantly. In particular, the previous 50 kW induction power supply has been replaced with a 1.2 MW unit which should allow more prototypical fuel element temperatures to be reached. The water cooling system was also upgraded to so as to be capable of removing 100% of the heat generated during. This new setup required that the NTREES vessel be raised onto a platform along with most of its associated gas and vent lines. In this arrangement, the induction heater and water systems are now located underneath the platform. In this new configuration, the 1.2 MW NTREES induction heater will be capable of testing fuel elements and fuel materials in flowing hydrogen at pressures up to 1000 psi at temperatures up to and beyond 3000 K and at near-prototypic reactor channel power densities. NTREES is also capable of testing potential fuel elements with a variety of propellants, including hydrogen with additives to inhibit

  8. APG: an Active Protein-Gene network model to quantify regulatory signals in complex biological systems.

    PubMed

    Wang, Jiguang; Sun, Yidan; Zheng, Si; Zhang, Xiang-Sun; Zhou, Huarong; Chen, Luonan

    2013-01-01

    Synergistic interactions among transcription factors (TFs) and their cofactors collectively determine gene expression in complex biological systems. In this work, we develop a novel graphical model, called Active Protein-Gene (APG) network model, to quantify regulatory signals of transcription in complex biomolecular networks through integrating both TF upstream-regulation and downstream-regulation high-throughput data. Firstly, we theoretically and computationally demonstrate the effectiveness of APG by comparing with the traditional strategy based only on TF downstream-regulation information. We then apply this model to study spontaneous type 2 diabetic Goto-Kakizaki (GK) and Wistar control rats. Our biological experiments validate the theoretical results. In particular, SP1 is found to be a hidden TF with changed regulatory activity, and the loss of SP1 activity contributes to the increased glucose production during diabetes development. APG model provides theoretical basis to quantitatively elucidate transcriptional regulation by modelling TF combinatorial interactions and exploiting multilevel high-throughput information.

  9. Unraveling the regulatory network of IncA/C plasmid mobilization: When genomic islands hijack conjugative elements.

    PubMed

    Carraro, Nicolas; Matteau, Dominick; Burrus, Vincent; Rodrigue, Sébastien

    2015-01-01

    Conjugative plasmids of the A/C incompatibility group (IncA/C) have become substantial players in the dissemination of multidrug resistance. These large conjugative plasmids are characterized by their broad host-range, extended spectrum of antimicrobials resistance, and prevalence in enteric bacteria recovered from both environmental and clinical settings. Until recently, relatively little was known about the basic biology of IncA/C plasmids, mostly because of the hindrance of multidrug resistance for molecular biology experiments. To circumvent this issue, we previously developed pVCR94ΔX, a convenient prototype that codes for a reduced set of antibiotic resistances. Using pVCR94ΔX, we then characterized the regulatory pathway governing IncA/C plasmid dissemination. We found that the expression of roughly 2 thirds of the genes encoded by this plasmid, including large operons involved in the conjugation process, depends on an FlhCD-like master activator called AcaCD. Beyond the mobility of IncA/C plasmids, AcaCD was also shown to play a key role in the mobilization of different classes of genomic islands (GIs) identified in various pathogenic bacteria. By doing so, IncA/C plasmids can have a considerable impact on bacterial genomes plasticity and evolution.

  10. Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements.

    PubMed

    Lutz, R; Bujard, H

    1997-03-15

    Based on parameters governing promoter activity and using regulatory elements of the lac, ara and tet operon transcription control sequences were composed which permit the regulation in Escherichia coli of several gene activities independently and quantitatively. The novel promoter PLtetO-1 allows the regulation of gene expression over an up to 5000-fold range with anhydrotetracycline (aTc) whereas with IPTG and arabinose the activity of Plac/ara-1 may be controlled 1800-fold. Escherichia coli host strains which produce defined amounts of the regulatory proteins, Lac and Tet repressor as well as AraC from chromosomally located expression units provide highly reproducible in vivo conditions. Controlling the expression of the genes encoding luciferase, the low abundance E.coli protein DnaJ and restriction endonuclease Cfr9I not only demonstrates that high levels of expression can be achieved but also suggests that under conditions of optimal repression only around one mRNA every 3rd generation is produced. This potential of quantitative control will open up new approaches in the study of gene function in vivo, in particular with low abundance regulatory gene products. The system will also provide new opportunities for the controlled expression of heterologous genes.

  11. A cis-acting regulatory element that affects the alternative splicing of a muscle-specific exon in the mouse NCAM gene.

    PubMed

    Kawahigashi, H; Harada, Y; Asano, A; Nakamura, M

    1998-05-11

    The pre-mRNA encoding the neural cell adhesion molecule (NCAM) is spliced to generate NCAM isoforms containing the muscle-specific domain (MSD) during myogenesis. Utilizing chimeric NCAM minigenes, we searched for cis-acting elements that contribute to the alternative selection of exon MSDb, one of the four exons encoding MSD, and identified an intronic cis-element located downstream of exon MSDb. The cis-element acted as a negative regulator for the selection of exon MSDb in nonmuscle fibroblasts but not in myoblasts, that are already destined to differentiate into muscle cells. The suppressive effect of this cis-element on the selection of exon MSDb was released in the process of myogenesis. When MyoD was co-expressed with a minigene containing this element in fibroblasts, the suppressive effect of the cis-element was released as the cells underwent differentiation. We propose that this cis-element contributes at least as one of the regulatory elements in the differentiation state-dependent selection of MSD exons in vivo.

  12. Tempo and Mode of Transposable Element Activity in Drosophila

    PubMed Central

    Kofler, Robert; Nolte, Viola; Schlötterer, Christian

    2015-01-01

    The evolutionary dynamics of transposable element (TE) insertions have been of continued interest since TE activity has important implications for genome evolution and adaptation. Here, we infer the transposition dynamics of TEs by comparing their abundance in natural D. melanogaster and D. simulans populations. Sequencing pools of more than 550 South African flies to at least 320-fold coverage, we determined the genome wide TE insertion frequencies in both species. We suggest that the predominance of low frequency insertions in the two species (>80% of the insertions have a frequency <0.2) is probably due to a high activity of more than 58 families in both species. We provide evidence for 50% of the TE families having temporally heterogenous transposition rates with different TE families being affected in the two species. While in D. melanogaster retrotransposons were more active, DNA transposons showed higher activity levels in D. simulans. Moreover, we suggest that LTR insertions are mostly of recent origin in both species, while DNA and non-LTR insertions are older and more frequently vertically transmitted since the split of D. melanogaster and D. simulans. We propose that the high TE activity is of recent origin in both species and a consequence of the demographic history, with habitat expansion triggering a period of rapid evolution. PMID:26186437

  13. Sequential activation and distinct functions for distal and proximal modules within the IgH 3′ regulatory region

    PubMed Central

    Garot, Armand; Marquet, Marie; Saintamand, Alexis; Bender, Sébastien; Le Noir, Sandrine; Rouaud, Pauline; Carrion, Claire; Oruc, Zéliha; Bébin, Anne-Gaëlle; Moreau, Jeanne; Lebrigand, Kevin; Denizot, Yves; Alt, Frederick W.; Cogné, Michel; Pinaud, Eric

    2016-01-01

    As a master regulator of functional Ig heavy chain (IgH) expression, the IgH 3′ regulatory region (3′RR) controls multiple transcription events at various stages of B-cell ontogeny, from newly formed B cells until the ultimate plasma cell stage. The IgH 3′RR plays a pivotal role in early B-cell receptor expression, germ-line transcription preceding class switch recombination, interactions between targeted switch (S) regions, variable region transcription before somatic hypermutation, and antibody heavy chain production, but the functional ranking of its different elements is still inaccurate, especially that of its evolutionarily conserved quasi-palindromic structure. By comparing relevant previous knockout (KO) mouse models (3′RR KO and hs3b-4 KO) to a novel mutant devoid of the 3′RR quasi-palindromic region (3′PAL KO), we pinpointed common features and differences that specify two distinct regulatory entities acting sequentially during B-cell ontogeny. Independently of exogenous antigens, the 3′RR distal part, including hs4, fine-tuned B-cell receptor expression in newly formed and naïve B-cell subsets. At mature stages, the 3′RR portion including the quasi-palindrome dictated antigen-dependent locus remodeling (global somatic hypermutation and class switch recombination to major isotypes) in activated B cells and antibody production in plasma cells. PMID:26831080

  14. The evolution of lineage-specific regulatory activities in the human embryonic limb.

    PubMed

    Cotney, Justin; Leng, Jing; Yin, Jun; Reilly, Steven K; DeMare, Laura E; Emera, Deena; Ayoub, Albert E; Rakic, Pasko; Noonan, James P

    2013-07-03

    The evolution of human anatomical features likely involved changes in gene regulation during development. However, the nature and extent of human-specific developmental regulatory functions remain unknown. We obtained a genome-wide view of cis-regulatory evolution in human embryonic tissues by comparing the histone modification H3K27ac, which provides a quantitative readout of promoter and enhancer activity, during human, rhesus, and mouse limb development. Based on increased H3K27ac, we find that 13% of promoters and 11% of enhancers have gained activity on the human lineage since the human-rhesus divergence. These gains largely arose by modification of ancestral regulatory activities in the limb or potential co-option from other tissues and are likely to have heterogeneous genetic causes. Most enhancers that exhibit gain of activity in humans originated in mammals. Gains at promoters and enhancers in the human limb are associated with increased gene expression, suggesting they include molecular drivers of human morphological evolution.

  15. The crucial role of GATA-1 in CCR3 gene transcription: modulated balance by multiple GATA elements in the CCR3 regulatory region.

    PubMed

    Kim, Byung Soo; Uhm, Tae Gi; Lee, Seol Kyoung; Lee, Sin-Hwa; Kang, Jin Hyun; Park, Choon-Sik; Chung, Il Yup

    2010-12-01

    GATA-1, a zinc finger-containing transcription factor, regulates not only the differentiation of eosinophils but also the expression of many eosinophil-specific genes. In the current study, we dissected CCR3 gene expression at the molecular level using several cell types that express varying levels of GATA-1 and CCR3. Chromatin immunoprecipitation analysis revealed that GATA-1 preferentially bound to sequences in both exon 1 and its proximal intron 1. A reporter plasmid assay showed that constructs harboring exon 1 and/or intron 1 sequences retained transactivation activity, which was essentially proportional to cellular levels of endogenous GATA-1. Introduction of a dominant-negative GATA-1 or small interfering RNA of GATA-1 resulted in a decrease in transcription activity of the CCR3 reporter. Both point mutation and EMSA analyses demonstrated that although GATA-1 bound to virtually all seven putative GATA elements present in exon 1-intron 1, the first GATA site in exon 1 exhibited the highest binding affinity for GATA-1 and was solely responsible for GATA-1-mediated transactivation. The fourth and fifth GATA sites in exon 1, which were postulated previously to be a canonical double-GATA site for GATA-1-mediated transcription of eosinophil-specific genes, appeared to play an inhibitory role in transactivation, albeit with a high affinity for GATA-1. Furthermore, mutation of the seventh GATA site (present in intron 1) increased transcription, suggesting an inhibitory role. These data suggest that GATA-1 controls CCR3 transcription by interacting dynamically with the multiple GATA sites in the regulatory region of the CCR3 gene.

  16. Real-time transposable element activity in individual live cells

    PubMed Central

    Lee, Gloria; Martini, K. Michael

    2016-01-01

    The excision and reintegration of transposable elements (TEs) restructure their host genomes, generating cellular diversity involved in evolution, development, and the etiology of human diseases. Our current knowledge of TE behavior primarily results from bulk techniques that generate time and cell ensemble averages, but cannot capture cell-to-cell variation or local environmental and temporal variability. We have developed an experimental system based on the bacterial TE IS608 that uses fluorescent reporters to directly observe single TE excision events in individual cells in real time. We find that TE activity depends upon the TE’s orientation in the genome and the amount of transposase protein in the cell. We also find that TE activity is highly variable throughout the lifetime of the cell. Upon entering stationary phase, TE activity increases in cells hereditarily predisposed to TE activity. These direct observations demonstrate that real-time live-cell imaging of evolution at the molecular and individual event level is a powerful tool for the exploration of genome plasticity in stressed cells. PMID:27298350

  17. Reduction of selenite to elemental selenium nanoparticles by activated sludge.

    PubMed

    Jain, Rohan; Matassa, Silvio; Singh, Satyendra; van Hullebusch, Eric D; Esposito, Giovanni; Lens, Piet N L

    2016-01-01

    Total selenium removal by the activated sludge process, where selenite is reduced to colloidal elemental selenium nanoparticles (BioSeNPs) that remain entrapped in the activated sludge flocs, was studied. Total selenium removal efficiencies with glucose as electron donor (2.0 g chemical oxygen demand (COD) L(-1)) at neutral pH and 30 °C gave 2.9 and 6.8 times higher removal efficiencies as compared to the electron donors lactate and acetate, respectively. Total selenium removal efficiencies of 79 (±3) and 86 (±1) % were achieved in shake flasks and fed batch reactors, respectively, at dissolved oxygen (DO) concentrations above 4.0 mg L(-1) and 30 °C when fed with 172 mg L(-1) (1 mM) Na2SeO3 and 2.0 g L(-1) COD of glucose. Continuously operated reactors operating at neutral pH, 30 °C and a DO >3 mg L(-1) removed 33.98 and 36.65 mg of total selenium per gram of total suspended solids (TSS) at TSS concentrations of 1.3 and 3.0 g L(-1), respectively. However, selenite toxicity to the activated sludge led to failure of a continuously operating activated sludge reactor at the applied loading rates. This suggests that a higher hydraulic retention time (HRT) or different reactor configurations need to be applied for selenium-removing activated sludge processes. Graphical Abstract Scheme representing the possible mechanisms of selenite reduction at high and low DO levels in the activated sludge process.

  18. Elements of the maize A1 promoter required for transactivation by the anthocyanin B/C1 or phlobaphene P regulatory genes.

    PubMed Central

    Tuerck, J A; Fromm, M E

    1994-01-01

    The extensive genetic and molecular characterization of the flavonoid pathway's structural and regulatory genes has provided some of the most detailed knowledge of gene interactions in plants. In maize flavonoid biosynthesis, the A1 gene is independently regulated in the anthocyanin and phlobaphene pathways. Anthocyanin production requires the expression of the C1 or PI and R or B regulatory genes, whereas phlobaphene production requires only the P regulatory gene. By deletion analysis of the A1 promoter, we show that the sequences between -123 and -88 are critical for activation by anthocyanin and phlobaphene regulatory genes. Linker-scanner mutations indicated that the -123 to -100 region is more important for transactivation by the P protein. The -98 to -88 region is more important for B/C1 transactivation and shows a strong homology with the region of the Bz1 anthocyanin structural gene promoter shown to be activated by B/C1 and not by P. We identified a 14-bp consensus sequence that is also present in the promoters of three other genes in the anthocyanin pathway, and we propose a model for how the flavonoid regulatory proteins interact with the promoters of the structural genes. PMID:7827497

  19. Anti-Müllerian hormone (AMH/AMH) in the European sea bass: its gene structure, regulatory elements, and the expression of alternatively-spliced isoforms.

    PubMed

    Halm, S; Rocha, A; Miura, T; Prat, F; Zanuy, S

    2007-02-15

    In mammals, a multitude of studies have shown that anti-Müllerian hormone (AMH/AMH), apart from inducing Müllerian duct regression during male sexual differentiation, exerts inhibitory effects on male and female gonadal steroidogenesis and differentiation. However, in lower vertebrates like teleost fish, the function of AMH/AMH has been far less explored. As a first step to unravel its potential role in reproduction in teleost fish, we isolated and characterised the AMH gene in the European sea bass (sb), Dicentrachus labrax, determined putative regulatory elements of its 5'-flanking region, and analysed its gene expression and those of alternatively-spliced transcripts. The characterisation of sb-AMH revealed distinct features that distinguishes it from mammalian and bird AMH, suggesting a high rate of diversification of AMH during vertebrate evolution. It contained 7 exons that were divided by 6 introns, of which the last intron (intron vi) was localised only a few nucleotides upstream of the putative peptide cleavage site. The guanine and cytosine content of the open reading frame (ORF) was 52.7% and thus notably lower than that of bird and mammalian AMH. Sb-AMH cDNA was 2045 base pairs (bp) long, containing an ORF of 1599 bp encoding 533 amino acids. Deduced amino acid similarities of the conserved, carboxyterminal domain were highest with AMH in Japanese flounder (84.2%) and lowest with chicken AMH (45.5%). In the proximal promoter sequence of sb-AMH, a steroidogenic factor-1 (SF-1) binding site was present; however other regulatory sequences essential for transcriptional activation of AMH in mammals were absent. Likewise, there was no sequence homology to an SF3A2 sequence within the first 3200 bp upstream of the sb-AMH translation start site. Gene expression of sb-AMH and of alternatively-spliced sb-AMH transcripts were analysed in male and female juvenile and adult gonads as well as in somatic tissues of juvenile males. sb-AMH expression was highest in

  20. Neutron activation analysis; A sensitive test for trace elements

    SciTech Connect

    Hossain, T.Z. . Ward Lab.)

    1992-01-01

    This paper discusses neutron activation analysis (NAA), an extremely sensitive technique for determining the elemental constituents of an unknown specimen. Currently, there are some twenty-five moderate-power TRIGA reactors scattered across the United States (fourteen of them at universities), and one of their principal uses is for NAA. NAA is procedurally simple. A small amount of the material to be tested (typically between one and one hundred milligrams) is irradiated for a period that varies from a few minutes to several hours in a neutron flux of around 10{sup 12} neutrons per square centimeter per second. A tiny fraction of the nuclei present (about 10{sup {minus}8}) is transmuted by nuclear reactions into radioactive forms. Subsequently, the nuclei decay, and the energy and intensity of the gamma rays that they emit can be measured in a gamma-ray spectrometer.

  1. The Amino Acid Specificity for Activation of Phenylalanine Hydroxylase Matches the Specificity for Stabilization of Regulatory Domain Dimers.

    PubMed

    Zhang, Shengnan; Hinck, Andrew P; Fitzpatrick, Paul F

    2015-08-25

    Liver phenylalanine hydroxylase is allosterically activated by phenylalanine. The structural changes that accompany activation have not been identified, but recent studies of the effects of phenylalanine on the isolated regulatory domain of the enzyme support a model in which phenylalanine binding promotes regulatory domain dimerization. Such a model predicts that compounds that stabilize the regulatory domain dimer will also activate the enzyme. Nuclear magnetic resonance spectroscopy and analytical ultracentrifugation were used to determine the ability of different amino acids and phenylalanine analogues to stabilize the regulatory domain dimer. The abilities of these compounds to activate the enzyme were analyzed by measuring their effects on the fluorescence change that accompanies activation and on the activity directly. At concentrations of 10-50 mM, d-phenylalanine, l-methionine, l-norleucine, and (S)-2-amino-3-phenyl-1-propanol were able to activate the enzyme to the same extent as 1 mM l-phenylalanine. Lower levels of activation were seen with l-4-aminophenylalanine, l-leucine, l-isoleucine, and 3-phenylpropionate. The ability of these compounds to stabilize the regulatory domain dimer agreed with their ability to activate the enzyme. These results support a model in which allosteric activation of phenylalanine hydroxylase is linked to dimerization of regulatory domains.

  2. Gaussian-state interferometry with passive and active elements

    NASA Astrophysics Data System (ADS)

    Sparaciari, Carlo; Olivares, Stefano; Paris, Matteo G. A.

    2016-02-01

    We address the precision of optical interferometers fed by quantum and semiclassical Gaussian states involving passive and/or active elements, such as beam splitters, photodetectors, and optical parametric amplifiers. We first address the ultimate bounds to precision by discussing the behavior of the quantum Fisher information. We then consider photodetection at the output and calculate the sensitivity of the interferometers taking into account the nonunit quantum efficiency of the detectors. Our results show that in the ideal case of photon number detectors with unit quantum efficiency the best configuration is the symmetric one, namely, a passive (active) interferometer with a passive (active) detection stage: in this case one may achieve Heisenberg scaling of sensitivity by suitably optimizing over Gaussian states at the input. On the other hand, in the realistic case of detectors with nonunit quantum efficiency, the performances of the passive scheme are unavoidably degraded, whereas detectors involving optical parametric amplifiers allow us to fully compensate for the presence of loss in the detection stage, thus restoring the Heisenberg scaling.

  3. Cis-Active RNA Elements (CREs) and Picornavirus RNA Replication

    PubMed Central

    Steil, Benjamin P.; Barton, David J.

    2009-01-01

    Our understanding of picornavirus RNA replication has improved over the past 10 years, due in large part to the discovery of cis-active RNA elements (CREs) within picornavirus RNA genomes. CREs function as templates for the conversion of VPg, the Viral Protein of the genome, into VPgpUpUOH. These so called CREs are different from the previously recognized cis-active RNA sequences and structures within the 5′ and 3′ NTRs of picornavirus genomes. Two adenosine residues in the loop of the CRE RNA structures allow the viral RNA-dependent RNA polymerase 3DPol to add two uridine residues to the tyrosine residue of VPg. Because VPg and/or VPgpUpUOH prime the initiation of viral RNA replication, the asymmetric replication of viral RNA could not be explained without an understanding of the viral RNA template involved in the conversion of VPg into VPgpUpUOH primers. We review the growing body of knowledge regarding picornavirus CREs and discuss how CRE RNAs work coordinately with viral replication proteins and other cis-active RNAs in the 5′ and 3′ NTRs during RNA replication. PMID:18773930

  4. Overexpression of SREBP1 (sterol regulatory element binding protein 1) promotes de novo fatty acid synthesis and triacylglycerol accumulation in goat mammary epithelial cells.

    PubMed

    Xu, H F; Luo, J; Zhao, W S; Yang, Y C; Tian, H B; Shi, H B; Bionaz, M

    2016-01-01

    Sterol regulatory element binding protein 1 (SREBP1; gene name SREBF1) is known to be the master regulator of lipid homeostasis in mammals, including milk fat synthesis. The major role of SREBP1 in controlling milk fat synthesis has been demonstrated in bovine mammary epithelial cells. Except for a demonstrated role in controlling the expression of FASN, a regulatory role of SREBP1 on milk fat synthesis is very likely, but has not yet been demonstrated in goat mammary epithelial cells (GMEC). To explore the regulatory function of SREBP1 on de novo fatty acids and triacylglycerol synthesis in GMEC, we overexpressed the mature form of SREBP1 (active NH2-terminal fragment) in GMEC using a recombinant adenovirus vector (Ad-nSREBP1), with Ad-GFP (recombinant adenovirus of green fluorescent protein) as control, and infected the GMEC for 48 h. In infected cells, we assessed the expression of 20 genes related to milk fat synthesis using real time-quantitative PCR, the protein abundance of SREBP1 and FASN by Western blot, the production of triacylglycerol, and the fatty acid profile. Expression of SREBF1 was modest in mammary compared with the other tissues in dairy goats but its expression increased approximately 30-fold from pregnancy to lactation. The overexpression of the mature form of SREBP1 was confirmed by >200-fold higher expression of SREBF1 in Ad-nSREBP1 compared with Ad-GFP. We observed no changes in amount of the precursor form of SREBP1 protein but a >10-fold increase of the mature form of SREBP1 protein with Ad-nSREBP1. Compared with Ad-GFP cells (control), Ad-nSREBP1 cells had a significant increase in expression of genes related to long-chain fatty acid activation (ACSL1), transport (FABP3), desaturation (SCD1), de novo synthesis of fatty acids (ACSS2, ACLY, IDH1, ACACA, FASN, and ELOVL6), and transcriptional factors (NR1H3 and PPARG). We observed a >10-fold increase in expression of INSIG1 but SCAP was downregulated by Ad-nSREBP1. Among genes related to

  5. Transposable Elements Contribute to Activation of Maize Genes in Response to Abiotic Stress

    PubMed Central

    Makarevitch, Irina; Waters, Amanda J.; West, Patrick T.; Stitzer, Michelle; Hirsch, Candice N.; Ross-Ibarra, Jeffrey; Springer, Nathan M.

    2015-01-01

    Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as “junk” DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize. PMID:25569788

  6. Intrinsic characteristics of neighboring DNA modulate transposable element activity in Drosophila melanogaster.

    PubMed

    Esnault, Caroline; Palavesam, Azhahianambi; Pilitt, Kristina; O'Brochta, David A

    2011-01-01

    Identifying factors influencing transposable element activity is essential for understanding how these elements impact genomes and their evolution as well as for fully exploiting them as functional genomics tools and gene-therapy vectors. Using a genetics-based approach, the influence of genomic position on piggyBac mobility in Drosophila melanogaster was assessed while controlling for element structure, genetic background, and transposase concentration. The mobility of piggyBac elements varied over more than two orders of magnitude solely as a result of their locations within the genome. The influence of genomic position on element activities was independent of factors resulting in position-dependent transgene expression ("position effects"). Elements could be relocated to new genomic locations without altering their activity if ≥ 500 bp of genomic DNA originally flanking the element was also relocated. Local intrinsic factors within the neighboring DNA that determined the activity of piggyBac elements were portable not only within the genome but also when elements were moved to plasmids. The predicted bendability of the first 50 bp flanking the 5' and 3' termini of piggyBac elements could account for 60% of the variance in position-dependent activity observed among elements. These results are significant because positional influences on transposable element activities will impact patterns of accumulation of elements within genomes. Manipulating and controlling the local sequence context of piggyBac elements could be a powerful, novel way of optimizing gene vector activity.

  7. Sterol regulatory element binding protein-1 expression is suppressed by dietary polyunsaturated fatty acids. A mechanism for the coordinate suppression of lipogenic genes by polyunsaturated fats.

    PubMed

    Xu, J; Nakamura, M T; Cho, H P; Clarke, S D

    1999-08-13

    Polyunsaturated fatty acids (PUFA) coordinately suppress the transcription of a wide array of hepatic lipogenic genes including fatty acid synthase (FAS) and acetyl-CoA carboxylase. Interestingly, the over-expression of sterol regulatory element binding protein-1 (SREBP-1) induces the expression of all of the enzymes suppressed by PUFA. This observation led us to hypothesize that PUFA coordinately inhibit lipogenic gene transcription by suppressing the expression of SREBP-1. Our initial studies revealed that the SREBP-1 and FAS mRNA contents of HepG2 cells were reduced by 20:4(n-6) in a dose-dependent manner (i.e. EC(50) approximately 10 microM), whereas 18:1(n-9) had no effect. Similarly, supplementing a fat-free, high glucose diet with oils rich in (n-6) or (n-3) PUFA reduced the hepatic content of precursor and nuclear SREBP-1 60 and 85%, respectively; however, PUFA had no effect on the nuclear content of upstream stimulatory factor (USF)-1. The PUFA-dependent decrease in nuclear content of mature SREBP-1 was paralleled by a 70-90% suppression in FAS gene transcription. In contrast, dietary 18:1(n-9), i.e. triolein, had no inhibitory influence on the expression of SREBP-1 or FAS. The decrease in hepatic expression of SREBP-1 and FAS associated with PUFA ingestion was mimicked by supplementing the fat-free diet with the PPARalpha-activator, WY 14, 643. Interestingly, nuclear run-on assays revealed that changes in SREBP-1 mRNA abundance were not accompanied by changes in SREBP-1 gene transcription. These results support the concept that PUFA coordinately inhibit lipogenic gene transcription by suppressing the expression of SREBP-1 and that the PUFA regulation of SREBP-1 appears to occur at the post-transcriptional level.

  8. Subunit architecture of the Golgi Dsc E3 ligase required for sterol regulatory element-binding protein (SREBP) cleavage in fission yeast.

    PubMed

    Lloyd, S Julie-Ann; Raychaudhuri, Sumana; Espenshade, Peter J

    2013-07-19

    The membrane-bound sterol regulatory element-binding protein (SREBP) transcription factors regulate lipogenesis in mammalian cells and are activated through sequential cleavage by the Golgi-localized Site-1 and Site-2 proteases. The mechanism of fission yeast SREBP cleavage is less well defined and, in contrast, requires the Golgi-localized Dsc E3 ligase complex. The Dsc E3 ligase consists of five integral membrane subunits, Dsc1 through Dsc5, and resembles membrane E3 ligases that function in endoplasmic reticulum-associated degradation. Using immunoprecipitation assays and blue native electrophoresis, we determined the subunit architecture for the complex of Dsc1 through Dsc5, showing that the Dsc proteins form subcomplexes and display defined connectivity. Dsc2 is a rhomboid pseudoprotease family member homologous to mammalian UBAC2 and a central component of the Dsc E3 ligase. We identified conservation in the architecture of the Dsc E3 ligase and the multisubunit E3 ligase gp78 in mammals. Specifically, Dsc1-Dsc2-Dsc5 forms a complex resembling gp78-UBAC2-UBXD8. Further characterization of Dsc2 revealed that its C-terminal UBA domain can bind to ubiquitin chains but that the Dsc2 UBA domain is not essential for yeast SREBP cleavage. Based on the ability of rhomboid superfamily members to bind transmembrane proteins, we speculate that Dsc2 functions in SREBP recognition and binding. Homologs of Dsc1 through Dsc4 are required for SREBP cleavage and virulence in the human opportunistic pathogen Aspergillus fumigatus. Thus, these studies advance our organizational understanding of multisubunit E3 ligases involved in endoplasmic reticulum-associated degradation and fungal pathogenesis.

  9. FoxO1 inhibits sterol regulatory element-binding protein-1c (SREBP-1c) gene expression via transcription factors Sp1 and SREBP-1c.

    PubMed

    Deng, Xiong; Zhang, Wenwei; O-Sullivan, InSug; Williams, J Bradley; Dong, Qingming; Park, Edwards A; Raghow, Rajendra; Unterman, Terry G; Elam, Marshall B

    2012-06-08

    Induction of lipogenesis in response to insulin is critically dependent on the transcription factor, sterol regulatory element-binding protein-1c (SREBP-1c). FoxO1, a forkhead box class-O transcription factor, is an important mediator of insulin action, but its role in the regulation of lipid metabolism has not been clearly defined. We examined the effects of FoxO1 on srebp1 gene expression in vivo and in vitro. In vivo studies showed that constitutively active (CA) FoxO1 (CA-FoxO1) reduced basal expression of SREBP-1c mRNA in liver by ∼60% and blunted induction of SREBP-1c in response to feeding. In liver-specific FoxO knock-out mice, SREBP-1c expression was increased ∼2-fold. Similarly, in primary hepatocytes, CA-FoxO1 suppressed SREBP1-c expression and inhibited basal and insulin-induced SREBP-1c promoter activity. SREBP-1c gene expression is induced by the liver X receptor (LXR), but CA-FoxO1 did not block the activation of SREBP-1c by the LXR agonist TO9. Insulin stimulates SREBP-1c transcription through Sp1 and via "feed forward" regulation by newly synthesized SREBP-1c. CA-FoxO1 inhibited SREBP-1c by reducing the transactivational capacity of both Sp1 and SREBP-1c. In addition, chromatin immunoprecipitation assays indicate that FoxO1 can associate with the proximal promoter region of the srebp1 gene and disrupt the assembly of key components of the transcriptional complex of the SREBP-1c promoter. We conclude that FoxO1 inhibits SREBP-1c transcription via combined actions on multiple transcription factors and that this effect is exerted at least in part through reduced transcriptional activity of Sp1 and SREBP-1c and disrupted assembly of the transcriptional initiation complex on the SREBP-1c promoter.

  10. Hormone withdrawal triggers a premature and sustained gene activation from delayed secondary glucocorticoid response elements.

    PubMed

    Hess, P; Payvar, F

    1992-02-15

    Glucocorticoid regulatory elements, denoted GREs and delayed secondary GREs (sGREs), bind the purified glucocorticoid receptors via distinctive sequence motifs and confer a primary and delayed secondary hormone inducibility, respectively, upon a linked reporter construct in stably transfected mammalian cells. The delayed secondary responses, but not the primary responses, are preceded by a time lag of several hours and blocked by protein synthesis inhibitors. In this report, we further characterized and distinguished these hormonal inductions. A 206-base pair DNA fragment from the hepatic rat alpha 2u-globulin (RUG) gene, containing at least two delayed sGREs, was specifically activated by glucocorticoids in a dose-dependent manner via a process which is sensitive to receptor antagonist RU486. Delayed sGRE-stimulated production of correctly initiated transcripts was preceded by a time lag of 2 h, a time when the GRE-mediated induction had reached maximal levels. A pulse of glucocorticoids sustained maximal activation of the delayed secondary response but not the primary response. In fact, hormone withdrawal triggered a premature induction of this delayed secondary response, suggesting that delayed sGREs are under both negative and positive control of the hormone receptor. Two separable elements of the 206-base pair fragment, including the 29-base pair sequence of a single receptor binding site, activated the reporter expression as effectively with transient, pulsatile exposure to hormone as with continuous exposure. Our results suggest that the information content of a hormonal pulse is retained, or "memorized," more persistently by a receptor binding site of delayed sGREs than those of the prototypical GREs.

  11. Long-range oncogenic activation of Igh-c-myc translocations by the Igh 3' regulatory region.

    PubMed

    Gostissa, Monica; Yan, Catherine T; Bianco, Julia M; Cogné, Michel; Pinaud, Eric; Alt, Frederick W

    2009-12-10

    B-cell malignancies, such as human Burkitt's lymphoma, often contain translocations that link c-myc or other proto-oncogenes to the immunoglobulin heavy chain locus (IgH, encoded by Igh). The nature of elements that activate oncogenes within such translocations has been a long-standing question. Translocations within Igh involve DNA double-strand breaks initiated either by the RAG1/2 endonuclease during variable, diversity and joining gene segment (V(D)J) recombination, or by activation-induced cytidine deaminase (AID, also known as AICDA) during class switch recombination (CSR). V(D)J recombination in progenitor B (pro-B) cells assembles Igh variable region exons upstream of mu constant region (Cmu) exons, which are the first of several sets of C(H) exons ('C(H) genes') within a C(H) locus that span several hundred kilobases (kb). In mature B cells, CSR deletes Cmu and replaces it with a downstream C(H) gene. An intronic enhancer (iEmu) between the variable region exons and Cmu promotes V(D)J recombination in developing B cells. Furthermore, the Igh 3' regulatory region (Igh3'RR) lies downstream of the C(H) locus and modulates CSR by long-range transcriptional enhancement of C(H) genes. Transgenic mice bearing iEmu or Igh3'RR sequences fused to c-myc are predisposed to B lymphomas, demonstrating that such elements can confer oncogenic c-myc expression. However, in many B-cell lymphomas, Igh-c-myc translocations delete iEmu and place c-myc up to 200 kb upstream of the Igh3'RR. Here we address the oncogenic role of the Igh3'RR by inactivating it in two distinct mouse models for B-cell lymphoma with Igh-c-myc translocations. We show that the Igh3'RR is dispensable for pro-B-cell lymphomas with V(D)J recombination-initiated translocations, but is required for peripheral B-cell lymphomas with CSR-associated translocations. As the Igh3'RR is not required for CSR-associated Igh breaks or Igh-c-myc translocations in peripheral B-cell lymphoma progenitors, we conclude that

  12. Assessment of nose protector for sport activities: finite element analysis.

    PubMed

    Coto, Neide Pena; Meira, Josete Barbosa Cruz; Brito e Dias, Reinaldo; Driemeier, Larissa; de Oliveira Roveri, Guilherme; Noritomi, Pedro Yoshito

    2012-04-01

    There has been a significant increase in the number of facial fractures stemming from sport activities in recent years, with the nasal bone one of the most affected structures. Researchers recommend the use of a nose protector, but there is no standardization regarding the material employed. Clinical experience has demonstrated that a combination of a flexible and rigid layer of ethylene vinyl acetate (EVA) offers both comfort and safety to practitioners of sports. The aim of the present study was the investigation into the stresses generated by the impact of a rigid body on the nasal bone on models with and without an EVA protector. For such, finite element analysis was employed. A craniofacial model was constructed from images obtained through computed tomography. The nose protector was modeled with two layers of EVA (1 mm of rigid EVA over 2 mm of flexible EVA), following the geometry of the soft tissue. Finite element analysis was performed using the LS Dyna program. The bone and rigid EVA were represented as elastic linear material, whereas the soft tissues and flexible EVA were represented as hyperelastic material. The impact from a rigid sphere on the frontal region of the face was simulated with a constant velocity of 20 m s(-1) for 9.1 μs. The model without the protector served as the control. The distribution of maximal stress of the facial bones was recorded. The maximal stress on the nasal bone surpassed the breaking limit of 0.13-0.34 MPa on the model without a protector, while remaining below this limit on the model with the protector. Thus, the nose protector made from both flexible and rigid EVA proved effective at protecting the nasal bones under high-impact conditions.

  13. Regulatory Activities of Four ArsR Proteins in Agrobacterium tumefaciens 5A

    PubMed Central

    Kang, Yoon-Suk; Brame, Keenan; Jetter, Jonathan; Bothner, Brian B.; Wang, Gejiao

    2016-01-01

    ABSTRACT ArsR is a well-studied transcriptional repressor that regulates microbe-arsenic interactions. Most microorganisms have an arsR gene, but in cases where multiple copies exist, the respective roles or potential functional overlap have not been explored. We examined the repressors encoded by arsR1 and arsR2 (ars1 operon) and by arsR3 and arsR4 (ars2 operon) in Agrobacterium tumefaciens 5A. ArsR1 and ArsR4 are very similar in their primary sequences and diverge phylogenetically from ArsR2 and ArsR3, which are also quite similar to one another. Reporter constructs (lacZ) for arsR1, arsR2, and arsR4 were all inducible by As(III), but expression of arsR3 (monitored by reverse transcriptase PCR) was not influenced by As(III) and appeared to be linked transcriptionally to an upstream lysR-type gene. Experiments using a combination of deletion mutations and additional reporter assays illustrated that the encoded repressors (i) are not all autoregulatory as is typically known for ArsR proteins, (ii) exhibit variable control of each other's encoding genes, and (iii) exert variable control of other genes previously shown to be under the control of ArsR1. Furthermore, ArsR2, ArsR3, and ArsR4 appear to have an activator-like function for some genes otherwise repressed by ArsR1, which deviates from the well-studied repressor role of ArsR proteins. The differential regulatory activities suggest a complex regulatory network not previously observed in ArsR studies. The results indicate that fine-scale ArsR sequence deviations of the reiterated regulatory proteins apparently translate to different regulatory roles. IMPORTANCE Given the significance of the ArsR repressor in regulating various aspects of microbe-arsenic interactions, it is important to assess potential regulatory overlap and/or interference when a microorganism carries multiple copies of arsR. This study explores this issue and shows that the four arsR genes in A. tumefaciens 5A, associated with two separate

  14. Identification of a regulatory element responsible for salt induction of rice OsRAV2 through ex situ and in situ promoter analysis.

    PubMed

    Duan, Yong-Bo; Li, Juan; Qin, Rui-Ying; Xu, Rong-Fang; Li, Hao; Yang, Ya-Chun; Ma, Hui; Li, Li; Wei, Peng-Cheng; Yang, Jian-Bo

    2016-01-01

    Salt is a major environmental stress factor that can affect rice growth and yields. Recent studies suggested that members of the AP2/ERF domain-containing RAV (related to ABI3/VP1) TF family are involved in abiotic stress adaptation. However, the transcriptional response of rice RAV genes (OsRAVs) to salt has not yet been fully characterized. In this study, the expression patterns of all five OsRAVs were examined under salt stress. Only one gene, OsRAV2, was stably induced by high-salinity treatment. Further expression profile analyses indicated that OsRAV2 is transcriptionally regulated by salt, but not KCl, osmotic stress, cold or ABA (abscisic acid) treatment. To elucidate the regulatory mechanism of the stress response at the transcriptional level, we isolated and characterized the promoter region of OsRAV2 (P OsRAV2 ). Transgenic analysis indicated that P OsRAV2 is induced by salt stress but not osmotic stress or ABA treatment. Serial 5' deletions and site-specific mutations in P OsRAV2 revealed that a GT-1 element located at position -664 relative to the putative translation start site is essential for the salt induction of P OsRAV2 . The regulatory function of the GT-1 element in the salt induction of OsRAV2 was verified in situ in plants with targeted mutations generated using the CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) system. Taken together, our results indicate that the GT-1 element directly controls the salt response of OsRAV2. This study provides a better understanding of the putative functions of OsRAVs and the molecular regulatory mechanisms of plant genes under salt stress.

  15. Enhanced killing activity of regulatory T cells ameliorates inflammation and autoimmunity.

    PubMed

    Askenasy, Nadir

    2013-08-01

    Regulatory T cells (Treg) are pivotal suppressor elements in immune homeostasis with potential therapeutic applications in inflammatory and autoimmune disorders. Using Treg as vehicles for targeted immunomodulation, a short-lived Fas-ligand (FasL) chimeric protein (killer Treg) was found efficient in preventing the progression of autoimmune insulitis in NOD mice, and amelioration of chronic colitis and graft versus host disease. The main mechanisms of disease suppression by killer Treg are: a) in the acute phase induction of apoptosis in effector cells at the site of inflammation decreases the pathogenic burden, and b) persistent increase in FoxP3⁺ Treg with variable CD25 co-expression induced by FasL sustains disease suppression over extended periods of time. Reduced sensitivity of Treg to receptor-mediated apoptosis under inflammatory conditions makes them optimal vehicles for targeted immunotherapy using apoptotic agents.

  16. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    PubMed

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles.

  17. LRE2, an active human L1 element, has low level transcriptional activity and extremely low reverse transcriptase activity

    SciTech Connect

    Holmes, S.E.; Dombroski, B.A.; Sassaman, D.M.

    1994-09-01

    Previously, we found a 2 kb insertion containing a rearranged L1 element plus a unique sequence component (USC) within exon 48 of the dystrophin gene of a patient with muscular dystrophy. We used the USC to clone the precursor of this insertion, the second known {open_quotes}active{close_quotes} human L1 element. The locus LRE2 (L1 Retrotransposable Element 2) has an allele derived from the patient which matches the insertion sequence exactly. LRE2 has a perfect 13-15 bp target site duplication, 2 open reading frames (ORFs), and an unusual 21 bp truncation of the 5{prime} end in a region known to be important for L1 transcription. The truncated LRE2 promoter has about 20% of the transcriptional activity of a previously studied L1 promoter after transfection into NTera2D1 cells of a construct in which the L1 promoter drives the expression of a lacZ gene. In addition, the reverse transcriptase (RT) encoded by LRE2 is active in an in vivo pseudogene assay in yeast and an in vitro assay. However, in both assays the RT of LRE2 is 1-5% as active as that of LRE1. These data demonstrate that multiple {open_quotes}active{close_quotes} L1 elements exist in the human genome, and that active elements can have highly variable rates of transcription and reverse transcriptase activity. That the RT of LRE2 has extremely low activity suggests the possibility that retrotransposition of an L1 element may in some cases involve an RT encoded by another L1 element.

  18. Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

    PubMed

    Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

    2013-10-01

    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

  19. Genome Wide Analysis Reveals Zic3 Interaction with Distal Regulatory Elements of Stage Specific Developmental Genes in Zebrafish

    PubMed Central

    Kumar, Vibhor; Srinivasan, Kandhadayar G.; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W.; Korzh, Vladimir; Mathavan, Sinnakaruppan

    2013-01-01

    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches – ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape. PMID:24204288

  20. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.

    PubMed

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser.

  1. Emergy of the Global Biogeochemical Cycles of Biologically Active Elements

    EPA Science Inventory

    Accurate estimates of the emergy of elemental flows are needed to accurately evaluate the far field effects of anthropogenic wastes. The transformity and specific emergy of the elements and of their different chemical species is also needed to quantify the inputs to many producti...

  2. Redefining the transcriptional regulatory dynamics of classically and alternatively activated macrophages by deepCAGE transcriptomics

    PubMed Central

    Roy, Sugata; Schmeier, Sebastian; Arner, Erik; Alam, Tanvir; Parihar, Suraj P.; Ozturk, Mumin; Tamgue, Ousman; Kawaji, Hideya; de Hoon, Michiel J. L.; Itoh, Masayoshi; Lassmann, Timo; Carninci, Piero; Hayashizaki, Yoshihide; Forrest, Alistair R. R.; Bajic, Vladimir B.; Guler, Reto; Consortium, FANTOM; Brombacher, Frank; Suzuki, Harukazu

    2015-01-01

    Classically or alternatively activated macrophages (M1 and M2, respectively) play distinct and important roles for microbiocidal activity, regulation of inflammation and tissue homeostasis. Despite this, their transcriptional regulatory dynamics are poorly understood. Using promoter-level expression profiling by non-biased deepCAGE we have studied the transcriptional dynamics of classically and alternatively activated macrophages. Transcription factor (TF) binding motif activity analysis revealed four motifs, NFKB1_REL_RELA, IRF1,2, IRF7 and TBP that are commonly activated but have distinct activity dynamics in M1 and M2 activation. We observe matching changes in the expression profiles of the corresponding TFs and show that only a restricted set of TFs change expression. There is an overall drastic and transient up-regulation in M1 and a weaker and more sustainable up-regulation in M2. Novel TFs, such as Thap6, Maff, (M1) and Hivep1, Nfil3, Prdm1, (M2) among others, were suggested to be involved in the activation processes. Additionally, 52 (M1) and 67 (M2) novel differentially expressed genes and, for the first time, several differentially expressed long non-coding RNA (lncRNA) transcriptome markers were identified. In conclusion, the finding of novel motifs, TFs and protein-coding and lncRNA genes is an important step forward to fully understand the transcriptional machinery of macrophage activation. PMID:26117544

  3. Trace Elements Induce Predominance among Methanogenic Activity in Anaerobic Digestion.

    PubMed

    Wintsche, Babett; Glaser, Karin; Sträuber, Heike; Centler, Florian; Liebetrau, Jan; Harms, Hauke; Kleinsteuber, Sabine

    2016-01-01

    Trace elements (TE) play an essential role in all organisms due to their functions in enzyme complexes. In anaerobic digesters, control, and supplementation of TEs lead to stable and more efficient methane production processes while TE deficits cause process imbalances. However, the underlying metabolic mechanisms and the adaptation of the affected microbial communities to such deficits are not yet fully understood. Here, we investigated the microbial community dynamics and resulting process changes induced by TE deprivation. Two identical lab-scale continuous stirred tank reactors fed with distiller's grains and supplemented with TEs (cobalt, molybdenum, nickel, tungsten) and a commercial iron additive were operated in parallel. After 72 weeks of identical operation, the feeding regime of one reactor was changed by omitting TE supplements and reducing the amount of iron additive. Both reactors were operated for further 21 weeks. Various process parameters (biogas production and composition, total solids and volatile solids, TE concentration, volatile fatty acids, total ammonium nitrogen, total organic acids/alkalinity ratio, and pH) and the composition and activity of the microbial communities were monitored over the total experimental time. While the methane yield remained stable, the concentrations of hydrogen sulfide, total ammonia nitrogen, and acetate increased in the TE-depleted reactor compared to the well-supplied control reactor. Methanosarcina and Methanoculleus dominated the methanogenic communities in both reactors. However, the activity ratio of these two genera was shown to depend on TE supplementation explainable by different TE requirements of their energy conservation systems. Methanosarcina dominated the well-supplied anaerobic digester, pointing to acetoclastic methanogenesis as the dominant methanogenic pathway. Under TE deprivation, Methanoculleus and thus hydrogenotrophic methanogenesis was favored although Methanosarcina was not overgrown by

  4. Trace Elements Induce Predominance among Methanogenic Activity in Anaerobic Digestion

    PubMed Central

    Wintsche, Babett; Glaser, Karin; Sträuber, Heike; Centler, Florian; Liebetrau, Jan; Harms, Hauke; Kleinsteuber, Sabine

    2016-01-01

    Trace elements (TE) play an essential role in all organisms due to their functions in enzyme complexes. In anaerobic digesters, control, and supplementation of TEs lead to stable and more efficient methane production processes while TE deficits cause process imbalances. However, the underlying metabolic mechanisms and the adaptation of the affected microbial communities to such deficits are not yet fully understood. Here, we investigated the microbial community dynamics and resulting process changes induced by TE deprivation. Two identical lab-scale continuous stirred tank reactors fed with distiller’s grains and supplemented with TEs (cobalt, molybdenum, nickel, tungsten) and a commercial iron additive were operated in parallel. After 72 weeks of identical operation, the feeding regime of one reactor was changed by omitting TE supplements and reducing the amount of iron additive. Both reactors were operated for further 21 weeks. Various process parameters (biogas production and composition, total solids and volatile solids, TE concentration, volatile fatty acids, total ammonium nitrogen, total organic acids/alkalinity ratio, and pH) and the composition and activity of the microbial communities were monitored over the total experimental time. While the methane yield remained stable, the concentrations of hydrogen sulfide, total ammonia nitrogen, and acetate increased in the TE-depleted reactor compared to the well-supplied control reactor. Methanosarcina and Methanoculleus dominated the methanogenic communities in both reactors. However, the activity ratio of these two genera was shown to depend on TE supplementation explainable by different TE requirements of their energy conservation systems. Methanosarcina dominated the well-supplied anaerobic digester, pointing to acetoclastic methanogenesis as the dominant methanogenic pathway. Under TE deprivation, Methanoculleus and thus hydrogenotrophic methanogenesis was favored although Methanosarcina was not overgrown

  5. The maize regulatory gene B-Peru contains a DNA rearrangement that specifies tissue-specific expression through both positive and negative promoter elements.

    PubMed Central

    Selinger, D A; Lisch, D; Chandler, V L

    1998-01-01

    The B-Peru allele of the maize b regulatory gene is unusual relative to most b alleles in that it is expressed in the aleurone layer of the seed. It is also expressed in a subset of plant vegetative tissues. Transgenic maize plants containing the B-Peru gene with the first 710 bases of upstream sequence conferred the same levels of aleurone expression as nontransgenic B-Peru plants, but no pigment was made in vegetative tissues. Transient transformation assays in aleurone tissue localized the aleurone-specific promoter to the first 176 bases of the B-Peru upstream region and identified two critically important regions within this fragment. Mutation of either region alone reduced expression greater than fivefold. Surprisingly, the double mutation actually increased expression to twice the native promoter level. Our results suggest that these two critical sequences, which lie close together in the promoter, may form a negative regulatory element. Several lines of evidence suggest that the B-Peru promoter arose through the translocation of an existing aleurone-specific promoter to the b locus. Immediately upstream of the aleurone-specific promoter elements and in the opposite orientation to the b coding sequence is a pseudogene sequence with strong similarity to a known class of proteins. Our findings that novel aleurone-specific promoter sequences of the B-Peru transcription factor are found adjacent to part of another gene in a small insertion are quite unexpected and have interesting evolutionary implications. PMID:9611220

  6. Wnt6 activates endoderm in the sea urchin gene regulatory network

    PubMed Central

    Croce, Jenifer; Range, Ryan; Wu, Shu-Yu; Miranda, Esther; Lhomond, Guy; Peng, Jeff Chieh-fu; Lepage, Thierry; McClay, David R.

    2011-01-01

    In the sea urchin, entry of β-catenin into the nuclei of the vegetal cells at 4th and 5th cleavages is necessary for activation of the endomesoderm gene regulatory network. Beyond that, little is known about how the embryo uses maternal information to initiate specification. Here, experiments establish that of the three maternal Wnts in the egg, Wnt6 is necessary for activation of endodermal genes in the endomesoderm GRN. A small region of the vegetal cortex is shown to be necessary for activation of the endomesoderm GRN. If that cortical region of the egg is removed, addition of Wnt6 rescues endoderm. At a molecular level, the vegetal cortex region contains a localized concentration of Dishevelled (Dsh) protein, a transducer of the canonical Wnt pathway; however, Wnt6 mRNA is not similarly localized. Ectopic activation of the Wnt pathway, through the expression of an activated form of β-catenin, of a dominant-negative variant of GSK-3β or of Dsh itself, rescues endomesoderm specification in eggs depleted of the vegetal cortex. Knockdown experiments in whole embryos show that absence of Wnt6 produces embryos that lack endoderm, but those embryos continue to express a number of mesoderm markers. Thus, maternal Wnt6 plus a localized vegetal cortical molecule, possibly Dsh, is necessary for endoderm specification; this has been verified in two species of sea urchin. The data also show that Wnt6 is only one of what are likely to be multiple components that are necessary for activation of the entire endomesoderm gene regulatory network. PMID:21750039

  7. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  8. The role of mecA and blaZ regulatory elements in mecA expression by regional clones of methicillin-resistant Staphylococcus pseudintermedius.

    PubMed

    Black, C C; Eberlein, L C; Solyman, S M; Wilkes, R P; Hartmann, F A; Rohrbach, B W; Bemis, D A; Kania, S A

    2011-08-05

    Two major regional clones of methicillin-resistant Staphylococcus pseudintermedius (MRSP) have been identified in Europe and North America. They are designated multilocus sequence types (ST) 71 and 68 and contain staphylococcal chromosome cassette (SCCmec) types II-III and V(T), respectively. One notable difference between the two clones is a deletion in the mecI/mecR1 regulatory apparatus of ST 68 SCCmec V(T). This deletion in analogous methicillin-resistant Staphylococcus aureus (MRSA) results in more responsive and greater expression of the mecA encoded penicillin-binding protein 2a, and is associated with SCCmec types occurring in community-acquired MRSA lineages. The aim of this study was to characterize mec and bla regulatory apparatuses in MRSP and determine their effects on expression of mecA. Seventeen S. pseudintermedius isolates representing nine methicillin-resistant ST lineages were screened for the presence of the repressors blaI and mecI and sensors blaR1 and mecR1. The bla and mec operons for each isolate were sequenced and compared for homology between the repressor open-reading frames (ORF), sensor ORFs, and mecA promoter regions. A real-time reverse transcriptase PCR expression assay was developed, validated and applied to nine isolates determining the effect of oxacillin induction on mecA transcription. Significant differences were found in mecA expression between isolates with a full regulatory complement (mecI/mecR1 and blaI/blaR1) and those with truncated and/or absent regulatory elements. Isolates representative of European and North American MRSP ST regional clones have dissimilar mecA responses to oxacillin.

  9. Trace element analysis of coal by neutron activation

    NASA Technical Reports Server (NTRS)

    Sheibley, D. W.

    1973-01-01

    The irradiation, counting, and data reduction scheme is described for an analysis capability of 1000 samples per year. Up to 56 elements are reported on each sample. The precision and accuracy of the method are shown for 25 elements designated as hazardous by the Environmental Protection Agency (EPA). The interference corrections for selenium and ytterbium on mercury and ytterbium on selenium are described. The effect of bromine and antimony on the determination of arsenic is also mentioned. The use of factorial design techniques to evaluate interferences in the determination of mercury, selenium, and arsenic is shown. Some typical trace element results for coal, fly ash, and bottom ash are given.

  10. Trace element analysis of coal by neutron activation.

    NASA Technical Reports Server (NTRS)

    Sheibley, D. W.

    1973-01-01

    The irradiation, counting, and data reduction scheme is described for an analysis capability of 1000 samples per year. Up to 56 elements are reported on each sample. The precision and accuracy of the method are shown for 25 elements designated as hazardous by the Environmental Protection Agency (EPA). The interference corrections for selenium and ytterbium on mercury and ytterbium on selenium are described. The effect of bromine and antimony on the determination of arsenic is also mentioned. The use of factorial design techniques to evaluate interferences in the determination of mercury, selenium, and arsenic is shown. Some typical trace element results for coal, fly ash, and bottom ash are given.

  11. Selection of active elements in system reduction of vibration

    NASA Astrophysics Data System (ADS)

    Bialas, K.

    2016-11-01

    This work presents non-classical method of design of mechatronic systems. The purpose of this paper is also introduces synthesis of mechatronic system understand as design of mechatronic systems. The synthesis may be applied to modify the already existing systems in order to achieve a desired result. The system was consisted from mechanical and electrical elements. Electrical elements were used as subsystem reducing unwanted vibration of mechanical system. Electrical elements can be realized in the form of coils with movable core. The system was modelled in Matlab Simulink.

  12. The salt-regulated element in the promoter of lycopene β-cyclase gene confers a salt regulatory pattern in carotenogenesis of Dunaliella bardawil.

    PubMed

    Liang, Ming-Hua; Lu, Yan; Chen, Hao-Hong; Jiang, Jian-Guo

    2017-03-01

    In the carotenoid biosynthesis, lycopene β-cyclase (LCYb) is a key regulatory enzyme involved in the conversion of lycopene into β-carotene. Under stress conditions, such as high salinity, high light and nutrient deprivation, large amounts of β-carotene can be accumulated in Dunaliella bardawil. To study on the molecular responses of salt stress in D. bardawil is of great significance to reveal the mechanisms of salt tolerance and engineer crop plants to be salt-tolerant. In this study, the full-length coding sequence of lcyb from D. bardawil (Dblcyb, GenBank: KX218392) was isolated by transcriptome sequencing. Then, the genomic sequence, promoter and terminator regions of Dblcyb were isolated by genome walking. The Dblcyb promoter (GenBank: KX218393) contained several typical transcription boxes, multiple light response elements and a salt-regulated element (SRE, GT1GMSCAM4). Dbpsy and Dblcyb responsible for β-carotene biosynthesis in D. bardawil was shown to be up-regulated under salt stress and their promoters contained the common SRE. By element deletion analysis and using Ble-EGFP as the reporter, the salt-inducible SRE was confirmed to confer salt-induced expression of Dblcyb promoter. It was indicated that the salt-regulated expression of Dblcyb may be attributed to the salt-responsive element (GT1GMSCAM4) and the GT-rich region in its genomic sequence.

  13. Unexpected T cell regulatory activity of anti-histone H1 autoantibody: Its mode of action in regulatory T cell-dependent and -independent manners

    SciTech Connect

    Takaoka, Yuki; Kawamoto, Seiji; Katayama, Akiko; Nakano, Toshiaki; Yamanaka, Yasushi; Takahashi, Miki; Shimada, Yayoi; Chiang, Kuei-Chen; Ohmori, Naoya; Aki, Tsunehiro; Goto, Takeshi; Sato, Shuji; Goto, Shigeru; Chen, Chao-Long; Ono, Kazuhisa

    2013-02-08

    Highlights: ► Anti-histone H1 autoantibody (anti-H1) acts on T cells to inhibit their activation. ► Anti-H1 suppresses T cell activation in Treg cell-dependent and -independent manners. ► Suboptimal dose of anti-H1 enhances suppressor function of Treg cells. ► High dose of anti-H1 directly inhibits T cell receptor signaling. -- Abstract: Induction of anti-nuclear antibodies against DNA or histones is a hallmark of autoimmune disorders, but their actual contribution to disease predisposition remains to be clarified. We have previously reported that autoantibodies against histone H1 work as a critical graft survival factor in a rat model of tolerogeneic liver transplantation. Here we show that an immunosuppressive anti-histone H1 monoclonal antibody (anti-H1 mAb) acts directly on T cells to inhibit their activation in response to T cell receptor (TCR) ligation. Intriguingly, the T cell activation inhibitory activity of anti-H1 mAb under suboptimal dosages required regulatory T (Treg) cells, while high dose stimulation with anti-H1 mAb triggered a Treg cell-independent, direct negative regulation of T cell activation upon TCR cross-linking. In the Treg cell-dependent mode of immunosuppressive action, anti-H1 mAb did not induce the expansion of CD4{sup +}Foxp3{sup +} Treg cells, but rather potentiated their regulatory capacity. These results reveal a previously unappreciated T cell regulatory role of anti-H1 autoantibody, whose overproduction is generally thought to be pathogenic in the autoimmune settings.

  14. Activation of IFN-beta element by IRF-1 requires a posttranslational event in addition to IRF-1 synthesis.

    PubMed Central

    Watanabe, N; Sakakibara, J; Hovanessian, A G; Taniguchi, T; Fujita, T

    1991-01-01

    Expression of the Type I IFN (i.e., IFN-alpha s and IFN-beta) genes is efficiently induced by viruses at the transcriptional level. This induction is mediated by at least two types of positive regulatory elements located in the human IFN-beta gene promoter: (1) the repeated elements which bind both the transcriptional activator IRF-1 and the repressor IRF-2 (IRF-elements; IRF-Es), and (2) the kappa B element (kappa B-E), which binds NF kappa B and is located between the IRF-Es and the TATA box. In this study we demonstrate that a promoter containing synthetic IRF-E, which displays high affinity for the IRFs can be efficiently activated by Newcastle disease virus (NDV). In contrast, such activation was either very weak or nil when cells were treated by IFN-beta or tumor necrosis factor-alpha (TNF-alpha), despite the fact they both efficiently induce de novo synthesis of the short-lived IRF-1 in L929 cells. In fact, efficient activation of the IRF-E apparently requires an event in addition to de novo IRF-1 induction, which can be elicited by NDV even in the presence of protein synthesis inhibitor, cycloheximide. Moreover, efficient activation of the IRF-E by NDV is specifically inhibited by the protein kinase inhibitor, Staurosporin. Hence our results suggest the importance of IRF-1 synthesis and post-translational modification event(s), possibly phosphorylation for the efficient activation of IRF-Es, which are otherwise under negative regulation by IRF-2. Images PMID:1886766

  15. Mangiferin inhibits macrophage classical activation via downregulating interferon regulatory factor 5 expression

    PubMed Central

    Wei, Zhiquan; Yan, Li; Chen, Yixin; Bao, Chuanhong; Deng, Jing; Deng, Jiagang

    2016-01-01

    Mangiferin is a natural polyphenol and the predominant effective component of Mangifera indica Linn. leaves. For hundreds of years, Mangifera indica Linn. leaf has been used as an ingredient in numerous traditional Chinese medicine preparations for the treatment of bronchitis. However, the pharmacological mechanism of mangiferin in the treatment of bronchitis remains to be elucidated. Macrophage classical activation is important role in the process of bronchial airway inflammation, and interferon regulatory factor 5 (IRF5) has been identified as a key regulatory factor for macrophage classical activation. The present study used the THP-1 human monocyte cell line to investigate whether mangiferin inhibits macrophage classical activation via suppressing IRF5 expression in vitro. THP-1 cells were differentiated to macrophages by phorbol 12-myristate 13-acetate. Macrophages were polarized to M1 macrophages following stimulation with lipopolysaccharide (LPS)/interferon-γ (IFN-γ). Flow cytometric analysis was conducted to detect the M1 macrophages. Reverse transcription-quantitative polymerase chain reaction was used to investigate cellular IRF5 gene expression. Levels of proinflammatory cytokines and IRF5 were assessed following cell culture and cellular homogenization using enzyme-linked immunosorbent assay. IRF5 protein and nuclei co-localization was performed in macrophages with laser scanning confocal microscope immunofluorescence analysis. The results of the present study demonstrated that mangiferin significantly inhibits LPS/IFN-γ stimulation-induced classical activation of macrophages in vitro and markedly decreases proinflammatory cytokine release. In addition, cellular IRF5 expression was markedly downregulated. These results suggest that the inhibitory effect of mangiferin on classical activation of macrophages may be exerted via downregulation of cellular IRF5 expression levels. PMID:27277156

  16. Immediate early transcription activation by salicylic acid via the cauliflower mosaic virus as-1 element.

    PubMed Central

    Qin, X F; Holuigue, L; Horvath, D M; Chua, N H

    1994-01-01

    Transgenic tobacco plants carrying a number of regulatory sequences derived from the cauliflower mosaic virus 35S promoter were tested for their response to treatment with salicylic acid (SA), an endogenous signal involved in plant defense responses. beta-Glucuronidase (GUS) gene fusions with the full-length (-343 to +8) 35S promoter or the -90 truncation were found to be induced by SA. Time course experiments revealed that, in the continuous presence of SA, the -90 promoter construct (-90 35S-GUS) displayed rapid and transient induction kinetics, with maximum RNA levels at 1 to 4 hr, which declined to low levels by 24 hr. Induction was still apparent in the presence of the protein synthesis inhibitor cycloheximide (CHX). Moreover, mRNA levels continued to accumulate over 24 hr rather than to decline. By contrast, mRNA from the endogenous pathogenesis-related protein-1a (PR-1a) gene began to accumulate at later times during SA treatment and steadily increased through 24 hr; transcription of this gene was almost completely blocked by the presence of CHX. Further dissection of the region from -90 and -46 of the 35S promoter revealed that the SA-responsive element corresponds to the previously characterized activation sequence-1 (as-1). These results represent a definitive analysis of immediate early responses to SA, relative to the late induction of PR genes, and potentially elucidate the early events of SA signal transduction during the plant defense response. PMID:8061520

  17. Asymmetrically reduced expression of hand1 homeologs involving a single nucleotide substitution in a cis-regulatory element.

    PubMed

    Ochi, Haruki; Suzuki, Nanoka; Kawaguchi, Akane; Ogino, Hajime

    2017-03-28

    During vertebrate evolution, whole genome duplications resulted in a number of duplicated genes, some of which eventually changed their expression patterns and/or levels via alteration of cis-regulatory sequences. However, the initial process involved in such cis-regulatory changes remains unclear. Therefore, we investigated this process by analyzing the duplicated hand1 genes of Xenopus laevis (hand1.L and hand1.S), which were generated by allotetraploidization 17-18 million years ago, and compared these with their single ortholog in the ancestral-type diploid species X. tropicalis. A dN/dS analysis indicated that hand1.L and hand1.S are still under purifying selection, and thus, their products appear to retain ancestral functional properties. RNA-seq and in situ hybridization analyses revealed that hand1.L and hand1.S have similar expression patterns to each other and to X. tropicalis hand1, but the hand1.S expression level was much lower than the hand1.L expression level in the primordial heart. A comparative sequence analysis, luciferase reporter analysis, ChIP-PCR analysis, and transgenic reporter analysis showed that a single nucleotide substitution in the hand1.S promoter was responsible for the reduced expression in the heart. These findings demonstrated that a small change in the promoter sequence can trigger diversification of duplicated gene expression prior to diversification of their encoded protein functions in a young duplicated genome.

  18. Transposable DNA elements and life history traits: II. Transposition of P DNA elements in somatic cells reduces fitness, mating activity, and locomotion of Drosophila melanogaster.

    PubMed

    Woodruff, R C; Thompson, J N; Barker, J S; Huai, H

    1999-01-01

    Some transposable DNA elements in higher organisms are active in somatic cells, as well as in germinal cells. What effect does the movement of DNA elements in somatic cells have on life history traits? It has previously been reported that somatically active P and mariner elements in Drosophila induce genetic damage and significantly reduce lifespan. In this study, we report that the movement of P elements in somatic cells also significantly reduces fitness, mating activity, and locomotion of Drosophila melanogaster. If other elements cause similar changes in life history traits, it is doubtful if transposable DNA elements remain active for long in somatic cells in natural populations.

  19. LWRS II&C Industry and Regulatory Engagement Activities for FY 11

    SciTech Connect

    Ken Thomas

    2011-09-01

    To ensure broad industry support and coordination for the Advanced Instrumentation, Information, and Controls (II&C) Systems Technologies research pathway, an engagement process will be continually pursued with nuclear asset owners, vendors, and suppliers, Nuclear Regulatory Commission (NRC), and the major industry support organizations of Electric Power Research Institute (EPRI), Institute of Nuclear Power Operations (INPO), and Nuclear Energy Institute (NEI). Nuclear asset owner engagement is a necessary and enabling activity to obtain data and accurate characterization of long-term operational challenges, assess the suitability of proposed research for addressing long-term needs, and gain access to data and representative infrastructure and expertise needed to ensure success of the proposed research and development (R&D) activities. Engagement with vendors and suppliers will ensure that vendor expectations and needs can be translated into requirements that can be met through technology commercialization.

  20. Interferon regulatory factor 3 as key element of the interferon signature in plasmacytoid dendritic cells from systemic lupus erythematosus patients: novel genetic associations in the Mexican mestizo population

    PubMed Central

    Santana-de Anda, K; Gómez-Martín, D; Monsivais-Urenda, A E; Salgado-Bustamante, M; González-Amaro, R; Alcocer-Varela, J

    2014-01-01

    Many genetic studies have found an association between interferon regulatory factors (IRF) single nucleotide polymorphisms (SNPs) and systemic lupus erythematosus (SLE); however, specific dendritic cell (DC) alterations have not been assessed. The aim of the present study was to address the expression of IRF3 and IRF5 on different DC subsets from SLE patients, as well as their association with interferon (IFN)-α production and novel SNPs. For the genetic association analyses, 156 SLE patients and 272 healthy controls from the Mexican mestizo population were included. From these, 36 patients and 36 controls were included for functional analysis. Two IRF3 SNPs − rs2304206 and rs2304204 – were determined. We found an increased percentage of circulating pDC in SLE patients in comparison to controls (8·04 ± 1·48 versus 3·35 ± 0·8, P = 0·032). We also observed enhanced expression of IRF3 (64 ± 6·36 versus 36·1 ± 5·57, P = 0·004) and IRF5 (40 ± 5·25 versus 22·5 ± 2·6%, P = 0·010) restricted to this circulating pDC subset from SLE patients versus healthy controls. This finding was associated with higher IFN-α serum levels in SLE (160·2 ± 21 versus 106·1 ± 14 pg/ml, P = 0·036). Moreover, the IRF3 rs2304206 polymorphism was associated with increased susceptibility to SLE [odds ratio (OR), 95% confidence interval (CI) = 2·401 (1·187–4·858), P = 0·021] as well as enhanced levels of serum type I IFN in SLE patients who were positive for dsDNA autoantibodies. The IRF3 rs2304204 GG and AG genotypes conferred decreased risk for SLE. Our findings suggest that the predominant IRF3 expression on circulating pDC is a key element for the increased IFN-α activation based on the interplay between the rs2304206 gene variant and the presence of dsDNA autoantibodies in Mexican mestizo SLE patients. PMID:25130328

  1. A 15-base-pair element activates the SPS4 gene midway through sporulation in Saccharomyces cerevisiae.

    PubMed Central

    Hepworth, S R; Ebisuzaki, L K; Segall, J

    1995-01-01

    Sporulation of the yeast Saccharomyces cerevisiae represents a simple developmental process in which the events of meiosis and spore wall formation are accompanied by the sequential activation of temporally distinct classes of genes. In this study, we have examined expression of the SPS4 gene, which belongs to a group of genes that is activated midway through sporulation. We mapped the upstream boundary of the regulatory region of SPS4 by monitoring the effect of sequential deletions of 5'-flanking sequence on expression of plasmid-borne versions of SPS4 introduced into a MATa/MAT alpha delta sps4/delta sps4 strain. This analysis indicated that the 5' boundary of the regulatory region was within 50 bp of the putative TATA box of the gene. By testing various oligonucleotides that spanned this boundary and the downstream sequence for their ability to activate expression of a heterologous promoter, we found that a 15-bp sequence sufficed to act as a sporulation-specific upstream activation sequence. This 15-bp fragment, designated UASSPS4, activated expression of a CYC1-lacZ reporter gene midway through sporulation and was equally active in both orientations. Extending the UAS fragment to include the adjacent 14-bp enhanced its activity 10-fold. We show that expression of SPS4 is regulated in a manner distinct from that of early meiotic genes: mutation of UME6 did not lead to vegetative expression of SPS4, and sporulation-specific expression was delayed by mutation of IME2. In vivo and in vitro assays suggested that a factor present in vegetative cells bind to the UASSPS4 element. We speculate that during sporulation this factor is modified to serve as an activator of the SPS4 gene or, alternatively, that it recruits an activator to the promoter. PMID:7791799

  2. Transformation mapping of the regulatory elements of the ecdysone-inducible P1 gene of Drosophila melanogaster

    SciTech Connect

    Maschat, F.; Dubertret, M.L.; Lepesant, J.A. )

    1991-05-01

    The transcription of the P1 gene is induced by 20-hydroxyecdysone in fat bodies of third-instar larvae. Germ line transformation showed that sequences between {minus}138 to +276 contain elements required for a qualitatively correct developmental and hormonal regulation of P1 transcription. Sequences from {minus}138 to {minus}68 are essential for this expression.

  3. Discrete elements within the SV40 enhancer region display different cell-specific enhancer activities.

    PubMed Central

    Ondek, B; Shepard, A; Herr, W

    1987-01-01

    The SV40 enhancer contains three genetically defined elements, called A, B and C, that can functionally compensate for one another. By using short, synthetic DNA oligonucleotides, we show that each of these elements can act autonomously as an enhancer when present as multiple tandem copies. Analysis of a progressive series of B element oligomers shows a single element is ineffective as an enhancer and that the activity of two or more elements increases with copy number. Assay in five different cell lines of two separate enhancers containing six tandem copies of either the B or C element shows that these elements possess different cell-specific activities. Parallel oligomer enhancer constructs containing closely spaced double point mutations display no enhancer activity in any of the cell lines tested, indicating that these elements represent single units of enhancer function. These elements contain either a 'core' or 'octamer' consensus sequence but these consensus sequences alone are not sufficient for enhancer activity. The different cell-specific activities of the B and C elements are consistent with functional interactions with different trans-acting factors. We discuss how tandem duplication of such dissimilar elements, as in the wild-type SV40 72-bp repeats, can serve to expand the conditions under which an enhancer can function. Images Fig. 2. Fig. 3. Fig. 4. PMID:3036487

  4. Trace elements by instrumental neutron activation analysis for pollution monitoring

    NASA Technical Reports Server (NTRS)

    Sheibley, D. W.

    1975-01-01

    Methods and technology were developed to analyze 1000 samples/yr of coal and other pollution-related samples. The complete trace element analysis of 20-24 samples/wk averaged 3-3.5 man-hours/sample. The computerized data reduction scheme could identify and report data on as many as 56 elements. In addition to coal, samples of fly ash, bottom ash, crude oil, fuel oil, residual oil, gasoline, jet fuel, kerosene, filtered air particulates, ore, stack scrubber water, clam tissue, crab shells, river sediment and water, and corn were analyzed. Precision of the method was plus or minus 25% based on all elements reported in coal and other sample matrices. Overall accuracy was estimated at 50%.

  5. Nuclear Thermal Rocket Element Environmental Simulator (NTREES) Upgrade Activities

    NASA Technical Reports Server (NTRS)

    Emrich, William J. Jr.; Moran, Robert P.; Pearson, J. Boise

    2012-01-01

    To support the on-going nuclear thermal propulsion effort, a state-of-the-art non nuclear experimental test setup has been constructed to evaluate the performance characteristics of candidate fuel element materials and geometries in representative environments. The facility to perform this testing is referred to as the Nuclear Thermal Rocket Element Environment Simulator (NTREES). This device can simulate the environmental conditions (minus the radiation) to which nuclear rocket fuel components will be subjected during reactor operation. Test articles mounted in the simulator are inductively heated in such a manner so as to accurately reproduce the temperatures and heat fluxes which would normally occur as a result of nuclear fission and would be exposed to flowing hydrogen. Initial testing of a somewhat prototypical fuel element has been successfully performed in NTREES and the facility has now been shutdown to allow for an extensive reconfiguration of the facility which will result in a significant upgrade in its capabilities

  6. Massively parallel quantification of the regulatory effects of noncoding genetic variation in a human cohort.

    PubMed

    Vockley, Christopher M; Guo, Cong; Majoros, William H; Nodzenski, Michael; Scholtens, Denise M; Hayes, M Geoffrey; Lowe, William L; Reddy, Timothy E

    2015-08-01

    We report a novel high-throughput method to empirically quantify individual-specific regulatory element activity at the population scale. The approach combines targeted DNA capture with a high-throughput reporter gene expression assay. As demonstration, we measured the activity of more than 100 putative regulatory elements from 95 individuals in a single experiment. In agreement with previous reports, we found that most genetic variants have weak effects on distal regulatory element activity. Because haplotypes are typically maintained within but not between assayed regulatory elements, the approach can be used to identify causal regulatory haplotypes that likely contribute to human phenotypes. Finally, we demonstrate the utility of the method to functionally fine map causal regulatory variants in regions of high linkage disequilibrium identified by expression quantitative trait loci (eQTL) analyses.

  7. Massively parallel quantification of the regulatory effects of noncoding genetic variation in a human cohort

    PubMed Central

    Vockley, Christopher M.; Guo, Cong; Majoros, William H.; Nodzenski, Michael; Scholtens, Denise M.; Hayes, M. Geoffrey; Lowe, William L.; Reddy, Timothy E.

    2015-01-01

    We report a novel high-throughput method to empirically quantify individual-specific regulatory element activity at the population scale. The approach combines targeted DNA capture with a high-throughput reporter gene expression assay. As demonstration, we measured the activity of more than 100 putative regulatory elements from 95 individuals in a single experiment. In agreement with previous reports, we found that most genetic variants have weak effects on distal regulatory element activity. Because haplotypes are typically maintained within but not between assayed regulatory elements, the approach can be used to identify causal regulatory haplotypes that likely contribute to human phenotypes. Finally, we demonstrate the utility of the method to functionally fine map causal regulatory variants in regions of high linkage disequilibrium identified by expression quantitative trait loci (eQTL) analyses. PMID:26084464

  8. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

    PubMed Central

    Asp, Torben; Kristensen, Michael

    2016-01-01

    Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s

  9. Gluconacetobacter diazotrophicus PAL5 possesses an active quorum sensing regulatory system.

    PubMed

    Bertini, Elisa V; Nieto Peñalver, Carlos G; Leguina, Ana C; Irazusta, Verónica P; de Figueroa, Lucía I C

    2014-09-01

    The endophytic bacterium Gluconacetobacter diazotrophicus colonizes a broad range of host plants. Its plant growth-promoting capability is related to the capacity to perform biological nitrogen fixation, the biosynthesis of siderophores, antimicrobial substances and the solubilization of mineral nutrients. Colonization of and survival in these endophytic niche requires a complex regulatory network. Among these, quorum sensing systems (QS) are signaling mechanisms involved in the control of several genes related to microbial interactions, host colonization and stress survival. G. diazotrophicus PAL5 possesses a QS composed of a luxR and a luxI homolog, and produces eight molecules from the AHL family as QS signals. In this report data are provided showing that glucose concentration modifies the relative levels of these signal molecules. The activity of G. diazotrophicus PAL5 QS is also altered in presence of other carbon sources and under saline stress conditions. Inactivation of the QS system of G. diazotrophicus PAL5 by means of a quorum quenching strategy allowed the identification of extracellular and intracellular proteins under the control of this regulatory mechanism.

  10. Removal of regulatory T cell activity reverses hyporesponsiveness and leads to filarial parasite clearance in vivo.

    PubMed

    Taylor, Matthew D; LeGoff, Laetitia; Harris, Anjanette; Malone, Eva; Allen, Judith E; Maizels, Rick M

    2005-04-15

    Human filarial parasites cause chronic infection associated with long-term down-regulation of the host's immune response. We show here that CD4+ T cell regulation is the main determinant of parasite survival. In a laboratory model of infection, using Litomosoides sigmodontis in BALB/c mice, parasites establish for >60 days in the thoracic cavity. During infection, CD4+ T cells at this site express increasing levels of CD25, CTLA-4, and glucocorticoid-induced TNF receptor family-related gene (GITR), and by day 60, up to 70% are CTLA-4(+)GITR(high), with a lesser fraction coexpressing CD25. Upon Ag stimulation, CD4(+)CTLA-4(+)GITR(high) cells are hyporesponsive for proliferation and cytokine production. To test the hypothesis that regulatory T cell activity maintains hyporesponsiveness and prolongs infection, we treated mice with Abs to CD25 and GITR. Combined Ab treatment was able to overcome an established infection, resulting in a 73% reduction in parasite numbers (p < 0.01). Parasite killing was accompanied by increased Ag-specific immune responses and markedly reduced levels of CTLA-4 expression. The action of the CD25(+)GITR+ cells was IL-10 independent as in vivo neutralization of IL-10R did not restore the ability of the immune system to kill parasites. These data suggest that regulatory T cells act, in an IL-10-independent manner, to suppress host immunity to filariasis.

  11. GITR ligand-costimulation activates effector and regulatory functions of CD4{sup +} T cells

    SciTech Connect

    Igarashi, Hanna; Cao, Yujia; Iwai, Hideyuki; Piao, Jinhua; Kamimura, Yosuke; Hashiguchi, Masaaki; Amagasa, Teruo; Azuma, Miyuki

    2008-05-16

    Engagement of glucocorticoid-induced TNFR-related protein (GITR) enables the costimulation of both CD25{sup -}CD4{sup +} effector (Teff) and CD25{sup +}CD4{sup +} regulatory (Treg) cells; however, the effects of GITR-costimulation on Treg function remain controversial. In this study, we examined the effects of GITR ligand (GITRL) binding on the respective functions of CD4{sup +} T cells. GITRL-P815 transfectants efficiently augmented anti-CD3-induced proliferation and cytokine production by Teff cells. Proliferation and IL-10 production in Treg were also enhanced by GITRL transfectants when exogenous IL-2 and stronger CD3 stimulation was provided. Concomitant GITRL-costimulation of Teff and Treg converted the anergic state of Treg into a proliferating state, maintaining and augmenting their function. Thus, GITRL-costimulation augments both effector and regulatory functions of CD4{sup +} T cells. Our results suggest that highly activated and increased ratios of Treg reverse the immune-enhancing effects of GITRL-costimulation in Teff, which may be problematic for therapeutic applications using strong GITR agonists.

  12. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  13. ELEMENTAL MERCURY ADSORPTION BY ACTIVATED CARBON TREATED WITH SULFURIC ACID

    EPA Science Inventory

    The paper gives results of a study of the adsorption of elemental mercury at 125 C by a sulfuric-acid (H2S04, 50% w/w/ solution)-treated carbon for the removal of mercury from flue gas. The pore structure of the sample was characterized by nitrogen (N2) at -196 C and the t-plot m...

  14. On the Role of the Artistic Element in Pedagogical Activity

    ERIC Educational Resources Information Center

    Bulatova, O. S.

    2006-01-01

    Pedagogy includes not only knowledge of the different sciences, but also elements of the artistic and imaginative perception of the world. In this article, the author discusses the importance of creating an atmosphere and construct situations that foster a rate of compassion, so that students can internalize feelings in their own spiritual space…

  15. Trace elements removal from water using modified activated carbon.

    PubMed

    Campos, V; Buchler, P M

    2008-02-01

    This paper present the possible alternative options for the remove of trace elements from drinking water supplies in the trace. Arsenic and chromium are two of the most toxic pollutants, introduced into natural waters from a variety of sources and causing various adverse effects on living bodies. The performance of three filter bed methods was evaluated in the laboratory. Experiments were conducted to investigate the sorption of arsenic and chromium on carbon steel and removal of trace elements from drinking water with a household filtration process. The affinity of the arsenic and chromium species for Fe/Fe3C (iron/iron carbide) sites is the key factor controlling the removal of the elements. The method is based on the use of powdered block carbon, powder carbon steel and ceramic spheres in the ion-sorption columns as a cleaning process. The modified powdered block carbon is a satisfactory and economical sorbent for trace elements (arsenite and chromate) dissolved in water due to its low unit cost of about $23 and compatibility with the traditional household filtration system.

  16. The impact of element-element interactions on antioxidant enzymatic activity in the blood of white stork (Ciconia ciconia) chicks.

    PubMed

    Kamiński, Piotr; Kurhalyuk, Nataliya; Kasprzak, Mariusz; Jerzak, Leszek; Tkachenko, Halyna; Szady-Grad, Małgorzata; Klawe, Jacek J; Koim, Beata

    2009-02-01

    The aim of this work was to determine interrelationships among macroelements Na, K, Ca, Mg, and Fe, microelements Zn, Cu, Mn, and Co, and toxic heavy metals Pb and Cd in the blood of white stork Ciconia ciconia, during postnatal development, in different Polish environments, and their impact on the activity of antioxidant enzymes. We considered the content of thiobarbituric acid-reactive substances (TBARSs), i.e., malondialdehyde (MDA), and activity of superoxide dismutase (SOD), catalase (CAT), ceruloplasmine (CP), glutathione peroxidase (GPx), and glutathione reductase (GR). Blood samples were collected from storks developing at Odra meadows (Kłopot; southwestern Poland). They were compared with blood of chicks from several suburban sites located 20 km away from Zielona Góra (0.1 million inhabitants; southwestern Poland) and near Głogów, where a copper smelter is situated. We also conducted research in the Pomeranian region (Cecenowo; northern Poland). We collected blood samples via venipuncture of the brachial vein of chicks in 2005-2007. They were retrieved from the nest and placed in individual ventilated cotton sacks. The blood was collected using a 5-ml syringe washed with ethylenediaminetetraacetic acid (EDTA). We found significant interactions between macro- and microelements and enzymatic activity and TBARS products. We noticed the predominance of Cd and Pb participation in element-enzyme interactions. Simultaneously, we found interrelationships between cadmium and Na, K, Ca, Mg, and Fe and the activity of antioxidant enzymes SOD, CAT, CP, GR, and TBARS products in the blood of white stork chicks. In the case of lead these relationships were not numerous and they were significant for Ca, Mg, Cu, Mn, and Co. Correlations with enzymes were significant for Pb-CAT and Pb-TBARS. We noted that activities of most enzymes (SOD, CAT, CP, GR) and TBARS products are determined by their interactions with physiological elements Na, Ca, Mg, Fe, and Zn and toxic

  17. Physical Activity in the Transition to University: The Role of Past Behavior and Concurrent Self-Regulatory Efficacy

    ERIC Educational Resources Information Center

    Crozier, Alyson J.; Gierc, Madelaine S. H.; Locke, Sean R.; Brawley, Lawrence R.

    2015-01-01

    Objective: Two studies were conducted to examine the relationship between past physical activity, concurrent self-regulatory efficacy (CSRE), and current physical activity during the transition to university. Participants: Study 1 included 110 first-year undergraduate students recruited during October/November of 2012. Study 2 involved 86…

  18. Regulatory Assistance, Stakeholder Outreach, and Coastal and Marine Spatial Planning Activities in Support of Marine and Hydrokinetic Energy Deployment

    SciTech Connect

    Geerlofs, Simon H.; Copping, Andrea E.; Van Cleve, Frances B.; Blake, Kara M.; Hanna, Luke A.

    2011-09-01

    This fiscal year 2011 progress report summarizes activities carried out under DOE Water Power Task 2.1.7, Permitting and Planning. Activities under Task 2.1.7 address the concerns of a wide range of stakeholders with an interest in the development of the marine and hydrokinetic (MHK) energy industry, including regulatory and resource management agencies, tribes, nongovernmental organizations, and industry.

  19. 78 FR 13712 - U.S. Nuclear Regulatory Commission Planned Monitoring Activities for F-Area Tank Farm at the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-28

    ... COMMISSION U.S. Nuclear Regulatory Commission Planned Monitoring Activities for F-Area Tank Farm at the... Savannah River Site F-Area Tank Farm Facility in Accordance with the National Defense Authorization Act for... DOE's waste disposal activities at the F-Area Tank Farm at the Savannah River Site, in accordance...

  20. Finite Element Learning Modules as Active Learning Tools

    ERIC Educational Resources Information Center

    Brown, Ashland O.; Jensen, Daniel; Rencis, Joseph; Wood, Kristin; Wood, John; White, Christina; Raaberg, Kristen Kaufman; Coffman, Josh

    2012-01-01

    The purpose of active learning is to solicit participation by students beyond the passive mode of traditional classroom lectures. Reading, writing, participating in discussions, hands-on activities, engaging in active problem solving, and collaborative learning can all be involved. The skills acquired during active learning tend to go above and…

  1. Treatment of Uveitis by In Situ Administration of Ex Vivo-Activated Polyclonal Regulatory T Cells.

    PubMed

    Grégoire, Sylvie; Terrada, Céline; Martin, Gaelle H; Fourcade, Gwladys; Baeyens, Audrey; Marodon, Gilles; Fisson, Sylvain; Billiard, Fabienne; Lucas, Bruno; Tadayoni, Ramin; Béhar-Cohen, Francine; Levacher, Béatrice; Galy, Anne; LeHoang, Phuc; Klatzmann, David; Bodaghi, Bahram; Salomon, Benoît L

    2016-03-01

    CD4(+)CD25(+)Foxp3(+) regulatory T (Treg) cell therapy is a promising approach for the treatment of autoimmune diseases. To be effective, Treg cells should be in an activated state in the target tissue. This can be achieved by systemic administration of Ag-specific Treg cells, which are difficult to produce in conditions that can be translated to the clinic. In this paper, we propose an alternative approach consisting of in situ injection of preactivated polyclonal Treg cells that would exert bystander suppression in the target tissue. We show that polyclonal Treg cells suppressed uveitis in mice as efficiently as Ag-specific Treg cells but only when preactivated and administered in the vitreous. Uveitis control was correlated with an increase of IL-10 and a decrease of reactive oxygen species produced by immune cell infiltrates in the eye. Thus, our results reveal a new mechanism of Treg cell-mediated suppression and a new Treg cell therapy approach.

  2. HRP-2, the Caenorhabditis elegans homolog of mammalian heterogeneous nuclear ribonucleoproteins Q and R, is an alternative splicing factor that binds to UCUAUC splicing regulatory elements.

    PubMed

    Kabat, Jennifer L; Barberan-Soler, Sergio; Zahler, Alan M

    2009-10-16

    Alternative splicing is regulated by cis sequences in the pre-mRNA that serve as binding sites for trans-acting alternative splicing factors. In a previous study, we used bioinformatics and molecular biology to identify and confirm that the intronic hexamer sequence UCUAUC is a nematode alternative splicing regulatory element. In this study, we used RNA affinity chromatography to identify trans factors that bind to this sequence. HRP-2, the Caenorhabditis elegans homolog of human heterogeneous nuclear ribonucleoproteins Q and R, binds to UCUAUC in the context of unc-52 intronic regulatory sequences as well as to RNAs containing tandem repeats of this sequence. The three Us in the hexamer are the most important determinants of this binding specificity. We demonstrate, using RNA interference, that HRP-2 regulates the alternative splicing of two genes, unc-52 and lin-10, both of which have cassette exons flanked by an intronic UCUAUC motif. We propose that HRP-2 is a protein responsible for regulating alternative splicing through binding interactions with the UCUAUC sequence.

  3. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    PubMed

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression.

  4. The protein tyrosine phosphatase SHP-1 modulates the suppressive activity of regulatory T cells

    PubMed Central

    Iype, Tessy; Sankarshanan, Mohan; Mauldin, Ileana S.; Mullins, David W.; Lorenz, Ulrike

    2010-01-01

    The importance of regulatory T cells (Treg) for immune tolerance is well recognized, yet the signaling molecules influencing their suppressive activity are relatively poorly understood. Here, through in vivo studies and complementary ex vivo studies, we make several important observations. First, we identify the cytoplasmic tyrosine phosphatase SHP-1 as a novel ‘endogenous brake’ and modifier of the suppressive ability of Treg cells; consistent with this notion, loss of SHP-1 expression strongly augments the ability of Treg cells to suppress inflammation in a mouse model. Second, specific pharmacological inhibition of SHP-1 enzymatic activity via the cancer drug sodium stibogluconate (SSG) potently augmented Treg cell suppressor activity both in vivo and ex vivo. Finally, through a quantitative imaging approach, we directly demonstrate that Treg cells prevent the activation of conventional T cells, and that SHP-1-deficient Treg cells are more efficient suppressors. Collectively, our data reveal SHP-1 as a critical modifier of Treg cell function, and a potential therapeutic target for augmenting Treg cell-mediated suppression in certain disease states. PMID:20952680

  5. Enterococcus faecalis reconfigures its gene regulatory network activation under copper exposure

    PubMed Central

    Latorre, Mauricio; Galloway-Peña, Jessica; Roh, Jung Hyeob; Budinich, Marko; Reyes-Jara, Angélica; Murray, Barbara E.; Maass, Alejandro; González, Mauricio

    2014-01-01

    A gene regulatory network was generated in the bacterium Enterococcus faecalis in order to understand how this organism can activate its expression under different copper concentrations. The topological evaluation of the network showed common patterns described in other organisms. Integrating microarray experiments allowed the identification of sub-networks activated under low (0.05 mM CuSO4) and high (0.5 mM CuSO4) copper concentrations. The analysis indicates the presence of specific functionally activated modules induced by copper, highlighting the regulons LysR, ArgR as global regulators and CopY, Fur and LexA as local regulators. Taking advantage of the fact that E. faecalis presented a homeostatic module isolated, we produced an in vivo intervention removing this system from the cell without affecting the connectivity of the global transcriptional network. This strategy led us to find that this bacterium can reconfigure its gene expression to maintain cellular homeostasis, activating new modules principally related to glucose metabolism and transcriptional processes. Finally, these results position E. faecalis as the organism having the most complete and controllable systemic model of copper homeostasis available to date. PMID:24382465

  6. Separating Tumorigenicity from Bile Acid Regulatory Activity for Endocrine Hormone FGF19.

    PubMed

    Zhou, Mei; Wang, Xueyan; Phung, Van; Lindhout, Darrin A; Mondal, Kalyani; Hsu, Jer-Yuan; Yang, Hong; Humphrey, Mark; Ding, Xunshan; Arora, Taruna; Learned, R Marc; DePaoli, Alex M; Tian, Hui; Ling, Lei

    2014-06-15

    Hepatocellular carcinoma (HCC), one of the leading causes of cancer-related death, develops from premalignant lesions in chronically damaged livers. Although it is well established that FGF19 acts through the receptor complex FGFR4-β-Klotho (KLB) to regulate bile acid metabolism, FGF19 is also implicated in the development of HCC. In humans, FGF19 is amplified in HCC and its expression is induced in the liver under cholestatic and cirrhotic conditions. In mice, ectopic overexpression of FGF19 drives HCC development in a process that requires FGFR4. In this study, we describe an engineered FGF19 (M70) that fully retains bile acid regulatory activity but does not promote HCC formation, demonstrating that regulating bile acid metabolism is distinct and separable from tumor-promoting activity. Mechanistically, we show that FGF19 stimulates tumor progression by activating the STAT3 pathway, an activity eliminated by M70. Furthermore, M70 inhibits FGF19-dependent tumor growth in a rodent model. Our results suggest that selectively targeting the FGF19-FGFR4 pathway may offer a tractable approach to improve the treatment of chronic liver disease and cancer.

  7. Ikkepsilon regulates viral-induced interferon regulatory factor-3 activation via a redox-sensitive pathway

    SciTech Connect

    Indukuri, Hemalatha; Castro, Shawn M.; Liao, S.-M.; Feeney, Lee Ann; Dorsch, Marion; Coyle, Anthony J.; Garofalo, Roberto P.; Brasier, Allan R.; Casola, Antonella . E-mail: ancasola@utmb.edu

    2006-09-15

    Respiratory syncytial virus (RSV)-induced chemokine gene expression occurs through the activation of a subset of transcription factors, including Interferon Regulatory Factor (IRF)-3. In this study, we have investigated the signaling pathway leading to RSV-induced IRF-3 activation and whether it is mediated by intracellular reactive oxygen species (ROS) generation. Our results show that RSV infection induces expression and catalytic activity of IKK{epsilon}, a noncanonical IKK-like kinase. Expression of a kinase-inactive IKK{epsilon} blocks RSV-induced IRF-3 serine phosphorylation, nuclear translocation and DNA-binding, leading to inhibition of RANTES gene transcription, mRNA expression and protein synthesis. Treatment of alveolar epithelial cells with antioxidants or with NAD(P)H oxidase inhibitors abrogates RSV-induced chemokine secretion, IRF-3 phosphorylation and IKK{epsilon} induction, indicating that ROS generation plays a fundamental role in the signaling pathway leading to IRF-3 activation, therefore, identifying a novel molecular target for the development of strategies aimed to modify the inflammatory response associated with RSV infection of the lung.

  8. Nuclear Thermal Rocket Element Environmental Simulator (NTREES) Upgrade Activities

    NASA Technical Reports Server (NTRS)

    Emrich, William

    2013-01-01

    A key technology element in Nuclear Thermal Propulsion is the development of fuel materials and components which can withstand extremely high temperatures while being exposed to flowing hydrogen. NTREES provides a cost effective method for rapidly screening of candidate fuel components with regard to their viability for use in NTR systems. The NTREES is designed to mimic the conditions (minus the radiation) to which nuclear rocket fuel elements and other components would be subjected to during reactor operation. The NTREES consists of a water cooled ASME code stamped pressure vessel and its associated control hardware and instrumentation coupled with inductive heaters to simulate the heat provided by the fission process. The NTREES has been designed to safely allow hydrogen gas to be injected into internal flow passages of an inductively heated test article mounted in the chamber.

  9. The nT1 translocation separates vulval regulatory elements from the egl-18 and elt-6 GATA factor genes.

    PubMed

    Koh, Kyunghee; Bernstein, Yelena; Sundaram, Meera V

    2004-03-01

    egl-18 and elt-6 are partially redundant, adjacent genes encoding GATA factors essential for viability, seam cell development, and vulval development in Caenorhabditis elegans. The nT1 reciprocal translocation causes a strong Vulvaless phenotype, and an nT1 breakpoint was previously mapped to the left arm of LGIV, where egl-18/elt-6 are located. Here we present evidence that the nT1 vulval phenotype is due to a disruption of egl-18/elt-6 function specifically in the vulva. egl-18 mutations do not complement nT1 for vulval defects, and the nT1 breakpoint on LGIV is located within approximately 800 bp upstream of a potential transcriptional start site of egl-18. In addition, we have identified a approximately 350-bp cis-regulatory region sufficient for vulval expression just upstream of the nT1 breakpoint. By examining the fusion state and division patterns of the cells in the developing vulva of nT1 mutants, we demonstrate that egl-18/elt-6 prevent fusion and promote cell proliferation at multiple steps of vulval development.

  10. Multiple functions of nucleosomes and regulatory factors in transcription.

    PubMed

    Workman, J L; Buchman, A R

    1993-03-01

    The in vivo packaging of DNA with histone proteins to form chromatin makes its transcription a difficult process. Biochemical and genetic studies are beginning to reveal mechanistic details of how transcriptional regulatory factors confront at least two hurdles created by nucleosomes, the primary structural unit of chromatin. Regulatory factors must gain access to their respective binding sites and activate the formation of transcription complexes at core promoter elements. Distinct regulatory factors may be specialized to perform these functions.

  11. HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genes▿

    PubMed Central

    Hassan, Mohammad Q.; Tare, Rahul; Lee, Suk Hee; Mandeville, Matthew; Weiner, Brian; Montecino, Martin; van Wijnen, Andre J.; Stein, Janet L.; Stein, Gary S.; Lian, Jane B.

    2007-01-01

    HOXA10 is necessary for embryonic patterning of skeletal elements, but its function in bone formation beyond this early developmental stage is unknown. Here we show that HOXA10 contributes to osteogenic lineage determination through activation of Runx2 and directly regulates osteoblastic phenotypic genes. In response to bone morphogenic protein BMP2, Hoxa10 is rapidly induced and functions to activate the Runx2 transcription factor essential for bone formation. A functional element with the Hox core motif was characterized for the bone-related Runx2 P1 promoter. HOXA10 also activates other osteogenic genes, including the alkaline phosphatase, osteocalcin, and bone sialoprotein genes, and temporally associates with these target gene promoters during stages of osteoblast differentiation prior to the recruitment of RUNX2. Exogenous expression and small interfering RNA knockdown studies establish that HOXA10 mediates chromatin hyperacetylation and trimethyl histone K4 (H3K4) methylation of these genes, correlating to active transcription. HOXA10 therefore contributes to early expression of osteogenic genes through chromatin remodeling. Importantly, HOXA10 can induce osteoblast genes in Runx2 null cells, providing evidence for a direct role in mediating osteoblast differentiation independent of RUNX2. We propose that HOXA10 activates RUNX2 in mesenchymal cells, contributing to the onset of osteogenesis, and that HOXA10 subsequently supports bone formation by direct regulation of osteoblast phenotypic genes. PMID:17325044

  12. Mutually exclusive splicing regulates the Nav 1.6 sodium channel function through a combinatorial mechanism that involves three distinct splicing regulatory elements and their ligands

    PubMed Central

    Zubović, Lorena; Baralle, Marco; Baralle, Francisco E.

    2012-01-01

    Mutually exclusive splicing is a form of alternative pre-mRNA processing that consists in the use of only one of a set of two or more exons. We have investigated the mechanisms involved in this process for exon 18 of the Nav 1.6 sodium channel transcript and its significance regarding gene-expression regulation. The 18N exon (neonatal form) has a stop codon in phase and although the mRNA can be detected by amplification methods, the truncated protein has not been observed. The switch from 18N to 18A (adult form) occurs only in a restricted set of neural tissues producing the functional channel while other tissues display the mRNA with the 18N exon also in adulthood. We demonstrate that the mRNA species carrying the stop codon is subjected to Nonsense-Mediated Decay, providing a control mechanism of channel expression. We also map a string of cis-elements within the mutually exclusive exons and in the flanking introns responsible for their strict tissue and temporal specificity. These elements bind a series of positive (RbFox-1, SRSF1, SRSF2) and negative (hnRNPA1, PTB, hnRNPA2/B1, hnRNPD-like JKTBP) splicing regulatory proteins. These splicing factors, with the exception of RbFox-1, are ubiquitous but their levels vary during development and differentiation, ensuing unique sets of tissue and temporal levels of splicing factors. The combinatorial nature of these elements is highlighted by the dominance of the elements that bind the ubiquitous factors over the tissue specific RbFox-1. PMID:22434879

  13. A new regulatory element mediates ethanol repression of KlADH3, a Kluyveromyces lactis gene coding for a mitochondrial alcohol dehydrogenase.

    PubMed

    Saliola, Michele; Getuli, Claudia; Mazzoni, Cristina; Fantozzi, Ivana; Falcone, Claudio

    2007-08-01

    KlADH3 is a Kluyveromyces lactis alcohol dehydrogenase gene induced in the presence of all respiratory carbon sources except ethanol, which specifically represses this gene. Deletion analysis of the KlADH3 promoter revealed the presence of both positive and negative elements. However, by site-directed mutagenesis and gel retardation experiments, we identified a 15-bp element responsible for the transcriptional repression of this gene by ethanol. In particular, this element showed putative sites required for the sequential binding of ethanol-induced factors responsible for the repressed conditions, and the binding of additional factors relieved repression. In addition, we showed that the ethanol element was required for in vivo repression of KlAdh3 activity.

  14. PreCisIon: PREdiction of CIS-regulatory elements improved by gene’s positION

    PubMed Central

    Elati, Mohamed; Nicolle, Rémy; Junier, Ivan; Fernández, David; Fekih, Rim; Font, Julio; Képès, François

    2013-01-01

    Conventional approaches to predict transcriptional regulatory interactions usually rely on the definition of a shared motif sequence on the target genes of a transcription factor (TF). These efforts have been frustrated by the limited availability and accuracy of TF binding site motifs, usually represented as position-specific scoring matrices, which may match large numbers of sites and produce an unreliable list of target genes. To improve the prediction of binding sites, we propose to additionally use the unrelated knowledge of the genome layout. Indeed, it has been shown that co-regulated genes tend to be either neighbors or periodically spaced along the whole chromosome. This study demonstrates that respective gene positioning carries significant information. This novel type of information is combined with traditional sequence information by a machine learning algorithm called PreCisIon. To optimize this combination, PreCisIon builds a strong gene target classifier by adaptively combining weak classifiers based on either local binding sequence or global gene position. This strategy generically paves the way to the optimized incorporation of any future advances in gene target prediction based on local sequence, genome layout or on novel criteria. With the current state of the art, PreCisIon consistently improves methods based on sequence information only. This is shown by implementing a cross-validation analysis of the 20 major TFs from two phylogenetically remote model organisms. For Bacillus subtilis and Escherichia coli, respectively, PreCisIon achieves on average an area under the receiver operating characteristic curve of 70 and 60%, a sensitivity of 80 and 70% and a specificity of 60 and 56%. The newly predicted gene targets are demonstrated to be functionally consistent with previously known targets, as assessed by analysis of Gene Ontology enrichment or of the relevant literature and databases. PMID:23241390

  15. Human secondary lymphoid organs typically contain polyclonally-activated proliferating regulatory T cells.

    PubMed

    Peters, Jorieke H; Koenen, Hans J P M; Fasse, Esther; Tijssen, Henk J; Ijzermans, Jan N M; Groenen, Patricia J T A; Schaap, Nicolaas P M; Kwekkeboom, Jaap; Joosten, Irma

    2013-09-26

    Immunomodulating regulatory T-cell (Treg) therapy is a promising strategy in autoimmunity and transplantation. However, to achieve full clinical efficacy, better understanding of in vivo human Treg biology is warranted. Here, we demonstrate that in contrast to blood and bone marrow Tregs, which showed a resting phenotype, the majority of CD4(pos)CD25(pos)CD127(neg)FoxP3(pos) Tregs in secondary lymphoid organs were proliferating activated CD69(pos)CD45RA(neg) cells with a hyperdemethylated FOXP3 gene and a broad T-cell receptor-Vβ repertoire, implying polyclonal activation. Activated CD69(pos) Tregs were distributed over both T-cell and B-cell areas, distant from Aire(pos) and CD11c(pos) cells. In contrast to the anergic peripheral blood Tregs, lymphoid organ Tregs had significant ex vivo proliferative capacity and produced cytokines like interleukin-2, while revealing similar suppressive potential. Also, next to Treg-expressing chemokine receptors important for a prolonged stay in lymphoid organs, a significant part of the cells expressed peripheral tissue-associated, functional homing markers. In conclusion, our data suggest that human secondary lymphoid organs aid in the maintenance and regulation of Treg function and homeostasis. This knowledge may be exploited for further optimization of Treg immunotherapy, for example, by ex vivo selection of Tregs with capacity to migrate to lymphoid organs providing an in vivo platform for further Treg expansion.

  16. Antioxidant and insect growth regulatory activities of stilbenes and extracts from Yucca periculosa.

    PubMed

    Torres, Patricio; Avila, J Guillermo; Romo de Vivar, Alfonso; García, Ana M; Marín, Juan C; Aranda, Eduardo; Céspedes, Carlos L

    2003-09-01

    The methanol extract from the bark of Yucca periculosa F. Baker afforded 4,4'-dihydroxstilbene, resveratrol and 3,3',5,5'-tetrahydroxy-4-methoxystilbene and had growth regulatory activity against the Fall Army worm (Spodoptera frugiperda J.E. Smith, Lepidoptera:Noctuidae) an insect pest of corn. The most active compound was 3,3',5,5'-tetrahydroxy-4-methoxystilbene which had significant effects at 3 microg/g in diets. In addition to the inhibitory activity on bleaching of crocin induced by alkoxyl radicals, these compounds also demonstrated scavenging properties toward 2,2-diphenyl-1-picrylhydrazyl in TLC autographic and spectrophotometric assays. Our results indicate that these compounds could be involved in interference of sclerotization and moulting. These compounds appear to have selective effects on the pre-emergence metabolism of the insect. The results were fully comparable to known natural insect growth inhibitors such as gedunin and Cedrela extracts and have had a possible role as natural insecticidal agents.

  17. Properties of osmolyte fluxes activated during regulatory volume decrease in cultured cerebellar granule neurons.

    PubMed

    Pasantes-Morales, H; Chacón, E; Murray, R A; Morán, J

    1994-04-15

    Efflux pathways for amino acids, K, and Cl activated during regulatory volume decrease (RVD) were characterized in cultured cerebellar granule neurons exposed to hyposmotic conditions. Results of this study favor diffusion pores (presumably channels) over energy-dependent transporters as the mechanisms responsible for the efflux of these osmolytes. The selectivity of osmolyte pathways activated by RVD was assessed by increasing the extracellular concentrations of cations, anions, and amino acids to such an extent that upon opening of the pathway, a permeable compound will enter the cell and block RVD by reducing the efflux of water carried by the exit of intracellular osmolytes. The cationic pathway was found selective for K (and Rb), whereas the anionic pathway was rather unselective being permeable to Cl, nitrate, iodine, benzoate, thiocyanate, and sulfate but impermeable to gluconate. Glutamate and aspartate as K but not as Na salts were permeable through the anion channel. RVD was slightly inhibited by quinidine but otherwise was insensitive to known K channel blockers. RVD was inhibited by 4,4'-diisothiocyanostilbene-2-2'-disulfonic acid (DIDS), niflumic acid, and dipyridamole. Gramicidin did not affect cell volume in isosmotic conditions but greatly accelerated RVD, suggesting that cell permeability to Cl is low in isosmotic conditions but increases markedly during RVD making K permeability the rate limit of the process. The permeability pathway for amino acids activated during RVD as permeable to short chain alpha- and beta-amino acids, but excluded glutamine and basic amino acids.

  18. Interaction between transcriptional activator protein LAC9 and negative regulatory protein GAL80.

    PubMed Central

    Salmeron, J M; Langdon, S D; Johnston, S A

    1989-01-01

    In Saccharomyces cerevisiae, transcriptional activation mediated by the GAL4 regulatory protein is repressed in the absence of galactose by the binding of the GAL80 protein, an interaction that requires the carboxy-terminal 28 amino acids of GAL4. The homolog of GAL4 from Kluyveromyces lactis, LAC9, activates transcription in S. cerevisiae and is highly similar to GAL4 in its carboxyl terminus but is not repressed by wild-type levels of GAL80 protein. Here we show that GAL80 does repress LAC9-activated transcription in S. cerevisiae if overproduced. We sought to determine the molecular basis for the difference in the responses of the LAC9 and GAL4 proteins to GAL80. Our results indicate that this difference is due primarily to the fact that under wild-type conditions, the level of LAC9 protein in S. cerevisiae is much higher than that of GAL4, which suggests that LAC9 escapes GAL80-mediated repression by titration of GAL80 protein in vivo. The difference in response to GAL80 is not due to amino acid sequence differences between the LAC9 and GAL4 carboxyl termini. We discuss the implications of these results for the mechanism of galactose metabolism regulation in S. cerevisiae and K. lactis. Images PMID:2550790

  19. Hepatitis B Virus Induces Expression of Antioxidant Response Element-regulated Genes by Activation of Nrf2*

    PubMed Central

    Schaedler, Stephanie; Krause, Janis; Himmelsbach, Kiyoshi; Carvajal-Yepes, Monica; Lieder, Franziska; Klingel, Karin; Nassal, Michael; Weiss, Thomas S.; Werner, Sabine; Hildt, Eberhard

    2010-01-01

    The expression of a variety of cytoprotective genes is regulated by short cis-acting elements in their promoters, called antioxidant response elements (AREs). A central regulator of ARE-mediated gene expression is the NF-E2-related factor 2 (Nrf2). Human hepatitis B virus (HBV) induces a strong activation of Nrf2/ARE-regulated genes in vitro and in vivo. This is triggered by the HBV-regulatory proteins (HBx and LHBs) via c-Raf and MEK. The Nrf2/ARE-mediated induction of cytoprotective genes by HBV results in a better protection of HBV-positive cells against oxidative damage as compared with control cells. Furthermore, there is a significantly increased expression of the Nrf2/ARE-regulated proteasomal subunit PSMB5 in HBV-positive cells that is associated with a decreased level of the immunoproteasome subunit PSMB5i. In accordance with this finding, HBV-positive cells display a higher constitutive proteasome activity and a decreased activity of the immunoproteasome as compared with control cells even after interferon α/γ treatment. The HBV-dependent induction of Nrf2/ARE-regulated genes might ensure survival of the infected cell, shape the immune response to HBV, and thereby promote establishment of the infection. PMID:20956535

  20. A novel tumor necrosis factor-responsive transcription factor which recognizes a regulatory element in hemopoietic growth factor genes

    SciTech Connect

    Shannon, M.F.; Pell, L.M.; Kuczek, E.S.; Occhiodoro, F.S.; Dunn, S.M.; Vadas, M.A. ); Lenardo, M.J. )

    1990-06-01

    A conserved DNA sequence element, termed cytokine 1 (CK-1), is found in the promoter regions of many hemopoietic growth factor (HGF) genes. Mutational analyses and modification interference experiments show that this sequence specifically binds a nuclear transcription factor, NF-GMa, which is a protein with a molecular mass of 43 kilodaltons. It interacts with different affinities with the CK-1-like sequence from a number of HGF genes, including granulocyte macrophage colony-stimulating factor (GM-CSF), granulocyte (G)-CSF, interleukin 3 (IL-3), and IL-5. The authors show that the level of NF-GMa binding is induced in embryonic fibroblasts by tumor necrosis factor {alpha} (TNF-{alpha}) treatment and that the CK-1 sequence from the G-CSF gene is a TNF-{alpha}-responsive enhancer in these cells.

  1. Transcriptional Analysis of the Global Regulatory Networks Active in Pseudomonas syringae during Leaf Colonization

    PubMed Central

    Yu, Xilan; Lund, Steven P.; Greenwald, Jessica W.; Records, Angela H.; Scott, Russell A.; Nettleton, Dan; Lindow, Steven E.; Gross, Dennis C.

    2014-01-01

    ABSTRACT The plant pathogen Pseudomonas syringae pv. syringae B728a grows and survives on leaf surfaces and in the leaf apoplast of its host, bean (Phaseolus vulgaris). To understand the contribution of distinct regulators to B728a fitness and pathogenicity, we performed a transcriptome analysis of strain B728a and nine regulatory mutants recovered from the surfaces and interior of leaves and exposed to environmental stresses in culture. The quorum-sensing regulators AhlR and AefR influenced few genes in planta or in vitro. In contrast, GacS and a downstream regulator, SalA, formed a large regulatory network that included a branch that regulated diverse traits and was independent of plant-specific environmental signals and a plant signal-dependent branch that positively regulated secondary metabolite genes and negatively regulated the type III secretion system. SalA functioned as a central regulator of iron status based on its reciprocal regulation of pyoverdine and achromobactin genes and also sulfur uptake, suggesting a role in the iron-sulfur balance. RetS functioned almost exclusively to repress secondary metabolite genes when the cells were not on leaves. Among the sigma factors examined, AlgU influenced many more genes than RpoS, and most AlgU-regulated genes depended on RpoN. RpoN differentially impacted many AlgU- and GacS-activated genes in cells recovered from apoplastic versus epiphytic sites, suggesting differences in environmental signals or bacterial stress status in these two habitats. Collectively, our findings illustrate a central role for GacS, SalA, RpoN, and AlgU in global regulation in B728a in planta and a high level of plasticity in these regulators’ responses to distinct environmental signals. PMID:25182327

  2. Exercise and Activity: Key Elements in the Management of OI

    MedlinePlus

    ... in both children and adults. Research indicates that physical activity is important because it promotes: general health through cardiovascular fitness mental alertness weight control improved sleep quality ...

  3. Determination of elements in National Bureau of Standards' geological Standard Reference Materials by neutron activation analysis

    SciTech Connect

    Graham, C.C.; Glascock, M.D.; Carni, J.J.; Vogt, J.R.; Spalding, T.G.

    1982-08-01

    Instrumental neutron activation analysis (INAA) and prompt gamma neutron activation analysis (PGNAA) have been used to determine elemental concentrations in two recently issued National Bureau of Standards (NBS) Standard Reference Materials (SRM's). The results obtained are in good agreement with the certified and information values reported by NBS for those elements in each material for which comparisons are available. Average concentrations of 35 elements in SRM 278 obsidian rock and 32 elements in SRM 688 basalt rock are reported for comparison with results that may be obtained by other laboratories.

  4. Emergent self-regulatory activity among young children during scientific inquiry: An analysis of six kindergarten children

    NASA Astrophysics Data System (ADS)

    Lomangino, Adrienne Gelpi

    2000-10-01

    This qualitative investigation extends the study of self-regulation to examine young children's developing self-regulated learning competencies. The framework for this research draws upon social cognitive, developmental, and sociocultural perspectives on self-regulation and research on children's scientific thinking. Taking a multiple case study approach, this study examines six kindergarten children's emerging self-regulatory competencies during inquiry-based science instruction. Data were collected during two inquiry-based science programs of study, one pertaining to light and shadow and a second pertaining to motion on inclined planes. Data sources included: videotaped records of the instruction, transcriptions of the videotapes, interviews with the children and teacher, student work, and field notes. Taking an inductive approach to analysis, patterns in the children's activity were identified through a recursive process of defining and refining categories that characterized the children's verbal and behavioral activity. Each case study examines a child's behavior within each phase of the inquiry for evidence of emerging self-regulatory competence. Analysis revealed nascent forms of goal-setting and planning, monitoring, resource management, seeking social assistance, and evaluating. Monitoring activity occurred more frequently than planning or evaluating. For several children, animating materials served to promote motivation. Children's efforts to support peers' activity and monitor the meaning of ongoing discourse contrast with common assumptions about children's attention to others' thinking. Variations in self-regulatory activity were found across phases of instruction. The children exhibited interpersonal self-regulatory efforts, in which monitoring and control of the self was entwined with the activity of others. Joint participation also played a critical role in supporting the metacognitive demands of self-regulation and prompting metacognitive awareness

  5. Preconcentration and Speciation of Trace Elements and Trace-Element Analogues of Radionuclides by Neutron Activation Analysis

    SciTech Connect

    Chatt, A.

    1999-11-14

    We have developed a number of preconcentration neutron activation analysis (PNAA) methods in our laboratory for the determination of trace elements in a variety of complex sample matrices. We developed a number of cocrystallization and coprecipitation methods for the determination of trace elements in water samples. We developed several methods for the determination of I in foods and diets. We have developed a number of PNAA methods in our laboratory We determined As and Sb in geological materials and natural waters by coprecipitation with Se and Au in silicate rocks and ores by coprecipitation with Te followed by NAA. We developed an indirect NAA method for the determination of B in leachates of borosilicate glass. We have been interested in studying the speciation of Am, Tc, and Np in simulated vitrified groundwater leachates of high-level wastes under oxid and anoxic conditions using a number of techniques. We then used PNAA methods to study speciation of trace-element analogues of radionuclides. We have been able to apply biochemical techniques and NAA for the separation, preconcentration, and characterization of metalloprotein and protein-bound trace-element species in subcellular fractions of bovine kidneys. Lately, we have concentrated our efforts to develop chemical and biochemical methods in conjunction with NAA, NMR, and MS for the separation and identification of extractable organohalogens (EOX) in tissues of beluga whales, cod, and northern pink shrimp

  6. Acetylation of glucokinase regulatory protein decreases glucose metabolism by suppressing glucokinase activity

    PubMed Central

    Park, Joo-Man; Kim, Tae-Hyun; Jo, Seong-Ho; Kim, Mi-Young; Ahn, Yong-Ho

    2015-01-01

    Glucokinase (GK), mainly expressed in the liver and pancreatic β-cells, is critical for maintaining gluco