Functional Evolution of PLP-dependent Enzymes based on Active-Site Structural Similarities
Catazaro, Jonathan; Caprez, Adam; Guru, Ashu; Swanson, David; Powers, Robert
2014-01-01
Families of distantly related proteins typically have very low sequence identity, which hinders evolutionary analysis and functional annotation. Slowly evolving features of proteins, such as an active site, are therefore valuable for annotating putative and distantly related proteins. To date, a complete evolutionary analysis of the functional relationship of an entire enzyme family based on active-site structural similarities has not yet been undertaken. Pyridoxal-5’-phosphate (PLP) dependent enzymes are primordial enzymes that diversified in the last universal ancestor. Using the Comparison of Protein Active Site Structures (CPASS) software and database, we show that the active site structures of PLP-dependent enzymes can be used to infer evolutionary relationships based on functional similarity. The enzymes successfully clustered together based on substrate specificity, function, and three-dimensional fold. This study demonstrates the value of using active site structures for functional evolutionary analysis and the effectiveness of CPASS. PMID:24920327
Functional evolution of PLP-dependent enzymes based on active-site structural similarities.
Catazaro, Jonathan; Caprez, Adam; Guru, Ashu; Swanson, David; Powers, Robert
2014-10-01
Families of distantly related proteins typically have very low sequence identity, which hinders evolutionary analysis and functional annotation. Slowly evolving features of proteins, such as an active site, are therefore valuable for annotating putative and distantly related proteins. To date, a complete evolutionary analysis of the functional relationship of an entire enzyme family based on active-site structural similarities has not yet been undertaken. Pyridoxal-5'-phosphate (PLP) dependent enzymes are primordial enzymes that diversified in the last universal ancestor. Using the comparison of protein active site structures (CPASS) software and database, we show that the active site structures of PLP-dependent enzymes can be used to infer evolutionary relationships based on functional similarity. The enzymes successfully clustered together based on substrate specificity, function, and three-dimensional-fold. This study demonstrates the value of using active site structures for functional evolutionary analysis and the effectiveness of CPASS. © 2014 Wiley Periodicals, Inc.
Discriminative structural approaches for enzyme active-site prediction.
Kato, Tsuyoshi; Nagano, Nozomi
2011-02-15
Predicting enzyme active-sites in proteins is an important issue not only for protein sciences but also for a variety of practical applications such as drug design. Because enzyme reaction mechanisms are based on the local structures of enzyme active-sites, various template-based methods that compare local structures in proteins have been developed to date. In comparing such local sites, a simple measurement, RMSD, has been used so far. This paper introduces new machine learning algorithms that refine the similarity/deviation for comparison of local structures. The similarity/deviation is applied to two types of applications, single template analysis and multiple template analysis. In the single template analysis, a single template is used as a query to search proteins for active sites, whereas a protein structure is examined as a query to discover the possible active-sites using a set of templates in the multiple template analysis. This paper experimentally illustrates that the machine learning algorithms effectively improve the similarity/deviation measurements for both the analyses.
Active Site Characterization of Proteases Sequences from Different Species of Aspergillus.
Morya, V K; Yadav, Virendra K; Yadav, Sangeeta; Yadav, Dinesh
2016-09-01
A total of 129 proteases sequences comprising 43 serine proteases, 36 aspartic proteases, 24 cysteine protease, 21 metalloproteases, and 05 neutral proteases from different Aspergillus species were analyzed for the catalytically active site residues using MEROPS database and various bioinformatics tools. Different proteases have predominance of variable active site residues. In case of 24 cysteine proteases of Aspergilli, the predominant active site residues observed were Gln193, Cys199, His364, Asn384 while for 43 serine proteases, the active site residues namely Asp164, His193, Asn284, Ser349 and Asp325, His357, Asn454, Ser519 were frequently observed. The analysis of 21 metalloproteases of Aspergilli revealed Glu298 and Glu388, Tyr476 as predominant active site residues. In general, Aspergilli species-specific active site residues were observed for different types of protease sequences analyzed. The phylogenetic analysis of these 129 proteases sequences revealed 14 different clans representing different types of proteases with diverse active site residues.
Zhu, Bao Ting
2010-01-01
Background Recent studies showed that some of the dietary bioflavonoids can strongly stimulate the catalytic activity of cyclooxygenase (COX) I and II in vitro and in vivo, presumably by facilitating enzyme re-activation. In this study, we sought to understand the structural basis of COX activation by these dietary compounds. Methodology/Principal Findings A combination of molecular modeling studies, biochemical analysis and site-directed mutagenesis assay was used as research tools. Three-dimensional quantitative structure-activity relationship analysis (QSAR/CoMFA) predicted that the ability of bioflavonoids to activate COX I and II depends heavily on their B-ring structure, a moiety known to be associated with strong antioxidant ability. Using the homology modeling and docking approaches, we identified the peroxidase active site of COX I and II as the binding site for bioflavonoids. Upon binding to this site, bioflavonoid can directly interact with hematin of the COX enzyme and facilitate the electron transfer from bioflavonoid to hematin. The docking results were verified by biochemical analysis, which reveals that when the cyclooxygenase activity of COXs is inhibited by covalent modification, myricetin can still stimulate the conversion of PGG2 to PGE2, a reaction selectively catalyzed by the peroxidase activity. Using the site-directed mutagenesis analysis, we confirmed that Q189 at the peroxidase site of COX II is essential for bioflavonoids to bind and re-activate its catalytic activity. Conclusions/Significance These findings provide the structural basis for bioflavonoids to function as high-affinity reducing co-substrates of COXs through binding to the peroxidase active site, facilitating electron transfer and enzyme re-activation. PMID:20808785
Gao, Yu-Fei; Li, Bi-Qing; Cai, Yu-Dong; Feng, Kai-Yan; Li, Zhan-Dong; Jiang, Yang
2013-01-27
Identification of catalytic residues plays a key role in understanding how enzymes work. Although numerous computational methods have been developed to predict catalytic residues and active sites, the prediction accuracy remains relatively low with high false positives. In this work, we developed a novel predictor based on the Random Forest algorithm (RF) aided by the maximum relevance minimum redundancy (mRMR) method and incremental feature selection (IFS). We incorporated features of physicochemical/biochemical properties, sequence conservation, residual disorder, secondary structure and solvent accessibility to predict active sites of enzymes and achieved an overall accuracy of 0.885687 and MCC of 0.689226 on an independent test dataset. Feature analysis showed that every category of the features except disorder contributed to the identification of active sites. It was also shown via the site-specific feature analysis that the features derived from the active site itself contributed most to the active site determination. Our prediction method may become a useful tool for identifying the active sites and the key features identified by the paper may provide valuable insights into the mechanism of catalysis.
Chow, Sih Yao; Wang, Yung Lin; Hsieh, Yu Chiao; Lee, Guan Chiun; Liaw, Shwu Huey
2017-11-01
Trehalose synthase (TS) catalyzes the reversible conversion of maltose to trehalose and belongs to glycoside hydrolase family 13 (GH13). Previous mechanistic analysis suggested a rate-limiting protein conformational change, which is probably the opening and closing of the active site. Consistently, crystal structures of Deinococcus radiodurans TS (DrTS) in complex with the inhibitor Tris displayed an enclosed active site for catalysis of the intramoleular isomerization. In this study, the apo structure of the DrTS N253F mutant displays a new open conformation with an empty active site. Analysis of these structures suggests that substrate binding induces a domain rotation to close the active site. Such a substrate-induced domain rotation has also been observed in some other GH13 enzymes.
Suplatov, D A; Arzhanik, V K; Svedas, V K
2011-01-01
Comparative bioinformatic analysis is the cornerstone of the study of enzymes' structure-function relationship. However, numerous enzymes that derive from a common ancestor and have undergone substantial functional alterations during natural selection appear not to have a sequence similarity acceptable for a statistically reliable comparative analysis. At the same time, their active site structures, in general, can be conserved, while other parts may largely differ. Therefore, it sounds both plausible and appealing to implement a comparative analysis of the most functionally important structural elements - the active site structures; that is, the amino acid residues involved in substrate binding and the catalytic mechanism. A computer algorithm has been developed to create a library of enzyme active site structures based on the use of the PDB database, together with programs of structural analysis and identification of functionally important amino acid residues and cavities in the enzyme structure. The proposed methodology has been used to compare some α,β-hydrolase superfamily enzymes. The insight has revealed a high structural similarity of catalytic site areas, including the conservative organization of a catalytic triad and oxyanion hole residues, despite the wide functional diversity among the remote homologues compared. The methodology can be used to compare the structural organization of the catalytic and substrate binding sites of various classes of enzymes, as well as study enzymes' evolution and to create of a databank of enzyme active site structures.
Shukla, Rohit; Shukla, Harish; Tripathi, Timir
2018-01-01
Mycobacterium tuberculosis isocitrate lyase (MtbICL) is a crucial enzyme of the glyoxylate cycle and is a validated anti-tuberculosis drug target. Structurally distant, non-active site mutation (H46A) in MtbICL has been found to cause loss of enzyme activity. The aim of the present work was to explore the structural alterations induced by H46A mutation that caused the loss of enzyme activity. The structural and dynamic consequences of H46A mutation were studied using multiple computational methods such as docking, molecular dynamics simulation and residue interaction network analysis (RIN). Principal component analysis and cross correlation analysis revealed the difference in conformational flexibility and collective modes of motions between the wild-type and mutant enzyme, particularly in the active site region. RIN analysis revealed that the active site geometry was disturbed in the mutant enzyme. Thus, the dynamic perturbation of the active site led to enzyme transition from its active form to inactive form upon mutation. The computational analyses elucidated the mutant-specific conformational alterations, differential dominant motions, and anomalous residue level interactions that contributed to the abrogated function of mutant MtbICL. An understanding of interactions of mutant enzymes may help in modifying the existing drugs and designing improved drugs for successful control of tuberculosis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Saravanan, Kandasamy; Kalaiarasi, Chinnasamy; Kumaradhas, Poomani
2017-12-01
Acetylcholinesterase (AChE) is an important enzyme responsible for Alzheimer's disease, as per report, keto-enol form of curcumin inhibits this enzyme. The present study aims to understand the binding mechanism of keto-enol curcumin with the recombinant human Acetylcholinesterase (rhAChE) from its conformational flexibility, intermolecular interactions, charge density distribution, and the electrostatic properties at the active site of rhAChE. To accomplish this, a molecular docking analysis of curcumin with the rhAChE was performed, which gives the structure and conformation of curcumin in the active site of rhAChE. Further, the charge density distribution and the electrostatic properties of curcumin molecule (lifted from the active site of rhAChE) were determined from the high level density functional theory (DFT) calculations coupled with the charge density analysis. On the other hand, the curcumin molecule was optimized (gas phase) using DFT method and further, the structure and charge density analysis were also carried out. On comparing the conformation, charge density distribution and the electrostatic potential of the active site form of curcumin with the corresponding gas phase form reveals that the above said properties are significantly altered when curcumin is present in the active site of rhAChE. The conformational stability and the interaction of curcumin in the active site are also studied using molecular dynamics simulation, which shows a large variation in the conformational geometry of curcumin as well as the intermolecular interactions.
Examination of a Social-Networking Site Activities Scale (SNSAS) Using Rasch Analysis
ERIC Educational Resources Information Center
Alhaythami, Hassan; Karpinski, Aryn; Kirschner, Paul; Bolden, Edward
2017-01-01
This study examined the psychometric properties of a social-networking site (SNS) activities scale (SNSAS) using Rasch Analysis. Items were also examined with Rasch Principal Components Analysis (PCA) and Differential Item Functioning (DIF) across groups of university students (i.e., males and females from the United States [US] and Europe; N =…
Jiang, Xukai; Li, Wen; Chen, Guanjun; Wang, Lushan
2017-02-27
The temperature dependence of enzyme catalysis is highly debated. Specifically, how high temperatures induce enzyme inactivation has broad implications for both fundamental and applied science. Here, we explored the mechanism of the reversible thermal inactivation in glycoside hydrolase family 12 (GH12) using comparative molecular dynamics simulations. First, we investigated the distribution of structural flexibility over the enzyme and found that the active site was the general thermal-sensitive region in GH12 cellulases. The dynamic perturbation of the active site before enzyme denaturation was explored through principal-component analysis, which indicated that variations in the collective motion and conformational ensemble of the active site may precisely correspond to enzyme transition from its active form to the inactive form. Furthermore, the degree of dynamic perturbation of the active site was found to be negatively correlated with the melting temperatures of GH12 enzymes, further proving the importance of the dynamic stability of the active site. Additionally, analysis of the residue-interaction network revealed that the active site in thermophilic enzyme was capable of forming additional contacts with other amino acids than those observed in the mesophilic enzyme. These interactions are likely the key mechanisms underlying the differences in rigidity of the active site. These findings provide further biophysical insights into the reversible thermal inactivation of enzymes and potential applications in future protein engineering.
ERIC Educational Resources Information Center
Martínez-Bello, Vladimir E.; Martínez-Rojas, Ángela; Molina-García, Javier
2017-01-01
The main aim of this study was to examine how different physical activity domains are represented on the official social media sites of Spanish universities, through a content analysis of the photographs. Our results show that the representation of different physical activity domains is not balanced. While the analysed images do promote a message…
In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.
Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M
2012-05-01
Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds.
Devipriya, B; Kumaradhas, P
2013-10-21
A molecular docking and charge density analysis have been carried out to understand the conformational change, charge distribution and electrostatic properties of N-(4-chloro-3-trifluoromethyl-phenyl)-2-ethoxy-6-pentadecyl-benzamide (CTPB) in the active site of p300. The nearest neighbors, shortest intermolecular contacts between CTPB-p300 and the lowest binding energy of CTPB have been analyzed from the docking analysis. Further, a charge density analysis has been carried out for the molecule in gas phase and for the corresponding molecule lifted from the active site of p300. Due to the intermolecular interaction between CTPB and the amino acids of active site, the conformation of the CTPB has been significantly altered (particularly the pentadecyl chain). CTPB forms strong interaction with the amino acid residues Tyr1397 and Trp1436 at the distance 2.12 and 2.72Å, respectively. However, the long pentadecyl alkyl chain of CTPB produces a barrier and reducing the chance of forming hydrogen bonding with p300. The electron density ρbcp(r) of the polar bonds (C-O, C-N, C-F and C-Cl) of CTPB are increased when it present in the active site. The dipole moment of CTPB in the active site is significantly less (5.73D) when compared with the gas phase (8.16D) form. In the gas phase structure, a large region of negative electrostatic potential (ESP) is found at the vicinity of O(2) and CF3 group, which is less around the O(1) atom. Whereas, in the active site, the negative ESP around the CF3 group is decreased and increased at the O(1) and O(2)-atoms. The ESP modifications of CTPB in the active site are mainly attributed to the effect of intermolecular interaction. The gas phase and active site study insights the molecular flexibility and the electrostatic properties of CTPB in the active site. © 2013 Elsevier Ltd. All rights reserved.
Comparison Analysis among Large Amount of SNS Sites
NASA Astrophysics Data System (ADS)
Toriumi, Fujio; Yamamoto, Hitoshi; Suwa, Hirohiko; Okada, Isamu; Izumi, Kiyoshi; Hashimoto, Yasuhiro
In recent years, application of Social Networking Services (SNS) and Blogs are growing as new communication tools on the Internet. Several large-scale SNS sites are prospering; meanwhile, many sites with relatively small scale are offering services. Such small-scale SNSs realize small-group isolated type of communication while neither mixi nor MySpace can do that. However, the studies on SNS are almost about particular large-scale SNSs and cannot analyze whether their results apply for general features or for special characteristics on the SNSs. From the point of view of comparison analysis on SNS, comparison with just several types of those cannot reach a statistically significant level. We analyze many SNS sites with the aim of classifying them by using some approaches. Our paper classifies 50,000 sites for small-scale SNSs and gives their features from the points of network structure, patterns of communication, and growth rate of SNS. The result of analysis for network structure shows that many SNS sites have small-world attribute with short path lengths and high coefficients of their cluster. Distribution of degrees of the SNS sites is close to power law. This result indicates the small-scale SNS sites raise the percentage of users with many friends than mixi. According to the analysis of their coefficients of assortativity, those SNS sites have negative values of assortativity, and that means users with high degree tend to connect users with small degree. Next, we analyze the patterns of user communication. A friend network of SNS is explicit while users' communication behaviors are defined as an implicit network. What kind of relationships do these networks have? To address this question, we obtain some characteristics of users' communication structure and activation patterns of users on the SNS sites. By using new indexes, friend aggregation rate and friend coverage rate, we show that SNS sites with high value of friend coverage rate activate diary postings and their comments. Besides, they become activated when hub users with high degree do not behave actively on the sites with high value of friend aggregation rate and high value of friend coverage rate. On the other hand, activation emerges when hub users behave actively on the sites with low value of friend aggregation rate and high value of friend coverage rate. Finally, we observe SNS sites which are increasing the number of users considerably, from the viewpoint of network structure, and extract characteristics of high growth SNS sites. As a result of discrimination on the basis of the decision tree analysis, we can recognize the high growth SNS sites with a high degree of accuracy. Besides, this approach suggests mixi and the other small-scale SNS sites have different character trait.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Desjardins, Morgan; Mak, Wai Shun; O’Brien, Terrence E.
Enzymes have been through millions of years of evolution during which their active-site microenvironments are fine-tuned. Active-site residues are commonly conserved within protein families, indicating their importance for substrate recognition and catalysis. In this work, we systematically mutated active-site residues of l-threonine dehydrogenase from Thermoplasma volcanium and characterized the mutants against a panel of substrate analogs. Our results demonstrate that only a subset of these residues plays an essential role in substrate recognition and catalysis and that the native enzyme activity can be further enhanced roughly 4.6-fold by a single point mutation. Kinetic characterization of mutants on substrate analogs showsmore » that l-threonine dehydrogenase possesses promiscuous activities toward other chemically similar compounds not previously observed. Quantum chemical calculations on the hydride-donating ability of these substrates also reveal that this enzyme did not evolve to harness the intrinsic substrate reactivity for enzyme catalysis. Our analysis provides insights into connections between the details of enzyme active-site structure and specific function. Finally, these results are directly applicable to rational enzyme design and engineering.« less
Desjardins, Morgan; Mak, Wai Shun; O’Brien, Terrence E.; ...
2017-07-07
Enzymes have been through millions of years of evolution during which their active-site microenvironments are fine-tuned. Active-site residues are commonly conserved within protein families, indicating their importance for substrate recognition and catalysis. In this work, we systematically mutated active-site residues of l-threonine dehydrogenase from Thermoplasma volcanium and characterized the mutants against a panel of substrate analogs. Our results demonstrate that only a subset of these residues plays an essential role in substrate recognition and catalysis and that the native enzyme activity can be further enhanced roughly 4.6-fold by a single point mutation. Kinetic characterization of mutants on substrate analogs showsmore » that l-threonine dehydrogenase possesses promiscuous activities toward other chemically similar compounds not previously observed. Quantum chemical calculations on the hydride-donating ability of these substrates also reveal that this enzyme did not evolve to harness the intrinsic substrate reactivity for enzyme catalysis. Our analysis provides insights into connections between the details of enzyme active-site structure and specific function. Finally, these results are directly applicable to rational enzyme design and engineering.« less
Paul, Kaninika; Dutta, Sayantani; Bhattacharjee, Paramita
2017-09-01
Our previous investigation on high pressure supercritical carbon dioxide treatment of a bacterial α-amylase had revealed enhanced activity of the same. 1 H NMR analysis of the activity enhanced enzyme led the authors to hypothesize that the enhancement was possibly owing to alterations in the active site of the enzyme. In the present study, the changes in the active site of the treated enzyme was analysed by Fourier-transform Raman (FT-Raman) spectroscopy. The spectra obtained revealed shifting of bands in the active site of α-amylase indicating a nudging effect of the bonds in this region consequent to high pressure treatment. Also, shifts in bands in the OH stretching vibration of water were observed in the enzyme spectra. These variations in the spectra confirmed changes in the active site as well as in the water associated with the same that perhaps had a concerted effect on the increased activity of α-amylase. Copyright © 2017 Elsevier Inc. All rights reserved.
Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok
2017-07-01
Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.
Xu, Wei; Shao, Rong; Wang, Zupeng; Yan, Xiuhua
2015-03-01
Neutral phytase is used as a feed additive for degradation of anti-nutritional phytate in aquatic feed industry. Site-directed mutagenesis of Bacillus amyloliquefaciens DSM 1061 phytase was performed with an aim to increase its activity. Mutation residues were chosen based on multiple sequence alignments and structure analysis of neutral phytsaes from different microorganisms. The mutation sites on surface (D148E, S197E and N156E) and around the active site (D52E) of phytase were selected. Analysis of the phytase variants showed that the specific activities of mutants D148E and S197E remarkably increased by about 35 and 13% over a temperature range of 40-75 °C at pH 7.0, respectively. The k cat of mutants D148E and S197E were 1.50 and 1.25 times than that of the wild-type phytase, respectively. Both D148E and S197E showed much higher thermostability than that of the wild-type phytase. However, mutants N156E and D52E led to significant loss of specific activity of the enzyme. Structural analysis revealed that these mutations may affect conformation of the active site of phytase. The present mutant phytases D148E and S197E with increased activities and thermostabilities have application potential as additives in aquaculture feed.
Improving Sampling, Analysis, and Data Management for Site Investigation and Cleanup
The United States Environmental Protection Agency (EPA) supports the adoption of streamlined approaches to sampling, analysis, and data management activities conducted during site assessment, characterization, and cleanup.
Landslide hazard assessment of the Black sea coastline (Caucasus, Russia) via drones
NASA Astrophysics Data System (ADS)
Kazeev, Andrey; Postoev, German; Fedotova, Ksenia
2017-04-01
Landslide hazard assessment of slopes of Sochi was performed along the railway between the cities Tuapse and Adler (total length 103 km). The railway passes through the territory with active development of hazardous geological processes such as landslides, rock falls and debris-flows. By the beginning of 2016, 36 landslide sites were discovered along the railway (total length 34 km), 48 rock-fall sites (length 31 km), and 5 debris-flow sites (length 0.14 km). In recent years the intensification of deformations was observed. For instance, during previous 10 years (1996¬¬-2005) 28 sudden deformations occurred due to slope processes, which caused interruptions in traffic. And in the present decade (2006-2015), 72 deformations were recorded. High landslide activity and economic loss determined the necessity of complex investigations of engineering geological conditions of landslides development and causes of its intensification. The protection strategy development was needed to minimize negative consequences. Thus, the investigations of landslide situation along the railway "Tuapse - Adler" included the categorization of landslide sites by level of hazard, with risk assessment based on numerical criteria. Preliminary evaluation of landslide hazard for the railway was conducted via the analysis of archived engineering-geological documents. 13 of 36 landslide sites (total length 13 km) were selected, reflecting the variety and peculiarities of landslide displacements on slopes (both active and inactive sites). Visual field observations of landslide slopes using drone "DJI Phantom 4" were completed during the second stage of this investigation. High-resolution photographs of landslide cirques, cracks, scarp walls, vegetation features were obtained via drone, which would have been impossible to obtain from the ground in conditions of dense subtropical vegetation cover. Possible approaches to the landslide activity and hazard assessment were evaluated: slope stability analysis, geophysical monitoring methods, analysis of critical deformations and critical velocities of displacement, the analysis of changes of conditions of landslide development during its displacement, as well as scoring approaches to landslide hazard and risk assessment. As the result, the method of probabilistic estimation of landslide activity and hazard has been proposed, based on selection and analysis of main factors, influencing landslide displacements. Slope steepness, landslide thickness, slope length, bedrock dip, slope relief, cracks, vegetation patterns and other factors were used for assessment of activity of landslide sites. The investigation was based on the proposed probabilistic method of assessment of landslide activity and hazard. The considered landslide sites were ranked by the rate of activity as inactive, potentially active and active. The most active sites were used to identify potentially the most hazardous sites. Furthermore, the following factors were additionally considered: the damage of railroad facilities due to landslide, landslide activity, thickness of landslide at the toe of the slope, bedrock stratification, the conditions for the cirque development, the position of the sliding surface relatively to the railway, the involvement of bedrock into displaced mass. As the result, the investigated railroad sites were divided into three categories: non-hazardous, potentially hazardous and hazardous. The research was supported by Russian Scientific Foundation (Project № 16-17-00125).
Ecological Characterization Data for the 2004 Composite Analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Downs, Janelle L.; Simmons, Mary A.; Stegen, Jennifer A.
2004-11-01
A composite analysis is required by U.S. Department of Energy (DOE) Order 435.1 to ensure public safety through the management of active and planned low-level radioactive waste disposal facilities associated with the Hanford Site. The original Hanford Site Composite Analysis of 1998 must be revised and submitted to DOE Headquarters (DOE-HQ) in 2004 because of revisions to waste site information in the 100, 200, and 300 Areas, updated performance assessments and environmental impact statements (EIS), changes in inventory estimates for key sites and constituents, and a change in the definition of offsite receptors. Beginning in fiscal year (FY) 2003, themore » DOE Richland Operations Office (DOE-RL) initiated activities, including the development of data packages, to support the 2004 Composite Analysis. This report describes the data compiled in FY 2003 to support ecological site assessment modeling for the 2004 Composite Analysis. This work was conducted as part of the Characterization of Systems Task of the Groundwater Remediation Project (formerly the Groundwater Protection Program) managed by Fluor Hanford, Inc., Richland, Washington. The purpose of this report is to provide summaries of the characterization information and available spatial data on the biological resources and ecological receptors found in the upland, riparian, aquatic, and island habitats on the Hanford Site. These data constitute the reference information used to establish parameters for the ecological risk assessment module of the System Assessment Capability and other assessment activities requiring information on the presence and distribution of biota on the Hanford Site.« less
Single atom catalysts on amorphous supports: A quenched disorder perspective
NASA Astrophysics Data System (ADS)
Peters, Baron; Scott, Susannah L.
2015-03-01
Phenomenological models that invoke catalyst sites with different adsorption constants and rate constants are well-established, but computational and experimental methods are just beginning to provide atomically resolved details about amorphous surfaces and their active sites. This letter develops a statistical transformation from the quenched disorder distribution of site structures to the distribution of activation energies for sites on amorphous supports. We show that the overall kinetics are highly sensitive to the precise nature of the low energy tail in the activation energy distribution. Our analysis motivates further development of systematic methods to identify and understand the most reactive members of the active site distribution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Andersen, Mie; Medford, Andrew J.; Norskov, Jens K.
Here, we present a generic analysis of the implications of energetic scaling relations on the possibilities for bifunctional gains at homogeneous bimetallic alloy catalysts. Such catalysts exhibit a large number of interface sites, where second-order reaction steps can involve intermediates adsorbed at different active sites. Using different types of model reaction schemes, we show that such site-coupling reaction steps can provide bifunctional gains that allow for a bimetallic catalyst composed of two individually poor catalyst materials to approach the activity of the optimal monomaterial catalyst. However, bifunctional gains cannot result in activities higher than the activity peak of the monomaterialmore » volcano curve as long as both sites obey similar scaling relations, as is generally the case for bimetallic catalysts. These scaling-relation-imposed limitations could be overcome by combining different classes of materials such as metals and oxides.« less
Andersen, Mie; Medford, Andrew J.; Norskov, Jens K.; ...
2017-04-14
Here, we present a generic analysis of the implications of energetic scaling relations on the possibilities for bifunctional gains at homogeneous bimetallic alloy catalysts. Such catalysts exhibit a large number of interface sites, where second-order reaction steps can involve intermediates adsorbed at different active sites. Using different types of model reaction schemes, we show that such site-coupling reaction steps can provide bifunctional gains that allow for a bimetallic catalyst composed of two individually poor catalyst materials to approach the activity of the optimal monomaterial catalyst. However, bifunctional gains cannot result in activities higher than the activity peak of the monomaterialmore » volcano curve as long as both sites obey similar scaling relations, as is generally the case for bimetallic catalysts. These scaling-relation-imposed limitations could be overcome by combining different classes of materials such as metals and oxides.« less
Erdemir, Aysegul; Mutlu, Ozal
2017-06-01
Lactate dehydrogenase (LDH) is an important metabolic enzyme in glycolysis and it has been considered as the main energy source in many organisms including apicomplexan parasites. Differences at the active site loop of the host and parasite LDH's makes this enzyme an attractive target for drug inhibitors. In this study, five amino acid insertions in the active site pocket of Theileria annulata LDH (TaLDH) were deleted by PCR-based site-directed mutagenesis, expression and activity analysis of mutant and wild type TaLDH enzymes were performed. Removal of the insertion at the active site loop caused production of an inactive enzyme. Furthermore, structures of wild and mutant enzymes were predicted by comparative modeling and the importance of the insertions at the active site loop were also assigned by molecular docking and dynamics simulations in order to evaluate essential role of this loop for the enzymatic activity. Pentapeptide insertion removal resulted in loss of LDH activity due to deletion of Trp96 and conformational change of Arg98 because of loop instability. Analysis of wild type and mutant enzymes with comparative molecular dynamics simulations showed that the fluctuations of the loop residues increase in mutant enzyme. Together with in silico studies, in vitro results revealed that active site loop has a vital role in the enzyme activity and our findings promise hope for the further drug design studies against theileriosis and other apicomplexan parasite diseases. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Unterberger, Claudia; Hanson, Steven; Department of Infection, Immunity and Inflammation, University of Leicester, University Road, Leicester LE1 9HN
Little is known about determinants regulating expression of Mannan-binding lectin associated serine protease-2 (MASP-2), the effector component of the lectin pathway of complement activation. Comparative bioinformatic analysis of the MASP2 promoter regions in human, mouse, and rat, revealed conservation of two putative Stat binding sites, termed StatA and StatB. Site directed mutagenesis specific for these sites was performed. Transcription activity was decreased 5-fold when StatB site was mutated in the wildtype reporter gene construct. Gel retardation and competition assays demonstrated that proteins contained in the nuclear extract prepared from HepG2 specifically bound double-stranded StatB oligonucleotides. Supershift analysis revealed Stat3 tomore » be the major specific binding protein. We conclude that Stat3 binding is important for MASP2 promoter activity.« less
Zhang, Yujing; Pang, Shaofeng; Wei, Zhihong; Jiao, Haijun; Dai, Xingchao; Wang, Hongli; Shi, Feng
2018-04-13
Generally, a homogeneous catalyst exhibits good activity and defined active sites but it is difficult to recycle. Meanwhile, a heterogeneous catalyst can easily be reused but its active site is difficult to reveal. It is interesting to bridge the gap between homogeneous and heterogeneous catalysis via controllable construction of a heterogeneous catalyst containing defined active sites. Here, we report that a molecularly defined, single-active site heterogeneous catalyst has been designed and prepared via the oxidative polymerization of maleimide derivatives. These polymaleimide derivatives can be active catalysts for the selective oxidation of heterocyclic compounds to quinoline and indole via the recycling of -C=O and -C-OH groups, which was confirmed by tracing the reaction with GC-MS using maleimide as the catalyst and by FT-IR analysis with polymaleimide as the catalyst. These results might promote the development of heterogeneous catalysts with molecularly defined single active sites exhibiting a comparable activity to homogeneous catalysts.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garfias-Mesias, L.F.; Alodan, M.; James, P.I.
1998-06-01
Scanning electrochemical microscopy (SECM) in ferrocyanide and bromide solutions was used to locate active sites (pitting precursors) on polycrystalline Ti where oxidation of Br{sup {minus}} and Fe(CN){sub 6}{sup 4{minus}} was possible. Analysis of the electrochemically active sites was done by using electron microscopy (SEM), energy dispersive X-ray analysis (EDX), atomic force microscopy (AFM), and in situ confocal laser scanning microscopy (CLSM). In most cases, the active sites were found to be associated with particles (inclusions) which contained mainly Al and Si; however, some other areas not associated with particles were also found to be active. Although the size of themore » inclusions was normally smaller than 20 {micro}m, as revealed by SEM and AFM imaging, in some cases larger particles were also found. Pitting corrosion tests in bromide solution at potentials above 1.5 V{sub SCE} followed by EDX analysis inside the pits and in situ CLSM observation, confirmed that most of the localized attack started in the areas where particles had been located.« less
Roche, John P.; Alsharif, Peter; Graf, Ethan R.
2015-01-01
At synapses, the release of neurotransmitter is regulated by molecular machinery that aggregates at specialized presynaptic release sites termed active zones. The complement of active zone proteins at each site is a determinant of release efficacy and can be remodeled to alter synapse function. The small GTPase Rab3 was previously identified as playing a novel role that controls the distribution of active zone proteins to individual release sites at the Drosophila neuromuscular junction. Rab3 has been extensively studied for its role in the synaptic vesicle cycle; however, the mechanism by which Rab3 controls active zone development remains unknown. To explore this mechanism, we conducted a mutational analysis to determine the molecular and structural requirements of Rab3 function at Drosophila synapses. We find that GTP-binding is required for Rab3 to traffick to synapses and distribute active zone components across release sites. Conversely, the hydrolytic activity of Rab3 is unnecessary for this function. Through a structure-function analysis we identify specific residues within the effector-binding switch regions that are required for Rab3 function and determine that membrane attachment is essential. Our findings suggest that Rab3 controls the distribution of active zone components via a vesicle docking mechanism that is consistent with standard Rab protein function. PMID:26317909
Dutta Banik, Sindrila; Chandra, Amalendu
2014-09-25
Pyridoxal 5'-phosphate (PLP) Schiff base, a versatile cofactor, exhibits a tautomeric equilibrium that involves an intramolecular proton transfer between the N-protonated zwitterionic ketoenamine tautomer and the O-protonated covalent enolimine tautomer. It has been postulated that for the catalytic activity, the PLP has to be in the zwitterionic ketoenamine tautomeric form. However, the exact position of the tautomeric equilibrium of Schiff base in the active site of PLP-dependent enzyme is not known yet. In the present work, we investigated the tautomeric equilibrium for the external aldimine state of PLP aspartate (PLP-Asp) Schiff base in the active site of aspartate aminotransferase (AspAT) using combined quantum mechanical and molecular mechanical simulations. The main focus of the present study is to analyze the factors that control the tautomeric equilibrium in the active sites of various PLP-dependent enzymes. The results show that the ketoenamine tautomer is more preferred than the enolimine tautomer both in the gas and aqueous phases as well as in the active site of AspAT. Current simulations show that the active site of AspAT is more suitable for the ketoenamine tautomer compared to the enolimine tautomer. Interestingly, the Tyr225 acts as a proton donor to the phenolic oxygen in the ketoenamine tautomer, while in the covalent enolimine tautomer, it acts as a proton acceptor to the phenolic oxygen. Finally, the metadynamics study confirms this result. The calculated free energy barrier is about 7.5 kcal/mol. A comparative analysis of the microenvironment created by the active site residues of three different PLP-dependent enzymes (aspartate aminotransferase, Dopa decarboxylase, and Ala-racemase) has been carried out to understand the controlling factor(s) of the tautomeric equilibrium. The analysis shows that the intermolecular hydrogen bonding between active site residues and the phenolic oxygen of PLP shifts the tautomeric equilibrium toward the N-protonated ketoenamine tautomeric form.
Zaman, Junaid A B; Sauer, William H; Alhusseini, Mahmood I; Baykaner, Tina; Borne, Ryan T; Kowalewski, Christopher A B; Busch, Sonia; Zei, Paul C; Park, Shirley; Viswanathan, Mohan N; Wang, Paul J; Brachmann, Johannes; Krummen, David E; Miller, John M; Rappel, Wouter Jan; Narayan, Sanjiv M; Peters, Nicholas S
2018-01-01
The mechanisms by which persistent atrial fibrillation (AF) terminates via localized ablation are not well understood. To address the hypothesis that sites where localized ablation terminates persistent AF have characteristics identifiable with activation mapping during AF, we systematically examined activation patterns acquired only in cases of unequivocal termination by ablation. We recruited 57 patients with persistent AF undergoing ablation, in whom localized ablation terminated AF to sinus rhythm or organized tachycardia. For each site, we performed an offline analysis of unprocessed unipolar electrograms collected during AF from multipolar basket catheters using the maximum -dV/dt assignment to construct isochronal activation maps for multiple cycles. Additional computational modeling and phase analysis were used to study mechanisms of map variability. At all sites of AF termination, localized repetitive activation patterns were observed. Partial rotational circuits were observed in 26 of 57 (46%) cases, focal patterns in 19 of 57 (33%), and complete rotational activity in 12 of 57 (21%) cases. In computer simulations, incomplete segments of partial rotations coincided with areas of slow conduction characterized by complex, multicomponent electrograms, and variations in assigning activation times at such sites substantially altered mapped mechanisms. Local activation mapping at sites of termination of persistent AF showed repetitive patterns of rotational or focal activity. In computer simulations, complete rotational activation sequence was observed but was sensitive to assignment of activation timing particularly in segments of slow conduction. The observed phenomena of repetitive localized activation and the mechanism by which local ablation terminates putative AF drivers require further investigation. © 2018 American Heart Association, Inc.
Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.
Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven
2003-04-01
Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.
NASA Astrophysics Data System (ADS)
Woolfrey, John R.; Avery, Mitchell A.; Doweyko, Arthur M.
1998-03-01
Two three-dimensional quantitative structure-activity relationship (3D-QSAR) methods, comparative molecular field analysis (CoMFA) and hypothetical active site lattice (HASL), were compared with respect to the analysis of a training set of 154 artemisinin analogues. Five models were created, including a complete HASL and two trimmed versions, as well as two CoMFA models (leave-one-out standard CoMFA and the guided-region selection protocol). Similar r2 and q2 values were obtained by each method, although some striking differences existed between CoMFA contour maps and the HASL output. Each of the four predictive models exhibited a similar ability to predict the activity of a test set of 23 artemisinin analogues, although some differences were noted as to which compounds were described well by either model.
Chakraborty, Sandeep; Minda, Renu; Salaye, Lipika; Bhattacharjee, Swapan K.; Rao, Basuthkar J.
2011-01-01
Computational methods are increasingly gaining importance as an aid in identifying active sites. Mostly these methods tend to have structural information that supplement sequence conservation based analyses. Development of tools that compute electrostatic potentials has further improved our ability to better characterize the active site residues in proteins. We have described a computational methodology for detecting active sites based on structural and electrostatic conformity - C ata L ytic A ctive S ite P rediction (CLASP). In our pipelined model, physical 3D signature of any particular enzymatic function as defined by its active sites is used to obtain spatially congruent matches. While previous work has revealed that catalytic residues have large pKa deviations from standard values, we show that for a given enzymatic activity, electrostatic potential difference (PD) between analogous residue pairs in an active site taken from different proteins of the same family are similar. False positives in spatially congruent matches are further pruned by PD analysis where cognate pairs with large deviations are rejected. We first present the results of active site prediction by CLASP for two enzymatic activities - β-lactamases and serine proteases, two of the most extensively investigated enzymes. The results of CLASP analysis on motifs extracted from Catalytic Site Atlas (CSA) are also presented in order to demonstrate its ability to accurately classify any protein, putative or otherwise, with known structure. The source code and database is made available at www.sanchak.com/clasp/. Subsequently, we probed alkaline phosphatases (AP), one of the well known promiscuous enzymes, for additional activities. Such a search has led us to predict a hitherto unknown function of shrimp alkaline phosphatase (SAP), where the protein acts as a protease. Finally, we present experimental evidence of the prediction by CLASP by showing that SAP indeed has protease activity in vitro. PMID:22174814
Ibrahim, Firas; Andre, Claire; Iutzeler, Anne; Guillaume, Yves Claude
2013-10-01
A biochromatographic system was used to study the direct effect of carbon nanoparticles (CNPs) on the acetylcholinesterase (AChE) activity. The AChE enzyme was covalently immobilized on a monolithic CIM-disk via its NH2 residues. Our results showed an increase in the AChE activity in presence of CNPs. The catalytic constant (k(cat)) was increased while the Michaelis constant (K(m)) was slightly decreased. This indicated an increase in the enzyme efficiency with increase of the substrate affinity to the active site. The thermodynamic data of the activation mechanism of the enzyme, i.e. ΔH* and ΔS*, showed no change in the substrate interaction mechanism with the anionic binding site. The increase of the enthalpy (ΔH*) and the entropy (ΔS*) with decrease in the free energy of activation (Ea) was related to structural conformation change in the active site gorge. This affected the stability of water molecules in the active site gorge and facilitated water displacement by substrate for entering to the active site of the enzyme.
GASS-WEB: a web server for identifying enzyme active sites based on genetic algorithms.
Moraes, João P A; Pappa, Gisele L; Pires, Douglas E V; Izidoro, Sandro C
2017-07-03
Enzyme active sites are important and conserved functional regions of proteins whose identification can be an invaluable step toward protein function prediction. Most of the existing methods for this task are based on active site similarity and present limitations including performing only exact matches on template residues, template size restraints, despite not being capable of finding inter-domain active sites. To fill this gap, we proposed GASS-WEB, a user-friendly web server that uses GASS (Genetic Active Site Search), a method based on an evolutionary algorithm to search for similar active sites in proteins. GASS-WEB can be used under two different scenarios: (i) given a protein of interest, to match a set of specific active site templates; or (ii) given an active site template, looking for it in a database of protein structures. The method has shown to be very effective on a range of experiments and was able to correctly identify >90% of the catalogued active sites from the Catalytic Site Atlas. It also managed to achieve a Matthew correlation coefficient of 0.63 using the Critical Assessment of protein Structure Prediction (CASP 10) dataset. In our analysis, GASS was ranking fourth among 18 methods. GASS-WEB is freely available at http://gass.unifei.edu.br/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1981-01-01
This bibliography contains general studies as well as chemical analysis of archaeological specimens. The chemical analysis is mainly activation analysis of articles such as metals, pottery, coins, paintings, soils, glass and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The general studies include results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 237 citations, none of which are new entries to the previous edition.)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nicholas, R.A.; Suzuki, H.; Hirota, Y.
This paper reports the sequence of the active site peptide of penicillin-binding protein 1b from Escherichia coli. Purified penicillin-binding protein 1b was labeled with (/sup 14/C)penicillin G, digested with trypsin, and partially purified by gel filtration. Upon further purification by high-pressure liquid chromatography, two radioactive peaks were observed, and the major peak, representing over 75% of the applied radioactivity, was submitted to amino acid analysis and sequencing. The sequence Ser-Ile-Gly-Ser-Leu-Ala-Lys was obtained. The active site nucleophile was identified by digesting the purified peptide with aminopeptidase M and separating the radioactive products on high-pressure liquid chromatography. Amino acid analysis confirmed thatmore » the serine residue in the middle of the sequence was covalently bonded to the (/sup 14/C)penicilloyl moiety. A comparison of this sequence to active site sequences of other penicillin-binding proteins and beta-lactamases is presented.« less
Wanat, Weronika; Talma, Michał; Hurek, Józef; Pawełczak, Małgorzata; Kafarski, Paweł
2018-06-08
A series of phosphonic acid analogues of phenylglycine variously substituted in phenyl ring have been synthesized and evaluated for their inhibitory activity towards potato L-phenylalanine ammonia lyase. Most of the compounds appeared to act as moderate (micromolar) inhibitors of the enzyme. Analysis of their binding performed using molecular modeling have shown that they might be bound either in active site of the enzyme or in the non-physiologic site. The latter one is located in adjoining deep site nearby the to the entrance channel for substrate into active site. Copyright © 2018. Published by Elsevier B.V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morgans, D. L.; Lindberg, S. L.
The purpose of this technical approach document (TAD) is to document the assumptions, equations, and methods used to perform the groundwater pathway radiological dose calculations for the revised Hanford Site Composite Analysis (CA). DOE M 435.1-1, states, “The composite analysis results shall be used for planning, radiation protection activities, and future use commitments to minimize the likelihood that current low-level waste disposal activities will result in the need for future corrective or remedial actions to adequately protect the public and the environment.”
The Energy Landscape Analysis of Cancer Mutations in Protein Kinases
Dixit, Anshuman; Verkhivker, Gennady M.
2011-01-01
The growing interest in quantifying the molecular basis of protein kinase activation and allosteric regulation by cancer mutations has fueled computational studies of allosteric signaling in protein kinases. In the present study, we combined computer simulations and the energy landscape analysis of protein kinases to characterize the interplay between oncogenic mutations and locally frustrated sites as important catalysts of allostetric kinase activation. While structurally rigid kinase core constitutes a minimally frustrated hub of the catalytic domain, locally frustrated residue clusters, whose interaction networks are not energetically optimized, are prone to dynamic modulation and could enable allosteric conformational transitions. The results of this study have shown that the energy landscape effect of oncogenic mutations may be allosteric eliciting global changes in the spatial distribution of highly frustrated residues. We have found that mutation-induced allosteric signaling may involve a dynamic coupling between structurally rigid (minimally frustrated) and plastic (locally frustrated) clusters of residues. The presented study has demonstrated that activation cancer mutations may affect the thermodynamic equilibrium between kinase states by allosterically altering the distribution of locally frustrated sites and increasing the local frustration in the inactive form, while eliminating locally frustrated sites and restoring structural rigidity of the active form. The energy landsape analysis of protein kinases and the proposed role of locally frustrated sites in activation mechanisms may have useful implications for bioinformatics-based screening and detection of functional sites critical for allosteric regulation in complex biomolecular systems. PMID:21998754
Partridge, Steve; Smith, Tom; Lewis, Tania
2009-01-01
A number of efforts in recent years have sought to predict bear activity in various habitats to minimize human disturbance and bear/human conflicts. Alaskan coastal areas provide important foraging areas for bears (Ursus americanus and U. arctos), particularly following den emergence when there may be no snow-free foraging alternatives. Additionally, coastal areas provide important food items for bears throughout the year. Glacier Bay National Park and Preserve (GLBA) in southeastern Alaska has extensive coastal habitats, and the National Park Service (NPS) has been long interested in learning more about the use of these coastal habitats by bears because these same habitats receive extensive human use by park visitors, especially kayaking recreationists. This study provides insight regarding the nature and intensity of bear activity at selected coastal sites within GLBA. We achieved a clearer understanding of bear/habitat relationships within GLBA by analyzing bear activity data collected with remote cameras, bear sign mapping, scat collections, and genetic analysis of bear hair. Although we could not quantify actual levels of bear activity at study sites, agreement among measures of activity (for example, sign counts, DNA analysis, and video record) lends support to our qualitative site assessments. This work suggests that habitat evaluation, bear sign mapping, and periodic scat counts can provide a useful index of bear activity for sites of interest.
Gaudio, A C; Richards, W G; Takahata, Y
2000-02-01
A quantitative structure-activity relationship study of N2-(substituted)-phenylguanines (PHG) as inhibitors of herpes simplex virus thymidine kinase (HSV TK) was performed. The activity of a set of PHG derivatives were analyzed against the thymidine kinase of herpes simplex virus types 1 (HSV1 TK) and 2 (HSV2 TK). Classic and calculated physicochemical parameters were included in the analysis. The results showed that there is an important difference in the activity of the meta substituted PHG derivatives against HSV1 TK and HSV2 TK. The activity of the meta derivatives against HSV2 TK is influenced by a steric effect, which is not observed against HSV1 TK. The superposition of the three-dimensional structures of the active sites of HSV1 TK (crystal structure) and HSV2 TK (homology model) revealed that the amino acid Ile97 is located near the meta position in the HSV1 TK active site, whereas the amino acid Leu97 is located near the meta position in the HSV2 TK active site. This single difference in the active sites of both enzymes can explain the source of the steric effect and serves as an indication that our previously proposed binding mode for the PHG derivatives is plausible. However, another observed mutation in the active site region, Ala168 by Ser168, suggests that an alternative binding mode, similar to that of ganciclovir, could be possible.
Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.
1998-01-01
Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886
Chen, Yuanyuan; Farquhar, Erik R.; Chance, Mark R.; Palczewski, Krzysztof; Kiser, Philip D.
2012-01-01
Aminopeptidases are key enzymes involved in the regulation of signaling peptide activity. Here, we present a detailed biochemical and structural analysis of an evolutionary highly conserved aspartyl aminopeptidase called DNPEP. We show that this peptidase can cleave multiple physiologically relevant substrates, including angiotensins, and thus may play a key role in regulating neuron function. Using a combination of x-ray crystallography, x-ray absorption spectroscopy, and single particle electron microscopy analysis, we provide the first detailed structural analysis of DNPEP. We show that this enzyme possesses a binuclear zinc-active site in which one of the zinc ions is readily exchangeable with other divalent cations such as manganese, which strongly stimulates the enzymatic activity of the protein. The plasticity of this metal-binding site suggests a mechanism for regulation of DNPEP activity. We also demonstrate that DNPEP assembles into a functionally relevant tetrahedral complex that restricts access of peptide substrates to the active site. These structural data allow rationalization of the enzyme's preference for short peptide substrates with N-terminal acidic residues. This study provides a structural basis for understanding the physiology and bioinorganic chemistry of DNPEP and other M18 family aminopeptidases. PMID:22356908
Miller, K A; Addison, R F; Bandiera, S M
2004-01-01
To assess chemical contaminant stress in the marine environment, ethoxyresorufin-O-deethylase (EROD) activity and cytochrome P450 1A (CYP1A) expression were measured in 88 English Sole (Pleuronectes vetulus) collected during May and June 1999 from four sites in Vancouver Harbour and at an expected reference site outside the harbour. Hepatic microsomes were prepared from the fish and analyzed for total CYP content, EROD activity, and CYP1A protein levels. Hepatic EROD activity and CYP1A protein levels were elevated in fish from two sites in the inner harbour. A comparison with sediment chemistry data showed that fish with increased EROD activity and CYP1A levels came from sites containing relatively high levels of polycyclic aromatic hydrocarbons and polychlorinated biphenyls. Unexpectedly high levels of EROD activity and CYP1A protein were also found in fish from a reference site near Gibsons, in Howe Sound. The elevated EROD activity and CYP1A expression in fish from this site cannot be explained by the chemical analysis data collected.
Astani, Elahe K; Heshmati, Emran; Chen, Chun-Jung; Hadipour, Nasser L
2016-07-01
A theoretical study at the level of density functional theory (DFT) was performed to characterize noncovalent intermolecular interactions, especially hydrogen bond interactions, in the active site of enzyme human androsterone sulphotransferase (SULT2A1/ADT). Geometry optimization, interaction energy, (2)H, (14)N, and (17)O electric field gradient (EFG) tensors, (1)H, (13)C, (17)O, and (15)N chemical shielding (CS) tensors, Natural Bonding Orbital (NBO) analysis, and quantum theory of atoms in molecules (QTAIM) analysis of this active site were investigated. It was found that androsterone (ADT) is able to form hydrogen bonds with residues Ser80, Ile82, and His99 of the active site. The interaction energy calculations and NBO analysis revealed that the ADT molecule forms the strongest hydrogen bond with Ser80. Results revealed that ADT interacts with the other residues through electrostatic and Van der Waals interactions. Results showed that these hydrogen bonds influence on the calculated (2)H, (14)N, and (17)O quadrupole coupling constants (QCCs), as well as (1)H, (13)C, (17)O, and (15)N CS tensors. The magnitude of the QCC and CS changes at each nucleus depends directly on its amount of contribution to the hydrogen bond interaction. Copyright © 2016 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yuan, Puwei; Bartlam, Mark; Lou, Zhiyong
2009-11-10
The heterotrimeric influenza virus polymerase, containing the PA, PB1 and PB2 proteins, catalyses viral RNA replication and transcription in the nucleus of infected cells. PB1 holds the polymerase active site and reportedly harbours endonuclease activity, whereas PB2 is responsible for cap binding. The PA amino terminus is understood to be the major functional part of the PA protein and has been implicated in several roles, including endonuclease and protease activities as well as viral RNA/complementary RNA promoter binding. Here we report the 2.2 angstrom (A) crystal structure of the N-terminal 197 residues of PA, termed PA(N), from an avian influenzamore » H5N1 virus. The PA(N) structure has an alpha/beta architecture and reveals a bound magnesium ion coordinated by a motif similar to the (P)DX(N)(D/E)XK motif characteristic of many endonucleases. Structural comparisons and mutagenesis analysis of the motif identified in PA(N) provide further evidence that PA(N) holds an endonuclease active site. Furthermore, functional analysis with in vivo ribonucleoprotein reconstitution and direct in vitro endonuclease assays strongly suggest that PA(N) holds the endonuclease active site and has critical roles in endonuclease activity of the influenza virus polymerase, rather than PB1. The high conservation of this endonuclease active site among influenza strains indicates that PA(N) is an important target for the design of new anti-influenza therapeutics.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cavagnaro, D.
1979-12-01
These citations of federally-funded research are divided into two parts; namely, a chemical analysis of archaeological specimens, and general studies. The chemical analysis section deals primarily with activation analysis. Articles examined include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The general studies section cites other archaeological research, including results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 237 abstracts, 149 of which are new entries to the previous edition.)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1981-01-01
These citations of federally-funded research contains the chemical analysis of archaeological specimens, as well as general studies. The chemical analysis deals primarily with activation analysis. Articles examined include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The general studies cites other archaeological research, including results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 133 citations, all of which are new entries to the previous edition.)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cavagnaro, D.
1979-12-01
The cited reports of Federally-funded research are divided into two parts: namely, a chemical analysis of archaeological specimens, and general studies. The chemical analysis section deals primarily with activation analysis. Artifacts examined include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The general studies section discusses other archaeological research, including results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 128 abstracts, none of which are new entries to the previous edition.)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cavagnaro, D.M.
1978-11-01
These citations of Federally-funded research are divided into two parts; namely, a chemical analysis of archaeological specimens, and general studies. The chemical analysis section deals primarily with activation analysis. Articles examined include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan and prehistoric times. The general studies section cites other archaeological research, including results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 209 abstracts, 141 of which are new entries to the previous edition.)
Taylor, Isaiah; Wang, Ying; Seitz, Kati; Baer, John; Bennewitz, Stefan; Mooney, Brian P.; Walker, John C.
2016-01-01
Receptor-like protein kinases (RLKs) are the largest family of plant transmembrane signaling proteins. Here we present functional analysis of HAESA, an RLK that regulates floral organ abscission in Arabidopsis. Through in vitro and in vivo analysis of HAE phosphorylation, we provide evidence that a conserved phosphorylation site on a region of the HAE protein kinase domain known as the activation segment positively regulates HAE activity. Additional analysis has identified another putative activation segment phosphorylation site common to multiple RLKs that potentially modulates HAE activity. Comparative analysis suggests that phosphorylation of this second activation segment residue is an RLK specific adaptation that may regulate protein kinase activity and substrate specificity. A growing number of RLKs have been shown to exhibit biologically relevant dual specificity toward serine/threonine and tyrosine residues, but the mechanisms underlying dual specificity of RLKs are not well understood. We show that a phospho-mimetic mutant of both HAE activation segment residues exhibits enhanced tyrosine auto-phosphorylation in vitro, indicating phosphorylation of this residue may contribute to dual specificity of HAE. These results add to an emerging framework for understanding the mechanisms and evolution of regulation of RLK activity and substrate specificity. PMID:26784444
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-15
... Activities; Proposed Collection; Comment Request; Distribution of Offsite Consequence Analysis Information... Collection Request (ICR), Distribution of Offsite Consequence Analysis Information under Section 112(r)(7)(H... Air Act Section 112(r)(7); Distribution of Off-Site Consequence Analysis Information. CAA section 112...
Hubley-Kozey, Cheryl L; Butler, Heather L; Kozey, John W
2012-08-01
Muscle synergies are important for spinal stability, but few studies examine temporal responses of spinal muscles to dynamic perturbations. This study examined activation amplitudes and temporal synergies among compartments of the back extensor and among abdominal wall muscles in response to dynamic bidirectional moments of force. We further examined whether responses were different between men and women. 19 women and 18 men performed a controlled transfer task. Surface electromyograms from bilateral sites over 6 back extensor compartments and 6 abdominal wall muscle sites were analyzed using principal component analysis. Key features were extracted from the measured electromyographic waveforms capturing amplitude and temporal variations among muscle sites. Three features explained 97% of the variance. Scores for each feature were computed for each measured waveform and analysis of variance found significant (p<.05) muscle main effects and a sex by muscle interaction. For the back extensors, post hoc analysis revealed that upper and more medial sites were recruited to higher amplitudes, medial sites responded to flexion moments, and the more lateral sites responded to lateral flexion moments. Women had more differences among muscle sites than men for the lateral flexion moment feature. For the abdominal wall muscles the oblique muscles responded with synergies related to fiber orientation, with women having higher amplitudes and more responsiveness to the lateral flexion moment than men. Synergies between the abdominal and back extensor sites as the moment demands change are discussed. These findings illustrate differential activation among erector spinae compartments and abdominal wall muscle sites supporting a highly organized pattern of response to bidirectional external moments with asynchronies more apparent in women. Copyright © 2012 Elsevier B.V. All rights reserved.
Wang, Shan; Yang, Shuo; An, Baiyi; Wang, Shichen; Yin, Yuejia; Lu, Yang; Xu, Ying; Hao, Dongyun
2011-01-01
CYP82E4, a cytochrome P450 monooxygenase, has nicotine N-demethylase (NND) activity, which mediates the bioconversion of nicotine into nornicotine in senescing tobacco leaves. Nornicotine is a precursor of the carcinogen, tobacco-specific nitrosamine. CYP82E3 is an ortholog of CYP82E4 with 95% sequence identity, but it lacks NND activity. A recent site-directed mutagenesis study revealed that a single amino acid substitution, i.e., cysteine to tryptophan at the 330 position in the middle of protein, restores the NND activity of CYP82E3 entirely. However, the same amino acid change caused the loss of the NND activity of CYP82E4. To determine the mechanism of the functional turnover of the two molecules, four 3D structures, i.e., the two molecules and their corresponding cys–trp mutants were modeled. The resulting structures exhibited that the mutation site is far from the active site, which suggests that no direct interaction occurs between the two sites. Simulation studies in different biological scenarios revealed that the mutation introduces a conformation drift with the largest change at the F-G loop. The dynamics trajectories analysis using principal component analysis and covariance analysis suggests that the single amino acid change causes the opening and closing of the transfer channels of the substrates, products, and water by altering the motion of the F-G and B-C loops. The motion of helix I is also correlated with the motion of both the F-G loop and the B-C loop and; the single amino acid mutation resulted in the curvature of helix I. These results suggest that the single amino acid mutation outside the active site region may have indirectly mediated the flexibility of the F-G and B-C loops through helix I, causing a functional turnover of the P450 monooxygenase. PMID:21858078
Orthogonal use of a human tRNA synthetase active site to achieve multifunctionality.
Zhou, Quansheng; Kapoor, Mili; Guo, Min; Belani, Rajesh; Xu, Xiaoling; Kiosses, William B; Hanan, Melanie; Park, Chulho; Armour, Eva; Do, Minh-Ha; Nangle, Leslie A; Schimmel, Paul; Yang, Xiang-Lei
2010-01-01
Protein multifunctionality is an emerging explanation for the complexity of higher organisms. In this regard, aminoacyl tRNA synthetases catalyze amino acid activation for protein synthesis, but some also act in pathways for inflammation, angiogenesis and apoptosis. It is unclear how these multiple functions evolved and how they relate to the active site. Here structural modeling analysis, mutagenesis and cell-based functional studies show that the potent angiostatic, natural fragment of human tryptophanyl-tRNA synthetase (TrpRS) associates via tryptophan side chains that protrude from its cognate cellular receptor vascular endothelial cadherin (VE-cadherin). VE-cadherin's tryptophan side chains fit into the tryptophan-specific active site of the synthetase. Thus, specific side chains of the receptor mimic amino acid substrates and expand the functionality of the active site of the synthetase. We propose that orthogonal use of the same active site may be a general way to develop multifunctionality of human tRNA synthetases and other proteins.
USDA-ARS?s Scientific Manuscript database
BRI1 becomes highly phosphorylated in vivo upon perception of the ligand, brassinolide, as a result of autophosphorylation and transphosphorylation by its co-receptor kinase, BAK1. Important autophosphorylation sites include those involved in activation of kinase activity and those that are inhibito...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mileni, Mauro; Garfunkle, Joie; Ezzili, Cyrine
2010-11-03
Three cocrystal X-ray structures of the {alpha}-ketoheterocycle inhibitors 3-5 bound to a humanized variant of fatty acid amide hydrolase (FAAH) are disclosed and comparatively discussed alongside those of 1 (OL-135) and its isomer 2. These five X-ray structures systematically probe each of the three active site regions key to substrate or inhibitor binding: (1) the conformationally mobile acyl chain-binding pocket and membrane access channel responsible for fatty acid amide substrate and inhibitor acyl chain binding, (2) the atypical active site catalytic residues and surrounding oxyanion hole that covalently binds the core of the {alpha}-ketoheterocycle inhibitors captured as deprotonated hemiketals mimickingmore » the tetrahedral intermediate of the enzyme-catalyzed reaction, and (3) the cytosolic port and its uniquely important imbedded ordered water molecules and a newly identified anion binding site. The detailed analysis of their key active site interactions and their implications on the interpretation of the available structure-activity relationships are discussed providing important insights for future design.« less
TRIPATHI, ASHUTOSH; DURRANT, DAVID; LEE, RAY M.; BARUCHELLO, RICCARDO; ROMAGNOLI, ROMEO; SIMONI, DANIELE; KELLOGG, GLEN E.
2009-01-01
The crucial role of the microtubule in the cell division has identified tubulin as a target for the development of therapeutics for cancer; in particular tubulin is a target for antineoplastic agents that act by interfering with the dynamic stability of microtubules. A molecular modeling study was carried out to accurately represent the complex structure and the binding mode of a new class of stilbene-based tubulin inhibitors that bind at the αβ-tubulin colchicine site. Computational docking along with HINT score analysis fitted these inhibitors into the colchicine site and revealed detailed structure-activity information useful for inhibitor design. Quantitative analysis of the results was in good agreement with the in vitro antiproliferative activity of these derivatives (ranging from 3 nM to 100 μM) such that calculated and measured free energies of binding correlate with an r2 of 0.89 (standard error ± 0.85 kcal mol−1). This correlation suggests that the activity of unknown compounds may be predicted. PMID:19912057
Fry, John C; Webster, Gordon; Cragg, Barry A; Weightman, Andrew J; Parkes, R John
2006-10-01
The aim of this work was to relate depth profiles of prokaryotic community composition with geochemical processes in the deep subseafloor biosphere at two shallow-water sites on the Peru Margin in the Pacific Ocean (ODP Leg 201, sites 1228 and 1229). Principal component analysis of denaturing gradient gel electrophoresis banding patterns of deep-sediment Bacteria, Archaea, Euryarchaeota and the novel candidate division JS1, followed by multiple regression, showed strong relationships with prokaryotic activity and geochemistry (R(2)=55-100%). Further correlation analysis, at one site, between the principal components from the community composition profiles for Bacteria and 12 other variables quantitatively confirmed their relationship with activity and geochemistry, which had previously only been implied. Comparison with previously published cell counts enumerated by fluorescent in situ hybridization with rRNA-targeted probes confirmed that these denaturing gradient gel electrophoresis profiles described an active prokaryotic community.
A Potential Biofilm Metabolite Signature for Caries Activity - A Pilot Clinical Study
Zandona, F; Soini, HA; Novotny, MV; Santiago, E; Eckert, GJ; Preisser, JS; Benecha, HK; Arthur, RA; Zero, DT
2016-01-01
Background This study's aim was to compare the dental biofilm metabolite-profile of caries-active (N=11) or caries-free (N=4) children by gas chromatography-mass spectrometry (GC/MS) analyses. Methods Samples collected after overnight fasting, with or without a previous glucose rinse, were combined for each child based on the caries status of the site, re-suspended in ethanol and analyzed by GC/MS. Results Biofilm from caries-active sites exhibited a different chromatographic profile compared to caries-free sites. Qualitative and quantitative analysis suggested a special cluster of branched alcohols and esters present at substantially higher intensity in biofilms of caries-active sites. Conclusions This pilot study indicates that there are metabolites present in the biofilm which have the potential to provide a characteristic metabolomics signature for caries activity. PMID:27885354
NASA Astrophysics Data System (ADS)
George, Merin; John, Nimmy L.; Saravana Kumar, M.; Subashini, A.; Sajan, D.
2017-01-01
The FT-IR, FT-Raman and UV-visible spectral analysis of 4-chloro 4'-methoxy benzylidene aniline were done experimentally and interpreted with the aid of normal coordinate analysis based on density functional theory (DFT) at the B3LYP/6-311++G (d, p) level of theory. Natural Bond orbital analysis was performed to understand the charge transfer interactions and reactive sites within the system. HOMO-LUMO analysis and first static and dynamic hyperpolarizability calculations were carried out in order to confirm the NLO activity of CMOBA. Photophysical characterization was done to understand the fluorescence emission and lifetime of CMOBA leading to application in blue OLEDs. The Molecular Electrostatic Potential Map was simulated to identify the active sites for electrophilic and nucleophilic attack or the active sites of the molecule which can bind to proteins. Molecular docking analysis revealed its potential as an inhibitor for different proteins which are responsible for cancer and many inflammatory diseases such as rheumatoid arthritis, inflammatory bowel disease, Crohn's disease and psoriasis. Experimental studies of invitro antiproliferative effect by MTT assay verified the anticancer properties of CMOBA.
Frederick, Thomas E; Peng, Jeffrey W
2018-01-01
Increasing evidence shows that active sites of proteins have non-trivial conformational dynamics. These dynamics include active site residues sampling different local conformations that allow for multiple, and possibly novel, inhibitor binding poses. Yet, active site dynamics garner only marginal attention in most inhibitor design efforts and exert little influence on synthesis strategies. This is partly because synthesis requires a level of atomic structural detail that is frequently missing in current characterizations of conformational dynamics. In particular, while the identity of the mobile protein residues may be clear, the specific conformations they sample remain obscure. Here, we show how an appropriate choice of ligand can significantly sharpen our abilities to describe the interconverting binding poses (conformations) of protein active sites. Specifically, we show how 2-(2'-carboxyphenyl)-benzoyl-6-aminopenicillanic acid (CBAP) exposes otherwise hidden dynamics of a protein active site that binds β-lactam antibiotics. When CBAP acylates (binds) the active site serine of the β-lactam sensor domain of BlaR1 (BlaRS), it shifts the time scale of the active site dynamics to the slow exchange regime. Slow exchange enables direct characterization of inter-converting protein and bound ligand conformations using NMR methods. These methods include chemical shift analysis, 2-d exchange spectroscopy, off-resonance ROESY of the bound ligand, and reduced spectral density mapping. The active site architecture of BlaRS is shared by many β-lactamases of therapeutic interest, suggesting CBAP could expose functional motions in other β-lactam binding proteins. More broadly, CBAP highlights the utility of identifying chemical probes common to structurally homologous proteins to better expose functional motions of active sites.
NASA Astrophysics Data System (ADS)
Nishiyama, Katsuhiko
2018-05-01
Using artificial intelligence, the binding styles of 167 tetrapeptides were predicted in the active site of papain and cathepsin K. Five tetrapeptides (Asn-Leu-Lys-Trp, Asp-Gln-Trp-Gly, Cys-Gln-Leu-Arg, Gln-Leu-Trp-Thr and Arg-Ser-Glu-Arg) were found to bind sites near the active center of both papain and cathepsin K. These five tetrapeptides have the potential to also bind sites of other cysteine proteases, and structural characteristics of these tetrapeptides should aid the design of a common inhibitor of cysteine proteases. Smart application of artificial intelligence should accelerate data mining of important complex systems.
Sun, Zhizeng; Mehta, Shrenik C; Adamski, Carolyn J; Gibbs, Richard A; Palzkill, Timothy
2016-09-12
CphA is a Zn(2+)-dependent metallo-β-lactamase that efficiently hydrolyzes only carbapenem antibiotics. To understand the sequence requirements for CphA function, single codon random mutant libraries were constructed for residues in and near the active site and mutants were selected for E. coli growth on increasing concentrations of imipenem, a carbapenem antibiotic. At high concentrations of imipenem that select for phenotypically wild-type mutants, the active-site residues exhibit stringent sequence requirements in that nearly all residues in positions that contact zinc, the substrate, or the catalytic water do not tolerate amino acid substitutions. In addition, at high imipenem concentrations a number of residues that do not directly contact zinc or substrate are also essential and do not tolerate substitutions. Biochemical analysis confirmed that amino acid substitutions at essential positions decreased the stability or catalytic activity of the CphA enzyme. Therefore, the CphA active - site is fragile to substitutions, suggesting active-site residues are optimized for imipenem hydrolysis. These results also suggest that resistance to inhibitors targeted to the CphA active site would be slow to develop because of the strong sequence constraints on function.
Bisht, Shveta; Rajaram, Venkatesan; Bharath, Sakshibeedu R; Kalyani, Josyula Nitya; Khan, Farida; Rao, Appaji N; Savithri, Handanahal S; Murthy, Mathur R N
2012-06-08
Pyridoxal 5'-phosphate (PLP)-dependent enzymes utilize the unique chemistry of a pyridine ring to carry out diverse reactions involving amino acids. Diaminopropionate (DAP) ammonia-lyase (DAPAL) is a prokaryotic PLP-dependent enzyme that catalyzes the degradation of d- and l-forms of DAP to pyruvate and ammonia. Here, we report the first crystal structure of DAPAL from Escherichia coli (EcDAPAL) in tetragonal and monoclinic forms at 2.0 and 2.2 Å resolutions, respectively. Structures of EcDAPAL soaked with substrates were also determined. EcDAPAL has a typical fold type II PLP-dependent enzyme topology consisting of a large and a small domain with the active site at the interface of the two domains. The enzyme is a homodimer with a unique biological interface not observed earlier. Structure of the enzyme in the tetragonal form had PLP bound at the active site, whereas the monoclinic structure was in the apo-form. Analysis of the apo and holo structures revealed that the region around the active site undergoes transition from a disordered to ordered state and assumes a conformation suitable for catalysis only upon PLP binding. A novel disulfide was found to occur near a channel that is likely to regulate entry of ligands to the active site. EcDAPAL soaked with dl-DAP revealed density at the active site appropriate for the reaction intermediate aminoacrylate, which is consistent with the observation that EcDAPAL has low activity under crystallization conditions. Based on the analysis of the structure and results of site-directed mutagenesis, a two-base mechanism of catalysis involving Asp(120) and Lys(77) is suggested.
Eckhard, Ulrich; Huesgen, Pitter F; Schilling, Oliver; Bellac, Caroline L; Butler, Georgina S; Cox, Jennifer H; Dufour, Antoine; Goebeler, Verena; Kappelhoff, Reinhild; Auf dem Keller, Ulrich; Klein, Theo; Lange, Philipp F; Marino, Giada; Morrison, Charlotte J; Prudova, Anna; Rodriguez, David; Starr, Amanda E; Wang, Yili; Overall, Christopher M
2016-06-01
The data described provide a comprehensive resource for the family-wide active site specificity portrayal of the human matrix metalloproteinase family. We used the high-throughput proteomic technique PICS (Proteomic Identification of protease Cleavage Sites) to comprehensively assay 9 different MMPs. We identified more than 4300 peptide cleavage sites, spanning both the prime and non-prime sides of the scissile peptide bond allowing detailed subsite cooperativity analysis. The proteomic cleavage data were expanded by kinetic analysis using a set of 6 quenched-fluorescent peptide substrates designed using these results. These datasets represent one of the largest specificity profiling efforts with subsequent structural follow up for any protease family and put the spotlight on the specificity similarities and differences of the MMP family. A detailed analysis of this data may be found in Eckhard et al. (2015) [1]. The raw mass spectrometry data and the corresponding metadata have been deposited in PRIDE/ProteomeXchange with the accession number PXD002265.
Basson, Marc D; Butler, Timothy
2006-11-01
Operating room (OR) activity transcends single ratios such as cases/room, but weighting multiple inputs and outputs may be arbitrary. Data-envelopment analysis (DEA) is a novel technique by which each facility is analyzed by the weightings that optimize its score. We performed DEA analysis of 23 Veterans Health Administration annual OR activity; 87,180 cases were performed, 24 publications generated, and 560 trainee-years of education delivered, in 168 ORs over 166,377 hours by 1,384 full-time equivalents of surgical and anesthesia providers and 523 nonproviders. Varying analyzed parameters produced similar efficiency rankings, with individual differences suggesting possible inefficiencies. We characterized returns to scale for efficient sites, suggesting whether patient flow might be efficiently further increased through these sites. We matched inefficient sites to similar efficient sites for comparison and suggested resource alterations to increase efficiency. Broader DEA application might characterize OR efficiency more informatively than conventional single-ratio rank ordering.
Lucas, James E; Siegel, Justin B
2015-01-01
Enzyme active site residues are often highly conserved, indicating a significant role in function. In this study we quantitate the functional contribution for all conserved molecular interactions occurring within a Michaelis complex for mannitol 2-dehydrogenase derived from Pseudomonas fluorescens (pfMDH). Through systematic mutagenesis of active site residues, we reveal that the molecular interactions in pfMDH mediated by highly conserved residues not directly involved in reaction chemistry can be as important to catalysis as those directly involved in the reaction chemistry. This quantitative analysis of the molecular interactions within the pfMDH active site provides direct insight into the functional role of each molecular interaction, several of which were unexpected based on canonical sequence conservation and structural analyses. PMID:25752240
Ozyurt, A Sinem; Selby, Thomas L
2008-07-01
This study describes a method to computationally assess the function of homologous enzymes through small molecule binding interaction energy. Three experimentally determined X-ray structures and four enzyme models from ornithine cyclo-deaminase, alanine dehydrogenase, and mu-crystallin were used in combination with nine small molecules to derive a function score (FS) for each enzyme-model combination. While energy values varied for a single molecule-enzyme combination due to differences in the active sites, we observe that the binding energies for the entire pathway were proportional for each set of small molecules investigated. This proportionality of energies for a reaction pathway appears to be dependent on the amino acids in the active site and their direct interactions with the small molecules, which allows a function score (FS) to be calculated to assess the specificity of each enzyme. Potential of mean force (PMF) calculations were used to obtain the energies, and the resulting FS values demonstrate that a measurement of function may be obtained using differences between these PMF values. Additionally, limitations of this method are discussed based on: (a) larger substrates with significant conformational flexibility; (b) low homology enzymes; and (c) open active sites. This method should be useful in accurately predicting specificity for single enzymes that have multiple steps in their reactions and in high throughput computational methods to accurately annotate uncharacterized proteins based on active site interaction analysis. 2008 Wiley-Liss, Inc.
Myette, James R; Soundararajan, Venkataramanan; Shriver, Zachary; Raman, Rahul; Sasisekharan, Ram
2009-12-11
Heparin and heparan sulfate glycosaminoglycans (HSGAGs) comprise a chemically heterogeneous class of sulfated polysaccharides. The development of structure-activity relationships for this class of polysaccharides requires the identification and characterization of degrading enzymes with defined substrate specificity and enzymatic activity. Toward this end, we report here the molecular cloning and extensive structure-function analysis of a 6-O-sulfatase from the Gram-negative bacterium Flavobacterium heparinum. In addition, we report the recombinant expression of this enzyme in Escherichia coli in a soluble, active form and identify it as a specific HSGAG sulfatase. We further define the mechanism of action of the enzyme through biochemical and structural studies. Through the use of defined substrates, we investigate the kinetic properties of the enzyme. This analysis was complemented by homology-based molecular modeling studies that sought to rationalize the substrate specificity of the enzyme and mode of action through an analysis of the active-site topology of the enzyme including identifying key enzyme-substrate interactions and assigning key amino acids within the active site of the enzyme. Taken together, our structural and biochemical studies indicate that 6-O-sulfatase is a predominantly exolytic enzyme that specifically acts on N-sulfated or N-acetylated 6-O-sulfated glucosamines present at the non-reducing end of HSGAG oligosaccharide substrates. This requirement for the N-acetyl or N-sulfo groups on the glucosamine substrate can be explained through eliciting favorable interactions with key residues within the active site of the enzyme. These findings provide a framework that enables the use of 6-O-sulfatase as a tool for HSGAG structure-activity studies as well as expand our biochemical and structural understanding of this important class of enzymes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shott, Gregory J.
This special analysis (SA) evaluates whether the Lawrence Livermore National Laboratory (LLNL) Low Activity Beta/Gamma Sources waste stream (BCLALADOEOSRP, Revision 0) is suitable for disposal by shallow land burial (SLB) at the Area 5 Radioactive Waste Management Site (RWMS) at the Nevada National Security Site (NNSS). The LLNL Low Activity Beta/Gamma Sources waste stream consists of sealed sources that are no longer needed. The LLNL Low Activity Beta/Gamma Sources waste stream required a special analysis because cobalt-60 (60Co), strontium-90 (90Sr), cesium-137 (137Cs), and radium-226 (226Ra) exceeded the NNSS Waste Acceptance Criteria (WAC) Action Levels (U.S. Department of Energy, National Nuclearmore » Security Administration Nevada Field Office [NNSA/NFO] 2015). The results indicate that all performance objectives can be met with disposal of the LLNL Low Activity Beta/Gamma Sources in a SLB trench. The LLNL Low Activity Beta/Gamma Sources waste stream is suitable for disposal by SLB at the Area 5 RWMS. However, the activity concentration of 226Ra listed on the waste profile sheet significantly exceeds the action level. Approval of the waste profile sheet could potentially allow the disposal of high activity 226Ra sources. To ensure that the generator does not include large 226Ra sources in this waste stream without additional evaluation, a control is need on the maximum 226Ra inventory. A limit based on the generator’s estimate of the total 226Ra inventory is recommended. The waste stream is recommended for approval with the control that the total 226Ra inventory disposed shall not exceed 5.5E10 Bq (1.5 Ci).« less
NASA Astrophysics Data System (ADS)
Yu, Xiaofang; Yu, Xiaobo; Wu, Shujie; Liu, Bo; Liu, Heng; Guan, Jingqi; Kan, Qiubin
2011-02-01
Acid-base bifunctional heterogeneous catalysts containing carboxylic and amine groups, which were immobilized at defined distance from one another on the mesoporous solid were synthesized by immobilizing lysine onto carboxyl-SBA-15. The obtained materials were characterized by X-ray diffraction (XRD), N 2 adsorption, Fourier-transform infrared spectroscopy (FTIR), thermogravimetric analysis (TGA), scanning electron micrographs (SEM), transmission electron micrographs (TEM), elemental analysis, and back titration. Proximal-C-A-SBA-15 with a proximal acid-base distance was more active than maximum-C-A-SBA-15 with a maximum acid-base distance in aldol condensation reaction between acetone and various aldehydes. It appears that the distance between acidic site and basic site immobilized on mesoporous solid should be an essential factor for catalysis optimization.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
NASA Astrophysics Data System (ADS)
D'Aquino, J. Alejandro; Ringe, Dagmar
2006-08-01
The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.
Does your web site draw new patients?
Wallin, Wendy S
2009-11-01
The absence of scientific data forces orthodontists to guess at how best to design Internet sites that persuade prospective patients to call for appointments. This study was conducted to identify the Web-site factors that lead prospective patients to make appointments or, conversely, to reject a practice. Ten participants actively looking online for an orthodontist were recruited to participate. They reviewed 64 orthodontic Web sites in their geographic areas and rated their likelihood of calling each practice for an appointment. The sessions were videotaped. Analysis of participant comments, navigation patterns, and ratings suggested 25 distinguishing factors. Statistical analysis showed 10 Web-site characteristics that predict the success of an orthodontic Web site in attracting new patients.
Information Architecture for Bilingual Web Sites.
ERIC Educational Resources Information Center
Cunliffe, Daniel; Jones, Helen; Jarvis, Melanie; Egan, Kevin; Huws, Rhian; Munro, Sian
2002-01-01
Discusses creating an information architecture for a bilingual Web site and reports work in progress on the development of a content-based bilingual Web site to facilitate shared resources between speech and language therapists. Considers a structural analysis of existing bilingual Web designs and explains a card-sorting activity conducted with…
NASA Astrophysics Data System (ADS)
Folkers, Gerd; Trumpp-Kallmeyer, Susanne; Gutbrod, Oliver; Krickl, Sabine; Fetzer, Jürgen; Keil, Günther M.
1991-10-01
Thymidine kinase (TK), which is induced by Herpes Simplex Virus 1 (HSV1), plays a key role in the antiviral activity of guanine derivatives such as aciclovir (ACV). In contrast, ACV shows only low affinity to the corresponding host cell enzyme. In order to define the differences in substrate binding of the two enzymes on molecular level, models for the three-dimensional (3-D) structures of the active sites of HSV1-TK and human TK were developed. The reconstruction of the active sites started from primary and secondary structure analysis of various kinases. The results were validated to homologous enzymes with known 3-D structures. The models predict that both enzymes consist of a central core β-sheet structure, connected by loops and α-helices very similar to the overall structure of other nucleotide binding enzymes. The phosphate binding is made up of a highly conserved glycine-rich loop at the N-terminus of the proteins and a conserved region at the C-terminus. The thymidine recognition site was found about 100 amino acids downstream from the phosphate binding loop. The differing substrate specificity of human and HSV1-TK can be explained by amino-acid substitutions in the homologous regions. To achieve a better understanding of the structure of the active site and how the thymidine kinase proteins interact with their substrates, the corresponding complexes of thymidine and dihydroxypropoxyguanine (DHPG) with HSV1 and human TK were built. For the docking of the guanine derivative, the X-ray structure of Elongation Factor Tu (EF-Tu), co-crystallized with guanosine diphosphate, was taken as reference. Fitting of thymidine into the active sites was done with respect to similar interactions found in thymidylate kinase. To complement the analysis of the 3-D structures of the two kinases and the substrate enzyme interactions, site-directed mutagenesis of the thymidine recognition site of HSV1-TK has been undertaken, changing Asp162 in the thymidine recognition site into Asn. First investigations reveal that the enzymatic activity of the mutant protein is destroyed.
Pratap, Shivendra; Katiki, Madhusudhanarao; Gill, Preet; Kumar, Pravindra; Golemi-Kotra, Dasantila
2016-01-01
Carbapenem-hydrolyzing class D β-lactamases (CHDLs) are a subgroup of class D β-lactamases, which are enzymes that hydrolyze β-lactams. They have attracted interest due to the emergence of multidrug-resistant Acinetobacter baumannii, which is not responsive to treatment with carbapenems, the usual antibiotics of choice for this bacterium. Unlike other class D β-lactamases, these enzymes efficiently hydrolyze carbapenem antibiotics. To explore the structural requirements for the catalysis of carbapenems by these enzymes, we determined the crystal structure of the OXA-58 CHDL of A. baumannii following acylation of its active-site serine by a 6α-hydroxymethyl penicillin derivative that is a structural mimetic for a carbapenem. In addition, several point mutation variants of the active site of OXA-58, as identified by the crystal structure analysis, were characterized kinetically. These combined studies confirm the mechanistic relevance of a hydrophobic bridge formed over the active site. This structural feature is suggested to stabilize the hydrolysis-productive acyl-enzyme species formed from the carbapenem substrates of this enzyme. Furthermore, our structural studies provide strong evidence that the hydroxyethyl group of carbapenems samples different orientations in the active sites of CHDLs, and the optimum orientation for catalysis depends on the topology of the active site allowing proper closure of the active site. We propose that CHDLs use the plasticity of the active site to drive the mechanism of carbapenem hydrolysis toward efficiency. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nemeria, Natalia S; Arjunan, Palaniappa; Chandrasekhar, Krishnamoorthy
2010-11-03
Kinetic, spectroscopic, and structural analysis tested the hypothesis that a chain of residues connecting the 4{prime}-aminopyrimidine N1{prime} atoms of thiamin diphosphates (ThDPs) in the two active centers of the Escherichia coli pyruvate dehydrogenase complex E1 component provides a signal transduction pathway. Substitution of the three acidic residues (Glu{sup 571}, Glu{sup 235}, and Glu{sup 237}) and Arg{sup 606} resulted in impaired binding of the second ThDP, once the first active center was filled, suggesting a pathway for communication between the two ThDPs. (1) Steady-state kinetic and fluorescence quenching studies revealed that upon E571A, E235A, E237A, and R606A substitutions, ThDP binding inmore » the second active center was affected. (2) Analysis of the kinetics of thiazolium C2 hydrogen/deuterium exchange of enzyme-bound ThDP suggests half-of-the-sites reactivity for the E1 component, with fast (activated site) and slow exchanging sites (dormant site). The E235A and E571A variants gave no evidence for the slow exchanging site, indicating that only one of two active sites is filled with ThDP. (3) Titration of the E235A and E237A variants with methyl acetylphosphonate monitored by circular dichroism suggested that only half of the active sites were filled with a covalent predecarboxylation intermediate analog. (4) Crystal structures of E235A and E571A in complex with ThDP revealed the structural basis for the spectroscopic and kinetic observations and showed that either substitution affects cofactor binding, despite the fact that Glu{sup 235} makes no direct contact with the cofactor. The role of the conserved Glu{sup 571} residue in both catalysis and cofactor orientation is revealed by the combined results for the first time.« less
Silver-coated nylon dressing plus active DC microcurrent for healing of autogenous skin donor sites.
Malin, Edward W; Galin, Chaya M; Lairet, Kimberley F; Huzar, Todd F; Williams, James F; Renz, Evan M; Wolf, Steven E; Cancio, Leopoldo C
2013-11-01
Burn wounds are a significant cause of morbidity and mortality, and improved outcomes are demonstrated with early closure of both primary burn wounds and skin donor sites. Thus, technology that decreases the healing time of burns and donor sites would be potentially lifesaving. We present the results of a single-center, prospective, double-blinded, randomized controlled trial to evaluate the efficacy of silver-coated dressing with active microcurrent in comparison to silver-coated dressing with sham microcurrent on wound-closure time for autogenous skin donor sites. Four hundred five patients were screened for treatment of their donor sites using a silver-coated nylon dressing with either sham or active microcurrent stimulation. Thirty patients were enrolled in the study and then randomized. Of these, 5 patients were removed from analysis due to protocol deviations. Differences in time-to-closure were analyzed using Kaplan-Meier analysis and the proportional hazard regression model. Subjective verbal pain rating scores (0-10; 0, no pain; 10, worst pain) were also recorded. All devices were blinded and programmed at an outside facility, so that every patient had either an active or sham device. The study was unblinded only after the final patient's donor site had healed. All patients achieved donor-site healing before postoperative day 20. The 14 patients in the active microcurrent group [mean, 10.8 (2.9) days; range, 7-15 days] experienced no difference in time to wound healing as compared to the remaining patients in the sham microcurrent group [mean, 11.1 (2.0) days; range, 8-14 days; P = 0.75]. There were no differences in pain from one group compared to the other. None of the donor sites exhibited clinical signs of infection. In a sample size of 25 burn patients, the addition of direct microcurrent to silver-nylon dressings did not decrease time to wound closure of skin donor sites, and it did not show a difference in reported pain levels.
Orthogonal use of a human tRNA synthetase active site to achieve multi-functionality
Zhou, Quansheng; Kapoor, Mili; Guo, Min; Belani, Rajesh; Xu, Xiaoling; Kiosses, William B.; Hanan, Melanie; Park, Chulho; Armour, Eva; Do, Minh-Ha; Nangle, Leslie A.; Schimmel, Paul; Yang, Xiang-Lei
2011-01-01
Protein multi-functionality is an emerging explanation for the complexity of higher organisms. In this regard, while aminoacyl tRNA synthetases catalyze amino acid activation for protein synthesis, some also act in pathways for inflammation, angiogenesis, and apoptosis. How multiple functions evolved and their relationship to the active site is not clear. Here structural modeling analysis, mutagenesis, and cell-based functional studies show that the potent angiostatic, natural fragment of human TrpRS associates via Trp side chains that protrude from the cognate cellular receptor VE-cadherin. Modeling indicates that (I prefer the way it was because the conclusion was reached not only by modeling, but more so by experimental studies.)VE-cadherin Trp side chains fit into the Trp-specific active site of the synthetase. Thus, specific side chains of the receptor mimic (?) amino acid substrates and expand the functionality of the active site of the synthetase. We propose that orthogonal use of the same active site may be a general way to develop multi-functionality of human tRNA synthetases and other proteins. PMID:20010843
Site Suitability Analysis for Beekeeping via Analythical Hyrearchy Process, Konya Example
NASA Astrophysics Data System (ADS)
Sarı, F.; Ceylan, D. A.
2017-11-01
Over the past decade, the importance of the beekeeping activities has been emphasized in the field of biodiversity, ecosystems, agriculture and human health. Thus, efficient management and deciding correct beekeeping activities seems essential to maintain and improve productivity and efficiency. Due to this importance, considering the economic contributions to the rural area, the need for suitability analysis concept has been revealed. At this point, Multi Criteria Decision Analysis (MCDA) and Geographical Information Systems (GIS) integration provides efficient solutions to the complex structure of decision- making process for beekeeping activities. In this study, site suitability analysis via Analytical Hierarchy Process (AHP) was carried out for Konya city in Turkey. Slope, elevation, aspect, distance to water resources, roads and settlements, precipitation and flora criteria are included to determine suitability. The requirements, expectations and limitations of beekeeping activities are specified with the participation of experts and stakeholders. The final suitability map were validated with existing 117 beekeeping locations and Turkish Statistical Institute 2016 beekeeping statistics for Konya province.
Henry, Anna E; Story, Mary
2009-01-01
To identify food and beverage brand Web sites featuring designated children's areas, assess marketing techniques present on those industry Web sites, and determine nutritional quality of branded food items marketed to children. Systematic content analysis of food and beverage brand Web sites and nutrient analysis of food and beverages advertised on these Web sites. The World Wide Web. One-hundred thirty Internet Web sites of food and beverage brands with top media expenditures based on the America's Top 2000 Brands section of Brandweek magazine's annual "Superbrands" report. A standardized content analysis rating form to determine marketing techniques used on the food and beverage brand Web sites. Nutritional analysis of food brands was conducted. Of 130 Web sites analyzed, 48% featured designated children's areas. These Web sites featured a variety of Internet marketing techniques, including advergaming on 85% of the Web sites and interactive programs on 92% of the Web sites. Branded spokescharacters and tie-ins to other products were featured on the majority of the Web sites, as well. Few food brands (13%) with Web sites that market to children met the nutrition criteria set by the National Alliance for Nutrition and Activity. Nearly half of branded Web sites analyzed used designated children's areas to market food and beverages to children, 87% of which were of low nutritional quality. Nutrition professionals should advocate the use of advertising techniques to encourage healthful food choices for children.
Paris Observatory Analysis Center (OPAR): Report on Activities, January - December 2012
NASA Technical Reports Server (NTRS)
Lambert, Sebastien; Barache, Christophe
2013-01-01
We report on activities of the Paris Observatory VLBI Analysis Center (OPAR) for calendar year 2012 concerning the development of operational tasks, the development of our Web site, and various other activities: monitoring of the Earth's free core nutation, measuring of the post-seismic displacements of some stations, and the analysis of the recent IVS R&D sessions, including observations of quasars close to the Sun.
Friesem, David E.; Lavi, Noa; Madella, Marco; Ajithprasad, P.; French, Charles
2016-01-01
Hunter-gatherer societies have distinct social perceptions and practices which are expressed in unique use of space and material deposition patterns. However, the identification of archaeological evidence associated with hunter-gatherer activity is often challenging, especially in tropical environments such as rainforests. We present an integrated study combining ethnoarchaeology and geoarchaeology in order to study archaeological site formation processes related to hunter-gatherers’ ways of living in tropical forests. Ethnographic data was collected from an habitation site of contemporary hunter-gatherers in the forests of South India, aimed at studying how everyday activities and way of living dictate patterns of material deposition. Ethnoarchaeological excavations of abandoned open-air sites and a rock-shelter of the same group located deep in the forests, involved field observations and sampling of sediments from the abandoned sites and the contemporary site. Laboratory analyses included geochemical analysis (i.e., FTIR, ICP-AES), phytolith concentration analysis and soil micromorphology. The results present a dynamic spatial deposition pattern of macroscopic, microscopic and chemical materials, which stem from the distinctive ways of living and use of space by hunter-gatherers. This study shows that post-depositional processes in tropical forests result in poor preservation of archaeological materials due to acidic conditions and intensive biological activity within the sediments. Yet, the multiple laboratory-based analyses were able to trace evidence for activity surfaces and their maintenance practices as well as localized concentrations of activity remains such as the use of plants, metals, hearths and construction materials. PMID:27783683
Archaeological data recovery at drill pad U19au, Nye County, Nevada
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henton, G.H.; Pippin, L.C.
1991-01-01
Construction activities accompanying underground nuclear tests result in the disturbance of the surface terrain at the Nevada Test Site. In compliance with Federal legislation (National Historic Preservation Act of 1966 (PL 89-665) and National Environmental Policy Act of 1969 (PL 91-190)), the US Department of Energy (DOE), Field Office, Nevada, has long required that cultural resources studies must precede all land-disturbing activities on the Nevada Test Site. In accordance with 36 CFR Part 800, these studies consist of archaeological surveys conducted prior to the land-disturbing activities. The intent of these surveys is to identify and evaluate all cultural resources thatmore » might be adversely affected by the proposed construction activity. This report presents the final analysis of the data recovered from archaeological investigations conducted at the U19au drill site and access road. This report includes descriptions of the archaeological sites as recorded during the original survey, the research design used to guide the investigations, the method and techniques used to collect and analyze the data, and the results and interpretations of the analysis. 200 refs., 112 figs., 53 tabs.« less
Sando, Steven K.; Vecchia, Aldo V.; Barnhart, Elliott P.; Sando, Thomas R.; Clark, Melanie L.; Lorenz, David L.
2014-01-01
The primary purpose of this report is to present information relating to flow-adjusted temporal trends in major-ion constituents and properties for 16 sampling sites in the Tongue and Powder River watersheds based on data collected during 1980–2010. In association with this primary purpose, the report presents background information on major-ion characteristics (including specific conductance, calcium, magnesium, potassium, sodium adsorption ratio, sodium, alkalinity, chloride, fluoride, dissolved sulfate, and dissolved solids) of the sampling sites and coal-bed methane (CBM) produced water (groundwater pumped from coal seams) in the site watersheds, trend analysis methods, streamflow conditions, and factors that affect trend results. The Tongue and Powder River watersheds overlie the Powder River structural basin (PRB) in northeastern Wyoming and southeastern Montana. Limited extraction of coal-bed methane (CBM) from the PRB began in the early 1990’s, and increased dramatically during the late 1990’s and early 2000’s. CBM-extraction activities produce discharges of water with high concentrations of dissolved solids (particularly sodium and bicarbonate ions) relative to most stream water in the Tongue and Powder River watersheds. Water-quality of CBM produced water is of concern because of potential effects of sodium on agricultural soils and potential effects of bicarbonate on aquatic biota. Two parametric trend-analysis methods were used in this study: the time-series model (TSM) and ordinary least squares regression (OLS) on time, streamflow, and season. The TSM was used to analyze trends for 11 of the 16 study sites. For five sites, data requirements of the TSM were not met and OLS was used to analyze trends. Two primary 10-year trend-analysis periods were selected. Trend-analysis period 1 (water years 1986–95; hereinafter referred to as period 1) was selected to represent variability in major-ion concentrations in the Tongue and Powder River watersheds before potential effects of CBM-extraction activities. Trend analysis period 2 (water years 2001–10; hereinafter referred to as period 2) was selected because it encompassed substantial CBM-extraction activities and therefore might indicate potential effects of CBM-extraction activities on water quality of receiving streams in the Tongue and Powder River watersheds. For sites that did not satisfy data requirements for the TSM, OLS was used to analyze trends for period 2 (if complete data were available) or a 6-year period (2005–10). Flow-rate characteristics of CBM-produced water were estimated to allow general comparisons with streamflow characteristics of the sampling sites. The information on flow-rate characteristics of CBM-produced water in relation to streamflow does not account for effects of disposal, treatment, or other remediation activities on the potential quantitative effects of CBM-produced water on receiving streams. In many places, CBM-produced water is discharged into impoundments or channels in upper reaches of tributary watersheds where water infiltrates and does not directly contribute to streamflow. For Tongue River at State line (site 4) mean annual pumping rate of CBM-produced water during water years 2001–10 (hereinafter referred to as mean CBM pumping rate) was 6 percent of the mean of annual median streamflows during water years 2001–10 (hereinafter referred to as 2001–10 median streamflow). For main-stem Tongue River sites 5, 7, and 10, mean CBM pumping rate was 8–12 percent of 2001–10 median streamflow. For main-stem Powder River sites (sites 12, 13, and 16), mean CBM pumping rates were 26, 28, and 34 percent of 2001–10 median streamflows, respectively. For main-stem Tongue River sites analyzed by using the TSM and downstream from substantial CBM-extraction activities [Tongue River at State line (site 4), Tongue River at Tongue River Dam (site 5), Tongue River at Birney Day School (site 7), and Tongue River at Miles City (site 10)], generally small significant or nonsignificant decreases in most constituents are indicated for period 1. For period 2 for these sites, the TSM trend results do not allow confident conclusions concerning detection of effects of CBM-extraction activities on stream water quality. Detection of significant trends in major-ion constituents and properties for period 2 generally was infrequent, and direction, magnitudes, and significance of fitted trends were not strongly consistent with relative differences in water quality between stream water and CBM-produced water. The TSM indicated significant or generally large magnitude increases in median values of sodium adsorption ratio (SAR), sodium, and alkalinity for period 2 for sites 5 and 7, which might indicate potential effects of CBM-extraction activities on stream water. However, other factors, including operations of Tongue River Reservoir, irrigation activities, contributions of saline groundwater, and operations of the Decker coal mine, confound confident determination of causes of detected significant trends for sites 5 and 7. For all mainstem Tongue River sites, trends for period 2 generally are within ranges of those for period 1 before substantial CBM-extraction activities. For main-stem Powder River sites analyzed by using the TSM [Powder River at Sussex (site 11), Powder River at Arvada (site 12), Powder River at Moorhead (site 13), and Powder River near Locate (site 16)], significant or generally large magnitude decreases in median values of SAR, sodium, estimated alkalinity, chloride, fluoride, specific conductance, and dissolved solids are indicated for period 1. Patterns in trend results for period 1 for main-stem Powder River sites are consistent with effects of Salt Creek oil-brine reinjection that started in 1990. Trend results for all main-stem Powder River sites downstream from substantial CBM-extraction activities (sites 12, 13, and 16) indicate evidence of potential effects of CBM-extraction activities on stream water quality, although evidence is stronger for sites 12 and 13 than for site 16. Evidence in support of potential CBM effects includes significant increases in median values of SAR, sodium, and estimated alkalinity for period 2 for sites 12, 13, and 16 that are consistent with relative differences between stream water and CBM-produced water. Significant increases in median values of these constituents for period 2 are not indicated for Powder River at Sussex (site 11) upstream from substantial CBM-extraction activities. In interpreting the trend results, it is notable that the fitted trends evaluate changes in median concentrations and also notable that changes in median concentrations that might be attributed to CBM-extraction activities probably are more strongly evident during low to median streamflow conditions than during mean to high streamflow conditions. This observation is relevant in assessing trend results in relation to specific water-quality concerns, including effects of water-quality changes on irrigators and effects on stream biota and ecology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gopal, B.; Madan, Lalima L.; Betz, Stephen F.
2010-11-10
Common structural motifs, such as the cupin domains, are found in enzymes performing different biochemical functions while retaining a similar active site configuration and structural scaffold. The soil bacterium Bacillus subtilis has 20 cupin genes (0.5% of the total genome) with up to 14% of its genes in the form of doublets, thus making it an attractive system for studying the effects of gene duplication. There are four bicupins in B. subtilis encoded by the genes yvrK, yoaN, yxaG, and ywfC. The gene products of yvrK and yoaN function as oxalate decarboxylases with a manganese ion at the active site(s),more » whereas YwfC is a bacitracin synthetase. Here we present the crystal structure of YxaG, a novel iron-containing quercetin 2,3-dioxygenase with one active site in each cupin domain. Yxag is a dimer, both in solution and in the crystal. The crystal structure shows that the coordination geometry of the Fe ion is different in the two active sites of YxaG. Replacement of the iron at the active site with other metal ions suggests modulation of enzymatic activity in accordance with the Irving-Williams observation on the stability of metal ion complexes. This observation, along with a comparison with the crystal structure of YvrK determined recently, has allowed for a detailed structure-function analysis of the active site, providing clues to the diversification of function in the bicupin family of proteins.« less
Dutta, Saheb; Choudhury, Kaberi; Banik, Sindrila Dutta; Nandi, Nilashis
2014-03-01
The present work is aimed at understanding the origin of the difference in the molecular organization of the active site nanospaces of the class I and class II aminoacyl tRNA synthetases (aaRSs) which are tunnel-like structures. The active site encloses the cognate amino acid (AA) and the adenosine triphosphate (ATP) to carry out aminoacylation reaction. Comparison of the structures of the active site of the class I and class II (aaRSs) shows that the nanodimensional tunnels are curved in opposite directions in the two classes. We investigated the origin of this difference using quantum mechanical computation of electrostatic potential (ESP) of substrates, surrounding residues and ions, using Atoms in Molecule (AIM) Theory and charge population analysis. We show that the difference is principally due to the variation in the spatial charge distribution of ATP in the two classes which correspond to extended and bent conformations of ATP. The present computation shows that the most feasible pathway for nucleophilic attack to alphaP is oppositely directed for class I and class II aaRSs. The available crystal structures show that the cognate AA is indeed located along the channel favorable for nucleophilic attack as predicted by the ESP analysis. It is also shown that the direction of the channel changes its orientation when the orientation of ATP is changed from extended to a bent like structure. We further used the AIM theory to confirm the direction of the approach of AA in each case and the results corroborate the results from the ESP analysis. The opposite curvatures of the active site nanospaces in class I and class II aaRSs are related with the influence of the charge distributions of the extended and bent conformations of ATP, respectively. The results of the computation of electrostatic potential by successive addition of active site residues show that their roles on the reaction are similar in both classes despite the difference in the organization of the active sites of class I and class II aaRSs. The difference in mechanism in two classes as pointed out in recent study (S. Dutta Banik and N. Nandi, J. Biomol. Struct. Dyn. 30, 701 (2012)) is related with the fact that the relative arrangement of the ATP with respect to the AA is opposite in class I and class II aaRSs as explained in the present work. The charge population difference between the reacting centers (which are the alphaP atom of ATP (q(p)) and the attacking oxygen atom of carboxylic acid group (q(o)), respectively) denoted by delta(q), is a measure of the propensity of nucleophilic attack. The population analysis of the substrate AA shows that a non-negligible difference exists between the attacking oxygens of AA in class I (syn) and in class II (anti) which is one reason for the lower value of delta(q) in class II relative to class I. The population analysis of the AA, ATP, Mg+2 ions and active site residues shows that the difference in delta(q) values of the two classes is substantially reduced. When ions and residues are considered. Thus, the bent state of ATP, Mg+2 ions and active site residues complements it cognate AA to carry out the nucleophilic reaction in class I as efficiently as occurs in class I (with the extended state of ATP, single Mg+2 ion and active site residues). This could be one reason for the two different conformations of ATP in the two classes. The mutual arrangements of AA and ATP in each aaRS are guided by the spatial charge distribution of ATP (extended and bent). The present work shows that the construction of nanospace complements the arrangement of the substrate (AA and ATP).
Contaminated site cleanups involving complex activities may benefit from a detailed environmental footprint analysis to inform decision-making about application of suitable best management practices for greener cleanups.
Gånedahl, H; Zsaludek Viklund, P; Carlén, K; Kylberg, E; Ekberg, J
2015-05-01
In Sweden, a work-site wellness programme implies reimbursing some of the expenses for health-promoting activities. Although work-site wellness programmes are readily available in Sweden, a large number of employees elect not to participate. The aim of this study was to investigate the association of physical activity, self-reported general health assessment and self-efficacy with participation in a work-site wellness programme. A cross-sectional study design was used. An online questionnaire was distributed to employees of a manufacturing company with 2500 employees in southwest Sweden. Those who took advantage of the work-site wellness programme assessed their general health as better and had higher assessment of physical activity. The study showed that being enlisted also implies a higher level of physical activity and general health; however, the effect sizes of these correlations were small. Self-efficacy, i.e. perceived behavioural control, was not associated with participation in the work-site wellness programme. However, self-efficacy was correlated with both general health assessment and physical activity. A regression analysis to determine explanatory contributions to the general health assessment score showed no significant contribution from participation in a work-site wellness programme, but was instead explained by perceived behavioural control and physical activity. Given the small effect size of the difference in physical activity between participators and non-participators in the work-site wellness programme, it is probable that only a small proportion of participators changed their health-promoting activities as a result of the work-site wellness programme. Copyright © 2015 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Smathers, J. B.; Kuykendall, W. E., Jr.; Wright, R. E., Jr.; Marshall, J. R.
1973-01-01
Radioisotope measurement techniques and neutron activation analysis are evaluated for use in identifying and locating contamination sources in space environment simulation chambers. The alpha range method allows the determination of total contaminant concentration in vapor state and condensate state. A Cf-252 neutron activation analysis system for detecting oils and greases tagged with stable elements is described. While neutron activation analysis of tagged contaminants offers specificity, an on-site system is extremely costly to implement and provides only marginal detection sensitivity under even the most favorable conditions.
Shan, S O; Herschlag, D
2000-01-01
The presence of catalytic metal ions in RNA active sites has often been inferred from metal-ion rescue of modified substrates and sometimes from inhibitory effects of alternative metal ions. Herein we report that, in the Tetrahymena group I ribozyme reaction, the deleterious effect of a thio substitution at the pro-Sp position of the reactive phosphoryl group is rescued by Mn2+. However, analysis of the reaction of this thio substrate and of substrates with other modifications strongly suggest that this rescue does not stem from a direct Mn2+ interaction with the Sp sulfur. Instead, the apparent rescue arises from a Mn2+ ion interacting with the residue immediately 3' of the cleavage site, A(+1), that stabilizes the tertiary interactions between the oligonucleotide substrate (S) and the active site. This metal site is referred to as site D herein. We also present evidence that a previously observed Ca2+ ion that inhibits the chemical step binds to metal site D. These and other observations suggest that, whereas the interactions of Mn2+ at site D are favorable for the chemical reaction, the Ca2+ at site D exerts its inhibitory effect by disrupting the alignment of the substrates within the active site. These results emphasize the vigilance necessary in the design and interpretation of metal-ion rescue and inhibition experiments. Conversely, in-depth mechanistic analysis of the effects of site-specific substrate modifications can allow the effects of specific metal ion-RNA interactions to be revealed and the properties of individual metal-ion sites to be probed, even within the sea of metal ions bound to RNA. PMID:10864040
Structure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic Enzyme.
Brown, Breann L; Kardon, Julia R; Sauer, Robert T; Baker, Tania A
2018-04-03
5-Aminolevulinic acid synthase (ALAS) catalyzes the first step in heme biosynthesis. We present the crystal structure of a eukaryotic ALAS from Saccharomyces cerevisiae. In this homodimeric structure, one ALAS subunit contains covalently bound cofactor, pyridoxal 5'-phosphate (PLP), whereas the second is PLP free. Comparison between the subunits reveals PLP-coupled reordering of the active site and of additional regions to achieve the active conformation of the enzyme. The eukaryotic C-terminal extension, a region altered in multiple human disease alleles, wraps around the dimer and contacts active-site-proximal residues. Mutational analysis demonstrates that this C-terminal region that engages the active site is important for ALAS activity. Our discovery of structural elements that change conformation upon PLP binding and of direct contact between the C-terminal extension and the active site thus provides a structural basis for investigation of disruptions in the first step of heme biosynthesis and resulting human disorders. Copyright © 2018 Elsevier Ltd. All rights reserved.
Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.
de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J
2002-09-01
The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.
Zhang, Haihan; Huang, Tinglin; Liu, Tingting
2013-01-01
Drinking water reservoir plays a vital role in the security of urban water supply, yet little is known about microbial community diversity harbored in the sediment of this oligotrophic freshwater environmental ecosystem. In the present study, integrating community level physiological profiles (CLPPs), nested polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) and clone sequence technologies, we examined the sediment urease and protease activities, bacterial community functional diversity, genetic diversity of bacterial and fungal communities in sediments from six sampling sites of Zhou cun drinking water reservoir, eastern China. The results showed that sediment urease activity was markedly distinct along the sites, ranged from 2.48 to 11.81 mg NH3-N/(g·24h). The highest average well color development (AWCD) was found in site C, indicating the highest metabolic activity of heterotrophic bacterial community. Principal component analysis (PCA) revealed tremendous differences in the functional (metabolic) diversity patterns of the sediment bacterial communities from different sites. Meanwhile, DGGE fingerprints also indicated spatial changes of genetic diversity of sediment bacterial and fungal communities. The sequence BLAST analysis of all the sediment samples found that Comamonas sp. was the dominant bacterial species harbored in site A. Alternaria alternate, Allomyces macrogynus and Rhizophydium sp. were most commonly detected fungal species in sediments of the Zhou cun drinking water reservoir. The results from this work provide new insights about the heterogeneity of sediment microbial community metabolic activity and genetic diversity in the oligotrophic drinking water reservoir. PMID:24205265
Carrer, Francesco
2017-01-01
This paper deals with the ethnoarchaeological analysis of the spatial pattern of artefacts and ecofacts within two traditional pastoral huts (a dwelling and a seasonal dairy) in the uplands of Val Maudagna (Cuneo province, Italian western Alps). The composition of the ethnoarchaeological assemblages of the two huts was studied and compared; point pattern analysis was applied to identify spatial processes mirrored in the interactions between objects; Moran's I correlogram and empirical variogram were used to investigate the effects of trampling on the displacement of objects on the floor. The results were compared with information provided by the herder who still used the huts. The quantitative and ethnographical data enabled inferences to be made that can help in the interpretation of archaeological seasonal sites. The function of a seasonal site can be recognized, as can the impact of delayed curation on the composition of the assemblage and the importance of the intensity of occupation compared with the frequency of occupation. The spatial organization of activities is reflected in the spatial patterns of objects, with clearer identification of activity areas in intensively occupied sites, and there is evidence for the behaviour behind the spatial segregation of activities. Trampling is a crucial post-depositional factor in the displacement of artefacts and ecofacts, especially in non-intensively exploited sites. From a methodological point of view, this research is another example that highlights the importance of integrating quantitative methods (especially spatial analysis and geostatistical methods) and ethnoarchaeological data in order to improve the interpretation of archaeological sites and assemblages.
Analysis of biomolecular solvation sites by 3D-RISM theory.
Sindhikara, Daniel J; Hirata, Fumio
2013-06-06
We derive, implement, and apply equilibrium solvation site analysis for biomolecules. Our method utilizes 3D-RISM calculations to quickly obtain equilibrium solvent distributions without either necessity of simulation or limits of solvent sampling. Our analysis of these distributions extracts highest likelihood poses of solvent as well as localized entropies, enthalpies, and solvation free energies. We demonstrate our method on a structure of HIV-1 protease where excellent structural and thermodynamic data are available for comparison. Our results, obtained within minutes, show systematic agreement with available experimental data. Further, our results are in good agreement with established simulation-based solvent analysis methods. This method can be used not only for visual analysis of active site solvation but also for virtual screening methods and experimental refinement.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lehmann, E.J.
1976-12-01
This bibliography was prepared in order to bring together Federally funded research relating to archaeology. It is divided into two sections. The first deals with the chemical analysis of archaeological specimens primarily using activation analysis. Articles studied include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The second section cites other archaeological research including results of excavations from all over the United States. Also covered is work on preservation of artifacts and remote sensing for site location. (This updated bibliography contains 135 abstracts, 18 of which are new entries to the previousmore » edition.) (GRA)« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cavagnaro, D.M.
1978-11-01
This bibliography was prepared in order to bring together Federally-funded research relating to archaeology. It is divided into two sections. The first deals with the chemical analysis of archaeological specimens primarily using activation analysis. Articles studied include metals, pottery, coins, paintings, soils, glass, and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The second section cites other archaeological research, including results of excavations from the United States. Also covered is work on preservation of artifacts and remote sensing for site location. (This updated bibliography contains 137 abstracts, none of which are new entries to the previous edition.)
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.
2005-01-01
The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less
Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts
Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.
2000-01-01
Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792
Conservation and Role of Electrostatics in Thymidylate Synthase.
Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C
2015-11-27
Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.
Molecular Dynamics of Mouse Acetylcholinesterase Complexed with Huperzine A
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tara, Sylvia; Helms, Volkhard H.; Straatsma, TP
1999-03-16
Two molecular dynamics simulations were performed for a modeled complex of mouse acetylcholinesterase liganded with huperzine A (HupA). Analysis of these simulations shows that HupA shifts in the active site toward Tyr 337 and Phe 338, and that several residues in the active site area reach out to make hydrogen bonds with the inhibitor. Rapid fluctuations of the gorge width are observed, ranging from widths that allow substrate access to the active site, to pinched structures that do not allow access of molecules as small as water. Additional openings or channels to the active site are found. One opening ismore » formed in the side wall of the active site gorge by residues Val 73, Asp 74, Thr 83, Glu 84, and Asn 87. Another opening is formed at the base of the gorge by residues Trp 86, Val 132, Glu 202, Gly 448, and Ile 451. Both of these openings have been observed separately in the Torpedo californica form of the enzyme. These channels could allow transport of waters and ions to and from the bulk solution.« less
The Role of Virtual Reference in Library Web Site Design: A Qualitative Source for Usage Data
ERIC Educational Resources Information Center
Powers, Amanda Clay; Shedd, Julie; Hill, Clay
2011-01-01
Gathering qualitative information about usage behavior of library Web sites is a time-consuming process requiring the active participation of patron communities. Libraries that collect virtual reference transcripts, however, hold valuable data regarding how the library Web site is used that could benefit Web designers. An analysis of virtual…
2010-06-01
comprise a chain of former volcanoes extending from the southwest portion of the site to the coast. Due to its proximity to the tectonic North...American and Pacific crustal plates, the area is seismically active. A large portion of the site consists of hills and mountains with three categories of
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishiyama, Katsuhiko; Hoshino, Tadatsugu; Graduate School of Pharmaceutical Sciences, Chiba University, 1-33 Yayoi-cho, Inage-ku, Chiba 263-8522
2007-05-21
Interactions between luciferase and a nanofabricated hydrophilic Si surface were explored by molecular-dynamics simulations. The structural changes in the active-site residues, the residues affecting the luciferin binding, and the residues affecting the bioluminescence color were smaller on the nanofabricated hydrophilic Si surface than on both a hydrophobic Si surface and a hydrophilic Si surface. The nanofabrication and wet-treatment techniques are expected to prevent the decrease in activity of luciferase on the Si surface.
X-ray absorption spectroscopic studies of mononuclear non-heme iron enzymes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Westre, Tami E.
Fe-K-edge X-ray absorption spectroscopy (XAS) has been used to investigate the electronic and geometric structure of the iron active site in non-heme iron enzymes. A new theoretical extended X-ray absorption fine structure (EXAFS) analysis approach, called GNXAS, has been tested on data for iron model complexes to evaluate the utility and reliability of this new technique, especially with respect to the effects of multiple-scattering. In addition, a detailed analysis of the 1s→3d pre-edge feature has been developed as a tool for investigating the oxidation state, spin state, and geometry of iron sites. Edge and EXAFS analyses have then been appliedmore » to the study of non-heme iron enzyme active sites.« less
Bate, Paul; Warwicker, Jim
2004-07-02
Calculations of charge interactions complement analysis of a characterised active site, rationalising pH-dependence of activity and transition state stabilisation. Prediction of active site location through large DeltapK(a)s or electrostatic strain is relevant for structural genomics. We report a study of ionisable groups in a set of 20 enzymes, finding that false positives obscure predictive potential. In a larger set of 156 enzymes, peaks in solvent-space electrostatic properties are calculated. Both electric field and potential match well to active site location. The best correlation is found with electrostatic potential calculated from uniform charge density over enzyme volume, rather than from assignment of a standard atom-specific charge set. Studying a shell around each molecule, for 77% of enzymes the potential peak is within that 5% of the shell closest to the active site centre, and 86% within 10%. Active site identification by largest cleft, also with projection onto a shell, gives 58% of enzymes for which the centre of the largest cleft lies within 5% of the active site, and 70% within 10%. Dielectric boundary conditions emphasise clefts in the uniform charge density method, which is suited to recognition of binding pockets embedded within larger clefts. The variation of peak potential with distance from active site, and comparison between enzyme and non-enzyme sets, gives an optimal threshold distinguishing enzyme from non-enzyme. We find that 87% of the enzyme set exceeds the threshold as compared to 29% of the non-enzyme set. Enzyme/non-enzyme homologues, "structural genomics" annotated proteins and catalytic/non-catalytic RNAs are studied in this context.
Yamamura, Daiki; Sano, Ayaka; Tateno, Takashi
2017-03-15
To examine local network properties of the mouse auditory cortex in vitro, we recorded extracellular spatiotemporal laminar profiles driven by short electric local stimulation on a planar multielectrode array substrate. The recorded local field potentials were subsequently evaluated using current source density (CSD) analysis to identify sources and sinks. Current sinks are thought to be an indicator of net synaptic current in the small volume of cortex surrounding the recording site. Thus, CSD analysis combined with multielectrode arrays enabled us to compare mean synaptic activity in response to small current stimuli on a layer-by-layer basis. We also used senescence-accelerated mice (SAM), some strains of which show earlier onset of age-related hearing loss, to examine the characteristic spatiotemporal CSD profiles stimulated by electrodes in specific cortical layers. Thus, the CSD patterns were classified into several clusters based on stimulation sites in the cortical layers. We also found some differences in CSD patterns between the two SAM strains in terms of aging according to principle component analysis with dimension reduction. For simultaneous two-site stimulation, we modeled the obtained CSD profiles as a linear superposition of the CSD profiles to individual single-site stimulation. The model analysis indicated the nonlinearity of spatiotemporal integration over stimulus-driven activity in a layer-specific manner. Finally, on the basis of these results, we discuss the auditory cortex local network properties and the effects of aging on these mouse strains. Copyright © 2017 Elsevier B.V. All rights reserved.
Stephenson, William J.; Odum, Jackson K.; McNamara, Daniel E.; Williams, Robert A.; Angster, Stephen J
2014-01-01
We characterize shear-wave velocity versus depth (Vs profile) at 16 portable seismograph sites through the epicentral region of the 2011 Mw 5.8 Mineral (Virginia, USA) earthquake to investigate ground-motion site effects in the area. We used a multimethod acquisition and analysis approach, where active-source horizontal shear (SH) wave reflection and refraction as well as active-source multichannel analysis of surface waves (MASW) and passive-source refraction microtremor (ReMi) Rayleigh wave dispersion were interpreted separately. The time-averaged shear-wave velocity to a depth of 30 m (Vs30), interpreted bedrock depth, and site resonant frequency were estimated from the best-fit Vs profile of each method at each location for analysis. Using the median Vs30 value (270–715 m/s) as representative of a given site, we estimate that all 16 sites are National Earthquake Hazards Reduction Program (NEHRP) site class C or D. Based on a comparison of simplified mapped surface geology to median Vs30 at our sites, we do not see clear evidence for using surface geologic units as a proxy for Vs30 in the epicentral region, although this may primarily be because the units are similar in age (Paleozoic) and may have similar bulk seismic properties. We compare resonant frequencies calculated from ambient noise horizontal:vertical spectral ratios (HVSR) at available sites to predicted site frequencies (generally between 1.9 and 7.6 Hz) derived from the median bedrock depth and average Vs to bedrock. Robust linear regression of HVSR to both site frequency and Vs30 demonstrate moderate correlation to each, and thus both appear to be generally representative of site response in this region. Based on Kendall tau rank correlation testing, we find that Vs30 and the site frequency calculated from average Vs to median interpreted bedrock depth can both be considered reliable predictors of weak-motion site effects in the epicentral region.
Knutson, Stacy T.; Westwood, Brian M.; Leuthaeuser, Janelle B.; Turner, Brandon E.; Nguyendac, Don; Shea, Gabrielle; Kumar, Kiran; Hayden, Julia D.; Harper, Angela F.; Brown, Shoshana D.; Morris, John H.; Ferrin, Thomas E.; Babbitt, Patricia C.
2017-01-01
Abstract Protein function identification remains a significant problem. Solving this problem at the molecular functional level would allow mechanistic determinant identification—amino acids that distinguish details between functional families within a superfamily. Active site profiling was developed to identify mechanistic determinants. DASP and DASP2 were developed as tools to search sequence databases using active site profiling. Here, TuLIP (Two‐Level Iterative clustering Process) is introduced as an iterative, divisive clustering process that utilizes active site profiling to separate structurally characterized superfamily members into functionally relevant clusters. Underlying TuLIP is the observation that functionally relevant families (curated by Structure‐Function Linkage Database, SFLD) self‐identify in DASP2 searches; clusters containing multiple functional families do not. Each TuLIP iteration produces candidate clusters, each evaluated to determine if it self‐identifies using DASP2. If so, it is deemed a functionally relevant group. Divisive clustering continues until each structure is either a functionally relevant group member or a singlet. TuLIP is validated on enolase and glutathione transferase structures, superfamilies well‐curated by SFLD. Correlation is strong; small numbers of structures prevent statistically significant analysis. TuLIP‐identified enolase clusters are used in DASP2 GenBank searches to identify sequences sharing functional site features. Analysis shows a true positive rate of 96%, false negative rate of 4%, and maximum false positive rate of 4%. F‐measure and performance analysis on the enolase search results and comparison to GEMMA and SCI‐PHY demonstrate that TuLIP avoids the over‐division problem of these methods. Mechanistic determinants for enolase families are evaluated and shown to correlate well with literature results. PMID:28054422
Knutson, Stacy T; Westwood, Brian M; Leuthaeuser, Janelle B; Turner, Brandon E; Nguyendac, Don; Shea, Gabrielle; Kumar, Kiran; Hayden, Julia D; Harper, Angela F; Brown, Shoshana D; Morris, John H; Ferrin, Thomas E; Babbitt, Patricia C; Fetrow, Jacquelyn S
2017-04-01
Protein function identification remains a significant problem. Solving this problem at the molecular functional level would allow mechanistic determinant identification-amino acids that distinguish details between functional families within a superfamily. Active site profiling was developed to identify mechanistic determinants. DASP and DASP2 were developed as tools to search sequence databases using active site profiling. Here, TuLIP (Two-Level Iterative clustering Process) is introduced as an iterative, divisive clustering process that utilizes active site profiling to separate structurally characterized superfamily members into functionally relevant clusters. Underlying TuLIP is the observation that functionally relevant families (curated by Structure-Function Linkage Database, SFLD) self-identify in DASP2 searches; clusters containing multiple functional families do not. Each TuLIP iteration produces candidate clusters, each evaluated to determine if it self-identifies using DASP2. If so, it is deemed a functionally relevant group. Divisive clustering continues until each structure is either a functionally relevant group member or a singlet. TuLIP is validated on enolase and glutathione transferase structures, superfamilies well-curated by SFLD. Correlation is strong; small numbers of structures prevent statistically significant analysis. TuLIP-identified enolase clusters are used in DASP2 GenBank searches to identify sequences sharing functional site features. Analysis shows a true positive rate of 96%, false negative rate of 4%, and maximum false positive rate of 4%. F-measure and performance analysis on the enolase search results and comparison to GEMMA and SCI-PHY demonstrate that TuLIP avoids the over-division problem of these methods. Mechanistic determinants for enolase families are evaluated and shown to correlate well with literature results. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Botvinick, E.H.; Frais, M.A.; Shosa, D.W.
1982-08-01
The ability of scintigraphic phase image analysis to characterize patterns of abnormal ventricular activation was investigated. The pattern of phase distribution and sequential phase changes over both right and left ventricular regions of interest were evaluated in 16 patients with normal electrical activation and wall motion and compared with those in 8 patients with an artificial pacemaker and 4 patients with sinus rhythm with the Wolff-Parkinson-White syndrome and delta waves. Normally, the site of earliest phase angle was seen at the base of the interventricular septum, with sequential change affecting the body of the septum and the cardiac apex andmore » then spreading laterally to involve the body of both ventricles. The site of earliest phase angle was located at the apex of the right ventricle in seven patients with a right ventricular endocardial pacemaker and on the lateral left ventricular wall in one patient with a left ventricular epicardial pacemaker. In each case the site corresponded exactly to the position of the pacing electrode as seen on posteroanterior and left lateral chest X-ray films, and sequential phase changes spread from the initial focus to affect both ventricles. In each of the patients with the Wolff-Parkinson-White syndrome, the site of earliest ventricular phase angle was located, and it corresponded exactly to the site of the bypass tract as determined by endocardial mapping. In this way, four bypass pathways, two posterior left paraseptal, one left lateral and one right lateral, were correctly localized scintigraphically. On the basis of the sequence of mechanical contraction, phase image analysis provides an accurate noninvasive method of detecting abnormal foci of ventricular activation.« less
Kawabata, Fuminori; Kawabata, Yuko; Liang, Ruojun; Nishimura, Shotaro; Tabata, Shoji
2017-01-01
Postprandial hyperglycemia is a risk factor for cardiovascular diseases. It has been reported that intragastric administration of allyl isothiocyanate (AITC), which is one of the pungent ingredients of wasabi and horseradish but it is not included in hot chili pepper, increased carbohydrate oxidation and reduced postprandial increase of blood glucose via transient receptor potential vanilloid 1 (TRPV1)in mice. However, the action site of AITC on TRPV1 for increasing carbohydrate oxidation is unclear. Both mammalian and chicken TRPV1 (cTRPV1) are activated by heat and acid, but unlike its mammalian counterpart, cTRPV1 is only faintly activated by capsaicin. This difference is due to the 8 chicken-specific amino acid residues around transmembrane 3, which is the main site of capsaicin-binding in rat TRPV1. Moreover, AITC-induced activation of mouse TRPV1 (mTRPV1) is largely dependent on S513, a residue that is involved in capsaicin-binding. Thus, we hypothesized that the increase of carbohydrate oxidation by AITC in mammals is induced by the binding of AITC to the capsaicin-binding site of TRPV1. In this study, we performed a comparative study using chickens and mice, since chickens are thought to partly lack the capsaicin-binding site of TRPV1. We examined the effects of AITC on the respiratory quotient (RQ), the index of carbohydrate oxidation and fat oxidation, in chickens and mice. Respiratory gas analysis revealed that AITC does not increase the RQ in chickens, and Ca 2+ imaging methods and a whole cell-patch clamp analysis showed that AITC does not activate cTRPV1. These results implied that the capsaicin-binding site is an important region for increasing carbohydrate oxidation by AITC administration in animals.
Rani, Nidhi; Vijayakumar, Saravanan; P T V, Lakshmi; Arunachalam, Annamalai
2016-08-01
Recent crystallographic study revealed the involvement of allosteric site in active site inhibition of penicillin binding protein (PBP2a), where one molecule of Ceftaroline (Cef) binds to the allosteric site of PBP2a and paved way for the other molecule (Cef) to bind at the active site. Though Cef has the potency to inhibit the PBP2a, its adverse side effects are of major concern. Previous studies have reported the antibacterial property of Quercetin derivatives, a group of natural compounds. Hence, the present study aims to evaluate the effect of Quercetin 3-o-rutinoside (Rut) in allosteric site-mediated active site inhibition of PBP2a. The molecular docking studies between allosteric site and ligands (Rut, Que, and Cef) revealed a better binding efficiency (G-score) of Rut (-7.790318) and Cef (-6.194946) with respect to Que (-5.079284). Molecular dynamic (MD) simulation studies showed significant changes at the active site in the presence of ligands (Rut and Cef) at allosteric site. Four different combinations of Rut and Cef were docked and their G-scores ranged between -6.320 and -8.623. MD studies revealed the stability of the key residue (Ser403) with Rut being at both sites, compared to other complexes. Morphological analysis through electron microscopy confirmed that combination of Rut and Cefixime was able to disturb the bacterial cell membrane in a similar fashion to that of Rut and Cefixime alone. The results of this study indicate that the affinity of Rut at both sites were equally good, with further validations Rut could be considered as an alternative for inhibiting MRSA growth.
DOE Office of Scientific and Technical Information (OSTI.GOV)
B Akabayov; C Richardson
Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstratemore » that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.« less
Quan, Quan; Xie, Shunji; Weng, Bo; Wang, Ye; Xu, Yi-Jun
2018-05-01
Charge separation/transfer is generally believed to be the most key factor affecting the efficiency of photocatalysis, which however will be counteracted if not taking the active site engineering into account for a specific photoredox reaction. Here, a 3D heterostructure composite is designed consisting of MoS 2 nanoplatelets decorated on reduced graphene oxide-wrapped TiO 2 nanotube arrays (TNTAs@RGO/MoS 2 ). Such a cascade configuration renders a directional migration of charge carriers and controlled immobilization of active sites, thereby showing much higher photoactivity for water splitting to H 2 than binary TNTAs@RGO and TNTAs/MoS 2 . The photoactivity comparison and mechanistic analysis reveal the double-edged sword role of RGO on boosted charge separation/transfer versus active site control in this composite system. The as-observed inconsistency between boosted charge transfer and lowered photoactivity over TNTAs@RGO is attributed to the decrease of active sites for H 2 evolution, which is significantly different from the previous reports in literature. The findings of the intrinsic relationship of balanced benefits from charge separation/transfer and active site control could promote the rational optimization of photocatalyst design by cooperatively manipulating charge flow and active site control, thereby improving the efficiency of photocatalysis for target photoredox processes. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Uddin, Shahadat; Mahmood, Hana; Senarath, Upul; Zahiruddin, Quazi; Karn, Sumit; Rasheed, Sabrina; Dibley, Michael
2017-06-13
Effective public policies are needed to support appropriate infant and young child feeding (IYCF) to ensure adequate child growth and development, especially in low and middle income countries. The aim of this study was to: (i) capture stakeholder networks in relation to funding and technical support for IYCF policy across five countries in South Asia (i.e. Sri Lanka, India, Nepal, Bangladesh and Pakistan); and (ii) understand how stakeholder networks differed between countries, and identify common actors and their patterns in network engagement across the region. The Net-Map method, which is an interview-based mapping technique to visualise and capture connections among different stakeholders that collaborate towards achieving a focused goal, has been used to map funding and technical support networks in all study sites. Our study was conducted at the national level in Bangladesh, India, Nepal, and Sri Lanka, as well as in selected states or provinces in India and Pakistan during 2013-2014. We analysed the network data using a social network analysis software (NodeXL). The number of stakeholders identified as providing technical support was higher than the number of stakeholders providing funding support, across all study sites. India (New Delhi site - national level) site had the highest number of influential stakeholders for both funding (43) and technical support (86) activities. Among all nine study sites, India (New Delhi - national level) and Sri Lanka had the highest number of participating government stakeholders (22) in their respective funding networks. Sri Lanka also had the highest number of participating government stakeholders for technical support (34) among all the study sites. Government stakeholders are more engaged in technical support activities compared with their involvement in funding activities. The United Nations Children's Emergency Fund (UNICEF) and the World Health Organization (WHO) were highly engaged stakeholders for both funding and technical support activities across all study sites. International stakeholders were highly involved in both the funding and technical support activities related to IYCF practices across these nine study sites. Government stakeholders received more support for funding and technical support activities from other stakeholders compared with the support that they offered. Stakeholders were, in general, more engaged for technical support activities compared with the funding activities.
Konrad, Christopher P.; Voss, Frank D.
2012-01-01
The streamflow-gaging network in the Puget Sound basin was analyzed for its capacity to monitor stormwater in small streams. The analysis consisted of an inventory of active and inactive gages and an evaluation of the coverage and resolution of the gaging network with an emphasis on lowland areas. The active gaging network covers much of the Puget Lowland largely by gages located at sites on larger streams and rivers. Assessments of stormwater impacts and management will likely require streamflow information with higher spatial resolution than provided by the current gaging network. Monitoring that emphasizes small streams in combination with approaches for estimating streamflow at ungaged sites provides an alternative to expanding the current gaging network that can improve the spatial resolution of streamflow information in the region. The highest priority gaps in the gaging network are low elevation basins close to the Puget Sound shoreline and sites that share less than 10 percent of the drainage area of an active gage. Although small, lowland sites with long records of streamflow are particularly valuable to maintain in the region, other criteria for prioritizing sites in the gaging network should be based on the specific questions that stormwater managers need to answer.
New insights into the molecular characteristics behind the function of Renilla luciferase.
Fanaei-Kahrani, Zahra; Ganjalikhany, Mohamad Reza; Rasa, Seyed Mohammad Mahdi; Emamzadeh, Rahman
2018-02-01
Renilla Luciferase (RLuc) is a blue light emitter protein which can be applied as a valuable tool in medical diagnosis. But due to lack of the crystal structure of RLuc-ligand complex, the functional motions and catalytic mechanism of this enzyme remain largely unknown. In the present study, the active site properties and the ligand-receptor interactions of the native RLuc and its red-shifted light emitting variant (Super RLuc 8) were investigated using molecular docking approach, molecular dynamics (MD) analysis, and MM-PBSA method. The detailed analysis of the main clusters led to identifying a lid-like structure and its functional motions. Furthermore, an induced-fit mechanism is proposed where ligand-binding induces conformational changes of the active site. Our findings give an insight into the deeper understanding of RLuc conformational changes during binding steps and ligand-receptor pattern. Moreover, our work broaden our understanding of how active site geometry is adjusted to support the catalytic activity and red-shifted light emission in Super RLuc 8. © 2017 Wiley Periodicals, Inc.
Source apportionment of groundwater pollution around landfill site in Nagpur, India.
Pujari, Paras R; Deshpande, Vijaya
2005-12-01
The present work attempts statistical analysis of groundwater quality near a Landfill site in Nagpur, India. The objective of the present work is to figure out the impact of different factors on the quality of groundwater in the study area. Statistical analysis of the data has been attempted by applying Factor Analysis concept. The analysis brings out the effect of five different factors governing the groundwater quality in the study area. Based on the contribution of the different parameters present in the extracted factors, the latter are linked to the geological setting, the leaching from the host rock, leachate of heavy metals from the landfill as well as the bacterial contamination from landfill site and other anthropogenic activities. The analysis brings out the vulnerability of the unconfined aquifer to contamination.
Malur, Achut G.; Gupta, Neera K.; De, Bishnu P.; Banerjee, Amiya K.
2002-01-01
The large protein (L) of the human parainfluenza virus type 3 (HPIV3) is the functional RNA-dependent RNA polymerase, which possesses highly conserved residues QGDNQ located within motif C of domain III comprising the putative polymerase active site. We have characterized the role of the QGDNQ residues as well as the residues flanking this region in the polymerase activity of the L protein by site-directed mutagenesis and examining the polymerase activity of the wild-type and mutant L proteins by an in vivo minigenome replication assay and an in vitro mRNA transcription assay. All mutations in the QGDNQ residues abolished transcription while mutations in the flanking residues gave rise to variable polymerase activities. These observations support the contention that the QGDNQ sequence is absolutely required for the polymerase activity of the HPIV3 RNA-dependent RNA polymerase. PMID:12064576
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilbert, R.O.; Eberhardt, L.L.; Fowler, E.B.
Reported here are results of the statistical design and analysis work conducted during Calendar Year 1974 for the Nevada Applied Ecology Group (NAEG) at plutonium study sites on the Nevada Test Site (NTS) and the Tonopah Test Range (TTR). Estimates of $sup 239-240$Pu inventory in surface soil (0 to 5-cm depth) are given for each of the NAEG intensive study sites, together with activity maps based on FIDLER surveys showing the field areas to which these estimates apply. There is evidence of a preliminary nature to suggest that the plutonium present in surface soil may be covered by a thinmore » (less than 2.5 cm) layer of soil whose alpha activity is considerably less than that directly below. Computer-drawn $sup 239-240$Pu concentration contours and three-dimensional surfaces in soil and vegetation are given for Area 13 and GMX as a first attempt at estimating the geographical distribution of $sup 239-240$Pu at these sites. (CH)« less
Oyama, Midori; Kariya, Yoshinobu; Kariya, Yukiko; Matsumoto, Kana; Kanno, Mayumi; Yamaguchi, Yoshiki; Hashimoto, Yasuhiro
2018-05-09
Osteopontin (OPN) is an extracellular glycosylated phosphoprotein that promotes cell adhesion by interacting with several integrin receptors. We previously reported that an OPN mutant lacking five O-glycosylation sites (Thr 134 /Thr 138 /Thr 143 /Thr 147 /Thr 152 ) in the threonine/proline-rich region increased cell adhesion activity and phosphorylation compared with the wild type. However, the role of O-glycosylation in cell adhesion activity and phosphorylation of OPN remains to be clarified. Here, we show that site-specific O-glycosylation in the threonine/proline-rich region of OPN affects its cell adhesion activity and phosphorylation independently and/or synergistically. Using site-directed mutagenesis, we found that OPN mutants with substitution sets of Thr 134 /Thr 138 or Thr 143 /Thr 147 /Thr 152 had decreased and increased cell adhesion activity, respectively. In contrast, the introduction of a single mutation into the O-glycosylation sites had no effect on OPN cell adhesion activity. An adhesion assay using function-blocking antibodies against αvβ3 and β1 integrins, as well as αvβ3 integrin-overexpressing A549 cells, revealed that site-specific O-glycosylation affected the association of OPN with the two integrins. Phosphorylation analyses using phos-tag and LC-MS/MS indicated that phosphorylation levels and sites were influenced by the O-glycosylation status, although the number of O-glycosylation sites was not correlated with the phosphorylation level in OPN. Furthermore, a correlation analysis between phosphorylation level and cell adhesion activity in OPN mutants with the site-specific O-glycosylation showed that they were not always correlated. These results provide conclusive evidence of a novel regulatory mechanism of cell adhesion activity and phosphorylation of OPN by site-specific O-glycosylation. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Law, B E
Research involves analysis and field direction of AmeriFlux operations, and the PI provides scientific leadership of the AmeriFlux network. Activities include the coordination and quality assurance of measurements across AmeriFlux network sites, synthesis of results across the network, organizing and supporting the annual Science Team Meeting, and communicating AmeriFlux results to the scientific community and other users. Objectives of measurement research include (i) coordination of flux and biometric measurement protocols (ii) timely data delivery to the Carbon Dioxide Information and Analysis Center (CDIAC); and (iii) assurance of data quality of flux and ecosystem measurements contributed by AmeriFlux sites. Objectives ofmore » integration and synthesis activities include (i) integration of site data into network-wide synthesis products; and (ii) participation in the analysis, modeling and interpretation of network data products. Communications objectives include (i) organizing an annual meeting of AmeriFlux investigators for reporting annual flux measurements and exchanging scientific information on ecosystem carbon budgets; (ii) developing focused topics for analysis and publication; and (iii) developing data reporting protocols in support of AmeriFlux network goals.« less
Saavedra, Juan M; Azócar, Mauricio A; Rodríguez, Vida; Ramírez-Sarmiento, César A; Andrews, Barbara A; Asenjo, Juan A; Parra, Loreto P
2018-03-25
Detailed molecular mechanisms underpinning enzymatic reactions are still a central problem in biochemistry. The need for active site flexibility to sustain catalytic activity constitutes a notion of wide acceptance, although its direct influence remains to be fully understood. With the aim of studying the relationship between structural dynamics and enzyme catalysis, the cellulase Cel5A from Bacillus agaradherans is used as a model for in silico comparative analysis with mesophilic and psychrophilic counterparts. Structural features that determine flexibility are related to kinetic and thermodynamic parameters of catalysis. As a result, three specific positions in the vicinity of the active site of Cel5A are selected for protein engineering via site-directed mutagenesis. Three Cel5A variants are generated, N141L, A137Y and I102A/A137Y, showing a concomitant increase in the catalytic activity at low temperatures and a decrease in activation energy and activation enthalpy, similar to cold-active enzymes. These results are interpreted in structural terms by molecular dynamics simulations, showing that disrupting a hydrogen bond network in the vicinity of the active site increases local flexibility. These results provide a structural framework for explaining the changes in thermodynamic parameters observed between homologous enzymes with varying temperature adaptations. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Discovery of HDAC Inhibitors That Lack an Active Site Zn(2+)-Binding Functional Group.
Vickers, Chris J; Olsen, Christian A; Leman, Luke J; Ghadiri, M Reza
2012-06-14
Natural and synthetic histone deacetylase (HDAC) inhibitors generally derive their strong binding affinity and high potency from a key functional group that binds to the Zn(2+) ion within the enzyme active site. However, this feature is also thought to carry the potential liability of undesirable off-target interactions with other metalloenzymes. As a step toward mitigating this issue, here, we describe the design, synthesis, and structure-activity characterizations of cyclic α3β-tetrapeptide HDAC inhibitors that lack the presumed indispensable Zn(2+)-binding group. The lead compounds (e.g., 15 and 26) display good potency against class 1 HDACs and are active in tissue culture against various human cancer cell lines. Importantly, enzymological analysis of 26 indicates that the cyclic α3β-tetrapeptide is a fast-on/off competitive inhibitor of HDACs 1-3 with K i values of 49, 33, and 37 nM, respectively. Our proof of principle study supports the idea that novel classes of HDAC inhibitors, which interact at the active-site opening, but not with the active site Zn(2+), can have potential in drug design.
Structural insights into xenobiotic and inhibitor binding to human aldehyde oxidase.
Coelho, Catarina; Foti, Alessandro; Hartmann, Tobias; Santos-Silva, Teresa; Leimkühler, Silke; Romão, Maria João
2015-10-01
Aldehyde oxidase (AOX) is a xanthine oxidase (XO)-related enzyme with emerging importance due to its role in the metabolism of drugs and xenobiotics. We report the first crystal structures of human AOX1, substrate free (2.6-Å resolution) and in complex with the substrate phthalazine and the inhibitor thioridazine (2.7-Å resolution). Analysis of the protein active site combined with steady-state kinetic studies highlight the unique features, including binding and substrate orientation at the active site, that characterize human AOX1 as an important drug-metabolizing enzyme. Structural analysis of the complex with the noncompetitive inhibitor thioridazine revealed a new, unexpected and fully occupied inhibitor-binding site that is structurally conserved among mammalian AOXs and XO. The new structural insights into the catalytic and inhibition mechanisms of human AOX that we now report will be of great value for the rational analysis of clinical drug interactions involving inhibition of AOX1 and for the prediction and design of AOX-stable putative drugs.
Activation mechanism of melB tyrosinase from Aspergillus oryzae by acidic treatment.
Fujieda, Nobutaka; Murata, Michiaki; Yabuta, Shintaro; Ikeda, Takuya; Shimokawa, Chizu; Nakamura, Yukihiro; Hata, Yoji; Itoh, Shinobu
2013-01-01
The pro form of recombinant tyrosinase from Aspergillus oryzae (melB) shows no catalytic activity, but acid treatment (around pH 3.5) of protyrosinase activates it to induce tyrosinase activity. Circular dichroism spectra, gel filtration analysis, and colorimetric assay have indicated that acid treatment around pH 3.5 induced the disruption of the conformation of the C-terminal domain covering the enzyme active site. These structural changes induced by the acid treatment may open the entrance to the enzyme active site for substrate incorporation. To compare the mechanism of hydroxylation by the acid-treated tyrosinase with that by trypsin-treated tyrosinase, a detailed steady-state kinetic analysis of the phenolase activity was performed by monitoring the O(2)-consumption rate using a Clark-type oxygen electrode. The results clearly show that the phenolase activity (phenol hydroxylation) of the activated tyrosinase involves an electrophilic aromatic substitution mechanism as in the case of mushroom tyrosinase (Yamazaki and Itoh in J. Am. Chem. Soc. 125:13034-13035, 2003) and activated hemocyanin with urea (Morioka et al. in J. Am. Chem. Soc. 128:6788-6789, 2006).
Buffer zone monitoring plan for the Dos Rios subdivision, Gunnison, Colorado
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1996-02-01
This report presents a plan for water quality monitoring at the Dos Rios subdivision (Units 2, 3, and the Island Unit) that is intended to satisfy the informational needs of residents who live southwest (downgradient) of the former Gunnison processing site. Water quality monitoring activities described in this report are designed to protect the public from residual contamination that entered the ground water as a result of previous uranium milling operations. Requirements presented in this monitoring plan are also included in the water sampling and analysis plan (WSAP) for the Gunnison Uranium Mill Tailings Remedial Action (UMTRA) Project site. Themore » Gunnison WSAP is a site-specific document prepared by the U.S. Department of Energy (DOE) that provides background, guidance, and justification for future ground water sampling and analysis activities for the UMTRA Project Gunnison processing and disposal sites. The WSAP will be updated annually, as additional water quality data are collected and interpreted, to provide ongoing protection for public health and the environment.« less
Figueroa-Romero, Claudia; Iñiguez-Lluhí, Jorge A.; Stadler, Julia; Chang, Chuang-Rung; Arnoult, Damien; Keller, Peter J.; Hong, Yu; Blackstone, Craig; Feldman, Eva L.
2009-01-01
Dynamin-related protein (Drp) 1 is a key regulator of mitochondrial fission and is composed of GTP-binding, Middle, insert B, and C-terminal GTPase effector (GED) domains. Drp1 associates with mitochondrial fission sites and promotes membrane constriction through its intrinsic GTPase activity. The mechanisms that regulate Drp1 activity remain poorly understood but are likely to involve reversible post-translational modifications, such as conjugation of small ubiquitin-like modifier (SUMO) proteins. Through a detailed analysis, we find that Drp1 interacts with the SUMO-conjugating enzyme Ubc9 via multiple regions and demonstrate that Drp1 is a direct target of SUMO modification by all three SUMO isoforms. While Drp1 does not harbor consensus SUMOylation sequences, our analysis identified2 clusters of lysine residues within the B domain that serve as noncanonical conjugation sites. Although initial analysis indicates that mitochondrial recruitment of ectopically expressed Drp1 in response to staurosporine is unaffected by loss of SUMOylation, we find that Drp1 SUMOylation is enhanced in the context of the K38A mutation. This dominant-negative mutant, which is deficient in GTP binding and hydrolysis, does not associate with mitochondria and prevents normal mitochondrial fission. This finding suggests that SUMOylation of Drp1 is linked to its activity cycle and is influenced by Drp1 localization.—Figueroa-Romero, C., Iñiguez-Lluhí, J. A., Stadler, J., Chang, C.-R., Arnoult, D., Keller, P. J., Hong, Y., Blackstone, C., Feldman, E. L. SUMOylation of the mitochondrial fission protein Drp1 occurs at multiple nonconsensus sites within the B domain and is linked to its activity cycle. PMID:19638400
The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase
NASA Astrophysics Data System (ADS)
Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy
2016-04-01
Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.
Rules based process window OPC
NASA Astrophysics Data System (ADS)
O'Brien, Sean; Soper, Robert; Best, Shane; Mason, Mark
2008-03-01
As a preliminary step towards Model-Based Process Window OPC we have analyzed the impact of correcting post-OPC layouts using rules based methods. Image processing on the Brion Tachyon was used to identify sites where the OPC model/recipe failed to generate an acceptable solution. A set of rules for 65nm active and poly were generated by classifying these failure sites. The rules were based upon segment runlengths, figure spaces, and adjacent figure widths. 2.1 million sites for active were corrected in a small chip (comparing the pre and post rules based operations), and 59 million were found at poly. Tachyon analysis of the final reticle layout found weak margin sites distinct from those sites repaired by rules-based corrections. For the active layer more than 75% of the sites corrected by rules would have printed without a defect indicating that most rulesbased cleanups degrade the lithographic pattern. Some sites were missed by the rules based cleanups due to either bugs in the DRC software or gaps in the rules table. In the end dramatic changes to the reticle prevented catastrophic lithography errors, but this method is far too blunt. A more subtle model-based procedure is needed changing only those sites which have unsatisfactory lithographic margin.
Molecular dynamics simulation studies of novel β-lactamase inhibitor.
Ul Haq, Farhan; Abro, Asma; Raza, Saad; Liedl, Klaus R; Azam, Syed Sikander
2017-06-01
New Delhi Metallo-β-Lactamase-1 (NDM-1) has drawn great attention due to its diverse antibiotic resistant activity. It can hydrolyze almost all clinically available β-lactam antibiotics. To inhibit the activity of NDM-1 a new strategy is proposed using computational methods. Molecular dynamics (MD) simulations are used to analyze the molecular interactions between selected inhibitor candidates and NDM-1 structure. The enzyme-ligand complex is subject to binding free energy calculations using MM(PB/GB)SA methods. The role of each residue of the active site contributing in ligand binding affinity is explored using energy decomposition analysis. Furthermore, a hydrogen bonding network between ligand and enzyme active site is observed and key residues are identified ensuring that the ligand stays inside the active site and maintains its movement towards the active site pocket. A production run of 150ns is carried out and results are analyzed using root mean square deviation (RMSD), root mean square fluctuation (RMSF), and radius of gyration (Rg) to explain the stability of enzyme ligand complex. Important active site residue e.g. PHE70, VAL73, TRP93, HIS122, GLN123, ASP124, HIS189, LYS216, CYS208, LYS211, ALA215, HIS250, and SER251 were observed to be involved in ligand attachemet inside the active site pocket, hence depicting its inhibitor potential. Hydrogen bonds involved in structural stability are analyzed through radial distribution function (RDF) and contribution of important residues involved in ligand movement is explained using a novel analytical tool, axial frequency distribution (AFD) to observe the role of important hydrogen bonding partners between ligand atoms and active site residues. Copyright © 2017 Elsevier Inc. All rights reserved.
Mhashal, Anil R; Choudhury, Chandan Kumar; Roy, Sudip
2016-03-01
Helicases are enzymes that unwind double-stranded DNA (dsDNA) into its single-stranded components. It is important to understand the binding and unbinding of ATP from the active sites of helicases, as this knowledge can be used to elucidate the functionality of helicases during the unwinding of dsDNA. In this work, we investigated the unbinding of ATP and its effect on the active-site residues of the helicase PcrA using molecular dynamic simulations. To mimic the unbinding process of ATP from the active site of the helicase, we simulated the application of an external force that pulls ATP from the active site and computed the free-energy change during this process. We estimated an energy cost of ~85 kJ/mol for the transformation of the helicase from the ATP-bound state (1QHH) to the ATP-free state (1PJR). Unbinding led to conformational changes in the residues of the protein at the active site. Some of the residues at the ATP-binding site were significantly reoriented when the ATP was pulled. We observed a clear competition between reorientation of the residues and energy stabilization by hydrogen bonds between the ATP and active-site residues. We also checked the flexibility of the PcrA protein using a principal component analysis of domain motion. We found that the ATP-free state of the helicase is more flexible than the ATP-bound state.
Structural and Kinetic Analyses of Macrophage Migration Inhibitory Factor Active Site Interactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Crichlow, G.; Lubetsky, J; Leng, L
Macrophage migration inhibitory factor (MIF) is a secreted protein expressed in numerous cell types that counters the antiinflammatory effects of glucocorticoids and has been implicated in sepsis, cancer, and certain autoimmune diseases. Interestingly, the structure of MIF contains a catalytic site resembling the tautomerase/isomerase sites of microbial enzymes. While bona fide physiological substrates remain unknown, model substrates have been identified. Selected compounds that bind in the tautomerase active site also inhibit biological functions of MIF. It had previously been shown that the acetaminophen metabolite, N-acetyl-p-benzoquinone imine (NAPQI), covalently binds to the active site of MIF. In this study, kinetic datamore » indicate that NAPQI inhibits MIF both covalently and noncovalently. The structure of MIF cocrystallized with NAPQI reveals that the NAPQI has undergone a chemical alteration forming an acetaminophen dimer (bi-APAP) and binds noncovalently to MIF at the mouth of the active site. We also find that the commonly used protease inhibitor, phenylmethylsulfonyl fluoride (PMSF), forms a covalent complex with MIF and inhibits the tautomerase activity. Crystallographic analysis reveals the formation of a stable, novel covalent bond for PMSF between the catalytic nitrogen of the N-terminal proline and the sulfur of PMSF with complete, well-defined electron density in all three active sites of the MIF homotrimer. Conclusions are drawn from the structures of these two MIF-inhibitor complexes regarding the design of novel compounds that may provide more potent reversible and irreversible inhibition of MIF.« less
Combined density functional theory (DFT) and continuum calculations of pKa in carbonic anhydrase.
Jiao, Dian; Rempe, Susan B
2012-07-31
Deprotonation of zinc-bound water in carbonic anhydrase II is the rate-limiting step in the catalysis of carbon dioxide between gas- and water-soluble forms. To understand the factors determining the extent of dissociation, or pK(a), of the zinc-bound water, we apply quantum chemistry calculations to the active site coupled with a continuum model of the surrounding environment. Experimentally determined changes in pK(a) associated with mutations of the active site are well reproduced by this approach. Analysis of the active site structure and charge/dipole values provides evidence that mutations cause changes in both conformation of the active site structure and local polarization, which accounts for the shifts in pK(a). More specifically, the shifts in pK(a) correlate with the dipole moments of the zinc-bound water upon deprotonation. The data further support the conclusion that the distinct pK(a) values found in mutations of the same type, but applied to different sites, result from asymmetric ligation and different electronic environments around the zinc ion.
Tilley, Sloane K; Reif, David M; Fry, Rebecca C
2017-04-01
The Superfund program of the Environmental Protection Agency (EPA) was established in 1980 to address public health concerns posed by toxic substances released into the environment in the United States. Forty-two of the 1328 hazardous waste sites that remain on the Superfund National Priority List are located in the state of North Carolina. We set out to develop a database that contained information on both the prevalence and biological activity of chemicals present at Superfund sites in North Carolina. A chemical characterization tool, the Toxicological Priority Index (ToxPi), was used to rank the biological activity of these chemicals based on their predicted bioavailability, documented associations with biological pathways, and activity in in vitro assays of the ToxCast and Tox21 programs. The ten most prevalent chemicals found at North Carolina Superfund sites were chromium, trichloroethene, lead, tetrachloroethene, arsenic, benzene, manganese, 1,2-dichloroethane, nickel, and barium. For all chemicals found at North Carolina Superfund sites, ToxPi analysis was used to rank their biological activity. Through this data integration, residual pesticides and organic solvents were identified to be some of the most highly-ranking predicted bioactive chemicals. This study provides a novel methodology for creating state or regional databases of biological activity of contaminants at Superfund sites. These data represent a novel integrated profile of the most prevalent chemicals at North Carolina Superfund sites. This information, and the associated methodology, is useful to toxicologists, risk assessors, and the communities living in close proximity to these sites. Copyright © 2016. Published by Elsevier Ltd.
Bruce, James F.
2002-01-01
The Fountain Creek Basin in and around Colorado Springs, Colorado, is affected by various land- and water-use activities. Biological, hydrological, water-quality, and land-use data were collected at 10 sites in the Fountain Creek Basin from April 1998 through April 2001 to provide a baseline characterization of macroinvertebrate communities and habitat conditions for comparison in subsequent studies; and to assess variation in macroinvertebrate community structure relative to habitat quality. Analysis of variance results indicated that instream and riparian variables were not affected by season, but significant differences were found among sites. Nine metrics were used to describe and evaluate macroinvertebrate community structure. Statistical analysis indicated that for six of the nine metrics, significant variability occurred between spring and fall seasons for 60 percent of the sites. Cluster analysis (unweighted pair group method average) using macroinvertebrate presence-absence data showed a well-defined separation between spring and fall samples. Six of the nine metrics had significant spatial variation. Cluster analysis using Sorenson?s Coefficient of Community values computed from macroinvertebrate density (number of organisms per square meter) data showed that macroinvertebrate community structure was more similar among tributary sites than main-stem sites. Canonical correspondence analysis identified a substrate particle-size gradient from site-specific species-abundance data and environmental correlates that decreased the 10 sites to 5 site clusters and their associated taxa.
Molecular dynamics explorations of active site structure in designed and evolved enzymes.
Osuna, Sílvia; Jiménez-Osés, Gonzalo; Noey, Elizabeth L; Houk, K N
2015-04-21
This Account describes the use of molecular dynamics (MD) simulations to reveal how mutations alter the structure and organization of enzyme active sites. As proposed by Pauling about 70 years ago and elaborated by many others since then, biocatalysis is efficient when functional groups in the active site of an enzyme are in optimal positions for transition state stabilization. Changes in mechanism and covalent interactions are often critical parts of enzyme catalysis. We describe our explorations of the dynamical preorganization of active sites using MD, studying the fluctuations between active and inactive conformations normally concealed to static crystallography. MD shows how the various arrangements of active site residues influence the free energy of the transition state and relates the populations of the catalytic conformational ensemble to the enzyme activity. This Account is organized around three case studies from our laboratory. We first describe the importance of dynamics in evaluating a series of computationally designed and experimentally evolved enzymes for the Kemp elimination, a popular subject in the enzyme design field. We find that the dynamics of the active site is influenced not only by the original sequence design and subsequent mutations but also by the nature of the ligand present in the active site. In the second example, we show how microsecond MD has been used to uncover the role of remote mutations in the active site dynamics and catalysis of a transesterase, LovD. This enzyme was evolved by Tang at UCLA and Codexis, Inc., and is a useful commercial catalyst for the production of the drug simvastatin. X-ray analysis of inactive and active mutants did not reveal differences in the active sites, but relatively long time scale MD in solution showed that the active site of the wild-type enzyme preorganizes only upon binding of the acyl carrier protein (ACP) that delivers the natural acyl group to the active site. In the absence of bound ACP, a noncatalytic arrangement of the catalytic triad is dominant. Unnatural truncated substrates are inactive because of the lack of protein-protein interactions provided by the ACP. Directed evolution is able to gradually restore the catalytic organization of the active site by motion of the protein backbone that alters the active site geometry. In the third case, we demonstrate the key role of MD in combination with crystallography to identify the origins of substrate-dependent stereoselectivities in a number of Codexis-engineered ketoreductases, one of which is used commercially for the production of the antibiotic sulopenem. Here, mutations alter the shape of the active site as well as the accessibility of water to different regions of it. Each of these examples reveals something different about how mutations can influence enzyme activity and shows that directed evolution, like natural evolution, can increase catalytic activity in a variety of remarkable and often subtle ways.
An additional substrate binding site in a bacterial phenylalanine hydroxylase
Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan
2014-01-01
Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686
Kuang, Zheng; Ji, Zhicheng
2018-01-01
Abstract Biological processes are usually associated with genome-wide remodeling of transcription driven by transcription factors (TFs). Identifying key TFs and their spatiotemporal binding patterns are indispensable to understanding how dynamic processes are programmed. However, most methods are designed to predict TF binding sites only. We present a computational method, dynamic motif occupancy analysis (DynaMO), to infer important TFs and their spatiotemporal binding activities in dynamic biological processes using chromatin profiling data from multiple biological conditions such as time-course histone modification ChIP-seq data. In the first step, DynaMO predicts TF binding sites with a random forests approach. Next and uniquely, DynaMO infers dynamic TF binding activities at predicted binding sites using their local chromatin profiles from multiple biological conditions. Another landmark of DynaMO is to identify key TFs in a dynamic process using a clustering and enrichment analysis of dynamic TF binding patterns. Application of DynaMO to the yeast ultradian cycle, mouse circadian clock and human neural differentiation exhibits its accuracy and versatility. We anticipate DynaMO will be generally useful for elucidating transcriptional programs in dynamic processes. PMID:29325176
NASA Astrophysics Data System (ADS)
Viswanathan, Venkatasubramanian; Wang, Frank Yi-Fei
2012-07-01
We perform a first-principles based computational analysis of the effect of particle size and support material on the electrocatalytic activity of platinum nanoparticles. Using a mechanism for oxygen reduction that accounts for electric field effects and stabilization from the water layer on the (111) and (100) facets, we show that the model used agrees well with linear sweep voltammetry and rotating ring disk electrode experiments. We find that the per-site activity of the nanoparticle saturates for particles larger than 5 nm and we show that the optimal particle size is in the range of 2.5-3.5 nm, which agrees well with recent experimental work. We examine the effect of support material and show that the perimeter sites on the metal-support interface are important in determining the overall activity of the nanoparticles. We also develop simple geometric estimates for the activity which can be used for determining the activity of other particle shapes and sizes.We perform a first-principles based computational analysis of the effect of particle size and support material on the electrocatalytic activity of platinum nanoparticles. Using a mechanism for oxygen reduction that accounts for electric field effects and stabilization from the water layer on the (111) and (100) facets, we show that the model used agrees well with linear sweep voltammetry and rotating ring disk electrode experiments. We find that the per-site activity of the nanoparticle saturates for particles larger than 5 nm and we show that the optimal particle size is in the range of 2.5-3.5 nm, which agrees well with recent experimental work. We examine the effect of support material and show that the perimeter sites on the metal-support interface are important in determining the overall activity of the nanoparticles. We also develop simple geometric estimates for the activity which can be used for determining the activity of other particle shapes and sizes. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr30572k
SABER: A computational method for identifying active sites for new reactions
Nosrati, Geoffrey R; Houk, K N
2012-01-01
A software suite, SABER (Selection of Active/Binding sites for Enzyme Redesign), has been developed for the analysis of atomic geometries in protein structures, using a geometric hashing algorithm (Barker and Thornton, Bioinformatics 2003;19:1644–1649). SABER is used to explore the Protein Data Bank (PDB) to locate proteins with a specific 3D arrangement of catalytic groups to identify active sites that might be redesigned to catalyze new reactions. As a proof-of-principle test, SABER was used to identify enzymes that have the same catalytic group arrangement present in o-succinyl benzoate synthase (OSBS). Among the highest-scoring scaffolds identified by the SABER search for enzymes with the same catalytic group arrangement as OSBS were l-Ala d/l-Glu epimerase (AEE) and muconate lactonizing enzyme II (MLE), both of which have been redesigned to become effective OSBS catalysts, demonstrated by experiments. Next, we used SABER to search for naturally existing active sites in the PDB with catalytic groups similar to those present in the designed Kemp elimination enzyme KE07. From over 2000 geometric matches to the KE07 active site, SABER identified 23 matches that corresponded to residues from known active sites. The best of these matches, with a 0.28 Å catalytic atom RMSD to KE07, was then redesigned to be compatible with the Kemp elimination using RosettaDesign. We also used SABER to search for potential Kemp eliminases using a theozyme predicted to provide a greater rate acceleration than the active site of KE07, and used Rosetta to create a design based on the proteins identified. PMID:22492397
Yang, Jiang-Ke; Zhang, Jing-Jing; Yu, Heng-Yu; Cheng, Jian-Wen; Miao, Li-Hong
2014-02-01
Cellulolytic bacteria in forest soil provide carbon sources to improve the soil fertility and sustain the nutrient balance of the forest ecological system through the decomposition of cellulosic remains. These bacteria can also be utilized for the biological conversion of biomass into renewable biofuels. In this study, the community compositions and activities of cellulolytic bacteria in the soils of forests planted with broad-leaved deciduous (Chang Qing Garden, CQG) and broad-leaved evergreen (Forest Park, FP) trees in Wuhan, China were resolved through restriction fragment length polymorphism (RFLP) and sequencing analysis of the 16S rRNA gene. All of the isolates exhibited 35 RFLP fingerprint patterns and were clustered into six groups at a similarity level of 50 %. The phylogeny analysis based on the 16S rRNA gene sequence revealed that these RFLP groups could be clustered into three phylogenetic groups and further divided into six subgroups at a higher resolution. Group I consists of isolates from Bacillus cereus, Bacillus subtilis complex (I-A) and from Paenibacillus amylolyticus-related complex (I-B) and exhibited the highest cellulase activity among all of the cellulolytic bacteria isolates. Cluster II consists of isolates belonging to Microbacterium testaceum (II-A), Chryseobacterium indoltheticum (II-B), and Flavobacterium pectinovorum and the related complex (II-C). Cluster III consists of isolates belonging to Pseudomonas putida-related species. The community shift with respect to the plant species and the soil properties was evidenced by the phylogenetic composition of the communities. Groups I-A and I-B, which account for 36.0 % of the cellulolytic communities in the CQG site, are the dominant groups (88.4 %) in the FP site. Alternatively, the ratio of the bacteria belonging to group III (P. putida-related isolates) shifted from 28.0 % in CQG to 4.0 % in FP. The soil nutrient analysis revealed that the CQG site planted with deciduous broad-leaved trees has a richer organic nutrient (total organic carbon and total nitrogen) than the FP site planted with evergreen broad-leaved trees. Against this background, the population density and the diversity of cellulolytic bacteria in the CQG site are clearly higher than those in the FP site, and the latter was dominated with high-cellulase-activity Bacillus- and Paenibacillus-related bacteria. The canonical correspondence analysis further indicated that the distribution of these groups is correlated with the FP site, whereas groups II and III are correlated with the organic nutrient-rich CQG site.
NASA Astrophysics Data System (ADS)
Otake, H.; Ohtake, M.; Ishihara, Y.; Masuda, K.; Sato, H.; Inoue, H.; Yamamoto, M.; Hoshino, T.; Wakabayashi, S.; Hashimoto, T.
2018-04-01
JAXA established JAXA Lunar and Planetary Exploration Data Analysis Group (JLPEDA) at 2016. Our group has been analyzing lunar and planetary data for various missions. Here, we introduce one of our activities.
VISMapper: ultra-fast exhaustive cartography of viral insertion sites for gene therapy.
Juanes, José M; Gallego, Asunción; Tárraga, Joaquín; Chaves, Felipe J; Marín-Garcia, Pablo; Medina, Ignacio; Arnau, Vicente; Dopazo, Joaquín
2017-09-20
The possibility of integrating viral vectors to become a persistent part of the host genome makes them a crucial element of clinical gene therapy. However, viral integration has associated risks, such as the unintentional activation of oncogenes that can result in cancer. Therefore, the analysis of integration sites of retroviral vectors is a crucial step in developing safer vectors for therapeutic use. Here we present VISMapper, a vector integration site analysis web server, to analyze next-generation sequencing data for retroviral vector integration sites. VISMapper can be found at: http://vismapper.babelomics.org . Because it uses novel mapping algorithms VISMapper is remarkably faster than previous available programs. It also provides a useful graphical interface to analyze the integration sites found in the genomic context.
Boughton, Berin A; Dobson, Renwick C J; Hutton, Craig A
2012-08-01
The crystal structure of Escherichia coli dihydrodipicolinate synthase with pyruvate and substrate analogue succinic acid semialdehyde condensed with the active site lysine-161 was solved to a resolution of 2.3 Å. Comparative analysis to a previously reported structure both resolves the configuration at the aldol addition center, where the final addition product clearly displays the (S)-configuration, and the final conformation of the adduct within the active site. Direct comparison to two other crystal structures found in the Protein Data Bank, 1YXC, and 3DU0, demonstrates significant similarity between the active site residues of these structures. Copyright © 2012 Wiley Periodicals, Inc.
Enhanced enzyme kinetic stability by increasing rigidity within the active site.
Xie, Yuan; An, Jiao; Yang, Guangyu; Wu, Geng; Zhang, Yong; Cui, Li; Feng, Yan
2014-03-14
Enzyme stability is an important issue for protein engineers. Understanding how rigidity in the active site affects protein kinetic stability will provide new insight into enzyme stabilization. In this study, we demonstrated enhanced kinetic stability of Candida antarctica lipase B (CalB) by mutating the structurally flexible residues within the active site. Six residues within 10 Å of the catalytic Ser(105) residue with a high B factor were selected for iterative saturation mutagenesis. After screening 2200 colonies, we obtained the D223G/L278M mutant, which exhibited a 13-fold increase in half-life at 48 °C and a 12 °C higher T50(15), the temperature at which enzyme activity is reduced to 50% after a 15-min heat treatment. Further characterization showed that global unfolding resistance against both thermal and chemical denaturation also improved. Analysis of the crystal structures of wild-type CalB and the D223G/L278M mutant revealed that the latter formed an extra main chain hydrogen bond network with seven structurally coupled residues within the flexible α10 helix that are primarily involved in forming the active site. Further investigation of the relative B factor profile and molecular dynamics simulation confirmed that the enhanced rigidity decreased fluctuation of the active site residues at high temperature. These results indicate that enhancing the rigidity of the flexible segment within the active site may provide an efficient method for improving enzyme kinetic stability.
McKay, Dennis B; Chang, Cheng; González-Cestari, Tatiana F; McKay, Susan B; El-Hajj, Raed A; Bryant, Darrell L; Zhu, Michael X; Swaan, Peter W; Arason, Kristjan M; Pulipaka, Aravinda B; Orac, Crina M; Bergmeier, Stephen C
2007-05-01
As a novel approach to drug discovery involving neuronal nicotinic acetylcholine receptors (nAChRs), our laboratory targeted nonagonist binding sites (i.e., noncompetitive binding sites, negative allosteric binding sites) located on nAChRs. Cultured bovine adrenal cells were used as neuronal models to investigate interactions of 67 analogs of methyllycaconitine (MLA) on native alpha3beta4* nAChRs. The availability of large numbers of structurally related molecules presents a unique opportunity for the development of pharmacophore models for noncompetitive binding sites. Our MLA analogs inhibited nicotine-mediated functional activation of both native and recombinant alpha3beta4* nAChRs with a wide range of IC(50) values (0.9-115 microM). These analogs had little or no inhibitory effects on agonist binding to native or recombinant nAChRs, supporting noncompetitive inhibitory activity. Based on these data, two highly predictive 3D quantitative structure-activity relationship (comparative molecular field analysis and comparative molecular similarity index analysis) models were generated. These computational models were successfully validated and provided insights into the molecular interactions of MLA analogs with nAChRs. In addition, a pharmacophore model was constructed to analyze and visualize the binding requirements to the analog binding site. The pharmacophore model was subsequently applied to search structurally diverse molecular databases to prospectively identify novel inhibitors. The rapid identification of eight molecules from database mining and our successful demonstration of in vitro inhibitory activity support the utility of these computational models as novel tools for the efficient retrieval of inhibitors. These results demonstrate the effectiveness of computational modeling and pharmacophore development, which may lead to the identification of new therapeutic drugs that target novel sites on nAChRs.
Kuang, Yuan-wen; Zhou, Guo-yi; Wen, Da-zhi; Li, Jiong; Sun, Fang-fang
2011-09-01
Concentrations of polycyclic aromatic hydrocarbons (PAHs) were examined and potential sources of PAHs were identified from the dated tree-rings of Masson pine (Pinus massoniana L.) near two industrial sites (Danshuikeng, DSK and Xiqiaoshan, XQS) in the Pearl River Delta of south China. Total concentrations of PAHs (∑PAHs) were revealed with similar patterns of temporal trends in the tree-rings at both sites, suggesting tree-rings recorded the historical variation in atmospheric PAHs. The differences of individual PAHs and of ∑PAHs detected in the tree-rings between the two sites reflected the historical differences of airborne PAHs. Regional changes in industrial activities might contribute to the site-specific and period-specific patterns of the tree-ring PAHs. The diagnostic PAH ratios of Ant/(Ant + PA), FL/(FL + Pyr), and BaA/(BaA + Chr)) revealed that PAHs in the tree-rings at both sites mainly stemmed from the combustion process (pyrogenic sources). Principal component analysis further confirmed that wood burning, coal combustion, diesel, and gasoline-powered vehicular emissions were the dominant contributors of PAHs sources at DSK, while diesel combustion, gasoline and natural gas combustion, and incomplete coal combustion were responsible for the main origins of PAHs at XQS. Tree-ring analysis of PAHs was indicative of PAHs from a mixture of sources of combustion, thus minimizing the bias of short-term active air sampling.
Sugrue, Elena; Carr, Paul D; Scott, Colin; Jackson, Colin J
2016-11-15
The desolvation of ionizable residues in the active sites of enzymes and the subsequent effects on catalysis and thermostability have been studied in model systems, yet little about how enzymes can naturally evolve to include active sites with highly reactive and desolvated charges is known. Variants of triazine hydrolase (TrzN) with significant differences in their active sites have been isolated from different bacterial strains: TrzN from Nocardioides sp. strain MTD22 contains a catalytic glutamate residue (Glu241) that is surrounded by hydrophobic and aromatic second-shell residues (Pro214 and Tyr215), whereas TrzN from Nocardioides sp. strain AN3 has a noncatalytic glutamine residue (Gln241) at an equivalent position, surrounded by hydrophilic residues (Thr214 and His215). To understand how and why these variants have evolved, a series of TrzN mutants were generated and characterized. These results show that desolvation by second-shell residues increases the pK a of Glu241, allowing it to act as a general acid at neutral pH. However, significant thermostability trade-offs are required to incorporate the ionizable Glu241 in the active site and to then enclose it in a hydrophobic microenvironment. Analysis of high-resolution crystal structures shows that there are almost no structural changes to the overall configuration of the active site due to these mutations, suggesting that the changes in activity and thermostability are purely based on the altered electrostatics. The natural evolution of these enzyme isoforms provides a unique system in which to study the fundamental process of charged residue desolvation in enzyme catalysis and its relative contribution to the creation and evolution of an enzyme active site.
Pozo, P; Valenzuela, M A; Melej, C; Zaldívar, M; Puente, J; Martínez, B; Gamonal, J
2005-06-01
The aim of this work was to improve the assessment of the periodontal disease status through measurements of extracellular matrix metalloproteinases (MMPs) and their tissular inhibitors (TIMPs) in the gingival crevicular fluid from patients diagnosed with chronic periodontitis. Gingival crevicular fluid samples from patients (n = 13) were taken from 60 sites initially, and from 51 and 41 sites, respectively, 3 and 6 months after scaling and root planing. Gingival crevicular fluid samples were also taken from healthy subjects (n = 11, 24 sites). The presence of MMP-9 and MMP-8 was assessed by zymography and immunowestern blotting, respectively. The actual MMP activity (gelatinase and collagenase) was measured using the fluorogenic substrate assay. TIMP-1 and -2 levels were measured by immunodot blot. The fluorogenic substrate assay determinations showed higher MMP activity in sites with probing depth > or = 4 mm, with significant reduction post-treatment. Gelatinase activity followed by zymography consisted mainly of MMP-9. A different pattern of MMP-8 in control and patient sites was found. Controls only showed species of a partially active form (69 kDa), whereas patient sites showed a high frequency of the active form (56 kDa), and in some cases the latent form (85 kDa) was also observed. The active form reduced its frequency in sites with probing depth > or = 4 mm. TIMP-1 and -2 levels in patients were significantly lower than in controls, and after treatment the recovery of TIMP-1 level similar to control was observed. Significant correlations between the severity of the periodontal disease and the actual MMP activity, the active form of MMP-8 and the low level of both TIMP-1 and TIMP-2 were found.
Qian, M.; Haser, R.; Payan, F.
1995-01-01
The X-ray structure analysis of a crystal of pig pancreatic alpha-amylase (PPA, EC 3.2.1.1.) that was soaked with the substrate maltopentaose showed electron density corresponding to two independent carbohydrate recognition sites on the surface of the molecule. Both binding sites are distinct from the active site described in detail in our previous high-resolution study of a complex between PPA and a carbohydrate inhibitor (Qian M, Buisson G, Duée E, Haser H, Payan F, 1994, Biochemistry 33:6284-6294). One of the binding sites previously identified in a 5-A-resolution electron density map, lies at a distance of 20 A from the active site cleft and can accommodate two glucose units. The second affinity site for sugar units is located close to the calcium binding site. The crystal structure of the maltopentaose complex was refined at 2.1 A resolution, to an R-factor of 17.5%, with an RMS deviation in bond distances of 0.007 A. The model includes all 496 residues of the enzyme, 1 calcium ion, 1 chloride ion, 425 water molecules, and 3 bound sugar rings. The binding sites are characterized and described in detail. The present complex structure provides the evidence of an increased stability of the structure upon interaction with the substrate and allows identification of an N-terminal pyrrolidonecarboxylic acid in PPA. PMID:7613472
Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy
2011-01-01
During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254
Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy
2011-01-14
During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.
USDA-ARS?s Scientific Manuscript database
Matrix morphology and surface polarity effects were investigated for Candida antarctica lipase B immobilization. Measurements of the amount of lipase immobilized (bicinchoninic acid method) and the catalyst’s tributyrin hydrolysis activity, coupled with a determination of the lipase’s functional fr...
This Multi-Site QAPP presents the organization, data quality objectives (DQOs), a set of anticipated activities, sample analysis, data handling and specific Quality Assurance/Quality Control (QA/QC) procedures associated with Studies done in EPA Region 5
DOE Office of Scientific and Technical Information (OSTI.GOV)
L.C. Hulstrom
2010-09-28
This report documents field activity associated with the collection, preparation, and shipment of fish samples. The purpose of the report is to describe the sampling locations, identify samples collected, and describe any modifications and additions made to the sampling and analysis plan.
Based on assessments of increased risk of terrorist/criminal activity, EPA and DOJ have issued a rule that allows public access to OCA information in ways that are designed to minimize likelihood of chemical accidents and public harm.
Varley, Adam; Tyler, Andrew; Smith, Leslie; Dale, Paul; Davies, Mike
2016-03-01
Radium ((226)Ra) contamination derived from military, industrial, and pharmaceutical products can be found at a number of historical sites across the world posing a risk to human health. The analysis of spectral data derived using gamma-ray spectrometry can offer a powerful tool to rapidly estimate and map the activity, depth, and lateral distribution of (226)Ra contamination covering an extensive area. Subsequently, reliable risk assessments can be developed for individual sites in a fraction of the timeframe compared to traditional labour-intensive sampling techniques: for example soil coring. However, local heterogeneity of the natural background, statistical counting uncertainty, and non-linear source response are confounding problems associated with gamma-ray spectral analysis. This is particularly challenging, when attempting to deal with enhanced concentrations of a naturally occurring radionuclide such as (226)Ra. As a result, conventional surveys tend to attribute the highest activities to the largest total signal received by a detector (Gross counts): an assumption that tends to neglect higher activities at depth. To overcome these limitations, a methodology was developed making use of Monte Carlo simulations, Principal Component Analysis and Machine Learning based algorithms to derive depth and activity estimates for (226)Ra contamination. The approach was applied on spectra taken using two gamma-ray detectors (Lanthanum Bromide and Sodium Iodide), with the aim of identifying an optimised combination of detector and spectral processing routine. It was confirmed that, through a combination of Neural Networks and Lanthanum Bromide, the most accurate depth and activity estimates could be found. The advantage of the method was demonstrated by mapping depth and activity estimates at a case study site in Scotland. There the method identified significantly higher activity (<3 Bq g(-1)) occurring at depth (>0.4m), that conventional gross counting algorithms failed to identify. It was concluded that the method could easily be employed to identify areas of high activity potentially occurring at depth, prior to intrusive investigation using conventional sampling techniques. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Effects of industrial and investigator disturbance on Arctic-nesting geese
Meixell, Brandt W.; Flint, Paul L.
2017-01-01
Oil and gas development on the Arctic Coastal Plain (ACP) of Alaska, USA may have effects on Arctic-nesting birds. To estimate effects of industrial activity and investigator disturbance on avian productivity, we monitored nests of greater white-fronted geese (Anser albifrons) with digital cameras and periodic nest visits during 2013–2014 at 2 sites on the ACP. A disturbed site was adjacent to human-made infrastructure and industrial clean-up activities initiated at the onset of the study and a control site was >2 km from sources of industrial disturbance. We assessed variation in estimates of incubation constancy, nest survival, and predator behavior relative to site, year, and distance from industrial activity using nest photographs obtained at 1-minute intervals. We compared analysis of hourly nest survival informed by intensive monitoring with cameras to analysis of daily nest survival informed by traditional nest visit data obtained at intervals of 5–7 days to assess how method and time scale of sampling affect ecological inference. Geese in both sites exhibited high levels of nest attendance and initiated incubation breaks less than once per day. Observer-caused incubation breaks associated with nest visits ( = 37.8 min) were longer than other types of incubation breaks ( = 8.7 min), demonstrating a differential response by nesting geese to direct human encroachment versus indirect vehicular and aircraft traffic. During both years, geese were absent from nests more frequently in the disturbed ( = 0.9 breaks/day) than control ( = 0.6 breaks/day) site, and this break frequency was slightly higher for nests closer to industrial activity. In the year with high rates of depredation, nest survival was positively related to distance from industrial activity and abandoned infrastructure, consistent with predictions of industry-caused effects. This relationship, however, was not evident in the year with reduced predation pressure, likely because of annual variation in arctic fox (Vulpes lagopus) behavior. Analysis of nest survival probability informed by camera data allowed for detection of detailed patterns of variation that were not supported when using only visit data for the same nests. Observer visits were responsible for reductions of 7–35% in nest survival probability, highlighting the importance of minimizing, and controlling for, observer effects in studies of avian productivity. Indirect vehicular and aircraft disturbance posed less risk to nest survival than direct encroachment by observers at nest sites. Therefore, effects of industrial activities on avian productivity in the Arctic can be minimized through practices that limit direct encounters with nests.
Structure of Thermotoga maritima Stationary Phase Survival Protein SurE: A Novel Acid Phosphatase
Zhang, R.-G.; Skarina, T.; Katz, J.E.; Beasley, S.; Khachatryan, A.; Vyas, S.; Arrowsmith, C.H.; Clarke, S.; Edwards, A.; Joachimiak, A.; Savchenko, A.
2009-01-01
Summary Background The rpoS, nlpD, pcm, and surE genes are among many whose expression is induced during the stationary phase of bacterial growth. rpoS codes for the stationary-phase RNA polymerase σ subunit, and nlpD codes for a lipoprotein. The pcm gene product repairs damaged proteins by converting the atypical isoaspartyl residues back to L-aspartyls. The physiological and biochemical functions of surE are unknown, but its importance in stress is supported by the duplication of the surE gene in E. coli subjected to high-temperature growth. The pcm and surE genes are highly conserved in bacteria, archaea, and plants. Results The structure of SurE from Thermotoga maritima was determined at 2.0 Å. The SurE monomer is composed of two domains; a conserved N-terminal domain, a Rossman fold, and a C-terminal oligomerization domain, a new fold. Monomers form a dimer that assembles into a tetramer. Biochemical analysis suggests that SurE is an acid phosphatase, with an optimum pH of 5.5–6.2. The active site was identified in the N-terminal domain through analysis of conserved residues. Structure-based site-directed point mutations abolished phosphatase activity. T. maritima SurE intra- and inter-subunit salt bridges were identified that may explain the SurE thermostability. Conclusions The structure of SurE provided information about the protein’s fold, oligomeric state, and active site. The protein possessed magnesium-dependent acid phosphatase activity, but the physiologically relevant substrate(s) remains to be identified. The importance of three of the assigned active site residues in catalysis was confirmed by site-directed mutagenesis. PMID:11709173
Viral replication. Structural basis for RNA replication by the hepatitis C virus polymerase.
Appleby, Todd C; Perry, Jason K; Murakami, Eisuke; Barauskas, Ona; Feng, Joy; Cho, Aesop; Fox, David; Wetmore, Diana R; McGrath, Mary E; Ray, Adrian S; Sofia, Michael J; Swaminathan, S; Edwards, Thomas E
2015-02-13
Nucleotide analog inhibitors have shown clinical success in the treatment of hepatitis C virus (HCV) infection, despite an incomplete mechanistic understanding of NS5B, the viral RNA-dependent RNA polymerase. Here we study the details of HCV RNA replication by determining crystal structures of stalled polymerase ternary complexes with enzymes, RNA templates, RNA primers, incoming nucleotides, and catalytic metal ions during both primed initiation and elongation of RNA synthesis. Our analysis revealed that highly conserved active-site residues in NS5B position the primer for in-line attack on the incoming nucleotide. A β loop and a C-terminal membrane-anchoring linker occlude the active-site cavity in the apo state, retract in the primed initiation assembly to enforce replication of the HCV genome from the 3' terminus, and vacate the active-site cavity during elongation. We investigated the incorporation of nucleotide analog inhibitors, including the clinically active metabolite formed by sofosbuvir, to elucidate key molecular interactions in the active site. Copyright © 2015, American Association for the Advancement of Science.
Zhang, Tao; Wei, Dong-Qing; Chou, Kuo-Chen
2012-03-01
Comparative molecular field analysis (CoMFA) is a widely used 3D-QSAR method by which we can investigate the potential relation between biological activity of compounds and their structural features. In this study, a new application of this approach is presented by combining the molecular modeling with a new developed pharmacophore model specific to CYP1A2 active site. During constructing the model, we used the molecular dynamics simulation and molecular docking method to select the sensible binding conformations for 17 CYP1A2 substrates based on the experimental data. Subsequently, the results obtained via the alignment of binding conformations of substrates were projected onto the active- site residues, upon which a simple blueprint of active site was produced. It was validated by the experimental and computational results that the model did exhibit the high degree of rationality and provide useful insights into the substrate binding. It is anticipated that our approach can be extended to investigate the protein-ligand interactions for many other enzyme-catalyzed systems as well.
He, Yuanyuan; Ford, Michael E.; Zhu, Minghui; ...
2016-04-14
We compared the molecular structures, surface acidity and catalytic activity for NO/NH 3/O 2 SCR of V 2O 5-WO 3/TiO 2 catalysts for two different synthesis methods: co-precipitation of aqueous vanadium and tungsten oxide precursors with TiO(OH) 2 and by incipient wetness impregnation of the aqueous precursors on a reference crystalline TiO 2 support (P25; primarily anatase phase). Bulk analysis by XRD showed that co-precipitation results in small and/or poorly ordered TiO 2(anatase) particles and that VO x and WO x do not form solid solutions with the bulk titania lattice. Surface analysis of the co-precipitated catalyst by High Sensitivity-Lowmore » Energy Ion Scattering (HS-LEIS) confirms that the VO x and WO x are surface segregated for the co-precipitated catalysts. In situ Raman and IR spectroscopy revealed that the vanadium and tungsten oxide components are present as surface mono-oxo O = VO 3 and O = WO 4 sites on the TiO 2 supports. Co-precipitation was shown for the first time to also form new mono-oxo surface VO 4 and WO 4 sites that appear to be anchored at surface defects of the TiO 2 support. IR analysis of chemisorbed ammonia showed the presence of both surface NH 3 * on Lewis acid sites and surface NH 4 +* on Brønsted acid sites. TPSR spectroscopy demonstrated that the specific SCR kinetics was controlled by the redox surface VO 4 species and that the surface kinetics was independent of TiO 2 synthesis method or presence of surface WO 5 sites. SCR reaction studies revealed that the surface WO5 sites possess minimal activity below ~325 °C and their primary function is to increase the adsorption capacity of ammonia. A relationship between the SCR activity and surface acidity was not found. The SCR reaction is controlled by the surface VO 4 sites that initiate the reaction at ~200 °C. The co-precipitated catalysts were always more active than the corresponding impregnated catalysts. Finally, we ascribe the higher activity of the co-precipitated catalysts to the presence of the new surface WO x sites associated surface defects on the TiO 2 support that increase the ammonia adsorption capacity.« less
Testing the applicability of rapid on-site enzymatic activity detection for surface water monitoring
NASA Astrophysics Data System (ADS)
Stadler, Philipp; Vogl, Wolfgang; Juri, Koschelnik; Markus, Epp; Maximilian, Lackner; Markus, Oismüller; Monika, Kumpan; Peter, Strauss; Regina, Sommer; Gabriela, Ryzinska-Paier; Farnleitner Andreas, H.; Matthias, Zessner
2015-04-01
On-site detection of enzymatic activities has been suggested as a rapid surrogate for microbiological pollution monitoring of water resources (e.g. using glucuronidases, galactosidases, esterases). Due to the possible short measuring intervals enzymatic methods have high potential as near-real time water quality monitoring tools. This presentation describes results from a long termed field test. For twelve months, two ColiMinder devices (Vienna Water Monitoring, Austria) for on-site determination of enzymatic activity were tested for stream water monitoring at the experimental catchment HOAL (Hydrological Open Air Laboratory, Center for Water Resource Systems, Vienna University of Technology). The devices were overall able to follow and reflect the diverse hydrological and microbiological conditions of the monitored stream during the test period. Continuous data in high temporal resolution captured the course of enzymatic activity in stream water during diverse rainfall events. The method also proofed sensitive enough to determine diurnal fluctuations of enzymatic activity in stream water during dry periods. The method was able to capture a seasonal trend of enzymatic activity in stream water that matches the results gained from Colilert18 analysis for E. coli and coliform bacteria of monthly grab samples. Furthermore the comparison of ColiMinder data with measurements gained at the same test site with devices using the same method but having different construction design (BACTcontrol, microLAN) showed consistent measuring results. Comparative analysis showed significant differences between measured enzymatic activity (modified fishman units and pmol/min/100ml) and cultivation based analyses (most probable number, colony forming unit). Methods of enzymatic activity measures are capable to detect ideally the enzymatic activity caused by all active target bacteria members, including VBNC (viable but nonculturable) while cultivation based methods cannot detect VBNC bacteria. Therefore the applicability of on-site enzymatic activity determination as a direct surrogate or proxy parameter for microbiological standard assays and quantification of fecal indicator bacteria (FIB) concentration could not be approved and further research in this field is necessary. Presently we conclude that rapid on-site detection of enzymatic activity is applicable for surface water monitoring and that it constitutes a complementary on-site monitoring parameter with high potential. Selection of the type of measured enzymatic activities has to be done on a catchment-specific basis and further work is needed to learn more about its detailed information characteristics in different habitats. The accomplishment of this method detecting continuous data of enzymatic activity in high temporal resolution caused by a target bacterial member is on the way of becoming a powerful tool for water quality monitoring, health related water quality- and early warning requirements.
DSOD Procedures for Seismic Hazard Analysis
NASA Astrophysics Data System (ADS)
Howard, J. K.; Fraser, W. A.
2005-12-01
DSOD, which has jurisdiction over more than 1200 dams in California, routinely evaluates their dynamic stability using seismic shaking input ranging from simple pseudostatic coefficients to spectrally matched earthquake time histories. Our seismic hazard assessments assume maximum earthquake scenarios of nearest active and conditionally active seismic sources. Multiple earthquake scenarios may be evaluated depending on sensitivity of the design analysis (e.g., to certain spectral amplitudes, duration of shaking). Active sources are defined as those with evidence of movement within the last 35,000 years. Conditionally active sources are those with reasonable expectation of activity, which are treated as active until demonstrated otherwise. The Division's Geology Branch develops seismic hazard estimates using spectral attenuation formulas applicable to California. The formulas were selected, in part, to achieve a site response model similar to the 2000 IBC's for rock, soft rock, and stiff soil sites. The level of dynamic loading used in the stability analysis (50th, 67th, or 84th percentile ground shaking estimates) is determined using a matrix that considers consequence of dam failure and fault slip rate. We account for near-source directivity amplification along such faults by adjusting target response spectra and developing appropriate design earthquakes for analysis of structures sensitive to long-period motion. Based on in-house studies, the orientation of the dam analysis section relative to the fault-normal direction is considered for strike-slip earthquakes, but directivity amplification is assumed in any orientation for dip-slip earthquakes. We do not have probabilistic standards, but we evaluate the probability of our ground shaking estimates using hazard curves constructed from the USGS Interactive De-Aggregation website. Typically, return periods for our design loads exceed 1000 years. Excessive return periods may warrant a lower design load. Minimum shaking levels are provided for sites far from active faulting. Our procedures and standards are presented at the DSOD website http://damsafety.water.ca.gov/. We review our methods and tools periodically under the guidance of our Consulting Board for Earthquake Analysis (and expect to make changes pending NGA completion), mindful that frequent procedural changes can interrupt design evaluations.
Phosphorylation Regulates myo-Inositol-3-phosphate Synthase
Deranieh, Rania M.; He, Quan; Caruso, Joseph A.; Greenberg, Miriam L.
2013-01-01
myo-Inositol-3-phosphate synthase (MIPS) plays a crucial role in inositol homeostasis. Transcription of the coding gene INO1 is highly regulated. However, regulation of the enzyme is not well defined. We previously showed that MIPS is indirectly inhibited by valproate, suggesting that the enzyme is post-translationally regulated. Using 32Pi labeling and phosphoamino acid analysis, we show that yeast MIPS is a phosphoprotein. Mass spectrometry analysis identified five phosphosites, three of which are conserved in the human MIPS. Analysis of phosphorylation-deficient and phosphomimetic site mutants indicated that the three conserved sites in yeast (Ser-184, Ser-296, and Ser-374) and humans (Ser-177, Ser-279, and Ser-357) affect MIPS activity. Both S296A and S296D yeast mutants and S177A and S177D human mutants exhibited decreased enzymatic activity, suggesting that a serine residue is critical at that location. The phosphomimetic mutations S184D (human S279D) and S374D (human S357D) but not the phosphodeficient mutations decreased activity, suggesting that phosphorylation of these two sites is inhibitory. The double mutation S184A/S374A caused an increase in MIPS activity, conferred a growth advantage, and partially rescued sensitivity to valproate. Our findings identify a novel mechanism of regulation of inositol synthesis by phosphorylation of MIPS. PMID:23902760
Extractive waste management: A risk analysis approach.
Mehta, Neha; Dino, Giovanna Antonella; Ajmone-Marsan, Franco; Lasagna, Manuela; Romè, Chiara; De Luca, Domenico Antonio
2018-05-01
Abandoned mine sites continue to present serious environmental hazards because the heavy metals associated with extractive waste are continuously released into the environment, where they threaten human life and the environment. Remediating and securing extractive waste are complex, lengthy and costly processes. Thus, in most European countries, a site is considered for intervention when it poses a risk to human health and the surrounding environment. As a consequence, risk analysis presents a viable decisional approach towards the management of extractive waste. To evaluate the effects posed by extractive waste to human health and groundwater, a risk analysis approach was used for an abandoned nickel extraction site in Campello Monti in North Italy. This site is located in the Southern Italian Alps. The area consists of large and voluminous mafic rocks intruded by mantle peridotite. The mining activities in this area have generated extractive waste. A risk analysis of the site was performed using Risk Based Corrective Action (RBCA) guidelines, considering the properties of extractive waste and water for the properties of environmental matrices. The results showed the presence of carcinogenic risk due to arsenic and risks to groundwater due to nickel. The results of the risk analysis form a basic understanding of the current situation at the site, which is affected by extractive waste. Copyright © 2017 Elsevier B.V. All rights reserved.
Preconcentration for Improved Long-term Monitoring of Contaminants in Groundwater
2014-04-10
Johnson of the US Army Corps of Engineers, Tulsa District (recently retired) provided sites in northeastern Oklahoma for field trials as well as...neighboring wildlife is also a concern. Long-term monitoring of sites undergoing remediation as well as sites that may eventually require cleanup is...Activated charcoal and peroxide cleanup steps offer potential avenues for addressing this problem. The materials may be of value in isotopic analysis of
The HTLV-I tax protein transcriptionally modulates OX40 antigen expression.
Pankow, R; Dürkop, H; Latza, U; Krause, H; Kunzendorf, U; Pohl, T; Bulfone-Paus, S
2000-07-01
OX40 is a member of the TNF receptor family, expressed on activated T cells. It is the only costimulatory T cell molecule known to be specifically up-regulated in human T cell leukemia virus type-I (HTLV-I)-producing cells. In a T cell line, OX40 surface expression was shown to be induced by HTLV-I Tax alone. To understand molecular mechanisms of OX40 gene regulation and modulation by HTLV-I Tax, we have cloned the human OX40 gene and analyzed its 5'-flanking region. By reporter gene analysis with progressive 5' deletions from nucleotides -1259 to -64, we have defined a 157-bp DNA fragment as a minimal promoter for constitutive expression. In addition, we show that in the OX40+ cell line, Co, Tax is able to further increase OX40 surface expression. Up-regulation of OX40 promoter activity by Tax requires two upstream NF-kappaB sites, which are not active in the constitutive OX40 expression. Their deletion abrogates Tax responsiveness in reporter gene analysis. The site-directed mutagenesis of each NF-kappaB site demonstrates that cooperative NF-kappaB binding is a prerequisite for Tax-directed activity as neither site alone is sufficient for a full Tax responsiveness of the OX40 promoter. Upon Tax expression, both sites bind p65 and c-Rel. These data provide new insight into the direct regulation of OX40 by Tax and add to our understanding of the possible role of the OX40/OX40 ligand system in the proliferation of HTLV-I+ T cells.
NASA Astrophysics Data System (ADS)
Valverde, Viviana; Mothes, Patricia; Andrade, Daniel
2014-05-01
A mineralogical analysis was done on 70 volcanic ashes; 9 corresponding to proximal samples of seven volcanoes: Cotopaxi (4500 yBP), Guagua Pichincha (3300 yBP, 1000 yBP and 1660 yAD), Cuicocha (3100 yBP), Pululahua (2400 yBP), Ninahuilca (2350 yBP and 4600 yBP) and 61 to distal ashes collected at eight archaeological sites in the Coastal, Sierra and Amazon regions of Ecuador. Cultural vestiges are from Pre-ceramic, Formative, Regional Development and Integration periods, with the exception of a site denominated Hacienda Malqui, which also has Inca vestiges. The sampling process was done in collaboration with various archaeologists in 2011-2013. The volcanic ashes were washed, dried and divided in order to obtain a representative fraction and their later analysis with binocular microscope. The microscope analysis allowed determination of the characteristics of each component of volcanic ash. These main elements are: pumice fragments, minerals, volcanic glass, lithics and exogenous material (non volcanic). The petrographic analysis of distal volcanic ash layers at each archaeological site was correlated by their components and characteristics with proximal volcanic ashes of source volcanoes. Some correlations permitted obtaining a relative age for the layers of distal volcanic ash in the archaeological sites. The petrographic analysis showed a correlation between the archaeological sites of Las Mercedes - Los Naranjos, Rumipamba and El Condado (located west of Quito) with the eruptive activity of Guagua Pichincha volcano (3300 yBP, 1000 yBP and 1660 yAD) and Pululahua volcano (2400 yBP). Also, a correlation with eruptive activity of Ninahuilca (2350 yBP), Cotopaxi (4500 yBP) and Quilotoa (800 yBP) volcanoes at Hda. Malqui (60 km west of Latacunga) was provided by mineralogy of the respective ashes expulsed by these volcanoes. The ash layers at Cuyuja (50 km east of Quito) are mostly superficial; they are associated with Quilotoa's 800 yBP plinian. Finally at the Huapula and Pablo VI sites (in the western Amazon region of Ecuador), the reworked ashes are predominantly of Sangay volcano (in permanent eruptive activity since 1628). Finally, the work shared between archaeologists and volcanologists allowed us to discover more deposits of volcanic ashes at archaeological sites. These layers sometimes have more than 30 cm thickness in distal regions, such as the thick ash layer left by Pululahua's 2400 yBP eruption, a fact which helps us to comprehend the impact of volcanoes on past cultures.
Differential Sox10 Genomic Occupancy in Myelinating Glia
Lopez-Anido, Camila; Sun, Guannan; Koenning, Matthias; Srinivasan, Rajini; Hung, Holly A.; Emery, Ben; Keles, Sunduz; Svaren, John
2015-01-01
Myelin is formed by specialized myelinating glia: oligodendrocytes and Schwann cells in the central and peripheral nervous systems, respectively. While there are distinct developmental aspects and regulatory pathways in these two cell types, myelination in both systems requires the transcriptional activator Sox10. Sox10 interacts with cell type-specific transcription factors at some loci to induce myelin gene expression, but it is largely unknown how Sox10 transcriptional networks globally compare between oligodendrocytes and Schwann cells. We used in vivo ChIP-Seq analysis of spinal cord and peripheral nerve (sciatic nerve) to identify unique and shared Sox10 binding sites and assess their correlation with active enhancers and transcriptional profiles in oligodendrocytes and Schwann cells. Sox10 binding sites overlap with active enhancers and critical cell type-specific regulators of myelination, such as Olig2 and Myrf in oligodendrocytes, and Egr2/Krox20 in Schwann cells. Sox10 sites also associate with genes critical for myelination in both oligodendrocytes and Schwann cells, and are found within super-enhancers previously defined in brain. In Schwann cells, Sox10 sites contain binding motifs of putative partners in the Sp/Klf, Tead, and nuclear receptor protein families. Specifically, siRNA analysis of nuclear receptors Nr2f1 and Nr2f2 revealed downregulation of myelin genes Mbp and Ndrg1 in primary Schwann cells. Our analysis highlights different mechanisms that establish cell type-specific genomic occupancy of Sox10, which reflects the unique characteristics of oligodendrocyte and Schwann cell differentiation. PMID:25974668
e-Ana and e-Mia: A Content Analysis of Pro–Eating Disorder Web Sites
Schenk, Summer; Wilson, Jenny L.; Peebles, Rebecka
2010-01-01
Objectives. The Internet offers Web sites that describe, endorse, and support eating disorders. We examined the features of pro–eating disorder Web sites and the messages to which users may be exposed. Methods. We conducted a systematic content analysis of 180 active Web sites, noting site logistics, site accessories, “thinspiration” material (images and prose intended to inspire weight loss), tips and tricks, recovery, themes, and perceived harm. Results. Practically all (91%) of the Web sites were open to the public, and most (79%) had interactive features. A large majority (84%) offered pro-anorexia content, and 64% provided pro-bulimia content. Few sites focused on eating disorders as a lifestyle choice. Thinspiration material appeared on 85% of the sites, and 83% provided overt suggestions on how to engage in eating-disordered behaviors. Thirty-eight percent of the sites included recovery-oriented information or links. Common themes were success, control, perfection, and solidarity. Conclusions. Pro–eating disorder Web sites present graphic material to encourage, support, and motivate site users to continue their efforts with anorexia and bulimia. Continued monitoring will offer a valuable foundation to build a better understanding of the effects of these sites on their users. PMID:20558807
Flammarion, P; Noury, P; Garric, J
2002-01-01
Biomarkers are early warning systems of the exposure of aquatic organisms to pollutants. Among them, the measurement of the cholinesterase (ChE) activities in fish muscle is a biomarker of the exposure to organophosphosphates and carbamates pesticides. As such it has been used in numerous field studies both in marine and continental waters. Cyprinids (chub, Leuciscus cephalus) were sampled in river sites (France) in relatively clean and polluted areas. We performed the statistical analysis of the ChE activities and we generally observed a statistical relationship between ChE activities and fish length, the larger fish having the lower ChE activities. We concluded that the great majority of the significant differences in ChE activities between sites could be due in fact to differences in fish length between field samples. We stress the importance of taking into account the fish length whenever differences in ChE levels between field sites must be interpreted.
Predicting Catalytic Activity of Nanoparticles by a DFT-Aided Machine-Learning Algorithm.
Jinnouchi, Ryosuke; Asahi, Ryoji
2017-09-07
Catalytic activities are often dominated by a few specific surface sites, and designing active sites is the key to realize high-performance heterogeneous catalysts. The great triumphs of modern surface science lead to reproduce catalytic reaction rates by modeling the arrangement of surface atoms with well-defined single-crystal surfaces. However, this method has limitations in the case for highly inhomogeneous atomic configurations such as on alloy nanoparticles with atomic-scale defects, where the arrangement cannot be decomposed into single crystals. Here, we propose a universal machine-learning scheme using a local similarity kernel, which allows interrogation of catalytic activities based on local atomic configurations. We then apply it to direct NO decomposition on RhAu alloy nanoparticles. The proposed method can efficiently predict energetics of catalytic reactions on nanoparticles using DFT data on single crystals, and its combination with kinetic analysis can provide detailed information on structures of active sites and size- and composition-dependent catalytic activities.
Konrad, Christopher; Sevier, Maria
2014-01-01
Geospatial information for the active streamflow gaging network in the Puget Sound Basin was compiled to support regional monitoring of stormwater effects to small streams. The compilation includes drainage area boundaries and physiographic and land use attributes that affect hydrologic processes. Three types of boundaries were used to tabulate attributes: Puget Sound Watershed Characterization analysis units (AU); the drainage area of active streamflow gages; and the catchments of Regional Stream Monitoring Program (RSMP) sites. The active streamflow gaging network generally includes sites that represent the ranges of attributes for lowland AUs, although there are few sites with low elevations (less than 60 meters), low precipitation (less than 1 meter year), or high stream density (greater than 5 kilometers per square kilometers). The active streamflow gaging network can serve to provide streamflow information in some AUs and RSMP sites, particularly where the streamflow gage measures streamflow generated from a part of the AU or that drains to the RSMP site, and that part of the AU or RSMP site is a significant fraction of the drainage area of the streamgage. The maximum fraction of each AU or RSMP catchment upstream of a streamflow gage and the maximum fraction of any one gaged basin in an AU or RSMP along with corresponding codes are provided in the attribute tables.
Balasuriya, Nileeka; Kunkel, Maya T; Liu, Xuguang; Biggar, Kyle K; Li, Shawn S-C; Newton, Alexandra C; O'Donoghue, Patrick
2018-05-17
The proto-oncogene Akt/protein kinase B (PKB) is a pivotal signal transducer for growth and survival. Growth factor stimulation leads to Akt phosphorylation at two regulatory sites (Thr308, Ser473), acutely activating Akt signaling. Delineating the exact role of each regulatory site is, however, technically challenging and has remained elusive. Here, we used genetic code expansion to produce site-specifically phosphorylated Akt1 in order to dissect the contribution of each regulatory site to Akt1 activity. We achieved recombinant production of full length Akt1 containing site-specific pThr and pSer residues for the first time. Our analysis of Akt1 site-specifically phosphorylated at either or both sites revealed that phosphorylation at both sites increases the apparent catalytic rate 1500-fold relative to un-phosphorylated Akt1, an increase attributable primarily to phosphorylation at Thr308. Live imaging of COS7 cells confirmed that phosphorylation of Thr308, but not Ser473, is required for cellular activation of Akt. We found in vitro and in the cell that pThr308 function cannot be mimicked with acidic residues nor could unphosphorylated Thr308 be mimicked by an Ala mutation. An Akt1 variant with pSer308 achieved only partial enzymatic and cellular signaling activity, revealing a critical interaction between the γ-methyl group of pThr308 and Cys310 in the Akt1 active site. Thus, pThr308 is necessary and sufficient to stimulate Akt signaling in cells and the common use of phosphomimetics is not appropriate for studying the biology of Akt signaling. Our data also indicate that pThr308 should be regarded as the primary diagnostic marker of Akt activity. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Tilley, Sloane K.; Reif, David M.; Fry, Rebecca C.
2017-01-01
Background The Superfund program of the Environmental Protection Agency (EPA) was established in 1980 to address public health concerns posed by toxic substances released into the environment in the United States. Forty-two of the 1328 hazardous waste sites that remain on the Superfund National Priority List are located in the state of North Carolina. Methods We set out to develop a database that contained information on both the prevalence and biological activity of chemicals present at Superfund sites in North Carolina. A chemical characterization tool, the Toxicological Priority Index (ToxPi), was used to rank the biological activity of these chemicals based on their predicted bioavailability, documented associations with biological pathways, and activity in in vitro assays of the ToxCast and Tox21 programs. Results The ten most prevalent chemicals found at North Carolina Superfund sites were chromium, trichloroethene, lead, tetrachloroethene, arsenic, benzene, manganese, 1,2-dichloroethane, nickel, and barium. For all chemicals found at North Carolina Superfund sites, ToxPi analysis was used to rank their biological activity. Through this data integration, residual pesticides and organic solvents were identified to be some of the most highly-ranking predicted bioactive chemicals. This study provides a novel methodology for creating state or regional databases of Superfund sites. Conclusions These data represent a novel integrated profile of the most prevalent chemicals at North Carolina Superfund sites. This information, and the associated methodology, is useful to toxicologists, risk assessors, and the communities living in close proximity to these sites. PMID:28153528
ANALYSIS OF 2,3,7,8-TCDD TUMOR PROMOTION ACTIVITY ...
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) has a high estimated cancer potency in animals which has been reasoned to imply that TCDD might be carcinogenic to man. The animal cancer data show that TCDD can act in a solitary manner causing tumors without the participation of other known factors. owever, there exist animal cancer data indicating that TCDD can act as a tumor-promoting compound. This analysis examines which type of carcinogen and which mechanism best characterize TCDD cancer activity. It is suggested that TCDD acts by a hormonal mechanism to cause cancer in solitary manner, at low doses, in two species, and in a number of different organs, including rare sites. These observations in toto characterize TCDD as a complete carcinogen, which by definition encompasses both initiation and promotion carcinogenic activities. This analysis examines which type of carcinogen and which mechanism best characterize TCDD cancer activity. It is suggested that TCDD acts by a hormonal mechanism to cause cancer in solitary manner, at low doses, in two species, and in a number of different organs, including rare sites
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-09-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. © 2015 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
SABER: a computational method for identifying active sites for new reactions.
Nosrati, Geoffrey R; Houk, K N
2012-05-01
A software suite, SABER (Selection of Active/Binding sites for Enzyme Redesign), has been developed for the analysis of atomic geometries in protein structures, using a geometric hashing algorithm (Barker and Thornton, Bioinformatics 2003;19:1644-1649). SABER is used to explore the Protein Data Bank (PDB) to locate proteins with a specific 3D arrangement of catalytic groups to identify active sites that might be redesigned to catalyze new reactions. As a proof-of-principle test, SABER was used to identify enzymes that have the same catalytic group arrangement present in o-succinyl benzoate synthase (OSBS). Among the highest-scoring scaffolds identified by the SABER search for enzymes with the same catalytic group arrangement as OSBS were L-Ala D/L-Glu epimerase (AEE) and muconate lactonizing enzyme II (MLE), both of which have been redesigned to become effective OSBS catalysts, demonstrated by experiments. Next, we used SABER to search for naturally existing active sites in the PDB with catalytic groups similar to those present in the designed Kemp elimination enzyme KE07. From over 2000 geometric matches to the KE07 active site, SABER identified 23 matches that corresponded to residues from known active sites. The best of these matches, with a 0.28 Å catalytic atom RMSD to KE07, was then redesigned to be compatible with the Kemp elimination using RosettaDesign. We also used SABER to search for potential Kemp eliminases using a theozyme predicted to provide a greater rate acceleration than the active site of KE07, and used Rosetta to create a design based on the proteins identified. Copyright © 2012 The Protein Society.
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-01-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. PMID:26073648
Hari, Sanjay B.; Perera, B. Gayani K.; Ranjitkar, Pratistha; Seeliger, Markus A.; Maly, Dustin J.
2013-01-01
Over the last decade, an increasingly diverse array of potent and selective inhibitors that target the ATP-binding sites of protein kinases have been developed. Many of these inhibitors, like the clinically approved drug imatinib (Gleevec), stabilize a specific catalytically inactive ATP-binding site conformation of their kinases targets. Imatinib is notable in that it is highly selective for its kinase target, Abl, over other closely-related tyrosine kinases, like Src. In addition, imatinib is highly sensitive to the phosphorylation state of Abl's activation loop, which is believed to be a general characteristic of all inhibitors that stabilize a similar inactive ATP-binding site conformation. In this report, we perform a systematic analysis of a diverse series of ATP-competitive inhibitors that stabilize a similar inactive ATP-binding site conformation as imatinib with the tyrosine kinases Src and Abl. In contrast to imatinib, many of these inhibitors have very similar potencies against Src and Abl. Furthermore, only a subset of this class of inhibitors is sensitive to the phosphorylation state of the activation loop of these kinases. In attempting to explain this observation, we have uncovered an unexpected correlation between Abl's activation loop and another flexible active site feature, called the phosphate-binding loop (p-loop). These studies shed light on how imatinib is able to obtain its high target selectivity and reveal how the conformational preference of flexible active site regions can vary between closely related kinases. PMID:24106839
Hierarchy within the mammary STAT5-driven Wap super-enhancer.
Shin, Ha Youn; Willi, Michaela; HyunYoo, Kyung; Zeng, Xianke; Wang, Chaochen; Metser, Gil; Hennighausen, Lothar
2016-08-01
Super-enhancers comprise dense transcription factor platforms highly enriched for active chromatin marks. A paucity of functional data led us to investigate the role of super-enhancers in the mammary gland, an organ characterized by exceptional gene regulatory dynamics during pregnancy. ChIP-seq analysis for the master regulator STAT5A, the glucocorticoid receptor, H3K27ac and MED1 identified 440 mammary-specific super-enhancers, half of which were associated with genes activated during pregnancy. We interrogated the Wap super-enhancer, generating mice carrying mutations in STAT5-binding sites within its constituent enhancers. Individually, the most distal site displayed the greatest enhancer activity. However, combinatorial mutation analysis showed that the 1,000-fold induction in gene expression during pregnancy relied on all enhancers. Disabling the binding sites of STAT5, NFIB and ELF5 in the proximal enhancer incapacitated the entire super-enhancer. Altogether, these data suggest a temporal and functional enhancer hierarchy. The identification of mammary-specific super-enhancers and the mechanistic exploration of the Wap locus provide insights into the regulation of cell-type-specific expression of hormone-sensing genes.
Environmental Justice analysis in Hydraulic Fracturing Analysis, June 13, 2011
This planning document describes the quality assurance/quality control activities and technical requirements that will be used during the research study, using an index-based approach to compare a nationally representative set of well sites fractured.
Monteiro, Rose A; Souza, Emanuel M; Geoffrey Yates, M; Steffens, M Berenice R; Pedrosa, Fábio O; Chubatsu, Leda S
2003-02-01
The Herbaspirillum seropedicae NifA protein is responsible for nif gene expression. The C-terminal domain of the H. seropedicae NifA protein, fused to a His-Tag sequence (His-Tag-C-terminal), was over-expressed and purified by metal-affinity chromatography to yield a highly purified and active protein. Band-shift assays showed that the NifA His-Tag-C-terminal bound specifically to the H. seropedicae nifB promoter region in vitro. In vivo analysis showed that this protein inhibited the Central + C-terminal domains of NifA protein from activating the nifH promoter of K. pneumoniae in Escherichia coli, indicating that the protein must be bound to the NifA-binding site (UAS site) at the nifH promoter region to activate transcription. Copyright 2002 Elsevier Science (USA)
Hagiwara, Kyoji; Sato, Hiroki; Inoue, Yoshihisa; Watanabe, Akira; Yoneda, Misako; Ikeda, Fusako; Fujita, Kentaro; Fukuda, Hiroyuki; Takamura, Chizuko; Kozuka-Hata, Hiroko; Oyama, Masaaki; Sugano, Sumio; Ohmi, Shinobu; Kai, Chieko
2008-05-01
We report the first identification of phosphorylation sites of the nucleoprotein (N) of the family Paramyxoviridae. The N protein is known to be the most abundant protein in infected cells; it constructs the N-RNA complex (nucleocapsid) and supports transcription and replication of viral genomic RNA. To determine the role of phosphorylation of the N protein, we expressed the N protein of the HL strain of measles virus (MV) in mammalian cells and purified the nucleocapsid. After separation of the C-terminal region from the core region, phosphorylated amino acids were assayed using MALDI-TOF/TOF and ESI-Q-TOF MS analyses. Two amino acids, S479 and S510, were shown to be phosphorylated by both methods of analysis. Metabolic labeling of the N protein with (32)P demonstrated that these two sites are the major phosphorylated sites within the MV-N protein. In transcriptional analysis using negative-strand minigenomic RNA containing the ORF of the luciferase gene, mutants of each phosphorylation site showed approximately 80% reduction in luciferase activity compared with the wild-type N, suggesting that the phosphorylation of N protein is important in the activation of the transcription of viral mRNA and/or replication of the genome in vivo.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Seon Sook; Lee, Eun Hye; Lee, Kooyeon
2015-04-17
Calcineurin is a calcium/calmodulin-dependent phosphatase that has been implicated in T cell activation through the induction of nuclear factors of activated T cells (NFAT). We have previously suggested that endogenous regulator of calcineurin (RCAN1, also known as DSCR1) is targeted by protein kinase A (PKA) for the control of calcineurin activity. In the present study, we characterized the PKA-mediated phosphorylation site in RCAN1 by mass spectrometric analysis and revealed that PKA directly phosphorylated RCAN1 at the Ser 93. PKA-induced phosphorylation and the increase in the half-life of the RCAN1 protein were prevented by the substitution of Ser 93 with Alamore » (S93A). Furthermore, the PKA-mediated phosphorylation of RCAN1 at Ser 93 potentiated the inhibition of calcineurin-dependent pro-inflammatory cytokine gene expression by RCAN1. Our results suggest the presence of a novel phosphorylation site in RCAN1 and that its phosphorylation influences calcineurin-dependent inflammatory target gene expression. - Highlights: • We identify novel phosphorylation sites in RCAN1 by LC-MS/MS analysis. • PKA-dependent phosphorylation of RCAN1 at Ser 93 inhibits calcineurin-mediated intracellular signaling. • We show the immunosuppressive function of RCAN1 phosphorylation at Ser 93 in suppressing cytokine expression.« less
Molecular dynamics simulations of glycosyltransferase LgtC.
Snajdrová, Lenka; Kulhánek, Petr; Imberty, Anne; Koca, Jaroslav
2004-04-02
Molecular dynamics simulations have been performed on fully solvated alpha-(1-->4)-galactosyltransferase LgtC from Neisseria meningitidis with and without the donor substrate UDP-Gal and in the presence of the manganese ion. The analysis of the trajectories revealed a limited movement in the loop X (residues 75-80) and a larger conformational change in the loop Y (residues 246-251) in the simulation, when UDP-Gal was not present. In this case, the loops X and Y open by almost 10A, exposing the active site to the solvent. The 'hinge region' responsible for the opening is composed of residues 246-247. We have also analyzed the behavior of the manganese ion in the simulations. The coordination number is 6 when UDP-Gal is present and it increases to 7 when it is absent. In the latter case, three water molecules become coordinated to the ion. In both cases, the coordination is very stable implying that the manganese ion is tightly bound in the active site of the enzyme even if UDP-Gal is not present. Further analysis of the structural water molecules location confirmed that the mobility of water molecules in the active site and the accessibility of this site for solvent are higher in the absence of the substrate.
Natural zeolite reactivity towards ozone: the role of compensating cations.
Valdés, Héctor; Alejandro, Serguei; Zaror, Claudio A
2012-08-15
Among indoor pollutants, ozone is recognised to pose a threat to human health. Recently, low cost natural zeolites have been applied as alternative materials for ozone abatement. In this work, the effect of compensating cation content of natural zeolite on ozone removal is studied. A Chilean natural zeolite is used here as starting material. The amount of compensating cations in the zeolite framework was modified by ion exchange using an ammonium sulphate solution (0.1 mol L(-1)). Characterisation of natural and modified zeolites were performed by X-ray powder diffraction (XRD), nitrogen adsorption at 77K, elemental analysis, X-ray fluorescence (XRF), thermogravimetric analysis coupled with mass spectroscopy (TGA-MS), and temperature-programmed desorption of ammonia (NH(3)-TPD). Ozone adsorption and/or decomposition on natural and modified zeolites were studied by diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS). Results show that the zeolite compensating cation content affects ozone interaction with zeolite active sites. Ammonium ion-exchange treatments followed by thermal out-gassing at 823 K, reduces ozone diffusion resistance inside the zeolite framework, increasing ozone abatement on zeolite surface active sites. Weak and strong Lewis acid sites of zeolite surface are identified here as the main active sites responsible of ozone removal. Copyright © 2012 Elsevier B.V. All rights reserved.
Al-Attar, Ghada; De Meyer, Sara; El-Gibaly, Omaima; Michielsen, Kristien; Animosa, Lydia H; Mmari, Kristin
2017-10-01
A gender analysis was conducted to illuminate the key elements of friendships highlighted by early adolescent girls and boys in two sites for the purpose of better understanding the impact of gender norms on adolescent friendships in different contexts. Narrative interviews with early adolescents were conducted in two sites: Assiut, Egypt (n = 37) and Ghent, Belgium (n = 30). The interviews were recorded, transcribed, translated into English, and coded using Atlas.ti for analysis. In both Assiut and Ghent, early adolescents reported some similarities in defining key characteristics of their same-sex friends as well as in the activities they share. However, differences were noticed among boys and girls within each site. In addition, the scope of shared activity was broader in Ghent than in Assiut. In both sites, few opposite-sex friendships were reported. Gender norms influenced choice of friends as well as the type and place of shared activities. Building on knowledge that adolescent friendships guide and reinforce attitudes, beliefs, and behaviors that impact immediate and long-term health, our findings indicate that gender norms inform early adolescent friendships, which may impact healthy development. Copyright © 2017 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Inhibitory Mechanism of Apigenin on α-Glucosidase and Synergy Analysis of Flavonoids.
Zeng, Li; Zhang, Guowen; Lin, Suyun; Gong, Deming
2016-09-21
Inhibition of α-glucosidase activity may suppress postprandial hyperglycemia. The inhibition kinetic analysis showed that apigenin reversibly inhibited α-glucosidase activity with an IC50 value of (10.5 ± 0.05) × 10(-6) mol L(-1), and the inhibition was in a noncompetitive manner through a monophasic kinetic process. The fluorescence quenching and conformational changes determined by fluorescence and circular dichroism were due to the formation of an α-glucosidase-apigenin complex, and the binding was mainly driven by hydrophobic interactions and hydrogen bonding. The molecular simulation showed that apigenin bound to a site close to the active site of α-glucosidase, which may induce the channel closure to prevent the access of substrate, eventually leading to the inhibition of α-glucosidase. Isobolographic analysis of the interaction between myricetin and apigenin or morin showed that both of them exhibited synergistic effects at low concentrations and tended to exhibit additive or antagonistic interaction at high concentrations.
Bomati, Erin K.; Noel, Joseph P.
2005-01-01
We describe the three-dimensional structure of sinapyl alcohol dehydrogenase (SAD) from Populus tremuloides (aspen), a member of the NADP(H)-dependent dehydrogenase family that catalyzes the last reductive step in the formation of monolignols. The active site topology revealed by the crystal structure substantiates kinetic results indicating that SAD maintains highest specificity for the substrate sinapaldehyde. We also report substantial substrate inhibition kinetics for the SAD-catalyzed reduction of hydroxycinnamaldehydes. Although SAD and classical cinnamyl alcohol dehydrogenases (CADs) catalyze the same reaction and share some sequence identity, the active site topology of SAD is strikingly different from that predicted for classical CADs. Kinetic analyses of wild-type SAD and several active site mutants demonstrate the complexity of defining determinants of substrate specificity in these enzymes. These results, along with a phylogenetic analysis, support the inclusion of SAD in a plant alcohol dehydrogenase subfamily that includes cinnamaldehyde and benzaldehyde dehydrogenases. We used the SAD three-dimensional structure to model several of these SAD-like enzymes, and although their active site topologies largely mirror that of SAD, we describe a correlation between substrate specificity and amino acid substitution patterns in their active sites. The SAD structure thus provides a framework for understanding substrate specificity in this family of enzymes and for engineering new enzyme specificities. PMID:15829607
Bomati, Erin K; Noel, Joseph P
2005-05-01
We describe the three-dimensional structure of sinapyl alcohol dehydrogenase (SAD) from Populus tremuloides (aspen), a member of the NADP(H)-dependent dehydrogenase family that catalyzes the last reductive step in the formation of monolignols. The active site topology revealed by the crystal structure substantiates kinetic results indicating that SAD maintains highest specificity for the substrate sinapaldehyde. We also report substantial substrate inhibition kinetics for the SAD-catalyzed reduction of hydroxycinnamaldehydes. Although SAD and classical cinnamyl alcohol dehydrogenases (CADs) catalyze the same reaction and share some sequence identity, the active site topology of SAD is strikingly different from that predicted for classical CADs. Kinetic analyses of wild-type SAD and several active site mutants demonstrate the complexity of defining determinants of substrate specificity in these enzymes. These results, along with a phylogenetic analysis, support the inclusion of SAD in a plant alcohol dehydrogenase subfamily that includes cinnamaldehyde and benzaldehyde dehydrogenases. We used the SAD three-dimensional structure to model several of these SAD-like enzymes, and although their active site topologies largely mirror that of SAD, we describe a correlation between substrate specificity and amino acid substitution patterns in their active sites. The SAD structure thus provides a framework for understanding substrate specificity in this family of enzymes and for engineering new enzyme specificities.
MalWebID-Autodetection and Identification of Malicious Web Hosts Through Live Traffic Analysis
2013-03-01
blogs, video services, and popular social media sites. In December 2000, there were near 361 million Internet users and by the end of December 2012...site (i.e., Porn , Rx/Pharmaceutical, illegal activity, etc.) – propagate or contain viruses, spyware, or other harmful programs, participate in spamming
Surface-Enhanced Raman Spectroscopy of Carbon Nanomembranes from Aromatic Self-Assembled Monolayers.
Zhang, Xianghui; Mainka, Marcel; Paneff, Florian; Hachmeister, Henning; Beyer, André; Gölzhäuser, Armin; Huser, Thomas
2018-02-27
Surface-enhanced Raman scattering spectroscopy (SERS) was employed to investigate the formation of self-assembled monolayers (SAMs) of biphenylthiol, 4'-nitro-1,1'-biphenyl-4-thiol, and p-terphenylthiol on Au surfaces and their structural transformations into carbon nanomembranes (CNMs) induced by electron irradiation. The high sensitivity of SERS allows us to identify two types of Raman scattering in electron-irradiated SAMs: (1) Raman-active sites exhibit similar bands as those of pristine SAMs in the fingerprint spectral region, but with indications of an amorphization process and (2) Raman-inactive sites show almost no Raman-scattering signals, except a very weak and broad D band, indicating a lack of structural order but for the presence of graphitic domains. Statistical analysis showed that the ratio of the number of Raman-active sites to the total number of measurement sites decreases exponentially with increasing the electron irradiation dose. The maximum degree of cross-linking ranged from 97 to 99% for the three SAMs. Proof-of-concept experiments were conducted to demonstrate potential applications of Raman-inactive CNMs as a supporting membrane for Raman analysis.
Alteration of gene expression by restriction enzymes electroporated into plant cells.
Ashraf, M; Altschuler, M; Galasinski, S; Griffiths, T D
1993-06-01
The alteration in the expression of a beta-glucuronidase (GUS) reporter gene was used to monitor the effect of restriction endonucleases electroporated into the tobacco (Nicotiana tabacum L.) protoplasts. Restriction enzyme (RE) Hind III which does not have a recognition site within the gene cassette, had little effect on enzyme activity. In contrast restriction endonucleases Hae III and Sau3A1 which possess 8 and 16 recognition sites in the GUS cassette, were found to reduce the enzyme activity by 89% and 94% respectively when compared to control electroporations. Restriction-site mutation analysis (RSM) and Southern blot analysis indicated the enzymatic degradation of GUS coding sequence by the REs Hae III and Sau3A1. Results of this study suggest that on electroporation, REs can enter into plant cells and alter the expression of the GUS gene. The alteration of gene expression is thus correlated with the digestion of GUS template DNA. Future applications of this technique could include addressing fundamental questions with regard to DNA repair, site-specific recombination, identifying mutations, insertional mutagenesis, enhancement of stable transformation and gene tagging in plants.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilbert, R O; Essington, E H; Brady, D N
Statistical design and analysis activities for the Nevada Applied Ecology Group (NAEG) during 1976 are briefly outlined. This is followed by a description of soil data collected thus far at nuclear study sites. Radionuclide concentrations in surface soil collected along a transect from ground zero (GZ) along the main fallout pattern are given for Nuclear Site (NS) 201. Concentrations in soil collected at 315 locations on a grid system at 200 foot spacings are also given for this site. The /sup 241/Am to /sup 137/Cs ratios change over NS 201 depending on location relative to GZ. They range from lessmore » than one where /sup 241/Am is at low levels, to more than fifty where /sup 241/Am levels are high (near GZ). The estimated median /sup 239/ /sup 240/Pu to /sup 241/Am ratio is 11 and appears to be relatively constant over the area (the 95 percent lower and upper limits on the true median ratio are about 8 and 14).« less
NASA Astrophysics Data System (ADS)
Kumar, Gaurav; Tibbitts, Luke; Newell, Jaclyn; Panthi, Basu; Mukhopadhyay, Ahana; Rioux, Robert M.; Pursell, Christopher J.; Janik, Michael; Chandler, Bert D.
2018-03-01
Supported metal catalysts, which are composed of metal nanoparticles dispersed on metal oxides or other high-surface-area materials, are ubiquitous in industrially catalysed reactions. Identifying and characterizing the catalytic active sites on these materials still remains a substantial challenge, even though it is required to guide rational design of practical heterogeneous catalysts. Metal-support interactions have an enormous impact on the chemistry of the catalytic active site and can determine the optimum support for a reaction; however, few direct probes of these interactions are available. Here we show how benzyl alcohol oxidation Hammett studies can be used to characterize differences in the catalytic activity of Au nanoparticles hosted on various metal-oxide supports. We combine reactivity analysis with density functional theory calculations to demonstrate that the slope of experimental Hammett plots is affected by electron donation from the underlying oxide support to the Au particles.
[Analysis of the web pages of the intensive care units of Spain].
Navarro-Arnedo, J M
2009-01-01
In order to determine the Intensive Care Units (ICU) of Spanish hospitals that had a web site, to analyze the information they offered and to know what information they needed to offer according to a sample of ICU nurses, a cross-sectional observational, descriptive study was carried out between January and September 2008. For each ICU website, an analysis was made on the information available on the unit, its care, teaching and research activity on nursing. Simultaneously, based on a sample of intensive care nurses, the information that should be contained on an ICU website was determined. The results, expressed in absolute numbers and percentage, showed that 66 of the 292 hospitals with ICU (22.6%) had a web site; 50.7% of the sites showed the number of beds, 19.7% the activity report, 11.3% the published articles/studies and followed research lines and 9.9% the organized formation courses. 14 webs (19.7%) displayed images of nurses. However, only 1 (1.4%) offered guides on the actions followed. No web site offered a navigation section for nursing, the E-mail of the chief nursing, the nursing documentation used or if any nursing model of their own was used. It is concluded that only one-fourth of the Spanish hospitals with ICU have a web site; number of beds was the data offered by the most sites, whereas information on care, educational and investigating activities was very reduced and that on nursing was practically omitted on the web pages of intensive care units.
Analysis of Binding Site Hot Spots on the Surface of Ras GTPase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buhrman, Greg; O; #8242
2012-09-17
We have recently discovered an allosteric switch in Ras, bringing an additional level of complexity to this GTPase whose mutants are involved in nearly 30% of cancers. Upon activation of the allosteric switch, there is a shift in helix 3/loop 7 associated with a disorder to order transition in the active site. Here, we use a combination of multiple solvent crystal structures and computational solvent mapping (FTMap) to determine binding site hot spots in the 'off' and 'on' allosteric states of the GTP-bound form of H-Ras. Thirteen sites are revealed, expanding possible target sites for ligand binding well beyond themore » active site. Comparison of FTMaps for the H and K isoforms reveals essentially identical hot spots. Furthermore, using NMR measurements of spin relaxation, we determined that K-Ras exhibits global conformational dynamics very similar to those we previously reported for H-Ras. We thus hypothesize that the global conformational rearrangement serves as a mechanism for allosteric coupling between the effector interface and remote hot spots in all Ras isoforms. At least with respect to the binding sites involving the G domain, H-Ras is an excellent model for K-Ras and probably N-Ras as well. Ras has so far been elusive as a target for drug design. The present work identifies various unexplored hot spots throughout the entire surface of Ras, extending the focus from the disordered active site to well-ordered locations that should be easier to target.« less
Motifs for molecular recognition exploiting hydrophobic enclosure in protein-ligand binding.
Young, Tom; Abel, Robert; Kim, Byungchan; Berne, Bruce J; Friesner, Richard A
2007-01-16
The thermodynamic properties and phase behavior of water in confined regions can vary significantly from that observed in the bulk. This is particularly true for systems in which the confinement is on the molecular-length scale. In this study, we use molecular dynamics simulations and a powerful solvent analysis technique based on inhomogenous solvation theory to investigate the properties of water molecules that solvate the confined regions of protein active sites. Our simulations and analysis indicate that the solvation of protein active sites that are characterized by hydrophobic enclosure and correlated hydrogen bonds induce atypical entropic and enthalpic penalties of hydration. These penalties apparently stabilize the protein-ligand complex with respect to the independently solvated ligand and protein, which leads to enhanced binding affinities. Our analysis elucidates several challenging cases, including the super affinity of the streptavidin-biotin system.
Kuang, Zheng; Ji, Zhicheng; Boeke, Jef D; Ji, Hongkai
2018-01-09
Biological processes are usually associated with genome-wide remodeling of transcription driven by transcription factors (TFs). Identifying key TFs and their spatiotemporal binding patterns are indispensable to understanding how dynamic processes are programmed. However, most methods are designed to predict TF binding sites only. We present a computational method, dynamic motif occupancy analysis (DynaMO), to infer important TFs and their spatiotemporal binding activities in dynamic biological processes using chromatin profiling data from multiple biological conditions such as time-course histone modification ChIP-seq data. In the first step, DynaMO predicts TF binding sites with a random forests approach. Next and uniquely, DynaMO infers dynamic TF binding activities at predicted binding sites using their local chromatin profiles from multiple biological conditions. Another landmark of DynaMO is to identify key TFs in a dynamic process using a clustering and enrichment analysis of dynamic TF binding patterns. Application of DynaMO to the yeast ultradian cycle, mouse circadian clock and human neural differentiation exhibits its accuracy and versatility. We anticipate DynaMO will be generally useful for elucidating transcriptional programs in dynamic processes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
1982-03-01
Illinois Historical Survey Library ( Urbana ). Very little documentary material pertinent to the project area was found. The Scripps’ (1891) manuscript...within the project area. Illinois Archaeological Survey ( Urbana ). The IAS maintains the active site files for archaeological sites within the state of...should include consulting these site files. University of Illinois ( Urbana ). The most interest- ing documentary materials here were the Smithsonian Insti
UMTRA project water sampling and analysis plan, Durango, Colorado
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1994-01-01
Surface remedial action has been completed at the Uranium Mill Tailings Remedial Action Project in Durango, Colorado. Contaminated soil and debris have been removed from the former processing site and placed in the Bodo Canyon disposal cell. Ground water at the former uranium mill/tailings site and raffinate pond area has been contaminated by the former milling operations. The ground water at the disposal site was not impacted by the former milling operations at the time of the cell`s construction. Activities for fiscal 1994 involve ground water sampling and site characterization of the disposal site.
Lovtang, Sara; Delistraty, Damon; Rochette, Elizabeth
2018-07-01
We challenge the suggestion by Sample et al. (2015) that a depth of 305 cm (10 ft) exceeds the depth of biological activity in soils at the Hanford Site, Washington, USA, or similar sites. Instead, we support the standard point of compliance, identified in the Model Toxics Control Act in the state of Washington, which specifies a depth of 457 cm (15 ft) for the protection of both human and ecological receptors at the Hanford Site. Our position is based on additional information considered in our expanded review of the literature, the influence of a changing environment over time, plant community dynamics at the Hanford Site, and inherent uncertainty in the Sample et al. (2015) analysis. Integr Environ Assess Manag 2018;14:442-446. © 2018 SETAC. © 2018 SETAC.
Analysis of state Superfund programs: 50 state study. 1998 update
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
States have remediated over 40,000 contaminated sites not on the federal Superfund list. ELI`s latest analysis of state Superfund programs examines the cleanup programs of all 50 states, Puerto Rico, and the District of Columbia. The study provides the most current data on state statutes, program organization, staffing, funding, expenditures, cleanup standards, and cleanup activities, voluntary cleanup programs and brownfields programs. State and federal policymakers and attorneys working on non-NPL sites should find this study useful.
Sodium and Potassium Ions in Proteins and Enzyme Catalysis.
Vašák, Milan; Schnabl, Joachim
2016-01-01
The group I alkali metal ions Na(+) and K(+) are ubiquitous components of biological fluids that surround biological macromolecules. They play important roles other than being nonspecific ionic buffering agents or mediators of solute exchange and transport. Molecular evolution and regulated high intracellular and extracellular M(+) concentrations led to incorporation of selective Na(+) and K(+) binding sites into enzymes to stabilize catalytic intermediates or to provide optimal positioning of substrates. The mechanism of M(+) activation, as derived from kinetic studies along with structural analysis, has led to the classification of cofactor-like (type I) or allosteric effector (type II) activated enzymes. In the type I mechanism substrate anchoring to the enzyme active site is mediated by M(+), often acting in tandem with a divalent cation like Mg(2+), Mn(2+) or Zn(2+). In the allosteric type II mechanism, M(+) binding enhances enzyme activity through conformational transitions triggered upon binding to a distant site. In this chapter, following the discussion of the coordination chemistry of Na(+) and K(+) ions and the structural features responsible for the metal binding site selectivity in M(+)-activated enzymes, well-defined examples of M(+)-activated enzymes are used to illustrate the structural basis for type I and type II activation by Na(+) and K(+).
Development of policies for Natura 2000 sites: a multi-criteria approach to support decision makers.
Cortina, Carla; Boggia, Antonio
2014-08-01
The aim of this study is to present a methodology to support decision makers in the choice of Natura 2000 sites needing an appropriate management plan to ensure a sustainable socio-economic development. In order to promote sustainable development in the Natura 2000 sites compatible with nature preservation, conservation measures or management plans are necessary. The main issue is to decide when only conservation measures can be applied and when the sites need an appropriate management plan. We present a case study for the Italian Region of Umbria. The methodology is based on a multi-criteria approach to identify the biodiversity index (BI), and on the development of a human activities index (HAI). By crossing the two indexes for each site on a Cartesian plane, four groups of sites were identified. Each group corresponds to a specific need for an appropriate management plan. Sites in the first group with a high level both of biodiversity and human activities have the most urgent need of an appropriate management plan to ensure sustainable development. The proposed methodology and analysis is replicable in other regions or countries by using the data available for each site in the Natura 2000 standard data form. A multi-criteria analysis is especially suitable for supporting decision makers when they deal with a multidimensional decision process. We found the multi-criteria approach particularly sound in this case, due to the concept of biodiversity itself, which is complex and multidimensional, and to the high number of alternatives (Natura 2000 sites) to be assessed. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
MacDonell, M.M.; Peterson, J.M.
1991-11-01
The US Department of Energy, under its Surplus Facilities Management Program (SFMP), is responsible for cleanup activities at the Weldon Spring site, located near Weldon Spring, Missouri. The site consists of two noncontiguous areas: (1) a raffinate pits and chemical plant area and (2) a quarry. This engineering evaluation/cost analysis (EE/CA) report has been prepared to support a proposed removal action to manage 15 nonprocess buildings, identified as the 15 Series buildings, at the chemical plant on the Weldon Spring site. These buildings have been nonoperational for more than 20 years, and the deterioration that has occurred during this timemore » has resulted in a potential threat to site workers, the general public, and the environment. The EE/CA documentation of this proposed action is consistent with guidance from the US Environmental Protection Agency (EPA) that addresses removal actions at sites subject to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) of 1980, as amended by the Superfund Amendments and Reauthorization Act of 1986. Actions at the Weldon Spring site are subject to CERCLA requirements because the site is on the EPA`s National Priorities List. The objectives of this report are to (1) identify alternatives for management of the nonprocess buildings; (2) document the selection of response activities that will mitigate the potential threat to workers, the public, and the environment associated with these buildings; and (3) address environmental impact associated with the proposed action.« less
Miklík, Dalibor; Šenigl, Filip; Hejnar, Jiří
2018-01-01
Individual groups of retroviruses and retroviral vectors differ in their integration site preference and interaction with the host genome. Hence, immediately after infection genome-wide distribution of integrated proviruses is non-random. During long-term in vitro or persistent in vivo infection, the genomic position and chromatin environment of the provirus affects its transcriptional activity. Thus, a selection of long-term stably expressed proviruses and elimination of proviruses, which have been gradually silenced by epigenetic mechanisms, helps in the identification of genomic compartments permissive for proviral transcription. We compare here the extent and time course of provirus silencing in single cell clones of the K562 human myeloid lymphoblastoma cell line that have been infected with retroviral reporter vectors derived from avian sarcoma/leukosis virus (ASLV), human immunodeficiency virus type 1 (HIV) and murine leukaemia virus (MLV). While MLV proviruses remain transcriptionally active, ASLV proviruses are prone to rapid silencing. The HIV provirus displays gradual silencing only after an extended time period in culture. The analysis of integration sites of long-term stably expressed proviruses shows a strong bias for some genomic features—especially integration close to the transcription start sites of active transcription units. Furthermore, complex analysis of histone modifications enriched at the site of integration points to the accumulation of proviruses of all three groups in gene regulatory segments, particularly close to the enhancer loci. We conclude that the proximity to active regulatory chromatin segments correlates with stable provirus expression in various retroviral species. PMID:29517993
NASA Astrophysics Data System (ADS)
Botchwey, Christian
This thesis summarizes the methods and major findings of Ni-W(P)/gamma-Al 2O3 nitride catalyst synthesis, characterization, hydrotreating activity, kinetic analysis and correlation of the catalysts' activities to their synthesis parameters and properties. The range of parameters for catalyst synthesis were W (15-40 wt%), Ni (0-8 wt%), P (0-5 wt%) and nitriding temperature (TN) (500-900 °C). Characterization techniques used included: N2 sorption studies, chemisorption, elemental analysis, temperature programmed studies, x-ray diffraction, scanning electron microscopy, energy dispersive x-ray, infrared spectroscopy, transmission electron microscopy and x-ray absorption near edge structure. Hydrodesulfurization (HDS), hydrodenitrogenation (HDN) and hydrodearomatization (HDA) were performed at: temperature (340-380 °C), pressure (6.2-9.0 MPa), liquid hourly space velocity (1-3 h-1) and hydrogen to oil ratio (600 ml/ml, STP). The predominant species on the catalyst surface were Ni3N, W2N and bimetallic Ni2W3N. The bimetallic Ni-W nitride species was more active than the individual activities of the Ni3N and W2N. P increased weak acid sites while nitriding temperature decreased amount of strong acid sites. Low nitriding temperature enhanced dispersion of metal particles. P interacted with Al 2O3 which increased the dispersion of metal nitrides on the catalyst surface. HDN activity increased with Ni and P loading but decreased with increase in nitriding temperature (optimum conversion; 60 wt%). HDS and HDA activities went through a maximum with increase in the synthesis parameters (optimum conversions; 88. wt% for HDS and 47 wt% for HDA). Increase in W loading led to increase in catalyst activity. The catalysts were stable to deactivation and had the nitride structure conserved during hydrotreating in the presence of hydrogen sulfide. The results showed good correlation between hydrotreating activities (HDS and HDN) and the catalyst nitrogen content, number of exposed active sites, catalyst particle size and BET surface area. HDS and HDN kinetic analyses, using Langmuir-Hinshelwood models, gave activation energies of 66 and 32 kJ/mol, respectively. There were no diffusion limitations in the reaction process. Two active sites were involved in HDS reaction while one site was used for HDN. HDS and HDN activities of the Ni-W(P)/gamma-Al 2O3 nitride catalysts were comparable to the corresponding sulfides.
A Measure of the Broad Substrate Specificity of Enzymes Based on ‘Duplicate’ Catalytic Residues
Chakraborty, Sandeep; Ásgeirsson, Bjarni; Rao, Basuthkar J.
2012-01-01
The ability of an enzyme to select and act upon a specific class of compounds with unerring precision and efficiency is an essential feature of life. Simultaneously, these enzymes often catalyze the reaction of a range of similar substrates of the same class, and also have promiscuous activities on unrelated substrates. Previously, we have established a methodology to quantify promiscuous activities in a wide range of proteins. In the current work, we quantitatively characterize the active site for the ability to catalyze distinct, yet related, substrates (BRASS). A protein with known structure and active site residues provides the framework for computing ‘duplicate’ residues, each of which results in slightly modified replicas of the active site scaffold. Such spatial congruence is supplemented by Finite difference Poisson Boltzmann analysis which filters out electrostatically unfavorable configurations. The congruent configurations are used to compute an index (BrassIndex), which reflects the broad substrate profile of the active site. We identify an acetylhydrolase and a methyltransferase as having the lowest and highest BrassIndex, respectively, from a set of non-homologous proteins extracted from the Catalytic Site Atlas. The acetylhydrolase, a regulatory enzyme, is known to be highly specific for platelet-activating factor. In the methyltransferase (PDB: 1QAM), various combinations of glycine (Gly38/40/42), asparagine (Asn101/11) and glutamic acid (Glu59/36) residues having similar spatial and electrostatic profiles with the specified scaffold (Gly38, Asn101 and Glu59) exemplifies the broad substrate profile such an active site may provide. ‘Duplicate’ residues identified by relaxing the spatial and/or electrostatic constraints can be the target of directed evolution methodologies, like saturation mutagenesis, for modulating the substrate specificity of proteins. PMID:23166637
Otero, Lisandro H.; Rojas-Altuve, Alzoray; Llarrull, Leticia I.; Carrasco-López, Cesar; Kumarasiri, Malika; Lastochkin, Elena; Fishovitz, Jennifer; Dawley, Matthew; Hesek, Dusan; Lee, Mijoon; Johnson, Jarrod W.; Fisher, Jed F.; Chang, Mayland; Mobashery, Shahriar; Hermoso, Juan A.
2013-01-01
The expression of penicillin binding protein 2a (PBP2a) is the basis for the broad clinical resistance to the β-lactam antibiotics by methicillin-resistant Staphylococcus aureus (MRSA). The high-molecular mass penicillin binding proteins of bacteria catalyze in separate domains the transglycosylase and transpeptidase activities required for the biosynthesis of the peptidoglycan polymer that comprises the bacterial cell wall. In bacteria susceptible to β-lactam antibiotics, the transpeptidase activity of their penicillin binding proteins (PBPs) is lost as a result of irreversible acylation of an active site serine by the β-lactam antibiotics. In contrast, the PBP2a of MRSA is resistant to β-lactam acylation and successfully catalyzes the dd-transpeptidation reaction necessary to complete the cell wall. The inability to contain MRSA infection with β-lactam antibiotics is a continuing public health concern. We report herein the identification of an allosteric binding domain—a remarkable 60 Å distant from the dd-transpeptidase active site—discovered by crystallographic analysis of a soluble construct of PBP2a. When this allosteric site is occupied, a multiresidue conformational change culminates in the opening of the active site to permit substrate entry. This same crystallographic analysis also reveals the identity of three allosteric ligands: muramic acid (a saccharide component of the peptidoglycan), the cell wall peptidoglycan, and ceftaroline, a recently approved anti-MRSA β-lactam antibiotic. The ability of an anti-MRSA β-lactam antibiotic to stimulate allosteric opening of the active site, thus predisposing PBP2a to inactivation by a second β-lactam molecule, opens an unprecedented realm for β-lactam antibiotic structure-based design. PMID:24085846
NASA Astrophysics Data System (ADS)
Rinderer, M.; McGlynn, B. L.; van Meerveld, I. H. J.
2016-12-01
Groundwater measurements can help us to improve our understanding of runoff generation at the catchment-scale but typically only provide point-scale data. These measurements, therefore, need to be interpolated or upscaled in order to obtain information about catchment scale groundwater dynamics. Our approach used data from 51 spatially distributed groundwater monitoring sites in a Swiss pre-alpine catchment and time series clustering to define six groundwater response clusters. Each of the clusters was characterized by distinctly different site characteristics (i.e., Topographic Wetness Index and curvature), which allowed us to assign all unmonitored locations to one of these clusters. Time series modeling and the definition of response thresholds (i.e., the depth of more transmissive soil layers) allowed us to derive maps of the spatial distribution of active (i.e., responding) locations across the catchment at 15 min time intervals. Connectivity between all active locations and the stream network was determined using a graph theory approach. The extent of the active and connected areas differed during events and suggests that not all active locations directly contributed to streamflow. Gate keeper sites prevented connectivity of upslope locations to the channel network. Streamflow dynamics at the catchment outlet were correlated to catchment average connectivity dynamics. In a sensitivity analysis we tested six different groundwater levels for a site to be considered "active", which showed that the definition of the threshold did not significantly influence the conclusions drawn from our analysis. This study is the first one to derive patterns of groundwater dynamics based on empirical data (rather than interpolation) and provides insight into the spatio-temporal evolution of the active and connected runoff source areas at the catchment-scale that is critical to understanding the dynamics of water quantity and quality in streams.
2013-01-01
Background Sediment bacterial communities are key players in biogeochemical cycling of elements in the aquatic environment. Copper mining, smelting, and processing operations located in Bor area (Serbia) are major environmental hot spots in the lower Danube Basin and Western Balkans. In the present study, we evaluate the influence of trace element (TE) concentration in sediments and physico-chemical properties of water on sediment microbial communities in water streams adjacent to the Copper Smelter Complex Bor (RTB Bor, Serbia). The degree to which metabolic activities of bacterial biota inhabiting differently polluted sites is inhibited by inorganic pollution were compared using selected enzymatic bioindicators. Results Cu, Zn, Pb, and As concentrations systematically exceeded the target values for metal loadings in aquatic sediments. Water electrical conductivity (WEC) followed the same pattern of spatial variation, irrespective of season. Interestingly, the most intense enzymatic activity occurred at the reference site although this site showed the greatest TE levels in aquatic sediments. Catalase activity (CA), potential dehydrogenase activity (PDA), actual dehydrogenase activity (ADA), urease activity (UA), and phosphatase activity (PA) in aquatic sediments displayed heterogeneous patterns of spatio-temporal variation. Inorganic pollution greatly affected CA, ADA, and PDA, but much less so UA and PA. Canonical correlation analysis showed that pH and WEC were the strongest determinants of enzymatic activity in bacterial biota, with the latter variable being reversely correlated with the enzymatic indicator of sediment quality (EISQ). The median values of EISQ increased with distance from the major sources of pollution. In addition, it was found that sites with different degrees of inorganic pollution can be appropriately classified by applying cluster analysis to EISQ, TE levels in sediments, and physico-chemical properties of water. Conclusions Because EISQ can precisely identify changes in overall enzymatic activity of sediment bacterial communities, this enzymatic bioindicator has a great potential for biomonitoring the current status of inorganic pollution in aquatic ecosystems. PMID:23536970
Bosshart, Andreas; Hee, Chee Seng; Bechtold, Matthias; Schirmer, Tilman; Panke, Sven
2015-03-02
Functional promiscuity of enzymes can often be harnessed as the starting point for the directed evolution of novel biocatalysts. Here we describe the divergent morphing of an engineered thermostable variant (Var8) of a promiscuous D-tagatose epimerase (DTE) into two efficient catalysts for the C3 epimerization of D-fructose to D-psicose and of L-sorbose to L-tagatose. Iterative single-site randomization and screening of 48 residues in the first and second shells around the substrate-binding site of Var8 yielded the eight-site mutant IDF8 (ninefold improved kcat for the epimerization of D-fructose) and the six-site mutant ILS6 (14-fold improved epimerization of L-sorbose), compared to Var8. Structure analysis of IDF8 revealed a charged patch at the entrance of its active site; this presumably facilitates entry of the polar substrate. The improvement in catalytic activity of variant ILS6 is thought to relate to subtle changes in the hydration of the bound substrate. The structures can now be used to select additional sites for further directed evolution of the ketohexose epimerase. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Smal, Caroline; Vertommen, Didier; Bertrand, Luc; Ntamashimikiro, Sandrine; Rider, Mark H; Van Den Neste, Eric; Bontemps, Françoise
2006-02-24
Deoxycytidine kinase (dCK) catalyzes the rate-limiting step of the deoxyribonucleoside salvage pathway in mammalian cells and plays a key role in the activation of numerous nucleoside analogues used in anti-cancer and antiviral chemotherapy. Although compelling evidence indicated that dCK activity might be regulated by phosphorylation/dephosphorylation, direct demonstration was lacking. Here we showed that dCK overexpressed in HEK 293T cells was labeled after incubating the cells with [32P]orthophosphate. Sorbitol, which was reported to decrease dCK activity, also decreased the labeling of dCK. These results indicated that dCK may exist as a phosphoprotein in vivo and that its activity can be correlated with its phosphorylation level. After purification of 32P-labeled dCK, digestion by trypsin, and analysis of the radioactive peptides by tandem mass spectrometry, the following four in vivo phosphorylation sites were identified: Thr-3, Ser-11, Ser-15, and Ser-74, the latter being the major phosphorylation site. Site-directed mutagenesis and use of an anti-phospho-Ser-74 antibody demonstrated that Ser-74 phosphorylation was crucial for dCK activity in HEK 293T cells, whereas phosphorylation of other identified sites did not seem essential. Phosphorylation of Ser-74 was also detected on endogenous dCK in leukemic cells, in which the Ser-74 phosphorylation state was increased by agents that enhanced dCK activity. Our study provided direct evidence that dCK activity can be controlled by phosphorylation in intact cells and highlights the importance of Ser-74 for dCK activity.
Enzyme Active Site Interactions by Raman/FTIR, NMR, and Ab Initio Calculations
Deng, Hua
2017-01-01
Characterization of enzyme active site structure and interactions at high resolution is important for the understanding of the enzyme catalysis. Vibrational frequency and NMR chemical shift measurements of enzyme-bound ligands are often used for such purpose when X-ray structures are not available or when higher resolution active site structures are desired. This review is focused on how ab initio calculations may be integrated with vibrational and NMR chemical shift measurements to quantitatively determine high-resolution ligand structures (up to 0.001 Å for bond length and 0.01 Å for hydrogen bonding distance) and how interaction energies between bound ligand and its surroundings at the active site may be determined. Quantitative characterization of substrate ionic states, bond polarizations, tautomeric forms, conformational changes and its interactions with surroundings in enzyme complexes that mimic ground state or transition state can provide snapshots for visualizing the substrate structural evolution along enzyme-catalyzed reaction pathway. Our results have shown that the integration of spectroscopic studies with theoretical computation greatly enhances our ability to interpret experimental data and significantly increases the reliability of the theoretical analysis. PMID:24018325
Arabidopsis thaliana dehydroascorbate reductase 2: Conformational flexibility during catalysis
NASA Astrophysics Data System (ADS)
Bodra, Nandita; Young, David; Astolfi Rosado, Leonardo; Pallo, Anna; Wahni, Khadija; de Proft, Frank; Huang, Jingjing; van Breusegem, Frank; Messens, Joris
2017-02-01
Dehydroascorbate reductase (DHAR) catalyzes the glutathione (GSH)-dependent reduction of dehydroascorbate and plays a direct role in regenerating ascorbic acid, an essential plant antioxidant vital for defense against oxidative stress. DHAR enzymes bear close structural homology to the glutathione transferase (GST) superfamily of enzymes and contain the same active site motif, but most GSTs do not exhibit DHAR activity. The presence of a cysteine at the active site is essential for the catalytic functioning of DHAR, as mutation of this cysteine abolishes the activity. Here we present the crystal structure of DHAR2 from Arabidopsis thaliana with GSH bound to the catalytic cysteine. This structure reveals localized conformational differences around the active site which distinguishes the GSH-bound DHAR2 structure from that of DHAR1. We also unraveled the enzymatic step in which DHAR releases oxidized glutathione (GSSG). To consolidate our structural and kinetic findings, we investigated potential conformational flexibility in DHAR2 by normal mode analysis and found that subdomain mobility could be linked to GSH binding or GSSG release.
Arabidopsis thaliana dehydroascorbate reductase 2: Conformational flexibility during catalysis
Bodra, Nandita; Young, David; Astolfi Rosado, Leonardo; Pallo, Anna; Wahni, Khadija; De Proft, Frank; Huang, Jingjing; Van Breusegem, Frank; Messens, Joris
2017-01-01
Dehydroascorbate reductase (DHAR) catalyzes the glutathione (GSH)-dependent reduction of dehydroascorbate and plays a direct role in regenerating ascorbic acid, an essential plant antioxidant vital for defense against oxidative stress. DHAR enzymes bear close structural homology to the glutathione transferase (GST) superfamily of enzymes and contain the same active site motif, but most GSTs do not exhibit DHAR activity. The presence of a cysteine at the active site is essential for the catalytic functioning of DHAR, as mutation of this cysteine abolishes the activity. Here we present the crystal structure of DHAR2 from Arabidopsis thaliana with GSH bound to the catalytic cysteine. This structure reveals localized conformational differences around the active site which distinguishes the GSH-bound DHAR2 structure from that of DHAR1. We also unraveled the enzymatic step in which DHAR releases oxidized glutathione (GSSG). To consolidate our structural and kinetic findings, we investigated potential conformational flexibility in DHAR2 by normal mode analysis and found that subdomain mobility could be linked to GSH binding or GSSG release. PMID:28195196
HammerCloud: A Stress Testing System for Distributed Analysis
NASA Astrophysics Data System (ADS)
van der Ster, Daniel C.; Elmsheuser, Johannes; Úbeda García, Mario; Paladin, Massimo
2011-12-01
Distributed analysis of LHC data is an I/O-intensive activity which places large demands on the internal network, storage, and local disks at remote computing facilities. Commissioning and maintaining a site to provide an efficient distributed analysis service is therefore a challenge which can be aided by tools to help evaluate a variety of infrastructure designs and configurations. HammerCloud is one such tool; it is a stress testing service which is used by central operations teams, regional coordinators, and local site admins to (a) submit arbitrary number of analysis jobs to a number of sites, (b) maintain at a steady-state a predefined number of jobs running at the sites under test, (c) produce web-based reports summarizing the efficiency and performance of the sites under test, and (d) present a web-interface for historical test results to both evaluate progress and compare sites. HammerCloud was built around the distributed analysis framework Ganga, exploiting its API for grid job management. HammerCloud has been employed by the ATLAS experiment for continuous testing of many sites worldwide, and also during large scale computing challenges such as STEP'09 and UAT'09, where the scale of the tests exceeded 10,000 concurrently running and 1,000,000 total jobs over multi-day periods. In addition, HammerCloud is being adopted by the CMS experiment; the plugin structure of HammerCloud allows the execution of CMS jobs using their official tool (CRAB).
NASA Astrophysics Data System (ADS)
White, Joshua S.; Matthews, Jeanna N.; Stacy, John L.
2012-06-01
Phishing website analysis is largely still a time-consuming manual process of discovering potential phishing sites, verifying if suspicious sites truly are malicious spoofs and if so, distributing their URLs to the appropriate blacklisting services. Attackers increasingly use sophisticated systems for bringing phishing sites up and down rapidly at new locations, making automated response essential. In this paper, we present a method for rapid, automated detection and analysis of phishing websites. Our method relies on near real-time gathering and analysis of URLs posted on social media sites. We fetch the pages pointed to by each URL and characterize each page with a set of easily computed values such as number of images and links. We also capture a screen-shot of the rendered page image, compute a hash of the image and use the Hamming distance between these image hashes as a form of visual comparison. We provide initial results demonstrate the feasibility of our techniques by comparing legitimate sites to known fraudulent versions from Phishtank.com, by actively introducing a series of minor changes to a phishing toolkit captured in a local honeypot and by performing some initial analysis on a set of over 2.8 million URLs posted to Twitter over a 4 days in August 2011. We discuss the issues encountered during our testing such as resolvability and legitimacy of URL's posted on Twitter, the data sets used, the characteristics of the phishing sites we discovered, and our plans for future work.
Blackler, Ryan J; Gagnon, Susannah M L; Polakowski, Robert; Rose, Natisha L; Zheng, Ruixiang B; Letts, James A; Johal, Asha R; Schuman, Brock; Borisova, Svetlana N; Palcic, Monica M; Evans, Stephen V
2017-04-01
The homologous glycosyltransferases α-1,3-N-acetylgalactosaminyltransferase (GTA) and α-1,3-galactosyltransferase (GTB) carry out the final synthetic step of the closely related human ABO(H) blood group A and B antigens. The catalytic mechanism of these model retaining enzymes remains under debate, where Glu303 has been suggested to act as a putative nucleophile in a double displacement mechanism, a local dipole stabilizing the intermediate in an orthogonal associative mechanism or a general base to stabilize the reactive oxocarbenium ion-like intermediate in an SNi-like mechanism. Kinetic analysis of GTA and GTB point mutants E303C, E303D, E303Q and E303A shows that despite the enzymes having nearly identical sequences, the corresponding mutants of GTA/GTB have up to a 13-fold difference in their residual activities relative to wild type. High-resolution single crystal X-ray diffraction studies reveal, surprisingly, that the mutated Cys, Asp and Gln functional groups are no more than 0.8 Å further from the anomeric carbon of donor substrate compared to wild type. However, complicating the analysis is the observation that Glu303 itself plays a critical role in maintaining the stability of a strained "double-turn" in the active site through several hydrogen bonds, and any mutation other than E303Q leads to significantly higher thermal motion or even disorder in the substrate recognition pockets. Thus, there is a remarkable juxtaposition of the mutants E303C and E303D, which retain significant activity despite disrupted active site architecture, with GTB/E303Q, which maintains active site architecture but exhibits zero activity. These findings indicate that nucleophilicity at position 303 is more catalytically valuable than active site stability and highlight the mechanistic elasticity of these enzymes. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Yu, J S; Chen, W J; Ni, M H; Chan, W H; Yang, S D
1998-08-15
Autophosphorylation-dependent protein kinase (auto-kinase) was identified from pig brain and liver on the basis of its unique autophosphorylation/activation property [Yang, Fong, Yu and Liu (1987) J. Biol. Chem. 262, 7034-7040; Yang, Chang and Soderling (1987) J. Biol. Chem. 262, 9421-9427]. Its substrate consensus sequence motif was determined as being -R-X-(X)-S*/T*-X3-S/T-. To characterize auto-kinase further, we partly sequenced the kinase purified from pig liver. The N-terminal sequence (VDGGAKTSDKQKKKAXMTDE) and two internal peptide sequences (EKLRTIV and LQNPEK/ILTP/FI) of auto-kinase were obtained. These sequences identify auto-kinase as a C-terminal catalytic fragment of p21-activated protein kinase 2 (PAK2 or gamma-PAK) lacking its N-terminal regulatory region. Auto-kinase can be recognized by an antibody raised against the C-terminal peptide of human PAK2 by immunoblotting. Furthermore the autophosphorylation site sequence of auto-kinase was successfully predicted on the basis of its substrate consensus sequence motif and the known PAK2 sequence, and was further demonstrated to be RST(P)MVGTPYWMAPEVVTR by phosphoamino acid analysis, manual Edman degradation and phosphopeptide mapping via the help of phosphorylation site analysis of a synthetic peptide corresponding to the sequence of PAK2 from residues 396 to 418. During the activation process, auto-kinase autophosphorylates mainly on a single threonine residue Thr402 (according to the sequence numbering of human PAK2). In addition, a phospho-specific antibody against a synthetic phosphopeptide containing this identified sequence was generated and shown to be able to differentially recognize the activated auto-kinase autophosphorylated at Thr402 but not the non-phosphorylated/inactive auto-kinase. Immunoblot analysis with this phospho-specific antibody further revealed that the change in phosphorylation level of Thr402 of auto-kinase was well correlated with the activity change of the kinase during both autophosphorylation/activation and protein phosphatase-mediated dephosphorylation/inactivation processes. Taken together, our results identify Thr402 as the regulatory autophosphorylation site of auto-kinase, which is a C-terminal catalytic fragment of PAK2.
Yu, J S; Chen, W J; Ni, M H; Chan, W H; Yang, S D
1998-01-01
Autophosphorylation-dependent protein kinase (auto-kinase) was identified from pig brain and liver on the basis of its unique autophosphorylation/activation property [Yang, Fong, Yu and Liu (1987) J. Biol. Chem. 262, 7034-7040; Yang, Chang and Soderling (1987) J. Biol. Chem. 262, 9421-9427]. Its substrate consensus sequence motif was determined as being -R-X-(X)-S*/T*-X3-S/T-. To characterize auto-kinase further, we partly sequenced the kinase purified from pig liver. The N-terminal sequence (VDGGAKTSDKQKKKAXMTDE) and two internal peptide sequences (EKLRTIV and LQNPEK/ILTP/FI) of auto-kinase were obtained. These sequences identify auto-kinase as a C-terminal catalytic fragment of p21-activated protein kinase 2 (PAK2 or gamma-PAK) lacking its N-terminal regulatory region. Auto-kinase can be recognized by an antibody raised against the C-terminal peptide of human PAK2 by immunoblotting. Furthermore the autophosphorylation site sequence of auto-kinase was successfully predicted on the basis of its substrate consensus sequence motif and the known PAK2 sequence, and was further demonstrated to be RST(P)MVGTPYWMAPEVVTR by phosphoamino acid analysis, manual Edman degradation and phosphopeptide mapping via the help of phosphorylation site analysis of a synthetic peptide corresponding to the sequence of PAK2 from residues 396 to 418. During the activation process, auto-kinase autophosphorylates mainly on a single threonine residue Thr402 (according to the sequence numbering of human PAK2). In addition, a phospho-specific antibody against a synthetic phosphopeptide containing this identified sequence was generated and shown to be able to differentially recognize the activated auto-kinase autophosphorylated at Thr402 but not the non-phosphorylated/inactive auto-kinase. Immunoblot analysis with this phospho-specific antibody further revealed that the change in phosphorylation level of Thr402 of auto-kinase was well correlated with the activity change of the kinase during both autophosphorylation/activation and protein phosphatase-mediated dephosphorylation/inactivation processes. Taken together, our results identify Thr402 as the regulatory autophosphorylation site of auto-kinase, which is a C-terminal catalytic fragment of PAK2. PMID:9693111
Vickers, Timothy A.; Freier, Susan M.; Bui, Huynh-Hoa; Watt, Andrew; Crooke, Stanley T.
2014-01-01
A new strategy for identifying potent RNase H-dependent antisense oligonucleotides (ASOs) is presented. Our analysis of the human transcriptome revealed that a significant proportion of genes contain unique repeated sequences of 16 or more nucleotides in length. Activities of ASOs targeting these repeated sites in several representative genes were compared to those of ASOs targeting unique single sites in the same transcript. Antisense activity at repeated sites was also evaluated in a highly controlled minigene system. Targeting both native and minigene repeat sites resulted in significant increases in potency as compared to targeting of non-repeated sites. The increased potency at these sites is a result of increased frequency of ASO/RNA interactions which, in turn, increases the probability of a productive interaction between the ASO/RNA heteroduplex and human RNase H1 in the cell. These results suggest a new, highly efficient strategy for rapid identification of highly potent ASOs. PMID:25334092
Ahumedo, Maicol; Drosos, Juan Carlos; Vivas-Reyes, Ricardo
2014-05-01
Molecular docking methods were applied to simulate the coupling of a set of nineteen acyl homoserine lactone analogs into the binding site of the transcriptional receptor LasR. The best pose of each ligand was explored and a qualitative analysis of the possible interactions present in the complex was performed. From the results of the protein-ligand complex analysis, it was found that residues Tyr-64 and Tyr-47 are involved in important interactions, which mainly determine the antagonistic activity of the AHL analogues considered for this study. The effect of different substituents on the aromatic ring, the common structure to all ligands, was also evaluated focusing on how the interaction with the two previously mentioned tyrosine residues was affected. Electrostatic potential map calculations based on the electron density and the van der Waals radii were performed on all ligands to graphically aid in the explanation of the variation of charge density on their structures when the substituent on the aromatic ring is changed through the elements of the halogen group series. A quantitative approach was also considered and for that purpose the ONIOM method was performed to estimate the energy change in the different ligand-receptor complex regions. Those energy values were tested for their relationship with the corresponding IC50 in order to establish if there is any correlation between energy changes in the selected regions and the biological activity. The results obtained using the two approaches may contribute to the field of quorum sensing active molecules; the docking analysis revealed the role of some binding site residues involved in the formation of a halogen bridge with ligands. These interactions have been demonstrated to be responsible for the interruption of the signal propagation needed for the quorum sensing circuit. Using the other approach, the structure-activity relationship (SAR) analysis, it was possible to establish which structural characteristics and chemical requirements are necessary to classify a compound as a possible agonist or antagonist against the LasR binding site.
Sondossi, Hoda A.; Fairley, Helen C.
2014-01-01
The development of a one-dimensional flow-routing model for the Colorado River between Lees Ferry and Diamond Creek, Arizona in 2008 provided a potentially useful tool for assessing the degree to which varying discharges from Glen Canyon Dam may inundate terrestrial environments and potentially affect resources located within the zone of inundation. Using outputs from the model, a geographic information system analysis was completed to evaluate the degree to which flows from Glen Canyon Dam might inundate archaeological sites located along the Colorado River in the Grand Canyon. The analysis indicates that between 4 and 19 sites could be partially inundated by flows released from Glen Canyon Dam under current (2014) operating guidelines, and as many as 82 archaeological sites may have been inundated to varying degrees by uncontrolled high flows released in June 1983. Additionally, the analysis indicates that more of the sites currently (2014) proposed for active management by the National Park Service are located at low elevations and, therefore, tend to be more susceptible to potential inundation effects than sites not currently (2014) targeted for management actions, although the potential for inundation occurs in both groups of sites. Because of several potential sources of error and uncertainty associated with the model and with limitations of the archaeological data used in this analysis, the results are not unequivocal. These caveats, along with the fact that dam-related impacts can involve more than surface-inundation effects, suggest that the results of this analysis should be used with caution to infer potential effects of Glen Canyon Dam on archaeological sites in the Grand Canyon.
Meneghini, C; Morante, S
1998-01-01
A detailed study of the x-ray absorption spectrum of tetanus neurotoxin in the K-edge EXAFS region of the zinc absorber is presented that allows the complete identification of the amino acid residues coordinated to the zinc active site. A very satisfactory interpretation of the experimental data can be given if multiple scattering contributions are included in the analysis. Comparing the absorption spectrum of tetanus neurotoxin to that of two other structurally similar zinc-endopeptidases, thermolysin and astacin, in which the zinc coordination mode is known from crystallographic data, we conclude that in tetanus neurotoxin, besides a water molecule, zinc is coordinated to two histidines and a tyrosine. PMID:9746536
Diamond, Sam R; Sultana, Tamanna; Servos, Mark R; Metcalfe, Chris D
2016-09-01
Urban and agricultural activities may introduce chemical stressors, including contaminants of emerging concern (CECs) and current use pesticides (CUPs) into riverine systems. The objective of this study was to determine if fish collected from various sites in the Grand River, ON, Canada show biomarkers of exposure to these classes of contaminants, and if the biomarker patterns vary in fish collected from urbanized and agricultural sites. Female rainbow darters (Etheostoma caeruleum) and female fantail darters (Etheostoma flabellare) were collected from the Grand River in June, 2014 for biomarker analysis from two urbanized sites and three agricultural sites. Over the same period of time, Polar Organic Chemical Integrative Samplers (POCIS) were deployed for 2weeks at each site to monitor for the presence of CUPs and CECs. Data on the liver somatic index for darters indicate site-specific differences in this condition factor (p<0.05). Significant differences in the levels of thiobarbituric acid reactive substances (TBARS) in gill tissue (p<0.05) of darters collected from the various sites indicate site-specific differences in oxidative stress. The activities of ethoxyresorufin-O-deethylase (EROD) in the liver tissue of rainbow darters were significantly different between sites (p<0.05), indicating differences in exposure to chemicals that induce or inhibit CYP450 1A metabolic activity. Finally, acetylcholinesterase (AChE) activity in brain tissue was significantly different between rainbow darters collected from rural and urban sites (p<0.05). These data showing different impacts from chemical inputs related to land uses in the watershed may be useful in developing mitigation strategies to reduce impacts on fish and other aquatic organisms in receiving environments. Copyright © 2016. Published by Elsevier Inc.
230Th/U ages Supporting Hanford Site-Wide Probabilistic Seismic Hazard Analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paces, James B.
This product represents a USGS Administrative Report that discusses samples and methods used to conduct uranium-series isotope analyses and resulting ages and initial 234U/238U activity ratios of pedogenic cements developed in several different surfaces in the Hanford area middle to late Pleistocene. Samples were collected and dated to provide calibration of soil development in surface deposits that are being used in the Hanford Site-Wide probabilistic seismic hazard analysis conducted by AMEC. The report includes description of sample locations and physical characteristics, sample preparation, chemical processing and mass spectrometry, analytical results, and calculated ages for individual sites. Ages of innermost rindsmore » on a number of samples from five sites in eastern Washington are consistent with a range of minimum depositional ages from 17 ka for cataclysmic flood deposits to greater than 500 ka for alluvium at several sites.« less
UMTRA Project water sampling and analysis plan, Durango, Colorado. Revision 1
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1995-09-01
Planned, routine ground water sampling activities at the US Department of Energy (DOE) Uranium Mill Tailings Remedial Action (UMTRA) Project site in Durango, Colorado, are described in this water sampling and analysis plan. The plan identifies and justifies the sampling locations, analytical parameters, detection limits, and sampling frequency for the routine monitoring stations at the site. The ground water data are used to characterize the site ground water compliance strategies and to monitor contaminants of potential concern identified in the baseline risk assessment (DOE, 1995a). Regulatory basis for routine ground water monitoring at UMTRA Project sites is derived from themore » US EPA regulations in 40 CFR Part 192 (1994) and EPA standards of 1995 (60 FR 2854). Sampling procedures are guided by the UMTRA Project standard operating procedures (SOP) (JEG, n.d.), the Technical Approach Document (TAD) (DOE, 1989), and the most effective technical approach for the site.« less
Schmitt, Christopher J.; Caldwell, Colleen A.; Olsen, Bill; Serdar, Dave; Coffey, Mike
2002-01-01
We assessed the effects on fish of lead (Pb) released to streamsby smelters located in Trail, BC (Canada), E. Helena, MT, Herculaneum, MO, and Glover, MO. Fish were collected by electrofishing from sites located downstream of smelters and from reference sites. Blood from each fish was analyzed for δ-aminolevulinic acid dehydratase (ALAD) activity and hemoglobin (Hb), and samples of blood, liver, or carcass were analyzed for Pb, zinc (Zn), or both. Fish collected downstreamof all four smelters sites had elevated Pb concentrations, decreased ALAD activity, or both relative to their respectivereference sites. At E. Helena, fish from the downstream site also had lower Hb concentrations than fish from upstream. Differences among taxa were also apparent. Consistent with previous studies, ALAD activity in catostomids (Pisces: Catostomidae-northern hog sucker,Hypentelium nigricans;river carpsucker, Carpiodes carpio; largescale sucker, Catostomus macrocheilus; and mountain sucker, C. platyrhynchus) seemed more sensitive to Pb-induced ALADinhibition than the salmonids (Pisces: Salmonidae-rainbow trout,Oncorhynchus mykiss; brook trout,Salvelinus fontinalis) or common carp (Cyprinus carpio). Some of these differences may have resulted from differential accumulation of Zn, which was not measured at all sites. We detected noALAD activity in channel catfish (Ictaluruspunctatus) from either site on the Mississippi River at Herculaneum, MO. Our findings confirmed that Pb is releasedto aquatic ecosystems by smelters and accumulated by fish, andwe documented potentially adverse effects of Pb in fish. We recommend that Zn be measured along with Pb when ALAD activityis used as a biomarker and the collection of at least 10 fish ofa species at each site to facilitate statistical analysis.
Kang, J J; Yokoi, T J; Holland, M J
1995-12-01
The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.
Johnson, Joseph L; Cusack, Bernadette; Davies, Matthew P; Fauq, Abdul; Rosenberry, Terrone L
2003-05-13
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge, and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acyl enzyme intermediate is produced. A conformational interaction between the A- and P-sites has recently been found to modulate ligand affinities. We now demonstrate that this interaction is of functional importance by showing that the acetylation rate constant of a substrate bound to the A-site is increased by a factor a when a second molecule of substrate binds to the P-site. This demonstration became feasible through the introduction of a new acetanilide substrate analogue of acetylcholine, 3-(acetamido)-N,N,N-trimethylanilinium (ATMA), for which a = 4. This substrate has a low acetylation rate constant and equilibrates with the catalytic site, allowing a tractable algebraic solution to the rate equation for substrate hydrolysis. ATMA affinities for the A- and P-sites deduced from the kinetic analysis were confirmed by fluorescence titration with thioflavin T as a reporter ligand. Values of a >1 give rise to a hydrolysis profile called substrate activation, and the AChE site-specific mutant W86F, and to a lesser extent wild-type human AChE itself, showed substrate activation with acetylthiocholine as the substrate. Substrate activation was incorporated into a previous catalytic scheme for AChE in which a bound P-site ligand can also block product dissociation from the A-site, and two additional features of the AChE catalytic pathway were revealed. First, the ability of a bound P-site ligand to increase the substrate acetylation rate constant varied with the structure of the ligand: thioflavin T accelerated ATMA acetylation by a factor a(2) of 1.3, while propidium failed to accelerate. Second, catalytic rate constants in the initial intermediate formed during acylation (EAP, where EA is the acyl enzyme and P is the alcohol leaving group cleaved from the ester substrate) may be constrained such that the leaving group P must dissociate before hydrolytic deacylation can occur.
Double layer zinc-UDP coordination polymers: structure and properties.
Qiu, Qi-Ming; Gu, Leilei; Ma, Hongwei; Yan, Li; Liu, Minghua; Li, Hui
2018-05-17
A homochiral Zn-UDP coordination polymer with an alternating parallel ABAB sequence was constructed and studied by X-ray single crystal diffraction analysis. Its crystal structure shows that there are potentially open sites in the 2D layers. The activation of the sites makes the coordination polymer a fluorescent sensor for novel heterogeneous detection of amino acids.
Community Indicators: A Framework for Observing and Supporting Community Activity on Cloudworks
ERIC Educational Resources Information Center
Galley, Rebecca; Conole, Gráinne; Alevizou, Panagiota
2014-01-01
Cloudworks (Cloudworks.ac.uk) is a social networking site designed for sharing, finding and discussing learning and teaching ideas and experiences. Design and development of the site has been based on an iterative analysis, development and implementation approach, underpinned by ongoing research and evaluation. To this end, we have been seeking to…
Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M
2013-03-19
Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.
Kots, Ekaterina D; Lushchekina, Sofya V; Varfolomeev, Sergey D; Nemukhin, Alexander V
2017-08-28
The results of molecular modeling suggest a mechanism of allosteric inhibition upon hydrolysis of N-acetyl-aspartate (NAA), one of the most abundant amino acid derivatives in brain, by human aspartoacylase (hAsp). Details of this reaction are important to suggest the practical ways to control the enzyme activity. Search for allosteric sites using the Allosite web server and SiteMap analysis allowed us to identify substrate binding pockets located at the interface between the subunits of the hAsp dimer molecule. Molecular docking of NAA to the pointed areas at the dimer interface predicted a specific site, in which the substrate molecule interacts with the Gly237, Arg233, Glu290, and Lys292 residues. Analysis of multiple long-scaled molecular dynamics trajectories (the total simulation time exceeded 1.5 μs) showed that binding of NAA to the identified allosteric site induced significant rigidity to the protein loops with the amino acid side chains forming gates to the enzyme active site. Application of the protein dynamical network algorithms showed that substantial reorganization of the signal propagation pathways of intersubunit communication in the dimer occurred upon allosteric NAA binding to the remote site. The modeling approaches provide an explanation to the observed decrease of the reaction rate of NAA hydrolysis by hAsp at high substrate concentrations.
Wu, M S; Higuchi, W I; Fox, J L; Friedman, M
1976-01-01
The model given in this report and the rotating disk method provide a useful combination in the study of dental enamel and hydroxyapatite dissolution kinetics. The present approach is a significant improvement over earlier studies, and both the ionic activity product that governs the dissolution reaction and the apparent surface dissolution reaction rate constant may be simultaneously obtained. Thus, these investigations have established the baseline for the dissolution rate studies under sink conditions. Concurrent studies, under conditions where the acidic buffer mediums are partially saturated with respect to hydroxyapatite have shown another dissolution site for hydroxyapatite that operates at a higher ionic activity product but has a much smaller apparent surface reaction rate constant. This has raised the question of whether the presence of this second site may interfere with the proper theoretical analysis of the experimental results obtained under sink conditions. A preliminary analysis of the two-site model has shown that the dissolution kinetics of hydroxyapatite under sink conditions is almost completely governed by the sink condition site (KHAP = 10(-124.5), k' = 174) established in this report. The difference between the predicted dissolution rate for the one-site model and the two-site model are generally of the order of 4 to 5% where the experiments are conducted under sink conditions and over the range of variables covered in the present study.
Mathupala, S P; Lowe, S E; Podkovyrov, S M; Zeikus, J G
1993-08-05
The complete nucleotide sequence of the gene encoding the dual active amylopullulanase of Thermoanaerobacter ethanolicus 39E (formerly Clostridium thermohydrosulfuricum) was determined. The structural gene (apu) contained a single open reading frame 4443 base pairs in length, corresponding to 1481 amino acids, with an estimated molecular weight of 162,780. Analysis of the deduced sequence of apu with sequences of alpha-amylases and alpha-1,6 debranching enzymes enabled the identification of four conserved regions putatively involved in substrate binding and in catalysis. The conserved regions were localized within a 2.9-kilobase pair gene fragment, which encoded a M(r) 100,000 protein that maintained the dual activities and thermostability of the native enzyme. The catalytic residues of amylopullulanase were tentatively identified by using hydrophobic cluster analysis for comparison of amino acid sequences of amylopullulanase and other amylolytic enzymes. Asp597, Glu626, and Asp703 were individually modified to their respective amide form, or the alternate acid form, and in all cases both alpha-amylase and pullulanase activities were lost, suggesting the possible involvement of 3 residues in a catalytic triad, and the presence of a putative single catalytic site within the enzyme. These findings substantiate amylopullulanase as a new type of amylosaccharidase.
Roles of s3 site residues of nattokinase on its activity and substrate specificity.
Wu, Shuming; Feng, Chi; Zhong, Jin; Huan, Liandong
2007-09-01
Nattokinase (Subtilisin NAT, NK) is a bacterial serine protease with high fibrinolytic activity. To probe their roles on protease activity and substrate specificity, three residues of S3 site (Gly(100), Ser(101) and Leu(126)) were mutated by site-directed mutagenesis. Kinetics parameters of 20 mutants were measured using tetrapeptides as substrates, and their fibrinolytic activities were determined by fibrin plate method. Results of mutation analysis showed that Gly(100) and Ser(101) had reverse steric and electrostatic effects. Residues with bulky or positively charged side chains at position 100 decreased the substrate binding and catalytic activity drastically, while residues with the same characters at position 101 could obviously enhance protease and fibrinolytic activity of NK. Mutation of Leu(126) might impair the structure of the active cleft and drastically decreased the activity of NK. Kinetics studies of the mutants showed that S3 residues were crucial to keep protease activity while they moderately affected substrate specificity of NK. The present study provided some original insight into the P3-S3 interaction in NK and other subtilisins, as well as showed successful protein engineering cases to improve NK as a potential therapeutic agent.
Dumuid, Dorothea; Olds, T; Lewis, L K; Martin-Fernández, J A; Barreira, T; Broyles, S; Chaput, J-P; Fogelholm, M; Hu, G; Kuriyan, R; Kurpad, A; Lambert, E V; Maia, J; Matsudo, V; Onywera, V O; Sarmiento, O L; Standage, M; Tremblay, M S; Tudor-Locke, C; Zhao, P; Katzmarzyk, P; Gillison, F; Maher, C
2018-02-01
The relationship between children's adiposity and lifestyle behaviour patterns is an area of growing interest. The objectives of this study are to identify clusters of children based on lifestyle behaviours and compare children's adiposity among clusters. Cross-sectional data from the International Study of Childhood Obesity, Lifestyle and the Environment were used. the participants were children (9-11 years) from 12 nations (n = 5710). 24-h accelerometry and self-reported diet and screen time were clustering input variables. Objectively measured adiposity indicators were waist-to-height ratio, percent body fat and body mass index z-scores. sex-stratified analyses were performed on the global sample and repeated on a site-wise basis. Cluster analysis (using isometric log ratios for compositional data) was used to identify common lifestyle behaviour patterns. Site representation and adiposity were compared across clusters using linear models. Four clusters emerged: (1) Junk Food Screenies, (2) Actives, (3) Sitters and (4) All-Rounders. Countries were represented differently among clusters. Chinese children were over-represented in Sitters and Colombian children in Actives. Adiposity varied across clusters, being highest in Sitters and lowest in Actives. Children from different sites clustered into groups of similar lifestyle behaviours. Cluster membership was linked with differing adiposity. Findings support the implementation of activity interventions in all countries, targeting both physical activity and sedentary time. © 2016 World Obesity Federation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
2003-08-06
This Proposed Plan (PP) presents the preferred alternative for addressing contaminated groundwater and springs at the Chemical Plant area of the Weldon Spring site, in Weldon Spring, Missouri. The site is located about 30 mi west of St. Louis, in St. Charles County (Figure 1). This proposed action constitutes the final remedial action for the Weldon Spring site. The residual contamination in groundwater and springs at the Chemical Plant area is the only remaining contamination that needs to be addressed for the site. All other contamination has been addressed by previous remedial actions. After this remedial action is implemented, long-termmore » surveillance and maintenance activities will maintain the effectiveness of all remedial actions conducted at the Weldon Spring site, including this final remedial action for groundwater and springs that is being proposed in this plan. DOE complies with the requirements of the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) in conducting remedial activities at the site. National Environmental Policy Act (NEPA) values have been incorporated into the CERCLA process; that is, the analysis conducted and presented in the remedial investigation/feasibility study (RI/FS) reports included an evaluation of environmental impacts that is comparable to that performed under NEPA. This PP is required under CERCLA to (1) notify the public and present a brief analysis of the remedial action alternatives, (2) identify and present the rationale for the preferred remedial action alternative identified in the PP, (3) summarize key information from the RI/FS evaluations, including the Baseline Risk Assessment (BRA), and (4) inform the public of its role in the remedy selection process and give the public the opportunity to participate in the process. Remediation activities at the Weldon Spring site have been coordinated with the U.S. Environmental Protection Agency (EPA) and the Missouri Department of Natural Resources (MDNR). The EPA has overall oversight and approval authority, with consultation provided by the MDNR. A range of alternatives was considered in identifying the preferred alternative. The alternatives were developed after careful analysis of geological, environmental, and human health and ecological risk data and an evaluation of the effectiveness, implementability, and cost of the various technologies available for groundwater remediation at the Chemical Plant area. Monitored natural attenuation (MNA) coupled with institutional controls (ICs) and contingency activities has been selected as the preferred alternative.« less
Mutational Analysis of Escherichia coli MoeA: Two Functional Activities Map to the Active Site Cleft
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nichols,J.; Xiang, S.; Schindelin, H.
2007-01-01
The molybdenum cofactor is ubiquitous in nature, and the pathway for Moco biosynthesis is conserved in all three domains of life. Recent work has helped to illuminate one of the most enigmatic steps in Moco biosynthesis, ligation of metal to molybdopterin (the organic component of the cofactor) to form the active cofactor. In Escherichia coli, the MoeA protein mediates ligation of Mo to molybdopterin while the MogA protein enhances this process in an ATP-dependent manner. The X-ray crystal structures for both proteins have been previously described as well as two essential MogA residues, Asp49 and Asp82. Here we describe amore » detailed mutational analysis of the MoeA protein. Variants of conserved residues at the putative active site of MoeA were analyzed for a loss of function in two different, previously described assays, one employing moeA{sup -} crude extracts and the other utilizing a defined system. Oddly, no correlation was observed between the activity in the two assays. In fact, our results showed a general trend toward an inverse relationship between the activity in each assay. Moco binding studies indicated a strong correlation between a variant's ability to bind Moco and its activity in the purified component assay. Crystal structures of the functionally characterized MoeA variants revealed no major structural changes, indicating that the functional differences observed are not due to disruption of the protein structure. On the basis of these results, two different functional areas were assigned to regions at or near the MoeA active site cleft.« less
Building a Prototype of LHC Analysis Oriented Computing Centers
NASA Astrophysics Data System (ADS)
Bagliesi, G.; Boccali, T.; Della Ricca, G.; Donvito, G.; Paganoni, M.
2012-12-01
A Consortium between four LHC Computing Centers (Bari, Milano, Pisa and Trieste) has been formed in 2010 to prototype Analysis-oriented facilities for CMS data analysis, profiting from a grant from the Italian Ministry of Research. The Consortium aims to realize an ad-hoc infrastructure to ease the analysis activities on the huge data set collected at the LHC Collider. While “Tier2” Computing Centres, specialized in organized processing tasks like Monte Carlo simulation, are nowadays a well established concept, with years of running experience, site specialized towards end user chaotic analysis activities do not yet have a defacto standard implementation. In our effort, we focus on all the aspects that can make the analysis tasks easier for a physics user not expert in computing. On the storage side, we are experimenting on storage techniques allowing for remote data access and on storage optimization on the typical analysis access patterns. On the networking side, we are studying the differences between flat and tiered LAN architecture, also using virtual partitioning of the same physical networking for the different use patterns. Finally, on the user side, we are developing tools and instruments to allow for an exhaustive monitoring of their processes at the site, and for an efficient support system in case of problems. We will report about the results of the test executed on different subsystem and give a description of the layout of the infrastructure in place at the site participating to the consortium.
Glutamine 89 is a key residue in the allosteric modulation of human serine racemase activity by ATP.
Canosa, Andrea V; Faggiano, Serena; Marchetti, Marialaura; Armao, Stefano; Bettati, Stefano; Bruno, Stefano; Percudani, Riccardo; Campanini, Barbara; Mozzarelli, Andrea
2018-06-13
Serine racemase (SR) catalyses two reactions: the reversible racemisation of L-serine and the irreversible dehydration of L- and D-serine to pyruvate and ammonia. SRs are evolutionarily related to serine dehydratases (SDH) and degradative threonine deaminases (TdcB). Most SRs and TdcBs - but not SDHs - are regulated by nucleotides. SR binds ATP cooperatively and the nucleotide allosterically stimulates the serine dehydratase activity of the enzyme. A H-bond network comprising five residues (T52, N86, Q89, E283 and N316) and water molecules connects the active site with the ATP-binding site. Conservation analysis points to Q89 as a key residue for the allosteric communication, since its mutation to either Met or Ala is linked to the loss of control of activity by nucleotides. We verified this hypothesis by introducing the Q89M and Q89A point mutations in the human SR sequence. The allosteric communication between the active site and the allosteric site in both mutants is almost completely abolished. Indeed, the stimulation of the dehydratase activity by ATP is severely diminished and the binding of the nucleotide is no more cooperative. Ancestral state reconstruction suggests that the allosteric control by nucleotides established early in SR evolution and has been maintained in most eukaryotic lineages.
Passamaneck, Yale J; Katikala, Lavanya; Perrone, Lorena; Dunn, Matthew P; Oda-Ishii, Izumi; Di Gregorio, Anna
2009-11-01
The notochord is a defining feature of the chordate body plan. Experiments in ascidian, frog and mouse embryos have shown that co-expression of Brachyury and FoxA class transcription factors is required for notochord development. However, studies on the cis-regulatory sequences mediating the synergistic effects of these transcription factors are complicated by the limited knowledge of notochord genes and cis-regulatory modules (CRMs) that are directly targeted by both. We have identified an easily testable model for such investigations in a 155-bp notochord-specific CRM from the ascidian Ciona intestinalis. This CRM contains functional binding sites for both Ciona Brachyury (Ci-Bra) and FoxA (Ci-FoxA-a). By combining point mutation analysis and misexpression experiments, we demonstrate that binding of both transcription factors to this CRM is necessary and sufficient to activate transcription. To gain insights into the cis-regulatory criteria controlling its activity, we investigated the organization of the transcription factor binding sites within the 155-bp CRM. The 155-bp sequence contains two Ci-Bra binding sites with identical core sequences but opposite orientations, only one of which is required for enhancer activity. Changes in both orientation and spacing of these sites substantially affect the activity of the CRM, as clusters of identical sites found in the Ciona genome with different arrangements are unable to activate transcription in notochord cells. This work presents the first evidence of a synergistic interaction between Brachyury and FoxA in the activation of an individual notochord CRM, and highlights the importance of transcription factor binding site arrangement for its function.
Poulton, Barry C.; Allert, Ann L.; Besser, John M.; Schmitt, Christopher J.; Brumbaugh, William G.; Fairchild, James F.
2010-01-01
The Viburnum Trend lead-zinc mining subdistrict is located in the southeast Missouri portion of the Ozark Plateau. In 2003 and 2004, we assessed the ecological effects of mining in several watersheds in the region. We included macroinvertebrate surveys, habitat assessments, and analysis of metals in sediment, pore water, and aquatic biota. Macroinvertebrates were sampled at 21 sites to determine aquatic life impairment status (full, partial, or nonsupport) and relative biotic condition scores. Macroinvertebrate biotic condition scores were significantly correlated with cadmium, nickel, lead, zinc, and specific conductance in 2003 (r = -0.61 to -0.68) and with cadmium, lead, and pore water toxic units in 2004 (r = -0.55 to -0.57). Reference sites were fully supporting of aquatic life and had the lowest metals concentrations and among the highest biotic condition scores in both years. Sites directly downstream from mining and related activities were partially supporting, with biotic condition scores 10% to 58% lower than reference sites. Sites located greater distances downstream from mining activities had intermediate scores and concentrations of metals. Results indicate that elevated concentrations of metals originating from mining activities were the underlying cause of aquatic life impairment in several of the streams studied. There was general concurrence among the adversely affected sites in how the various indicators responded to mining activities during the overall study.
Iron binding to human heavy-chain ferritin.
Pozzi, Cecilia; Di Pisa, Flavio; Bernacchioni, Caterina; Ciambellotti, Silvia; Turano, Paola; Mangani, Stefano
2015-09-01
Maxi-ferritins are ubiquitous iron-storage proteins with a common cage architecture made up of 24 identical subunits of five α-helices that drive iron biomineralization through catalytic iron(II) oxidation occurring at oxidoreductase sites (OS). Structures of iron-bound human H ferritin were solved at high resolution by freezing ferritin crystals at different time intervals after exposure to a ferrous salt. Multiple binding sites were identified that define the iron path from the entry ion channels to the oxidoreductase sites. Similar data are available for another vertebrate ferritin: the M protein from Rana catesbeiana. A comparative analysis of the iron sites in the two proteins identifies new reaction intermediates and underlines clear differences in the pattern of ligands that define the additional iron sites that precede the oxidoreductase binding sites along this path. Stopped-flow kinetics assays revealed that human H ferritin has different levels of activity compared with its R. catesbeiana counterpart. The role of the different pattern of transient iron-binding sites in the OS is discussed with respect to the observed differences in activity across the species.
Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H
1999-10-28
We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.
Liepe, Juliane; Holzhütter, Hermann-Georg; Bellavista, Elena; Kloetzel, Peter M; Stumpf, Michael PH; Mishto, Michele
2015-01-01
Proteasomal protein degradation is a key determinant of protein half-life and hence of cellular processes ranging from basic metabolism to a host of immunological processes. Despite its importance the mechanisms regulating proteasome activity are only incompletely understood. Here we use an iterative and tightly integrated experimental and modelling approach to develop, explore and validate mechanistic models of proteasomal peptide-hydrolysis dynamics. The 20S proteasome is a dynamic enzyme and its activity varies over time because of interactions between substrates and products and the proteolytic and regulatory sites; the locations of these sites and the interactions between them are predicted by the model, and experimentally supported. The analysis suggests that the rate-limiting step of hydrolysis is the transport of the substrates into the proteasome. The transport efficiency varies between human standard- and immuno-proteasomes thereby impinging upon total degradation rate and substrate cleavage-site usage. DOI: http://dx.doi.org/10.7554/eLife.07545.001 PMID:26393687
NASA Astrophysics Data System (ADS)
Pilz, Marco; Parolai, Stefano; Leyton, Felipe; Campos, Jaime; Zschau, Jochen
2009-08-01
Situated in an active tectonic region, Santiago de Chile, the country's capital with more than six million inhabitants, faces tremendous earthquake risk. Macroseismic data for the 1985 Valparaiso event show large variations in the distribution of damage to buildings within short distances, indicating strong effects of local sediments on ground motion. Therefore, a temporary seismic network was installed in the urban area for recording earthquake activity and a study was carried out aiming to estimate site amplification derived from horizontal-to-vertical (H/V) spectral ratios from earthquake data (EHV) and ambient noise (NHV), as well as using the standard spectral ratio (SSR) technique with a nearby reference station located on igneous rock. The results lead to the following conclusions: (1) The analysis of earthquake data shows significant dependence on the local geological structure with respect to amplitude and duration. (2) An amplification of ground motion at frequencies higher than the fundamental one can be found. This amplification would not be found when looking at NHV ratios alone. (3) The analysis of NHV spectral ratios shows that they can only provide a lower bound in amplitude for site amplification. (4) P-wave site responses always show lower amplitudes than those derived by S waves, and sometimes even fail to provide some frequencies of amplification. (5) No variability in terms of time and amplitude is observed in the analysis of the H/V ratio of noise. (6) Due to the geological conditions in some parts of the investigated area, the fundamental resonance frequency of a site is difficult to estimate following standard criteria proposed by the SESAME consortium, suggesting that these are too restrictive under certain circumstances.
Mutational analysis of the major soybean UreF paralogue involved in urease activation
USDA-ARS?s Scientific Manuscript database
In soybean, mutation at Eu2 or Eu3 eliminates the urease activities of both the embryo-specific and the tissue-ubiquitous (assimilatory) isozymes, encoded by Eu1 and Eu4, respectively. Eu3 encodes UreG, a GTP’ase necessary for proper emplacement of Ni and carbon dioxide in the urease active site. ...
Substrate uptake and protein stability relationship in mammalian histidine decarboxylase.
Pino-Angeles, A; Morreale, A; Negri, A; Sánchez-Jiménez, F; Moya-García, A A
2010-01-01
There is some evidence linking the substrate entrance in the active site of mammalian histidine decarboxylase and an increased stability against proteolytic degradation. In this work, we study the basis of this relationship by means of protein structure network analysis and molecular dynamics simulations. We find that the substrate binding to the active site influences the conformation of a flexible region sensible to proteolytic degradation and observe how formation of the Michaelis-Menten complex increases stability in the conformation of this region. (c) 2009 Wiley-Liss, Inc.
Brasil, Edikarlos M; Canavieira, Luciana M; Cardoso, Érica T C; Silva, Edilene O; Lameira, Jerônimo; Nascimento, José L M; Eifler-Lima, Vera L; Macchi, Barbarella M; Sriram, Dharmarajan; Bernhardt, Paul V; Silva, José Rogério Araújo; Williams, Craig M; Alves, Cláudio N
2017-11-01
Inhibition of mushroom tyrosinase was observed with synthetic dihydropyrano[3,2-b]chromenediones. Among them, DHPC04 displayed the most potent tyrosinase inhibitory activity with a K i value of 4 μm, comparable to the reference standard inhibitor kojic acid. A kinetic study suggested that these synthetic heterocyclic compounds behave as competitive inhibitors for the L-DOPA binding site of the enzyme. Furthermore, molecular modeling provided important insight into the mechanism of binding interactions with the tyrosinase copper active site. © 2017 John Wiley & Sons A/S.
Huang, Bau-Lin; Brugger, Sean M; Lyons, Karen M
2010-09-03
CCN2/connective tissue growth factor is highly expressed in hypertrophic chondrocytes and is required for chondrogenesis. However, the transcriptional mechanisms controlling its expression in cartilage are largely unknown. The activity of the Ccn2 promoter was, therefore, investigated in osteochondro-progenitor cells and hypertrophic chondrocytes to ascertain these mechanisms. Sox9 and T-cell factor (TCF) x lymphoid enhancer factor (LEF) factors contain HMG domains and bind to related consensus sites. TCF x LEF factors are normally repressive but when bound to DNA in a complex with beta-catenin become activators of gene expression. In silico analysis of the Ccn2 proximal promoter identified multiple consensus TCF x LEF elements, one of which was also a consensus binding site for Sox9. Using luciferase reporter constructs, the TCF x LEF x Sox9 site was found to be involved in stage-specific expression of Ccn2. Luciferase, electrophoretic mobility shift assay (EMSA), and ChIP analysis revealed that Sox9 represses Ccn2 expression by binding to the consensus TCF x LEF x Sox9 site. On the other hand, the same assays showed that in hypertrophic chondrocytes, TCF x LEF x beta-catenin complexes occupy the consensus TCF x LEF x Sox9 site and activate Ccn2 expression. Furthermore, transgenic mice in which lacZ expression is driven under the control of the proximal Ccn2 promoter revealed that the proximal Ccn2 promoter responded to Wnt signaling in cartilage. Hence, we propose that differential occupancy of the TCF x LEF x Sox9 site by Sox9 versus beta-catenin restricts high levels of Ccn2 expression to hypertrophic chondrocytes.
McCormick, Michael S.; Lippard, Stephen J.
2011-01-01
In all structurally characterized bacterial multicomponent monooxygenase (BMM) hydroxylase proteins, a series of hydrophobic cavities in the α-subunit trace a conserved path from the protein exterior to the carboxylate-bridged diiron active site. The present study examines these cavities as a potential route for dioxygen transport to the active site by crystallographic characterization of a xenon-pressurized sample of the hydroxylase component of phenol hydroxylase from Pseudomonas sp. OX1. Computational analyses of the hydrophobic cavities in the hydroxylase α-subunits of phenol hydroxylase (PHH), toluene/o-xylene monooxygenase (ToMOH), and soluble methane monooxygenase (sMMOH) are also presented. The results, together with previous findings from crystallographic studies of xenon-pressurized sMMO hydroxylase, clearly identify the propensity for these cavities to bind hydrophobic gas molecules in the protein interior. This proposed functional role is supported by recent stopped flow kinetic studies of ToMOH variants (Song, et al., 2011). In addition to information about the Xe sites, the structure determination revealed significantly reduced regulatory protein binding to the hydroxylase in comparison to the previously reported structure of PHH, as well as the presence of a newly identified metal binding site in the α-subunit that adopts a linear coordination environment consistent with Cu(I), and a glycerol molecule bound to Fe1 in a fashion that is unique among hydrocarbon-diiron site adducts reported to date in BMM hydroxylase structures. Finally, a comparative analysis of the α-subunit structures of MMOH, ToMOH, and PHH details proposed routes for the other three BMM substrates, the hydrocarbon, electrons, and protons, comprising cavities, channels, hydrogen-bonding networks, and pores in the structures of their α-subunits. PMID:22136180
Interim Draft: Biological Sampling and Analysis Plan Outline ...
Standard Operation Procedures This interim sampling and analysis plan (SAP) outline was developed specifically as an outline of the output that will be generated by a developing on-line tool called the MicroSAP. The goal of the MicroSAP tool is to assist users with development of SAPs needed for site characterization, verification sampling, and post decontamination sampling stages of biological sampling and analysis activities in which the EPA would be responsible for conducting sampling. These activities could include sampling and analysis for a biological contamination incident, a research study, or an exercise. The development of this SAP outline did not consider the initial response of an incident, as it is assumed that the initial response would have been previously completed by another agency during the response, or the clearance phase, as it is assumed that separate committee would be established to make decisions regarding clearing a site. This outline also includes considerations for capturing the associated data quality objectives in the SAP.
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1995-08-01
During the first half of fiscal year 1995, most activities at the Yucca Mountain Site Characterization Project were directed at implementing the Program Plan developed by the Office of Civilian Radioactive Waste Management. The Plan is designed to enable the Office to make measurable and significant progress toward key objectives over the next five years within the financial resources that can be realistically expected. Activities this period focused on the immediate goal of determining by 1998 whether Yucca Mountain, Nevada, is technically suitable as a possible site for a geologic repository for the permanent disposal of spent nuclear fuel andmore » high-level radioactive waste. Work on the Project advanced in several critical areas, including programmatic activities such as issuing the Program Plan, completing the first technical basis report to support the assessment of three 10 CFR 960 guidelines, developing the Notice of Intent for the Environmental Impact Statement, submitting the License Application Annotated Outline, and beginning a rebaselining effort to conform with the goals of the Program Plan. Scientific investigation and analysis of the site and design and construction activities to support the evaluation of the technical suitability of the site also advanced. Specific details relating to all Project activities and reports generated are presented in this report.« less
Heyes, Logan C; Reichau, Sebastian; Cross, Penelope J; Jameson, Geoffrey B; Parker, Emily J
2014-12-01
3-Deoxy-d-arabino-heptulosonate 7-phosphate synthase (DAH7PS) catalyses the first committed step of the shikimate pathway, which produces the aromatic amino acids as well as many other aromatic metabolites. DAH7PS catalyses an aldol-like reaction between phosphoenolpyruvate and erythrose 4-phosphate. Three phosphoenolpyruvate mimics, (R)-phospholactate, (S)-phospholactate and vinyl phosphonate [(E)-2-methyl-3-phosphonoacrylate], were found to competitively inhibit DAH7PS from Neisseria meningitidis, which is the pathogen responsible for bacterial meningitis. The most potent inhibitor was the vinyl phosphonate with a Ki value of 3.9±0.4μM. We report for the first time crystal structures of these compounds bound in the active site of a DAH7PS enzyme which reveals that the inhibitors bind to the active site of the enzyme in binding modes that mimic those of the predicted oxocarbenium and tetrahedral intermediates of the enzyme-catalysed reaction. Furthermore, the inhibitors accommodate the binding of a key active site water molecule. Together, these observations provide strong evidence that this active site water participates directly in the DAH7PS reaction, enabling the facial selectivity of the enzyme-catalysed reaction sequence to be delineated. Copyright © 2014 Elsevier Inc. All rights reserved.
Recent Experience Using Active Love Wave Techniques to Characterize Seismographic Station Sites
NASA Astrophysics Data System (ADS)
Martin, A. J.; Yong, A.; Salomone, L.
2014-12-01
Active-source Love waves recorded by the multi-channel analysis of surface wave (MASLW) technique were recently analyzed in two site characterization projects. Between 2010 and 2011, the 2009 American Recovery and Reinvestment Act (ARRA) funded GEOVision to conduct geophysical investigations at 189 seismographic stations—185 in California and 4 in the Central Eastern U.S. (CEUS). The original project plan was to utilize active and passive Rayleigh wave-based techniques to obtain shear-wave velocity (VS) profiles to a minimum depth of 30 m and the time-averaged VS of the upper 30 meters (VS30). Early in the investigation it became evident that Rayleigh wave techniques, such as multi-channel analysis of surface waves (MASRW), were not effective at characterizing all sites. Shear-wave seismic refraction and MASLW techniques were therefore applied. The MASLW technique was deployed at a total of 38 sites, in addition to other methods, and used as the primary technique to characterize 22 sites, 5 of which were also characterized using Rayleigh wave techniques. In 2012, the Electric Power Research Institute funded characterization of 33 CEUS station sites. Based on experience from the ARRA investigation, both MASRW and MASLW data were acquired by GEOVision at 24 CEUS sites—the remaining 9 sites and 2 overlapping sites were characterized by University of Texas, Austin. Of the 24 sites characterized by GEOVision, 16 were characterized using MASLW data, 4 using both MASLW and MASRW data and 4 using MASRW data. Love wave techniques were often found to perform better, or at least yield phase velocity data that could be more readily modeled using the fundamental mode assumption, at shallow rock sites, sites with steep velocity gradients, and, sites with a thin, low velocity, surficial soil layer overlying stiffer sediments. These types of velocity structure often excite dominant higher modes in Rayleigh wave data, but not in Love wave data. At such sites, it may be possible to model Rayleigh wave data using multi- or effective-mode techniques; however, in many cases extraction of adequate Rayleigh wave dispersion data for modeling was difficult. These results imply that field procedures should include careful scrutiny of Rayleigh wave-based dispersion data in order to collect Love wave data when warranted.
Frahm, Ken Steffen; Mørch, Carsten Dahl; Grill, Warren M; Andersen, Ole Kæseler
2013-09-01
During electrocutaneous stimulations, variation in skin properties across locations can lead to differences in neural activation. However, little focus has been given to the effect of different skin thicknesses on neural activation. Electrical stimulation was applied to six sites across the sole of the foot. The intensities used were two and four times perception threshold. The subjects (n = 8) rated the perception quality and intensity using the McGill Pain Questionnaire and a visual analog scale (VAS). A finite element model was developed and combined with the activation function (AF) to estimate neural activation. Electrical stimulation was perceived as significantly less sharp at the heel compared to all other sites, except one site in the forefoot (logistic regression, p < 0.05). The VAS scores were significantly higher in the arch than at the heel (RM ANOVA, p < 0.05). The model showed that the AF was between 91 and 231 % higher at the five other sites than at the heel. The differences in perception across the sole of the foot indicated that the CNS received different inputs depending on the stimulus site. The lower AF at the heel indicated that the skin thicknesses could contribute to the perceived differences.
Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard
2017-07-05
Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jackson, Colin J.; Hadler, Kieran S.; Carr, Paul D.
2011-09-28
The structure of a malonate-bound form of the glycerophosphodiesterase from Enterobacter aerogenes, GpdQ, has been refined at a resolution of 2.2 {angstrom} to a final R factor of 17.1%. The structure was originally solved to 2.9 {angstrom} resolution using SAD phases from Zn{sup 2+} metal ions introduced into the active site of the apoenzyme [Jackson et al. (2007), J. Mol. Biol. 367, 1047-1062]. However, the 2.9 {angstrom} resolution was insufficient to discern significant details of the architecture of the binuclear metal centre that constitutes the active site. Furthermore, kinetic analysis revealed that the enzyme lost a significant amount of activitymore » in the presence of Zn2+, suggesting that it is unlikely to be a catalytically relevant metal ion. In this communication, a higher resolution structure of GpdQ is presented in which malonate is visibly coordinated in the active site and analysis of the native metal-ion preference is presented using atomic absorption spectroscopy and anomalous scattering. Catalytic implications of the structure and its Fe{sup 2+} metal-ion preference are discussed.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jackson, Colin J.; Hadler, Kieran S.; Carr, Paul D.
2010-09-20
The structure of a malonate-bound form of the glycerophosphodiesterase from Enterobacter aerogenes, GpdQ, has been refined at a resolution of 2.2 {angstrom} to a final R factor of 17.1%. The structure was originally solved to 2.9 {angstrom} resolution using SAD phases from Zn{sup 2+} metal ions introduced into the active site of the apoenzyme [Jackson et al. (2007), J. Mol. Biol. 367, 1047-1062]. However, the 2.9 {angstrom} resolution was insufficient to discern significant details of the architecture of the binuclear metal centre that constitutes the active site. Furthermore, kinetic analysis revealed that the enzyme lost a significant amount of activitymore » in the presence of Zn{sup 2+}, suggesting that it is unlikely to be a catalytically relevant metal ion. In this communication, a higher resolution structure of GpdQ is presented in which malonate is visibly coordinated in the active site and analysis of the native metal-ion preference is presented using atomic absorption spectroscopy and anomalous scattering. Catalytic implications of the structure and its Fe{sup 2+} metal-ion preference are discussed.« less
Feng, You; Maity, Ranjan; Whitelegge, Julian P.; Hadjikyriacou, Andrea; Li, Ziwei; Zurita-Lopez, Cecilia; Al-Hadid, Qais; Clark, Amander T.; Bedford, Mark T.; Masson, Jean-Yves; Clarke, Steven G.
2013-01-01
The mammalian protein arginine methyltransferase 7 (PRMT7) has been implicated in roles of transcriptional regulation, DNA damage repair, RNA splicing, cell differentiation, and metastasis. However, the type of reaction that it catalyzes and its substrate specificity remain controversial. In this study, we purified a recombinant mouse PRMT7 expressed in insect cells that demonstrates a robust methyltransferase activity. Using a variety of substrates, we demonstrate that the enzyme only catalyzes the formation of ω-monomethylarginine residues, and we confirm its activity as the prototype type III protein arginine methyltransferase. This enzyme is active on all recombinant human core histones, but histone H2B is a highly preferred substrate. Analysis of the specific methylation sites within intact histone H2B and within H2B and H4 peptides revealed novel post-translational modification sites and a unique specificity of PRMT7 for methylating arginine residues in lysine- and arginine-rich regions. We demonstrate that a prominent substrate recognition motif consists of a pair of arginine residues separated by one residue (RXR motif). These findings will significantly accelerate substrate profile analysis, biological function study, and inhibitor discovery for PRMT7. PMID:24247247
Feng, You; Maity, Ranjan; Whitelegge, Julian P; Hadjikyriacou, Andrea; Li, Ziwei; Zurita-Lopez, Cecilia; Al-Hadid, Qais; Clark, Amander T; Bedford, Mark T; Masson, Jean-Yves; Clarke, Steven G
2013-12-27
The mammalian protein arginine methyltransferase 7 (PRMT7) has been implicated in roles of transcriptional regulation, DNA damage repair, RNA splicing, cell differentiation, and metastasis. However, the type of reaction that it catalyzes and its substrate specificity remain controversial. In this study, we purified a recombinant mouse PRMT7 expressed in insect cells that demonstrates a robust methyltransferase activity. Using a variety of substrates, we demonstrate that the enzyme only catalyzes the formation of ω-monomethylarginine residues, and we confirm its activity as the prototype type III protein arginine methyltransferase. This enzyme is active on all recombinant human core histones, but histone H2B is a highly preferred substrate. Analysis of the specific methylation sites within intact histone H2B and within H2B and H4 peptides revealed novel post-translational modification sites and a unique specificity of PRMT7 for methylating arginine residues in lysine- and arginine-rich regions. We demonstrate that a prominent substrate recognition motif consists of a pair of arginine residues separated by one residue (RXR motif). These findings will significantly accelerate substrate profile analysis, biological function study, and inhibitor discovery for PRMT7.
Lohning, Anna E; Marx, Wolfgang; Isenring, Liz
2016-11-01
Gingerols and shogaols are the primary non-volatile actives within ginger (Zingiber officinale). These compounds have demonstrated in vitro to exert 5-HT 3 receptor antagonism which could benefit chemotherapy-induced nausea and vomiting (CINV). The site and mechanism of action by which these compounds interact with the 5-HT 3 receptor is not fully understood although research indicates they may bind to a currently unidentified allosteric binding site. Using in silico techniques, such as molecular docking and GRID analysis, we have characterized the recently available murine 5-HT 3 receptor by identifying sites of strong interaction with particular functional groups at both the orthogonal (serotonin) site and a proposed allosteric binding site situated at the interface between the transmembrane region and the extracellular domain. These were assessed concurrently with the top-scoring poses of the docked ligands and included key active gingerols, shogaols and dehydroshogaols as well as competitive antagonists (e.g. setron class of pharmacologically active drugs), serotonin and its structural analogues, curcumin and capsaicin, non-competitive antagonists and decoys. Unexpectedly, we found that the ginger compounds and their structural analogs generally outscored other ligands at both sites. Our results correlated well with previous site-directed mutagenesis studies in identifying key binding site residues. We have identified new residues important for binding the ginger compounds. Overall, the results suggest that the ginger compounds and their structural analogues possess a high binding affinity to both sites. Notwithstanding the limitations of such theoretical analyses, these results suggest that the ginger compounds could act both competitively or non-competitively as has been shown for palonosetron and other modulators of CYS loop receptors. Copyright © 2016 Elsevier Inc. All rights reserved.
Kurth, Fabian; Duprez, Wilko; Premkumar, Lakshmanane; Schembri, Mark A.; Fairlie, David P.; Martin, Jennifer L.
2014-01-01
The disulfide bond forming DsbA enzymes and their DsbB interaction partners are attractive targets for development of antivirulence drugs because both are essential for virulence factor assembly in Gram-negative pathogens. Here we characterize PmDsbA from Proteus mirabilis, a bacterial pathogen increasingly associated with multidrug resistance. PmDsbA exhibits the characteristic properties of a DsbA, including an oxidizing potential, destabilizing disulfide, acidic active site cysteine, and dithiol oxidase catalytic activity. We evaluated a peptide, PWATCDS, derived from the partner protein DsbB and showed by thermal shift and isothermal titration calorimetry that it binds to PmDsbA. The crystal structures of PmDsbA, and the active site variant PmDsbAC30S were determined to high resolution. Analysis of these structures allows categorization of PmDsbA into the DsbA class exemplified by the archetypal Escherichia coli DsbA enzyme. We also present a crystal structure of PmDsbAC30S in complex with the peptide PWATCDS. The structure shows that the peptide binds non-covalently to the active site CXXC motif, the cis-Pro loop, and the hydrophobic groove adjacent to the active site of the enzyme. This high-resolution structural data provides a critical advance for future structure-based design of non-covalent peptidomimetic inhibitors. Such inhibitors would represent an entirely new antibacterial class that work by switching off the DSB virulence assembly machinery. PMID:24831013
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Da-Jiang; Evans, James W.
An accurate description of oxygen dissociation pathways and kinetics for various local adlayer environments is key for an understanding not just of the coverage dependence of oxygen sticking, but also of reactive steady states in oxidation reactions. Density functional theory analysis for M(100) surfaces with M=Pd, Rh, and Ni, where O prefers the fourfold hollow adsorption site, does not support the traditional Brundle-Behm-Barker picture of dissociative adsorption onto second-nearest-neighbor hollow sites with an additional blocking constraint. Rather adsorption via neighboring vicinal bridge sites dominates, although other pathways can be active. The same conclusion also applies for M=Pt and Ir, wheremore » oxygen prefers the bridge adsorption site. Statistical mechanical analysis is performed based on kinetic Monte Carlo simulation of a multisite lattice-gas model consistent with our revised picture of adsorption. This analysis determines the coverage and temperature dependence of sticking for a realistic treatment of the oxygen adlayer structure.« less
The hppA gene of Helicobacter pylori encodes the class C acid phosphatase precursor.
Godlewska, Renata; Bujnicki, Janusz M; Ostrowski, Jerzy; Jagusztyn-Krynicka, Elzbieta K
2002-08-14
Screening of the Helicobacter pylori genomic library with sera from infected humans and from immunized rabbits resulted in identification of the 25 kDa protein cell envelope (HppA) which exhibits acid phosphatase activity. Enzyme activity was demonstrated by specific enzymatic assays with whole-cell protein preparations of H. pylori strain N6 and from Escherichia coli carrying the hppA gene (pUWM192). HppA showed optimum activity at pH 5.6 and was resistant to inhibition by EDTA. Bioinformatics analysis and site-directed mutagenesis of two putative active site residues (D73 and D192) provide further insight into the sequence-structure-function relationships of HppA as a member of the DDDD phosphohydrolase superfamily.
Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; Zhou, Zhaoye; He, Bin
2013-10-01
Imaging myocardial activation from noninvasive body surface potentials promises to aid in both cardiovascular research and clinical medicine. To investigate the ability of a noninvasive 3-dimensional cardiac electrical imaging technique for characterizing the activation patterns of dynamically changing ventricular arrhythmias during drug-induced QT prolongation in rabbits. Simultaneous body surface potential mapping and 3-dimensional intracardiac mapping were performed in a closed-chest condition in 8 rabbits. Data analysis was performed on premature ventricular complexes, couplets, and torsades de pointes (TdP) induced during intravenous administration of clofilium and phenylephrine with combinations of various infusion rates. The drug infusion led to a significant increase in the QT interval (from 175 ± 7 to 274 ± 31 ms) and rate-corrected QT interval (from 183 ± 5 to 262 ± 21 ms) during the first dose cycle. All the ectopic beats initiated by a focal activation pattern. The initial beat of TdPs arose at the focal site, whereas the subsequent beats were due to focal activity from different sites or 2 competing focal sites. The imaged results captured the dynamic shift of activation patterns and were in good correlation with the simultaneous measurements, with a correlation coefficient of 0.65 ± 0.02 averaged over 111 ectopic beats. Sites of initial activation were localized to be ~5 mm from the directly measured initiation sites. The 3-dimensional cardiac electrical imaging technique could localize the origin of activation and image activation sequence of TdP during QT prolongation induced by clofilium and phenylephrine in rabbits. It offers the potential to noninvasively investigate the proarrhythmic effects of drug infusion and assess the mechanisms of arrhythmias on a beat-to-beat basis. © 2013 Heart Rhythm Society. All rights reserved.
Awate, Sunita; Wilson, Heather L; Singh, Baljit; Babiuk, Lorne A; Mutwiri, George
2014-05-01
Poly[di(sodiumcarboxylatoethylphenoxy)phosphazene] (PCEP) has shown great potential as a vaccine adjuvant, but the mechanisms that mediate its adjuvant activity have not been investigated. Previously, we had reported the potential of PCEP to induce cytokines and chemokines at the site of injection. Hence, we hypothesized that PCEP creates strong immuno-competent environment leading to recruitment of immune cells at the injection site. Intramuscular injection of mice with PCEP induced significant recruitment of neutrophils, macrophages, monocytes, dendritic cells (DCs), and lymphocytes at the site of injection as well as in the draining lymph nodes. Flow cytometric analysis showed that the majority of the recruited immune cells took up and/or were associated with PCEP at the injection site, with lymphocytes taking up PCEP in lesser quantity. Further, confocal analysis revealed intracytoplasmic lysosomal localization of PCEP in recruited immune cells. These observations suggest that recruitment of distinct immune cells to the site of injection site may be an important mechanism by which PCEP potentiates immune responses to antigens. Copyright © 2014 Elsevier Ltd. All rights reserved.
Role of Disulfide Bridges in the Activity and Stability of a Cold-Active α-Amylase
Siddiqui, Khawar Sohail; Poljak, Anne; Guilhaus, Michael; Feller, Georges; D'Amico, Salvino; Gerday, Charles; Cavicchioli, Ricardo
2005-01-01
The cold-adapted α-amylase from Pseudoalteromonas haloplanktis unfolds reversibly and cooperatively according to a two-state mechanism at 30°C and unfolds reversibly and sequentially with two transitions at temperatures below 12°C. To examine the role of the four disulfide bridges in activity and conformational stability of the enzyme, the eight cysteine residues were reduced with β-mercaptoethanol or chemically modified using iodoacetamide or iodoacetic acid. Matrix-assisted laser desorption-time of flight mass spectrometry analysis confirmed that all of the cysteines were modified. The iodoacetamide-modified enzyme reversibly folded/unfolded and retained approximately one-third of its activity. Removal of all disulfide bonds resulted in stabilization of the least stable region of the enzyme (including the active site), with a concomitant decrease in activity (increase in activation enthalpy). Disulfide bond removal had a greater impact on enzyme activity than on stability (particularly the active-site region). The functional role of the disulfide bridges appears to be to prevent the active site from developing ionic interactions. Overall, the study demonstrated that none of the four disulfide bonds are important in stabilizing the native structure of enzyme, and instead, they appear to promote a localized destabilization to preserve activity. PMID:16109962
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koller, G.R.
1979-08-01
Stream sediment and stream water samples were collected from small streams at 1328 sites. Ground water samples were collected at 664 sites. Neutron activation analysis (NAA) results are given for uranium and 16 other elements in sediments, and for uranium and 8 other elements in ground water and surface water.
Katherine J. Elliott; James M. Vose
1994-01-01
We measured net photosynthesis,leaf conductance, xylem water potential, and growth of Pinus strbus L. seedlings two years after planting on two clear-cut and burned sites in the southern Appalachians. Multiple regression analysis was used to relate seedling net pholosynthesis to vapor pressure deficit, seedling crown temperature, photosynthetically active radiation (...
Monitoring of phenolic compounds and surfactants in water of Ganga Canal, Haridwar (India)
NASA Astrophysics Data System (ADS)
Seth, Richa; Singh, Prashant; Mohan, Manindra; Singh, Rakesh; Aswal, Ravinder Singh
2013-12-01
The Ganga Canal emerging out from Ganga River has great ritual importance among pilgrims and tourists at Haridwar, Uttarakhand, India. The Canal is being polluted due to mass bathing, washing, disposal of sewage, industrial waste and these human activities are deteriorating its water quality. To determine the impact of these activities, Ganga Canal water quality at five sites between Haridwar and Roorkee namely Pantdweep, Har Ki Pauri, Singhdwar, Piran Kaliyar and Old Bridge, Roorkee has been analyzed for organic pollutants phenolic compounds and surfactants, which have rarely been assessed and reported so far. The results of analysis show that phenolic compounds are not present in water samples of selected five sites during bi-monthly monitoring from January 2012 to November 2012. The Har Ki Pauri, Singhdwar, Piran Kaliyar and Old Bridge, Roorkee sites have been detected with surfactant concentrations (1.18, 1.63, 3.2 and 2.5 mg/l) more than permissible limit (1.00 mg/l). Also at most of the sites, surfactants' concentration crossed the desirable limit of BIS during the period of analysis. This distribution of surfactants in water has potential risk for skin diseases and cancer and requires regular monitoring with appropriate measures.
NASA Astrophysics Data System (ADS)
Kasban, H.; Hamid, Ashraf
2015-12-01
Instrumental Neutron Activation Analysis using k0 (k0-INAA) method has been used to determine a number of elements in sediment samples collected from El-Manzala Lake in Egypt. k0-INAA according to Westcott's formalism has been implemented using the complete irradiation kit of the fast pneumatic rabbit and some selected manually loaded irradiation sites for short and long irradiation at Egypt Second Research Reactor (ETRR-2). Zr-Au and Co sets as neutron flux monitors are used to determine the neutron flux parameters (f and α) in each irradiation sites. Two reference materials IAEA Soil-7 samples have been inserted and implemented for data validation and an internal monostandard multi monitor used (k0 based IM-NAA). It was given a good agreement between the experimental analyzed values and that obtained of the certified values. The major and trace elements in the sediment samples have been evaluated with the use of Co as an internal and Au as an external monostandard comparators. The concentrations of the elements (Cr, Mn and Zn) in the sediment samples of the present work are discussed regarding to those obtained from other sites.
Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping
2018-04-01
In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Ullah, Riaz; Yasir, Muhammad; Khan, Imran; Bibi, Fehmida; Sohrab, Sayed Sartaj; Al-Ansari, Ahmed; Al-Abbasi, Fahad; Al-Sofyani, Abdulmohsin A; Daur, Ihsanullah; Lee, Seon-Woo; Azhar, Esam I
2017-08-01
Mangrove habitats are ecologically important ecosystems that are under severe pressure worldwide because of environmental changes and human activities. In this study, 16S rRNA gene amplicon deep-sequencing was used to compare bacterial communities in Red Sea mangrove ecosystems at anthropogenically influenced coastal sites with those at a relatively pristine island site. In total, 32 phyla were identified from the mangrove rhizospheres, with Proteobacteria predominating at each of the studied sites; however, the relative abundance was significantly decreased at the coastal sites (Mastorah, MG-MS; Ar-Rayis, MG-AR) compared with the pristine island site near Dhahban (MG-DBI). The phyla Actinobacteria, Firmicutes, Acidobacteria, Chloroflexi, Spirochetes, and Planctomycetes were present at a relative abundance of >1% at the MG-MS and MG-AR sites, but their concentration was <1% at the MG-DBI site. A total of 1659 operational taxonomic units (OTUs) were identified at the species level, and approximately 945 OTUs were shared across the different sampling sites. Multivariate principal coordinate data analysis separated the MG-DBI site from the MG-AR and MG-MS cluster. Specific bacterial taxa were enriched at each location, and in particular, the genera Pseudoalteromonas and Cobetia were predominantly identified in the MG-DBI site compared with the anthropogenically influenced coastal sites.
The use of computers to teach human anatomy and physiology to allied health and nursing students
NASA Astrophysics Data System (ADS)
Bergeron, Valerie J.
Educational institutions are under tremendous pressure to adopt the newest technologies in order to prepare their students to meet the challenges of the twenty-first century. For the last twenty years huge amounts of money have been spent on computers, printers, software, multimedia projection equipment, and so forth. A reasonable question is, "Has it worked?" Has this infusion of resources, financial as well as human, resulted in improved learning? Are the students meeting the intended learning goals? Any attempt to develop answers to these questions should include examining the intended goals and exploring the effects of the changes on students and faculty. This project investigated the impact of a specific application of a computer program in a community college setting on students' attitudes and understanding of human anatomy and physiology. In this investigation two sites of the same community college with seemingly similar students populations, seven miles apart, used different laboratory activities to teach human anatomy and physiology. At one site nursing students were taught using traditional dissections and laboratory activities; at the other site two of the dissections, specifically cat and sheep pluck, were replaced with the A.D.A.M.RTM (Animated Dissection of Anatomy for Medicine) computer program. Analysis of the attitude data indicated that students at both sites were extremely positive about their laboratory experiences. Analysis of the content data indicated a statistically significant difference in performance between the two sites in two of the eight content areas that were studied. For both topics the students using the computer program scored higher. A detailed analysis of the surveys, interviews with faculty and students, examination of laboratory materials, and observations of laboratory facilities in both sites, and cost-benefit analysis led to the development of seven recommendations. The recommendations call for action at the level of the institution requiring investment in additional resources, and at the level of the faculty requiring a commitment to exploration and reflective practice.
Greenpeace Greenspeak: A Transcultural Discourse Analysis
ERIC Educational Resources Information Center
Heinz, Bettina; Cheng, Hsin-I; Inuzuka, Ako
2007-01-01
This cross-cultural discourse analysis examines the construction of environmental issues on Greenpeace web pages in China, Japan and Germany. To uncover the semantic representation of environmental activism on these sites, the authors sought to identify discursive homogeneity and divergence and to bring to light embedded cultural assumptions. The…
Daniel, Bastian; Wallner, Silvia; Steiner, Barbara; Oberdorfer, Gustav; Kumar, Prashant; van der Graaff, Eric; Roitsch, Thomas; Sensen, Christoph W; Gruber, Karl; Macheroux, Peter
2016-01-01
Berberine bridge enzyme-like (BBE-like) proteins form a multigene family (pfam 08031), which is present in plants, fungi and bacteria. They adopt the vanillyl alcohol-oxidase fold and predominantly show bi-covalent tethering of the FAD cofactor to a cysteine and histidine residue, respectively. The Arabidopsis thaliana genome was recently shown to contain genes coding for 28 BBE-like proteins, while featuring four distinct active site compositions. We determined the structure of a member of the AtBBE-like protein family (termed AtBBE-like 28), which has an active site composition that has not been structurally and biochemically characterized thus far. The most salient and distinguishing features of the active site found in AtBBE-like 28 are a mono-covalent linkage of a histidine to the 8α-position of the flavin-isoalloxazine ring and the lack of a second covalent linkage to the 6-position, owing to the replacement of a cysteine with a histidine. In addition, the structure reveals the interaction of a glutamic acid (Glu426) with an aspartic acid (Asp369) at the active site, which appear to share a proton. This arrangement leads to the delocalization of a negative charge at the active site that may be exploited for catalysis. The structure also indicates a shift of the position of the isoalloxazine ring in comparison to other members of the BBE-like family. The dioxygen surrogate chloride was found near the C(4a) position of the isoalloxazine ring in the oxygen pocket, pointing to a rapid reoxidation of reduced enzyme by dioxygen. A T-DNA insertional mutant line for AtBBE-like 28 results in a phenotype, that is characterized by reduced biomass and lower salt stress tolerance. Multiple sequence analysis showed that the active site composition found in AtBBE-like 28 is only present in the Brassicaceae, suggesting that it plays a specific role in the metabolism of this plant family.
Arrieta, Daniel E; Ontiveros, Cynthia C; Li, Wen-Whai; Garcia, Jose H; Denison, Michael S; McDonald, Jacob D; Burchiel, Scott W; Washburn, Barbara Shayne
2003-01-01
In this study, we determined the biologic activity of dichloromethane-extracted particulate matter < 10 micro m in aerodynamic diameter (PM10) obtained from filters at three sites in the Paso del Norte airshed, which includes El Paso, Texas, USA; Juarez, Chihuahua, Mexico, and Sunland Park, New Mexico, USA. The extracts were rich in polycyclic aromatic hydrocarbons (PAHs) and had significant biologic activity, measured using two in vitro assay systems: ethoxyresorufin-(O-deethylase (EROD) induction and the aryl hydrocarbon-receptor luciferase reporter system. In most cases, both EROD (5.25 pmol/min/mg protein) and luciferase activities (994 relative light units/mg) were highest in extracts from the Advance site located in an industrial neighborhood in Juarez. These values represented 58% and 55%, respectively, of induction associated with 1 micro M ss-naphthoflavone exposures. In contrast, little activity was observed at the Northeast Clinic site in El Paso, the reference site. In most cases, luciferase and EROD activity from extracts collected from the Tillman Health Center site, situated in downtown El Paso, fell between those observed at the other two sites. Overall, a statistically significant correlation existed between PM10 and EROD and luciferase activities. Chemical analysis of extracts collected from the Advance site demonstrated that concentrations of most PAHs were higher than those reported in most other metropolitan areas in the United States. Calculations made with these data suggest a cancer risk of 5-12 cases per 100,000 people. This risk estimate, as well as comparisons with the work of other investigators, raises concern regarding the potential for adverse health effects to the residents of this airshed. Further work is needed to understand the sources, exposure, and effects of PM10 and particulate organic material in the Paso del Norte airshed. PMID:12896850
Critical management practices influencing on-site waste minimization in construction projects.
Ajayi, Saheed O; Oyedele, Lukumon O; Bilal, Muhammad; Akinade, Olugbenga O; Alaka, Hafiz A; Owolabi, Hakeem A
2017-01-01
As a result of increasing recognition of effective site management as the strategic approach for achieving the required performance in construction projects, this study seeks to identify the key site management practices that are requisite for construction waste minimization. A mixed methods approach, involving field study and survey research were used as means of data collection. After confirmation of construct validity and reliability of scale, data analysis was carried out through a combination of Kruskal-Wallis test, descriptive statistics and exploratory factor analysis. The study suggests that site management functions could significantly reduce waste generation through strict adherence to project drawings, and by ensuring fewer or no design changes during construction process. Provision of waste skips for specific materials and maximisation of on-site reuse of materials are also found to be among the key factors for engendering waste minimization. The result of factor analysis suggests four factors underlying on-site waste management practices with 96.093% of total variance. These measures include contractual provisions for waste minimization, waste segregation, maximisation of materials reuse and effective logistic management. Strategies through which each of the underlying measures could be achieved are further discussed in the paper. Findings of this study would assist construction site managers and other site operatives in reducing waste generated by construction activities. Copyright © 2016 Elsevier Ltd. All rights reserved.
Language Planning and Policy in a School Site: A Diachronic Analysis
ERIC Educational Resources Information Center
Kemp, Shaun
2017-01-01
This article engages with diachronic analysis, an analysis of changes over time, as it relates to the field of language planning and policy (LPP) through a case study of a local language problem: the introduction of Chinese language into an established government school over a 10-year period. Using cultural-historical activity theory, expanding…
Protein pharmacophore selection using hydration-site analysis
Hu, Bingjie; Lill, Markus A.
2012-01-01
Virtual screening using pharmacophore models is an efficient method to identify potential lead compounds for target proteins. Pharmacophore models based on protein structures are advantageous because a priori knowledge of active ligands is not required and the models are not biased by the chemical space of previously identified actives. However, in order to capture most potential interactions between all potentially binding ligands and the protein, the size of the pharmacophore model, i.e. number of pharmacophore elements, is typically quite large and therefore reduces the efficiency of pharmacophore based screening. We have developed a new method to select important pharmacophore elements using hydration-site information. The basic premise is that ligand functional groups that replace water molecules in the apo protein contribute strongly to the overall binding affinity of the ligand, due to the additional free energy gained from releasing the water molecule into the bulk solvent. We computed the free energy of water released from the binding site for each hydration site using thermodynamic analysis of molecular dynamics (MD) simulations. Pharmacophores which are co-localized with hydration sites with estimated favorable contributions to the free energy of binding are selected to generate a reduced pharmacophore model. We constructed reduced pharmacophore models for three protein systems and demonstrated good enrichment quality combined with high efficiency. The reduction in pharmacophore model size reduces the required screening time by a factor of 200–500 compared to using all protein pharmacophore elements. We also describe a training process using a small set of known actives to reliably select the optimal set of criteria for pharmacophore selection for each protein system. PMID:22397751
[Social Studies in the Out of Doors].
ERIC Educational Resources Information Center
Huchro, John; Fisch, Tom
Designed for instruction of emotionally handicapped children and youth, these six articles present concepts and activities relative to social studies and outdoor education. Defining social studies as the study of man and his relationship with his environment, the first article emphasizes a site analysis approach. Activity suggestions utilize a…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aurelio, Mario; Taguibao, Kristine Joy; Vargas, Edmundo
In the selection of sites for disposal facilities involving low- and intermediate-level radioactive waste (LILW), International Atomic Energy Agency (IAEA) recommendations require that 'the region in which the site is located shall be such that significant tectonic and surface processes are not expected to occur with an intensity that would compromise the required isolation capability of the repository'. Evaluating the appropriateness of a site therefore requires a deep understanding of the geological and tectonic setting of the area. The Philippines sits in a tectonically active region frequented by earthquakes and volcanic activity. Its highly variable morphology coupled with its locationmore » along the typhoon corridor in the west Pacific region subjects the country to surface processes often manifested in the form of landslides. The Philippine LILW near surface repository project site is located on the north eastern sector of the Island of Luzon in northern Philippines. This island is surrounded by active subduction trenches; to the east by the East Luzon Trough and to the west by the Manila Trench. The island is also traversed by several branches of the Philippine Fault System. The Philippine LILW repository project is located more than 100 km away from any of these major active fault systems. In the near field, the project site is located less than 10 km from a minor fault (Dummon River Fault) and more than 40 km away from a volcanic edifice (Mt. Caguas). This paper presents an analysis of the potential hazards that these active tectonic features may pose to the project site. The assessment of such geologic hazards is imperative in the characterization of the site and a crucial input in the design and safety assessment of the repository. (authors)« less
NASA Astrophysics Data System (ADS)
Sato, S.; Takatsu, H.; Maki, K.; Yamada, K.; Mori, S.; Iida, H.; Santoro, R. T.
1997-09-01
Gamma-ray exposure dose rates at the ITER site boundary were estimated for the cases of removal of a failed activated Toroidal Field (TF) coil from the torus and removal of a failed activated TF coil together with a sector of the activated Vacuum Vessel (VV). Skyshine analyses were performed using the two-dimensional SN radiation transport code, DOT3.5. The exposure gamma-ray dose rates on the ground at the site boundary (presently assumed to be 1 km from the ITER building), were calculated to be 1.1 and 84 μSv/year for removal of the TF coil without and with a VV sector, respectively. The dose rate level for the latter case is close to the tentative radiation limit of 100 μSv/year so an additional ˜14 cm of concrete is required in the ITER building roof to satisfy the criterion for a safety factor often for the site boundary dose rate.
Epigenetic regulation of TTF-I-mediated promoter–terminator interactions of rRNA genes
Németh, Attila; Guibert, Sylvain; Tiwari, Vijay Kumar; Ohlsson, Rolf; Längst, Gernot
2008-01-01
Ribosomal RNA synthesis is the eukaryotic cell's main transcriptional activity, but little is known about the chromatin domain organization and epigenetics of actively transcribed rRNA genes. Here, we show epigenetic and spatial organization of mouse rRNA genes at the molecular level. TTF-I-binding sites subdivide the rRNA transcription unit into functional chromatin domains and sharply delimit transcription factor occupancy. H2A.Z-containing nucleosomes occupy the spacer promoter next to a newly characterized TTF-I-binding site. The spacer and the promoter proximal TTF-I-binding sites demarcate the enhancer. DNA from both the enhancer and the coding region is hypomethylated in actively transcribed repeats. 3C analysis revealed an interaction between promoter and terminator regions, which brings the beginning and end of active rRNA genes into close contact. Reporter assays show that TTF-I mediates this interaction, thereby linking topology and epigenetic regulation of the rRNA genes. PMID:18354495
Yu, Ming; Riva, Laura; Xie, Huafeng; Schindler, Yocheved; Moran, Tyler B.; Cheng, Yong; Yu, Duonan; Hardison, Ross; Weiss, Mitchell J; Orkin, Stuart H.; Bernstein, Bradley E.; Fraenkel, Ernest; Cantor, Alan B.
2009-01-01
Summary The transcription factor GATA-1 is required for terminal erythroid maturation and functions as an activator or repressor depending on gene context. Yet its in vivo site selectivity and ability to distinguish between activated versus repressed genes remain incompletely understood. In this study, we performed GATA-1 ChIP-seq in erythroid cells and compared it to GATA-1 induced gene expression changes. Bound and differentially expressed genes contain a greater number of GATA binding motifs, a higher frequency of palindromic GATA sites, and closer occupancy to the transcriptional start site versus non-differentially expressed genes. Moreover, we show that the transcription factor Zbtb7a occupies GATA-1 bound regions of some direct GATA-1 target genes, that the presence of SCL/TAL1 helps distinguish transcriptional activation versus repression, and that Polycomb Repressive Complex 2 (PRC2) is involved in epigenetic silencing of a subset of GATA-1 repressed genes. These data provide insights into GATA-1 mediated gene regulation in vivo. PMID:19941827
Retrotransposon Tf1 is targeted to pol II promoters by transcription activators
Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.
2008-01-01
SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330
Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.
Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L
2008-04-11
The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.
NASA Astrophysics Data System (ADS)
Taha, Mutasem O.; Habash, Maha; Khanfar, Mohammad A.
2014-05-01
Glucokinase (GK) is involved in normal glucose homeostasis and therefore it is a valid target for drug design and discovery efforts. GK activators (GKAs) have excellent potential as treatments of hyperglycemia and diabetes. The combined recent interest in GKAs, together with docking limitations and shortages of docking validation methods prompted us to use our new 3D-QSAR analysis, namely, docking-based comparative intermolecular contacts analysis (dbCICA), to validate docking configurations performed on a group of GKAs within GK binding site. dbCICA assesses the consistency of docking by assessing the correlation between ligands' affinities and their contacts with binding site spots. Optimal dbCICA models were validated by receiver operating characteristic curve analysis and comparative molecular field analysis. dbCICA models were also converted into valid pharmacophores that were used as search queries to mine 3D structural databases for new GKAs. The search yielded several potent bioactivators that experimentally increased GK bioactivity up to 7.5-folds at 10 μM.
Pombo, A; Jackson, D A; Hollinshead, M; Wang, Z; Roeder, R G; Cook, P R
1999-01-01
Mammalian nuclei contain three different RNA polymerases defined by their characteristic locations and drug sensitivities; polymerase I is found in nucleoli, and polymerases II and III in the nucleoplasm. As nascent transcripts made by polymerases I and II are concentrated in discrete sites, the locations of those made by polymerase III were investigated. HeLa cells were lysed with saponin in an improved 'physiological' buffer that preserves transcriptional activity and nuclear ultrastructure; then, engaged polymerases were allowed to extend nascent transcripts in Br-UTP, before the resulting Br-RNA was immunolabelled indirectly with fluorochromes or gold particles. Biochemical analysis showed that approximately 10 000 transcripts were being made by polymerase III at the moment of lysis, while confocal and electron microscopy showed that these transcripts were concentrated in only approximately 2000 sites (diameter approximately 40 nm). Therefore, each site contains approximately five active polymerases. These sites contain specific subunits of polymerase III, but not the hyperphosphorylated form of the largest subunit of polymerase II. The results indicate that the active forms of all three nuclear polymerases are concentrated in their own dedicated transcription sites or 'factories', suggesting that different regions of the nucleus specialize in the transcription of different types of gene. PMID:10205177
Reliability of an fMRI Paradigm for Emotional Processing in a Multisite Longitudinal Study
Gee, Dylan G.; McEwen, Sarah C.; Forsyth, Jennifer K.; Haut, Kristen M.; Bearden, Carrie E.; Addington, Jean; Goodyear, Bradley; Cadenhead, Kristin S.; Mirzakhanian, Heline; Cornblatt, Barbara A.; Olvet, Doreen; Mathalon, Daniel H.; McGlashan, Thomas H.; Perkins, Diana O.; Belger, Aysenil; Seidman, Larry J.; Thermenos, Heidi; Tsuang, Ming T.; van Erp, Theo G.M.; Walker, Elaine F.; Hamann, Stephan; Woods, Scott W.; Constable, Todd; Cannon, Tyrone D.
2015-01-01
Multisite neuroimaging studies can facilitate the investigation of brain-related changes in many contexts, including patient groups that are relatively rare in the general population. Though multisite studies have characterized the reliability of brain activation during working memory and motor functional magnetic resonance imaging tasks, emotion processing tasks, pertinent to many clinical populations, remain less explored. A traveling participants study was conducted with eight healthy volunteers scanned twice on consecutive days at each of the eight North American Longitudinal Prodrome Study sites. Tests derived from generalizability theory showed excellent reliability in the amygdala (Eρ2=0.82), inferior frontal gyrus (IFG;Eρ2=0.83), anterior cingulate cortex (ACC;Eρ2=0.76), insula (Eρ2=0.85), and fusiform gyrus (Eρ2=0.91) for maximum activation and fair to excellent reliability in the amygdala (Eρ2=0.44), IFG (Eρ2=0.48), ACC (Eρ2=0.55), insula (Eρ2=0.42), and fusiform gyrus (Eρ2=0.83) for mean activation across sites and test days. For the amygdala, habituation (Eρ2=0.71) was more stable than mean activation. In a second investigation, data from 111 healthy individuals across sites were aggregated in a voxelwise, quantitative meta-analysis. When compared with a mixed effects model controlling for site, both approaches identified robust activation in regions consistent with expected results based on prior single-site research. Overall, regions central to emotion processing showed strong reliability in the traveling participants study and robust activation in the aggregation study. These results support the reliability of blood oxygen level-dependent signal in emotion processing areas across different sites and scanners and may inform future efforts to increase efficiency and enhance knowledge of rare conditions in the population through multisite neuroimaging paradigms. PMID:25821147
Srivastava, D. K.; Jude, Kevin M.; Banerjee, Abir L.; Haldar, Manas; Manokaran, Sumathra; Kooren, Joel; Mallik, Sanku; Christianson, David W.
2008-01-01
Despite the similarity in the active site pockets of carbonic anhydrase (CA) isozymes I and II, the binding affinities of benzenesulfonamide inhibitors are invariably higher with CA II as compared to CA I. To explore the structural basis of this molecular recognition phenomenon, we have designed and synthesized simple benzenesulfonamide inhibitors substituted at the para position with positively-charged, negatively-charged, and neutral functional groups, and we have determined the affinities and X-ray crystal structures of their enzyme complexes. The para-substituents are designed to bind in the midsection of the 15 Å deep active site cleft, where interactions with enzyme residues and solvent molecules are possible. We find that a para-substituted positively-charged amino group is more poorly tolerated in the active site of CA I compared with CA II. In contrast, a para-substituted negatively-charged carboxylate substituent is tolerated equally well in the active sites of both CA isozymes. Notably, enzyme-inhibitor affinity increases upon neutralization of inhibitor charged groups by amidation or esterification. These results inform the design of short molecular linkers connecting the benzenesulfonamide group and a para-substituted tail group in “two-prong” CA inhibitors: an optimal linker segment will be electronically neutral, yet capable of engaging in at least some hydrogen bond interactions with protein residues and/or solvent. Microcalorimetric data reveal that inhibitor binding to CA I is enthalpically less favorable and entropically more favorable than inhibitor binding to CA II. This contrasting behavior may arise in part from differences in active site desolvation and the conformational entropy of inhibitor binding to each isozyme active site. PMID:17407288
Dredging and contaminant exposure to tree swallows nesting on the upper Mississippi River
Custer, Thomas W.; Dummer, Paul; Custer, Christine M.; Warburton, David
2013-01-01
n 2008 and 2009, dredge material from the Mississippi River in Pool 8 south of Brownsville, Minnesota was used to construct nearby islands. Chemical analysis of sediment in 2001 and 2002 in the area to be dredged indicated detectable concentrations of organic and inorganic contaminants. Tree swallows (Tachycineta bicolor), whose diet is mainly aquatic invertebrates, were used to evaluate contaminant exposure in both the dredged and newly created habitat. Organic and inorganic contaminant data were collected from tree swallows in 2007 through 2010 at one study site near the dredging operation, a reference study site upriver from the dredging activity, one study site down river from the dredging activity, and one study site on a newly created island (2009 and 2010 only). Organic and element concentrations were at background levels in all samples. Polychlorinated biphenyl and p,p′-dichlorodiphenyldichloroethylene concentrations in tree swallow nestlings decreased at all study sites over the period 2007 to 2010 including the island study site between 2009 and 2010. Element concentrations in tree swallow livers for the non-island study sites did not show a trend among years in relation to the dredging. Selenium concentrations at the newly created island were higher and cadmium concentrations were lower in 2010 than 2009. Hatching success of eggs in successful nests was not associated with dredging activities.
Munroe, Jeffrey S.; Doolittle, James A.; Kanevskiy, Mikhail; Hinkel, Kenneth M.; Nelson, Frederick E.; Jones, Benjamin M.; Shur, Yuri; Kimble, John M.
2007-01-01
Three-dimensional ground-penetrating radar (3D GPR) was used to investigate the subsurface structure of ice-wedge polygons and other features of the frozen active layer and near-surface permafrost near Barrow, Alaska. Surveys were conducted at three sites located on landscapes of different geomorphic age. At each site, sediment cores were collected and characterised to aid interpretation of GPR data. At two sites, 3D GPR was able to delineate subsurface ice-wedge networks with high fidelity. Three-dimensional GPR data also revealed a fundamental difference in ice-wedge morphology between these two sites that is consistent with differences in landscape age. At a third site, the combination of two-dimensional and 3D GPR revealed the location of an active frost boil with ataxitic cryostructure. When supplemented by analysis of soil cores, 3D GPR offers considerable potential for imaging, interpreting and 3D mapping of near-surface soil and ice structures in permafrost environments.
A population genetic analysis of the midget faded rattlesnake in Wyoming
Oyler-McCance, Sara J.; Parker, J.M.
2010-01-01
Little is known about the population biology of midget faded rattlesnakes, a sensitive subspecies of the Western Rattlesnake, despite conservation efforts to protect them. We conducted a molecular genetic study of midget faded rattlesnakes in southwestern Wyoming to investigate population genetic structure in this area, particularly with reference to Flaming Gorge Reservoir and its associated human activities, and to document levels of genetic diversity. We genotyped 229 snakes from 11 sampling sites using 9 microsatellite loci. We found significant levels of genetic structure among sites that were better explained by geographic region and isolation by distance than by position relative to waterways. Sites on either side of the reservoir at its widest point were not significantly different. Six of the sites showed signatures of a population bottleneck using an alpha value of 0.05. Three of these bottlenecked sites (the three most northern) were the most genetically distinct and occur in areas of greatest impact from human activity.
Locating bomb factories by detecting hydrogen peroxide.
Romolo, Francesco Saverio; Connell, Samantha; Ferrari, Carlotta; Suarez, Guillaume; Sauvain, Jean-Jacques; Hopf, Nancy B
2016-11-01
The analytical capability to detect hydrogen peroxide vapour can play a key role in localizing a site where a H2O2 based Improvised Explosive (IE) is manufactured. In security activities it is very important to obtain information in a short time. For this reason, an analytical method to be used in security activity needs portable devices. The authors have developed the first analytical method based on a portable luminometer, specifically designed and validated to locate IE manufacturing sites using quantitative on-site vapour analysis for H2O2. The method was tested both indoor and outdoor. The results demonstrate that the detection of H2O2 vapours could allow police forces to locate the site, while terrorists are preparing an attack. The collected data are also very important in developing new sensors, able to give an early alarm if located at a proper distance from a site where an H2O2 based IE is prepared. Copyright © 2016 Elsevier B.V. All rights reserved.
Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050
Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.
Exploitation of the Ornithine Effect Enhances Characterization of Stapled and Cyclic Peptides
NASA Astrophysics Data System (ADS)
Crittenden, Christopher M.; Parker, W. Ryan; Jenner, Zachary B.; Bruns, Kerry A.; Akin, Lucas D.; McGee, William M.; Ciccimaro, Eugene; Brodbelt, Jennifer S.
2016-05-01
A method to facilitate the characterization of stapled or cyclic peptides is reported via an arginine-selective derivatization strategy coupled with MS/MS analysis. Arginine residues are converted to ornithine residues through a deguanidination reaction that installs a highly selectively cleavable site in peptides. Upon activation by CID or UVPD, the ornithine residue cyclizes to promote cleavage of the adjacent amide bond. This Arg-specific process offers a unique strategy for site-selective ring opening of stapled and cyclic peptides. Upon activation of each derivatized peptide, site-specific backbone cleavage at the ornithine residue results in two complementary products: the lactam ring-containing portion of the peptide and the amine-containing portion. The deguanidination process not only provides a specific marker site that initiates fragmentation of the peptide but also offers a means to unlock the staple and differentiate isobaric stapled peptides.
Zalacain, M; Malpartida, F; Pulido, D; Jiménez, A
1987-01-15
The Streptomyces hygroscopicus hyg gene encoding a hygromycin B phosphotransferase has been introduced into different sites of both the Escherichia coli plasmid pBR322 and the Escherichia coli-Saccharomyces cerevisiae shuttle vector YRp7. When this gene was inserted into the BamHI site of pBR322 and then cloned in E. coli phosphorylating activity was not detected, indicating that the hyg gene promoter was not functional in this bacterium. However, when the hyg gene was inserted into either the unique PstI site of pBR322 or into each of the two PstI sites of YRp7, phosphotransferase activity was observed. Analysis of the translation products from these constructions by coupled in vitro transcription-translation systems suggested that in all cases transcrition was regulated by a promoter not provided by the inserted hyg gene and that the synthesized polypeptide was identical to that present in S. hygroscopicus.
Tian, Li; Liu, Shijia; Wang, Shuai; Wang, Lushan
2016-03-24
Biomass can be converted into sugars by a series of lignocellulolytic enzymes, which belong to the glycoside hydrolase (GH) families summarized in CAZy databases. Here, using a structural bioinformatics method, we analyzed the active site architecture of the main lignocellulolytic enzyme families. The aromatic amino acids Trp/Tyr and polar amino acids Glu/Asp/Asn/Gln/Arg occurred at higher frequencies in the active site architecture than in the whole enzyme structure. And the number of potential subsites was significantly different among different families. In the cellulase and xylanase families, the conserved amino acids in the active site architecture were mostly found at the -2 to +1 subsites, while in β-glucosidase they were mainly concentrated at the -1 subsite. Families with more conserved binding amino acid residues displayed strong selectivity for their ligands, while those with fewer conserved binding amino acid residues often exhibited promiscuity when recognizing ligands. Enzymes with different activities also tended to bind different hydroxyl oxygen atoms on the ligand. These results may help us to better understand the common and unique structural bases of enzyme-ligand recognition from different families and provide a theoretical basis for the functional evolution and rational design of major lignocellulolytic enzymes.
Active Site Flexibility of Mycobacterium tuberculosis Isocitrate Lyase in Dimer Form.
Lee, Yie-Vern; Choi, Sy Bing; Wahab, Habibah A; Choong, Yee Siew
2017-09-25
Tuberculosis (TB) still remains a global threat due to the emergence of a drug-resistant strain. Instead of focusing on the drug target of active stage TB, we are highlighting the isocitrate lyase (ICL) at the dormant stage TB. ICL is one of the persistent factors for Mycobacterium tuberculosis (MTB) to survive during the dormant phase. In addition, the absence of ICL in human has made ICL a potential drug target for TB therapy. However, the dynamic details of ICL which could give insights to the ICL-ligand interaction have yet to be solved. Therefore, a series of ICL dimer dynamics studies through molecular dynamics simulation were performed in this work. The ICL active site entrance gate closure is contributed to by hydrogen bonding and electrostatic interactions with the C-terminal. Analysis suggested that the open-closed behavior of the ICL active site entrance depends on the type of ligand present in the active site. We also observed four residues (Ser91, Asp108, Asp153, and Cys191) which could possibly be the nucleophiles for nucleophilic attack on the cleavage of isocitrate at the C 2 -C 3 bond. We hope that the elucidation of ICL dynamics can benefit future works such as lead identification or antibody design against ICL for TB therapeutics.
An analysis of flaring and venting activity in the Alberta upstream oil and gas industry.
Johnson, Matthew R; Coderre, Adam R
2011-02-01
Alberta, Canada, is an important global producer of petroleum resources. In association with this production, large amounts of gas (1.14 billion m3 in 2008) are flared or vented. Although the amount of flaring and venting has been measurably reduced since 2002, data from 2005 reveal sharp increases in venting, which have important implications in terms of resource conservation and greenhouse gas emissions (which exceeded 8 million tonnes of carbon dioxide equivalent in 2008). With use of extensive monthly production data for 18,203 active batteries spanning the years 2002-2008 obtained in close cooperation with the Alberta Energy Resources Conservation Board, a detailed analysis has been completed to examine activity patterns of flaring and venting and reasons behind these trends in the Alberta upstream oil and gas industry. In any given year, approximately 6000 batteries reported flaring and/or venting, but the distribution of volumes flared and vented at individual sites was highly skewed, such that small numbers of sites handled large fractions of the total gas flaring and venting in the Province. Examination of month-to-month volume variability at individual sites, cast in terms of a nominal turndown ratio that would be required for a compressor to capture that gas and direct it into a pipeline, further revealed that volumes at a majority of sites were reasonably stable and there was no evidence that larger or more stable sites had been preferentially reduced, leaving potential barriers to future mitigation. Through linking of geospatial data with production data coupled with additional statistical analysis, the 31.2% increase in venting volumes since 2005 was revealed to be predominantly associated with increased production of heavier oils and bitumen in the Lloydminster region of the Province. Overall, the data suggest that quite significant reductions in flaring and venting could be realized by seeking mitigation solutions for only the largest batteries in the Province.
Martin, Antony; Yong, Alan K.; Salomone, Larry A.
2014-01-01
Active-source Love waves, recorded by the multi-channel analysis of surface wave (MASLW) technique, were recently analyzed in two site characterization projects. Between 2010 and 2012, the 2009 American Recovery and Reinvestment Act (ARRA) funded GEOVision to conduct geophysical investigations at 191 seismographic stations in California and the Central Eastern U.S. (CEUS). The original project plan was to utilize active and passive Rayleigh wave-based techniques to obtain shear-wave velocity (VS) profiles to a minimum depth of 30 m and the time-averaged VS of the upper 30 meters (VS30). Early in this investigation it became clear that Rayleigh wave techniques, such as multi-channel analysis of surface waves (MASRW), were not suited for characterizing all sites. Shear-wave seismic refraction and MASLW techniques were therefore applied. In 2012, the Electric Power Research Institute funded characterization of 33 CEUS station sites. Based on experience from the ARRA investigation, both MASRW and MASLW data were acquired by GEOVision at 24 CEUS sites. At shallow rock sites, sites with steep velocity gradients, and, sites with a thin, low velocity, surficial soil layer overlying stiffer sediments, Love wave techniques generally were found to be easier to interpret, i.e., Love wave data typically yielded unambiguous fundamental mode dispersion curves and thus, reduce uncertainty in the resultant VS model. These types of velocity structure often excite dominant higher modes in Rayleigh wave data, but not in the Love wave data. It is possible to model Rayleigh wave data using multi- or effective-mode techniques; however, extraction of Rayleigh wave dispersion data was found to be difficult in many cases. These results imply that field procedures should include careful scrutiny of Rayleigh wave-based dispersion data in order to also collect Love wave data when warranted.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karmi, S.
1996-03-04
The United States Air Force (Air Force) has prepared this Remedial Investigation/Feasibility Study (RI/FS) report to present the results of RI/FS activities at four sites located at the Point Lay radar installation. The remedial investigation (RI) field activities were conducted at the Point Lay radar installation during the summer of 1993. The four sites at Point Lay were investigated because they were suspected of being contaminated with hazardous substances. RI activities were conducted using methods and procedures specified in the RI/FS Work Plan, Sampling and Analysis Plan (SAP), and Health and Safety Plan.
75 FR 53273 - Federal Aquatic Nuisance Species Research Risk Analysis Protocol
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-31
....)]. The Protocol encourages the incorporation of a Hazard Analysis and Critical Control Point (HACCP) approach for prevention planning within research activities. Information about the use of HACCP is available at http://www.seagrant.umn.edu/ais/haccp . A web site detailing the application of HACCP to...
Structure of granzyme C reveals an unusual mechanism of protease autoinhibition
Kaiserman, Dion; Buckle, Ashley M.; Van Damme, Petra; Irving, James A.; Law, Ruby H. P.; Matthews, Antony Y.; Bashtannyk-Puhalovich, Tanya; Langendorf, Chris; Thompson, Philip; Vandekerckhove, Joël; Gevaert, Kris; Whisstock, James C.; Bird, Phillip I.
2009-01-01
Proteases act in important homeostatic pathways and are tightly regulated. Here, we report an unusual structural mechanism of regulation observed by the 2.5-Å X-ray crystal structure of the serine protease, granzyme C. Although the active-site triad residues adopt canonical conformations, the oxyanion hole is improperly formed, and access to the primary specificity (S1) pocket is blocked through a reversible rearrangement involving Phe-191. Specifically, a register shift in the 190-strand preceding the active-site serine leads to Phe-191 filling the S1 pocket. Mutation of a unique Glu–Glu motif at positions 192–193 unlocks the enzyme, which displays chymase activity, and proteomic analysis confirms that activity of the wild-type protease can be released through interactions with an appropriate substrate. The 2.5-Å structure of the unlocked enzyme reveals unprecedented flexibility in the 190-strand preceding the active-site serine that results in Phe-191 vacating the S1 pocket. Overall, these observations describe a broadly applicable mechanism of protease regulation that cannot be predicted by template-based modeling or bioinformatic approaches alone. PMID:19299505
Chung, Suhman; Himmel, Daniel M.; Jiang, Jian-Kang; Wojtak, Krzysztof; Bauman, Joseph D.; Rausch, Jason W.; Wilson, Jennifer A.; Beutler, John A.; Thomas, Craig J.; Arnold, Eddy; Le Grice, Stuart F.J.
2011-01-01
The α-hydroxytroplone, manicol (5,7-dihydroxy-2-isopropenyl-9-methyl-1,2,3,4-tetrahydro-benzocyclohepten-6-one) potently and specifically inhibits ribonuclease H (RNase H) activity of human immunodeficiency virus reverse transcriptase (HIV RT) in vitro. However, manicol was ineffective in reducing virus replication in culture. Ongoing efforts to improve the potency and specificity over the lead compound led us to synthesize 14 manicol derivatives that retain the divalent metal-chelating α-hydroxytropolone pharmacophore. These efforts were augmented by a high resolution structure of p66/p51 HIV-1 RT containing the nonnucleoside reverse transcriptase inhibitor (NNRTI), TMC278 and manicol in the DNA polymerase and RNase H active sites, respectively. We demonstrate here that several modified α-hydroxytropolones exhibit antiviral activity at non-cytotoxic concentrations. Inclusion of RNase H active site mutants indicated that manicol analogs can occupy an additional site in or around the DNA polymerase catalytic center. Collectively, our studies will promote future structure-based design of improved α-hydroxytropolones to complement the NRTI and NNRTI currently in clinical use. PMID:21568335
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.
2004-08-06
The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less
Singh, Shailza; Mandlik, Vineetha; Shinde, Sonali
2015-03-01
GPI12 represents an important enzyme in the GPI biosynthetic pathway of several parasites like 'Leishmania'. GPI activity is generally regulated through either the hindrance in GPI complex assembly formation or the modulation of the lipophosphoglycan (LPG) flux to either reduce or enhance the pathogenicity in an organism. Of the various GPI molecules known, GPI12 is an important enzyme in the GPI biosynthetic pathway which can be exploited as a target due to the substrate specificity difference in parasites and humans. In the present study, the functional importance of the co-evolving residues of the GPI12 protein of Leishmania has been highlighted using the GPI proteins belonging to the GlcNAC-deacetylase family. Exploring the active site of the GPI12 protein and designing inhibitors against the functional residues provide ways and means to change the efficiency of deacetylation activity of the enzyme. The activity of de-N-acetylase is low in the absence of metal ions like zinc. Hence we designed eight small molecules in order to modulate the activity of GPI12. Compound 8 was found to be an appropriate choice to target the agonist (GPI12) active site thereby targeting the residues which were essential in the Zn binding and chelation activity. Inhibition of these sites offered a strong constraint to block the protein activity and in turn GPI biosynthesis.
Baker, Beth H.; Martinovic-Weigelt, Dalma; Ferrey, Mark L.; Barber, Larry B.; Writer, Jeffrey H.; Rosenberry, Donald O.; Kiesling, Richard L.; Lundy, James R.; Schoenfuss, Heiko L.
2014-01-01
Contaminants of emerging concern, particularly endocrine active compounds (EACs), have been identified as a threat to aquatic wildlife. However, little is known about the impact of EACs on lakes through groundwater from onsite wastewater treatment systems (OWTS). This study aims to identify specific contributions of OWTS to Sullivan Lake, Minnesota, USA. Lake hydrology, water chemistry, caged bluegill sunfish (Lepomis macrochirus), and larval fathead minnow (Pimephales promelas) exposures were used to assess whether EACs entered the lake through OWTS inflow and the resultant biological impact on fish. Study areas included two OWTS-influenced near-shore sites with native bluegill spawning habitats and two in-lake control sites without nearby EAC sources. Caged bluegill sunfish were analyzed for plasma vitellogenin concentrations, organosomatic indices, and histological pathologies. Surface and porewater was collected from each site and analyzed for EACs. Porewater was also collected for laboratory exposure of larval fathead minnow, before analysis of predator escape performance and gene expression profiles. Chemical analysis showed EACs present at low concentrations at each study site, whereas discrete variations were reported between sites and between summer and fall samplings. Body condition index and liver vacuolization of sunfish were found to differ among study sites as did gene expression in exposed larval fathead minnows. Interestingly, biological exposure data and water chemistry did not match. Therefore, although results highlight the potential impacts of seepage from OWTS, further investigation of mixture effects and life history factor as well as chemical fate is warranted.
NASA Technical Reports Server (NTRS)
Murphy, Douglas G.; Qu, Min; Salas, Andrea O.
2006-01-01
The NASA Integrated Modeling and Simulation (IM&S) project aims to develop a collaborative engineering system to include distributed analysis, integrated tools, and web-enabled graphics. Engineers on the IM&S team were tasked with applying IM&S capabilities to an orbital mechanics analysis for a lunar mission study. An interactive lunar globe was created to show 7 landing sites, contour lines depicting the energy required to reach a given site, and the optimal lunar orbit orientation to meet the mission constraints. Activation of the lunar globe rotation shows the change of the angle between the landing site latitude and the orbit plane. A heads-up-display was used to embed straightforward interface elements.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Prieur, Xavier; Coste, Herve; Rodriguez, Joan C
2003-07-11
The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.
Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C
2001-07-01
The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.
Code of Federal Regulations, 2014 CFR
2014-10-01
... Commercial Independent Risk Analysis Services Blanket Purchase Agreements (BPA), dated February 4, 2008, available on the OMB Web site. HHS policy is for contracting activities to use the GSA BPA sources to the...
Code of Federal Regulations, 2013 CFR
2013-10-01
... Commercial Independent Risk Analysis Services Blanket Purchase Agreements (BPA), dated February 4, 2008, available on the OMB Web site. HHS policy is for contracting activities to use the GSA BPA sources to the...
Code of Federal Regulations, 2012 CFR
2012-10-01
... Commercial Independent Risk Analysis Services Blanket Purchase Agreements (BPA), dated February 4, 2008, available on the OMB Web site. HHS policy is for contracting activities to use the GSA BPA sources to the...
Code of Federal Regulations, 2010 CFR
2010-10-01
... Commercial Independent Risk Analysis Services Blanket Purchase Agreements (BPA), dated February 4, 2008, available on the OMB Web site. HHS policy is for contracting activities to use the GSA BPA sources to the...
Code of Federal Regulations, 2011 CFR
2011-10-01
... Commercial Independent Risk Analysis Services Blanket Purchase Agreements (BPA), dated February 4, 2008, available on the OMB Web site. HHS policy is for contracting activities to use the GSA BPA sources to the...
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
PROTEIN ADDUCTS AS BIOMAKERS OF EXPOSURE TO ORGANOPHOSPHORUS COMPOUNDS
Marsillach, Judit; Costa, Lucio G.; Furlong, Clement E.
2013-01-01
Exposure to organophosphorus (OP) compounds can lead to serious neurological damage or death. Following bioactivation by the liver cytochromes P450, the OP metabolites produced are potent inhibitors of serine active-site enzymes including esterases, proteases and lipases. OPs may form adducts on other cellular proteins. Blood cholinesterases (ChEs) have long served as biomarkers of OP exposure in humans. However, the enzymatic assays used for biomonitoring OP exposures have several drawbacks. A more useful approach will focus on multiple biomarkers and avoid problems with the enzymatic activity assays. OP inhibitory effects result from a covalent bond with the active-site serine of the target enzymes. The serine OP adducts become irreversible following a process referred to as aging where one alkyl group dissociates over variable lengths of time depending on the OP adduct. The OP-adducted enzyme then remains in circulation until it is degraded, allowing for a longer window of detection compared with direct analysis of OPs or their metabolites. Mass spectrometry (MS) provides a very sensitive method for identification of post-translational protein modifications. MS analyses of the percentage adduction of the active-site serine of biomarker proteins such as ChEs will eliminate the need for basal activity levels of the individual and will provide for a more accurate determination of OP exposure. MS analysis of biomarker proteins also provides information about the OP that has caused inhibition. Other useful biomarker proteins include other serine hydrolases, albumin, tubulin and transferrin. PMID:23261756
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
Predictability of dune activity in real dune fields under unidirectional wind regimes
NASA Astrophysics Data System (ADS)
Barchyn, Thomas E.; Hugenholtz, Chris H.
2015-02-01
We present an analysis of 10 dune fields to test a model-derived hypothesis of dune field activity. The hypothesis suggests that a quantifiable threshold exists for stabilization in unidirectional wind regimes: active dunes have slipface deposition rates that exceed the vegetation deposition tolerance, and stabilizing dunes have the opposite. We quantified aeolian sand flux, slipface geometry, and vegetation deposition tolerance to directly test the hypothesis at four dune fields (Bigstick, White Sands Stable, White Sands Active, and Cape Cod). We indirectly tested the hypothesis at six additional dune fields with limited vegetation data (Hanford, Año Nuevo, Skagen Odde, Salton Sea, Oceano Stable, and Oceano Active, "inverse calculation sites"). We used digital topographic data and estimates of aeolian sand flux to approximate the slipface deposition rates prior to stabilization. Results revealed a distinct, quantifiable, and consistent pattern despite diverse environmental conditions: the modal peak of prestabilization slipface deposition rates was 80% of the vegetation deposition tolerance at stabilized or stabilizing dune fields. Results from inverse calculation sites indicate deposition rates at stabilized sites were near a hypothesized maximum vegetation deposition tolerance (1 m a-1), and active sites had slipface deposition rates much higher. Overall, these results confirm the hypothesis and provide evidence of a globally applicable, simple, and previously unidentified predictor for the dynamics of vegetation cover in dune fields under unidirectional wind regimes.
Control of peroxisome proliferator-activated receptor gamma2 stability and activity by SUMOylation.
Floyd, Z Elizabeth; Stephens, Jacqueline M
2004-06-01
To determine whether small ubiquitin-related modifier (SUMO)ylation of lysine 107 plays a role in regulating the activity of peroxisome proliferator-activated receptor gamma (PPARgamma). Transient expression of wild-type and K107R-PPARgamma2 in the NIH 3T3 fibroblast cell line was carried out in conjunction with half-life studies, luciferase activity assays, and indirect immunofluorescence localization studies. Additional in vitro analysis was carried out using recombinant SUMOylation pathway proteins along with in vitro transcribed and translated wild-type or K107R-PPARgamma2 to examine the SUMO-1 modification state of wild-type and SUMO-deficient K107R-PPARgamma2. While examining PPARgamma2 for potential ubiquitylation sites, we identified a strong consensus site for SUMO modification that contains lysine 107. In vitro, SUMOylation studies showed that lysine 107 of PPARgamma2 is a major SUMOylation site and that at least one other SUMOylation site is present in PPARgamma. In addition, our results demonstrated that SUMO-1 affects PPARgamma stability and transcriptional activity but not the nuclear localization of PPARgamma. These results indicated that SUMOylation plays a role in regulating PPARgamma, both indirectly and directly by modification of lysine 107. Because PPARgamma is regulated in numerous animal models of obesity, understanding the covalent modifications of PPARgamma may enhance our understanding of the metabolic syndrome.
Modulation of HIV Protease Flexibility by the T80N Mutation
Zhou, Hao; Li, Shangyang; Badger, John; Nalivaika, Ellen; Cai, Yufeng; Foulkes-Murzycki, Jennifer; Schiffer, Celia; Makowski, Lee
2015-01-01
The flexibility of HIV protease plays a critical role in enabling enzymatic activity and is required for substrate access to the active site. While the importance of flexibility in the flaps that cover the active site is well known, flexibility in other parts of the enzyme is also critical for function. One key region is a loop containing Thr 80 which forms the walls of the active site. Although not situated within the active site, amino acid Thr80 is absolutely conserved. The mutation T80N preserves the structure of the enzyme but catalytic activity is completely lost. To investigate the potential influence of the T80N mutation on HIVp flexibility, wide-angle scattering (WAXS) data was measured for a series of HIV protease variants. Starting with a calculated WAXS pattern from a rigid atomic model, the modulations in the intensity distribution caused by structural fluctuations in the protein were predicted by simple analytic methods and compared to the experimental data. An analysis of T80N WAXS data shows that this variant is significantly more rigid than the WT across all length scales. The effects of this single point mutation extend throughout the protein, so as to alter the mobility of amino acids in the enzymatic core. These results support the contentions that significant protein flexibility extends throughout HIV protease and is critical to catalytic function. PMID:25488402
Stepankova, Veronika; Khabiri, Morteza; Brezovsky, Jan; Pavelka, Antonin; Sykora, Jan; Amaro, Mariana; Minofar, Babak; Prokop, Zbynek; Hof, Martin; Ettrich, Rudiger; Chaloupkova, Radka; Damborsky, Jiri
2013-05-10
The use of enzymes for biocatalysis can be significantly enhanced by using organic cosolvents in the reaction mixtures. Selection of the cosolvent type and concentration range for an enzymatic reaction is challenging and requires extensive empirical testing. An understanding of protein-solvent interaction could provide a theoretical framework for rationalising the selection process. Here, the behaviour of three model enzymes (haloalkane dehalogenases) was investigated in the presence of three representative organic cosolvents (acetone, formamide, and isopropanol). Steady-state kinetics assays, molecular dynamics simulations, and time-resolved fluorescence spectroscopy were used to elucidate the molecular mechanisms of enzyme-solvent interactions. Cosolvent molecules entered the enzymes' access tunnels and active sites, enlarged their volumes with no change in overall protein structure, but surprisingly did not act as competitive inhibitors. At low concentrations, the cosolvents either enhanced catalysis by lowering K(0.5) and increasing k(cat), or caused enzyme inactivation by promoting substrate inhibition and decreasing k(cat). The induced activation and inhibition of the enzymes correlated with expansion of the active-site pockets and their occupancy by cosolvent molecules. The study demonstrates that quantitative analysis of the proportions of the access tunnels and active-sites occupied by organic solvent molecules provides the valuable information for rational selection of appropriate protein-solvent pair and effective cosolvent concentration. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Simakov, Nikolay; Leonard, David A.; Smith, Jeremy C.; ...
2016-09-26
Widespread antibiotic resistance, particularly when mediated by broad-spectrum β-lactamases, has major implications for public health. Substitutions in the active site often allow broad-spectrum enzymes to accommodate diverse types of β-lactams. Substitutions observed outside the active site are thought to compensate for the loss of thermal stability. The OXA-1 clade of class D β-lactamases contains a pair of conserved cysteines located outside the active site that forms a disulfide bond in the periplasm. In this paper, the effect of the distal disulfide bond on the structure and dynamics of OXA-1 was investigated via 4 μs molecular dynamics simulations. The results revealmore » that the disulfide promotes the preorganized orientation of the catalytic residues and affects the conformation of the functionally important Ω loop. Furthermore, principal component analysis reveals differences in the global dynamics between the oxidized and reduced forms, especially in the motions involving the Ω loop. A dynamical network analysis indicates that, in the oxidized form, in addition to its role in ligand binding, the KTG family motif is a central hub of the global dynamics. Finally, as activity of OXA-1 has been measured only in the reduced form, we suggest that accurate assessment of its functional profile would require oxidative conditions mimicking periplasm.« less
EPA Region 2 SEMS_CERCLIS Sites All [R2] and SEMS_CERCLIS Sites NPL [R2] GIS Layers
The Region 2 SEMS_CERCLIS Sites All [R2] GIS layer contains unique Superfund Enterprise Management System (SEMS) site records. These records have the following NPL_STATUS designations: CURRENTLY ON FINAL NPL, DELETED FROM FINAL NPL, NOT ON NPL, PROPOSED FOR NPL, REMOVED FROM PROPOSED NPL, and SITE IS PART OF NPL SITE. The Region 2 SEMS_CERCLIS NPL Sites [R2] GIS layer only has SEMS records with the following NPL_STATUS designations: 'CURRENTLY ON FINAL NPL', 'DELETED FROM FINAL NPL', 'PROPOSED FOR NPL'.The Superfund Enterprise Management System (SEMS) is EPA's official record for tracking hazardous waste sites, potentially hazardous waste sites, and remedial activities performed in support of the Superfund Program across the nation. This includes sites that are on the National Priorities List (NPL) or are being considered for the NPL. SEMS represents a joint development and ongoing collaboration between Superfund's Remedial, Removal, Federal Facilities, Enforcement, and Emergency Response programs. It provides its wide audience base with a means of ongoing analysis of Superfund Program activities and informational needs at the site, regional management, and national management levels. The customers of SEMS or SEMS data are five EPA Headquarters offices and regional staff, citizens, the regulated community, other Federal agencies, States, Tribes, local agencies, and industry. SEMS stakeholders are States, Congress, other Federal agencies, industry groups, and cit
Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.
Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G
2016-11-01
Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.
Spatially resolved thermal desorption/ionization coupled with mass spectrometry
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jesse, Stephen; Van Berkel, Gary J; Ovchinnikova, Olga S
2013-02-26
A system and method for sub-micron analysis of a chemical composition of a specimen are described. The method includes providing a specimen for evaluation and a thermal desorption probe, thermally desorbing an analyte from a target site of said specimen using the thermally active tip to form a gaseous analyte, ionizing the gaseous analyte to form an ionized analyte, and analyzing a chemical composition of the ionized analyte. The thermally desorbing step can include heating said thermally active tip to above 200.degree. C., and positioning the target site and the thermally active tip such that the heating step forms themore » gaseous analyte. The thermal desorption probe can include a thermally active tip extending from a cantilever body and an apex of the thermally active tip can have a radius of 250 nm or less.« less
Dowd, Carola D; Chronis, Demosthenis; Radakovic, Zoran S; Siddique, Shahid; Schmülling, Thomas; Werner, Tomáš; Kakimoto, Tatsuo; Grundler, Florian M W; Mitchum, Melissa G
2017-10-01
Cyst and root-knot nematodes are obligate parasites of economic importance with a remarkable ability to reprogram root cells into unique metabolically active feeding sites. Previous studies have suggested a role for cytokinin in feeding site formation induced by these two types of nematodes, but the mechanistic details have not yet been described. Using Arabidopsis as a host plant species, we conducted a comparative analysis of cytokinin genes in response to the beet cyst nematode (BCN), Heterodera schachtii, and the root-knot nematode (RKN), Meloidogyne incognita. We identified distinct differences in the expression of cytokinin biosynthesis, catabolism and signaling genes in response to infection by BCN and RKN, suggesting differential manipulation of the cytokinin pathway by these two nematode species. Furthermore, we evaluated Arabidopsis histidine kinase receptor mutant lines ahk2/3, ahk2/4 and ahk3/4 in response to RKN infection. Similar to our previous studies with BCN, these lines were significantly less susceptible to RKN without compromising nematode penetration, suggesting a requirement of cytokinin signaling in RKN feeding site formation. Moreover, an analysis of ahk double mutants using CycB1;1:GUS/ahk introgressed lines revealed contrasting differences in the cytokinin receptors mediating cell cycle activation in feeding sites induced by BCN and RKN. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Study of a metallurgical site in Tuscany (Italy) by radiocarbon dating
NASA Astrophysics Data System (ADS)
Cartocci, A.; Fedi, M. E.; Taccetti, F.; Benvenuti, M.; Chiarantini, L.; Guideri, S.
2007-06-01
Tuscany represents one of the most important ancient mining districts of Italy. Metalworking activities have been present in the area since ancient times and several mining centres have been active in the region since the Etruscan period. Two of the more notable mining locations are the island of Elba and the towns of Populonia and Massa Marittima. In order to reconstruct the development of metallurgical techniques in the past, a multi-disciplinary approach is required, involving both archaeological study and archaeometric analysis of the sites of interest. One of the most complex problems is establishing the chronological history of metallurgical exploitation in ancient sites: archaeological remains are sometimes incomplete and the stratigraphy of archaeological horizons might have been deeply altered. Thus, direct dating of metallurgical slags and other remains of mining and metalworking activities using radiocarbon measurements is particularly useful for developing site chronologies. Charcoal samples from a recent excavation in Populonia were dated by AMS radiocarbon in order to reconstruct the chronological evolution of ancient metallurgical production; results reported here are consistent with archaeological observations.
Maugeri, Pearson T; Griese, Julia J; Branca, Rui M; Miller, Effie K; Smith, Zachary R; Eirich, Jürgen; Högbom, Martin; Shafaat, Hannah S
2018-01-31
The heterobimetallic R2lox protein binds both manganese and iron ions in a site-selective fashion and activates oxygen, ultimately performing C-H bond oxidation to generate a tyrosine-valine cross-link near the active site. In this work, we demonstrate that, following assembly, R2lox undergoes photoinduced changes to the active site geometry and metal coordination motif. Through spectroscopic, structural, and mass spectrometric characterization, the photoconverted species is found to consist of a tyrosinate-bound iron center following light-induced decarboxylation of a coordinating glutamate residue and cleavage of the tyrosine-valine cross-link. This process occurs with high quantum efficiencies (Φ = 3%) using violet and near-ultraviolet light, suggesting that the photodecarboxylation is initiated via ligand-to-metal charge transfer excitation. Site-directed mutagenesis and structural analysis suggest that the cross-linked tyrosine-162 is the coordinating residue. One primary product is observed following irradiation, indicating potential use of this class of proteins, which contains a putative substrate channel, for controlled photoinduced decarboxylation processes, with relevance for in vivo functionality of R2lox as well as application in environmental remediation.
Kwong, Huey Chong; Chidan Kumar, C S; Mah, Siau Hui; Chia, Tze Shyang; Quah, Ching Kheng; Loh, Zi Han; Chandraju, Siddegowda; Lim, Gin Keat
2017-01-01
Biphenyl-based compounds are clinically important for the treatments of hypertension and inflammatory, while many more are under development for pharmaceutical uses. In the present study, a series of 2-([1,1'-biphenyl]-4-yl)-2-oxoethyl benzoates, 2(a-q), and 2-([1,1'-biphenyl]-4-yl)-2-oxoethyl pyridinecarboxylate, 2(r-s) were synthesized by reacting 1-([1,1'-biphenyl]-4-yl)-2-bromoethan-1-one with various carboxylic acids using potassium carbonate in dimethylformamide at ambient temperature. Single-crystal X-ray diffraction studies revealed a more closely packed crystal structure can be produced by introduction of biphenyl moiety. Five of the compounds among the reported series exhibited significant anti-tyrosinase activities, in which 2p, 2r and 2s displayed good inhibitions which are comparable to standard inhibitor kojic acid at concentrations of 100 and 250 μg/mL. The inhibitory effects of these active compounds were further confirmed by computational molecular docking studies and the results revealed the primary binding site is active-site entrance instead of inner copper binding site which acted as the secondary binding site.
An Analysis of NSF Geosciences 2009 Research Experience for Undergraduate Site Programs
NASA Astrophysics Data System (ADS)
Sanchez, S. C.; Patino, L. C.; Rom, E. L.; Weiler, S. C.
2009-12-01
The Research Experience for Undergraduate (REU) Program at the U.S. National Science Foundation (NSF) provides undergraduate students the opportunity to conduct research at different institutions and in areas that may not be available in their home campuses. The Geosciences REU Sites foster research opportunities in areas closely aligned with undergraduate majors and facilitates discovery of the multidisciplinary nature of the Geosciences. The aim of this paper is to provide an overview of the Geosciences REU Site programs run in 2009. A survey requesting information on recruitment methods, student demographics, enrichment activities, and fields of research was sent to the Principal Investigators of each of the 50 active REU Sites; over 70% of the surveys were returned with the requested information. The internet is the most widely used mechanism to recruit participants, but the survey did not distinguish among different tools like websites, emails, social networks, etc. The admissions rate for REU Sites in Geosciences varies from less than 10% to 50%, with the majority of participants being rising seniors and juniors. A few Sites include rising sophomores. At least 40% of the participants come from non-PhD granting institutions. Among the participants, gender distribution is balanced, with a slightly larger number of female participants. Regarding ethnic diversity, the REU Sites reflect the difficulty of attracting diverse students into Geosciences as a discipline; more than 75% of the participants are Caucasian and Asian students. Furthermore, participants from minority-serving institutions constitute a small percentage of those taking part in these research experiences. The enrichment activities are very similar across the REU Sites, and mimic well activities common to the scientific community, including intellectual exchange of ideas (lab meetings, seminars, and professional meetings), networking and social activities. There are some clear similarities among REU Sites managed by the three divisions in the Directorate of Geosciences (e.g. recruitment tools, academic level of participants, and enrichment activities), but other aspects vary among the Sites managed by the different divisions (e.g. admissions rate, diversity, and distribution among research disciplines). The results from this survey will be used to examine strengths in the REU Sites in the Geosciences, opportunities that may be under utilized, and community needs to enhance this NSF wide program.
Kathiravan, G; Sureban, Sripathi M; Sree, Harsha N; Bhuvaneshwari, V; Kramony, Evelin
2012-12-01
Extraction and investigation of TAXOL from Pestalotiopsis breviseta (Sacc.) using protein docking, which is a computational technique that samples conformations of small molecules in protein-binding sites. Scoring functions are used to assess which of these conformations best complements the protein binding site and active site prediction. Coelomycetous fungi P. breviseta (Sacc.) Steyaert was screened for the production of TAXOL, an anticancer drug. TAXOL PRODUCTION WAS CONFIRMED BY THE FOLLOWING METHODS: Ultraviolet (UV) spectroscopic analysis, Infrared analysis, High performance liquid chromatography analysis (HPLC), and Liquid chromatography mass spectrum (LC-MASS). TAXOL produced by the fungi was compared with authentic TAXOL, and protein docking studies were performed. The BCL2 protein of human origin showed a higher affinity toward the compound paclitaxel. It has the binding energy value of -13.0061 (KJ/Mol) with four hydrogen bonds.
Kathiravan, G.; Sureban, Sripathi M.; Sree, Harsha N.; Bhuvaneshwari, V.; Kramony, Evelin
2012-01-01
Background: Extraction and investigation of TAXOL from Pestalotiopsis breviseta (Sacc.) using protein docking, which is a computational technique that samples conformations of small molecules in protein-binding sites. Scoring functions are used to assess which of these conformations best complements the protein binding site and active site prediction. Materials and Methods: Coelomycetous fungi P. breviseta (Sacc.) Steyaert was screened for the production of TAXOL, an anticancer drug. Results: TAXOL production was confirmed by the following methods: Ultraviolet (UV) spectroscopic analysis, Infrared analysis, High performance liquid chromatography analysis (HPLC), and Liquid chromatography mass spectrum (LC-MASS). TAXOL produced by the fungi was compared with authentic TAXOL, and protein docking studies were performed. Conclusion: The BCL2 protein of human origin showed a higher affinity toward the compound paclitaxel. It has the binding energy value of −13.0061 (KJ/Mol) with four hydrogen bonds. PMID:24808664
Adhikari, Utpal Kumar; Rahman, M Mizanur
2017-04-01
The nirk gene encoding the copper-containing nitrite reductase (CuNiR), a key catalytic enzyme in the environmental denitrification process that helps to produce nitric oxide from nitrite. The molecular mechanism of denitrification process is definitely complex and in this case a theoretical investigation has been conducted to know the sequence information and amino acid composition of the active site of CuNiR enzyme using various Bioinformatics tools. 10 Fasta formatted sequences were retrieved from the NCBI database and the domain and disordered regions identification and phylogenetic analyses were done on these sequences. The comparative modeling of protein was performed through Modeller 9v14 program and visualized by PyMOL tools. Validated protein models were deposited in the Protein Model Database (PMDB) (PMDB id: PM0080150 to PM0080159). Active sites of nirk encoding CuNiR enzyme were identified by Castp server. The PROCHECK showed significant scores for four protein models in the most favored regions of the Ramachandran plot. Active sites and cavities prediction exhibited that the amino acid, namely Glycine, Alanine, Histidine, Aspartic acid, Glutamic acid, Threonine, and Glutamine were common in four predicted protein models. The present in silico study anticipates that active site analyses result will pave the way for further research on the complex denitrification mechanism of the selected species in the experimental laboratory. Copyright © 2016. Published by Elsevier Ltd.
Buhrke, Thorsten; Brecht, Marc; Lubitz, Wolfgang; Friedrich, Bärbel
2002-09-01
[NiFe] hydrogenases contain a highly conserved histidine residue close to the [NiFe] active site which is altered by a glutamine residue in the H(2)-sensing [NiFe] hydrogenases. In this study, we exchanged the respective glutamine residue of the H(2) sensor (RH) of Ralstonia eutropha, Q67 of the RH large subunit HoxC, by histidine, asparagine and glutamate. The replacement by histidine and asparagine resulted in slightly unstable RH proteins which were hardly affected in their regulatory and enzymatic properties. The exchange to glutamate led to a completely unstable RH protein. The purified wild-type RH and the mutant protein with the Gln/His exchange were analysed by continuous-wave and pulsed electron paramagnetic resonance (EPR) techniques. We observed a coupling of a nitrogen nucleus with the [NiFe] active site for the mutant protein which was absent in the spectrum of the wild-type RH. A combination of theoretical calculations with the experimental data provided an explanation for the observed coupling. It is shown that the coupling is due to the formation of a weak hydrogen bond between the protonated N(epsilon) nucleus of the histidine with the sulfur of a conserved cysteine residue which coordinates the metal atoms of the [NiFe] active site as a bridging ligand. The effect of this hydrogen bond on the local structure of the [NiFe] active site is discussed.
Rastija, Vesna; Agić, Dejan; Tomiš, Sanja; Nikolič, Sonja; Hranjec, Marijana; Grace, Karminski-Zamola; Abramić, Marija
2015-01-01
A molecular modeling study is performed on series of benzimidazol-based inhibitors of human dipeptidyl peptidase III (DPP III). An eight novel compounds were synthesized in excellent yields using green chemistry approach. This study is aimed to elucidate the structural features of benzimidazole derivatives required for antagonism of human DPP III activity using Quantitative Structure-Activity Relationship (QSAR) analysis, and to understand the mechanism of one of the most potent inhibitor binding into the active site of this enzyme, by molecular dynamics (MD) simulations. The best model obtained includes S3K and RDF045m descriptors which have explained 89.4 % of inhibitory activity. Depicted moiety for strong inhibition activity matches to the structure of most potent compound. MD simulation has revealed importance of imidazolinyl and phenyl groups in the mechanism of binding into the active site of human DPP III.
230Th/U ages Supporting Hanford Site‐Wide Probabilistic Seismic Hazard Analysis
Paces, James B.
2014-01-01
This product represents a USGS Administrative Report that discusses samples and methods used to conduct uranium-series isotope analyses and resulting ages and initial 234U/238U activity ratios of pedogenic cements developed in several different surfaces in the Hanford area middle to late Pleistocene. Samples were collected and dated to provide calibration of soil development in surface deposits that are being used in the Hanford Site-Wide probabilistic seismic hazard analysis conducted by AMEC. The report includes description of sample locations and physical characteristics, sample preparation, chemical processing and mass spectrometry, analytical results, and calculated ages for individual sites. Ages of innermost rinds on a number of samples from five sites in eastern Washington are consistent with a range of minimum depositional ages from 17 ka for cataclysmic flood deposits to greater than 500 ka for alluvium at several sites.
Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB
Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria
2016-01-01
Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114
Kurth, Fabian; Duprez, Wilko; Premkumar, Lakshmanane; Schembri, Mark A; Fairlie, David P; Martin, Jennifer L
2014-07-11
The disulfide bond forming DsbA enzymes and their DsbB interaction partners are attractive targets for development of antivirulence drugs because both are essential for virulence factor assembly in Gram-negative pathogens. Here we characterize PmDsbA from Proteus mirabilis, a bacterial pathogen increasingly associated with multidrug resistance. PmDsbA exhibits the characteristic properties of a DsbA, including an oxidizing potential, destabilizing disulfide, acidic active site cysteine, and dithiol oxidase catalytic activity. We evaluated a peptide, PWATCDS, derived from the partner protein DsbB and showed by thermal shift and isothermal titration calorimetry that it binds to PmDsbA. The crystal structures of PmDsbA, and the active site variant PmDsbAC30S were determined to high resolution. Analysis of these structures allows categorization of PmDsbA into the DsbA class exemplified by the archetypal Escherichia coli DsbA enzyme. We also present a crystal structure of PmDsbAC30S in complex with the peptide PWATCDS. The structure shows that the peptide binds non-covalently to the active site CXXC motif, the cis-Pro loop, and the hydrophobic groove adjacent to the active site of the enzyme. This high-resolution structural data provides a critical advance for future structure-based design of non-covalent peptidomimetic inhibitors. Such inhibitors would represent an entirely new antibacterial class that work by switching off the DSB virulence assembly machinery. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
A comprehensive study of Superfund program benefits in the Denver and Tampa Bay metropolitan areas
DOE Office of Scientific and Technical Information (OSTI.GOV)
Held, K.; Casper, B.; Siddhanti, S.K.
1995-12-31
The purpose of the study is to evaluate the benefits of the Superfund program in selected geographic areas. The study demonstrates how the cleanup of Superfund sites has improved the overall quality of life of those in the affected communities. The study presents findings on the benefits of Superfund cleanup activity in the Denver, Colorado and Tampa Bay, Florida metropolitan areas. Denver and Tampa Bay were chosen from several areas that the EPA evaluated and screened during the initial phase of the study. These locations were chosen because of a substantial presence of Superfund activities, making it possible to assessmore » the efficacy of the program. Several features make this study unique in terms of its overall goal. The study examines a broad range of benefit categories related to human health, environmental, and socioeconomic effects of Superfund cleanup activities. The study is also designed to assess benefits due to completed, current, and future planned activity at Superfund sites. This assessment covers Federal remedial activities at National Priorities List (NPL) sites, as well as relevant Federal removal actions in the study areas. These benefits are investigated from an area-wide perspective, as opposed to site-by-site, to determine Superfund`s overall effect on the communities in each area. The study consists of two major phases: Phase 1: Screening and ranking 16 prospective geographic areas and selecting Denver and Tampa Bay as the most appropriate areas for in-depth analysis; and Phase 2: Developing methodologies for assessing benefits, collecting relevant data, and analyzing the benefits from Superfund cleanup activity.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jarvis, T.T.; Andrews, W.B.; Buck, J.W.
1998-03-01
Since 1989, the Department of Energy`s (DOE) Environmental Management (EM) Program has managed the environmental legacy of US nuclear weapons production, research and testing at 137 facilities in 31 states and one US territory. The EM program has conducted several studies on the public risks posed by contaminated sites at these facilities. In Risks and the Risk Debate [DOE, 1995a], the Department analyzed the risks at sites before, during, and after remediation work by the EM program. The results indicated that aside from a few urgent risks, most hazards present little inherent risk because physical and active site management controlsmore » limit both the releases of site contaminants, and public access to these hazards. Without these controls, these sites would pose greater risks to the public. Past risk reports, however, provided little information about post-cleanup risk, primarily because of uncertainty about future site uses and site characteristics at the end of planned cleanup activities. This is of concern because in many cases current cleanup technologies, and remedies, will last a shorter period of time than the waste itself and the resulting contamination will remain hazardous.« less
Analysis of Web Site Activity and Technology Transfer Accomplishments
Daniel L. Schmoldt; Matthew F. Winn; Philip A. Araman
1997-01-01
Government research activities are coming under increased scrutiny to justify their research direction, and to validate research project existence. One way to justify research is to pay closer attention to research clientele, their needs and their willingness and ability to adopt new technologies. Because many research products are informational rather than tangible,...
Azimuth selection for sea level measurements using geodetic GPS receivers
NASA Astrophysics Data System (ADS)
Wang, Xiaolei; Zhang, Qin; Zhang, Shuangcheng
2018-03-01
Based on analysis of Global Positioning System (GPS) multipath signals recorded by a geodetic GPS receiver, GPS Reflectometry (GPS-R) has demonstrated unique advantages in relation to sea level monitoring. Founded on multipath reflectometry theory, sea level changes can be measured by GPS-R through spectral analysis of recorded signal-to-noise ratio data. However, prior to estimating multipath parameters, it is necessary to define azimuth and elevation angle mask to ensure the reflecting zones are on water. Here, a method is presented to address azimuth selection, a topic currently under active development in the field of GPS-R. Data from three test sites: the Kachemak Bay GPS site PBAY in Alaska (USA), Friday Harbor GPS site SC02 in the San Juan Islands (USA), and Brest Harbor GPS site BRST in Brest (France) are analyzed. These sites are located in different multipath environments, from a rural coastal area to a busy harbor, and they experience different tidal ranges. Estimates by the GPS tide gauges at azimuths selected by the presented method are compared with measurements from physical tide gauges and acceptable correspondence found for all three sites.
Paule, M A; Memon, S A; Lee, B-Y; Umer, S R; Lee, C-H
2014-01-01
Stormwater runoff quality is sensitive to land use and land cover (LULC) change. It is difficult to understand their relationship in predicting the pollution potential and developing watershed management practices to eliminate or reduce the pollution risk. In this study, the relationship between LULC change and stormwater runoff quality in two separate monitoring sites comprising a construction area (Site 1) and mixed land use (Site 2) was analyzed using geographic information system (GIS), event mean concentration (EMC), and correlation analysis. It was detected that bare land area increased, while other land use areas such as agriculture, commercial, forest, grassland, parking lot, residential, and road reduced. Based on the analyses performed, high maximum range and average EMCs were found in Site 2 for most of the water pollutants. Also, urban areas and increased conversion of LULC into bare land corresponded to degradation of stormwater quality. Correlation analysis between LULC and stormwater quality showed the influence of different factors such as farming practices, geographical location, and amount of precipitation, vegetation loss, and anthropogenic activities in monitoring sites. This research found that GIS application was an efficient tool for monthly monitoring, validation and statistical analysis of LULC change in the study area.
Yuasa, Motoyuki; Shirayama, Yoshihisa; Osato, Keiichi; Miranda, Cesar; Condore, Julia; Siles, Roxana
2015-06-20
An assessment of self-efficacy and social capital may have the potential to detect an effect of dynamic, complex and comprehensive collective actions in community-based health promotion. In 2003, a healthy village project was launched in Santa Cruz, Bolivia with technical assistance from the Japan International Cooperation Agency (JICA). The originally developed FORSA (Fortalecimiento de Redes de Salud) model accounted for participatory processes in which people could improve their health and well-being through individual behavioral changes and family/community-driven activities. This study aimed to examine the extent of self-efficacy and social capital obtained via project activities by a cross-sectional analysis. We randomly selected 340 subjects from the healthy village project site and 113 subjects from a control area. Both groups were interviewed using the same structured questionnaire. Self-efficacy was assessed with a General Self-Efficacy Scale (GSES), while social capital was measured as the frequency of formal group participation in community meetings during the past three months, perceived social solidarity, and general trust. The study results showed that the participants in the project site had higher self-efficacy and social capital compared to those in the control site. The number of times a subject participated in the health committee activities was positively associated with the self-efficacy scale. Regarding social capital, females and lower-educated people were more likely to have had more frequent participation in formal groups; males and higher-educated participants showed less formal group participation, but more generosity to contribute money for the community. The main perceived benefit of participation in formal group activities varied among individuals. The findings suggest that people in the healthy village project site have higher self-efficacy, especially those with active participation in the health committee activities. To recruit more participants in future healthy village projects, we should consider the gender and level of education, and match the perceived benefits of participants accordingly.
Size of bacterial ice-nucleation sites measured in situ by radiation inactivation analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Govindarajan, A.G.; Lindow, S.E.
1988-03-01
Four bacterial species are known to catalyze ice formation at temperatures just below 0/sup 0/C. To better understand the relationship between the molecular structure of bacterial ice-nucleation site(s) and the quantitative and qualitative features of the ice-nucleation-active phenotype, the authors determined by ..gamma..-radiation analysis the in situ size of ice-nucleation sites in strains of Pseudomonas syringae and Erwinia herbicola and in Escherichia coli HB101 carrying the plasmid pICE1.1. Lyophilized cells of each bacterial strain were irradiated with a flux of ..gamma.. radiation from 0 to 10.2 Mrad. Differential concentrations of active ice nuclei decreased as a first-order function of radiationmore » dose in all strains as temperature was decreased from -2/sup 0/C to -14/sup 0/C in 1/sup 0/C intervals. Sizes of ice nuclei were calculated from the /sup +/-radiation flux at which 37% of initial ice nuclei active within each 1/sup 0/C temperature interval remained. The minimum mass of a functional ice nucleus was about 150 kDa for all strains. The size of ice nuclei increased logarithmically with increasing temperature from -12/sup 0/CC to -2/sup 0/C, where the estimated nucleant mass was 19,000 kDa. The ice nucleant in these three bacterial species may represent an oligomeric structure, composed at least in part of an ice gene product that can self-associate to assume many possible sizes.« less
Hou, Guanhua; Cui, Qiang
2013-07-17
The first step for the hydrolysis of a phosphate monoester (pNPP(2-)) in enzymes of the alkaline phosphatase (AP) superfamily, R166S AP and wild-type NPP, is studied using QM/MM simulations based on an approximate density functional theory (SCC-DFTBPR) and a recently introduced QM/MM interaction Hamiltonian. The calculations suggest that similar loose transition states are involved in both enzymes, despite the fact that phosphate monoesters are the cognate substrates for AP but promiscuous substrates for NPP. The computed loose transition states are clearly different from the more synchronous ones previously calculated for diester reactions in the same AP enzymes. Therefore, our results explicitly support the proposal that AP enzymes are able to recognize and stabilize different types of transition states in a single active site. Analysis of the structural features of computed transition states indicates that the plastic nature of the bimetallic site plays a minor role in accommodating multiple types of transition states and that the high degree of solvent accessibility of the AP active site also contributes to its ability to stabilize diverse transition-state structures without the need of causing large structural distortions of the bimetallic motif. The binding mode of the leaving group in the transition state highlights that vanadate may not always be an ideal transition state analog for loose phosphoryl transfer transition states.
Marciano, David C; Brown, Nicholas G; Palzkill, Timothy
2009-01-01
A large number of β-lactamases have emerged that are capable of conferring bacterial resistance to β-lactam antibiotics. Comparison of the structural and functional features of this family has refined understanding of the catalytic properties of these enzymes. An arginine residue present at position 244 in TEM-1 β-lactamase interacts with the carboxyl group common to penicillin and cephalosporin antibiotics and thereby stabilizes both the substrate and transition state complexes. A comparison of class A β-lactamase sequences reveals that arginine at position 244 is not conserved, although a positive charge at this structural location is conserved and is provided by an arginine at positions 220 or 276 for those enzymes lacking arginine at position 244. The plasticity of the location of positive charge in the β-lactamase active site was experimentally investigated by relocating the arginine at position 244 in TEM-1 β-lactamase to positions 220, 272, and 276 by site-directed mutagenesis. Kinetic analysis of the engineered β-lactamases revealed that removal of arginine 244 by alanine mutation reduced catalytic efficiency against all substrates tested and restoration of an arginine at positions 272 or 276 partially suppresses the catalytic defect of the Arg244Ala substitution. These results suggest an evolutionary mechanism for the observed divergence of the position of positive charge in the active site of class A β-lactamases. PMID:19672877
Cousin, E; Medcalf, R L; Bergonzelli, G E; Kruithof, E K
1991-01-01
Gene transcription rates and mRNA levels of plasminogen activator inhibitor type 2 (PAI-2) are markedly induced by the tumor promoting agent phorbol 12-myristate 13-acetate (PMA) in human HT1080 fibrosarcoma cells. To identify promoter elements required for basal-, and phorbol ester-inducible expression, deletion mutants of the PAI-1 promoter fused to the chloramphenicol acetyl transferase (CAT) reporter gene, were transiently expressed in HT1080 cells. Constitutive CAT activity was expressed from constructs containing more than 215 bp of promoter sequence, whereas deletion to position -91 bp abolished CAT gene expression. Treatment of transfected cells with PMA resulted in a three- to ten-fold increase in CAT expression from all constructs except from the construct shortened to position -91. DNAse1 protection analysis of the promoter region between -215 and the transcription initiation site revealed numerous protected regions, including two AP1-like binding sites (AP1a and AP1b) and one CRE-like element. Site-directed mutagenesis of the AP1a site or of the CRE-like site resulted in the loss of basal CAT activity and abolished the PMA effect, whereas mutagenesis of AP1b only partially inhibited basal and PMA-mediated expression. Our results suggest that the PAI-2 promoter contains at least two elements required for basal gene transcription and PMA-mediated induction. Images PMID:1650454
Emergence of Secondary Trigger Sites after Primary Migraine Surgery.
Punjabi, Ayesha; Brown, Matthew; Guyuron, Bahman
2016-04-01
Surgical decompression of a migraine headache may unmask headaches originating from secondary sites. A retrospective chart review investigated the incidence and characteristics of secondary trigger sites to identify clinical patterns that could aid in predicting and perhaps reducing postoperative migraines. One hundred eighty-five charts for migraine patients who underwent surgery at the senior author's (B.G.) practice were reviewed. Sites from which migraine headaches initiated or occurred independently were considered primary. The sites that were not active at the time of preoperative evaluation but became active after surgery were considered secondary. Bivariate analysis was performed to characterize postoperative migraines. Of 185 patients, 33 (17.8 percent) developed secondary migraine headache trigger sites. Of patients with primary site I (frontal) symptoms, 20.83 percent had site III (septonasal) symptoms unmasked after surgery (versus 7 percent for patients with other primary sites; p = 0.04). Of the patients with site II (temporal) migraines, 17.14 percent had secondary frontal symptoms (versus 5.68 percent; p = 0.04). Primary site II symptoms predicted postoperative site IV (occipital) symptoms (11.43 versus 1.1 percent; p = 0.008), and primary occipital symptoms predicted postoperative temporal symptoms (11.1 versus 2.33 percent; p = 0.04). The authors observed that 17.8 percent of patients develop postoperative migraine headache triggers that are not reported during the initial assessment. Knowledge of secondary migraine emergence patterns, and the presence of some preoperative symptoms, can aid in predicting the migraines that will arise from a new site postoperatively. Therapeutic, IV.
Hwa, Kuo Yuan; Subramani, Boopathi; Shen, San-Tai; Lee, Yu-May
2015-09-01
β-Glycosidase from Thermococcus kodakarensis KOD1 is a hyperthermophilic enzyme with β-glucosidase, β-mannosidase, β-fucosidase and β-galactosidase activities. Sequence alignment with other β-glycosidases from hyperthermophilic archaea showed two unique active site residues, Gln77 and Asp206. These residues were represented by Arg and Asp in all other hyperthermophilic β-glycosidases. The two active site residues were mutated to Q77R, D206N and D206Q, to study the role of these unique active site residues in catalytic activity and to alter the substrate specificity to enhance its β-glucosidase activity. The secondary structure analysis of all the mutants showed no change in their structure and exhibited in similar conformation like wild-type as they all existed in dimer form in an SDS-PAGE under non-reducing conditions. Q77R and D206Q affected the catalytic activity of the enzyme whereas the D206N altered the catalytic turn-over rate for glucosidase and mannosidase activities with fucosidase activity remain unchanged. Gln77 is reported to interact with catalytic nucleophile and Asp206 with axial C2-hydroxyl group of substrates. Q77R might have made some changes in three dimensional structure due to its electrostatic effect and lost its catalytic activity. The extended side chains of D206Q is predicted to affect the substrate binding during catalysis. The high-catalytic turn-over rate by D206N for β-glucosidase activity makes it a useful enzyme in cellulose degradation at high temperatures. Copyright © 2015 Elsevier Inc. All rights reserved.
Rudolph, G; Bechmann, M; Berninger, T; Kutschbach, E; Held, U; Tornow, R P; Kalpadakis, P; Zol'nikova, I V; Shamshinova, A M
2001-01-01
A new method of multifocal electroretinography making use of scanning laser ophthalmoscope with a wavelength of 630 nm (SLO-m-ERG), evoking short spatial visual stimuli on the retina, is proposed. Algorithm of presenting the visual stimuli and analysis of distribution of local electroretinograms on the surface of the retina is based on short m-sequences. Mathematical cross correlation analysis shows a three-dimensional distribution of bioelectrical activity of the retina in the central visual field. In normal subjects the cone bioelectrical activity is the maximum in the macular area (corresponding to the density of cone distribution) and absent in the blind spot. The method detects the slightest pathological changes in the retina under control of the site of stimulation and ophthalmoscopic picture of the fundus oculi. The site of the pathological process correlates with the topography of changes in bioelectrical activity of the examined retinal area in diseases of the macular area and pigmented retinitis detectable by ophthalmoscopy.
Formation of RNA oligomers on montmorillonite: site of catalysis
NASA Technical Reports Server (NTRS)
Ertem, G.; Ferris, J. P.
1998-01-01
Certain montmorillonites catalyze the self condensation of the 5'-phosphorimidazolide of nucleosides in pH 8 aqueous electrolyte solutions at ambient temperatures leading to formation of RNA oligomers. In order to establish the nature of the sites on montmorillonite responsible for this catalytic activity, oligomerization reactions were run with montmorillonites which had been selectively modified (I) at the edges by (a) fluoride treatment, (b) silylation, (c) metaphosphate treatment of the anion exchange sites (II) in the interlayer by (a) saturation with quaternary alkylammonium ions of increasing size, (b) aluminum polyoxo cations. High pressure liquid chromatography, HPLC, analysis of condensation products for their chain lengths and yields indicated that modification at the edges did not affect the catalytic activity to a significant extent, while blocking the interlayer strongly inhibited product formation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Lu-Cun; Friend, C. M.; Fushimi, Rebecca
The activation of molecular O 2as well as the reactivity of adsorbed oxygen species is of central importance in aerobic selective oxidation chemistry on Au-based catalysts. Herein, we address the issue of O 2activation on unsupported nanoporous gold (npAu) catalysts by applying a transient pressure technique, a temporal analysis of products (TAP) reactor, to measure the saturation coverage of atomic oxygen, its collisional dissociation probability, the activation barrier for O 2dissociation, and the facility with which adsorbed O species activate methanol, the initial step in the catalytic cycle of esterification. The results from these experiments indicate that molecular O 2dissociationmore » is associated with surface silver, that the density of reactive sites is quite low, that adsorbed oxygen atoms do not spill over from the sites of activation onto the surrounding surface, and that methanol reacts quite facilely with the adsorbed oxygen atoms. In addition, the O species from O 2dissociation exhibits reactivity for the selective oxidation of methanol but not for CO. The TAP experiments also revealed that the surface of the npAu catalyst is saturated with adsorbed O under steady state reaction conditions, at least for the pulse reaction.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Lu-Cun; Friend, C. M.; Fushimi, Rebecca
2016-01-01
The activation of molecular O 2as well as the reactivity of adsorbed oxygen species is of central importance in aerobic selective oxidation chemistry on Au-based catalysts. Herein, we address the issue of O 2activation on unsupported nanoporous gold (npAu) catalysts by applying a transient pressure technique, a temporal analysis of products (TAP) reactor, to measure the saturation coverage of atomic oxygen, its collisional dissociation probability, the activation barrier for O 2dissociation, and the facility with which adsorbed O species activate methanol, the initial step in the catalytic cycle of esterification. The results from these experiments indicate that molecular O 2dissociationmore » is associated with surface silver, that the density of reactive sites is quite low, that adsorbed oxygen atoms do not spill over from the sites of activation onto the surrounding surface, and that methanol reacts quite facilely with the adsorbed oxygen atoms. In addition, the O species from O 2dissociation exhibits reactivity for the selective oxidation of methanol but not for CO. The TAP experiments also revealed that the surface of the npAu catalyst is saturated with adsorbed O under steady state reaction conditions, at least for the pulse reaction.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Davison, Claire C.
1972-09-01
Glass beads from archaeological sites of sub-Saharan Africa were analyzed by neutron activation and by X-ray fluorescence, and the results interpreted archaeologically. The glass beads from Igbo Ukwu (Nigeria), dated approximately to the ninth century A.D., were mostly soda-lime glasses, but a few potassium glasses were found. The glass artifacts from Ife (Nigeria), dated to approximately the tenth to twelfth centuries A.D., were mostly potassium glasses , with some soda-lime glasses. Some close resemblances were found between the glasses of the two sites . Evidence for glassworking which exists at Ife is interpreted as evidence of reworking, rather than manufacturemore » from raw materials. A European provenience is suggested for the potassium glasses, but the provenience of the soda-lime glasses i s unclear.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Robertshaw, G.A.; Snyder, A.L.; Weiner, M.M.
1993-05-14
The proposed HAARP emitters at the Gakona (Alaska) preferred site and at the Clear AFS (Alaska) alternative site are the Ionospheric Research Instrument (IRI), the Incoherent Scatter Radar (ISR), and the Vertical Incidence Sounder(VIS). The electromagnetic interference (EMI) impact of those emitters on receiving systems in the vicinity of the sites is estimated in this study. The results are intended for use as an input to the Air Force Environmental Impact Statement as part of the Environmental Impact Analysis Process.
Pattern Activity Clustering and Evaluation (PACE)
NASA Astrophysics Data System (ADS)
Blasch, Erik; Banas, Christopher; Paul, Michael; Bussjager, Becky; Seetharaman, Guna
2012-06-01
With the vast amount of network information available on activities of people (i.e. motions, transportation routes, and site visits) there is a need to explore the salient properties of data that detect and discriminate the behavior of individuals. Recent machine learning approaches include methods of data mining, statistical analysis, clustering, and estimation that support activity-based intelligence. We seek to explore contemporary methods in activity analysis using machine learning techniques that discover and characterize behaviors that enable grouping, anomaly detection, and adversarial intent prediction. To evaluate these methods, we describe the mathematics and potential information theory metrics to characterize behavior. A scenario is presented to demonstrate the concept and metrics that could be useful for layered sensing behavior pattern learning and analysis. We leverage work on group tracking, learning and clustering approaches; as well as utilize information theoretical metrics for classification, behavioral and event pattern recognition, and activity and entity analysis. The performance evaluation of activity analysis supports high-level information fusion of user alerts, data queries and sensor management for data extraction, relations discovery, and situation analysis of existing data.
Remote Exosites of the Catalytic Domain of Matrix Metalloproteinase-12 Enhance Elastin Degradation┼
Fulcher, Yan G.; Van Doren, Steven R.
2011-01-01
How does matrix metalloproteinase-12 (MMP-12 or metalloelastase) degrade elastin with high specific activity? NMR suggested soluble elastin to cover surfaces of MMP-12 far from its active site. Two of these surfaces have been found, by mutagenesis guided by the BINDSIght approach, to affect degradation and affinity for elastin substrates but not a small peptide substrate. Main exosite 1 has been extended out to Asp124 that binds calcium. Novel exosite 2 comprises residues from the II–III loop and β-strand I near the back of the catalytic domain. The high exposure of these distal exosites may make them accessible to elastin made more flexible by partial hydrolysis. Importantly, combination of a lesion at each of exosites 1 and 2 and active site decreased catalytic competence towards soluble elastin by 13- to 18-fold to the level of MMP-3, homologue and poor elastase. Double mutant cycle analysis of conservative mutations of Met156 (exosite 2) and either Asp124 (exosite 1) or Ile180 (active site) had additive effects. Compared to polar substitutions observed in other MMPs, Met156 enhanced affinity and Ile180 kcat for soluble elastin. Both residues detracted from the higher folding stability with polar mutations. This resembles the trend in enzymes of an inverse relationship between folding stability and activity. Restoring Asp124 from combination mutants enhanced kcat for soluble elastin. In elastin degradation, exosites 1 and 2 contributed independently of each other and Ile180 at the active site, but with partial coupling to Ala182 near the active site. The concept of weak, separated interactions coalescing somewhat independently can be extended to this proteolytic digestion of a protein from fibrils. PMID:21967233
Activation of CO2 by supported Cu clusters.
Iyemperumal, Satish Kumar; Deskins, N Aaron
2017-11-01
Catalytic reduction of carbon dioxide to useful chemicals is a potent way to mitigate this greenhouse gas, but the challenge lies in finding active reduction catalysts. Using density functional theory we studied CO 2 activation over TiO 2 -supported Cu clusters of size 1-4 atoms. The linear to bent transformation of CO 2 is necessary for activation, and we found that all the clusters stabilized bent CO 2 , along with a significant gain of electrons on the CO 2 (indicative of activation). On all the TiO 2 supported Cu clusters, the interfacial sites were found to stabilize the bent CO 2 adsorption, where the active site of adsorption on Cu dimer, trimer and tetramer was on the Cu atom farthest away from the TiO 2 surface. Particularly, the Cu dimer stabilized bent CO 2 very strongly, although this species was found to be unstable on the surface. A synthesis technique that could stabilize the Cu dimer could therefore lead to a very active catalyst. Furthermore we found (using vibrational and charge analysis) that the active sites for the CO 2 activation predominantly had 0 and +1 oxidation states; the oxidation state of Cu is known to directly affect CO 2 reduction activity. Our study shows TiO 2 -supported small Cu clusters can be active catalysts for CO 2 reduction and also provides further motivation for theoretical and experimental studies of metal clusters.
Masukagami, Yumiko; Tivendale, Kelly Anne; Browning, Glenn Francis; Sansom, Fiona Margaret
2018-02-01
The lactate dehydrogenase (LDH) of Mycoplasma genitalium has been predicted to also act as a malate dehydrogenase (MDH), but there has been no experimental validation of this hypothesized dual function for any mollicute. Our analysis of the metabolite profile of Mycoplasma bovis using gas chromatography/mass spectrometry (GC/MS) and liquid chromatography/mass spectrometry (LC/MS) detected malate, suggesting that there may be MDH activity in M. bovis. To investigate whether the putative l-LDH enzyme of M. bovis has a dual function (MDH and LDH), we performed bioinformatic and functional biochemical analyses. Although the amino acid sequence and predicted structural analysis of M. bovisl-LDH revealed unusual residues within the catalytic site, suggesting that it may have the flexibility to possess a dual function, our biochemical studies using recombinant M. bovis -LDH did not detect any MDH activity. However, we did show that the enzyme has typical LDH activity that could be inhibited by both MDH substrates oxaloacetate (OAA) and malate, suggesting that these substrates may be able to bind to M. bovis LDH. Inhibition of the conversion of pyruvate to lactate by OAA may be one method the mycoplasma cell uses to reduce the potential for accumulation of intracellular lactate.
NASA Technical Reports Server (NTRS)
Stoker, C. R.; Zavaleta, J.; Bell, M.; Direto, S.; Foing, B.; Blake, D.; Kim, S.
2010-01-01
DOMEX (Drilling on the Moon and Mars in Human Exploration) is using analog missions to develop the approach for using human crews to perform science activities on the Moon and Mars involving exploration and sampling of the subsurface. Subsurface science is an important activity that may be uniquely enabled by human crews. DOMEX provides an opportunity to plan and execute planetary mission science activities without the expense and overhead of a planetary mission. Objectives: The objective of this first in a series of DOMEX missions were to 1) explore the regional area to understand the geologic context and determine stratigraphy and geologic history of various geologic units in the area. 2) Explore for and characterize sites for deploying a deep (10 m depth) drilling system in a subsequent field season. 3) Perform GPR on candidate drill sites. 4) Select sites that represent different geological units deposited in different epochs and collect soil cores using sterile procedures for mineralogical, organic and biological analysis. 5) Operate the MUM in 3 different sites representing different geological units and soil characteristics. 6) Collect rock and soil samples of sites visited and analyze them at the habitat. Results: At mission start the crew performed a regional survey to identify major geologic units that were correlated to recognized stratigraphy and regional geologic maps. Several candidate drill sites were identified. During the rest of the mission, successful GPR surveys were conducted in four locations. Soil cores were collected in 5 locations representing soils from 4 different geologic units, to depths up to 1m. Soil cores from two locations were analyzed with PCR in the laboratory. The remainder were reserved for subsequent analysis. XRD analysis was performed in the habitat and in the field on 39 samples, to assist with sample characterization, conservation, and archiving. MUM was deployed at 3 field locations and 1 test location (outside the habitat) where it operated autonomously for 2-4 hours at each site. Depths achieved ranged from 15 to 70 cm depending on the soil compressive strength and the presence and depth of subsurface indurated layers. Subsurface samples weighing 0.5 to 1 g were collected at the deepest depth encountered at each of the sites using the MUM automated sample collection system, and subsequently analyzed with XRD. Downhole inspection of holes produced by MUM with the Raman spectrometer was acquired on two of the holes and spectral features associated with selenite were identified in specific soil layers. Previously unreported fossilized remains of vertebrate fauna from the Jurassic era were discovered during our mission. Analysis of mineral biomarkers associated with this discovery are underway.
Kongpichitchoke, Teeradate; Hsu, Jue-Liang; Huang, Tzou-Chi
2015-05-13
Although flavonoids have been reported for their benefits and nutraceutical potential use, the importance of their structure on their beneficial effects, especially on signal transduction mechanisms, has not been well clarified. In this study, three flavonoids, pinocembrin, naringenin, and eriodictyol, were chosen to determine the effect of hydroxyl groups on the B-ring of flavonoid structure on their antioxidant activity. In vitro assays, including DPPH scavenging activity, ROS quantification by flow cytometer, and proteins immunoblotting, and in silico analysis by molecular docking between the flavonoids and C1B domain of PKCδ phorbol ester binding site were both used to complete this study. Eriodictyol (10 μM), containing two hydroxyl groups on the B-ring, exhibited significantly higher (p < 0.05) antioxidant activity than pinocembrin and naringenin. The IC50 values of eriodictyol, naringenin, and pinocembrin were 17.4 ± 0.40, 30.2 ± 0.61, and 44.9 ± 0.57 μM, respectively. In addition, eriodictyol at 10 μM remarkably inhibited the phosphorylation of PKCδ at 63.4% compared with PMA-activated RAW264.7, whereas pinocembrin and naringenin performed inhibition activity at 76.8 and 72.6%, respectively. According to the molecular docking analysis, pinocembrin, naringenin, and eriodictyol showed -CDOCKER_energy values of 15.22, 16.95, and 21.49, respectively, reflecting that eriodictyol could bind with the binding site better than the other two flavonoids. Interestingly, eriodictyol had a remarkably different pose to bind with the kinase as a result of the two hydroxyl groups on its B-ring, which consequently contributed to greater antioxidant activity over pinocembrin and naringenin.
Human Activity Helps Prey Win the Predator-Prey Space Race
Muhly, Tyler B.; Semeniuk, Christina; Massolo, Alessandro; Hickman, Laura; Musiani, Marco
2011-01-01
Predator-prey interactions, including between large mammalian wildlife species, can be represented as a “space race”, where prey try to minimize and predators maximize spatial overlap. Human activity can also influence the distribution of wildlife species. In particular, high-human disturbance can displace large carnivore predators, a trait-mediated direct effect. Predator displacement by humans could then indirectly benefit prey species by reducing predation risk, a trait-mediated indirect effect of humans that spatially decouples predators from prey. The purpose of this research was to test the hypothesis that high-human activity was displacing predators and thus indirectly creating spatial refuge for prey species, helping prey win the “space race”. We measured the occurrence of eleven large mammal species (including humans and cattle) at 43 camera traps deployed on roads and trails in southwest Alberta, Canada. We tested species co-occurrence at camera sites using hierarchical cluster and nonmetric multidimensional scaling (NMS) analyses; and tested whether human activity, food and/or habitat influenced predator and prey species counts at camera sites using regression tree analysis. Cluster and NMS analysis indicated that at camera sites humans co-occurred with prey species more than predator species and predator species had relatively low co-occurrence with prey species. Regression tree analysis indicated that prey species were three times more abundant on roads and trails with >32 humans/day. However, predators were less abundant on roads and trails that exceeded 18 humans/day. Our results support the hypothesis that high-human activity displaced predators but not prey species, creating spatial refuge from predation. High-human activity on roads and trails (i.e., >18 humans/day) has the potential to interfere with predator-prey interactions via trait-mediated direct and indirect effects. We urge scientist and managers to carefully consider and quantify the trait-mediated indirect effects of humans, in addition to direct effects, when assessing human impacts on wildlife and ecosystems. PMID:21399682
Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul
2008-11-21
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.
Assessing bat detectability and occupancy with multiple automated echolocation detectors
Gorresen, P.M.; Miles, A.C.; Todd, C.M.; Bonaccorso, F.J.; Weller, T.J.
2008-01-01
Occupancy analysis and its ability to account for differential detection probabilities is important for studies in which detecting echolocation calls is used as a measure of bat occurrence and activity. We examined the feasibility of remotely acquiring bat encounter histories to estimate detection probability and occupancy. We used echolocation detectors coupled to digital recorders operating at a series of proximate sites on consecutive nights in 2 trial surveys for the Hawaiian hoary bat (Lasiurus cinereus semotus). Our results confirmed that the technique is readily amenable for use in occupancy analysis. We also conducted a simulation exercise to assess the effects of sampling effort on parameter estimation. The results indicated that the precision and bias of parameter estimation were often more influenced by the number of sites sampled than number of visits. Acceptable accuracy often was not attained until at least 15 sites or 15 visits were used to estimate detection probability and occupancy. The method has significant potential for use in monitoring trends in bat activity and in comparative studies of habitat use. ?? 2008 American Society of Mammalogists.
Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium
Cai, Yongping; Lin, Yi
2013-01-01
In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048
Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J
1992-03-01
The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary.
Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J
1992-01-01
The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788
Ganou, C A; Eleftheriou, P Th; Theodosis-Nobelos, P; Fesatidou, M; Geronikaki, A A; Lialiaris, T; Rekka, E A
2018-02-01
PTP1b is a protein tyrosine phosphatase involved in the inactivation of insulin receptor. Since inhibition of PTP1b may prolong the action of the receptor, PTP1b has become a drug target for the treatment of type II diabetes. In the present study, prediction of inhibition using docking analysis targeted specifically to the active or allosteric site was performed on 87 compounds structurally belonging to 10 different groups. Two groups, consisting of 15 thiomorpholine and 10 thiazolyl derivatives exhibiting the best prediction results, were selected for in vitro evaluation. All thiomorpholines showed inhibitory action (with IC 50 = 4-45 μΜ, Ki = 2-23 μM), while only three thiazolyl derivatives showed low inhibition (best IC 50 = 18 μΜ, Ki = 9 μΜ). However, free binding energy (E) was in accordance with the IC 50 values only for some compounds. Docking analysis targeted to the whole enzyme revealed that the compounds exhibiting IC 50 values higher than expected could bind to other peripheral sites with lower free energy, E o , than when bound to the active/allosteric site. A prediction factor, E- (Σ Eo × 0.16), which takes into account lower energy binding to peripheral sites, was proposed and was found to correlate well with the IC 50 values following an asymmetrical sigmoidal equation with r 2 = 0.9692.
Architecting Learning Continuities for Families Across Informal Science Experiences
NASA Astrophysics Data System (ADS)
Perin, Suzanne Marie
By first recognizing the valuable social and scientific practices taking place within families as they learn science together across multiple, everyday settings, this dissertation addresses questions of how to design and scaffold activities that build and expand on those practices to foster a deep understanding of science, and how the aesthetic experience of learning science builds connections across educational settings. Families were invited to visit a natural history museum, an aquarium, and a place or activity of the family's choice that they associated with science learning. Some families were asked to use a set of activities during their study visits based on the practices of science (National Research Council, 2012), which were delivered via smartphone app or on paper cards. I use design-based research, video data analysis and interaction analysis to examine how families build connections between informal science learning settings. Chapter 2 outlines the research-based design process of creating activities for families that fostered connections across multiple learning settings, regardless of the topical content of those settings. Implications of this study point to means for linking everyday family social practices such as questioning, observing, and disagreeing to the practices of science through activities that are not site-specific. The next paper delves into aesthetic experience of science learning, and I use video interaction analysis and linguistic analysis to show how notions of beauty and pleasure (and their opposites) are perfused throughout learning activity. Designing for aesthetic experience overtly -- building on the sensations of enjoyment and pleasure in the learning experience -- can motivate those who might feel alienated by the common conception of science as merely a dispassionate assembly of facts, discrete procedures or inaccessible theory. The third paper, a case study of a family who learns about salmon in each of the sites they visit, highlights the contributions of multiple sites of learning in an ecological view of learning. Finally, the dissertations' conclusion highlights the broad implications for conceiving of the many varied learning settings in a community as an educational infrastructure, and reflections on using aesthetic experience for broadening participation the sciences through the design of informal environments.
LeVine, Michael V.; Weinstein, Harel
2014-01-01
Complex networks of interacting residues and microdomains in the structures of biomolecular systems underlie the reliable propagation of information from an input signal, such as the concentration of a ligand, to sites that generate the appropriate output signal, such as enzymatic activity. This information transduction often carries the signal across relatively large distances at the molecular scale in a form of allostery that is essential for the physiological functions performed by biomolecules. While allosteric behaviors have been documented from experiments and computation, the mechanism of this form of allostery proved difficult to identify at the molecular level. Here, we introduce a novel analysis framework, called N-body Information Theory (NbIT) analysis, which is based on information theory and uses measures of configurational entropy in a biomolecular system to identify microdomains and individual residues that act as (i)-channels for long-distance information sharing between functional sites, and (ii)-coordinators that organize dynamics within functional sites. Application of the new method to molecular dynamics (MD) trajectories of the occluded state of the bacterial leucine transporter LeuT identifies a channel of allosteric coupling between the functionally important intracellular gate and the substrate binding sites known to modulate it. NbIT analysis is shown also to differentiate residues involved primarily in stabilizing the functional sites, from those that contribute to allosteric couplings between sites. NbIT analysis of MD data thus reveals rigorous mechanistic elements of allostery underlying the dynamics of biomolecular systems. PMID:24785005
Fasciglione, Giovanni Francesco; Sbardella, Diego; Sciandra, Francesca; Casella, MariaLuisa; Camerini, Serena; Crescenzi, Marco; Gori, Alessandro; Tarantino, Umberto; Cozza, Paola; Brancaccio, Andrea; Coletta, Massimo; Bozzi, Manuela
2018-01-01
Dystroglycan (DG) is a membrane receptor, belonging to the dystrophin-glycoprotein complex (DGC) and formed by two subunits, α-dystroglycan (α-DG) and β-dystroglycan (β -DG). The C-terminal domain of α-DG and the N-terminal extracellular domain of β -DG are connected, providing a link between the extracellular matrix and the cytosol. Under pathological conditions, such as cancer and muscular dystrophies, DG may be the target of metalloproteinases MMP-2 and MMP-9, contributing to disease progression. Previously, we reported that the C-terminal domain α-DG (483–628) domain is particularly susceptible to the catalytic activity of MMP-2; here we show that the α-DG 621–628 region is required to carry out its complete digestion, suggesting that this portion may represent a MMP-2 anchoring site. Following this observation, we synthesized an α-DG based-peptide, spanning the (613–651) C-terminal region. The analysis of the kinetic and thermodynamic parameters of the whole and the isolated catalytic domain of MMP-2 (cdMMP-2) has shown its inhibitory properties, indicating the presence of (at least) two binding sites for the peptide, both located within the catalytic domain, only one of the two being topologically distinct from the catalytic active groove. However, the different behavior between whole MMP-2 and cdMMP-2 envisages the occurrence of an additional binding site for the peptide on the hemopexin-like domain of MMP-2. Interestingly, mass spectrometry analysis has shown that α-DG (613–651) peptide is cleavable even though it is a very poor substrate of MMP-2, a feature that renders this molecule a promising template for developing a selective MMP-2 inhibitor. PMID:29447293
Raghav, Darpan; Ashraf, Shabeeba M; Mohan, Lakshmi; Rathinasamy, Krishnan
2017-05-23
Berberine has been used traditionally for its diverse pharmacological actions. It exhibits remarkable anticancer activities and is currently under clinical trials. In this study, we report that the anticancer activity of berberine could be partly due to its inhibitory actions on tubulin and microtubule assembly. Berberine inhibited the proliferation of HeLa cells with an IC 50 of 18 μM and induced significant depolymerization of interphase and mitotic microtubules. At its IC 50 , berberine exerted a moderate G2/M arrest and mitotic block as detected by fluorescence-activated cell sorting analysis and fluorescence microscopy, respectively. In a wound closure assay, berberine inhibited the migration of HeLa cells at concentrations lower than its IC 50 , indicating its excellent potential as an anticancer agent. In vitro studies with tubulin isolated from goat brain indicated that berberine binds to tubulin at a single site with a K d of 11 μM. Berberine inhibited the assembly of tubulin into microtubules and also disrupted the preformed microtubules polymerized in the presence of glutamate and paclitaxel. Competition experiments indicated that berberine could partially displace colchicine from its binding site. Results from fluorescence resonance energy transfer, computational docking, and molecular dynamics simulations suggest that berberine forms a stable complex with tubulin and binds at a novel site 24 Å from the colchicine site on the β-tubulin. Data obtained from synchronous fluorescence analysis of the tryptophan residues of tubulin and from the Fourier transform infrared spectroscopy studies revealed that binding of berberine alters the conformation of the tubulin heterodimer, which could be the molecular mechanism behind the depolymerizing effects on tubulin assembly.
Watershed Planning within a Quantitative Scenario Analysis Framework.
Merriam, Eric R; Petty, J Todd; Strager, Michael P
2016-07-24
There is a critical need for tools and methodologies capable of managing aquatic systems within heavily impacted watersheds. Current efforts often fall short as a result of an inability to quantify and predict complex cumulative effects of current and future land use scenarios at relevant spatial scales. The goal of this manuscript is to provide methods for conducting a targeted watershed assessment that enables resource managers to produce landscape-based cumulative effects models for use within a scenario analysis management framework. Sites are first selected for inclusion within the watershed assessment by identifying sites that fall along independent gradients and combinations of known stressors. Field and laboratory techniques are then used to obtain data on the physical, chemical, and biological effects of multiple land use activities. Multiple linear regression analysis is then used to produce landscape-based cumulative effects models for predicting aquatic conditions. Lastly, methods for incorporating cumulative effects models within a scenario analysis framework for guiding management and regulatory decisions (e.g., permitting and mitigation) within actively developing watersheds are discussed and demonstrated for 2 sub-watersheds within the mountaintop mining region of central Appalachia. The watershed assessment and management approach provided herein enables resource managers to facilitate economic and development activity while protecting aquatic resources and producing opportunity for net ecological benefits through targeted remediation.
Managing for desired experiences and site preferences: the case of fee-fishing anglers.
Schuett, Michael A; Pierskalla, Chad D
2007-02-01
Fee-fishing involves paying a fee for the privilege of fishing a body of water where fish populations are enhanced by stocking fish. Past literature on this activity has focused more on the operation of the enterprise and management of the fish than the people and site characteristics. The objectives of the study were to profile anglers and describe their site/management preferences. This study utilized an on-site interview and mail-back questionnaire at fee-fishing establishments in West Virginia (n = 212). Factor analysis of desired recreation experiences yielded five factors: Experience nature & adventure, Stress release & relaxation, Trophy fishing, Escape, and Family time. Cluster analysis showed that these anglers can be segmented into two distinct clusters, differing by sociodemographic characteristics, fishing behavior, and site/management preferences. The findings from this study provide baseline data to aid public resource managers and fee-fishing business owners in determining how to provide satisfying outdoor experiences and deliver desired services on-site. Future research will be needed from additional fee-fishing sites to obtain more detail about this outdoor recreation cohort and be able to generalize to a larger population of participants.
Managing for Desired Experiences and Site Preferences: The Case of Fee-Fishing Anglers
NASA Astrophysics Data System (ADS)
Schuett, Michael A.; Pierskalla, Chad D.
2007-02-01
Fee-fishing involves paying a fee for the privilege of fishing a body of water where fish populations are enhanced by stocking fish. Past literature on this activity has focused more on the operation of the enterprise and management of the fish than the people and site characteristics. The objectives of the study were to profile anglers and describe their site/management preferences. This study utilized an on-site interview and mail-back questionnaire at fee-fishing establishments in West Virginia ( n = 212). Factor analysis of desired recreation experiences yielded five factors: Experience nature & adventure, Stress release & relaxation, Trophy fishing, Escape, and Family time. Cluster analysis showed that these anglers can be segmented into two distinct clusters, differing by sociodemographic characteristics, fishing behavior, and site/management preferences. The findings from this study provide baseline data to aid public resource managers and fee-fishing business owners in determining how to provide satisfying outdoor experiences and deliver desired services on-site. Future research will be needed from additional fee-fishing sites to obtain more detail about this outdoor recreation cohort and be able to generalize to a larger population of participants.
Sequence-Specific Targeting of Dosage Compensation in Drosophila Favors an Active Chromatin Context
Gelbart, Marnie; Tolstorukov, Michael Y.; Plachetka, Annette; Kharchenko, Peter V.; Jung, Youngsook L.; Gorchakov, Andrey A.; Larschan, Erica; Gu, Tingting; Minoda, Aki; Riddle, Nicole C.; Schwartz, Yuri B.; Elgin, Sarah C. R.; Karpen, Gary H.; Pirrotta, Vincenzo; Kuroda, Mitzi I.; Park, Peter J.
2012-01-01
The Drosophila MSL complex mediates dosage compensation by increasing transcription of the single X chromosome in males approximately two-fold. This is accomplished through recognition of the X chromosome and subsequent acetylation of histone H4K16 on X-linked genes. Initial binding to the X is thought to occur at “entry sites” that contain a consensus sequence motif (“MSL recognition element” or MRE). However, this motif is only ∼2 fold enriched on X, and only a fraction of the motifs on X are initially targeted. Here we ask whether chromatin context could distinguish between utilized and non-utilized copies of the motif, by comparing their relative enrichment for histone modifications and chromosomal proteins mapped in the modENCODE project. Through a comparative analysis of the chromatin features in male S2 cells (which contain MSL complex) and female Kc cells (which lack the complex), we find that the presence of active chromatin modifications, together with an elevated local GC content in the surrounding sequences, has strong predictive value for functional MSL entry sites, independent of MSL binding. We tested these sites for function in Kc cells by RNAi knockdown of Sxl, resulting in induction of MSL complex. We show that ectopic MSL expression in Kc cells leads to H4K16 acetylation around these sites and a relative increase in X chromosome transcription. Collectively, our results support a model in which a pre-existing active chromatin environment, coincident with H3K36me3, contributes to MSL entry site selection. The consequences of MSL targeting of the male X chromosome include increase in nucleosome lability, enrichment for H4K16 acetylation and JIL-1 kinase, and depletion of linker histone H1 on active X-linked genes. Our analysis can serve as a model for identifying chromatin and local sequence features that may contribute to selection of functional protein binding sites in the genome. PMID:22570616
Hypoxia induces mucin expression and secretion in human bronchial epithelial cells.
Zhou, Xiangdong; Tu, Jing; Li, Qi; Kolosov, Victor P; Perelman, Juliy M
2012-12-01
The study objective was to investigate the role of hypoxia-inducible factor 1 (HIF-1) in the transcriptional activation of MUC5AC in human bronchial epithelial (HBE) 16 cells under hypoxia conditions and the effect of hypoxia on expression and secretion of MUC5AC. Cells were incubated in hypoxia medium. Serial deletions or mutations of the MUC5AC promoter were cloned in the reporter pGL3-basic plasmid (Promega Biotech Co, Ltd, Beijing, China). These reporter plasmids were cotransfected with HIF-1α small interfering RNA. Hypoxia markedly increased the level of MUC5AC secretion and the transcriptional activity of MUC5AC promoters. Western blot analysis showed that HIF-1α and MUC5AC proteins were strongly increased after HBE16 cells were exposed to hypoxic conditions. Treatment of HBE16 cells with HIF-1α inhibitor (YC-1) or HIF-1α small interfering RNA significantly inhibited the expression of HIF-1α and MUC5AC, and the secretion of MUC5AC. Depletion of the promoter sequence did not reduce the MUC5AC promoter activity to hypoxia. Luciferase assay indicated that HRE in the MUC5AC promoter was in the region from -120 to +54. Promoter sequence analysis showed that 1 HRE site at -65 plays an important role in hypoxia activation of the MUC5AC. The inactivation of the HRE site using site-directed mutagenesis led to the complete loss of induction by hypoxia, which further confirmed the key role of the HRE site. MUC5AC expression and secretion are upregulated in response to hypoxia. The HRE site at -65 in the MUC5AC promoter and the HIF-1α are the major regulators for the cellular response against hypoxia in human bronchial epithelial cells. Copyright © 2012 Mosby, Inc. All rights reserved.
SWS: accessing SRS sites contents through Web Services.
Romano, Paolo; Marra, Domenico
2008-03-26
Web Services and Workflow Management Systems can support creation and deployment of network systems, able to automate data analysis and retrieval processes in biomedical research. Web Services have been implemented at bioinformatics centres and workflow systems have been proposed for biological data analysis. New databanks are often developed by taking into account these technologies, but many existing databases do not allow a programmatic access. Only a fraction of available databanks can thus be queried through programmatic interfaces. SRS is a well know indexing and search engine for biomedical databanks offering public access to many databanks and analysis tools. Unfortunately, these data are not easily and efficiently accessible through Web Services. We have developed 'SRS by WS' (SWS), a tool that makes information available in SRS sites accessible through Web Services. Information on known sites is maintained in a database, srsdb. SWS consists in a suite of WS that can query both srsdb, for information on sites and databases, and SRS sites. SWS returns results in a text-only format and can be accessed through a WSDL compliant client. SWS enables interoperability between workflow systems and SRS implementations, by also managing access to alternative sites, in order to cope with network and maintenance problems, and selecting the most up-to-date among available systems. Development and implementation of Web Services, allowing to make a programmatic access to an exhaustive set of biomedical databases can significantly improve automation of in-silico analysis. SWS supports this activity by making biological databanks that are managed in public SRS sites available through a programmatic interface.
Toth, Marta; Smith, Clyde A; Antunes, Nuno T; Stewart, Nichole K; Maltz, Lauren; Vakulenko, Sergei B
2017-08-01
Carbapenem-hydrolyzing class D β-lactamases (CHDLs) produce resistance to the last-resort carbapenem antibiotics and render these drugs ineffective for the treatment of life-threatening infections. Here, it is shown that among the clinically important CHDLs, OXA-143 produces the highest levels of resistance to carbapenems and has the highest catalytic efficiency against these substrates. Structural data demonstrate that acylated carbapenems entirely fill the active site of CHDLs, leaving no space for water molecules, including the deacylating water. Since the entrance to the active site is obstructed by the acylated antibiotic, the deacylating water molecule must take a different route for entry. It is shown that in OXA-143 the movement of a conserved hydrophobic valine residue on the surface opens a channel to the active site of the enzyme, which would not only allow the exchange of water molecules between the active site and the milieu, but would also create extra space for a water molecule to position itself in the vicinity of the scissile bond of the acyl-enzyme intermediate to perform deacylation. Structural analysis of the OXA-23 carbapenemase shows that in this enzyme movement of the conserved leucine residue, juxtaposed to the valine on the molecular surface, creates a similar channel to the active site. These data strongly suggest that all CHDLs may employ a mechanism whereupon the movement of highly conserved valine or leucine residues would allow a water molecule to access the active site to promote deacylation. It is further demonstrated that the 6α-hydroxyethyl group of the bound carbapenem plays an important role in the stabilization of this channel. The recognition of a universal deacylation mechanism for CHDLs suggests a direction for the future development of inhibitors and novel antibiotics for these enzymes of utmost clinical importance.
Daugherty, Ashley B; Horton, John R; Cheng, Xiaodong; Lutz, Stefan
2015-02-06
Circular permutation of the NADPH-dependent oxidoreductase Old Yellow Enzyme from Saccharomyces pastorianus (OYE1) can significantly enhance the enzyme's catalytic performance. Termini relocation into four regions of the protein (sectors I-IV) near the active site has proven effective in altering enzyme function. To better understand the structural consequences and rationalize the observed functional gains in these OYE1 variants, we selected representatives from sectors I-III for further characterization by biophysical methods and X-ray crystallography. These investigations not only show trends in enzyme stability and quaternary structure as a function of termini location, but also provide a possible explanation for the catalytic gains in our top-performing OYE variant (new N-terminus at residue 303; sector III). Crystallographic analysis indicates that termini relocation into sector III affects the loop β6 region (amino acid positions: 290-310) of OYE1 which forms a lid over the active site. Peptide backbone cleavage greatly enhances local flexibility, effectively converting the loop into a tether and consequently increasing the environmental exposure of the active site. Interestingly, such active site remodeling does not negatively impact the enzyme's activity and stereoselectivity, nor does it perturb the conformation of other key active site residues with the exception of Y375. These observations were confirmed in truncation experiments, deleting all residues of the loop β6 region in our OYE variant. Intrigued by the finding that circular permutation leaves most of the key catalytic residues unchanged, we also tested OYE permutants for possible additive or synergistic effects of amino acid substitutions. Distinct functional changes in these OYE variants were detected upon mutations at W116, known in native OYE1 to cause inversion of diastereo-selectivity for ( S )-carvone reduction. Our findings demonstrate the contribution of loop β6 toward determining the stereoselectivity of OYE1, an important insight for future OYE engineering efforts.
Daugherty, Ashley B.; Horton, John R.; Cheng, Xiaodong; ...
2014-12-09
Circular permutation of the NADPH-dependent oxidoreductase Old Yellow Enzyme from Saccharomyces pastorianus (OYE1) can significantly enhance the enzyme’s catalytic performance. Termini relocation into four regions of the protein (sectors I–IV) near the active site has proven effective in altering enzyme function. To better understand the structural consequences and rationalize the observed functional gains in these OYE1 variants, we selected representatives from sectors I–III for further characterization by biophysical methods and X-ray crystallography. These investigations not only show trends in enzyme stability and quaternary structure as a function of termini location but also provide a possible explanation for the catalytic gainsmore » in our top-performing OYE variant (new N-terminus at residue 303; sector III). Crystallographic analysis indicates that termini relocation into sector III affects the loop β6 region (amino acid positions: 290–310) of OYE1, which forms a lid over the active site. Peptide backbone cleavage greatly enhances local flexibility, effectively converting the loop into a tether and consequently increasing the environmental exposure of the active site. Interestingly, such an active site remodeling does not negatively impact the enzyme’s activity and stereoselectivity; neither does it perturb the conformation of other key active site residues with the exception of Y375. These observations were confirmed in truncation experiments, deleting all residues of the loop β6 region in our OYE variant. Intrigued by the finding that circular permutation leaves most of the key catalytic residues unchanged, we also tested OYE permutants for possible additive or synergistic effects of amino acid substitutions. Distinct functional changes in these OYE variants were detected upon mutations at W116, known in native OYE1 to cause inversion of diastereoselectivity for (S)-carvone reduction. In conclusion, our findings demonstrate the contribution of loop β6 toward determining the stereoselectivity of OYE1, an important insight for future OYE engineering efforts.« less
Sadeghian, Hakimeh; Kousari, Aliasghar; Majidi, Shahla; Rezvanfard, Mehrnaz; Kazemisaeid, Ali; Moezzi, Seyed Ali; Vasheghani Farahani, Ali; Abdar Esfahani, Morteza; Sahebjam, Mohammad; Zoroufian, Arezoo; Sadeghian, Afsaneh
2016-07-06
Background: It is not clear whether the latest activation sites in the left ventricle (LV) are matched with infracted regions in patients with ischemic cardiomyopathy (ICM). We aimed to investigate whether the latest activation sites in the LV are in agreement with the region of akinesia in patients with ICM. Methods: Data were analyzed in 106 patients (age = 60.5 ± 12.1 y, male = 88.7%) with ICM (ejection fraction ≤ 35%) who were refractory to pharmacological therapy and were referred to the echocardiography department for an evaluation of the feasibility of cardiac resynchronization therapy. Wall motion abnormalities, time to peak systolic myocardial velocity (Ts) of 6 basal and 6 mid-portion segments of the LV, and 4 frequently used dyssynchrony indices were measured using 2-dimensional echocardiography and tissue Doppler imaging (TDI). To evaluate the influence of the electrocardiographic pattern, we categorized the patients into 2 groups: patients with QRS ≤ 120 ms and those with QRS >120 ms. Results: A total of 1 272 segments were studied. The latest activation sites (with longest Ts) were most frequently located in the mid-anterior (n = 32, 30.2%) and basal-anterior segments (n = 29, 27.4%), while the most common sites of akinesia were the mid-anteroseptal (n = 65, 61.3%) and mid-septal (n = 51, 48.1%) segments. Generally, no significant concordance was found between the latest activated segments and akinesia either in all the patients or in the QRS groups. Detailed analysis within the segments indicated a good agreement between akinesia and delayed activation in the basal-lateral segment solely in the patients with QRS duration ≤ 120 ms (Φ = 0.707; p value ≤ 0.001). Conclusion: The akinetic segment on 2-dimensional echocardiogram was not matched with the latest activation sites in the LV determined by TDI in patients with ICM.
Sadeghian, Hakimeh; Kousari, Aliasghar; Majidi, Shahla; Rezvanfard, Mehrnaz; Kazemisaeid, Ali; Moezzi, Seyed Ali; Vasheghani Farahani, Ali; Abdar Esfahani, Morteza; Sahebjam, Mohammad; Zoroufian, Arezoo; Sadeghian, Afsaneh
2016-01-01
Background: It is not clear whether the latest activation sites in the left ventricle (LV) are matched with infracted regions in patients with ischemic cardiomyopathy (ICM). We aimed to investigate whether the latest activation sites in the LV are in agreement with the region of akinesia in patients with ICM. Methods: Data were analyzed in 106 patients (age = 60.5 ± 12.1 y, male = 88.7%) with ICM (ejection fraction ≤ 35%) who were refractory to pharmacological therapy and were referred to the echocardiography department for an evaluation of the feasibility of cardiac resynchronization therapy. Wall motion abnormalities, time to peak systolic myocardial velocity (Ts) of 6 basal and 6 mid-portion segments of the LV, and 4 frequently used dyssynchrony indices were measured using 2-dimensional echocardiography and tissue Doppler imaging (TDI). To evaluate the influence of the electrocardiographic pattern, we categorized the patients into 2 groups: patients with QRS ≤ 120 ms and those with QRS >120 ms. Results: A total of 1 272 segments were studied. The latest activation sites (with longest Ts) were most frequently located in the mid-anterior (n = 32, 30.2%) and basal-anterior segments (n = 29, 27.4%), while the most common sites of akinesia were the mid-anteroseptal (n = 65, 61.3%) and mid-septal (n = 51, 48.1%) segments. Generally, no significant concordance was found between the latest activated segments and akinesia either in all the patients or in the QRS groups. Detailed analysis within the segments indicated a good agreement between akinesia and delayed activation in the basal-lateral segment solely in the patients with QRS duration ≤ 120 ms (Φ = 0.707; p value ≤ 0.001). Conclusion: The akinetic segment on 2-dimensional echocardiogram was not matched with the latest activation sites in the LV determined by TDI in patients with ICM. PMID:27956911
Oak Ridge Reservation annual site environmental report for 1996
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1997-10-01
The US Department of Energy currently oversees activities on the Oak Ridge Reservation (ORR), a government-owned, contractor-operated facility. Three sites compose the reservation: the Oak Ridge Y-12 Plant, Oak Ridge National Laboratory, and East Tennessee Technology Park (formerly the K-25 Site). The ORR was established in the early 1940s as part of the Manhattan Project, a secret undertaking that produced the materials for the first atomic bombs. The reservation`s role has evolved over the years, and it continues to adapt to meet the changing defense, energy, and research needs of the US. Both the work carried out for the warmore » effort and subsequent research, development, and production activities have produced (and continue to produce) radiological and hazardous wastes. This document contains a summary of environmental monitoring activities on the ORR and its surroundings. Environmental monitoring on the ORR consists of two major activities: effluent monitoring and environmental surveillance. Effluent monitoring involves the collection and analysis of samples or measurements of liquid and gaseous effluents prior to release into the environment; these measurements allow the quantification and official reporting of contaminants, assessment of radiation exposures to the public, and demonstration of compliance with applicable standards and permit requirements. Environmental surveillance consists of the collection and analysis of environmental samples from the site and its environs; this provides direct measurement of contaminants in air, water, groundwater, soil, foods, biota, and other media subsequent to effluent release into the environment. Environmental surveillance data verify ORR`s compliance status and, combined with data from effluent monitoring, allow the determination of chemical and radiation dose/exposure assessment of ORR operations and effects, if any, on the local environment.« less
Liu, Yanyan; Yan, Bing; Winkler, David A; Fu, Jianjie; Zhang, Aiqian
2017-06-07
Acetylcholinesterase (AChE) activity regulation by chemical agents or, potentially, nanomaterials is important for both toxicology and pharmacology. Competitive inhibition via direct catalytic active sites (CAS) binding or noncompetitive inhibition through interference with substrate and product entering and exiting has been recognized previously as an AChE-inhibition mechanism for bespoke nanomaterials. The competitive inhibition by peripheral anionic site (PAS) interaction without CAS binding remains unexplored. Here, we proposed and verified the occurrence of a presumed competitive inhibition of AChE without CAS binding for hydrophobically functionalized C 60 nanoparticles (NPs) by employing both experimental and computational methods. The kinetic inhibition analysis distinguished six competitive inhibitors, probably targeting the PAS, from the pristine and hydrophilically modified C 60 NPs. A simple quantitative nanostructure-activity relationship (QNAR) model relating the pocket accessible length of substituent to inhibition capacity was then established to reveal how the geometry of the surface group decides the NP difference in AChE inhibition. Molecular docking identified the PAS as the potential binding site interacting with the NPs via a T-shaped plug-in mode. Specifically, the fullerene core covered the enzyme gorge as a lid through π-π stacking with Tyr72 and Trp286 in the PAS, while the hydrophobic ligands on the fullerene surface inserted into the AChE active site to provide further stability for the complexes. The modeling predicted that inhibition would be severely compromised by Tyr72 and Trp286 deletions, and the subsequent site-directed mutagenesis experiments proved this prediction. Our results demonstrate AChE competitive inhibition of NPs without CAS participation to gain further understanding of both the neurotoxicity and the curative effect of NPs.
Electrogram morphology recurrence patterns during atrial fibrillation.
Ng, Jason; Gordon, David; Passman, Rod S; Knight, Bradley P; Arora, Rishi; Goldberger, Jeffrey J
2014-11-01
Traditional mapping of atrial fibrillation (AF) is limited by changing electrogram morphologies and variable cycle lengths. We tested the hypothesis that morphology recurrence plot analysis would identify sites of stable and repeatable electrogram morphology patterns. AF electrograms recorded from left atrial (LA) and right atrial (RA) sites in 19 patients (10 men; mean age 59 ± 10 years) before AF ablation were analyzed. Morphology recurrence plots for each electrogram recording were created by cross-correlation of each automatically detected activation with every other activation in the recording. A recurrence percentage, the percentage of the most common morphology, and the mean cycle length of activations with the most recurrent morphology were computed. The morphology recurrence plots commonly showed checkerboard patterns of alternating high and low cross-correlation values, indicating periodic recurrences in morphologies. The mean recurrence percentage for all sites and all patients was 38 ± 25%. The highest recurrence percentage per patient averaged 83 ± 17%. The highest recurrence percentage was located in the RA in 5 patients and in the LA in 14 patients. Patients with sites of shortest mean cycle length of activations with the most recurrent morphology in the LA and RA had ablation failure rates of 25% and 100%, respectively (hazard ratio 4.95; P = .05). A new technique to characterize electrogram morphology recurrence demonstrated that there is a distribution of sites with high and low repeatability of electrogram morphologies. Sites with rapid activation of highly repetitive morphology patterns may be critical to sustaining AF. Further testing of this approach to map and ablate AF sources is warranted. Copyright © 2014 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.
Newbold, Stephen C; Siikamäki, Juha
2009-10-01
In recent years a large literature on reserve site selection (RSS) has developed at the interface between ecology, operations research, and environmental economics. Reserve site selection models use numerical optimization techniques to select sites for a network of nature reserves for protecting biodiversity. In this paper, we develop a population viability analysis (PVA) model for salmon and incorporate it into an RSS framework for prioritizing conservation activities in upstream watersheds. We use spawner return data for three closely related salmon stocks in the upper Columbia River basin and estimates of the economic costs of watershed protection from NOAA to illustrate the framework. We compare the relative cost-effectiveness of five alternative watershed prioritization methods, based on various combinations of biological and economic information. Prioritization based on biological benefit-economic cost comparisons and accounting for spatial interdependencies among watersheds substantially outperforms other more heuristic methods. When using this best-performing prioritization method, spending 10% of the cost of protecting all upstream watersheds yields 79% of the biological benefits (increase in stock persistence) from protecting all watersheds, compared to between 20% and 64% for the alternative methods. We also find that prioritization based on either costs or benefits alone can lead to severe reductions in cost-effectiveness.
Cho, Seong-Jun; Kang, Hana; Kim, Min Young; Lee, Jung Eun; Kim, Sung Jin; Nam, Seon Young; Kim, Ji Young; Kim, Hee Sun; Pyo, Suhkneung; Yang, Kwang Hee
2016-04-01
To determine how low-dose ionizing radiation (LDIR) regulates B lympho-proliferation and its molecular mechanism related with Ikaros, transcription factor. Splenocytes and IM-9 cells were uniformly irradiated with various doses of a (137)Cs γ-source, and cell proliferation was analyzed. To determine the LDIR-specific phosphorylation of Ikaros, immunoprecipitation and Western blot analysis were performed. To investigate the physiologic function of LDIR-mediatied Ikaros phosphorylation, Ikaros mutants at phosphorylation sites were generated, and cell cycle analysis was performed. First, we found that LDIR enhances B lymphoblast proliferation in an Ikaros-dependent manner. Moreover, we found that LDIR elevates the phosphorylation level of Ikaros protein. Interestingly, we showed that CK2 and AKT are involved in LDIR-induced Ikaros phosphorylation and capable of regulating DNA binding activity of Ikaros via specific phosphorylation. Finally, we identified LDIR-specific Ikaros phosphorylation sites at S391/S393 and showed that the Ikaros phosphorylations at these sites control Ikaros's ability to regulate G1/S cell cycle progression. Low-dose ionizing radiation specifically phosphorylates Ikaros protein at Ser 391/393 residues to regulate cell cycle progression in B lymphoblast. Copyright © 2016 Elsevier Inc. All rights reserved.
Searles, Keith; Siddiqi, Georges; Safonova, Olga V.
2017-01-01
Single-site gallium centers on the surface of silica are prepared via grafting of [Ga(OSi(OtBu)3)3(THF)] on SiO2–700 followed by a thermolysis step. The resulting surface species corresponds to well-defined tetra-coordinate gallium single-sites, [( 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 SiO)3Ga(XOSi)] (X = –H or Si) according to IR, X-ray absorption near-edge structure and extended X-ray absorption fine structure analysis. These gallium sites show high activity, selectivity and stability for propane dehydrogenation with an initial turnover frequency of 20 per h per gallium center, propylene selectivity of ≥93% and remarkable stability over 20 h. The stability of the catalyst probably results from site-isolation of the active site on a non-reducible support such as silica, diminishing facile reduction typical of Ga2O3-based catalysts. PMID:28553501
NASA Astrophysics Data System (ADS)
Dolce, Gregory Martin
1997-11-01
A series of gamma-Alsb2Osb3 supported molybdenum nitrides and carbides were prepared by the temperature programmed reaction of supported molybdates with ammonia and methane/hydrogen mixtures, respectively. In the first part of this research, the effects of synthesis heating rates and molybdenum loading on the catalytic properties of the materials were examined. A significant amount of excess carbon was deposited on the surface of the carbides during synthesis. The materials consisted of small particles which were very highly dispersed. Oxygen chemisorption indicated that the nitride particles may have been two-dimensional. The dispersion of the carbides, however, appeared to decrease as the loading increased. The catalysts were evaluated for hydrodenitrogenation (HDN), hydrodesulfurization (HDS), and hydrodeoxygenation (HDO). The molybdenum loading had the largest effect on the activity of the materials. For the nitrides, the HDN and HDS activities were inverse functions of the loading. This suggested that the most active HDN and HDS sites were located at the perimeter of the two-dimensional particles. The HDN and HDS activities of the carbides followed the same trend as the oxygen uptake. This result suggested that oxygen titrated the active sites on the supported carbides. Selected catalysts were evaluated for methylcarbazole HDN, dibenzothiophene HDS, and dibenzofuran HDO. The activity and selectivity of the nitrides and carbides were competitive with a presulfided commercial catalyst. In the second part of this work, a series of supported nitrides and carbides were prepared using a wider range of loadings (5-30 wt% Mo). Thermogravimetric analysis was used to determine the temperature at which excess carbon was deposited on the carbides. By modifying the synthesis parameters, the deposition of excess carbon was effectively inhibited. The dispersions of the supported nitrides and carbides were constant and suggested that the materials consisted of two-dimensional raft-like particles. The HDN activity of the nitrides decreased as the loading increased, while that of the carbides was relatively constant. Carbon monoxide and methylamine adsorbed on the same types of sites on the nitrides and carbides. Infrared spectroscopy and temperature programmed desorption revealed that some methylamine underwent HDN on the nitrides and carbides. Carbon monoxide appeared to adsorb on two types of sites. One type of site adsorbed CO which desorbed upon heating while the other type of site adsorbed CO which dissociated when the material was heated. The relative amounts of desorbed CO and methylamine scaled with the activity of the nitrides suggesting that CO and methylamine titrated the active sites. It appeared that the active sites of the supported carbides were different from those on the supported nitrides. It was proposed that the active sites on the supported nitrides were at the perimeter of the two-dimensional particles while the active sites of the carbides were "on top" of the particles.
Feagan, Brian; Sandborn, William J; Rutgeerts, Paul; Levesque, Barrett G; Khanna, Reena; Huang, Bidan; Zhou, Qian; Maa, Jen-Fue; Wallace, Kori; Lacerda, Ana; Thakkar, Roopal B; Robinson, Anne M
2018-04-23
Clinical trial endpoints for Crohn's disease (CD) activity correlate poorly with mucosal inflammation; to assess treatment efficacy, patient-reported outcomes and endoscopic assessments are preferred. This study assessed the impact on treatment efficacy estimations of using different definitions of clinical and endoscopic remission and endoscopic response, and of using site- or central-based endoscopy evaluation. This post hoc analysis of data fromEXTEND (extend the safety and efficacy of adalimumab through endoscopic healing), a placebo (PBO)-controlled, randomized trial of adalimumab (ADA) for mucosal healing, included adults with moderate-to-severe CD. Subsets of patients meeting specified Simplified Endoscopic Score for CD (SES-CD) inclusion criteria, according to site or central reading, and baseline stool frequency (SF) and/or abdominal pain score (AP) thresholds were evaluated. Various endpoint definitions based on the Crohn's Disease Activity Index (CDAI), its SF and AP components, SES-CD, and composite endpoints were compared between treatment groups. Increased stringency of Week 12 clinical endpoints compared to CDAI<150 to SF≤3.0/1.5&AP≤1.0 reduced PBO response rates by ≥12% and increased treatment effects by ≤10%. Amending the SES-CD endpoint from ≤4 to ≤2 reduced the treatment effect from 24% to 8%. Composite endpoints further diminished response rates and effect sizes. Site-based evaluation was associated with lower remission rates versus central reading in the PBO group and, thus, greater ADA-related treatment effects. This analysis is the first to demonstrate that increasing the stringency of clinical and endoscopic endpoint definitions in CD trials, especially lowering SF or SES-CD definitions, reduces the ability to detect treatment-related change in CD activity; focus on endpoints that reflect clinical change is warranted.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, Mary A.; Tangyunyong, Paiboon; Cole, Edward I.
2016-01-14
Laser-based failure analysis techniques demonstrate the ability to quickly and non-intrusively screen deep ultraviolet light-emitting diodes (LEDs) for electrically-active defects. In particular, two laser-based techniques, light-induced voltage alteration and thermally-induced voltage alteration, generate applied voltage maps (AVMs) that provide information on electrically-active defect behavior including turn-on bias, density, and spatial location. Here, multiple commercial LEDs were examined and found to have dark defect signals in the AVM indicating a site of reduced resistance or leakage through the diode. The existence of the dark defect signals in the AVM correlates strongly with an increased forward-bias leakage current. This increased leakage ismore » not present in devices without AVM signals. Transmission electron microscopy analysis of a dark defect signal site revealed a dislocation cluster through the pn junction. The cluster included an open core dislocation. Even though LEDs with few dark AVM defect signals did not correlate strongly with power loss, direct association between increased open core dislocation densities and reduced LED device performance has been presented elsewhere [M. W. Moseley et al., J. Appl. Phys. 117, 095301 (2015)].« less
Sharma, Sonia; Vig, Adarsh Pal
2014-01-01
Butanol and hexane leaves extracts of Parkinsonia aculeata L. (Fabaceae) were assessed for its antioxidant potential by in vitro methods. Phytochemical analysis and antioxidant activity of plant extracts were studied using different in vitro assays. UPLC analysis of extracts was carried out for the identification of chemical constituents. The total phenolic contents of the butanol and hexane leaf extract were 42 mgGAE/g and 34 mgGAE/g whereas flavonoid contents of these extracts were found to be 0.044 mgRE/g and 0.005 mgRE/g, respectively. Among both extracts, butanol extract shows maximum inhibition (%) of 93.88%, 80.02%, 52.06%, 94.68%, and 69.37% in DPPH, non-site-specific and site-specific, FTC, and TBA assays and absorbance of 0.852 and 0.522 in reducing power and CUPRAC assay at the highest concentration tested. The FRAP and TAC values of butanol extract were found to be 678 μM Fe(II)/g and 36 mgAAE/100 mg. UPLC analysis of extracts revealed the presence of various polyphenols. The tested plant extracts were found to possess potent antioxidant and free radical scavenging activity which may be due to the presence of flavonoids and polyphenols.
Spencer, Jeffrey A.; Major, Michael L.; Misra, Ravi P.
1999-01-01
Serum response factor (SRF) plays a central role in the transcriptional response of mammalian cells to a variety of extracellular signals. It is a key regulator of many cellular early response genes which are believed to be involved in cell growth and differentiation. The mechanism by which SRF activates transcription in response to mitogenic agents has been extensively studied; however, significantly less is known about regulation of the SRF gene itself. Previously, we identified distinct regulatory elements in the SRF promoter that play a role in activation, including a consensus ETS domain binding site, a consensus overlapping Sp/Egr-1 binding site, and two SRF binding sites. We further showed that serum induces SRF by a mechanism that requires an intact SRF binding site, also termed a CArG box. In the present study we demonstrate that in response to stimulation of cells by a purified growth factor, basic fibroblast growth factor (bFGF), the SRF promoter is upregulated by a complex pathway that involves at least two independent mechanisms: a CArG box-independent mechanism that is mediated by an ETS binding site, and a novel CArG box-dependent mechanism that requires both an Sp factor binding site and the CArG motifs for maximal stimulation. Our analysis indicates that the CArG/Sp element activation mechanism is mediated by distinct signaling pathways. The CArG box-dependent component is targeted by a Rho-mediated pathway, and the Sp binding site-dependent component is targeted by a Ras-mediated pathway. Both SRF and bFGF have been implicated in playing an important role in mediating cardiogenesis during development. The implications of our findings for SRF expression during development are discussed. PMID:10330138
Perera, Lalith; Freudenthal, Bret D.; Beard, William A.; Shock, David D.; Pedersen, Lee G.; Wilson, Samuel H.
2015-01-01
DNA polymerases facilitate faithful insertion of nucleotides, a central reaction occurring during DNA replication and repair. DNA synthesis (forward reaction) is “balanced,” as dictated by the chemical equilibrium by the reverse reaction of pyrophosphorolysis. Two closely spaced divalent metal ions (catalytic and nucleotide-binding metals) provide the scaffold for these reactions. The catalytic metal lowers the pKa of O3′ of the growing primer terminus, and the nucleotide-binding metal facilitates substrate binding. Recent time-lapse crystallographic studies of DNA polymerases have identified an additional metal ion (product metal) associated with pyrophosphate formation, leading to the suggestion of its possible involvement in the reverse reaction. Here, we establish a rationale for a role of the product metal using quantum mechanical/molecular mechanical calculations of the reverse reaction in the confines of the DNA polymerase β active site. Additionally, site-directed mutagenesis identifies essential residues and metal-binding sites necessary for pyrophosphorolysis. The results indicate that the catalytic metal site must be occupied by a magnesium ion for pyrophosphorolysis to occur. Critically, the product metal site is occupied by a magnesium ion early in the pyrophosphorolysis reaction path but must be removed later. The proposed dynamic nature of the active site metal ions is consistent with crystallographic structures. The transition barrier for pyrophosphorolysis was estimated to be significantly higher than that for the forward reaction, consistent with kinetic activity measurements of the respective reactions. These observations provide a framework to understand how ions and active site changes could modulate the internal chemical equilibrium of a reaction that is central to genome stability. PMID:26351676
Niv-Spector, Leonora; Gonen-Berger, Dana; Gourdou, Isabelle; Biener, Eva; Gussakovsky, Eugene E.; Benomar, Yackir; Ramanujan, Krishnan V.; Taouis, Mohammed; Herman, Brian; Callebaut, Isabelle; Djiane, Jean; Gertler, Arieh
2005-01-01
Interaction of leptin with its receptors resembles that of interleukin-6 and granulocyte colony-stimulating factor, which interact with their receptors through binding sites I–III. Site III plays a pivotal role in receptors' dimerization or tetramerization and subsequent activation. Leptin's site III also mediates the formation of an active multimeric complex through its interaction with the IGD (immunoglobulin-like domain) of LEPRs (leptin receptors). Using a sensitive hydrophobic cluster analysis of leptin's and LEPR's sequences, we identified hydrophobic stretches in leptin's A–B loop (amino acids 39–42) and in the N-terminal end of LEPR's IGD (amino acids 325–328) that are predicted to participate in site III and to interact with each other in a β-sheet-like configuration. To verify this hypothesis, we prepared and purified to homogeneity (as verified by SDS/PAGE, gel filtration and reverse-phase chromatography) several alanine muteins of amino acids 39–42 in human and ovine leptins. CD analyses revealed that those mutations hardly affect the secondary structure. All muteins acted as true antagonists, i.e. they bound LEPR with an affinity similar to the wild-type hormone, had no agonistic activity and specifically inhibited leptin action in several leptin-responsive in vitro bioassays. Alanine mutagenesis of LEPR's IGD (amino acids 325–328) drastically reduced its biological but not binding activity, indicating the importance of this region for interaction with leptin's site III. FRET (fluorescence resonance energy transfer) microscopy experiments have documented that the transient FRET signalling occurring upon exposure to leptin results not from binding of the ligand, but from ligand-induced oligomerization of LEPRs mediated by leptin's site III. PMID:15952938
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qiu, James A.; Wilson, Heather L.; Rajagopalan, K.V.
Eukaryotic sulfite oxidase is a dimeric protein that contains the molybdenum cofactor and catalyzes the metabolically essential conversion of sulfite to sulfate as the terminal step in the metabolism of cysteine and methionine. Nitrate reductase is an evolutionarily related molybdoprotein in lower organisms that is essential for growth on nitrate. In this study, we describe human and chicken sulfite oxidase variants in which the active site has been modified to alter substrate specificity and activity from sulfite oxidation to nitrate reduction. On the basis of sequence alignments and the known crystal structure of chicken sulfite oxidase, two residues are conservedmore » in nitrate reductases that align with residues in the active site of sulfite oxidase. On the basis of the crystal structure of yeast nitrate reductase, both positions were mutated in human sulfite oxidase and chicken sulfite oxidase. The resulting double-mutant variants demonstrated a marked decrease in sulfite oxidase activity but gained nitrate reductase activity. An additional methionine residue in the active site was proposed to be important in nitrate catalysis, and therefore, the triple variant was also produced. The nitrate reducing ability of the human sulfite oxidase triple mutant was nearly 3-fold greater than that of the double mutant. To obtain detailed structural data for the active site of these variants, we introduced the analogous mutations into chicken sulfite oxidase to perform crystallographic analysis. The crystal structures of the Mo domains of the double and triple mutants were determined to 2.4 and 2.1 {angstrom} resolution, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.
2004-08-06
Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less
Kato, Takamitsu A.; Suzuki, Takehiro; Dohmae, Naoshi; Takizawa, Kazuya; Nakazawa, Yuka; Genet, Matthew D.; Saotome, Mika; Hama, Michio; Nakajima, Nakako Izumi; Hazawa, Masaharu; Tomita, Masanori; Koike, Manabu; Noshiro, Katsuko; Tomiyama, Kenichi; Obara, Chizuka; Gotoh, Takaya; Ui, Ayako; Fujimori, Akira; Nakayama, Fumiaki; Sugasawa, Kaoru; Okayasu, Ryuichi; Tajima, Katsushi
2018-01-01
The p300 and CBP histone acetyltransferases are recruited to DNA double-strand break (DSB) sites where they induce histone acetylation, thereby influencing the chromatin structure and DNA repair process. Whether p300/CBP at DSB sites also acetylate non-histone proteins, and how their acetylation affects DSB repair, remain unknown. Here we show that p300/CBP acetylate RAD52, a human homologous recombination (HR) DNA repair protein, at DSB sites. Using in vitro acetylated RAD52, we identified 13 potential acetylation sites in RAD52 by a mass spectrometry analysis. An immunofluorescence microscopy analysis revealed that RAD52 acetylation at DSBs sites is counteracted by SIRT2- and SIRT3-mediated deacetylation, and that non-acetylated RAD52 initially accumulates at DSB sites, but dissociates prematurely from them. In the absence of RAD52 acetylation, RAD51, which plays a central role in HR, also dissociates prematurely from DSB sites, and hence HR is impaired. Furthermore, inhibition of ataxia telangiectasia mutated (ATM) protein by siRNA or inhibitor treatment demonstrated that the acetylation of RAD52 at DSB sites is dependent on the ATM protein kinase activity, through the formation of RAD52, p300/CBP, SIRT2, and SIRT3 foci at DSB sites. Our findings clarify the importance of RAD52 acetylation in HR and its underlying mechanism. PMID:29590107
Moran, Kevin
2014-01-01
In high-income countries, death as a consequence of recreational jumping into water from height has not been well investigated partly because it traditionally has been a covert activity within youth culture. An observational study of video recordings posted on the YouTube web site was used to gather data on the nature of jumping activity in New Zealand and Australia. An analytical framework was developed to identify site- participant- social characteristics (10 variables) and online feedback (4 variables). Of the 389 videos recorded in New Zealand (n = 210) and Australia (n = 179), 929 jumpers were observed, and rivers were the most frequently reported site of jumping activity (New Zealand 47%; Australia 35%). One fifth (20%) of the jumps in New Zealand and one third (33%) in Australia were from heights estimated to be more than 12 m. The YouTube website portraying jumps from height were visited almost half a million times (495,686 hits). Ways of reducing recreational jumping risk via targeted education interventions may be best directed at young male adults. Use of social network sites to foster safe behaviours may be an effective way to educate young people of the inherent risks of jumping from height into water.
Tyrosine phosphorylation of Jak2 in the JH2 domain inhibits cytokine signaling.
Feener, Edward P; Rosario, Felicia; Dunn, Sarah L; Stancheva, Zlatina; Myers, Martin G
2004-06-01
Jak family tyrosine kinases mediate signaling by cytokine receptors to regulate diverse biological processes. Although Jak2 and other Jak kinase family members are phosphorylated on numerous sites during cytokine signaling, the identity and function of most of these sites remains unknown. Using tandem mass spectroscopic analysis of activated Jak2 protein from intact cells, we identified Tyr(221) and Tyr(570) as novel sites of Jak2 phosphorylation. Phosphorylation of both sites was stimulated by cytokine treatment of cultured cells, and this stimulation required Jak2 kinase activity. While we observed no gross alteration of signaling upon mutation of Tyr(221), Tyr(570) lies within the inhibitory JH2 domain of Jak2, and mutation of this site (Jak2(Y570F)) results in constitutive Jak2-dependent signaling in the absence of cytokine stimulation and enhances and prolongs Jak2 activation during cytokine stimulation. Mutation of Tyr(570) does not alter the ability of SOCS3 to bind or inhibit Jak2, however. Thus, the phosphorylation of Tyr(570) in vivo inhibits Jak2-dependent signaling independently of SOCS3-mediated inhibition. This Tyr(570)-dependent mechanism of Jak2 inhibition likely represents an important mechanism by which cytokine function is regulated.
Esser, Lothar; Yu, Chang-An; Xia, Di
2016-01-01
The emergence of drug resistance has devastating economic and social consequences, a testimonial of which is the rise and fall of inhibitors against the respiratory component cytochrome bc1 complex, a time tested and highly effective target for disease control. Unfortunately, the mechanism of resistance is a multivariate problem, including primarily mutations in the gene of the cytochrome b subunit but also activation of alternative pathways of ubiquinol oxidation and pharmacokinetic effects. There is a considerable interest in designing new bc1 inhibitors with novel modes of binding and lower propensity to induce the development of resistance. The accumulation of crystallographic data of bc1 complexes with and without inhibitors bound provides the structural basis for rational drug design. In particular, the cytochrome b subunit offers two distinct active sites that can be targeted for inhibition - the quinol oxidation site and the quinone reduction site. This review brings together available structural information of inhibited bc1 by various quinol oxidation- and reduction-site inhibitors, the inhibitor binding modes, conformational changes upon inhibitor binding of side chains in the active site and large scale domain movements of the iron-sulfur protein subunit. Structural data analysis provides a clear understanding of where and why existing inhibitors fail and points towards promising alternatives. PMID:23688079
Airport Surface Delays and Causes: A Preliminary Analysis
NASA Technical Reports Server (NTRS)
Chin, David K.; Goldberg, Jay; Tang, Tammy
1997-01-01
This report summarizes FAA Program Analysis and Operations Research Service (ASD-400)/Lockheed Martin activities and findings related to airport surface delays and causes, in support of NASA Langley Research Center's Terminal Area Productivity (TAP) Program. The activities described in this report were initiated in June 1995. A preliminary report was published on September 30, 1995. The final report incorporates data collection forms filled out by traffic managers, other FAA staff, and an airline for the New York City area, some updates, data previously requested from various sources to support this analysis, and further quantification and documentation than in the preliminary report. This final report is based on data available as of April 12, 1996. This report incorporates data obtained from review and analysis of data bases and literature, discussions/interviews with engineers, air-traffic staff, other FAA technical personnel, and airline staff, site visits, and a survey on surface delays and causes. It includes analysis of delay statistics; preliminary findings and conclusions on surface movement, surface delay sources and causes, runway occupancy time (ROT), and airport characteristics impacting surface operations and delays; and site-specific data on the New York City area airports, which are the focus airports for this report.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bulfer, Stacie L.; Scott, Erin M.; Couture, Jean-François
2010-01-12
Homocitrate synthase (HCS) catalyzes the first and committed step in lysine biosynthesis in many fungi and certain Archaea and is a potential target for antifungal drugs. Here we report the crystal structure of the HCS apoenzyme from Schizosaccharomyces pombe and two distinct structures of the enzyme in complex with the substrate 2-oxoglutarate (2-OG). The structures reveal that HCS forms an intertwined homodimer stabilized by domain-swapping between the N- and C-terminal domains of each monomer. The N-terminal catalytic domain is composed of a TIM barrel fold in which 2-OG binds via hydrogen bonds and coordination to the active site divalent metalmore » ion, whereas the C-terminal domain is composed of mixed {alpha}/{beta} topology. In the structures of the HCS apoenzyme and one of the 2-OG binary complexes, a lid motif from the C-terminal domain occludes the entrance to the active site of the neighboring monomer, whereas in the second 2-OG complex the lid is disordered, suggesting that it regulates substrate access to the active site through its apparent flexibility. Mutations of the active site residues involved in 2-OG binding or implicated in acid-base catalysis impair or abolish activity in vitro and in vivo. Together, these results yield new insights into the structure and catalytic mechanism of HCSs and furnish a platform for developing HCS-selective inhibitors.« less
Law, Mary E; Ferreira, Renan B; Davis, Bradley J; Higgins, Paul J; Kim, Jae-Sung; Castellano, Ronald K; Chen, Sixue; Luesch, Hendrik; Law, Brian K
2016-08-05
While localized malignancies often respond to available therapies, most disseminated cancers are refractory. Novel approaches, therefore, are needed for the treatment of metastatic disease. CUB domain-containing protein1 (CDCP1) plays an important role in metastasis and drug resistance; the mechanism however, is poorly understood. Breast cancer cell lines were engineered to stably express EGFR, CDCP1 or phosphorylation site mutants of CDCP1. These cell lines were used for immunoblot analysis or affinity purification followed by immunoblot analysis to assess protein phosphorylation and/or protein complex formation with CDCP1. Kinase activity was evaluated using phosphorylation site-specific antibodies and immunoblot analysis in in vitro kinase assays. Protein band excision and mass spectrometry was utilized to further identify proteins complexed with CDCP1 or ΔCDCP1, which is a mimetic of the cleaved form of CDCP1. Cell detachment was assessed using cell counting. This paper reports that CDCP1 forms ternary protein complexes with Src and EGFR, facilitating Src activation and Src-dependent EGFR transactivation. Importantly, we have discovered that a class of compounds termed Disulfide bond Disrupting Agents (DDAs) blocks CDCP1/EGFR/Src ternary complex formation and downstream signaling. CDCP1 and EGFR cooperate to induce detachment of breast cancer cells from the substratum and to disrupt adherens junctions. Analysis of CDCP1-containing complexes using proteomics techniques reveals that CDCP1 associates with several proteins involved in cell adhesion, including adherens junction and desmosomal cadherins, and cytoskeletal elements. Together, these results suggest that CDCP1 may facilitate loss of adhesion by promoting activation of EGFR and Src at sites of cell-cell and cell-substratum contact.
LEDGF/p75 interacts with mRNA splicing factors and targets HIV-1 integration to highly spliced genes
Singh, Parmit Kumar; Plumb, Matthew R.; Ferris, Andrea L.; Iben, James R.; Wu, Xiaolin; Fadel, Hind J.; Luke, Brian T.; Esnault, Caroline; Poeschla, Eric M.; Hughes, Stephen H.; Kvaratskhelia, Mamuka; Levin, Henry L.
2015-01-01
The host chromatin-binding factor LEDGF/p75 interacts with HIV-1 integrase and directs integration to active transcription units. To understand how LEDGF/p75 recognizes transcription units, we sequenced 1 million HIV-1 integration sites isolated from cultured HEK293T cells. Analysis of integration sites showed that cancer genes were preferentially targeted, raising concerns about using lentivirus vectors for gene therapy. Additional analysis led to the discovery that introns and alternative splicing contributed significantly to integration site selection. These correlations were independent of transcription levels, size of transcription units, and length of the introns. Multivariate analysis with five parameters previously found to predict integration sites showed that intron density is the strongest predictor of integration density in transcription units. Analysis of previously published HIV-1 integration site data showed that integration density in transcription units in mouse embryonic fibroblasts also correlated strongly with intron number, and this correlation was absent in cells lacking LEDGF. Affinity purification showed that LEDGF/p75 is associated with a number of splicing factors, and RNA sequencing (RNA-seq) analysis of HEK293T cells lacking LEDGF/p75 or the LEDGF/p75 integrase-binding domain (IBD) showed that LEDGF/p75 contributes to splicing patterns in half of the transcription units that have alternative isoforms. Thus, LEDGF/p75 interacts with splicing factors, contributes to exon choice, and directs HIV-1 integration to transcription units that are highly spliced. PMID:26545813
The pimeloyl-CoA synthetase BioW defines a new fold for adenylate-forming enzymes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Estrada, Paola; Manandhar, Miglena; Dong, Shi-Hui
Reactions that activate carboxylates through acyl-adenylate intermediates are found throughout biology and include acyl- and aryl-CoA synthetases and tRNA synthetases. Here we describe the characterization of Aquifex aeolicus BioW, which represents a new protein fold within the superfamily of adenylating enzymes. Substrate-bound structures identified the enzyme active site and elucidated the mechanistic strategy for conjugating CoA to the seven-carbon α,ω-dicarboxylate pimelate, a biotin precursor. Proper position of reactive groups for the two half-reactions is achieved solely through movements of active site residues, as confirmed by site-directed mutational analysis. The ability of BioW to hydrolyze adenylates of noncognate substrates is reminiscentmore » of pre-transfer proofreading observed in some tRNA synthetases, and we show that this activity can be abolished by mutation of a single residue. These studies illustrate how BioW can carry out three different biologically prevalent chemical reactions (adenylation, thioesterification, and proofreading) in the context of a new protein fold.« less
Cheng, Feng; Yang, Jianhua; Bocola, Marco; Schwaneberg, Ulrich; Zhu, Leilei
2018-05-05
Protein engineering of enzyme loop regions is an effective strategy to improve enzymatic properties. Previous studies that aimed to boost the activity of PpADI (an arginine deiminase from Pseudomonas plecoglossicida) under physiological conditions yielded several significantly improved variants that harbor substitutions predominantly located in active-site-decorating loops. A multi-site saturation mutagenesis at four positions in loop 1 (37, 38, 42, and 43) and three positions in loop 4 (402, 403, and 404) was performed to elucidate the importance of these loops in modulating the substrate affinity of PpADI. The identified "best" variant (M6-L1-4) showed a decreased S 0.5 ('K M ') of 0.48 mM compared with the parent M6 (0.81 mM). Subsequently, a rational design to recombine beneficial substitutions within loops 1 and 4 yielded variant L6 with a substantially decreased S 0.5 value (0.17 mM). A comprehensive simulation analysis resulted in a conclusion that high loop flexibility (especially the gating residue Arg400) is beneficial for substrate affinity due to less efficient blocking of the active site. Copyright © 2018 Elsevier Inc. All rights reserved.
Liu, Shijia; Shao, Shangjin; Li, Linlin; Cheng, Zhi; Tian, Li; Gao, Peiji; Wang, Lushan
2015-12-11
Chitinases and chitosanases, referred to as chitinolytic enzymes, are two important categories of glycoside hydrolases (GH) that play a key role in degrading chitin and chitosan, two naturally abundant polysaccharides. Here, we investigate the active site architecture of the major chitosanase (GH8, GH46) and chitinase families (GH18, GH19). Both charged (Glu, His, Arg, Asp) and aromatic amino acids (Tyr, Trp, Phe) are observed with higher frequency within chitinolytic active sites as compared to elsewhere in the enzyme structure, indicating significant roles related to enzyme function. Hydrogen bonds between chitinolytic enzymes and the substrate C2 functional groups, i.e. amino groups and N-acetyl groups, drive substrate recognition, while non-specific CH-π interactions between aromatic residues and substrate mainly contribute to tighter binding and enhanced processivity evident in GH8 and GH18 enzymes. For different families of chitinolytic enzymes, the number, type, and position of substrate atoms bound in the active site vary, resulting in different substrate-binding specificities. The data presented here explain the synergistic action of multiple enzyme families at a molecular level and provide a more reasonable method for functional annotation, which can be further applied toward the practical engineering of chitinases and chitosanases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Identification of continuous interaction sites in PLA(2)-based protein complexes by peptide arrays.
Fortes-Dias, Consuelo Latorre; Santos, Roberta Márcia Marques dos; Magro, Angelo José; Fontes, Marcos Roberto de Mattos; Chávez-Olórtegui, Carlos; Granier, Claude
2009-01-01
Crotoxin (CA.CB) is a beta-neurotoxin from Crotalus durissus terrificus snake venom that is responsible for main envenomation effects upon biting by this snake. It is a heterodimer of an acidic protein (CA) devoid of any biological activity per se and a basic, enzymatically active, PLA(2) counterpart (CB). Both lethal and enzymatic activities of crotoxin have been shown to be inhibited by CNF, a protein from the blood of C. d. terrificus snakes. CNF replaces CA in the CA.CB complex, forming a stable, non-toxic complex CNF.CB. The molecular sites involved in the tight interfacial protein-protein interactions in these PLA(2)-based complexes have not been clearly determined. To help address this question, we used the peptide arrays approach to map possible interfacial interaction sites in CA.CB and CNF.CB. Amino acid stretches putatively involved in these interactions were firstly identified in the primary structure of CB. Further analysis of the interfacial availability of these stretches in the presumed biologically active structure of CB, suggested two interaction main sites, located at the amino-terminus and beta-wing regions. Peptide segments at the carboxyl-terminus of CB were also suggested to play a secondary role in the binding of both CA and CNF.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Changela, Anita; DiGate, Russell J.; Mondragon, Alfonso
Escherichia coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5{prime} phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an eight-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is boundmore » along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding.« less
Jana, Kalyanashis; Bandyopadhyay, Tusar; Ganguly, Bishwajit
2017-11-01
Acid suppressant SCH28080 and its derivatives reversibly reduce acid secretion activity of the H + ,K + -ATPase in a K + competitive manner. The results on homologation of the SCH28080 by varying the linker chain length suggested the improvement in efficacy. However, the pharmacokinetic studies reveal that the hydrophobic nature of the CH 2 linker units may not help it to function as a better acid suppressant. We have exploited the role of linker unit to enhance the efficacy of such reversible acid suppressant drug molecules using hetero linker, i.e., disulfide and peroxy linkers. The logarithm of partition coefficient defined for a drug molecule relates to the partition coefficient, which allows the optimum solubility characteristics to reach the active site. The logarithm of partition coefficient calculated for the designed inhibitors suggests that inhibitors would possibly reach the active site in sufficient concentration like in the case of SCH28080. The steered molecular dynamics studies have revealed that the Inhibitor-1 with disulfide linker unit is more stable at the active site due to greater noncovalent interactions compared to the SCH28080. Centre of mass distance analysis suggests that the Cysteine-813 amino acid residue selectively plays an important role in the inhibition of H + ,K + -ATPase for Inhibitor-1. Furthermore, the quantum chemical calculations with M11L/6-31+G(d,p) level of theory have been performed to account the noncovalent interactions responsible for the stabilization of inhibitor molecules in the active site gorge of the gastric proton pump at different time scale. The hydrogen bonding and hydrophobic interaction studies corroborate the center of mass distance analysis as well. Well-tempered metadynamics free energy surface and center of mass separation analysis for the Inhibitor-1 is in good agreement with the steered molecular dynamics results. The torsional angle of the linker units seems to be crucial for better efficacy of drug molecules. The torsional angle of linker units of SCH28080 (COCH 2 C) and of Inhibitor 1 (CSSC) prefers to lie within ∼60°-90° for a longer time during the simulations, whereas, the peroxy linker (COOC) of Inhibitor 2 prefers to adopt ∼120-160°. Therefore, it appears that the smaller torsion angle of linker units can achieve better interactions with the active site residues of H + ,K + -ATPase to inhibit the acid secretion activity. The reversible drug molecules with disulfide linker unit would be a promising candidate as proton pump antagonist to H + ,K + -ATPase. Copyright © 2017 Elsevier Inc. All rights reserved.
Closure Report for Corrective Action Unit 536: Area 3 Release Site, Nevada Test Site, Nevada
DOE Office of Scientific and Technical Information (OSTI.GOV)
NSTec Environmental Restoration
Corrective Action Unit (CAU) 536 is located in Area 3 of the Nevada Test Site. CAU 536 is listed in the Federal Facility Agreement and Consent Order of 1996 as Area 3 Release Site, and comprises a single Corrective Action Site (CAS): {sm_bullet} CAS 03-44-02, Steam Jenny Discharge The Nevada Division of Environmental Protection (NDEP)-approved corrective action alternative for CAS 03-44-02 is clean closure. Closure activities included removing and disposing of total petroleum hydrocarbon (TPH)- and polyaromatic hydrocarbon (PAH)-impacted soil, soil impacted with plutonium (Pu)-239, and concrete pad debris. CAU 536 was closed in accordance with the NDEP-approved CAU 536more » Corrective Action Plan (CAP), with minor deviations as approved by NDEP. The closure activities specified in the CAP were based on the recommendations presented in the CAU 536 Corrective Action Decision Document (U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office, 2004). This Closure Report documents CAU 536 closure activities. During closure activities, approximately 1,000 cubic yards (yd3) of hydrocarbon waste in the form of TPH- and PAH-impacted soil and debris, approximately 8 yd3 of Pu-239-impacted soil, and approximately 100 yd3 of concrete debris were generated, managed, and disposed of appropriately. Additionally, a previously uncharacterized, buried drum was excavated, removed, and disposed of as hydrocarbon waste as a best management practice. Waste minimization techniques, such as the utilization of laboratory analysis to characterize and classify waste streams, were employed during the performance of closure« less
Electrogram Morphology Recurrence Patterns during Atrial Fibrillation
Ng, Jason; Gordon, David; Passman, Rod S.; Knight, Bradley P.; Arora, Rishi; Goldberger, Jeffrey J.
2014-01-01
Background Traditional mapping of atrial fibrillation (AF) is limited by changing electrogram morphologies and variable cycle lengths. Objective We tested the hypothesis that morphology recurrence plot analysis would identify sites of stable and repeatable electrogram morphology patterns. Methods AF electrograms recorded from left atrial (LA) and right atrial (RA) sites in 19 patients (10 male, 59±10 years old) prior to AF ablation were analyzed. Morphology recurrence plots for each electrogram recording were created by cross-correlation of each automatically detected activation with every other activation in the recording. A recurrence percentage, the percentage of the most common morphology, and the mean cycle length of activations with the most common morphology (CLR) were computed. Results The morphology recurrence plots commonly showed checkerboard patterns of alternating high and low cross correlation values indicating periodic recurrences in morphologies. The mean recurrence percentage for all sites and all patients was 38±25%. The highest recurrence percentage per patient averaged 83±17%. The highest recurrence percentage was located in the RA in 5 patients and in the LA in 14 patients. Patients with sites of shortest CLR in the LA and RA had ablation failure rates of 25% and 100%, respectively (HR=4.95; p=0.05). Conclusions A new technique to characterize electrogram morphology recurrence demonstrated that there is a distribution of sites with high and low repeatability of electrogram morphologies. Sites with rapid activation of highly repetitive morphology patterns may be critical to sustaining AF. Further testing of this approach to map and ablate AF sources is warranted. PMID:25101485
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bailey, Lucas J.; Acheson, Justin F.; McCoy, Jason G.
Crystal structures of toluene 4-monooxygenase hydroxylase in complex with reaction products and effector protein reveal active site interactions leading to regiospecificity. Complexes with phenolic products yield an asymmetric {mu}-phenoxo-bridged diiron center and a shift of diiron ligand E231 into a hydrogen bonding position with conserved T201. In contrast, complexes with inhibitors p-NH{sub 2}-benzoate and p-Br-benzoate showed a {mu}-1,1 coordination of carboxylate oxygen between the iron atoms and only a partial shift in the position of E231. Among active site residues, F176 trapped the aromatic ring of products against a surface of the active site cavity formed by G103, E104 andmore » A107, while F196 positioned the aromatic ring against this surface via a {pi}-stacking interaction. The proximity of G103 and F176 to the para substituent of the substrate aromatic ring and the structure of G103L T4moHD suggest how changes in regiospecificity arise from mutations at G103. Although effector protein binding produced significant shifts in the positions of residues along the outer portion of the active site (T201, N202, and Q228) and in some iron ligands (E231 and E197), surprisingly minor shifts (<1 {angstrom}) were produced in F176, F196, and other interior residues of the active site. Likewise, products bound to the diiron center in either the presence or absence of effector protein did not significantly shift the position of the interior residues, suggesting that positioning of the cognate substrates will not be strongly influenced by effector protein binding. Thus, changes in product distributions in the absence of the effector protein are proposed to arise from differences in rates of chemical steps of the reaction relative to motion of substrates within the active site channel of the uncomplexed, less efficient enzyme, while structural changes in diiron ligand geometry associated with cycling between diferrous and diferric states are discussed for their potential contribution to product release.« less
Lee, Jae Hoon; Sundin, George W; Zhao, Youfu
2016-06-01
The type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by an RpoN-HrpL sigma factor cascade, which is activated by the bacterial alarmone (p)ppGpp. In this study, the binding site of HrpS, an enhancer binding protein, was identified for the first time in plant-pathogenic bacteria. Complementation of the hrpL mutant with promoter deletion constructs of the hrpL gene and promoter activity analyses using various lengths of the hrpL promoter fused to a promoter-less green fluorescent protein (gfp) reporter gene delineated the upstream region for HrpS binding. Sequence analysis revealed a dyad symmetry sequence between -138 and -125 nucleotides (TGCAA-N4-TTGCA) as the potential HrpS binding site, which is conserved in the promoter of the hrpL gene among plant enterobacterial pathogens. Results of quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and electrophoresis mobility shift assay coupled with site-directed mutagenesis (SDM) analysis showed that the intact dyad symmetry sequence was essential for HrpS binding, full activation of T3SS gene expression and virulence. In addition, the role of the GAYTGA motif (RpoN binding site) of HrpS in the regulation of T3SS gene expression in E. amylovora was characterized by complementation of the hrpS mutant using mutant variants generated by SDM. Results showed that a Y100F substitution of HrpS complemented the hrpS mutant, whereas Y100A and Y101A substitutions did not. These results suggest that tyrosine (Y) and phenylalanine (F) function interchangeably in the conserved GAYTGA motif of HrpS in E. amylovora. © 2015 BSPP AND JOHN WILEY & SONS LTD.
Qian, Siyu; Yu, Ping; Hailey, David M; Zhang, Zhenyu; Davy, Pamela J; Nelson, Mark I
2014-05-01
To examine the time, frequency and duration of each direct care activity conducted by personal carers in Australian residential aged care homes. A time-motion study was conducted to observe 46 personal carers at two high-care houses in two facilities (14 days at Site 1 and 16 days at Site 2). Twenty-three direct care activities were classified into eight categories for analysis. Overall, a personal carer spent approximately 45% of their time on direct care, corresponding to 3.5h in an 8-h daytime shift. The two sites had similar ratios of personal carers to residents, and each resident received 30 min of direct care. No significant differences between the two sites were found in the time spent on oral communication, personal hygiene and continence activities. Personal carers at Site 1 spent significantly less time on toileting and mobility activities than those at Site 2, but more time on lunch activity. Although oral communication took the longest time (2h), it occurred concurrently with other activities (e.g. dressing) for 1.5h. The findings provide information that may assist decision makers in managing the operation of high-care residential aged care facilities, such as planning for task allocation and staffing. What is known about the topic? Overall, 30%-45% of the care staff's time is spent on direct care in residential aged care facilities. What does this paper add? This paper adds knowledge about how much time is required to conduct each direct care activity and the frequency and duration of conducting these activities to meet residents' day-to-day care needs in two high-care houses in two aged care facilities. What are the implications for practitioners? On average, a resident with high-care needs requires 30 min direct care. There may exist a basic minimum desirable ratio of personal carers to residents in high-care facilities. Residents' toileting needs are high after meals. Communication with residents represents an essential role in providing care.
Lee, Sook-Jung; Chae, Young-Gil
2007-10-01
We conducted a survey of 222 fourth-, fifth-, and sixth-grade Korean children to examine (a) whether children's Internet use influences declines in family time and family communication and (b) how parental mediation techniques are related to children's online activities. According to the findings, total time using the Internet was related to perceived declines in family time but not related to family communication. The influence of the Internet on family time and family communication differed by the type of children's online activities. The analysis of the relationship between parental mediation techniques and children's online activities indicated that parents' recommendation of useful Web sites and co-using were positively related to frequency of children's educational online activities. However, parental restrictions on time and Web sites did not alter children's actual Internet usage.
Pedersen, Hege Lynum; Johnson, Kenneth A; McVey, Colin E; Leiros, Ingar; Moe, Elin
2015-10-01
Uracil-DNA N-glycosylase (UNG) is a DNA-repair enzyme in the base-excision repair (BER) pathway which removes uracil from DNA. Here, the crystal structure of UNG from the extremophilic bacterium Deinococcus radiodurans (DrUNG) in complex with DNA is reported at a resolution of 1.35 Å. Prior to the crystallization experiments, the affinity between DrUNG and different DNA oligonucleotides was tested by electrophoretic mobility shift assays (EMSAs). As a result of this analysis, two 16 nt double-stranded DNAs were chosen for the co-crystallization experiments, one of which (16 nt AU) resulted in well diffracting crystals. The DNA in the co-crystal structure contained an abasic site (substrate product) flipped into the active site of the enzyme, with no uracil in the active-site pocket. Despite the high resolution, it was not possible to fit all of the terminal nucleotides of the DNA complex into electron density owing to disorder caused by a lack of stabilizing interactions. However, the DNA which was in contact with the enzyme, close to the active site, was well ordered and allowed detailed analysis of the enzyme-DNA interaction. The complex revealed that the interaction between DrUNG and DNA is similar to that in the previously determined crystal structure of human UNG (hUNG) in complex with DNA [Slupphaug et al. (1996). Nature (London), 384, 87-92]. Substitutions in a (here defined) variable part of the leucine loop result in a shorter loop (eight residues instead of nine) in DrUNG compared with hUNG; regardless of this, it seems to fulfil its role and generate a stabilizing force with the minor groove upon flipping out of the damaged base into the active site. The structure also provides a rationale for the previously observed high catalytic efficiency of DrUNG caused by high substrate affinity by demonstrating an increased number of long-range electrostatic interactions between the enzyme and the DNA. Interestingly, specific interactions between residues in the N-terminus of a symmetry-related molecule and the complementary DNA strand facing away from the active site were also observed which seem to stabilize the enzyme-DNA complex. However, the significance of this observation remains to be investigated. The results provide new insights into the current knowledge about DNA damage recognition and repair by uracil-DNA glycosylases.
NASA Astrophysics Data System (ADS)
Rom, E. L.; Patino, L. C.; Weiler, S.; Sanchez, S. C.; Colon, Y.; Antell, L.
2011-12-01
The Research Experience for Undergraduate (REU) Program at the U.S. National Science Foundation (NSF) provides U.S. undergraduate students from any college or university the opportunity to conduct research at a different institution and gain a better understanding of research career pathways. The Geosciences REU Sites foster research opportunities in areas closely aligned with geoscience programs, particularly those related to earth, atmospheric and ocean sciences. The aim of this paper is to provide an overview of the Geosciences REU Site programs run in 2009 through 2011. A survey requesting information on recruitment methods, student demographics, enrichment activities, and fields of research was sent to the Principal Investigators of each of the active REU Sites. Over 70% of the surveys were returned with the requested information from about 50 to 60 sites each year. The internet is the most widely used mechanism to recruit participants, with personal communication as the second most important recruiting tool. The admissions rate for REU Sites in Geosciences varies from less than 10% to 50%, with the majority of participants being rising seniors and juniors. Many of the participants come from non-PhD granting institutions. Among the participants, gender distribution varies by discipline, with ocean sciences having a large majority of women and earth sciences having a majority of men. Regarding ethnic diversity, the REU Sites reflect the difficulty of attracting diverse students into Geosciences as a discipline; a large majority of participants are Caucasian and Asian students. Furthermore, participants from minority-serving institutions and community colleges constitute a small percentage of those taking part in these research experiences. The enrichment activities are very similar across the REU Sites, and mimic activities common to the scientific community, including intellectual exchange of ideas (lab meetings, seminars, and professional meetings), networking and social activities. The results from this survey will be used to examine strengths in the REU Sites in the Geosciences, opportunities that may be under utilized, and community needs to enhance this NSF wide program.
Yong, Alan; Martin, Antony; Stokoe, Kenneth; Diehl, John
2013-01-01
Funded by the 2009 American Recovery and Reinvestment Act (ARRA), we conducted geophysical site characterizations at 191 strong-motion stations: 187 in California and 4 in the Central-Eastern United States (CEUS). The geophysical methods used at each site included passive and active surface-wave and body-wave techniques. Multiple techniques were used at most sites, with the goal of robustly determining VS (shear-wave velocity) profiles and VS30 (the time-averaged shear-wave velocity in the upper 30 meters depth). These techniques included: horizontal-to-vertical spectral ratio (HVSR), two-dimensional (2-D) array microtremor (AM), refraction microtremor (ReMi™), spectral analysis of surface wave (SASW), multi-channel analysis of surface waves (Rayleigh wave: MASRW; and Love wave: MASLW), and compressional- and shear-wave refraction. Of the selected sites, 47 percent have crystalline, volcanic, or sedimentary rock at the surface or at relatively shallow depth, and 53 percent are of Quaternary sediments located in either rural or urban environments. Calculated values of VS30 span almost the full range of the National Earthquake Hazards Reduction Program (NEHRP) Site Classes, from D (stiff soils) to B (rock). The NEHRP Site Classes based on VS30 range from being consistent with the Class expected from analysis of surficial geology, to being one or two Site Classes below expected. In a few cases where differences between the observed and expected Site Class occurred, it was the consequence of inaccurate or coarse geologic mapping, as well as considerable degradation of the near-surface rock. Additionally, several sites mapped as rock have Site Class D (stiff soil) velocities, which is due to the extensive weathering of the surficial rock.
Dodge, Kent A.; Hornberger, Michelle I.; Turner, Matthew A.
2018-03-30
Water, bed sediment, and biota were sampled in selected streams from Butte to near Missoula, Montana, as part of a monitoring program in the upper Clark Fork Basin of western Montana. The sampling program was led by the U.S. Geological Survey, in cooperation with the U.S. Environmental Protection Agency, to characterize aquatic resources in the Clark Fork Basin, with emphasis on trace elements associated with historic mining and smelting activities. Sampling sites were on the Clark Fork and selected tributaries. Water samples were collected periodically at 20 sites from October 2015 through September 2016. Bed-sediment and biota samples were collected once at 13 sites during August 2016.This report presents the analytical results and quality-assurance data for water-quality, bed-sediment, and biota samples collected at sites from October 2015 through September 2016. Water-quality data include concentrations of selected major ions, trace elements, and suspended sediment. Samples for analysis of turbidity were collected at 13 sites, whereas samples for analysis of dissolved organic carbon were collected at 10 sites. In addition, samples for analysis of nitrogen (nitrate plus nitrite) were collected at two sites. Daily values of mean suspended-sediment concentration and suspended-sediment discharge were determined for three sites. Seasonal daily values of turbidity were determined for five sites. Bed-sediment data include trace-element concentrations in the fine-grained (less than 0.063 millimeter) fraction. Biological data include trace-element concentrations in whole-body tissue of aquatic benthic insects. Statistical summaries of water-quality, bed-sediment, and biological data for sites in the upper Clark Fork Basin are provided for the period of record.
Refining the site conceptual model at a former uranium mill site in Riverton, Wyoming, USA
Dam, William; Campbell, Sam; Johnson, Ray; ...
2015-07-07
Milling activities at a former uranium mill site near Riverton, Wyoming, USA, contaminated the shallow groundwater beneath and downgradient of the site. Although the mill operated for <6 years (1958-1963), its impact remains an environmental liability. Groundwater modeling predicted that contaminant concentrations were declining steadily, which confirmed the conceptual site model (CSM). However, local flooding in 2010 mobilized contaminants that migrated downgradient from the Riverton site and resulted in a dramatic increase in groundwater contaminant concentrations. This observation indicated that the original CSM was inadequate to explain site conditions and needed to be refined. In response to the new observationsmore » after the flood, a collaborative investigation to better understand site conditions and processes commenced. This investigation included installing 103 boreholes to collect soil and groundwater samples, sampling and analysis of evaporite minerals along the bank of the Little Wind River, an analysis of evaportranspiration in the shallow aquifer, and sampling naturally organic-rich sediments near groundwater discharge areas. The enhanced characterization revealed that the existing CSM did not account for high uranium concentrations in groundwater remaining on the former mill site and groundwater plume stagnation near the Little Wind River. Observations from the flood and subsequent investigations indicate that additional characterization is still needed to continue refining the CSM and determine the viability of the natural flushing compliance strategy. Additional sampling, analysis, and testing of soil and groundwater are necessary to investigate secondary contaminant sources, mobilization of contaminants during floods, geochemical processes, contaminant plume stagnation, distribution of evaporite minerals and organic-rich sediments, and mechanisms and rates of contaminant transfer from soil to groundwater. Future data collection will be used to continually revise the CSM and evaluate the compliance strategy at the site.« less
Sun, Jian; Zhang, Qiang; Zhou, Jia; Wei, Qinping
2014-01-01
We used a next-generation, Illumina-based sequencing approach to characterize the bacterial community development of apple rhizosphere soil in a replant site (RePlant) and a new planting site (NewPlant) in Beijing. Dwarfing apple nurseries of ‘Fuji’/SH6/Pingyitiancha trees were planted in the spring of 2013. Before planting, soil from the apple rhizosphere of the replant site (ReSoil) and from the new planting site (NewSoil) was sampled for analysis on the Illumina MiSeq platform. In late September, the rhizosphere soil from both sites was resampled (RePlant and NewPlant). More than 16,000 valid reads were obtained for each replicate, and the community was composed of five dominant groups (Proteobacteria, Acidobacteria, Bacteroidetes, Gemmatimonadetes and Actinobacteria). The bacterial diversity decreased after apple planting. Principal component analyses revealed that the rhizosphere samples were significantly different among treatments. Apple nursery planting showed a large impact on the soil bacterial community, and the community development was significantly different between the replanted and newly planted soils. Verrucomicrobia were less abundant in RePlant soil, while Pseudomonas and Lysobacter were increased in RePlant compared with ReSoil and NewPlant. Both RePlant and ReSoil showed relatively higher invertase and cellulase activities than NewPlant and NewSoil, but only NewPlant soil showed higher urease activity, and this soil also had the higher plant growth. Our experimental results suggest that planting apple nurseries has a significant impact on soil bacterial community development at both replant and new planting sites, and planting on new site resulted in significantly higher soil urease activity and a different bacterial community composition. PMID:25360786
Buckbinder, L; Miralles, V J; Reinberg, D
1989-01-01
We have examined the control of gene expression from the adenovirus early region III (Ad-EIII) promoter, which contains two previously defined elements, the AP1 and ATF sites. We found that the AP1 element is capable of mediating activation by the adenovirus immediate early (EIa) gene products. Consistent with studies demonstrating that the AP1 site mediates signal transduction in response to 12-O-tetradecanoylphorbol 13-acetate (TPA) we have shown that TPA can activate Ad-EIII expression and overcome the requirement for EIa. Together TPA and EIa elicited a synergistic response in expression from the Ad-EIII promoter during both transient expression assays and viral infections. This synergistic effect required the AP1 element. An EIII promoter construct, in which sequences upstream of the TATA box had been replaced with four AP1 sites, was responsive to TPA and EIa and in combination promoted the synergistic effect. The analysis of specific factors involved in transcription from the Ad-EIII indicated that proteins recognizing the ATF and AP1 sites were important in expression from this promoter in vitro. Purification of protein factors that specifically stimulated EIII expression resulted in the isolation of a set of factors of the AP1 family. Affinity purified AP1 recognized and activated transcription through both the AP1 and ATF elements. In addition, a protein fraction was identified with DNA binding activity specific for the ATF element. This fraction was dependent on the ATF site for transcriptional activity. Images PMID:2531661
Systems-level identification of PKA-dependent signaling in epithelial cells.
Isobe, Kiyoshi; Jung, Hyun Jun; Yang, Chin-Rang; Claxton, J'Neka; Sandoval, Pablo; Burg, Maurice B; Raghuram, Viswanathan; Knepper, Mark A
2017-10-17
G protein stimulatory α-subunit (G αs )-coupled heptahelical receptors regulate cell processes largely through activation of protein kinase A (PKA). To identify signaling processes downstream of PKA, we deleted both PKA catalytic subunits using CRISPR-Cas9, followed by a "multiomic" analysis in mouse kidney epithelial cells expressing the G αs -coupled V2 vasopressin receptor. RNA-seq (sequencing)-based transcriptomics and SILAC (stable isotope labeling of amino acids in cell culture)-based quantitative proteomics revealed a complete loss of expression of the water-channel gene Aqp2 in PKA knockout cells. SILAC-based quantitative phosphoproteomics identified 229 PKA phosphorylation sites. Most of these PKA targets are thus far unannotated in public databases. Surprisingly, 1,915 phosphorylation sites with the motif x-(S/T)-P showed increased phosphooccupancy, pointing to increased activity of one or more MAP kinases in PKA knockout cells. Indeed, phosphorylation changes associated with activation of ERK2 were seen in PKA knockout cells. The ERK2 site is downstream of a direct PKA site in the Rap1GAP, Sipa1l1, that indirectly inhibits Raf1. In addition, a direct PKA site that inhibits the MAP kinase kinase kinase Map3k5 (ASK1) is upstream of JNK1 activation. The datasets were integrated to identify a causal network describing PKA signaling that explains vasopressin-mediated regulation of membrane trafficking and gene transcription. The model predicts that, through PKA activation, vasopressin stimulates AQP2 exocytosis by inhibiting MAP kinase signaling. The model also predicts that, through PKA activation, vasopressin stimulates Aqp2 transcription through induction of nuclear translocation of the acetyltransferase EP300, which increases histone H3K27 acetylation of vasopressin-responsive genes (confirmed by ChIP-seq).
Deep sub-seafloor prokaryotes stimulated at interfaces over geological time.
Parkes, R John; Webster, Gordon; Cragg, Barry A; Weightman, Andrew J; Newberry, Carole J; Ferdelman, Timothy G; Kallmeyer, Jens; Jørgensen, Bo B; Aiello, Ivano W; Fry, John C
2005-07-21
The sub-seafloor biosphere is the largest prokaryotic habitat on Earth but also a habitat with the lowest metabolic rates. Modelled activity rates are very low, indicating that most prokaryotes may be inactive or have extraordinarily slow metabolism. Here we present results from two Pacific Ocean sites, margin and open ocean, both of which have deep, subsurface stimulation of prokaryotic processes associated with geochemical and/or sedimentary interfaces. At 90 m depth in the margin site, stimulation was such that prokaryote numbers were higher (about 13-fold) and activity rates higher than or similar to near-surface values. Analysis of high-molecular-mass DNA confirmed the presence of viable prokaryotes and showed changes in biodiversity with depth that were coupled to geochemistry, including a marked community change at the 90-m interface. At the open ocean site, increases in numbers of prokaryotes at depth were more restricted but also corresponded to increased activity; however, this time they were associated with repeating layers of diatom-rich sediments (about 9 Myr old). These results show that deep sedimentary prokaryotes can have high activity, have changing diversity associated with interfaces and are active over geological timescales.
Dubiel, Grzegorz; Rogoziński, Paweł; Żaloudik, Elżbieta; Bruliński, Krzysztof; Różańska, Anna; Wójkowska-Mach, Jadwiga
2017-10-01
Surgical site infection (SSI) is considered to be a priority in infection control. The objective of this study is the analysis of results of active targeted surveillance conducted over a two-year period in the Department of Thoracic Surgery at the Pulmonology and Thoracic Surgery Center in Bystra, in southern Poland. The retrospective analysis was carried out on the basis of results of active monitoring of SSI in the 45-bed Department of Thoracic Surgery at the Pulmonology and Thoracic Surgery Center in Bystra between April 1, 2014 and April 30, 2016. Surgical site infections were identified based on the definitions of the European Centre for Disease Prevention and Control (ECDC) taking into account the time of symptom onset, specifically, whether the symptoms occurred within 30 d after the surgical procedure. Detection of SSI relied on daily inspection of incisions by a trained nurse, analysis of medical and nursing entries in the computer system, and analysis of all results of microbiologic tests taken in the unit and in the operating room. In the study period, data were collected regarding 1,387 treatment procedures meeting the registration criteria. Forty cases of SSI were detected yielding an incidence rate of 3%. Most cases (55%) were found in the course of hospitalization and 45% were detected after the patient's discharge. The SSIs were classified as follows: superficial, 37.5%; deep infections, 7.5%; and organ/space infection, 55%. Among patients who were diagnosed with SSI, most were male (77.5%). For patients with an American Society of Anesthesiologists (ASA) score I-II the incidence rate was 2%; ASA score III or more, 3.7%. The incidence rate varied from 0.3% in clean surgical site to 6.5% in clean-contaminated site. The study validated the usefulness of targeted surveillance in monitoring SSIs in patients hospitalized in thoracic surgery departments. Surgical site infection surveillance identified areas of care requiring modifications, namely, organization of post-discharge and microbiologic diagnostics of infection cases.
Qian, S.S.; Anderson, Chauncey W.
1999-01-01
We analyzed available concentration data of five commonly used herbicides and three pesticides collected from small streams in the Willamette River Basin in Oregon to identify factors that affect the variation of their concentrations in the area. The emphasis of this paper is the innovative use of classification and regression tree models for exploratory data analysis as well as analyzing data with a substantial amount of left-censored values. Among variables included in this analysis, land-use pattern in the watershed is the most important for all but one (simazine) of the eight pesticides studied, followed by geographic location, intensity of agriculture activities in the watershed (represented by nutrient concentrations in the stream), and the size of the watershed. The significant difference between urban sites and agriculture sites is the variability of stream concentrations. While all 16 nonurban watersheds have significantly higher variation than urban sites, the same is not necessarily true for the mean concentrations. Seasonal variation accounts for only a small fraction of the total variance in all eight pesticides.We analyzed available concentration data of five commonly used herbicides and three pesticides collected from small streams in the Willamette River Basin in Oregon to identify factors that affect the variation of their concentrations in the area. The emphasis of this paper is the innovative use of classification and regression tree models for exploratory data analysis as well as analyzing data with a substantial amount of left-censored values. Among variables included in this analysis, land-use pattern in the watershed is the most important for all but one (simazine) of the eight pesticides studied, followed by geographic location, intensity of agriculture activities in the watershed (represented by nutrient concentrations in the stream), and the size of the watershed. The significant difference between urban sites and agriculture sites is the variability of stream concentrations. While all 16 nonurban watersheds have significantly higher variation than urban sites, the same is not necessarily true for the mean concentrations. Seasonal variation accounts for only a small fraction of the total variance in all eight pesticides.
Structural Analysis of ADP-Glucose Pyrophosphorylase From the Bacterium Agrobacterium Tumefaciens
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cupp-Vickery, J.R.; Igarashi, R.Y.; Perez, M.
2009-05-14
ADP-glucose pyrophosphorylase (ADPGlc PPase) catalyzes the conversion of glucose 1-phosphate and ATP to ADP-glucose and pyrophosphate. As a key step in glucan synthesis, the ADPGlc PPases are highly regulated by allosteric activators and inhibitors in accord with the carbon metabolism pathways of the organism. Crystals of Agrobacterium tumefaciens ADPGlc PPase were obtained using lithium sulfate as a precipitant. A complete anomalous selenomethionyl derivative X-ray diffraction data set was collected with unit cell dimensions a = 85.38 {angstrom}, b = 93.79 {angstrom}, and c = 140.29 {angstrom} ({alpha} = {beta} = {gamma} = 90{sup o}) and space group I{sub 222}. Themore » A. tumefaciens ADPGlc PPase model was refined to 2.1 {angstrom} with an R{sub factor} = 22% and R{sub free} = 26.6%. The model consists of two domains: an N-terminal {alpha}{beta}{alpha} sandwich and a C-terminal parallel {beta}-helix. ATP and glucose 1-phosphate were successfully modeled in the proposed active site, and site-directed mutagenesis of conserved glycines in this region (G20, G21, and G23) resulted in substantial loss of activity. The interface between the N- and the C-terminal domains harbors a strong sulfate-binding site, and kinetic studies revealed that sulfate is a competitive inhibitor for the allosteric activator fructose 6-phosphate. These results suggest that the interface between the N- and C-terminal domains binds the allosteric regulator, and fructose 6-phosphate was modeled into this region. The A. tumefaciens ADPGlc PPase/fructose 6-phosphate structural model along with sequence alignment analysis was used to design mutagenesis experiments to expand the activator specificity to include fructose 1,6-bisphosphate. The H379R and H379K enzymes were found to be activated by fructose 1,6-bisphosphate.« less
NASA Astrophysics Data System (ADS)
Look, Cory
The overall goal of this research is to evaluate the efficacy of pXRF for the identification of ancient activity areas at Pre-Columbian sites in Antigua that range across time periods, geographic regions, site types with a variety of features, and various states of preservation. These findings have important implications for identifying and reconstructing places full of human activity but void of material remains. A synthesis for an archaeology of void spaces requires the construction of new ways of testing anthrosols, and identifying elemental patterns that can be used to connect people with their places and objects. This research begins with an exploration of rich middens in order to study void spaces. Midden archaeology has been a central focus in Caribbean research, and consists of an accumulation of discarded remnants from past human activities that can be tested against anthrosols. The archaeological collections visited for this research project involved creating new databases to generate a comprehensive inventory of sites, materials excavated, and assemblages available for study. Of the more than 129 Pre-Columbian sites documented in Antigua, few sites have been thoroughly surveyed or excavated. Twelve Pre-Columbian sites, consisting of thirty-six excavated units were selected for study; all of which contained complete assemblages for comparison and soil samples for testing. These excavations consisted almost entirely of midden excavations, requiring new archaeological investigations to be carried out in spaces primarily void of material remains but within the village context. Over the course of three seasons excavations, shovel test pits, and soil augers were used to obtain a variety of anthrosols and archaeological assemblages in order to generate new datasets to study Pre-Columbian activity areas. The selection of two primary case study sites were used for comparison: Indian Creek and Doigs. Findings from this research indicate that accounting for the variety of activity areas that make up a site can imbue a site with an identity of purpose and shed light on how different sites may have served different purposes within a regional framework. Excavations at the site of Indian Creek identified a series of raised middens that enclosed an open space for approximately 1500 years. This research explores this open space, and questions the meaning of 'void' and 'empty' with respect to past human activities. While archaeologists recognize that areas void of material remains are certainly part of the larger site, the question remains, without an understand of these spaces; what aspects of past life are we possibly masking? The integration of anthrosols alongside archaeological excavations and spatial analysis indicate that the site of Indian Creek contained a ceremonial plaza that formed early on and was maintained until abandonment. The spatial distribution of material objects combined with anthrosol studies provided additional evidence of ritual deposits concentrated in one part of the plaza associated with a nearby creek-bed. The second site, Doigs represents one of the last intact undisturbed Early Ceramic Age site of its kind in the Eastern Caribbean. Since its discovery in the 1970's, Doig's has been partially surveyed and excavated. The identification of residential activity areas including several potential structures, bead manufacturing loci, and cooking hearths were used to help test chemical signatures with archaeologically defined activity areas. Findings from this site illustrated the uniqueness of elemental patterns associated with activity areas, and also generated new questions regarding void spaces enriched with elemental patterns associated with concentrations of plant and vegetation debris. It is the hope of this study to contribute to our general knowledge for the identification of ancient activity areas as well as the different places that give sites their identity. These assemblages of activity areas can provide Caribbeanists with an alternative approach to studying social organization at a village scale and generate new discussions regarding island wide-community relationships.
Zhu, Hui; Shuman, Stewart
2005-04-01
NAD+-dependent DNA ligase (LigA) is essential for bacterial growth and a potential target for antimicrobial drug discovery. Here we queried the role of 14 conserved amino acids of Escherichia coli LigA by alanine scanning and thereby identified five new residues within the nucleotidyltransferase domain as being essential for LigA function in vitro and in vivo. Structure activity relationships were determined by conservative mutagenesis for the Glu-173, Arg-200, Arg-208, and Arg-277 side chains, as well as four other essential side chains that had been identified previously (Lys-115, Asp-117, Asp-285, and Lys-314). In addition, we identified Lys-290 as important for LigA activity. Reference to the structure of Enterococcus faecalis LigA allowed us to discriminate three classes of essential/important side chains that: (i) contact NAD+ directly (Lys-115, Glu-173, Lys-290, and Lys-314); (ii) comprise the interface between the NMN-binding domain (domain Ia) and the nucleotidyltransferase domain or comprise part of a nick-binding site on the surface of the nucleotidyltransferase domain (Arg-200 and Arg-208); or (iii) stabilize the active site fold of the nucleotidyltransferase domain (Arg-277). Analysis of mutational effects on the isolated ligase adenylylation and phosphodiester formation reactions revealed different functions for essential side chains at different steps of the DNA ligase pathway, consistent with the proposal that the active site is serially remodeled as the reaction proceeds.
Yeager, C.M.; Kornosky, J.L.; Housman, D.C.; Grote, E.E.; Belnap, J.; Kuske, C.R.
2004-01-01
The objective of this study was to characterize the community structure and activity of N2-fixing microorganisms in mature and poorly developed biological soil crusts from both the Colorado Plateau and Chihuahuan Desert. Nitrogenase activity was approximately 10 and 2.5 times higher in mature crusts than in poorly developed crusts at the Colorado Plateau site and Chihuahuan Desert site, respectively. Analysis of nifH sequences by clone sequencing and the terminal restriction fragment length polymorphism technique indicated that the crust diazotrophic community was 80 to 90% heterocystous cyanobacteria most closely related to Nostoc spp. and that the composition of N2-fixing species did not vary significantly between the poorly developed and mature crusts at either site. In contrast, the abundance of nifH sequences was approximately 7.5 times greater (per microgram of total DNA) in mature crusts than in poorly developed crusts at a given site as measured by quantitative PCR. 16S rRNA gene clone sequencing and microscopic analysis of the cyanobacterial community within both crust types demonstrated a transition from a Microcoleus vaginatus-dominated, poorly developed crust to mature crusts harboring a greater percentage of Nostoc and Scytonema spp. We hypothesize that ecological factors, such as soil instability and water stress, may constrain the growth of N2-fixing microorganisms at our study sites and that the transition to a mature, nitrogen-producing crust initially requires bioengineering of the surface microenvironment by Microcoleus vaginatus.
Statistical trend analysis of groundwater data at Louisiana Army Ammunition Plant
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhinge, D; Patel, J.; Skibinski, J.N.
1994-12-31
Statistical regression techniques were used to characterize temporal trends in groundwater monitoring data collected between 1980 and 1994 at Former Area P Lagoons, Louisiana Army Ammunition Plant (LAAP), a National Priorities List (NPL) site. Groundwater sampling data were evaluated for 12 wells (9 in the shallow aquifer and 3 in the deeper aquifer) and 9 contaminants of concern (COCs). A trend index (TI) was calculated from the sum of the number of improving and stable trends minus the number of deteriorating trends for each contaminant, each well, and the overall site. A positive TI indicates an improving trend for themore » site, contaminant, or well. Conversely, a negative TI indicates a deteriorating trend. The overall trend indices at the site for the shallow and deeper aquifers were found to be positive, indicating that the groundwater quality at Area P is generally improving. Interim remedial action was conducted at Area P from 1988 through 1990. The effect of remedial activities on groundwater quality was assessed by comparing the groundwater concentrations of nitro compounds measured immediately after the site remediation to those measured prior to the remedial action. The regression curves and the data indicated that a downward trend in the groundwater concentrations was observed immediately following the remediation activity at Area P. The trends from the regression analysis indicated that the overall remedy at Area P has been effective in reducing COC concentrations in groundwater.« less
Seagrass mitigation site modeling and assessment.
DOT National Transportation Integrated Search
2013-05-01
Spatiotemporal analysis of Lake Surprise and SL-15 (15th spoil island in St. Lucie County) has allowed for a robust assessment of successful Florida Department of Transportation (FDOT) activities. Project results showed that bridge construction in La...
Olazaran, Fabián E; Rivera, Gildardo; Pérez-Vázquez, Alondra M; Morales-Reyes, Cynthia M; Segura-Cabrera, Aldo; Balderas-Rentería, Isaías
2017-01-12
Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [ N -( p -methoxy-phenyl)-2-( p -methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site.
2016-01-01
Potential anticancer activity of 16 azetidin-2-one derivatives was evaluated showing that compound 6 [N-(p-methoxy-phenyl)-2-(p-methyl-phenyl)-3-phenoxy-azetidin-2-one] presented cytotoxic activity in SiHa cells and B16F10 cells. The caspase-3 assay in B16F10 cells displayed that azetidin-2-one derivatives induce apoptosis. Microarray and molecular analysis showed that compound 6 was involved on specific gene overexpression of cytoskeleton regulation and apoptosis due to the inhibition of some cell cycle genes. From the 16 derivatives, compound 6 showed the highest selectivity to neoplastic cells, it was an inducer of apoptosis, and according to an in silico analysis of chemical interactions with colchicine binding site of human α/β-tubulin, the mechanism of action could be a molecular interaction involving the amino acids outlining such binding site. PMID:28105271
Kulminskaya, Anna A; Arand, Michael; Eneyskaya, Elena V; Ivanen, Dina R; Shabalin, Konstantin A; Shishlyannikov, Sergei M; Saveliev, Andrew N; Korneeva, Olga S; Neustroev, Kirill N
2003-08-21
1H-NMR analysis was applied to investigate the hydrolytic activity of Aspergillus awamori inulinase. The obtained NMR signals and deduced metabolite pattern revealed that the enzyme cleaves off only fructose from inulin and does not possess transglycosylating activity. Kinetics for the enzyme hydrolysis of inulooligosaccharides with different degree of polymerization (d.p.) were recorded. The enzyme hydrolyzed both beta2,1- as well as beta2,6-fructosyl linkages in fructooligosaccharides. From the k(cat)/K(m) ratios obtained with inulooligosaccharides with d.p. from 2 to 7, we deduce that the catalytic site of the inulinase contains at least five fructosyl-binding sites and can be classified as exo-acting enzyme. Product analysis of inulopentaose and inulohexaose hydrolysis by the Aspergillus inulinase provided no evidence for a possible multiple-attack mode of action, suggesting that the enzyme acts exclusively as an exoinulinase.
Morning glory resin glycosides as α-glucosidase inhibitors: In vitro and in silico analysis.
Rosas-Ramírez, Daniel; Escandón-Rivera, Sonia; Pereda-Miranda, Rogelio
2018-04-01
Twenty-seven individual resin glycosides from the morning glory family (Convolvulaceae) were evaluated for their α-glucosidase inhibitory potential. Four of these compounds displayed an inhibitory activity comparable to acarbose, which was used as a positive control. Molecular modeling studies performed by docking analysis were accomplished to predict that the active compounds and acarbose bind to the α-1,4-glucosidase enzyme catalytic site of MAL12 from the yeast Saccharomyces cerevisiae through stable hydrogen bonds primarily with the amino acid residues HIS279 and GLN322. Docking studies with the human maltase-glucoamylase (MGAM) also identified binding modes for resin glycosides inside the catalytic site in the proximity of TYR1251. These results postulate that resin glycosides may be a source of phytotherapeutic agents with antihyperglycemic properties for the prophylaxis and treatment of non-insulin-dependent type 2 diabetes mellitus. Copyright © 2018 Elsevier Ltd. All rights reserved.
Carreón-Diazconti, Concepción; Santamaría, Johanna; Berkompas, Justin; Field, James A.; Brusseau, Mark L.
2010-01-01
Isotopic analysis and molecular-based bioassay methods were used in conjunction with geochemical data to assess intrinsic reductive dechlorination processes for a chlorinated-solvent contaminated site in Tucson, Arizona. Groundwater samples were obtained from monitoring wells within a contaminant plume comprising tetrachloroethene and its metabolites trichloroethene, cis-1,2-dichloroethene, vinyl chloride, and ethene, as well as compounds associated with free-phase diesel present at the site. Compound specific isotope (CSI) analysis was performed to characterize biotransformation processes influencing the transport and fate of the chlorinated contaminants. PCR analysis was used to assess the presence of indigenous reductive dechlorinators. The target regions employed were the 16s rRNA gene sequences of Dehalococcoides sp. and Desulfuromonas sp., and DNA sequences of genes pceA, tceA, bvcA, and vcrA, which encode reductive dehalogenases. The results of the analyses indicate that relevant microbial populations are present and that reductive dechlorination is presently occurring at the site. The results further show that potential degrader populations as well as biotransformation activity is non-uniformly distributed within the site. The results of laboratory microcosm studies conducted using groundwater collected from the field site confirmed the reductive dechlorination of tetrachloroethene to dichloroethene. This study illustrates the use of an integrated, multiple-method approach for assessing natural attenuation at a complex chlorinated-solvent contaminated site. PMID:19603638
Zhang, Emma Xuxiao; Yang, Yinping; Di Shang, Richard; Simons, Joseph John Pyne; Quek, Boon Kiat; Yin, Xiao Feng; See, Wanhan; Oh, Olivia Seen Huey; Nandar, Khine Sein Tun; Ling, Vivienne Ruo Yun; Chan, Pei Pei; Wang, Zhaoxia; Goh, Rick Siow Mong; James, Lyn; Tey, Jeannie Su Hui
2015-01-01
We conducted in-depth analysis on the use of a popular Chinese social networking and microblogging site, Sina Weibo, to monitor an avian influenza A(H7N9) outbreak in China and to assess the value of social networking sites in the surveillance of disease outbreaks that occur overseas. Two data sets were employed for our analysis: a line listing of confirmed cases obtained from conventional public health information channels and case information from Weibo posts. Our findings showed that the level of activity on Weibo corresponded with the number of new cases reported. In addition, the reporting of new cases on Weibo was significantly faster than those of conventional reporting sites and non-local news media. A qualitative review of the functions of Weibo also revealed that Weibo enabled timely monitoring of other outbreak-relevant information, provided access to additional crowd-sourced epidemiological information and was leveraged by the local government as an interactive platform for risk communication and monitoring public sentiment on the policy response. Our analysis demonstrated the potential for social networking sites to be used by public health agencies to enhance traditional communicable disease surveillance systems for the global surveillance of overseas public health threats. Social networking sites also can be used by governments for calibration of response policies and measures and for risk communication.
Zhang, Emma Xuxiao; Yang, Yinping; Di Shang, Richard; Simons, Joseph John Pyne; Quek, Boon Kiat; Yin, Xiao Feng; See, Wanhan; Oh, Olivia Seen Huey; Nandar, Khine Sein Tun; Ling, Vivienne Ruo Yun; Chan, Pei Pei; Wang, Zhaoxia; Goh, Rick Siow Mong; James, Lyn
2015-01-01
We conducted in-depth analysis on the use of a popular Chinese social networking and microblogging site, Sina Weibo, to monitor an avian influenza A(H7N9) outbreak in China and to assess the value of social networking sites in the surveillance of disease outbreaks that occur overseas. Two data sets were employed for our analysis: a line listing of confirmed cases obtained from conventional public health information channels and case information from Weibo posts. Our findings showed that the level of activity on Weibo corresponded with the number of new cases reported. In addition, the reporting of new cases on Weibo was significantly faster than those of conventional reporting sites and non-local news media. A qualitative review of the functions of Weibo also revealed that Weibo enabled timely monitoring of other outbreak-relevant information, provided access to additional crowd-sourced epidemiological information and was leveraged by the local government as an interactive platform for risk communication and monitoring public sentiment on the policy response. Our analysis demonstrated the potential for social networking sites to be used by public health agencies to enhance traditional communicable disease surveillance systems for the global surveillance of overseas public health threats. Social networking sites also can be used by governments for calibration of response policies and measures and for risk communication. PMID:26306219
Environmental impact reduction through ecological planning at Bahia Magdalena, Mexico.
Malagrino, Giovanni; Lagunas, Magdalena; Rubio, Alfredo Ortega
2008-03-01
For analyzing basic marine and coastal characteristics we selected the potential sites where shrimp culture could be developed in a large coastal zone, Bahia Magdalena, Baja California Sur, Mexico. Based on our analysis, 6 sites were preselected and field stages of work were then developed to assess the precise suitability of each site in order to develop the proposed aquaculture activities. In ranking the suitability we were able to recommend the most appropriate places to develop shrimp culture in this region. Also, knowing the exact biological, physico-chemical and social environment, we determined the best species to cultivate, the recommended total area and the methodology to be used to lessen the environmental impact and to obtain the maximum profitability Our methodology could be used not only to select appropriate sites for shrimp culture in other coastal lagoons, but it also could be applied to assess the suitability in a quick and accurate way, of any other production activity in coastal zones.
Endothelial stress induces the release of vitamin D-binding protein, a novel growth factor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Raymond, Marc-Andre; Desormeaux, Anik; Labelle, Andree
2005-12-23
Endothelial cells (EC) under stress release paracrine mediators that facilitate accumulation of vascular smooth muscle cells (VSCM) at sites of vascular injury. We found that medium conditioned by serum-starved EC increase proliferation and migration of VSCM in vitro. Fractionation of the conditioned medium followed by mass spectral analysis identified one bioactive component as vitamin D-binding protein (DBP). DBP induced both proliferation and migration of VSMC in vitro in association with increased phosphorylation of ERK 1/2. PD 98059, a biochemical inhibitor of ERK 1/2, abrogated these proliferative and migratory responses in VSMC. DBP is an important carrier for the vitamin-D sterols,more » 25-hydroxyvitamin-D, and 1{alpha},25-dihydroxyvitamin-D. Both sterols inhibited the activity of DBP on VSMC, suggesting that vitamin D binding sites are important for initiating the activities of DBP on VSMC. Release of DBP at sites of endothelial injury represents a novel pathway favoring accumulation of VSMC at sites of vascular injury.« less
Adding Value to the Health Care System: Identifying Value-Added Systems Roles for Medical Students.
Gonzalo, Jed D; Graaf, Deanna; Johannes, Bobbie; Blatt, Barbara; Wolpaw, Daniel R
To catalyze learning in Health Systems Science and add value to health systems, education programs are seeking to incorporate students into systems roles, which are not well described. The authors sought to identify authentic roles for students within a range of clinical sites and explore site leaders' perceptions of the value of students performing these roles. From 2013 to 2015, site visits and interviews with leadership from an array of clinical sites (n = 30) were conducted. Thematic analysis was used to identify tasks and benefits of integrating students into interprofessional care teams. Types of systems roles included direct patient benefit activities, including monitoring patient progress with care plans and facilitating access to resources, and clinic benefit activities, including facilitating coordination and improving clinical processes. Perceived benefits included improved value of the clinical mission and enhanced student education. These results elucidate a framework for student roles that enhance learning and add value to health systems.
Cloning and characterization of a novel acidic cutinase from Sirococcus conigenus.
Nyyssölä, Antti; Pihlajaniemi, Ville; Häkkinen, Mari; Kontkanen, Hanna; Saloheimo, Markku; Nakari-Setälä, Tiina
2014-04-01
A cutinase gene (ScCut1) was amplified by PCR from the genomic DNA of the ascomycetous plant pathogen Sirococcous conigenus VTT D-04989 using degenerate primers designed on the basis of conserved segments of known cutinases and cutinase-like enzymes. No introns or N- or O-glycosylation sites could be detected by analysis of the ScCut1 gene sequence. The alignment of ScCut1 with other fungal cutinases indicated that ScCut1 contained the conserved motif G-Y-S-Q-G surrounding the active site serine as well as the aspartic acid and histidine residues of the cutinase active site. The gene was expressed in Pichia pastoris, and the recombinantly produced ScCut1 enzyme was purified to homogeneity by immobilized metal affinity chromatography exploiting a C-terminal His-tag translationally fused to the protein. The purified ScCut1 exhibited activity at acidic pH. The K(m) and V(max) values determined for pNP-butyrate esterase activity at pH 4.5 were 1.7 mM and 740 nkat mg⁻¹, respectively. Maximal activities were determined at between pH 4.7 and 5.2 and at between pH 4.1 and 4.6 with pNP-butyrate and tritiated cutin as the substrates, respectively. With both substrates, the enzyme was active over a broad pH range (between pH 3.0 and 7.5). Activity could still be detected at pH 3.0 both with tritiated cutin and with p-nitrophenyl butyrate (relative activity of 25 %) as the substrates. ScCut1 showed activity towards shorter (C2 to C3) fatty acid esters of p-nitrophenol than towards longer ones. Circular dichroism analysis suggested that the denaturation of ScCut1 by heating the protein sample to 80 °C was to a great extent reversible.
NASA Astrophysics Data System (ADS)
Kaur, Jasmit; Walia, Harpreet; Mabwoga, Samson Okongo; Arora, Saroj
2017-06-01
The present study entails the investigation of mutagenic and genotoxic effect of surface water samples collected from 13 different sites of the Harike wetland using the histidine reversion point mutation assay in Salmonella typhimurium (TA98) strain and plasmid nicking assay using pBR322, respectively. The physicochemical characterization of water samples using different parameters was conducted for water quality monitoring. Heavy metal analysis was performed to quantify the toxic components present in water samples. It was observed that although the water samples of all the sites demonstrated mutagenic as well as genotoxic activity, the effect was quite significant with the water samples from sites containing water from river Satluj, i.e., site 1 (upstream Satluj river), site 2 (Satluj river) and site 3 (reservoir Satluj). The high level of pollution due to industrial effluents and agricultural run-off at these sites may engender the genotoxicity and mutagenicity of water samples.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Winters, M.S.; McElheny, G.; Houston, L.M.
2013-07-01
A case study is presented on specific program elements that supported the transition of a temporary field radiological screening lab to an accredited operation capable of meeting client quality objectives for definitive results data. The temporary field lab is located at the Formerly Utilized Sites Remedial Action Program Linde Site in Tonawanda, NY. The site is undergoing remediation under the direction of the United States Army Corps of Engineers - Buffalo District, with Cabrera Services Inc. as the remediation contractor and operator of the on-site lab. Analysis methods employed in the on-site lab include gross counting of alpha and betamore » particle activity on swipes and air filters and gamma spectroscopy of soils and other solid samples. A discussion of key program elements and lessons learned may help other organizations considering pursuit of accreditation for on-site screening laboratories. (authors)« less
Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau
2015-09-10
The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.
Cheesman, Myles R; Oganesyan, Vasily S; Watmough, Nicholas J; Butler, Clive S; Thomson, Andrew J
2004-04-07
Fully oxidized cytochrome bo3 from Escherichia coli has been studied in its oxidized and several ligand-bound forms using electron paramagnetic resonance (EPR) and magnetic circular dichroism (MCD) spectroscopies. In each form, the spin-coupled high-spin Fe(III) heme o3 and CuB(II) ion at the active site give rise to similar fast-relaxing broad features in the dual-mode X-band EPR spectra. Simulations of dual-mode spectra are presented which show that this EPR can arise only from a dinuclear site in which the metal ions are weakly coupled by an anisotropic exchange interaction of J 1 cm-1. A variable-temperature and magnetic field (VTVF) MCD study is also presented for the cytochrome bo3 fluoride and azide derivatives. New methods are used to extract the contribution to the MCD of the spin-coupled active site in the presence of strong transitions from low-spin Fe(III) heme b. Analysis of the MCD data, independent of the EPR study, also shows that the spin-coupling within the active site is weak with J approximately 1 cm-1. These conclusions overturn a long-held view that such EPR signals in bovine cytochrome c oxidase arise from an S' = 2 ground state resulting from strong exchange coupling (J > 10(2) cm-1) within the active site.
Dual allosteric activation mechanisms in monomeric human glucokinase
Whittington, A. Carl; Larion, Mioara; Bowler, Joseph M.; Ramsey, Kristen M.; Brüschweiler, Rafael; Miller, Brian G.
2015-01-01
Cooperativity in human glucokinase (GCK), the body’s primary glucose sensor and a major determinant of glucose homeostatic diseases, is fundamentally different from textbook models of allostery because GCK is monomeric and contains only one glucose-binding site. Prior work has demonstrated that millisecond timescale order-disorder transitions within the enzyme’s small domain govern cooperativity. Here, using limited proteolysis, we map the site of disorder in unliganded GCK to a 30-residue active-site loop that closes upon glucose binding. Positional randomization of the loop, coupled with genetic selection in a glucokinase-deficient bacterium, uncovers a hyperactive GCK variant with substantially reduced cooperativity. Biochemical and structural analysis of this loop variant and GCK variants associated with hyperinsulinemic hypoglycemia reveal two distinct mechanisms of enzyme activation. In α-type activation, glucose affinity is increased, the proteolytic susceptibility of the active site loop is suppressed and the 1H-13C heteronuclear multiple quantum coherence (HMQC) spectrum of 13C-Ile–labeled enzyme resembles the glucose-bound state. In β-type activation, glucose affinity is largely unchanged, proteolytic susceptibility of the loop is enhanced, and the 1H-13C HMQC spectrum reveals no perturbation in ensemble structure. Leveraging both activation mechanisms, we engineer a fully noncooperative GCK variant, whose functional properties are indistinguishable from other hexokinase isozymes, and which displays a 100-fold increase in catalytic efficiency over wild-type GCK. This work elucidates specific structural features responsible for generating allostery in a monomeric enzyme and suggests a general strategy for engineering cooperativity into proteins that lack the structural framework typical of traditional allosteric systems. PMID:26283387
Dual allosteric activation mechanisms in monomeric human glucokinase.
Whittington, A Carl; Larion, Mioara; Bowler, Joseph M; Ramsey, Kristen M; Brüschweiler, Rafael; Miller, Brian G
2015-09-15
Cooperativity in human glucokinase (GCK), the body's primary glucose sensor and a major determinant of glucose homeostatic diseases, is fundamentally different from textbook models of allostery because GCK is monomeric and contains only one glucose-binding site. Prior work has demonstrated that millisecond timescale order-disorder transitions within the enzyme's small domain govern cooperativity. Here, using limited proteolysis, we map the site of disorder in unliganded GCK to a 30-residue active-site loop that closes upon glucose binding. Positional randomization of the loop, coupled with genetic selection in a glucokinase-deficient bacterium, uncovers a hyperactive GCK variant with substantially reduced cooperativity. Biochemical and structural analysis of this loop variant and GCK variants associated with hyperinsulinemic hypoglycemia reveal two distinct mechanisms of enzyme activation. In α-type activation, glucose affinity is increased, the proteolytic susceptibility of the active site loop is suppressed and the (1)H-(13)C heteronuclear multiple quantum coherence (HMQC) spectrum of (13)C-Ile-labeled enzyme resembles the glucose-bound state. In β-type activation, glucose affinity is largely unchanged, proteolytic susceptibility of the loop is enhanced, and the (1)H-(13)C HMQC spectrum reveals no perturbation in ensemble structure. Leveraging both activation mechanisms, we engineer a fully noncooperative GCK variant, whose functional properties are indistinguishable from other hexokinase isozymes, and which displays a 100-fold increase in catalytic efficiency over wild-type GCK. This work elucidates specific structural features responsible for generating allostery in a monomeric enzyme and suggests a general strategy for engineering cooperativity into proteins that lack the structural framework typical of traditional allosteric systems.
Ananvoranich, S; Lafontaine, D A; Perreault, J P
1999-01-01
Our previous report on delta ribozyme cleavage using a trans -acting antigenomic delta ribozyme and a collection of short substrates showed that the middle nucleotides of the P1 stem, the substrate binding site, are essential for the cleavage activity. Here we have further investigated the effect of alterations in the P1 stem on the kinetic and thermodynamic parameters of delta ribozyme cleavage using various ribozyme variants carrying single base mutations at putative positions reported. The kinetic and thermodynamic values obtained in mutational studies of the two middle nucleotides of the P1 stem suggest that the binding and active sites of the delta ribozyme are uniquely formed. Firstly, the substrate and the ribozyme are engaged in the formation of a helix, known as the P1 stem, which may contain a weak hydrogen bond(s) or a bulge. Secondly, a tertiary interaction involving the base moieties in the middle of the P1 stem likely plays a role in defining the chemical environment. As a con-sequence, the active site might form simultaneously or subsequently to the binding site during later steps of the pathway. PMID:10037808
Lysine Methylation of Nuclear Co-repressor Receptor Interacting Protein 140
Huq, MD Mostaqul; Ha, Sung Gil; Barcelona, Helene; Wei, Li-Na
2009-01-01
Receptor interacting protein 140 (RIP140) undergoes extensive posttranslational modifications (PTMs), including phosphorylation, acetylation, arginine methylation, and pyridoxylation. PTMs affect its sub-cellular distribution, protein-protein interaction, and biological activity in adipocyte differentiation. Arginine methylation on Arg240, Arg650, and Arg948 suppresses the repressive activity of RIP140. Here we find that endogenous RIP140 in differentiated 3T3-L1 cells is also modified by lysine methylation. Three lysine residues, Lys591, Lys653, and Lys757 are mapped as potential methylation sites by mass spectrometry. Site-directed mutagenesis study shows that lysine methylation enhances its gene repressive activity. Mutation of lysine methylation sites enhances arginine methylation, while mutation on arginine methylation sites has little effect on its lysine methylation, suggesting a relationship between lysine methylation and arginine methylation. Kinetic analysis of PTMs of endogenous RIP140 in differentiated 3T3-L1 cells demonstrates sequential modifications on RIP140, initiated from constitutive lysine methylation, followed by increased arginine methylation later in differentiation. This study reveals a potential hierarchy of modifications, at least for lysine and arginine methylation, which bi-directionally regulate the functionality of a non-histone protein. PMID:19216533
Bringing the CMS distributed computing system into scalable operations
NASA Astrophysics Data System (ADS)
Belforte, S.; Fanfani, A.; Fisk, I.; Flix, J.; Hernández, J. M.; Kress, T.; Letts, J.; Magini, N.; Miccio, V.; Sciabà, A.
2010-04-01
Establishing efficient and scalable operations of the CMS distributed computing system critically relies on the proper integration, commissioning and scale testing of the data and workload management tools, the various computing workflows and the underlying computing infrastructure, located at more than 50 computing centres worldwide and interconnected by the Worldwide LHC Computing Grid. Computing challenges periodically undertaken by CMS in the past years with increasing scale and complexity have revealed the need for a sustained effort on computing integration and commissioning activities. The Processing and Data Access (PADA) Task Force was established at the beginning of 2008 within the CMS Computing Program with the mandate of validating the infrastructure for organized processing and user analysis including the sites and the workload and data management tools, validating the distributed production system by performing functionality, reliability and scale tests, helping sites to commission, configure and optimize the networking and storage through scale testing data transfers and data processing, and improving the efficiency of accessing data across the CMS computing system from global transfers to local access. This contribution reports on the tools and procedures developed by CMS for computing commissioning and scale testing as well as the improvements accomplished towards efficient, reliable and scalable computing operations. The activities include the development and operation of load generators for job submission and data transfers with the aim of stressing the experiment and Grid data management and workload management systems, site commissioning procedures and tools to monitor and improve site availability and reliability, as well as activities targeted to the commissioning of the distributed production, user analysis and monitoring systems.
Source identification of uranium-containing materials at mine legacy sites in Portugal.
Keatley, A C; Martin, P G; Hallam, K R; Payton, O D; Awbery, R; Carvalho, F P; Oliveira, J M; Silva, L; Malta, M; Scott, T B
2018-03-01
Whilst prior nuclear forensic studies have focused on identifying signatures to distinguish between different uranium deposit types, this paper focuses on providing a scientific basis for source identification of materials from different uranium mine sites within a single region, which can then be potentially used within nuclear forensics. A number of different tools, including gamma spectrometry, alpha spectrometry, mineralogy and major and minor elemental analysis, have been utilised to determine the provenance of uranium mineral samples collected at eight mine sites, located within three different uranium provinces, in Portugal. A radiation survey was initially conducted by foot and/or unmanned aerial vehicle at each site to assist sample collection. The results from each mine site were then compared to determine if individual mine sites could be distinguished based on characteristic elemental and isotopic signatures. Gamma and alpha spectrometry were used to differentiate between samples from different sites and also give an indication of past milling and mining activities. Ore samples from the different mine sites were found to be very similar in terms of gangue and uranium mineralogy. However, rarer minerals or specific impurity elements, such as calcium and copper, did permit some separation of the sites examined. In addition, classification rates using linear discriminant analysis were comparable to those in the literature. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.
Schmaderer, Harald; Bhuyan, Mouchumi
2009-01-01
Summary Flavin chromophores can mediate redox reactions upon irradiation by blue light. In an attempt to increase their catalytic efficacy, flavin derivatives bearing a guanidinium ion as oxoanion binding site were prepared. Chromophore and substrate binding site are linked by a rigid Kemp’s acid structure. The molecular structure of the new flavins was confirmed by an X-ray structure analysis and their photocatalytic activity was investigated in benzyl ester cleavage, nitroarene reduction and a Diels–Alder reaction. The modified flavins photocatalyze the reactions, but the introduced substrate binding site does not enhance their performance. PMID:19590745
Schmaderer, Harald; Bhuyan, Mouchumi; König, Burkhard
2009-05-28
Flavin chromophores can mediate redox reactions upon irradiation by blue light. In an attempt to increase their catalytic efficacy, flavin derivatives bearing a guanidinium ion as oxoanion binding site were prepared. Chromophore and substrate binding site are linked by a rigid Kemp's acid structure. The molecular structure of the new flavins was confirmed by an X-ray structure analysis and their photocatalytic activity was investigated in benzyl ester cleavage, nitroarene reduction and a Diels-Alder reaction. The modified flavins photocatalyze the reactions, but the introduced substrate binding site does not enhance their performance.
Precursory Slope Deformation around Landslide Area Detected by Insar Throughout Japan
NASA Astrophysics Data System (ADS)
Nakano, T.; Wada, K.; Yamanaka, M.; Kamiya, I.; Nakajima, H.
2016-06-01
Interferometric Synthetic Aperture Radar (InSAR) technique is able to detect a slope deformation around landslide (e.g., Singhroy et al., 2004; Une et al., 2008; Riedel and Walther, 2008; Sato et al., 2014). Geospatial Information Authority (GSI) of Japan has been performing the InSAR analysis regularly by using ALOS/PALSAR data and ALOS-2/PALSAR-2 data throughout Japan. There are a lot of small phase change sites except for crustal deformation with earthquake or volcano activity in the InSAR imagery. Most of the phase change sites are located in landslide area. We conducted field survey at the 10 sites of those phase change sites. As a result, we identified deformation of artificial structures or linear depressions caused by mass movement at the 9 sites. This result indicates that InSAR technique can detect on the continual deformation of landslide block for several years. GSI of Japan will continue to perform the InSAR analysis throughout Japan. Therefore, we will be able to observe and monitor precursory slope deformation around landslide areas throughout Japan.
Hassan, Mubashir; Abbas, Qamar; Raza, Hussain; Moustafa, Ahmed A; Seo, Sung-Yum
2017-07-25
Misfolding and structural alteration in proteins lead to serious malfunctions and cause various diseases in humans. Mutations at the active binding site in tyrosinase impair structural stability and cause lethal albinism by abolishing copper binding. To evaluate the histidine mutational effect, all mutated structures were built using homology modelling. The protein sequence was retrieved from the UniProt database, and 3D models of original and mutated human tyrosinase sequences were predicted by changing the residual positions within the target sequence separately. Structural and mutational analyses were performed to interpret the significance of mutated residues (N 180 , R 202 , Q 202 , R 211 , Y 363 , R 367 , Y 367 and D 390 ) at the active binding site of tyrosinases. CSpritz analysis depicted that 23.25% residues actively participate in the instability of tyrosinase. The accuracy of predicted models was confirmed through online servers ProSA-web, ERRAT score and VERIFY 3D values. The theoretical pI and GRAVY generated results also showed the accuracy of the predicted models. The CCA negative correlation results depicted that the replacement of mutated residues at His within the active binding site disturbs the structural stability of tyrosinases. The predicted CCA scores of Tyr 367 (-0.079) and Q/R 202 (0.032) revealed that both mutations have more potential to disturb the structural stability. MD simulation analyses of all predicted models justified that Gln 202 , Arg 202 , Tyr 367 and D 390 replacement made the protein structures more susceptible to destabilization. Mutational results showed that the replacement of His with Q/R 202 and Y/R 363 has a lethal effect and may cause melanin associated diseases such as OCA1. Taken together, our computational analysis depicts that the mutated residues such as Q/R 202 and Y/R 363 actively participate in instability and misfolding of tyrosinases, which may govern OCA1 through disturbing the melanin biosynthetic pathway.
NASA Astrophysics Data System (ADS)
Saffari, Arian; Daher, Nancy; Shafer, Martin M.; Schauer, James J.; Sioutas, Constantinos
2013-11-01
Seasonal and spatial variation in redox activity of quasi-ultrafine particles (PM0.25) and its association with chemical species was investigated at 9 distinct sampling sites across the Los Angeles metropolitan area. Biologically reactive oxygen species (ROS) assay (generation of ROS in rat alveolar macrophage cells) was employed in order to assess the redox activity of PM0.25 samples. Seasonally, fall and summer displayed higher volume-based ROS activity (i.e. ROS activity per unit volume of air) compared to spring and winter. ROS levels were generally higher at near source and urban background sites compared to rural receptor locations, except for summer when comparable ROS activity was observed at the rural receptor sites. Univariate linear regression analysis indicated association (R > 0.7) between ROS activity and organic carbon (OC), water soluble organic carbon (WSOC) and water soluble transition metals (including Fe, V, Cr, Cd, Ni, Zn, Mn, Pb and Cu). A multivariate regression method was also used to obtain a model to predict the ROS activity of PM0.25, based on its water-soluble components. The most important species associated with ROS were Cu and La at the source site of Long Beach, and Fe and V at urban Los Angeles sites. These metals are tracers of road dust enriched with vehicular emissions (Fe and Cu) and residual oil combustion (V and La). At Riverside, a rural receptor location, WSOC and Ni (tracers of secondary organic aerosol and metal plating, respectively) were the dominant species driving the ROS activity. At Long Beach, the multivariate model was able to reconstruct the ROS activity with a high coefficient of determination (R2 = 0.82). For Los Angeles and Riverside, however, the regression models could only explain 63% and 68% of the ROS activity, respectively. The unexplained portion of the measured ROS activity is likely attributed to the nature of organic species not captured in the organic carbon (OC) measurement as well as non-linear effects, which were not included in our linear model.
Wang, Zhaoguo; Yang, Zhaoping; Du, Xishihui
2015-01-01
World Natural Heritage Sites (WNHS) are treasures that need human protection and invite appreciation, which makes conservation of WNHS an urgent task. This paper assesses where in the world threats are most pressing and which WNHS require emergency assistance. Using an analysis of "hot spots" and inverse distance weighting, it finds that Africa is the region where WNHS are least secure. Reports of the state of the conservation of WNHS describe the many threats that exist. Of these, management activities and institutional factors are the primary threats. The paper suggests relevant measures to improve the WNHS security.
Chae, Yooeun; Cui, Rongxue; Woong Kim, Shin; An, Gyeonghyeon; Jeong, Seung-Woo; An, Youn-Joo
2017-01-01
It is essential to remediate or amend soils contaminated with various heavy metals or pollutants so that the soils may be used again safely. Verifying that the remediated or amended soils meet soil quality standards is an important part of the process. We estimated the activity levels of eight soil exoenzymes (acid phosphatase, arylsulfatase, catalase, dehydrogenase, fluorescein diacetate hydrolase, protease, urease, and ß-glucosidase) in contaminated and remediated soils from two sites near a non-ferrous metal smelter, using colorimetric and titrimetric determination methods. Our results provided the levels of activity of soil exoenzymes that indicate soil health. Most enzymes showed lower activity levels in remediated soils than in contaminated soils, with the exception of protease and urease, which showed higher activity after remediation in some soils, perhaps due to the limited nutrients available in remediated soils. Soil exoenzymes showed significantly higher activity in soils from one of the sites than from the other, due to improper conditions at the second site, including high pH, poor nutrient levels, and a high proportion of sand in the latter soil. Principal component analysis revealed that ß-glucosidase was the best indicator of soil ecosystem health, among the enzymes evaluated. We recommend using ß-glucosidase enzyme activity as a prior indicator in estimating soil ecosystem health. Copyright © 2016 Elsevier Inc. All rights reserved.
Natural phenomena evaluations of the K-25 site UF{sub 6} cylinder storage yards
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fricke, K.E.
1996-09-15
The K-25 Site UF{sub 6} cylinder storage yards are used for the temporary storage of UF{sub 6} normal assay cylinders and long-term storage of other UF{sub 6} cylinders. The K-25 Site UF{sub 6} cylinder storage yards consist of six on-site areas: K-1066-B, K-1066-E, K-1066-F, K-1066-J, K-1066-K and K-1066-L. There are no permanent structures erected on the cylinder yards, except for five portable buildings. The operating contractor for the K-25 Site is preparing a Safety Analysis Report (SAR) to examine the safety related aspects of the K-25 Site UF{sub 6} cylinder storage yards. The SAR preparation encompasses many tasks terminating inmore » consequence analysis for the release of gaseous and liquid UF{sub 6}, one of which is the evaluation of natural phenomena threats, such as earthquakes, floods, and winds. In support of the SAR, the six active cylinder storage yards were evaluated for vulnerabilities to natural phenomena, earthquakes, high winds and tornados, tornado-generated missiles, floods (local and regional), and lightning. This report summarizes those studies. 30 refs.« less
Selective Enrichment and Direct Analysis of Protein S-Palmitoylation Sites.
Thinon, Emmanuelle; Fernandez, Joseph P; Molina, Henrik; Hang, Howard C
2018-05-04
S-Fatty-acylation is the covalent attachment of long chain fatty acids, predominately palmitate (C16:0, S-palmitoylation), to cysteine (Cys) residues via a thioester linkage on proteins. This post-translational and reversible lipid modification regulates protein function and localization in eukaryotes and is important in mammalian physiology and human diseases. While chemical labeling methods have improved the detection and enrichment of S-fatty-acylated proteins, mapping sites of modification and characterizing the endogenously attached fatty acids are still challenging. Here, we describe the integration and optimization of fatty acid chemical reporter labeling with hydroxylamine-mediated enrichment of S-fatty-acylated proteins and direct tagging of modified Cys residues to selectively map lipid modification sites. This afforded improved enrichment and direct identification of many protein S-fatty-acylation sites compared to previously described methods. Notably, we directly identified the S-fatty-acylation sites of IFITM3, an important interferon-stimulated inhibitor of virus entry, and we further demonstrated that the highly conserved Cys residues are primarily modified by palmitic acid. The methods described here should facilitate the direct analysis of protein S-fatty-acylation sites and their endogenously attached fatty acids in diverse cell types and activation states important for mammalian physiology and diseases.
Rational design and validation of a vanilloid-sensitive TRPV2 ion channel.
Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie
2016-06-28
Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S-S498F-L505T-Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular "glue" that bridges the S4-S5 linker to the S1-S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor.
In silico structural analysis of group 3, 6 and 9 allergens from Dermatophagoides farinae.
Teng, Feixiang; Yu, Lili; Bian, Yonghua; Sun, Jinxia; Wu, Juansong; Ling, Cunbao; Yang, Li; Wang, Yungang; Cui, Yubao
2015-05-01
Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) are the predominant source of dust mite allergens, which provoke allergic diseases, such as rhinitis, asthma and eczema. Of the 30 allergen groups produced by D. farinae, the Der f 3, Der f 6 and Der f 9 allergens are all trypsin‑associated proteins, however little else is currently known about them. The present study used in silico tools to compare the amino acid sequences, and predict the secondary and tertiary structures of Der f 3, Der f 6 and Der f 9 allergens. Protein sequence alignment detected ~46% identity between Der f 3, Der f 6 and Der f 9. Furthermore, each protein was shown to contain three active sites and two highly conserved trypsin functional domains. Predictions of the secondary and tertiary structure identified α‑helices, β‑sheets and random coils. The active sites of the three proteins appeared to fold onto each other in a three‑dimensional model, constituting the active site of the enzyme. Epitope analysis demonstrated that Der f 3, Der f 6 and Der f 9 have 4‑5 potential epitopes located in random coils, and the epitope sequences of Der f 3, Der f 6 and Der f 9 were shown to overlap in two domains (at amino acids 83‑87 and 179‑180); however the residues in these two domains were not identical. The present study aimed to conduct a biochemical and genetic analysis of these three allergens, and to potentially contribute to the development of vaccines for allergen‑specific immunotherapy.
Mapping Sites of O-Glycosylation and Fringe Elongation on Drosophila Notch*
Harvey, Beth M.; Rana, Nadia A.; Moss, Hillary; Leonardi, Jessica; Jafar-Nejad, Hamed; Haltiwanger, Robert S.
2016-01-01
Glycosylation of the Notch receptor is essential for its activity and serves as an important modulator of signaling. Three major forms of O-glycosylation are predicted to occur at consensus sites within the epidermal growth factor-like repeats in the extracellular domain of the receptor: O-fucosylation, O-glucosylation, and O-GlcNAcylation. We have performed comprehensive mass spectral analyses of these three types of O-glycosylation on Drosophila Notch produced in S2 cells and identified peptides containing all 22 predicted O-fucose sites, all 18 predicted O-glucose sites, and all 18 putative O-GlcNAc sites. Using semiquantitative mass spectral methods, we have evaluated the occupancy and relative amounts of glycans at each site. The majority of the O-fucose sites were modified to high stoichiometries. Upon expression of the β3-N-acetylglucosaminyltransferase Fringe with Notch, we observed varying degrees of elongation beyond O-fucose monosaccharide, indicating that Fringe preferentially modifies certain sites more than others. Rumi modified O-glucose sites to high stoichiometries, although elongation of the O-glucose was site-specific. Although the current putative consensus sequence for O-GlcNAcylation predicts 18 O-GlcNAc sites on Notch, we only observed apparent O-GlcNAc modification at five sites. In addition, we performed mass spectral analysis on endogenous Notch purified from Drosophila embryos and found that the glycosylation states were similar to those found on Notch from S2 cells. These data provide foundational information for future studies investigating the mechanisms of how O-glycosylation regulates Notch activity. PMID:27268051
Wang, J; Froeyen, M; Hendrix, C; Andrei, C; Snoeck, R; Lescrinier, E; De Clercq, E; Herdewijn, P
2001-01-01
(D)- and (L)-cyclohexeneyl-G were synthesized enantioselectively starting from (R)-carvone. Both show potent and selective anti-herpesvirus activity (HSV-1, HSV-2, VZV, CMV). Molecular modeling demonstrates that both isomers are bound in the active site of HSV-1 thymidine kinase in a high-energy conformation with the base moiety orienting in an equatorial position. It is believed that the flexibility of the cyclohexene ring is essential for their antiviral activity.
Communal space design as student interaction in polnep campus
NASA Astrophysics Data System (ADS)
Hasriyanti, N.; Zulestari, A.; Judhi, J.; Ikayanti, P.
2018-03-01
Communal space is a means to do for social interaction, from private to the public. The purpose of this study was conducted to explore the phenomenon of communal space setting of Pontianak State Polytechnic students from 8 departments of study both indoor and outdoor spaces. The research method used is a rationalistic study. The planned activities to be undertaken include the determination of communal places (indoor and outdoor), sample determination, data collection with surveys and interviews, presenting data and analysis and drawing conclusions as a basis for designing communal space for Polnep students. The research were analyzed of building and space character, analysis of space organization and circulation, space requirement analysis, material and color analysis, site analysis, and analysis of inner space elements and outer space elements. From the results of this study, it can be concluded that Polnep campus environment requires the addition of public space for students in conducting formal activities outside lectures. Some activity which to do some student such as activity to waiting lecturer, do some coursework, discussion, relaxation, extracurricular activities, and other informal activities still require adequate space infrastructure and are equipped with street furnitures such as garden lights, benches, outer space markers and shade vegetation.
Kim, J. Dongun; Senn, Stefan; Harel, Arye; Jelen, Benjamin I.; Falkowski, Paul G.
2013-01-01
Oxidoreductases play a central role in catalysing enzymatic electron-transfer reactions across the tree of life. To first order, the equilibrium thermodynamic properties of these proteins are governed by protein folds associated with specific transition metals and ligands at the active site. A global analysis of holoenzyme structures and functions suggests that there are fewer than approximately 500 fundamental oxidoreductases, which can be further clustered into 35 unique groups. These catalysts evolved in prokaryotes early in the Earth's history and are largely responsible for the emergence of non-equilibrium biogeochemical cycles on the planet's surface. Although the evolutionary history of the amino acid sequences in the oxidoreductases is very difficult to reconstruct due to gene duplication and horizontal gene transfer, the evolution of the folds in the catalytic sites can potentially be used to infer the history of these enzymes. Using a novel, yet simple analysis of the secondary structures associated with the ligands in oxidoreductases, we developed a structural phylogeny of these enzymes. The results of this ‘composome’ analysis suggest an early split from a basal set of a small group of proteins dominated by loop structures into two families of oxidoreductases, one dominated by α-helices and the second by β-sheets. The structural evolutionary patterns in both clades trace redox gradients and increased hydrogen bond energy in the active sites. The overall pattern suggests that the evolution of the oxidoreductases led to decreased entropy in the transition metal folds over approximately 2.5 billion years, allowing the enzymes to use increasingly oxidized substrates with high specificity. PMID:23754810
Schmitt, Christopher J.
2002-01-01
We collected, examined, and analyzed 1378 fish of 22 species from 47 sites in the Mississippi River basin (MRB) during 1995 and from a reference site in 1996. The sampling sites in the MRB represented National Contaminant Biomonitoring Program (NCBP) stations situated at key points on major rivers and National Water- Quality Assessment Program (NAWQA) stations located on lower-order rivers and streams in the Eastern Iowa Basins (EIB) and Mississippi Embayment (MSE) Study Units. The reference site was the water supply system of the USGS-Leetown Science Center in rural Jefferson County, WV. Common carp (Cyprinus carpio; carp) and black basses (Micropterus spp.; bass), the targeted species, together represented 82% of the fish collected. Each fish was examined in the field for externally and internally visible gross lesions, selected organs were weighed to compute various ponderal and organo-somatic indices, and selected tissues and fluids were obtained and preserved for analysis of biomarkers. Fish health indicators included splenic macrophage aggregates, lysozyme activity, and hispathological analysis of liver, kidney, and other tissues. Reproductive biomarkers included analysis of plasma concentrations of vitellogenin (vtg) and the sex steroid hormones 17-estradiol (E2) and 11-ketotestosterone (11- kt); and the histological determination of percent oocyte atresia (in female fish) and gonadal stage. Hepatic ethoxyresorufin O-deethylase (EROD) activity was also measured. Composite samples of whole fish from each station were grouped by species and gender and analyzed for persistent organochlorine and elemental contaminants and for dioxin-like activity (TCDD-EQ) using the H4IIE rat hepatoma cell bioassay. Organochlorine and inorganic contaminant concentrations in fish were generally low relative to historical levels at most sites, but remained present at concentrations representing threats to piscivorous wildlife in some locations. Toxaphene and DDT (mostly as p,p?-DDE) concentrations remained elevated in fish from the cottongrowing regions of the lower Mississippi valley, and were generally greater in the smaller streams draining agricultural areas (that is, in the MSE Study Unit) than at large river sites. Cyclodiene pesticide concentrations were also greatest in the EIB Study Unit and elsewhere in the corn-growing regions of the mid-MRB. Former point-sources of organochlorine pesticides also remained evident, especially in the Mississippi River near Memphis, TN. Consistent with previous findings, total PCB concentrations tended to be greatest (1-3 g/g) in the industrialized and urbanized Ohio River and Upper Mississippi sub-basins and at Memphis, TN, and were generally correlated with TCDD-EQ and EROD activity. Conversely, PCB concentrations were low (0.3 g/g) in bass from the Mississippi River at Memphis and several other sites and in carp from one MSE site. Concentrations of Se were also great enough to constitute a hazard to piscivorous wildlife (>0.6 g/g) at several MRB sites in the western parts of the MRB and were especially high (4-5 g/g) in fish from John Martin Reservoir, CO, where elevated concentrations were reported previously. Biomarker results indicated that fish from many stations had been exposed to contaminants, but at no sites did findings indicate exposure to high concentrations of toxic chemicals. Noteworthy among biomarker findings was that 73% of the male smallmouth bass (Micropterus dolomieui) from the Mississippi River at Lake City, MN (Lake Pepin) were intersex as indicated by the histological detection of ovotestes; and the combined EROD and H4IIE results indicated that fish from several rural sites in the
Davis, David A; Naiman, Nicole E; Wang, Victoria; Shrestha, Prabha; Haque, Muzammel; Hu, Duosha; Anagho, Holda A; Carey, Robert F; Davidoff, Katharine S; Yarchoan, Robert
2015-07-01
Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus-8, is the causative agent of three hyperproliferative disorders: Kaposi's sarcoma, primary effusion lymphoma (PEL) and multicentric Castleman's disease. During viral latency a small subset of viral genes are produced, including KSHV latency-associated nuclear antigen (LANA), which help the virus thwart cellular defense responses. We found that exposure of KSHV-infected cells to oxidative stress, or other inducers of apoptosis and caspase activation, led to processing of LANA and that this processing could be inhibited with the pan-caspase inhibitor Z-VAD-FMK. Using sequence, peptide, and mutational analysis, two caspase cleavage sites within LANA were identified: a site for caspase-3 type caspases at the N-terminus and a site for caspase-1 and-3 type caspases at the C-terminus. Using LANA expression plasmids, we demonstrated that mutation of these cleavage sites prevents caspase-1 and caspase-3 processing of LANA. This indicates that these are the principal sites that are susceptible to caspase cleavage. Using peptides spanning the identified LANA cleavage sites, we show that caspase activity can be inhibited in vitro and that a cell-permeable peptide spanning the C-terminal cleavage site could inhibit cleavage of poly (ADP-ribose) polymerase and increase viability in cells undergoing etoposide-induced apoptosis. The C-terminal peptide of LANA also inhibited interleukin-1 beta (IL-1β) production from lipopolysaccharide-treated THP-1 cells by more than 50%. Furthermore, mutation of the two cleavage sites in LANA led to a significant increase in IL-1β production in transfected THP-1 cells; this provides evidence that these sites function to blunt the inflammasome, which is known to be activated in latently infected PEL cells. These results suggest that specific caspase cleavage sites in KSHV LANA function to blunt apoptosis as well as interfere with the caspase-1-mediated inflammasome, thus thwarting key cellular defense mechanisms.
Unusual features of a recombinant apple alpha-farnesene synthase.
Green, Sol; Friel, Ellen N; Matich, Adam; Beuning, Lesley L; Cooney, Janine M; Rowan, Daryl D; MacRae, Elspeth
2007-01-01
A recombinant alpha-farnesene synthase from apple (Malus x domestica), expressed in Escherichia coli, showed features not previously reported. Activity was enhanced 5-fold by K(+) and all four isomers of alpha-farnesene, as well as beta-farnesene, were produced from an isomeric mixture of farnesyl diphosphate (FDP). Monoterpenes, linalool, (Z)- and (E)-beta-ocimene and beta-myrcene, were synthesised from geranyl diphosphate (GDP), but at 18% of the optimised rate for alpha-farnesene synthesis from FDP. Addition of K(+) reduced monoterpene synthase activity. The enzyme also produced alpha-farnesene by a reaction involving coupling of GDP and isoprenyl diphosphate but at <1% of the rate with FDP. Mutagenesis of active site aspartate residues removed sesquiterpene, monoterpene and prenyltransferase activities suggesting catalysis through the same active site. Phylogenetic analysis clusters this enzyme with isoprene synthases rather than with other sesquiterpene synthases, suggesting that it has evolved differently from other plant sesquiterpene synthases. This is the first demonstration of a sesquiterpene synthase possessing prenyltransferase activity.
The ammonium sulfate inhibition of human angiogenin.
Chatzileontiadou, Demetra S M; Tsirkone, Vicky G; Dossi, Kyriaki; Kassouni, Aikaterini G; Liggri, Panagiota G V; Kantsadi, Anastassia L; Stravodimos, George A; Balatsos, Nikolaos A A; Skamnaki, Vassiliki T; Leonidas, Demetres D
2016-09-01
In this study, we investigate the inhibition of human angiogenin by ammonium sulfate. The inhibitory potency of ammonium sulfate for human angiogenin (IC50 = 123.5 ± 14.9 mm) is comparable to that previously reported for RNase A (119.0 ± 6.5 mm) and RNase 2 (95.7 ± 9.3 mm). However, analysis of two X-ray crystal structures of human angiogenin in complex with sulfate anions (in acidic and basic pH environments, respectively) indicates an entirely distinct mechanism of inhibition. While ammonium sulfate inhibits the ribonucleolytic activity of RNase A and RNase 2 by binding to the active site of these enzymes, sulfate anions bind only to peripheral substrate anion-binding subsites of human angiogenin, and not to the active site. © 2016 Federation of European Biochemical Societies.
Iannelli, Renato; Bianchi, Veronica; Macci, Cristina; Peruzzi, Eleonora; Chiellini, Carolina; Petroni, Giulio; Masciandaro, Grazia
2012-06-01
The main objective of this study was to assess the impact of pollution on seabed bacterial diversity, structure and activity in the Port of Livorno. Samples of seabed sediments taken from five selected sites within the port were subjected to chemical analyses, enzymatic activity detection, bacterial count and biomolecular analysis. Five different statistics were used to correlate the level of contamination with the detected biological indicators. The results showed that the port is mainly contaminated by variable levels of petroleum hydrocarbons and heavy metals, which affect the structure and activity of the bacterial population. Irrespective of pollution levels, the bacterial diversity did not diverge significantly among the assessed sites and samples, and no dominance was observed. The type of impact of hydrocarbons and heavy metals was controversial, thus enforcing the supposition that the structure of the bacterial community is mainly driven by the levels of nutrients. The combined use of chemical and biological essays resulted in an in-depth observation and analysis of the existing links between pollution macro-indicators and biological response of seabed bacterial communities. Copyright © 2012 Elsevier B.V. All rights reserved.
ANALYSIS OF GEOTHERMAL WASTES FOR HAZARDOUS COMPONENTS
Regulations governing the disposal of hazardous wastes led to an assessment for geothermal solid wastes for potentially hazardous properties. Samples were collected from three active geothermal sites in the western United States: The Geysers, Imperial Valley, and northwestern Nev...
Estimation of empirical site amplification factors in Taiwan
NASA Astrophysics Data System (ADS)
Chung, Chi-Hsuan; Wen, Kuo-Liang; Kuo, Chun-Hsiang
2017-04-01
Lots of infrastructures are under construction in metropolises in Taiwan in recent years and thus leads to increasement of population density and urbanization in those area. Taiwan island is located in plate boundaries in which the high seismicity is caused by active tectonic plates. The Chi-Chi earthquake (Mw 7.6) in 1999 caused a fatality of more than 2000, and the Meinong earthquake (Mw 6.5) in 2016 caused a fatality of 117 in Tainan city as well as damages on hundreds of buildings. The cases imply seismic vulnerability of urban area. During the improvements for seismic hazard analysis and seismic design, consideration of seismic site amplifications in different site conditions is one of important issues. This study used selected and processed strong motion records observed by the TSMIP network. The site conditions considered as Vs30 used in this study were investigated at most stations (Kuo et al. 2012; Kuo et al. 2016). Since strong motion records and site conditions are both available, we are able to use the data to analyze site amplifications of seismic waves at different periods. The result may be a reference for future modification of seismic design codes to decrease potential seismic hazards and losses. We adopted the strong motion and site database of the SSHAC (Senior Seismic Hazard Analysis Committee) Level 3 project in Taiwan. The selected significant crustal and subduction events of magnitude larger than six for analysis. The amplification factors of PGA, PGV, PGD, and spectra acceleration at 0.3, 1.0, and 3.0 seconds were evaluated using the processed strong motions. According to the recommendation of SSHAC Level 3 project, the site condition of Vs30 = 760 m/s is considered as the reference rock site in this study. The stations with Vs30 between 600 m/s and 900 m/s and used as the reference rock sites in reality. For each event, we find a reference rock site and other site within a certain distance (region dependent) to calculate site amplifications of ground motions. Relationships of site amplification factors and Vs30 are therefore derived for strong motions by regression analysis. Soil nonlinearity (decrease of amplifications) has to be considered at soft soil sites during a strong shaking. We also discuss amplification factors in terms of different intensities if data is available.