A Single Base Difference between Pit-1 Binding Sites at the hGH Promoter and Locus Control Region Specifies Distinct Pit-1 Conformations and Functions

PubMed Central

Shewchuk, Brian M.; Ho, Yugong; Liebhaber, Stephen A.; Cooke, Nancy E.

2006-01-01

Activation of the human growth hormone (hGH-N) gene in pituitary somatotropes is mediated by a locus control region (LCR). This LCR is composed of DNase I-hypersensitive sites (HS) located −14.5 kb to −32 kb relative to the hGH-N promoter. HSI, at −14.5 kb, is the dominant determinant of hGH-N expression and is essential for establishment of a 32-kb domain of histone acetylation that encompasses the active hGH locus. This activity is conferred by three binding sites for the POU domain transcription factor Pit-1. These Pit-1 elements are sufficient to activate hGH-N expression in the mouse pituitary. In contrast, Pit-1 sites at the hGH-N promoter are consistently unable to mediate similar activity. In the present study, we demonstrate that the functional difference between the promoter-proximal and the HSI Pit-1 binding sites can be attributed in part to a single base difference. This base affects the conformation of the Pit-1/DNA complex, and reciprocal exchange of the divergent bases between the two sets of Pit-1 elements results in a partial reversal of their transgenic activities. These data support a model in which the Pit-1 binding sites in the hGH LCR allosterically program the bound Pit-1 complex for chromatin activating functions. PMID:16914737

Fragment-based identification of determinants of conformational and spectroscopic change at the ricin active site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carra,J.; McHugh, C.; Mulligan, S.

2007-01-01

We found that amide ligands can bind weakly but specifically to the ricin active site, producing significant shifts in positions of the critical active site residues Arg180 and Tyr80. These results indicate that fragment-based drug discovery methods are capable of identifying minimal bonding determinants of active-site side-chain rearrangements and the mechanistic origins of spectroscopic shifts. Our results suggest that tryptophan fluorescence provides a sensitive probe for the geometric relationship of arginine-tryptophan pairs, which often have significant roles in protein function. Using the unusual characteristics of the RTA system, we measured the still controversial thermodynamic changes of site-specific urea binding tomore » a protein, results that are relevant to understanding the physical mechanisms of protein denaturation.« less

Spectroscopic insights into the nature of active sites in iron–nitrogen–carbon electrocatalysts for oxygen reduction in acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jia, Qingying; Ramaswamy, Nagappan; Tylus, Urszula

Developing efficient and inexpensive catalysts for the sluggish oxygen reduction reaction (ORR) constitutes one of the grand challenges in the fabrication of commercially viable fuel cell devices and metal–air batteries for future energy applications. Despite recent achievements in designing advanced Pt-based and Pt-free catalysts, current progress primarily involves an empirical approach of trial-and-error combination of precursors and synthesis conditions, which limits further progress. Rational design of catalyst materials requires proper understanding of the mechanistic origin of the ORR and the underlying surface properties under operating conditions that govern catalytic activity. Herein, several different groups of iron-based catalysts synthesized via differentmore » methods and/or precursors were systematically studied by combining multiple spectroscopic techniques under ex situ and in situ conditions in an effort to obtain a comprehensive understanding of the synthesis-products correlations, nature of active sites, and the reaction mechanisms. These catalysts include original macrocycles, macrocycle-pyrolyzed catalysts, and Fe-N–C catalysts synthesized from individual Fe, N, and C precursors including polymer-based catalysts, metal organic framework (MOF)-based catalysts, and sacrificial support method (SSM)-based catalysts. The latter group of catalysts is most promising as not only they exhibit exceptional ORR activity and/or durability, but also the final products are controllable. We show that the high activity observed for most pyrolyzed Fe-based catalysts can mainly be attributed to a single active site: non-planar Fe–N 4 moiety embedded in distorted carbon matrix characterized by a high potential for the Fe 2+/3+ redox transition in acidic electrolyte/environment. The high intrinsic ORR activity, or turnover frequency (TOF), of this site is shown to be accounted for by redox catalysis mechanism that highlights the dominant role of the site-blocking effect. Moreover, a highly active MOF-based catalyst without Fe–N moieties was developed, and the active sites were identified as nitrogen-doped carbon fibers with embedded iron particles that are not directly involved in the oxygen reduction pathway. The high ORR activity and durability of catalysts involving this second site, as demonstrated in fuel cell, are attributed to the high density of active sites and the elimination or reduction of Fenton-type processes. The latter are initiated by hydrogen peroxide but are known to be accelerated by iron ions exposed to the surface, resulting in the formation of damaging free-radicals.« less

Discriminative structural approaches for enzyme active-site prediction.

PubMed

Kato, Tsuyoshi; Nagano, Nozomi

2011-02-15

Predicting enzyme active-sites in proteins is an important issue not only for protein sciences but also for a variety of practical applications such as drug design. Because enzyme reaction mechanisms are based on the local structures of enzyme active-sites, various template-based methods that compare local structures in proteins have been developed to date. In comparing such local sites, a simple measurement, RMSD, has been used so far. This paper introduces new machine learning algorithms that refine the similarity/deviation for comparison of local structures. The similarity/deviation is applied to two types of applications, single template analysis and multiple template analysis. In the single template analysis, a single template is used as a query to search proteins for active sites, whereas a protein structure is examined as a query to discover the possible active-sites using a set of templates in the multiple template analysis. This paper experimentally illustrates that the machine learning algorithms effectively improve the similarity/deviation measurements for both the analyses.

A hybrid QM/MM simulation study of intramolecular proton transfer in the pyridoxal 5'-phosphate in the active site of transaminase: influence of active site interaction on proton transfer.

PubMed

Dutta Banik, Sindrila; Chandra, Amalendu

2014-09-25

Pyridoxal 5'-phosphate (PLP) Schiff base, a versatile cofactor, exhibits a tautomeric equilibrium that involves an intramolecular proton transfer between the N-protonated zwitterionic ketoenamine tautomer and the O-protonated covalent enolimine tautomer. It has been postulated that for the catalytic activity, the PLP has to be in the zwitterionic ketoenamine tautomeric form. However, the exact position of the tautomeric equilibrium of Schiff base in the active site of PLP-dependent enzyme is not known yet. In the present work, we investigated the tautomeric equilibrium for the external aldimine state of PLP aspartate (PLP-Asp) Schiff base in the active site of aspartate aminotransferase (AspAT) using combined quantum mechanical and molecular mechanical simulations. The main focus of the present study is to analyze the factors that control the tautomeric equilibrium in the active sites of various PLP-dependent enzymes. The results show that the ketoenamine tautomer is more preferred than the enolimine tautomer both in the gas and aqueous phases as well as in the active site of AspAT. Current simulations show that the active site of AspAT is more suitable for the ketoenamine tautomer compared to the enolimine tautomer. Interestingly, the Tyr225 acts as a proton donor to the phenolic oxygen in the ketoenamine tautomer, while in the covalent enolimine tautomer, it acts as a proton acceptor to the phenolic oxygen. Finally, the metadynamics study confirms this result. The calculated free energy barrier is about 7.5 kcal/mol. A comparative analysis of the microenvironment created by the active site residues of three different PLP-dependent enzymes (aspartate aminotransferase, Dopa decarboxylase, and Ala-racemase) has been carried out to understand the controlling factor(s) of the tautomeric equilibrium. The analysis shows that the intermolecular hydrogen bonding between active site residues and the phenolic oxygen of PLP shifts the tautomeric equilibrium toward the N-protonated ketoenamine tautomeric form.

Nicotinamide Cofactors Suppress Active-Site Labeling of Aldehyde Dehydrogenases.

PubMed

Stiti, Naim; Chandrasekar, Balakumaran; Strubl, Laura; Mohammed, Shabaz; Bartels, Dorothea; van der Hoorn, Renier A L

2016-06-17

Active site labeling by (re)activity-based probes is a powerful chemical proteomic tool to globally map active sites in native proteomes without using substrates. Active site labeling is usually taken as a readout for the active state of the enzyme because labeling reflects the availability and reactivity of active sites, which are hallmarks for enzyme activities. Here, we show that this relationship holds tightly, but we also reveal an important exception to this rule. Labeling of Arabidopsis ALDH3H1 with a chloroacetamide probe occurs at the catalytic Cys, and labeling is suppressed upon nitrosylation and oxidation, and upon treatment with other Cys modifiers. These experiments display a consistent and strong correlation between active site labeling and enzymatic activity. Surprisingly, however, labeling is suppressed by the cofactor NAD(+), and this property is shared with other members of the ALDH superfamily and also detected for unrelated GAPDH enzymes with an unrelated hydantoin-based probe in crude extracts of plant cell cultures. Suppression requires cofactor binding to its binding pocket. Labeling is also suppressed by ALDH modulators that bind at the substrate entrance tunnel, confirming that labeling occurs through the substrate-binding cavity. Our data indicate that cofactor binding adjusts the catalytic Cys into a conformation that reduces the reactivity toward chloroacetamide probes.

Spatially-Explicit Assessments of Genetic Biodiversity and Dispersal in Gopher Tortoises for Evaluation of Habitat Fragmentation at DoD Sites

DTIC Science & Technology

2008-10-01

tortoise refuge on Camp Shelby). The markers showed that the no military activity sites they are closer to the high- impact sites than they are to...19 km south of Hattiesburg. The facility contains a 15 km2 “ impact area” used for artillery training activities. Activity within this area includes...However, these sites are more closely related to the impacted sites (based upon patterns of clustering) than that are to each other. This suggests

Relocating the Active-Site Lysine in Rhodopsin: 2. Evolutionary Intermediates.

PubMed

Devine, Erin L; Theobald, Douglas L; Oprian, Daniel D

2016-08-30

The visual pigment rhodopsin is a G protein-coupled receptor that covalently binds its retinal chromophore via a Schiff base linkage to an active-site Lys residue in the seventh transmembrane helix. Although this residue is strictly conserved among all type II retinylidene proteins, we found previously that the active-site Lys in bovine rhodopsin (Lys296) can be moved to three other locations (G90K, T94K, S186K) while retaining the ability to form a pigment with retinal and to activate transducin in a light-dependent manner [ Devine et al. ( 2013 ) Proc. Natl. Acad. Sci. USA 110 , 13351 - 13355 ]. Because the active-site Lys is not functionally constrained to be in helix seven, it is possible that it could relocate within the protein, most likely via an evolutionary intermediate with two active-site Lys. Therefore, in this study we characterized potential evolutionary intermediates with two Lys in the active site. Four mutant rhodopsins were prepared in which the original Lys296 was left untouched and a second Lys residue was substituted for G90K, T94K, S186K, or F293K. All four constructs covalently bind 11-cis-retinal, form a pigment, and activate transducin in a light-dependent manner. These results demonstrate that rhodopsin can tolerate a second Lys in the retinal binding pocket and suggest that an evolutionary intermediate with two Lys could allow migration of the Schiff base Lys to a position other than the observed, highly conserved location in the seventh TM helix. From sequence-based searches, we identified two groups of natural opsins, insect UV cones and neuropsins, that contain Lys residues at two positions in their active sites and also have intriguing spectral similarities to the mutant rhodopsins studied here.

Dithiolato-bridged nickel-iron complexes as models for the active site of [NiFe]-hydrogenases.

PubMed

Song, Li-Cheng; Yang, Xi-Yue; Cao, Meng; Gao, Xiu-Yun; Liu, Bei-Bei; Zhu, Liang; Jiang, Feng

2017-03-30

The structural and functional modeling of the active site of [NiFe]-hydrogenases has been proved to be challenging to a great extent. Herein, we report the synthesis, structures, and some properties of the NiFe-based dicarbonyl, terminal hydride, and μ-hydroxo models for the active site of [NiFe]-hydrogenases.

Characterization of Missouri surface waters near point sources of pollution reveals potential novel atmospheric route of exposure for bisphenol A and wastewater hormonal activity pattern.

PubMed

Kassotis, Christopher D; Alvarez, David A; Taylor, Julia A; vom Saal, Frederick S; Nagel, Susan C; Tillitt, Donald E

2015-08-15

Surface water contamination by chemical pollutants increasingly threatens water quality around the world. Among the many contaminants found in surface water, there is growing concern regarding endocrine disrupting chemicals, based on their ability to interfere with some aspect of hormone action in exposed organisms, including humans. This study assessed water quality at several sites across Missouri (near wastewater treatment plants and airborne release sites of bisphenol A) based on hormone receptor activation potencies and chemical concentrations present in the surface water. We hypothesized that bisphenol A and ethinylestradiol would be greater in water near permitted airborne release sites and wastewater treatment plant inputs, respectively, and that these two compounds would be responsible for the majority of activities in receptor-based assays conducted with water collected near these sites. Concentrations of bisphenol A and ethinylestradiol were compared to observed receptor activities using authentic standards to assess contribution to total activities, and quantitation of a comprehensive set of wastewater compounds was performed to better characterize each site. Bisphenol A concentrations were found to be elevated in surface water near permitted airborne release sites, raising questions that airborne releases of BPA may influence nearby surface water contamination and may represent a previously underestimated source to the environment and potential for human exposure. Estrogen and androgen receptor activities of surface water samples were predictive of wastewater input, although the lower sensitivity of the ethinylestradiol ELISA relative to the very high sensitivity of the bioassay approaches did not allow a direct comparison. Wastewater-influenced sites also had elevated anti-estrogenic and anti-androgenic equivalence, while sites without wastewater discharges exhibited no antagonist activities. Published by Elsevier B.V.

Characterization of Missouri surface waters near point sources of pollution reveals potential novel atmospheric route of exposure for bisphenol A and wastewater hormonal activity pattern

USGS Publications Warehouse

Kassotis, Christopher D.; Alvarez, David A.; Taylor, Julia A.; vom Saal, Frederick S.; Nagel, Susan C.; Tillitt, Donald E.

2015-01-01

Surface water contamination by chemical pollutants increasingly threatens water quality around the world. Among the many contaminants found in surface water, there is growing concern regarding endocrine disrupting chemicals, based on their ability to interfere with some aspect of hormone action in exposed organisms, including humans. This study assessed water quality at several sites across Missouri (near wastewater treatment plants and airborne release sites of bisphenol A) based on hormone receptor activation potencies and chemical concentrationspresent in the surface water. We hypothesized that bisphenol A and ethinylestradiol would be greater in water near permitted airborne release sites and wastewater treatment plant inputs, respectively, and that these two compounds would be responsible for the majority of activities in receptor-based assays conducted with water collected near these sites. Concentrations of bisphenol A and ethinylestradiol were compared to observed receptor activities using authentic standards to assess contribution to total activities, and quantitation of a comprehensive set of wastewater compounds was performed to better characterize each site. Bisphenol A concentrations were found to be elevated in surface water near permitted airborne release sites, raising questions that airborne releases of BPA may influence nearby surface water contamination and may represent a previously underestimated source to the environment and potential for human exposure. Estrogen and androgen receptor activities of surface water samples were predictive of wastewater input, although the lower sensitivity of the ethinylestradiol ELISA relative to the very high sensitivity of the bioassay approaches did not allow a direct comparison. Wastewater-influenced sites also had elevated anti-estrogenic and anti-androgenic equivalence, while sites without wastewater discharges exhibited no antagonist activities.

Diffusional correlations among multiple active sites in a single enzyme.

PubMed

Echeverria, Carlos; Kapral, Raymond

2014-04-07

Simulations of the enzymatic dynamics of a model enzyme containing multiple substrate binding sites indicate the existence of diffusional correlations in the chemical reactivity of the active sites. A coarse-grain, particle-based, mesoscopic description of the system, comprising the enzyme, the substrate, the product and solvent, is constructed to study these effects. The reactive and non-reactive dynamics is followed using a hybrid scheme that combines molecular dynamics for the enzyme, substrate and product molecules with multiparticle collision dynamics for the solvent. It is found that the reactivity of an individual active site in the multiple-active-site enzyme is reduced substantially, and this effect is analyzed and attributed to diffusive competition for the substrate among the different active sites in the enzyme.

Heterogeneous Electrocatalyst with Molecular Cobalt Ions Serving as the Center of Active Sites.

PubMed

Wang, Jiong; Ge, Xiaoming; Liu, Zhaolin; Thia, Larissa; Yan, Ya; Xiao, Wei; Wang, Xin

2017-02-08

Molecular Co 2+ ions were grafted onto doped graphene in a coordination environment, resulting in the formation of molecularly well-defined, highly active electrocatalytic sites at a heterogeneous interface for the oxygen evolution reaction (OER). The S dopants of graphene are suggested to be one of the binding sites and to be responsible for improving the intrinsic activity of the Co sites. The turnover frequency of such Co sites is greater than that of many Co-based nanostructures and IrO 2 catalysts. Through a series of carefully designed experiments, the pathway for the evolution of the Co cation-based molecular catalyst for the OER was further demonstrated on such a single Co-ion site for the first time. The Co 2+ ions were successively oxidized to Co 3+ and Co 4+ states prior to the OER. The sequential oxidation was coupled with the transfer of different numbers of protons/hydroxides and generated an active Co 4+ ═O fragment. A side-on hydroperoxo ligand of the Co 4+ site is proposed as a key intermediate for the formation of dioxygen.

NHS-Esters As Versatile Reactivity-Based Probes for Mapping Proteome-Wide Ligandable Hotspots.

PubMed

Ward, Carl C; Kleinman, Jordan I; Nomura, Daniel K

2017-06-16

Most of the proteome is considered undruggable, oftentimes hindering translational efforts for drug discovery. Identifying previously unknown druggable hotspots in proteins would enable strategies for pharmacologically interrogating these sites with small molecules. Activity-based protein profiling (ABPP) has arisen as a powerful chemoproteomic strategy that uses reactivity-based chemical probes to map reactive, functional, and ligandable hotspots in complex proteomes, which has enabled inhibitor discovery against various therapeutic protein targets. Here, we report an alkyne-functionalized N-hydroxysuccinimide-ester (NHS-ester) as a versatile reactivity-based probe for mapping the reactivity of a wide range of nucleophilic ligandable hotspots, including lysines, serines, threonines, and tyrosines, encompassing active sites, allosteric sites, post-translational modification sites, protein interaction sites, and previously uncharacterized potential binding sites. Surprisingly, we also show that fragment-based NHS-ester ligands can be made to confer selectivity for specific lysine hotspots on specific targets including Dpyd, Aldh2, and Gstt1. We thus put forth NHS-esters as promising reactivity-based probes and chemical scaffolds for covalent ligand discovery.

Cyanide does more to inhibit heme enzymes, than merely serving as an active-site ligand

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parashar, Abhinav; Venkatachalam, Avanthika; Gideon, Daniel Andrew

Highlights: • Cyanide (CN) is a well-studied toxic principle, known to inhibit heme-enzymes. • Inhibition is supposed to result from CN binding at the active site as a ligand. • Diverse heme enzymes’ CN inhibition profiles challenge prevailing mechanism. • Poor binding efficiency of CN at low enzyme concentrations and ligand pressures. • CN-based diffusible radicals cause ‘non-productive electron transfers’ (inhibition). - Abstract: The toxicity of cyanide is hitherto attributed to its ability to bind to heme proteins’ active site and thereby inhibit their activity. It is shown herein that the long-held interpretation is inadequate to explain several observations inmore » heme-enzyme reaction systems. Generation of cyanide-based diffusible radicals in heme-enzyme reaction milieu could shunt electron transfers (by non-active site processes), and thus be detrimental to the efficiency of oxidative outcomes.« less

Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors

PubMed Central

Monse, Hella; Laufs, Stephanie; Kuate, Seraphin; Zeller, W. Jens; Fruehauf, Stefan; Überla, Klaus

2006-01-01

Preferential integration into transcriptionally active regions of genomes has been observed for retroviral vectors based on gamma-retroviruses and lentiviruses. However, differences in the integration site preferences were detected, which might be explained by differences in viral components of the preintegration complexes. Viral determinants of integration site preferences have not been defined. Therefore, integration sites of simian immunodeficiency virus (SIV)-based vectors produced in the absence of accessory genes or lacking promoter and enhancer elements were compared. Similar integration patterns for the different SIV vectors indicate that vif, vpr, vpx, nef, env, and promoter or enhancer elements are not required for preferential integration of SIV into transcriptionally active regions of genomes. PMID:16873270

Discovery of d-amino acid oxidase inhibitors based on virtual screening against the lid-open enzyme conformation.

PubMed

Szilágyi, Bence; Skok, Žiga; Rácz, Anita; Frlan, Rok; Ferenczy, György G; Ilaš, Janez; Keserű, György M

2018-06-01

d-Amino acid oxidase (DAAO) inhibitors are typically small polar compounds with often suboptimal pharmacokinetic properties. Features of the native binding site limit the operational freedom of further medicinal chemistry efforts. We therefore initiated a structure based virtual screening campaign based on the X-ray structures of DAAO complexes where larger ligands shifted the loop (lid opening) covering the native binding site. The virtual screening of our in-house collection followed by the in vitro test of the best ranked compounds led to the identification of a new scaffold with micromolar IC 50 . Subsequent SAR explorations enabled us to identify submicromolar inhibitors. Docking studies supported by in vitro activity measurements suggest that compounds bind to the active site with a salt-bridge characteristic to DAAO inhibitor binding. In addition, displacement of and interaction with the loop covering the active site contributes significantly to the activity of the most potent compounds. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effectiveness of off-line and web-based promotion of health information web sites.

PubMed

Jones, Craig E; Pinnock, Carole B

2002-01-01

The relative effectiveness of off-line and web-based promotional activities in increasing the use of health information web sites by target audiences were compared. Visitor sessions were classified according to their method of arrival at the site (referral) as external web site, search engine, or "no referrer" (i.e., visitor arriving at the site by inputting URL or using bookmarks). The number of Australian visitor sessions correlated with no referrer referrals but not web site or search-engine referrals. Results showed that the targeted consumer group is more likely to access the web site as a result of off-line promotional activities. The properties of target audiences likely to influence the effectiveness of off-line versus on-line promotional strategies include the size of the Internet using population of the target audience, their proficiency in the use of the Internet, and the increase in effectiveness of off-line promotional activities when applied to locally defined target audiences.

Skinfold thickness at 8 common cryotherapy sites in various athletic populations.

PubMed

Jutte, Lisa S; Hawkins, Jeremy; Miller, Kevin C; Long, Blaine C; Knight, Kenneth L

2012-01-01

Researchers have observed slower cooling rates in thigh muscle with greater overlying adipose tissue, suggesting that cryotherapy duration should be based on the adipose thickness of the treatment site. Skinfold data do not exist for other common cryotherapy sites, and no one has reported how those skinfolds might vary because of physical activity level or sex. To determine the variability in skinfold thickness among common cryotherapy sites relative to sex and activity level (National Collegiate Athletic Association Division I athletes, recreationally active college athletes). Descriptive laboratory study. Field. Three hundred eighty-nine college students participated; 196 Division I athletes (157 men, 39 women) were recruited during preseason physicals, and 193 recreationally active college athletes (108 men, 85 women) were recruited from physical education classes. Three skinfold measurements to within 1 mm were taken at 8 sites (inferior angle of the scapula, middle deltoid, ulnar groove, midforearm, midthigh, medial collateral ligament, midcalf, and anterior talofibular ligament [ATF]) using Lange skinfold calipers. Skinfold thickness in millimeters. We noted interactions among sex, activity level, and skinfold site. Male athletes had smaller skinfold measurements than female athletes at all sites except the ATF, scapula, and ulnar groove (F₇,₂₇₀₂ = 69.85, P < .001). Skinfold measurements were greater for recreationally active athletes than their Division I counterparts at all sites except the ATF, deltoid, and ulnar groove (F₇,₂₇₀₂ = 30.79, P < .001). Thigh skinfold measurements of recreationally active female athletes were the largest, and their ATF skinfolds were the smallest. Skinfold thickness at common cryotherapy treatment sites varied based on level of physical activity and sex. Therefore, clinicians should measure skinfold thickness to determine an appropriate cryotherapy duration.

Skinfold Thickness at 8 Common Cryotherapy Sites in Various Athletic Populations

PubMed Central

Jutte, Lisa S.; Hawkins, Jeremy; Miller, Kevin C.; Long, Blaine C.; Knight, Kenneth L.

2012-01-01

Context: Researchers have observed slower cooling rates in thigh muscle with greater overlying adipose tissue, suggesting that cryotherapy duration should be based on the adipose thickness of the treatment site. Skinfold data do not exist for other common cryotherapy sites, and no one has reported how those skinfolds might vary because of physical activity level or sex. Objective: To determine the variability in skinfold thickness among common cryotherapy sites relative to sex and activity level (National Collegiate Athletic Association Division I athletes, recreationally active college athletes). Design: Descriptive laboratory study. Setting: Field. Patients or Other Participants: Three hundred eighty-nine college students participated; 196 Division I athletes (157 men, 39 women) were recruited during preseason physicals, and 193 recreationally active college athletes (108 men, 85 women) were recruited from physical education classes. Intervention(s): Three skinfold measurements to within 1 mm were taken at 8 sites (inferior angle of the scapula, middle deltoid, ulnar groove, midforearm, midthigh, medial collateral ligament, midcalf, and anterior talofibular ligament [ATF]) using Lange skinfold calipers. Main Outcome Measure(s): Skinfold thickness in millimeters. Results: We noted interactions among sex, activity level, and skinfold site. Male athletes had smaller skinfold measurements than female athletes at all sites except the ATF, scapula, and ulnar groove (F7,2702 = 69.85, P < .001). Skinfold measurements were greater for recreationally active athletes than their Division I counterparts at all sites except the ATF, deltoid, and ulnar groove (F7,2702 = 30.79, P < .001). Thigh skinfold measurements of recreationally active female athletes were the largest, and their ATF skinfolds were the smallest. Conclusions: Skinfold thickness at common cryotherapy treatment sites varied based on level of physical activity and sex. Therefore, clinicians should measure skinfold thickness to determine an appropriate cryotherapy duration. PMID:22488282

Blogs and Social Network Sites as Activity Systems: Exploring Adult Informal Learning Process through Activity Theory Framework

ERIC Educational Resources Information Center

Heo, Gyeong Mi; Lee, Romee

2013-01-01

This paper uses an Activity Theory framework to explore adult user activities and informal learning processes as reflected in their blogs and social network sites (SNS). Using the assumption that a web-based space is an activity system in which learning occurs, typical features of the components were investigated and each activity system then…

Prediction of active sites of enzymes by maximum relevance minimum redundancy (mRMR) feature selection.

PubMed

Gao, Yu-Fei; Li, Bi-Qing; Cai, Yu-Dong; Feng, Kai-Yan; Li, Zhan-Dong; Jiang, Yang

2013-01-27

Identification of catalytic residues plays a key role in understanding how enzymes work. Although numerous computational methods have been developed to predict catalytic residues and active sites, the prediction accuracy remains relatively low with high false positives. In this work, we developed a novel predictor based on the Random Forest algorithm (RF) aided by the maximum relevance minimum redundancy (mRMR) method and incremental feature selection (IFS). We incorporated features of physicochemical/biochemical properties, sequence conservation, residual disorder, secondary structure and solvent accessibility to predict active sites of enzymes and achieved an overall accuracy of 0.885687 and MCC of 0.689226 on an independent test dataset. Feature analysis showed that every category of the features except disorder contributed to the identification of active sites. It was also shown via the site-specific feature analysis that the features derived from the active site itself contributed most to the active site determination. Our prediction method may become a useful tool for identifying the active sites and the key features identified by the paper may provide valuable insights into the mechanism of catalysis.

Community Update on Site Activities, July 19, 2013

EPA Pesticide Factsheets

In an effort to engage and inform community members interested in the New Bedford Harbor Superfund Site cleanup, EPA will be issuing periodic topic-based fact sheets that will provide background information and updates about ongoing activities.

Cyanide does more to inhibit heme enzymes, than merely serving as an active-site ligand.

PubMed

Parashar, Abhinav; Venkatachalam, Avanthika; Gideon, Daniel Andrew; Manoj, Kelath Murali

2014-12-12

The toxicity of cyanide is hitherto attributed to its ability to bind to heme proteins' active site and thereby inhibit their activity. It is shown herein that the long-held interpretation is inadequate to explain several observations in heme-enzyme reaction systems. Generation of cyanide-based diffusible radicals in heme-enzyme reaction milieu could shunt electron transfers (by non-active site processes), and thus be detrimental to the efficiency of oxidative outcomes. Copyright © 2014 Elsevier Inc. All rights reserved.

Chemical repair activity of free radical scavenger edaravone: reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA

PubMed Central

Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Lin, Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu, Haiying; Katsumura, Yosuke

2015-01-01

Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 108 dm3 mol−1 s−1 and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10–1000 μmol dm−3) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. PMID:25212600

DFT study of the active site of the XoxF-type natural, cerium-dependent methanol dehydrogenase enzyme.

PubMed

Bogart, Justin A; Lewis, Andrew J; Schelter, Eric J

2015-01-19

Rare-earth metal cations have recently been demonstrated to be essential co-factors for the growth of the methanotrophic bacterium Methylacidiphilum fumariolicum SolV. A crystal structure of the rare-earth-dependent methanol dehydrogenase (MDH) includes a cerium cation in the active site. Herein, the Ce-MDH active site has been analyzed through DFT calculations. The results show the stability of the Ce(III)-pyrroloquinoline quinone (PQQ) semiquinone configuration. Calculations on the active oxidized form of this complex indicate a 0.81 eV stabilization of the PQQ(0) LUMO at cerium versus calcium, supporting the observation that the cerium cation in the active site confers a competitive advantage to Methylacidiphilum fumariolicum SolV. Using reported aqueous electrochemical data, a semi-empirical correlation was established based on cerium(IV/III) redox potentials. The correlation allowed estimation of the cerium oxidation potential of +1.35 V versus saturated calomel electrode (SCE) in the active site. The results are expected to guide the design of functional model complexes and alcohol-oxidation catalysts based on lanthanide complexes of biologically relevant quinones. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Machine-Learning Methods Enable Exhaustive Searches for Active Bimetallic Facets and Reveal Active Site Motifs for CO 2 Reduction

DOE PAGES

Ulissi, Zachary W.; Tang, Michael T.; Xiao, Jianping; ...

2017-07-27

Bimetallic catalysts are promising for the most difficult thermal and electrochemical reactions, but modeling the many diverse active sites on polycrystalline samples is an open challenge. Here, we present a general framework for addressing this complexity in a systematic and predictive fashion. Active sites for every stable low-index facet of a bimetallic crystal are enumerated and cataloged, yielding hundreds of possible active sites. The activity of these sites is explored in parallel using a neural-network-based surrogate model to share information between the many density functional theory (DFT) relaxations, resulting in activity estimates with an order of magnitude fewer explicit DFTmore » calculations. Sites with interesting activity were found and provide targets for follow-up calculations. This process was applied to the electrochemical reduction of CO 2 on nickel gallium bimetallics and indicated that most facets had similar activity to Ni surfaces, but a few exposed Ni sites with a very favorable on-top CO configuration. This motif emerged naturally from the predictive modeling and represents a class of intermetallic CO 2 reduction catalysts. These sites rationalize recent experimental reports of nickel gallium activity and why previous materials screens missed this exciting material. Most importantly these methods suggest that bimetallic catalysts will be discovered by studying facet reactivity and diversity of active sites more systematically.« less

Machine-Learning Methods Enable Exhaustive Searches for Active Bimetallic Facets and Reveal Active Site Motifs for CO 2 Reduction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ulissi, Zachary W.; Tang, Michael T.; Xiao, Jianping

Bimetallic catalysts are promising for the most difficult thermal and electrochemical reactions, but modeling the many diverse active sites on polycrystalline samples is an open challenge. Here, we present a general framework for addressing this complexity in a systematic and predictive fashion. Active sites for every stable low-index facet of a bimetallic crystal are enumerated and cataloged, yielding hundreds of possible active sites. The activity of these sites is explored in parallel using a neural-network-based surrogate model to share information between the many density functional theory (DFT) relaxations, resulting in activity estimates with an order of magnitude fewer explicit DFTmore » calculations. Sites with interesting activity were found and provide targets for follow-up calculations. This process was applied to the electrochemical reduction of CO 2 on nickel gallium bimetallics and indicated that most facets had similar activity to Ni surfaces, but a few exposed Ni sites with a very favorable on-top CO configuration. This motif emerged naturally from the predictive modeling and represents a class of intermetallic CO 2 reduction catalysts. These sites rationalize recent experimental reports of nickel gallium activity and why previous materials screens missed this exciting material. Most importantly these methods suggest that bimetallic catalysts will be discovered by studying facet reactivity and diversity of active sites more systematically.« less

Automating ATLAS Computing Operations using the Site Status Board

NASA Astrophysics Data System (ADS)

J, Andreeva; Iglesias C, Borrego; S, Campana; Girolamo A, Di; I, Dzhunov; Curull X, Espinal; S, Gayazov; E, Magradze; M, Nowotka M.; L, Rinaldi; P, Saiz; J, Schovancova; A, Stewart G.; M, Wright

2012-12-01

The automation of operations is essential to reduce manpower costs and improve the reliability of the system. The Site Status Board (SSB) is a framework which allows Virtual Organizations to monitor their computing activities at distributed sites and to evaluate site performance. The ATLAS experiment intensively uses the SSB for the distributed computing shifts, for estimating data processing and data transfer efficiencies at a particular site, and for implementing automatic exclusion of sites from computing activities, in case of potential problems. The ATLAS SSB provides a real-time aggregated monitoring view and keeps the history of the monitoring metrics. Based on this history, usability of a site from the perspective of ATLAS is calculated. The paper will describe how the SSB is integrated in the ATLAS operations and computing infrastructure and will cover implementation details of the ATLAS SSB sensors and alarm system, based on the information in the SSB. It will demonstrate the positive impact of the use of the SSB on the overall performance of ATLAS computing activities and will overview future plans.

Active Site Detection by Spatial Conformity and Electrostatic Analysis—Unravelling a Proteolytic Function in Shrimp Alkaline Phosphatase

PubMed Central

Chakraborty, Sandeep; Minda, Renu; Salaye, Lipika; Bhattacharjee, Swapan K.; Rao, Basuthkar J.

2011-01-01

Computational methods are increasingly gaining importance as an aid in identifying active sites. Mostly these methods tend to have structural information that supplement sequence conservation based analyses. Development of tools that compute electrostatic potentials has further improved our ability to better characterize the active site residues in proteins. We have described a computational methodology for detecting active sites based on structural and electrostatic conformity - C ata L ytic A ctive S ite P rediction (CLASP). In our pipelined model, physical 3D signature of any particular enzymatic function as defined by its active sites is used to obtain spatially congruent matches. While previous work has revealed that catalytic residues have large pKa deviations from standard values, we show that for a given enzymatic activity, electrostatic potential difference (PD) between analogous residue pairs in an active site taken from different proteins of the same family are similar. False positives in spatially congruent matches are further pruned by PD analysis where cognate pairs with large deviations are rejected. We first present the results of active site prediction by CLASP for two enzymatic activities - β-lactamases and serine proteases, two of the most extensively investigated enzymes. The results of CLASP analysis on motifs extracted from Catalytic Site Atlas (CSA) are also presented in order to demonstrate its ability to accurately classify any protein, putative or otherwise, with known structure. The source code and database is made available at www.sanchak.com/clasp/. Subsequently, we probed alkaline phosphatases (AP), one of the well known promiscuous enzymes, for additional activities. Such a search has led us to predict a hitherto unknown function of shrimp alkaline phosphatase (SAP), where the protein acts as a protease. Finally, we present experimental evidence of the prediction by CLASP by showing that SAP indeed has protease activity in vitro. PMID:22174814

Ethenoguanines Undergo Glycosylation by Nucleoside 2′-Deoxyribosyltransferases at Non-Natural Sites

PubMed Central

Ye, Wenjie; Paul, Debamita; Gao, Lina; Seckute, Jolita; Jayaraj, Karupiah; Zhang, Zhenfa; Kaminski, P. Alexandre

2014-01-01

Deoxyribosyl transferases and functionally related purine nucleoside phosphorylases are used extensively for synthesis of non-natural deoxynucleosides as pharmaceuticals or standards for characterizing and quantitating DNA adducts. Hence exploring the conformational tolerance of the active sites of these enzymes is of considerable practical interest. We have determined the crystal structure at 2.1 Å resolution of Lactobacillus helveticus purine deoxyribosyl transferase (PDT) with the tricyclic purine 8,9-dihydro-9-oxoimidazo[2,1-b]purine (N 2,3-ethenoguanine) at the active site. The active site electron density map was compatible with four orientations, two consistent with sites for deoxyribosylation and two appearing to be unproductive. In accord with the crystal structure, Lactobacillus helveticus PDT glycosylates the 8,9-dihydro-9-oxoimidazo[2,1-b]purine at N7 and N1, with a marked preference for N7. The activity of Lactobacillus helveticus PDT was compared with that of the nucleoside 2′-deoxyribosyltransferase enzymes (DRT Type II) from Lactobacillus leichmannii and Lactobacillus fermentum, which were somewhat more effective in the deoxyribosylation than Lactobacillus helveticus PDT, glycosylating the substrate with product profiles dependent on the pH of the incubation. The purine nucleoside phosphorylase of Escherichia coli, also commonly used in ribosylation of non-natural bases, was an order of magnitude less efficient than the transferase enzymes. Modeling based on published active-site structures as templates suggests that in all cases, an active site Phe is critical in orienting the molecular plane of the purine derivative. Adventitious hydrogen bonding with additional active site residues appears to result in presentation of multiple nucleophilic sites on the periphery of the acceptor base for ribosylation to give a distribution of nucleosides. Chemical glycosylation of O 9-benzylated 8,9-dihydro-9-oxoimidazo[2,1-b]purine also resulted in N7 and N1 ribosylation. Absent from the enzymatic and chemical glycosylations is the natural pattern of N3 ribosylation, verified by comparison of spectroscopic and chromatographic properties with an authentic standard synthesized by an unambiguous route. PMID:25521390

A Mechanism-Based Model for the Prediction of the Metabolic Sites of Steroids Mediated by Cytochrome P450 3A4.

PubMed

Dai, Zi-Ru; Ai, Chun-Zhi; Ge, Guang-Bo; He, Yu-Qi; Wu, Jing-Jing; Wang, Jia-Yue; Man, Hui-Zi; Jia, Yan; Yang, Ling

2015-06-30

Early prediction of xenobiotic metabolism is essential for drug discovery and development. As the most important human drug-metabolizing enzyme, cytochrome P450 3A4 has a large active cavity and metabolizes a broad spectrum of substrates. The poor substrate specificity of CYP3A4 makes it a huge challenge to predict the metabolic site(s) on its substrates. This study aimed to develop a mechanism-based prediction model based on two key parameters, including the binding conformation and the reaction activity of ligands, which could reveal the process of real metabolic reaction(s) and the site(s) of modification. The newly established model was applied to predict the metabolic site(s) of steroids; a class of CYP3A4-preferred substrates. 38 steroids and 12 non-steroids were randomly divided into training and test sets. Two major metabolic reactions, including aliphatic hydroxylation and N-dealkylation, were involved in this study. At least one of the top three predicted metabolic sites was validated by the experimental data. The overall accuracy for the training and test were 82.14% and 86.36%, respectively. In summary, a mechanism-based prediction model was established for the first time, which could be used to predict the metabolic site(s) of CYP3A4 on steroids with high predictive accuracy.

Developing a programmatic approach to investigating and remediating many unrelated comprehensive environmental response, compensation, and liability act sites at Kelly Air Force Base

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamp, G.; Regan, P.; Ninesteel, R.

1988-01-01

Kelly Air Force Base (AFB), which was founded in 1917, is involved in logistics and maintenance activities supporting the Air Logistics Command. In addition, Kelly AFB hosts over 50 tenant organizations representing the Air Force, Department of Defense, and other government agencies. Over the years waste disposal from this complex was conducted in a manner that led to the identification of over 30 sites to be included in the Installation Restoration Program (IRP) after the Phase 1 investigation. A methodology was needed to prioritize the Remedial Investigations and Feasibility Study (RI/FS) activities for the sites. A Strategy Plan was developedmore » that involved reviewing and interpreting existing data, identifying data voids relative to site specific RI/FS activities, and developing methodology to prioritize activities. Sites were prioritized, and a comprehensive IRP planning document was developed. One data deficiency was revealed -- the lack of understanding of the Basewide hydrogeologic conditions necessary to establish an effective restoration program. A Hydrogeologic Investigation was initiated to provide this data. This data will allow better interpretation of the interaction of the sites, particularly those in close proximity, and improved planning of remediation activities.« less

Stereoselectivity of supported alkene metathesis catalysts: a goal and a tool to characterize active sites.

PubMed

Copéret, Christophe

2011-01-05

Stereoselectivity in alkene metathesis is a challenge and can be used as a tool to study active sites under working conditions. This review describes the stereochemical relevance and problems in alkene metathesis (kinetic vs. thermodynamic issues), the use of (E/Z) ratio at low conversions as a tool to characterize active sites of heterogeneous catalysts and finally to propose strategies to improve catalysts based on the current state of the art.

[Adenylate cyclase from rabbit heart: substrate binding site].

PubMed

Perfil'eva, E A; Khropov, Iu V; Khachatrian, L; Bulargina, T V; Baranova, L A

1981-08-01

The effects of 17 ATP analogs on the solubilized rabbit heart adenylate cyclase were studied. The triphosphate chain, position 8 of the adenine base and the ribose residue of the ATP molecule were modified. Despite the presence of the alkylating groups in two former types of the analogs tested, no covalent blocking of the active site of the enzyme was observed. Most of the compounds appeared to be competitive reversible inhibitors. The kinetic data confirmed the importance of the triphosphate chain for substrate binding in the active site of adenylate cyclase. (Formula: See Text) The inhibitors with different substituents in position 8 of the adenine base had a low affinity for the enzyme. The possible orientation of the triphosphate chain and the advantages of anti-conformation of the ATP molecule for their binding in the active site of adenylate cyclase are discussed.

The National Children's Study: Recruitment Outcomes Using an Enhanced Household-Based Approach.

PubMed

Blaisdell, Laura L; Zellner, Jennifer A; King, Alison A; Faustman, Elaine; Wilhelm, Mari; Hudak, Mark L; Annett, Robert D

2016-06-01

Ten National Children's Study (NCS) study locations with diverse demographic characteristics used an enhanced household-based recruitment (EHBR) approach to enroll preconceptional and pregnant women. Study centers used different types and dosages of community outreach and engagement (COE) activities and supplemental strategies. The goal of the study was to determine whether variability in enumeration and recruitment outcomes correlated with study location characteristics or types and dosages of COE activities (number of COE events, number of advance household mailings, total media expenditures, and total COE expenditures). Each of the sites provided data on COE activities, protocol implementation, supplemental recruitment activities, location demographic characteristics, and enumeration/recruitment outcomes. COE activities varied across sites in breadth and scope. Numerous strategies were used, including media advertising, social media, participation in community-wide events, presentations to stakeholders, and creation of advisory boards. Some sites included supplemental recruitment efforts. EHBR sites enrolled 1404 women at the initial pregnancy screening. No significant relationships were found between study location demographic characteristics or between the types and dosages of COE activities and recruitment outcomes. Probability sampling for a long-term study requires a positive image with stakeholders and within communities; this requirement may be especially true for door-to-door recruitment. EHBR sites successfully recruited a representative sample of preconceptional and pregnant women. Sites reported implementing similar COE activities but with varying dosage and cost; however, analyses did not support a benefit of COE strategies on study recruitment. Copyright © 2016 by the American Academy of Pediatrics.

Chemical repair activity of free radical scavenger edaravone: reduction reactions with dGMP hydroxyl radical adducts and suppression of base lesions and AP sites on irradiated plasmid DNA.

PubMed

Hata, Kuniki; Urushibara, Ayumi; Yamashita, Shinichi; Lin, Mingzhang; Muroya, Yusa; Shikazono, Naoya; Yokoya, Akinari; Fu, Haiying; Katsumura, Yosuke

2015-01-01

Reactions of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one) with deoxyguanosine monophosphate (dGMP) hydroxyl radical adducts were investigated by pulse radiolysis technique. Edaravone was found to reduce the dGMP hydroxyl radical adducts through electron transfer reactions. The rate constants of the reactions were greater than 4 × 10(8) dm(3) mol(-1) s(-1) and similar to those of the reactions of ascorbic acid, which is a representative antioxidant. Yields of single-strand breaks, base lesions, and abasic sites produced in pUC18 plasmid DNA by gamma ray irradiation in the presence of low concentrations (10-1000 μmol dm(-3)) of edaravone were also quantified, and the chemical repair activity of edaravone was estimated by a method recently developed by the authors. By comparing suppression efficiencies to the induction of each DNA lesion, it was found that base lesions and abasic sites were suppressed by the chemical repair activity of edaravone, although the suppression of single-strand breaks was not very effective. This phenomenon was attributed to the chemical repair activity of edaravone toward base lesions and abasic sites. However, the chemical repair activity of edaravone for base lesions was lower than that of ascorbic acid. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

Pain, pain intensity and pain disability in high school students are differently associated with physical activity, screening hours and sleep.

PubMed

Silva, Anabela G; Sa-Couto, Pedro; Queirós, Alexandra; Neto, Maritza; Rocha, Nelson P

2017-05-16

Studies exploring the association between physical activity, screen time and sleep and pain usually focus on a limited number of painful body sites. Nevertheless, pain at different body sites is likely to be of different nature. Therefore, this study aims to explore and compare the association between time spent in self-reported physical activity, in screen based activities and sleeping and i) pain presence in the last 7-days for 9 different body sites; ii) pain intensity at 9 different body sites and iii) global disability. Nine hundred sixty nine students completed a questionnaire on pain, time spent in moderate and vigorous physical activity, screen based time watching TV/DVD, playing, using mobile phones and computers and sleeping hours. Univariate and multivariate associations between pain presence, pain intensity and disability and physical activity, screen based time and sleeping hours were investigated. Pain presence: sleeping remained in the multivariable model for the neck, mid back, wrists, knees and ankles/feet (OR 1.17 to 2.11); moderate physical activity remained in the multivariate model for the neck, shoulders, wrists, hips and ankles/feet (OR 1.06 to 1.08); vigorous physical activity remained in the multivariate model for mid back, knees and ankles/feet (OR 1.05 to 1.09) and screen time remained in the multivariate model for the low back (OR = 2.34. Pain intensity: screen time and moderate physical activity remained in the multivariable model for pain intensity at the neck, mid back, low back, shoulder, knees and ankles/feet (Rp 2 0.02 to 0.04) and at the wrists (Rp 2  = 0.04), respectively. Disability showed no association with sleeping, screen time or physical activity. This study suggests both similarities and differences in the patterns of association between time spent in physical activity, sleeping and in screen based activities and pain presence at 8 different body sites. In addition, they also suggest that the factors associated with the presence of pain, pain intensity and pain associated disability are different.

Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method.

PubMed

Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

2014-08-01

Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

Prediction of allosteric sites on protein surfaces with an elastic-network-model-based thermodynamic method

NASA Astrophysics Data System (ADS)

Su, Ji Guo; Qi, Li Sheng; Li, Chun Hua; Zhu, Yan Ying; Du, Hui Jing; Hou, Yan Xue; Hao, Rui; Wang, Ji Hua

2014-08-01

Allostery is a rapid and efficient way in many biological processes to regulate protein functions, where binding of an effector at the allosteric site alters the activity and function at a distant active site. Allosteric regulation of protein biological functions provides a promising strategy for novel drug design. However, how to effectively identify the allosteric sites remains one of the major challenges for allosteric drug design. In the present work, a thermodynamic method based on the elastic network model was proposed to predict the allosteric sites on the protein surface. In our method, the thermodynamic coupling between the allosteric and active sites was considered, and then the allosteric sites were identified as those where the binding of an effector molecule induces a large change in the binding free energy of the protein with its ligand. Using the proposed method, two proteins, i.e., the 70 kD heat shock protein (Hsp70) and GluA2 alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptor, were studied and the allosteric sites on the protein surface were successfully identified. The predicted results are consistent with the available experimental data, which indicates that our method is a simple yet effective approach for the identification of allosteric sites on proteins.

A contact photo-cross-linking investigation of the active site of the 8-17 deoxyribozyme.

PubMed

Liu, Yong; Sen, Dipankar

2008-09-12

The small RNA-cleaving 8-17 deoxyribozyme (DNAzyme) has been the subject of extensive mechanistic and structural investigation, including a number of recent single-molecule studies of its global folding. Little detailed insight exists, however, into this DNAzyme's active site; for instance, the identity of specific nucleotides that are proximal to or in contact with the scissile site in the substrate. Here, we report a systematic replacement of a number of bases within the magnesium-folded DNAzyme-substrate complex with thio- and halogen-substituted base analogues, which were then photochemically activated to generate contact cross-links within the complex. Mapping of the cross-links revealed a striking pattern of DNAzyme-substrate cross-links but an absence of significant intra-DNAzyme cross-links. Notably, the two nucleotides directly flanking the scissile phosphodiester cross-linked strongly with functionally important elements within the DNAzyme, the thymine of a G.T wobble base pair, a WCGR bulge loop, and a terminal AGC loop. Mutation of the wobble base pair to a G-C pair led to a significant folding instability of the DNAzyme-substrate complex. The cross-linking patterns obtained were used to generate a model for the DNAzyme's active site that had the substrate's scissile phosphodiester sandwiched between the DNAzyme's wobble thymine and its AGC and WCGR loops.

The effect of the distance between acidic site and basic site immobilized on mesoporous solid on the activity in catalyzing aldol condensation

NASA Astrophysics Data System (ADS)

Yu, Xiaofang; Yu, Xiaobo; Wu, Shujie; Liu, Bo; Liu, Heng; Guan, Jingqi; Kan, Qiubin

2011-02-01

Acid-base bifunctional heterogeneous catalysts containing carboxylic and amine groups, which were immobilized at defined distance from one another on the mesoporous solid were synthesized by immobilizing lysine onto carboxyl-SBA-15. The obtained materials were characterized by X-ray diffraction (XRD), N 2 adsorption, Fourier-transform infrared spectroscopy (FTIR), thermogravimetric analysis (TGA), scanning electron micrographs (SEM), transmission electron micrographs (TEM), elemental analysis, and back titration. Proximal-C-A-SBA-15 with a proximal acid-base distance was more active than maximum-C-A-SBA-15 with a maximum acid-base distance in aldol condensation reaction between acetone and various aldehydes. It appears that the distance between acidic site and basic site immobilized on mesoporous solid should be an essential factor for catalysis optimization.

Web-Based Assessment Tool for Communication and Active Listening Skill Development

ERIC Educational Resources Information Center

Cheon, Jongpil; Grant, Michael

2009-01-01

The website "Active Listening" was developed within a larger project--"Interactive Web-based training in the subtleties of communication and active listening skill development." The Active Listening site aims to provide beginning counseling psychology students with didactic and experimental learning activities and interactive tests so that…

Evaluation of physical activity web sites for use of behavior change theories.

PubMed

Doshi, Amol; Patrick, Kevin; Sallis, James F; Calfas, Karen

2003-01-01

Physical activity (PA) Web sites were assessed for their use of behavior change theories, including constructs of the health belief model, Transtheoretical Model, social cognitive theory, and the theory of reasoned action and planned behavior. An evaluation template for assessing PA Web sites was developed, and content validity and interrater reliability were demonstrated. Two independent raters evaluated 24 PA Web sites. Web sites varied widely in application of theory-based constructs, ranging from 5 to 48 on a 100-point scale. The most common intervention strategies were general information, social support, and realistic goal areas. Coverage of theory-based strategies was low, varying from 26% for social cognitive theory to 39% for health belief model. Overall, PA Web sites provided little assessment, feedback, or individually tailored assistance for users. They were unable to substantially tailor the on-line experience for users at different stages of change or different demographic characteristics.

Use of satellite remote sensing as a monitoring tool for land and water resources development activities in an Indian tropical site.

PubMed

Behera, M D; Gupta, A K; Barik, S K; Das, P; Panda, R M

2018-06-15

With the availability of satellite data from free data domain, remote sensing has increasingly become a fast-hand tool for monitoring of land and water resources development activities with minimal cost and time. Here, we verified construction of check dams and implementation of plantation activities in two districts of Tripura state using Landsat and Sentinel-2 images for the years 2008 and 2016-2017, respectively. We applied spectral reflectance curves and index-based proxies to quantify these activities for two time periods. A subset of the total check dams and plantation sites was chosen on the basis of site condition, nature of check dams, and planted species for identification on satellite images, and another subset was randomly chosen to validate identification procedure. The normalized difference water index (NDWI) derived from Landsat and Senitnel-2 were used to quantify water area evolved, qualify the water quality, and influence of associated tree shadows. Three types of check dams were observed, i.e., full, partial, and fully soil exposed on the basis of the presence of grass or scrub on the check dams. Based on the nature of check dam and site characteristics, we classified the water bodies under 11-categories using six interpretation keys (size, shape, water depth, quality, shadow of associated trees, catchment area). The check dams constructed on existing narrow gullies totally covered by branches or associated plants were not identified without field verification. Further, use of EVI enabled us to approve the plantation activities and adjudge the corresponding increase in vegetation vigor. The plantation activities were established based on the presence and absence of existing vegetation. Clearing on the plantation sites for plantation shows differential increase in EVI values during the initial years. The 403 plantation sites were categorized into 12 major groups on the basis of presence of dominant species and site conditions. The dominant species were Areca catechu, Musa paradisiaca, Ananas comosus, Bambusa sp., and mix plantation of A. catechu and M. paradisiaca. However, the highest maximum increase in average EVI was observed for the pine apple plantation sites (0.11), followed by Bambussa sp. (0.10). These sites were fully covered with plantation without any exposed soil. The present study successfully demonstrates a satellite-based survey supplemented with ground information evaluating the changes in vegetation profile due to plantation activities, locations of check dams, extent of water bodies, downstream irrigation, and catchment area of water bodies.

Improved ethanol electrooxidation performance by shortening Pd-Ni active site distance in Pd-Ni-P nanocatalysts

NASA Astrophysics Data System (ADS)

Chen, Lin; Lu, Lilin; Zhu, Hengli; Chen, Yueguang; Huang, Yu; Li, Yadong; Wang, Leyu

2017-01-01

Incorporating oxophilic metals into noble metal-based catalysts represents an emerging strategy to improve the catalytic performance of electrocatalysts in fuel cells. However, effects of the distance between the noble metal and oxophilic metal active sites on the catalytic performance have rarely been investigated. Herein, we report on ultrasmall (~5 nm) Pd-Ni-P ternary nanoparticles for ethanol electrooxidation. The activity is improved up to 4.95 A per mgPd, which is 6.88 times higher than commercial Pd/C (0.72 A per mgPd), by shortening the distance between Pd and Ni active sites, achieved through shape transformation from Pd/Ni-P heterodimers into Pd-Ni-P nanoparticles and tuning the Ni/Pd atomic ratio to 1:1. Density functional theory calculations reveal that the improved activity and stability stems from the promoted production of free OH radicals (on Ni active sites) which facilitate the oxidative removal of carbonaceous poison and combination with CH3CO radicals on adjacent Pd active sites.

Ultrafast Light-Driven Substrate Expulsion from the Active Site of a Photoswitchable Catalyst.

PubMed

Pescher, Manuel D; van Wilderen, Luuk J G W; Grützner, Susanne; Slavov, Chavdar; Wachtveitl, Josef; Hecht, Stefan; Bredenbeck, Jens

2017-09-25

The photoswitchable piperidine general base catalyst is a prototype structure for light control of catalysis. Its azobenzene moiety moves sterically shielding groups to either protect or expose the active site, thereby changing the basicity and hydrogen-bonding affinity of the compound. The reversible switching dynamics of the catalyst is probed in the infrared spectral range by monitoring hydrogen bond (HB) formation between its active site and methanol (MeOH) as HB donor. Steady-state infrared (IR) and ultrafast IR and UV/Vis spectroscopies are used to uncover ultrafast expulsion of MeOH from the active site within a few picoseconds. Thus, the force generated by the azobenzene moiety even in the final phase of its isomerization is sufficient to break a strong HB within 3 ps and to shut down access to the active site. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Locating bomb factories by detecting hydrogen peroxide.

PubMed

Romolo, Francesco Saverio; Connell, Samantha; Ferrari, Carlotta; Suarez, Guillaume; Sauvain, Jean-Jacques; Hopf, Nancy B

2016-11-01

The analytical capability to detect hydrogen peroxide vapour can play a key role in localizing a site where a H2O2 based Improvised Explosive (IE) is manufactured. In security activities it is very important to obtain information in a short time. For this reason, an analytical method to be used in security activity needs portable devices. The authors have developed the first analytical method based on a portable luminometer, specifically designed and validated to locate IE manufacturing sites using quantitative on-site vapour analysis for H2O2. The method was tested both indoor and outdoor. The results demonstrate that the detection of H2O2 vapours could allow police forces to locate the site, while terrorists are preparing an attack. The collected data are also very important in developing new sensors, able to give an early alarm if located at a proper distance from a site where an H2O2 based IE is prepared. Copyright © 2016 Elsevier B.V. All rights reserved.

ATP hydrolysis in Eg5 kinesin involves a catalytic two-water mechanism.

PubMed

Parke, Courtney L; Wojcik, Edward J; Kim, Sunyoung; Worthylake, David K

2010-02-19

Motor proteins couple steps in ATP binding and hydrolysis to conformational switching both in and remote from the active site. In our kinesin.AMPPPNP crystal structure, closure of the active site results in structural transformations appropriate for microtubule binding and organizes an orthosteric two-water cluster. We conclude that a proton is shared between the lytic water, positioned for gamma-phosphate attack, and a second water that serves as a general base. To our knowledge, this is the first experimental detection of the catalytic base for any ATPase. Deprotonation of the second water by switch residues likely triggers subsequent large scale structural rearrangements. Therefore, the catalytic base is responsible for initiating nucleophilic attack of ATP and for relaying the positive charge over long distances to initiate mechanotransduction. Coordination of switch movements via sequential proton transfer along paired water clusters may be universal for nucleotide triphosphatases with conserved active sites, such as myosins and G-proteins.

Event-based soil loss models for construction sites

NASA Astrophysics Data System (ADS)

Trenouth, William R.; Gharabaghi, Bahram

2015-05-01

The elevated rates of soil erosion stemming from land clearing and grading activities during urban development, can result in excessive amounts of eroded sediments entering waterways and causing harm to the biota living therein. However, construction site event-based soil loss simulations - required for reliable design of erosion and sediment controls - are one of the most uncertain types of hydrologic models. This study presents models with improved degree of accuracy to advance the design of erosion and sediment controls for construction sites. The new models are developed using multiple linear regression (MLR) on event-based permutations of the Universal Soil Loss Equation (USLE) and artificial neural networks (ANN). These models were developed using surface runoff monitoring datasets obtained from three sites - Greensborough, Cookstown, and Alcona - in Ontario and datasets mined from the literature for three additional sites - Treynor, Iowa, Coshocton, Ohio and Cordoba, Spain. The predictive MLR and ANN models can serve as both diagnostic and design tools for the effective sizing of erosion and sediment controls on active construction sites, and can be used for dynamic scenario forecasting when considering rapidly changing land use conditions during various phases of construction.

Structure of the endonuclease IV homologue from Thermotoga maritima in the presence of active-site divalent metal ions

PubMed Central

Tomanicek, Stephen J.; Hughes, Ronny C.; Ng, Joseph D.; Coates, Leighton

2010-01-01

The most frequent lesion in DNA is at apurinic/apyrimidinic (AP) sites resulting from DNA-base losses. These AP-site lesions can stall DNA replication and lead to genome instability if left unrepaired. The AP endonucleases are an important class of enzymes that are involved in the repair of AP-site intermediates during damage-general DNA base-excision repair pathways. These enzymes hydrolytically cleave the 5′-phosphodiester bond at an AP site to generate a free 3′-­hydroxyl group and a 5′-terminal sugar phosphate using their AP nuclease activity. Specifically, Thermotoga maritima endonuclease IV is a member of the second conserved AP endonuclease family that includes Escherichia coli endonuclease IV, which is the archetype of the AP endonuclease superfamily. In order to more fully characterize the AP endonuclease family of enzymes, two X-­ray crystal structures of the T. maritima endonuclease IV homologue were determined in the presence of divalent metal ions bound in the active-site region. These structures of the T. maritima endonuclease IV homologue further revealed the use of the TIM-barrel fold and the trinuclear metal binding site as important highly conserved structural elements that are involved in DNA-binding and AP-site repair processes in the AP endonuclease superfamily. PMID:20823514

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Orthogonal use of a human tRNA synthetase active site to achieve multifunctionality.

PubMed

Zhou, Quansheng; Kapoor, Mili; Guo, Min; Belani, Rajesh; Xu, Xiaoling; Kiosses, William B; Hanan, Melanie; Park, Chulho; Armour, Eva; Do, Minh-Ha; Nangle, Leslie A; Schimmel, Paul; Yang, Xiang-Lei

2010-01-01

Protein multifunctionality is an emerging explanation for the complexity of higher organisms. In this regard, aminoacyl tRNA synthetases catalyze amino acid activation for protein synthesis, but some also act in pathways for inflammation, angiogenesis and apoptosis. It is unclear how these multiple functions evolved and how they relate to the active site. Here structural modeling analysis, mutagenesis and cell-based functional studies show that the potent angiostatic, natural fragment of human tryptophanyl-tRNA synthetase (TrpRS) associates via tryptophan side chains that protrude from its cognate cellular receptor vascular endothelial cadherin (VE-cadherin). VE-cadherin's tryptophan side chains fit into the tryptophan-specific active site of the synthetase. Thus, specific side chains of the receptor mimic amino acid substrates and expand the functionality of the active site of the synthetase. We propose that orthogonal use of the same active site may be a general way to develop multifunctionality of human tRNA synthetases and other proteins.

Converting Transaldolase into Aldolase through Swapping of the Multifunctional Acid-Base Catalyst: Common and Divergent Catalytic Principles in F6P Aldolase and Transaldolase.

PubMed

Sautner, Viktor; Friedrich, Mascha Miriam; Lehwess-Litzmann, Anja; Tittmann, Kai

2015-07-28

Transaldolase (TAL) and fructose-6-phosphate aldolase (FSA) both belong to the class I aldolase family and share a high degree of structural similarity and sequence identity. The molecular basis of the different reaction specificities (transferase vs aldolase) has remained enigmatic. A notable difference between the active sites is the presence of either a TAL-specific Glu (Gln in FSA) or a FSA-specific Tyr (Phe in TAL). Both residues seem to have analoguous multifunctional catalytic roles but are positioned at different faces of the substrate locale. We have engineered a TAL double variant (Glu to Gln and Phe to Tyr) with an active site resembling that of FSA. This variant indeed exhibits aldolase activity as its main activity with a catalytic efficiency even larger than that of authentic FSA, while TAL activity is greatly impaired. Structural analysis of this variant in complex with the dihydroxyacetone Schiff base formed upon substrate cleavage identifies the introduced Tyr (genuine in FSA) to catalyze protonation of the central carbanion-enamine intermediate as a key determinant of the aldolase reaction. Our studies pinpoint that the Glu in TAL and the Tyr in FSA, although located at different positions at the active site, similarly act as bona fide acid-base catalysts in numerous catalytic steps, including substrate binding, dehydration of the carbinolamine, and substrate cleavage. We propose that the different spatial positions of the multifunctional Glu in TAL and of the corresponding multifunctional Tyr in FSA relative to the substrate locale are critically controlling reaction specificity through either unfavorable (TAL) or favorable (FSA) geometry of proton transfer onto the common carbanion-enamine intermediate. The presence of both potential acid-base residues, Glu and Tyr, in the active site of TAL has deleterious effects on substrate binding and cleavage, most likely resulting from a differently organized H-bonding network. Large-scale motions of the protein associated with opening and closing of the active site that seem to bear relevance for catalysis are observed as covalent intermediates are exclusively observed in the "closed" conformation of the active site. Pre-steady-state kinetics are used to monitor catalytic processes and structural transitions and to refine the kinetic framework of TAL catalysis.

Evaluating Engagement Models for a Citizen Science Project: Lessons Learned From Four Years of Nature's Notebook

NASA Astrophysics Data System (ADS)

Crimmins, T. M.; Rosemartin, A.

2012-12-01

The success of citizen science programs hinges on their abilities to recruit and maintain active participants. The USA National Phenology Network's plant and animal phenology observation program, Nature's Notebook, has been active since 2009. This program engages thousands of citizen scientists in tracking plant and animal life cycle activity over the course of the year. We embarked on an evaluation of the various observer recruitment and retention tactics that we have employed over the ~4-year life of this program to better inform future outreach efforts specific to Nature's Notebook and for the broader citizen science community. Participants in Nature's Notebook may become engaged via one of three pathways: individuals may join Nature's Notebook directly, they may be invited to join through a USA-NPN partner organization, or they may engage through a group with local, site-based leadership. The level and type of recruitment tactics, training, and retention efforts that are employed varies markedly among these three models. In this evaluation, we compared the efficacy of these three engagement models using several metrics: number of individuals recruited, number of individuals that go on to submit at least one data point, retention rates over time, duration of activity, and quantity of data points submitted. We also qualitatively considered the differences in costs the three models require to support. In terms of recruitment, direct engagement yielded 20-100 times more registrants than other two models. In contrast, rates of participation were highest for site-based leadership (>35%, versus 20-30% for direct engagement; rates for partner organizations were highly variable due to small sample sizes). Individuals participating through partners with site-based leadership showed a much higher rate of retention (41% of participants remained active for two+ years) than those participating directly in Nature's Notebook (27% of participants remained active for two+ years) or individuals participating through membership organizations (12% of participants remained active for two+ years). Long-term observer retention was significantly higher for participants that joined via groups with site-based leadership compared to observers that joined Nature's Notebook directly in 2010 and 2011 (direct-engagement observers remained active for ~4 months; observers in groups with site-based leaderships remained active for ~6 months). There were no differences in within-year retention among the three models, indicating that the approaches perform essentially equally in terms of keeping observers engaged within the year of registration. In both 2011 and 2012 (to-date), observers participating via groups with site-based leadership submitted over twice the observations than observers participating directly in Nature's Notebook. Through this evaluation, we learned that direct engagement, which costs the USA-NPN the least to undertake and maintain, yields the greatest number of program registrants. However, this model results in the lowest rates of participant retention and data submission. In contrast, programs with site-based leadership, such as local Master Gardener chapters, yield the longest durations of activity and much higher rates of data submission, but are much more labor-intensive to support.

Physical Activity Guidelines

MedlinePlus

... use this site. health.gov Physical Activity Guidelines Physical Activity Physical activity is key to improving the health of the Nation. Based on the latest science, the Physical Activity Guidelines for Americans is an essential resource for ...

Transition State Charge Stabilization and Acid-Base Catalysis of mRNA Cleavage by the Endoribonuclease RelE

PubMed Central

Dunican, Brian F.; Hiller, David A.; Strobel, Scott A.

2015-01-01

The bacterial toxin RelE is a ribosome-dependent endoribonuclease. It is part of a type II toxin-antitoxin system that contributes to antibiotic resistance and biofilm formation. During amino acid starvation RelE cleaves mRNA in the ribosomal A-site, globally inhibiting protein translation. RelE is structurally similar to microbial RNases that employ general acid-base catalysis to facilitate RNA cleavage. The RelE active-site is atypical for acid-base catalysis, in that it is enriched for positively charged residues and lacks the prototypical histidine-glutamate catalytic pair, making the mechanism of mRNA cleavage unclear. In this study we use a single-turnover kinetic analysis to measure the effect of pH and phosphorothioate substitution on the rate constant for cleavage of mRNA by wild-type RelE and seven active-site mutants. Mutation and thio-effects indicate a major role for stabilization of increased negative change in the transition state by arginine 61. The wild-type RelE cleavage rate constant is pH-independent, but the reaction catalyzed by many of the mutants is strongly pH dependent, suggestive of general acid-base catalysis. pH-rate curves indicate that wild-type RelE operates with the pKa of at least one catalytic residue significantly downshifted by the local environment. Mutation of any single active-site residue is sufficient to disrupt this microenvironment and revert the shifted pKa back above neutrality. pH-rate curves are consistent with K54 functioning as a general base and R81 as a general acid. The capacity of RelE to effect a large pKa shift and facilitate a common catalytic mechanism by uncommon means furthers our understanding of other atypical enzymatic active sites. PMID:26535789

Biological Characterization of an Improved Pyrrole-Based Colchicine Site Agent Identified through Structure-Based Design

PubMed Central

Rohena, Cristina C.; Telang, Nakul S.; Da, Chenxiao; Risinger, April L.; Sikorski, James A.; Kellogg, Glen E.; Gupton, John T.

2016-01-01

A refined model of the colchicine site on tubulin was used to design an improved analog of the pyrrole parent compound, JG-03-14. The optimized compound, NT-7-16, was evaluated in biological assays that confirm that it has potent activities as a new colchicine site microtubule depolymerizer. NT-7-16 exhibits antiproliferative and cytotoxic activities against multiple cancer cell lines, with IC50 values of 10–16 nM, and it is able to overcome drug resistance mediated by the expression of P-glycoprotein and the βIII isotype of tubulin. NT-7-16 initiated the concentration-dependent loss of cellular microtubules and caused the formation of abnormal mitotic spindles, leading to mitotic accumulation. The direct interaction of NT-7-16 with purified tubulin was confirmed, and it was more potent than combretastatin A-4 in these assays. Binding studies verified that NT-7-16 binds to tubulin within the colchicine site. The antitumor effects of NT-7-16 were evaluated in an MDA-MB-435 xenograft model and it had excellent activity at concentrations that were not toxic. A second compound, NT-9-21, which contains dichloro moieties in place of the 3,5-dibromo substituents of NT-7-16, had a poorer fit within the colchicine site as predicted by modeling and the Hydropathic INTeractions score. Biological evaluations showed that NT-9-21 has 10-fold lower potency than NT-7-16, confirming the modeling predictions. These studies highlight the value of the refined colchicine-site model and identify a new pyrrole-based colchicine-site agent with potent in vitro activities and promising in vivo antitumor actions. PMID:26655304

Comparing responses to horticultural-based and traditional activities in dementia care programs.

PubMed

Jarrott, Shannon E; Gigliotti, Christina M

2010-12-01

Engaging persons with dementia in meaningful activities supports well-being; however, care staff are challenged to implement age- and ability-appropriate activities in a group setting. We compared a randomly assigned treatment group, who received horticultural therapy-based (HT-based) programming to a comparison group, who engaged in traditional activities (TA) programming, on engagement and affect. Horticultural therapy-based programming was implemented twice weekly at 4 treatment sites for 6 weeks, while regular TA were observed at comparison sites. Results revealed no differences between groups on affective domains. Levels of adaptive behavior differed between the groups, with the treatment group demonstrating higher levels of active, passive, and other engagement and the comparison group demonstrating higher levels of self-engagement. Our results highlight the value of HT-based programs and the importance of simultaneously capturing participants' affective and behavioral responses. Theoretical and practical considerations about the facilitation of and context in which the programming occurs are discussed.

Landslide hazard assessment of the Black sea coastline (Caucasus, Russia) via drones

NASA Astrophysics Data System (ADS)

Kazeev, Andrey; Postoev, German; Fedotova, Ksenia

2017-04-01

Landslide hazard assessment of slopes of Sochi was performed along the railway between the cities Tuapse and Adler (total length 103 km). The railway passes through the territory with active development of hazardous geological processes such as landslides, rock falls and debris-flows. By the beginning of 2016, 36 landslide sites were discovered along the railway (total length 34 km), 48 rock-fall sites (length 31 km), and 5 debris-flow sites (length 0.14 km). In recent years the intensification of deformations was observed. For instance, during previous 10 years (1996¬¬-2005) 28 sudden deformations occurred due to slope processes, which caused interruptions in traffic. And in the present decade (2006-2015), 72 deformations were recorded. High landslide activity and economic loss determined the necessity of complex investigations of engineering geological conditions of landslides development and causes of its intensification. The protection strategy development was needed to minimize negative consequences. Thus, the investigations of landslide situation along the railway "Tuapse - Adler" included the categorization of landslide sites by level of hazard, with risk assessment based on numerical criteria. Preliminary evaluation of landslide hazard for the railway was conducted via the analysis of archived engineering-geological documents. 13 of 36 landslide sites (total length 13 km) were selected, reflecting the variety and peculiarities of landslide displacements on slopes (both active and inactive sites). Visual field observations of landslide slopes using drone "DJI Phantom 4" were completed during the second stage of this investigation. High-resolution photographs of landslide cirques, cracks, scarp walls, vegetation features were obtained via drone, which would have been impossible to obtain from the ground in conditions of dense subtropical vegetation cover. Possible approaches to the landslide activity and hazard assessment were evaluated: slope stability analysis, geophysical monitoring methods, analysis of critical deformations and critical velocities of displacement, the analysis of changes of conditions of landslide development during its displacement, as well as scoring approaches to landslide hazard and risk assessment. As the result, the method of probabilistic estimation of landslide activity and hazard has been proposed, based on selection and analysis of main factors, influencing landslide displacements. Slope steepness, landslide thickness, slope length, bedrock dip, slope relief, cracks, vegetation patterns and other factors were used for assessment of activity of landslide sites. The investigation was based on the proposed probabilistic method of assessment of landslide activity and hazard. The considered landslide sites were ranked by the rate of activity as inactive, potentially active and active. The most active sites were used to identify potentially the most hazardous sites. Furthermore, the following factors were additionally considered: the damage of railroad facilities due to landslide, landslide activity, thickness of landslide at the toe of the slope, bedrock stratification, the conditions for the cirque development, the position of the sliding surface relatively to the railway, the involvement of bedrock into displaced mass. As the result, the investigated railroad sites were divided into three categories: non-hazardous, potentially hazardous and hazardous. The research was supported by Russian Scientific Foundation (Project № 16-17-00125).

Pyrrole-Based Antitubulin Agents: Two Distinct Binding Modalities Are Predicted for C-2 Analogues in the Colchicine Site

PubMed Central

2011-01-01

3,5-Dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2-carboxylic acid ethyl ester is a promising antitubulin lead agent that targets the colchicine site of tubulin. C-2 analogues were synthesized and tested for microtubule depolymerizing and antiproliferative activity. Molecular modeling studies using both GOLD docking and HINT (Hydropathic INTeraction) scoring revealed two distinct binding modes that explain the structure–activity relationships and are in accord with the structural basis of colchicine binding to tubulin. The binding mode of higher activity compounds is buried deeper in the site and overlaps well with rings A and C of colchicine, while the lower activity binding mode shows fewer critical contacts with tubulin. The model distinguishes highly active compounds from those with weaker activities and provides novel insights into the colchicine site and compound design. PMID:22611477

Pyrrole-Based Antitubulin Agents: Two Distinct Binding Modalities are Predicted for C-2 Analogs in the Colchicine Site.

PubMed

Da, Chenxiao; Telang, Nakul; Barelli, Peter; Jia, Xin; Gupton, John T; Mooberry, Susan L; Kellogg, Glen E

2012-01-12

3,5-dibromo-4-(3,4-dimethoxyphenyl)-1H-pyrrole-2-carboxylic acid ethyl ester is a promising antitubulin lead agent that targets the colchicine site of tubulin. C-2 analogs were synthesized and tested for microtubule depolymerizing and antiproliferative activity. Molecular modeling studies using both GOLD docking and HINT (Hydropathic INTeraction) scoring revealed two distinct binding modes that explain the structural-activity relationships and are in accord with the structural basis of colchicine binding to tubulin. The binding mode of higher activity compounds is buried deeper in the site and overlaps well with rings A and C of colchicine, while the lower activity binding mode shows fewer critical contacts with tubulin. The model distinguishes highly active compounds from those with weaker activities and provides novel insights into the colchicine site and compound design.

Engineering Translational Activators with CRISPR-Cas System.

PubMed

Du, Pei; Miao, Chensi; Lou, Qiuli; Wang, Zefeng; Lou, Chunbo

2016-01-15

RNA parts often serve as critical components in genetic engineering. Here we report a design of translational activators which is composed of an RNA endoribonuclease (Csy4) and two exchangeable RNA modules. Csy4, a member of Cas endoribonuclease, cleaves at a specific recognition site; this cleavage releases a cis-repressive RNA module (crRNA) from the masked ribosome binding site (RBS), which subsequently allows the downstream translation initiation. Unlike small RNA as a translational activator, the endoribonuclease-based activator is able to efficiently unfold the perfect RBS-crRNA pairing. As an exchangeable module, the crRNA-RBS duplex was forwardly and reversely engineered to modulate the dynamic range of translational activity. We further showed that Csy4 and its recognition site, together as a module, can also be replaced by orthogonal endoribonuclease-recognition site homologues. These modularly structured, high-performance translational activators would endow the programming of gene expression in the translation level with higher feasibility.

Greenhouse Gas Fluxes at the Tablelands, NL, Canada: A Site of Active Serpentinization

NASA Astrophysics Data System (ADS)

Morrill, P. L.; Morrissey, L. S.; Cumming, E.

2016-12-01

Active sites of serpentinization have been proposed as sites for carbon capture and storage (CCS) projects. However, in addition to their ability to convert carbon dioxide to carbonate rock, sites of serpentinization also have the potential release methane, which is a more power greenhouse gas than carbon dioxide. Very little is known about the natural flux of carbon dioxide sequestered and methane released into the atmosphere from active sites of serpentinization. In this study we measured carbon dioxide, methane, and nitrous oxide gas fluxes at a pool of ultra-basic water discharging from serpentinized rock in Winterhouse Canyon, Gros Morne, Newfoundland. We found that the flux of methane released was 4.6 x 10-7 mol/m2/min and the carbon dioxide sequestered was 1.9 x 10-5 mol/m2/min, while the concentrations of nitrous oxide showed little change. Based on these fluxes we calculated predictive climate change parameters such as net radiative forcing and global warming potential which predicted that despite the methane being released the site still had an overall long-term atmospheric cooling effect based on the natural rate of carbon dioxide sequestration.

A Potential Biofilm Metabolite Signature for Caries Activity - A Pilot Clinical Study

PubMed Central

Zandona, F; Soini, HA; Novotny, MV; Santiago, E; Eckert, GJ; Preisser, JS; Benecha, HK; Arthur, RA; Zero, DT

2016-01-01

Background This study's aim was to compare the dental biofilm metabolite-profile of caries-active (N=11) or caries-free (N=4) children by gas chromatography-mass spectrometry (GC/MS) analyses. Methods Samples collected after overnight fasting, with or without a previous glucose rinse, were combined for each child based on the caries status of the site, re-suspended in ethanol and analyzed by GC/MS. Results Biofilm from caries-active sites exhibited a different chromatographic profile compared to caries-free sites. Qualitative and quantitative analysis suggested a special cluster of branched alcohols and esters present at substantially higher intensity in biofilms of caries-active sites. Conclusions This pilot study indicates that there are metabolites present in the biofilm which have the potential to provide a characteristic metabolomics signature for caries activity. PMID:27885354

Systems-level identification of PKA-dependent signaling in epithelial cells.

PubMed

Isobe, Kiyoshi; Jung, Hyun Jun; Yang, Chin-Rang; Claxton, J'Neka; Sandoval, Pablo; Burg, Maurice B; Raghuram, Viswanathan; Knepper, Mark A

2017-10-17

G protein stimulatory α-subunit (G αs )-coupled heptahelical receptors regulate cell processes largely through activation of protein kinase A (PKA). To identify signaling processes downstream of PKA, we deleted both PKA catalytic subunits using CRISPR-Cas9, followed by a "multiomic" analysis in mouse kidney epithelial cells expressing the G αs -coupled V2 vasopressin receptor. RNA-seq (sequencing)-based transcriptomics and SILAC (stable isotope labeling of amino acids in cell culture)-based quantitative proteomics revealed a complete loss of expression of the water-channel gene Aqp2 in PKA knockout cells. SILAC-based quantitative phosphoproteomics identified 229 PKA phosphorylation sites. Most of these PKA targets are thus far unannotated in public databases. Surprisingly, 1,915 phosphorylation sites with the motif x-(S/T)-P showed increased phosphooccupancy, pointing to increased activity of one or more MAP kinases in PKA knockout cells. Indeed, phosphorylation changes associated with activation of ERK2 were seen in PKA knockout cells. The ERK2 site is downstream of a direct PKA site in the Rap1GAP, Sipa1l1, that indirectly inhibits Raf1. In addition, a direct PKA site that inhibits the MAP kinase kinase kinase Map3k5 (ASK1) is upstream of JNK1 activation. The datasets were integrated to identify a causal network describing PKA signaling that explains vasopressin-mediated regulation of membrane trafficking and gene transcription. The model predicts that, through PKA activation, vasopressin stimulates AQP2 exocytosis by inhibiting MAP kinase signaling. The model also predicts that, through PKA activation, vasopressin stimulates Aqp2 transcription through induction of nuclear translocation of the acetyltransferase EP300, which increases histone H3K27 acetylation of vasopressin-responsive genes (confirmed by ChIP-seq).

Improved ethanol electrooxidation performance by shortening Pd–Ni active site distance in Pd–Ni–P nanocatalysts

PubMed Central

Chen, Lin; Lu, Lilin; Zhu, Hengli; Chen, Yueguang; Huang, Yu; Li, Yadong; Wang, Leyu

2017-01-01

Incorporating oxophilic metals into noble metal-based catalysts represents an emerging strategy to improve the catalytic performance of electrocatalysts in fuel cells. However, effects of the distance between the noble metal and oxophilic metal active sites on the catalytic performance have rarely been investigated. Herein, we report on ultrasmall (∼5 nm) Pd–Ni–P ternary nanoparticles for ethanol electrooxidation. The activity is improved up to 4.95 A per mgPd, which is 6.88 times higher than commercial Pd/C (0.72 A per mgPd), by shortening the distance between Pd and Ni active sites, achieved through shape transformation from Pd/Ni–P heterodimers into Pd–Ni–P nanoparticles and tuning the Ni/Pd atomic ratio to 1:1. Density functional theory calculations reveal that the improved activity and stability stems from the promoted production of free OH radicals (on Ni active sites) which facilitate the oxidative removal of carbonaceous poison and combination with CH3CO radicals on adjacent Pd active sites. PMID:28071650

76 FR 39133 - Agency Information Collection Activities: Proposed Collection; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2011-07-05

... assess the adequacy of proposed seismic design bases and the design bases for other site hazards for... sited, designed, constructed, and maintained to withstand geologic hazards, such as faulting, seismic... potential man-made hazards will be appropriately accounted for in the design of nuclear power and test...

Unique active site promotes error-free replication opposite an 8-oxo-guanine lesion by human DNA polymerase iota

PubMed Central

Kirouac, Kevin N.; Ling, Hong

2011-01-01

The 8-oxo-guanine (8-oxo-G) lesion is the most abundant and mutagenic oxidative DNA damage existing in the genome. Due to its dual coding nature, 8-oxo-G causes most DNA polymerases to misincorporate adenine. Human Y-family DNA polymerase iota (polι) preferentially incorporates the correct cytosine nucleotide opposite 8-oxo-G. This unique specificity may contribute to polι’s biological role in cellular protection against oxidative stress. However, the structural basis of this preferential cytosine incorporation is currently unknown. Here we present four crystal structures of polι in complex with DNA containing an 8-oxo-G lesion, paired with correct dCTP or incorrect dATP, dGTP, and dTTP nucleotides. An exceptionally narrow polι active site restricts the purine bases in a syn conformation, which prevents the dual coding properties of 8-oxo-G by inhibiting syn/anti conformational equilibrium. More importantly, the 8-oxo-G base in a syn conformation is not mutagenic in polι because its Hoogsteen edge does not form a stable base pair with dATP in the narrow active site. Instead, the syn 8-oxo-G template base forms the most stable replicating base pair with correct dCTP due to its small pyrimidine base size and enhanced hydrogen bonding with the Hoogsteen edge of 8-oxo-G. In combination with site directed mutagenesis, we show that Gln59 in the finger domain specifically interacts with the additional O8 atom of the lesion base, which influences nucleotide selection, enzymatic efficiency, and replication stalling at the lesion site. Our work provides the structural mechanism of high-fidelity 8-oxo-G replication by a human DNA polymerase. PMID:21300901

Virtual Lead Identification of Farnesyltransferase Inhibitors Based on Ligand and Structure-Based Pharmacophore Techniques

PubMed Central

Al-Balas, Qosay A.; Amawi, Haneen A.; Hassan, Mohammad A.; Qandil, Amjad M.; Almaaytah, Ammar M.; Mhaidat, Nizar M.

2013-01-01

Farnesyltransferase enzyme (FTase) is considered an essential enzyme in the Ras signaling pathway associated with cancer. Thus, designing inhibitors for this enzyme might lead to the discovery of compounds with effective anticancer activity. In an attempt to obtain effective FTase inhibitors, pharmacophore hypotheses were generated using structure-based and ligand-based approaches built in Discovery Studio v3.1. Knowing the presence of the zinc feature is essential for inhibitor’s binding to the active site of FTase enzyme; further customization was applied to include this feature in the generated pharmacophore hypotheses. These pharmacophore hypotheses were thoroughly validated using various procedures such as ROC analysis and ligand pharmacophore mapping. The validated pharmacophore hypotheses were used to screen 3D databases to identify possible hits. Those which were both high ranked and showed sufficient ability to bind the zinc feature in active site, were further refined by applying drug-like criteria such as Lipiniski’s “rule of five” and ADMET filters. Finally, the two candidate compounds (ZINC39323901 and ZINC01034774) were allowed to dock using CDOCKER and GOLD in the active site of FTase enzyme to optimize hit selection. PMID:24276257

Virtual lead identification of farnesyltransferase inhibitors based on ligand and structure-based pharmacophore techniques.

PubMed

Al-Balas, Qosay A; Amawi, Haneen A; Hassan, Mohammad A; Qandil, Amjad M; Almaaytah, Ammar M; Mhaidat, Nizar M

2013-05-27

Farnesyltransferase enzyme (FTase) is considered an essential enzyme in the Ras signaling pathway associated with cancer. Thus, designing inhibitors for this enzyme might lead to the discovery of compounds with effective anticancer activity. In an attempt to obtain effective FTase inhibitors, pharmacophore hypotheses were generated using structure-based and ligand-based approaches built in Discovery Studio v3.1. Knowing the presence of the zinc feature is essential for inhibitor's binding to the active site of FTase enzyme; further customization was applied to include this feature in the generated pharmacophore hypotheses. These pharmacophore hypotheses were thoroughly validated using various procedures such as ROC analysis and ligand pharmacophore mapping. The validated pharmacophore hypotheses were used to screen 3D databases to identify possible hits. Those which were both high ranked and showed sufficient ability to bind the zinc feature in active site, were further refined by applying drug-like criteria such as Lipiniski's "rule of five" and ADMET filters. Finally, the two candidate compounds (ZINC39323901 and ZINC01034774) were allowed to dock using CDOCKER and GOLD in the active site of FTase enzyme to optimize hit selection.

Environmental restoration and waste management: Robotics technology development program: Robotics 5-year program plan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

In FY 1990 Robotics Technology Development Program (RTDP) planning teams visited five DOE sites. These sites were selected by the Office of Technology Development to provide a needs basis for developing a 5-Year Plan. Visits to five DOE sites provided identification of needs for robotics technology development to support Environmental Restoration and Waste Management (ER WM) projects at those sites. Additional site visits will be conducted in the future to expand the planning basis. This volume summarizes both the results of the site visits and the needs and requirements of the priority ER WM activities at the sites, including potentialmore » needs for robotics and remote systems technology. It also discusses hazards associated with the site activities and any problems or technical uncertainties associated with dealing with the hazards in the performance of the ER WM work. Robotic or remote systems currently under development for remediation projects or waste operations are also discussed. The information in this document is organized principally by site, activity, and priority. Section 2.0, Site Needs, is based on information from the site visit reports and provides a summary which focuses on the site needs and requirements for each priority activity. Section 2.0 also records evaluations and discussions by the RTDP team following the site visit. Section 3.0, Commonality Assessment, documents similar site needs where common, or cross-cutting, robotics technology might be applied to several activities. Section 4.0 contains a summary of the site needs and requirements in tabular form. 1 tab.« less

Crystal structure of Escherichia coli diaminopropionate ammonia-lyase reveals mechanism of enzyme activation and catalysis.

PubMed

Bisht, Shveta; Rajaram, Venkatesan; Bharath, Sakshibeedu R; Kalyani, Josyula Nitya; Khan, Farida; Rao, Appaji N; Savithri, Handanahal S; Murthy, Mathur R N

2012-06-08

Pyridoxal 5'-phosphate (PLP)-dependent enzymes utilize the unique chemistry of a pyridine ring to carry out diverse reactions involving amino acids. Diaminopropionate (DAP) ammonia-lyase (DAPAL) is a prokaryotic PLP-dependent enzyme that catalyzes the degradation of d- and l-forms of DAP to pyruvate and ammonia. Here, we report the first crystal structure of DAPAL from Escherichia coli (EcDAPAL) in tetragonal and monoclinic forms at 2.0 and 2.2 Å resolutions, respectively. Structures of EcDAPAL soaked with substrates were also determined. EcDAPAL has a typical fold type II PLP-dependent enzyme topology consisting of a large and a small domain with the active site at the interface of the two domains. The enzyme is a homodimer with a unique biological interface not observed earlier. Structure of the enzyme in the tetragonal form had PLP bound at the active site, whereas the monoclinic structure was in the apo-form. Analysis of the apo and holo structures revealed that the region around the active site undergoes transition from a disordered to ordered state and assumes a conformation suitable for catalysis only upon PLP binding. A novel disulfide was found to occur near a channel that is likely to regulate entry of ligands to the active site. EcDAPAL soaked with dl-DAP revealed density at the active site appropriate for the reaction intermediate aminoacrylate, which is consistent with the observation that EcDAPAL has low activity under crystallization conditions. Based on the analysis of the structure and results of site-directed mutagenesis, a two-base mechanism of catalysis involving Asp(120) and Lys(77) is suggested.

Quantitative functional characterization of conserved molecular interactions in the active site of mannitol 2-dehydrogenase

PubMed Central

Lucas, James E; Siegel, Justin B

2015-01-01

Enzyme active site residues are often highly conserved, indicating a significant role in function. In this study we quantitate the functional contribution for all conserved molecular interactions occurring within a Michaelis complex for mannitol 2-dehydrogenase derived from Pseudomonas fluorescens (pfMDH). Through systematic mutagenesis of active site residues, we reveal that the molecular interactions in pfMDH mediated by highly conserved residues not directly involved in reaction chemistry can be as important to catalysis as those directly involved in the reaction chemistry. This quantitative analysis of the molecular interactions within the pfMDH active site provides direct insight into the functional role of each molecular interaction, several of which were unexpected based on canonical sequence conservation and structural analyses. PMID:25752240

Site-Specific Measurement of Water Dynamics in the Substrate Pocket of Ketosteroid Isomerase Using Time-Resolved Vibrational Spectroscopy

PubMed Central

Jha, Santosh Kumar; Ji, Minbiao; Gaffney, Kelly J.; Boxer, Steven G.

2012-01-01

Little is known about the reorganization capacity of water molecules at the active sites of enzymes and how this couples to the catalytic reaction. Here, we study the dynamics of water molecules at the active site of a highly proficient enzyme, Δ5-3-ketosteroid isomerase (KSI), during a light-activated mimic of its catalytic cycle. Photo-excitation of a nitrile containing photo-acid, coumarin183 (C183), mimics the change in charge density that occurs at the active site of KSI during the first step of the catalytic reaction. The nitrile of C183 is exposed to water when bound to the KSI active site, and we used time-resolved vibrational spectroscopy as a site-specific probe to study the solvation dynamics of water molecules in the vicinity of the nitrile. We observed that water molecules at the active site of KSI are highly rigid, during the light-activated catalytic cycle, compared to the solvation dynamics observed in bulk water. Based upon this result we hypothesize that rigid water dipoles at the active site might help in the maintenance of the pre-organized electrostatic environment required for efficient catalysis. The results also demonstrate the utility of nitrile probes in measuring the dynamics of local (H-bonded) water molecules in contrast to the commonly used fluorescence methods which measure the average behavior of primary and subsequent spheres of solvation. PMID:22931297

Towards novel therapeutics for HIV through fragment-based screening and drug design.

PubMed

Tiefendbrunn, Theresa; Stout, C David

2014-01-01

Fragment-based drug discovery has been applied with varying levels of success to a number of proteins involved in the HIV (Human Immunodeficiency Virus) life cycle. Fragment-based approaches have led to the discovery of novel binding sites within protease, reverse transcriptase, integrase, and gp41. Novel compounds that bind to known pockets within CCR5 have also been identified via fragment screening, and a fragment-based approach to target the TAR-Tat interaction was explored. In the context of HIV-1 reverse transcriptase (RT), fragment-based approaches have yielded fragment hits with mid-μM activity in an in vitro activity assay, as well as fragment hits that are active against drug-resistant variants of RT. Fragment-based drug discovery is a powerful method to elucidate novel binding sites within proteins, and the method has had significant success in the context of HIV proteins.

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Computational active site analysis of molecular pathways to improve functional classification of enzymes.

PubMed

Ozyurt, A Sinem; Selby, Thomas L

2008-07-01

This study describes a method to computationally assess the function of homologous enzymes through small molecule binding interaction energy. Three experimentally determined X-ray structures and four enzyme models from ornithine cyclo-deaminase, alanine dehydrogenase, and mu-crystallin were used in combination with nine small molecules to derive a function score (FS) for each enzyme-model combination. While energy values varied for a single molecule-enzyme combination due to differences in the active sites, we observe that the binding energies for the entire pathway were proportional for each set of small molecules investigated. This proportionality of energies for a reaction pathway appears to be dependent on the amino acids in the active site and their direct interactions with the small molecules, which allows a function score (FS) to be calculated to assess the specificity of each enzyme. Potential of mean force (PMF) calculations were used to obtain the energies, and the resulting FS values demonstrate that a measurement of function may be obtained using differences between these PMF values. Additionally, limitations of this method are discussed based on: (a) larger substrates with significant conformational flexibility; (b) low homology enzymes; and (c) open active sites. This method should be useful in accurately predicting specificity for single enzymes that have multiple steps in their reactions and in high throughput computational methods to accurately annotate uncharacterized proteins based on active site interaction analysis. 2008 Wiley-Liss, Inc.

Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

PubMed

Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

2003-04-01

Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

Active-site monovalent cations revealed in a 1.55-Å-resolution hammerhead ribozyme structure.

PubMed

Anderson, Michael; Schultz, Eric P; Martick, Monika; Scott, William G

2013-10-23

We have obtained a 1.55-Å crystal structure of a hammerhead ribozyme derived from Schistosoma mansoni under conditions that permit detailed observations of Na(+) ion binding in the ribozyme's active site. At least two such Na(+) ions are observed. The first Na(+) ion binds to the N7 of G10.1 and the adjacent A9 phosphate in a manner identical with that previously observed for divalent cations. A second Na(+) ion binds to the Hoogsteen face of G12, the general base in the hammerhead cleavage reaction, thereby potentially dissipating the negative charge of the catalytically active enolate form of the nucleotide base. A potential but more ambiguous third site bridges the A9 and scissile phosphates in a manner consistent with that of previous predictions. Hammerhead ribozymes have been observed to be active in the presence of high concentrations of monovalent cations, including Na(+), but the mechanism by which monovalent cations substitute for divalent cations in hammerhead catalysis remains unclear. Our results enable us to suggest that Na(+) directly and specifically substitutes for divalent cations in the hammerhead active site. The detailed geometry of the pre-catalytic active-site complex is also revealed with a new level of precision, thanks to the quality of the electron density maps obtained from what is currently the highest-resolution ribozyme structure in the Protein Data Bank. Copyright © 2013 Elsevier Ltd. All rights reserved.

An evaluation of the behaviour-change techniques used on Canadian cancer centre Web sites to support physical activity behaviour for breast cancer survivors

PubMed Central

Sylvester, B.D.; Zammit, K.; Fong, A.J.; Sabiston, C.M.

2017-01-01

Background Cancer centre Web sites can be a useful tool for distributing information about the benefits of physical activity for breast cancer (bca) survivors, and they hold potential for supporting health behaviour change. However, the extent to which cancer centre Web sites use evidence-based behaviour change techniques to foster physical activity behaviour among bca survivors is currently unknown. The aim of our study was to evaluate the presentation of behaviour-change techniques on Canadian cancer centre Web sites to promote physical activity behaviour for bca survivors. Methods All Canadian cancer centre Web sites (n = 39) were evaluated by two raters using the Coventry, Aberdeen, and London–Refined (calo-re) taxonomy of behaviour change techniques and the eEurope 2002 Quality Criteria for Health Related Websites. Descriptive statistics were calculated. Results The most common behaviour change techniques used on Web sites were providing information about consequences in general (80%), suggesting goal-setting behaviour (56%), and planning social support or social change (46%). Overall, Canadian cancer centre Web sites presented an average of M = 6.31 behaviour change techniques (of 40 that were coded) to help bca survivors increase their physical activity behaviour. Evidence of quality factors ranged from 90% (sites that provided evidence of readability) to 0% (sites that provided an editorial policy). Conclusions Our results provide preliminary evidence that, of 40 behaviour-change techniques that were coded, fewer than 20% were used to promote physical activity behaviour to bca survivors on cancer centre Web sites, and that the most effective techniques were inconsistently used. On cancer centre Web sites, health promotion specialists could focus on emphasizing knowledge mobilization efforts using available research into behaviour-change techniques to help bca survivors increase their physical activity. PMID:29270056

An evaluation of the behaviour-change techniques used on Canadian cancer centre Web sites to support physical activity behaviour for breast cancer survivors.

PubMed

Sylvester, B D; Zammit, K; Fong, A J; Sabiston, C M

2017-12-01

Cancer centre Web sites can be a useful tool for distributing information about the benefits of physical activity for breast cancer (bca) survivors, and they hold potential for supporting health behaviour change. However, the extent to which cancer centre Web sites use evidence-based behaviour change techniques to foster physical activity behaviour among bca survivors is currently unknown. The aim of our study was to evaluate the presentation of behaviour-change techniques on Canadian cancer centre Web sites to promote physical activity behaviour for bca survivors. All Canadian cancer centre Web sites ( n = 39) were evaluated by two raters using the Coventry, Aberdeen, and London-Refined (calo-re) taxonomy of behaviour change techniques and the eEurope 2002 Quality Criteria for Health Related Websites. Descriptive statistics were calculated. The most common behaviour change techniques used on Web sites were providing information about consequences in general (80%), suggesting goal-setting behaviour (56%), and planning social support or social change (46%). Overall, Canadian cancer centre Web sites presented an average of M = 6.31 behaviour change techniques (of 40 that were coded) to help bca survivors increase their physical activity behaviour. Evidence of quality factors ranged from 90% (sites that provided evidence of readability) to 0% (sites that provided an editorial policy). Our results provide preliminary evidence that, of 40 behaviour-change techniques that were coded, fewer than 20% were used to promote physical activity behaviour to bca survivors on cancer centre Web sites, and that the most effective techniques were inconsistently used. On cancer centre Web sites, health promotion specialists could focus on emphasizing knowledge mobilization efforts using available research into behaviour-change techniques to help bca survivors increase their physical activity.

Orthogonal use of a human tRNA synthetase active site to achieve multi-functionality

PubMed Central

Zhou, Quansheng; Kapoor, Mili; Guo, Min; Belani, Rajesh; Xu, Xiaoling; Kiosses, William B.; Hanan, Melanie; Park, Chulho; Armour, Eva; Do, Minh-Ha; Nangle, Leslie A.; Schimmel, Paul; Yang, Xiang-Lei

2011-01-01

Protein multi-functionality is an emerging explanation for the complexity of higher organisms. In this regard, while aminoacyl tRNA synthetases catalyze amino acid activation for protein synthesis, some also act in pathways for inflammation, angiogenesis, and apoptosis. How multiple functions evolved and their relationship to the active site is not clear. Here structural modeling analysis, mutagenesis, and cell-based functional studies show that the potent angiostatic, natural fragment of human TrpRS associates via Trp side chains that protrude from the cognate cellular receptor VE-cadherin. Modeling indicates that (I prefer the way it was because the conclusion was reached not only by modeling, but more so by experimental studies.)VE-cadherin Trp side chains fit into the Trp-specific active site of the synthetase. Thus, specific side chains of the receptor mimic (?) amino acid substrates and expand the functionality of the active site of the synthetase. We propose that orthogonal use of the same active site may be a general way to develop multi-functionality of human tRNA synthetases and other proteins. PMID:20010843

An integrated approach for identifying priority contaminant in ...

EPA Pesticide Factsheets

Environmental assessment of complex mixtures typically requires integration of chemical and biological measurements. This study demonstrates the use of a combination of instrumental chemical analyses, effects-based monitoring, and bio-effects prediction approaches to help identify potential hazards and priority contaminants in two Great Lakes Areas of Concern (AOCs), the Lower Green Bay/Fox River located near Green Bay, WI, USA and the Milwaukee River Estuary, located near Milwaukee, WI, USA. Fathead minnows were caged at four sites within each AOC (eight sites total). Following 4 d of in situ exposure, tissues and biofluids were sampled and used for targeted biological effects analyses. Additionally, 4 d composite water samples were collected concurrently at each caged fish site and analyzed for 134 analytes as well as evaluated for total estrogenic and androgenic activity using cell-based bioassays. Of the analytes examined, 75 were detected in composite samples from at least one site. Based on multiple analyses, one site in the East River and another site near a paper mill discharge from lower Green Bay/Fox River AOC, were prioritized due to their estrogenic and androgenic acitvity, respectively. The water samples from other sites generally did not exhibit significant estrogenic or androgenic activity, nor was there evidence for endocrine disruption in the fish exposed at these sites as indicated the the lack of alterations in ex vivo steroid production, c

Generation of basic centers in high-silica zeolites and their application in gas-phase upgrading of bio-oil.

PubMed

Keller, Tobias C; Rodrigues, Elodie G; Pérez-Ramírez, Javier

2014-06-01

High-silica zeolites have been reported recently as efficient catalysts for liquid- and gas-phase condensation reactions because of the presence of a complementary source of basicity compared to Al-rich basic zeolites. Herein, we describe the controlled generation of these active sites on silica-rich FAU, BEA, and MFI zeolites. Through the application of a mild base treatment in aqueous Na2CO3, alkali-metal-coordinating defects are generated within the zeolite whereas the porous properties are fully preserved. The resulting catalysts were applied in the gas-phase condensation of propanal at 673 K as a model reaction for the catalytic upgrading of pyrolysis oil, for which an up to 20-fold increased activity compared to the unmodified zeolites was attained. The moderate basicity of these new sites leads to a coke resistance superior to traditional base catalysts such as CsX and MgO, and comparable activity and excellent selectivity is achieved for the condensation pathways. Through strategic acid and base treatments and the use of magic-angle spinning NMR spectroscopy, the nature of the active sites was investigated, which supports the theory of siloxy sites as basic centers. This contribution represents a key step in the understanding and design of high-silica base catalysts for the intermediate deoxygenation of crude bio-oil prior to the hydrotreating step for the production of second-generation biofuels. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Information Architecture for Bilingual Web Sites.

ERIC Educational Resources Information Center

Cunliffe, Daniel; Jones, Helen; Jarvis, Melanie; Egan, Kevin; Huws, Rhian; Munro, Sian

2002-01-01

Discusses creating an information architecture for a bilingual Web site and reports work in progress on the development of a content-based bilingual Web site to facilitate shared resources between speech and language therapists. Considers a structural analysis of existing bilingual Web designs and explains a card-sorting activity conducted with…

Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

NASA Technical Reports Server (NTRS)

D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

2002-01-01

Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

Open challenges in structure-based virtual screening: Receptor modeling, target flexibility consideration and active site water molecules description.

PubMed

Spyrakis, Francesca; Cavasotto, Claudio N

2015-10-01

Structure-based virtual screening is currently an established tool in drug lead discovery projects. Although in the last years the field saw an impressive progress in terms of algorithm development, computational performance, and retrospective and prospective applications in ligand identification, there are still long-standing challenges where further improvement is needed. In this review, we consider the conceptual frame, state-of-the-art and recent developments of three critical "structural" issues in structure-based drug lead discovery: the use of homology modeling to accurately model the binding site when no experimental structures are available, the necessity of accounting for the dynamics of intrinsically flexible systems as proteins, and the importance of considering active site water molecules in lead identification and optimization campaigns. Copyright © 2015 Elsevier Inc. All rights reserved.

A unique dual recognition hairpin probe mediated fluorescence amplification method for sensitive detection of uracil-DNA glycosylase and endonuclease IV activities.

PubMed

Wu, Yushu; Yan, Ping; Xu, Xiaowen; Jiang, Wei

2016-03-07

Uracil-DNA glycosylase (UDG) and endonuclease IV (Endo IV) play cooperative roles in uracil base-excision repair (UBER) and inactivity of either will interrupt the UBER to cause disease. Detection of UDG and Endo IV activities is crucial to evaluate the UBER process in fundamental research and diagnostic application. Here, a unique dual recognition hairpin probe mediated fluorescence amplification method was developed for sensitively and selectively detecting UDG and Endo IV activities. For detecting UDG activity, the uracil base in the probe was excised by the target enzyme to generate an apurinic/apyrimidinic (AP) site, achieving the UDG recognition. Then, the AP site was cleaved by a tool enzyme Endo IV, releasing a primer to trigger rolling circle amplification (RCA) reaction. Finally, the RCA reaction produced numerous repeated G-quadruplex sequences, which interacted with N-methyl-mesoporphyrin IX to generate an enhanced fluorescence signal. Alternatively, for detecting Endo IV activity, the uracil base in the probe was first converted into an AP site by a tool enzyme UDG. Next, the AP site was cleaved by the target enzyme, achieving the Endo IV recognition. The signal was then generated and amplified in the same way as those in the UDG activity assay. The detection limits were as low as 0.00017 U mL(-1) for UDG and 0.11 U mL(-1) for Endo IV, respectively. Moreover, UDG and Endo IV can be well distinguished from their analogs. This method is beneficial for properly evaluating the UBER process in function studies and disease prognoses.

Optimization of strand displacement amplification-sensitized G-quadruplex DNAzyme-based sensing system and its application in activity detection of uracil-DNA glycosylase.

PubMed

Du, Yi-Chen; Jiang, Hong-Xin; Huo, Yan-Fang; Han, Gui-Mei; Kong, De-Ming

2016-03-15

As an isothermal nucleic acid amplification technique, strand displacement amplification (SDA) reaction has been introduced in G-quadruplex DNAzyme-based sensing system to improve the sensing performance. To further provide useful information for the design of SDA-amplified G-quadruplex DNAzyme-based sensors, the effects of nicking site number in SDA template DNA were investigated. With the increase of the nicking site number from 1 to 2, enrichment of G-quadruplex DNAzyme by SDA is changed from a linear amplification to an exponential amplification, thus greatly increasing the amplification efficiency and subsequently improving the sensing performance of corresponding sensing system. The nicking site number cannot be further increased because more nicking sites might result in high background signals. However, we demonstrated that G-quadruplex DNAzyme enrichment efficiency could be further improved by introducing a cross-triggered SDA strategy, in which two templates each has two nicking sites are used. To validate the proposed cross-triggered SDA strategy, we used it to develop a sensing platform for the detection of uracil-DNA glycosylase (UDG) activity. The sensor enables sensitive detection of UDG activity in the range of 1 × 10(-4)-1 U/mL with a detection limit of 1 × 10(-4)U/mL. Copyright © 2015 Elsevier B.V. All rights reserved.

24 CFR 92.206 - Eligible project costs.

Code of Federal Regulations, 2013 CFR

2013-04-01

... lead-based paint activities, as required by part 35 of this title. (3) For both new construction and... on-site roads and sewer and water lines necessary to the development of the project. The project site...

24 CFR 92.206 - Eligible project costs.

Code of Federal Regulations, 2011 CFR

2011-04-01

... lead-based paint activities, as required by part 35 of this title. (3) For both new construction and... on-site roads and sewer and water lines necessary to the development of the project. The project site...

24 CFR 92.206 - Eligible project costs.

Code of Federal Regulations, 2012 CFR

2012-04-01

... lead-based paint activities, as required by part 35 of this title. (3) For both new construction and... on-site roads and sewer and water lines necessary to the development of the project. The project site...

Detection of damaged DNA bases by DNA glycosylase enzymes.

PubMed

Friedman, Joshua I; Stivers, James T

2010-06-22

A fundamental and shared process in all forms of life is the use of DNA glycosylase enzymes to excise rare damaged bases from genomic DNA. Without such enzymes, the highly ordered primary sequences of genes would rapidly deteriorate. Recent structural and biophysical studies are beginning to reveal a fascinating multistep mechanism for damaged base detection that begins with short-range sliding of the glycosylase along the DNA chain in a distinct conformation we call the search complex (SC). Sliding is frequently punctuated by the formation of a transient "interrogation" complex (IC) where the enzyme extrahelically inspects both normal and damaged bases in an exosite pocket that is distant from the active site. When normal bases are presented in the exosite, the IC rapidly collapses back to the SC, while a damaged base will efficiently partition forward into the active site to form the catalytically competent excision complex (EC). Here we review the unique problems associated with enzymatic detection of rare damaged DNA bases in the genome and emphasize how each complex must have specific dynamic properties that are tuned to optimize the rate and efficiency of damage site location.

Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

PubMed Central

Been, M D; Perrotta, A T

1995-01-01

A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

Identification of essential histidine residues in the active site of Escherichia coli xylose (glucose) isomerase.

PubMed Central

Batt, C A; Jamieson, A C; Vandeyar, M A

1990-01-01

Two conserved histidine residues (His-101 and His-271) appear to be essential components in the active site of the enzyme xylose (glucose) isomerase (EC 5.3.1.5). These amino acid residues were targeted for mutagenesis on the basis of sequence homology among xylose isomerases isolated from Escherichia coli, Bacillus subtilis, Ampullariella sp. strain 3876, and Streptomyces violaceus-niger. Each residue was selectively replaced by site-directed mutagenesis and shown to be essential for activity. No measurable activity was observed for any mutations replacing either His-101 or His-271. Circular dichroism measurements revealed no significant change in the overall conformation of the mutant enzymes, and all formed dimers similar to the wild-type enzyme. Mutations at His-271 could be distinguished from those at His-101, since the former resulted in a thermolabile protein whereas no significant change in heat stability was observed for the latter. Based upon these results and structural data recently reported, we speculate that His-101 is the catalytic base mediating the reaction. Replacement of His-271 may render the enzyme thermolabile, since this residue appears to be a ligand for one of the metal ions in the active site of the enzyme. Images PMID:2405386

Purification and Kinetics of Higher Plant NADH:Nitrate Reductase.

PubMed

Campbell, W H; Smarrelli, J

1978-04-01

Squash cotyledon (Cucurbita pepo L.) NADH:nitrate reductase (NR) was purified 150-fold with 50% recovery by a single step procedure based on the affinity of the NR for blue-Sepharose. Blue-Sepharose, which is prepared by direct coupling of Cibacron blue to Sepharose, appears to bind squash NR at the NADH site. The NR can be purified in 2 to 3 hours to a specific activity of 2 mumol of NADH oxidized/minute * milligram of protein. Corn (Zea mays L.) leaf NR was also purified to a specific activity of 6.9 mumol of NADH oxidized/minute * milligram of protein using a blue-Sepharose affinity step. The blue-Sepharose method offers the advantages of a rapid purification of plant NR to a high specific activity with reasonable recovery of total activity.The kinetic mechanism of higher plant NR was investigated using these highly purified squash and corn NR preparations. Based on initial velocity and product inhibition studies utilizing both enzymes, a two-site ping-pong mechanism is proposed for NR. This kinetic mechanism incorporates the concept of the reduced NR transferring electrons from the NADH site to a physically separated nitrate site.

Conservation and Role of Electrostatics in Thymidylate Synthase.

PubMed

Garg, Divita; Skouloubris, Stephane; Briffotaux, Julien; Myllykallio, Hannu; Wade, Rebecca C

2015-11-27

Conservation of function across families of orthologous enzymes is generally accompanied by conservation of their active site electrostatic potentials. To study the electrostatic conservation in the highly conserved essential enzyme, thymidylate synthase (TS), we conducted a systematic species-based comparison of the electrostatic potential in the vicinity of its active site. Whereas the electrostatics of the active site of TS are generally well conserved, the TSs from minimal organisms do not conform to the overall trend. Since the genomes of minimal organisms have a high thymidine content compared to other organisms, the observation of non-conserved electrostatics was surprising. Analysis of the symbiotic relationship between minimal organisms and their hosts, and the genetic completeness of the thymidine synthesis pathway suggested that TS from the minimal organism Wigglesworthia glossinidia (W.g.b.) must be active. Four residues in the vicinity of the active site of Escherichia coli TS were mutated individually and simultaneously to mimic the electrostatics of W.g.b TS. The measured activities of the E. coli TS mutants imply that conservation of electrostatics in the region of the active site is important for the activity of TS, and suggest that the W.g.b. TS has the minimal activity necessary to support replication of its reduced genome.

Non-active site mutation (Q123A) in New Delhi metallo-β-lactamase (NDM-1) enhanced its enzyme activity.

PubMed

Ali, Abid; Azam, Mohd W; Khan, Asad U

2018-06-01

New Delhi metallo β-lactamase-1 is one of the carbapenemases, causing hydrolysis of almost all β-lactamase antibiotics. Seventeen different NDM variants have been reported so far, they varied in their sequences either by single or multiple amino acid substitutions. Hence, it is important to understand its structural and functional relation. In the earlier studies role of active site residues has been studied but non-active site residues has not studied in detail. Therefore, we have initiated to further comprehend its structure and function relation by mutating some of its non-active site residues. A laboratory mutant of NDM-1 was generated by PCR-based site-directed mutagenesis, replacing Q to A at 123 position. The MICs of imipenem and meropenem for NDM-1 Q123A were found increased by 2 fold as compare to wild type and so the hydrolytic activity was enhanced (Kcat/Km) as compared to NDM-1 wild type. GOLD fitness scores were also found in favour of kinetics data. Secondary structure for α-helical content was determined by Far-UV circular dichroism (CD), which showed significant conformational changes. We conclude a noteworthy role of non-active-site amino acid residues in the catalytic activity of NDM-1. This study also provides an insight of emergence of new variants through natural evolution. Copyright © 2018 Elsevier B.V. All rights reserved.

Structure-based design of bacterial nitric oxide synthase inhibitors

DOE PAGES

Holden, Jeffrey K.; Kang, Soosung; Hollingsworth, Scott A.; ...

2014-12-18

Inhibition of bacterial nitric oxide synthase (bNOS) has the potential to improve the efficacy of antimicrobials used to treat infections by Gram-positive pathogens Staphylococcus aureus and Bacillus anthracis. However, inhibitor specificity toward bNOS over the mammalian NOS (mNOS) isoforms remains a challenge because of the near identical NOS active sites. One key structural difference between the NOS isoforms is the amino acid composition of the pterin cofactor binding site that is adjacent to the NOS active site. Previously, we demonstrated that a NOS inhibitor targeting both the active and pterin sites was potent and functioned as an antimicrobial. Here wemore » present additional crystal structures, binding analyses, and bacterial killing studies of inhibitors that target both the active and pterin sites of a bNOS and function as antimicrobials. Lastly, these data provide a framework for continued development of bNOS inhibitors, as each molecule represents an excellent chemical scaffold for the design of isoform selective bNOS inhibitors.« less

DNA damage during the G0/G1 phase triggers RNA-templated, Cockayne syndrome B-dependent homologous recombination.

PubMed

Wei, Leizhen; Nakajima, Satoshi; Böhm, Stefanie; Bernstein, Kara A; Shen, Zhiyuan; Tsang, Michael; Levine, Arthur S; Lan, Li

2015-07-07

Damage repair mechanisms at transcriptionally active sites during the G0/G1 phase are largely unknown. To elucidate these mechanisms, we introduced genome site-specific oxidative DNA damage and determined the role of transcription in repair factor assembly. We find that KU and NBS1 are recruited to damage sites independent of transcription. However, assembly of RPA1, RAD51C, RAD51, and RAD52 at such sites is strictly governed by active transcription and requires both wild-type Cockayne syndrome protein B (CSB) function and the presence of RNA in the G0/G1 phase. We show that the ATPase activity of CSB is indispensable for loading and binding of the recombination factors. CSB counters radiation-induced DNA damage in both cells and zebrafish models. Taken together, our results have uncovered a novel, RNA-based recombination mechanism by which CSB protects genome stability from strand breaks at transcriptionally active sites and may provide insight into the clinical manifestations of Cockayne syndrome.

77 FR 3768 - Agency Information Collection Activities; Proposed Collection; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-25

... the TSCA Section 8(b) Inventory Data Base, Production and Site Reports'' and identified by EPA ICR No... section 8. Title: Partial Update of the TSCA Section 8(b) Inventory Data Base, Production and Site Reports... assumptions that you used. 3. Provide copies of any technical information and/or data you used that support...

Active chemisorption sites in functionalized ionic liquids for carbon capture.

PubMed

Cui, Guokai; Wang, Jianji; Zhang, Suojiang

2016-07-25

Development of novel technologies for the efficient and reversible capture of CO2 is highly desired. In the last decade, CO2 capture using ionic liquids has attracted intensive attention from both academia and industry, and has been recognized as a very promising technology. Recently, a new approach has been developed for highly efficient capture of CO2 by site-containing ionic liquids through chemical interaction. This perspective review focuses on the recent advances in the chemical absorption of CO2 using site-containing ionic liquids, such as amino-based ionic liquids, azolate ionic liquids, phenolate ionic liquids, dual-functionalized ionic liquids, pyridine-containing ionic liquids and so on. Other site-containing liquid absorbents such as amine-based solutions, switchable solvents, and functionalized ionic liquid-amine blends are also investigated. Strategies have been discussed for how to activate the existent reactive sites and develop novel reactive sites by physical and chemical methods to enhance CO2 absorption capacity and reduce absorption enthalpy. The carbon capture mechanisms of these site-containing liquid absorbents are also presented. Particular attention has been paid to the latest progress in CO2 capture in multiple-site interactions by amino-free anion-functionalized ionic liquids. In the last section, future directions and prospects for carbon capture by site-containing ionic liquids are outlined.

Enzyme/non-enzyme discrimination and prediction of enzyme active site location using charge-based methods.

PubMed

Bate, Paul; Warwicker, Jim

2004-07-02

Calculations of charge interactions complement analysis of a characterised active site, rationalising pH-dependence of activity and transition state stabilisation. Prediction of active site location through large DeltapK(a)s or electrostatic strain is relevant for structural genomics. We report a study of ionisable groups in a set of 20 enzymes, finding that false positives obscure predictive potential. In a larger set of 156 enzymes, peaks in solvent-space electrostatic properties are calculated. Both electric field and potential match well to active site location. The best correlation is found with electrostatic potential calculated from uniform charge density over enzyme volume, rather than from assignment of a standard atom-specific charge set. Studying a shell around each molecule, for 77% of enzymes the potential peak is within that 5% of the shell closest to the active site centre, and 86% within 10%. Active site identification by largest cleft, also with projection onto a shell, gives 58% of enzymes for which the centre of the largest cleft lies within 5% of the active site, and 70% within 10%. Dielectric boundary conditions emphasise clefts in the uniform charge density method, which is suited to recognition of binding pockets embedded within larger clefts. The variation of peak potential with distance from active site, and comparison between enzyme and non-enzyme sets, gives an optimal threshold distinguishing enzyme from non-enzyme. We find that 87% of the enzyme set exceeds the threshold as compared to 29% of the non-enzyme set. Enzyme/non-enzyme homologues, "structural genomics" annotated proteins and catalytic/non-catalytic RNAs are studied in this context.

34 CFR 380.5 - What activities may the Secretary fund under community-based supported employment projects?

Code of Federal Regulations, 2014 CFR

2014-07-01

... development, including work site modification and use of advanced learning technology for skills training. (3...-based supported employment projects? 380.5 Section 380.5 Education Regulations of the Offices of the... the Secretary fund under community-based supported employment projects? (a) Authorized activities. The...

34 CFR 380.5 - What activities may the Secretary fund under community-based supported employment projects?

Code of Federal Regulations, 2012 CFR

2012-07-01

... development, including work site modification and use of advanced learning technology for skills training. (3...-based supported employment projects? 380.5 Section 380.5 Education Regulations of the Offices of the... the Secretary fund under community-based supported employment projects? (a) Authorized activities. The...

34 CFR 380.5 - What activities may the Secretary fund under community-based supported employment projects?

Code of Federal Regulations, 2013 CFR

2013-07-01

... development, including work site modification and use of advanced learning technology for skills training. (3...-based supported employment projects? 380.5 Section 380.5 Education Regulations of the Offices of the... the Secretary fund under community-based supported employment projects? (a) Authorized activities. The...

Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

PubMed

Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

2014-10-01

Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

Database for landscape-scale carbon monitoring sites

Treesearch

Jason A. Cole; Kristopher D. Johnson; Richard A. Birdsey; Yude Pan; Craig A. Wayson; Kevin McCullough; Coeli M. Hoover; David Y. Hollinger; John B. Bradford; Michael G. Ryan; Randall K. Kolka; Peter Wieshampel; Kenneth L. Clark; Nicholas S. Skowronski; John Hom; Scott V. Ollinger; Steven G. McNulty; Michael J. Gavazzi

2013-01-01

This report describes the database used to compile, store, and manage intensive ground-based biometric data collected at research sites in Colorado, Minnesota, New Hampshire, New Jersey, North Carolina, and Wyoming, supporting research activities of the U.S. North American Carbon Program (NACP). This report also provides details of each site, the sampling design and...

Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB

PubMed Central

Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria

2016-01-01

Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114

Detection of Tuberculosis Infection Hotspots Using Activity Spaces Based Spatial Approach in an Urban Tokyo, from 2003 to 2011.

PubMed

Izumi, Kiyohiko; Ohkado, Akihiro; Uchimura, Kazuhiro; Murase, Yoshiro; Tatsumi, Yuriko; Kayebeta, Aya; Watanabe, Yu; Ishikawa, Nobukatsu

2015-01-01

Identifying ongoing tuberculosis infection sites is crucial for breaking chains of transmission in tuberculosis-prevalent urban areas. Previous studies have pointed out that detection of local accumulation of tuberculosis patients based on their residential addresses may be limited by a lack of matching between residences and tuberculosis infection sites. This study aimed to identify possible tuberculosis hotspots using TB genotype clustering statuses and a concept of "activity space", a place where patients spend most of their waking hours. We further compared the spatial distribution by different residential statuses and describe urban environmental features of the detected hotspots. Culture-positive tuberculosis patients notified to Shinjuku city from 2003 to 2011 were enrolled in this case-based cross-sectional study, and their demographic and clinical information, TB genotype clustering statuses, and activity space were collected. Spatial statistics (Global Moran's I and Getis-Ord Gi* statistics) identified significant hotspots in 152 census tracts, and urban environmental features and tuberculosis patients' characteristics in these hotspots were assessed. Of the enrolled 643 culture-positive tuberculosis patients, 416 (64.2%) were general inhabitants, 42 (6.5%) were foreign-born people, and 184 were homeless people (28.6%). The percentage of overall genotype clustering was 43.7%. Genotype-clustered general inhabitants and homeless people formed significant hotspots around a major railway station, whereas the non-clustered general inhabitants formed no hotspots. This suggested the detected hotspots of activity spaces may reflect ongoing tuberculosis transmission sites and were characterized by smaller residential floor size and a higher proportion of non-working households. Activity space-based spatial analysis suggested possible TB transmission sites around the major railway station and it can assist in further comprehension of TB transmission dynamics in an urban setting in Japan.

Critical Amino Acids in the Active Site of Meprin Metalloproteinases for Substrate and Peptide Bond Specificity*

PubMed Central

Villa, James P.; Bertenshaw, Greg P.; Bond, Judith S.

2008-01-01

SUMMARY The protease domains of the evolutionarily-related α and ß subunits of meprin metalloproteases are approximately 55% identical at the amino acid level, however, their substrate and peptide bond specificities differ markedly. The meprin ß subunit favors acidic residues proximal to the scissile bond, while the α subunit prefers small or aromatic amino acids flanking the scissile bond. Thus gastrin, a peptide that contains a string of five Glu residues, is an excellent substrate for meprin ß while it is not hydrolyzed by meprin α. Work herein aimed to identify critical amino acids in the meprin active sites that determine the substrate specificity differences. Sequence alignments and homology models, based on the crystal structure of the crayfish astacin, showed electrostatic differences within the meprin active sites. Site-directed mutagenesis of active site residues demonstrated that replacement of a hydrophobic residue by a basic amino acid enabled the meprin α protease to cleave gastrin. The meprin αY199K mutant was most effective; the corresponding mutation of meprin ßK185Y resulted in decreased activity toward gastrin. Peptide cleavage site determinations and kinetic analyses using a variety of peptides extended evidence that meprin αTyr199/ßLys185 are substrate specificity determinants in meprin active sites. These studies shed light on the molecular basis for the substrate specificity differences of astacin metalloproteinases. PMID:12888571

Molecular Dynamics of Mouse Acetylcholinesterase Complexed with Huperzine A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tara, Sylvia; Helms, Volkhard H.; Straatsma, TP

1999-03-16

Two molecular dynamics simulations were performed for a modeled complex of mouse acetylcholinesterase liganded with huperzine A (HupA). Analysis of these simulations shows that HupA shifts in the active site toward Tyr 337 and Phe 338, and that several residues in the active site area reach out to make hydrogen bonds with the inhibitor. Rapid fluctuations of the gorge width are observed, ranging from widths that allow substrate access to the active site, to pinched structures that do not allow access of molecules as small as water. Additional openings or channels to the active site are found. One opening ismore » formed in the side wall of the active site gorge by residues Val 73, Asp 74, Thr 83, Glu 84, and Asn 87. Another opening is formed at the base of the gorge by residues Trp 86, Val 132, Glu 202, Gly 448, and Ile 451. Both of these openings have been observed separately in the Torpedo californica form of the enzyme. These channels could allow transport of waters and ions to and from the bulk solution.« less

Elucidating Oxygen Reduction Active Sites in Pyrolyzed Metal-Nitrogen Coordinated Non-Precious-Metal Electrocatalyst Systems.

PubMed

Tylus, Urszula; Jia, Qingying; Strickland, Kara; Ramaswamy, Nagappan; Serov, Alexey; Atanassov, Plamen; Mukerjee, Sanjeev

2014-05-01

Detailed understanding of the nature of the active centers in non-precious-metal-based electrocatalyst, and their role in oxygen reduction reaction (ORR) mechanistic pathways will have a profound effect on successful commercialization of emission-free energy devices such as fuel cells. Recently, using pyrolyzed model structures of iron porphyrins, we have demonstrated that a covalent integration of the Fe-N x sites into π-conjugated carbon basal plane modifies electron donating/withdrawing capability of the carbonaceous ligand, consequently improving ORR activity. Here, we employ a combination of in situ X-ray spectroscopy and electrochemical methods to identify the various structural and functional forms of the active centers in non-heme Fe/N/C catalysts. Both methods corroboratively confirm the single site 2e - × 2e - mechanism in alkaline media on the primary Fe 2+ -N 4 centers and the dual-site 2e - × 2e - mechanism in acid media with the significant role of the surface bound coexisting Fe/Fe x O y nanoparticles (NPs) as the secondary active sites.

Elucidating Oxygen Reduction Active Sites in Pyrolyzed Metal–Nitrogen Coordinated Non-Precious-Metal Electrocatalyst Systems

PubMed Central

2015-01-01

Detailed understanding of the nature of the active centers in non-precious-metal-based electrocatalyst, and their role in oxygen reduction reaction (ORR) mechanistic pathways will have a profound effect on successful commercialization of emission-free energy devices such as fuel cells. Recently, using pyrolyzed model structures of iron porphyrins, we have demonstrated that a covalent integration of the Fe–Nx sites into π-conjugated carbon basal plane modifies electron donating/withdrawing capability of the carbonaceous ligand, consequently improving ORR activity. Here, we employ a combination of in situ X-ray spectroscopy and electrochemical methods to identify the various structural and functional forms of the active centers in non-heme Fe/N/C catalysts. Both methods corroboratively confirm the single site 2e– × 2e– mechanism in alkaline media on the primary Fe2+–N4 centers and the dual-site 2e– × 2e– mechanism in acid media with the significant role of the surface bound coexisting Fe/FexOy nanoparticles (NPs) as the secondary active sites. PMID:24817921

Platinum nanoparticle during electrochemical hydrogen evolution: Adsorbate distribution, active reaction species, and size effect

DOE PAGES

Tan, Teck L.; Wang, Lin -Lin; Zhang, Jia; ...

2015-03-02

For small Pt nanoparticles (NPs), catalytic activity is, as observed, adversely affected by size in the 1–3 nm range. We elucidate, via first-principles-based thermodynamics, the operation H* distribution and cyclic voltammetry (CV) during the hydrogen evolution reaction (HER) across the electrochemical potential, including the underpotential region (U ≤ 0) that is difficult to assess in experiment. We consider multiple adsorption sites on a 1 nm Pt NP model and show that the characteristic CV peaks from different H* species correspond well to experiment. We next quantify the activity contribution from each H* species to explain the adverse effect of size.more » From the resolved CV peaks at the standard hydrogen electrode potential (U = 0), we first deduce that the active species for the HER are the partially covered (100)-facet bridge sites and the (111)-facet hollow sites. Upon evaluation of the reaction barriers at operation H* distribution and microkinetic modeling of the exchange current, we find that the nearest-neighbor (100)-facet bridge site pairs have the lowest activation energy and contribute to ~75% of the NP activity. Edge bridge sites (fully covered by H*) per se are not active; however, they react with neighboring (100)-facet H* to account for ~18% of the activity, whereas (111)-facet hollow sites contribute little. As a result, extrapolating the relative contributions to larger NPs in which the ratio of facet-to-edge sites increases, we show that the adverse size effect of Pt NP HER activity kicks in for sizes below 2 nm.« less

Functional and structural characterization of the pentapeptide insertion of Theileria annulata lactate dehydrogenase by site-directed mutagenesis, comparative modeling and molecular dynamics simulations.

PubMed

Erdemir, Aysegul; Mutlu, Ozal

2017-06-01

Lactate dehydrogenase (LDH) is an important metabolic enzyme in glycolysis and it has been considered as the main energy source in many organisms including apicomplexan parasites. Differences at the active site loop of the host and parasite LDH's makes this enzyme an attractive target for drug inhibitors. In this study, five amino acid insertions in the active site pocket of Theileria annulata LDH (TaLDH) were deleted by PCR-based site-directed mutagenesis, expression and activity analysis of mutant and wild type TaLDH enzymes were performed. Removal of the insertion at the active site loop caused production of an inactive enzyme. Furthermore, structures of wild and mutant enzymes were predicted by comparative modeling and the importance of the insertions at the active site loop were also assigned by molecular docking and dynamics simulations in order to evaluate essential role of this loop for the enzymatic activity. Pentapeptide insertion removal resulted in loss of LDH activity due to deletion of Trp96 and conformational change of Arg98 because of loop instability. Analysis of wild type and mutant enzymes with comparative molecular dynamics simulations showed that the fluctuations of the loop residues increase in mutant enzyme. Together with in silico studies, in vitro results revealed that active site loop has a vital role in the enzyme activity and our findings promise hope for the further drug design studies against theileriosis and other apicomplexan parasite diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

The role of His-83 of yeast apurinic/apyrimidinic endonuclease Apn1 in catalytic incision of abasic sites in DNA.

PubMed

Dyakonova, Elena S; Koval, Vladimir V; Lomzov, Alexander A; Ishchenko, Alexander A; Fedorova, Olga S

2015-06-01

The apurinic/apyrimidinic (AP) endonuclease Apn1 from Saccharomyces cerevisiae is a key enzyme involved in the base excision repair (BER) at the cleavage stage of abasic sites (AP sites) in DNA. The crystal structure of Apn1 from S. cerevisiae is unresolved. Based on its high amino acid homology to Escherichia coli Endo IV, His-83 is believed to coordinate one of three Zn2+ ions in Apn1's active site similar to His-69 in Endo IV. Substituting His-83 with Ala is proposed to decrease the AP endonuclease activity of Apn1 owing to weak coordination of Zn2+ ions involved in enzymatic catalysis. The kinetics of recognition, binding, and incision of DNA substrates with the H83A Apn1 mutant was investigated. The stopped-flow method detecting fluorescence intensity changes of 2-aminopurine (2-aPu) was used to monitor the conformational dynamics of DNA at pre-steady-state conditions. We found substituting His-83 with Ala influenced catalytic complex formation and further incision of the damaged DNA strand. The H83A Apn1 catalysis depends not only on the location of the mismatch relative to the abasic site in DNA, but also on the nature of damage. We consider His-83 properly coordinates the active site Zn2+ ion playing a crucial role in catalytic incision stage. Our data prove suppressed enzymatic activity of H83A Apn1 results from the reduced number of active site Zn2+ ions. Our study provides insights into mechanistic specialty of AP site repair by yeast AP endonuclease Apn1 of Endo IV family, which members are not found in mammals, but are present in many microorganisms. The results will provide useful guidelines for design of new anti-fungal and anti-malarial agents. Copyright © 2015 Elsevier B.V. All rights reserved.

Discovery of Novel Nonactive Site Inhibitors of the Prothrombinase Enzyme Complex.

PubMed

Kapoor, Karan; McGill, Nicole; Peterson, Cynthia B; Meyers, Harold V; Blackburn, Michael N; Baudry, Jerome

2016-03-28

The risk of serious bleeding is a major liability of anticoagulant drugs that are active-site competitive inhibitors targeting the Factor Xa (FXa) prothrombin (PT) binding site. The present work identifies several new classes of small molecule anticoagulants that can act as nonactive site inhibitors of the prothrombinase (PTase) complex composed of FXa and Factor Va (FVa). These new classes of anticoagulants were identified, using a novel agnostic computational approach to identify previously unrecognized binding pockets at the FXa-FVa interface. From about three million docking calculations of 281,128 compounds in a conformational ensemble of FXa heavy chains identified by molecular dynamics (MD) simulations, 97 compounds and their structural analogues were selected for experimental validation, through a series of inhibition assays. The compound selection was based on their predicted binding affinities to FXa and their ability to successfully bind to multiple protein conformations while showing selectivity for particular binding sites at the FXa/FVa interface. From these, thirty-one (31) compounds were experimentally identified as nonactive site inhibitors. Concentration-based assays further identified 10 compounds represented by four small-molecule families of inhibitors that achieve dose-independent partial inhibition of PTase activity in a nonactive site-dependent and self-limiting mechanism. Several compounds were identified for their ability to bind to protein conformations only seen during MD, highlighting the importance of accounting for protein flexibility in structure-based drug discovery approaches.

Site Assessment of a New State-Wide Seismic Network in Texas (TexNet)

NASA Astrophysics Data System (ADS)

Savvaidis, A.; Young, B.; Mukherjee, T.; Hennings, P.; Rathje, E.; Zalachoris, G.; Young, M.; Walter, J. I.; DeShon, H. R.; Frohlich, C.

2016-12-01

Earthquake activity has recently increased in the southern mid-continent of the U.S., including Texas. To monitor seismicity activity in the state of Texas, a new seismicity monitoring program known as TexNet, was funded by the Texas State Legislature in 2015. TexNet consists of 22 new permanent broadband (120s post-hole) seismic stations that will complement the 17 stations currently operating in the State. These permanent stations will provide the baseline seismicity of the state. In addition, 36 portable stations (incorporating both a 20s post-hole seismometer and a post-hole accelerometer) will be used to densify the network in specific areas, of the State, depending on measured seismicity level, proximity to infrastructure, or other scientific investigations. One goal for TexNet is to provide authenticated data needed to evaluate the location, and frequency of earthquakes. To minimize the uncertainties in earthquake locations and increase detectability of the network, an extensive site assessment survey was conducted. The initial station positions were chosen based on Earthscope, Transportable Array (TA) site positions, while ensuring that the stations were relatively evenly-spaced across the State. We then analyzed the noise and earthquake data from the TA seismometers, and added new locations based on geology, topography, and absence of nearby human activities. A 30-min noise test was conducted at each site to identify the site amplification using HVSR information. A 24-hr survey then followed, where the noise level during day and night was identified, analyzed using power spectral density and compared to the NHNM and NLNM (Peterson, 1993; USGS Open File Report, 322). Based on these survey results nearby alternative sites were evaluated to improve final site position. Full deployment and data streaming is expected by December 2016, and will be discussed during this presentation.

Site Assessment of a New State-Wide Seismic Network in Texas (TexNet), USA.

NASA Astrophysics Data System (ADS)

Savvaidis, Alexandros; Young, Bissett; Hennings, Peter; Rathje, Ellen; Zalachoris, George; Young, Michael H.; Walter, Jacob I.; DeShon, Heather R.; Frohlich, Cliff

2017-04-01

Earthquake activity has recently increased in the southern mid-continent of the U.S., including Texas. To monitor seismicity activity in the state of Texas, a new seismicity monitoring program known as TexNet, was funded by the Texas State Legislature in 2015. TexNet consists of 22 new permanent broadband (120s post-hole) seismic stations that will complement the 17 stations currently operating in the State. These permanent stations will provide the baseline seismicity of the state. In addition, 36 portable stations (incorporating both a 20s post-hole seismometer and a post-hole accelerometer) will be used to densify the network in specific areas, of the State, depending on measured seismicity level, proximity to infrastructure, or other scientific investigations. One goal for TexNet is to provide authenticated data needed to evaluate the location, and frequency of earthquakes. To minimize the uncertainties in earthquake locations and increase detectability of the network, an extensive site assessment survey was conducted. The initial station positions were chosen based on Earthscope, Transportable Array (TA) site positions, while ensuring that the stations were relatively evenly-spaced across the State. We then analyzed the noise and earthquake data from the TA seismometers, and added new locations based on geology, topography, and absence of nearby human activities. A 30-min noise test was conducted at each site to identify the site amplification using HVSR information. A 24-hr survey then followed, where the noise level during day and night was identified, analyzed using power spectral density and compared to the NHNM and NLNM (Peterson, 1993; USGS Open File Report, 322). Based on these survey results nearby alternative sites were evaluated to improve final site position. Deployment and data streaming started on September 2016, and will be discussed during this presentation.

Scaling-Relation-Based Analysis of Bifunctional Catalysis: The Case for Homogeneous Bimetallic Alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, Mie; Medford, Andrew J.; Norskov, Jens K.

Here, we present a generic analysis of the implications of energetic scaling relations on the possibilities for bifunctional gains at homogeneous bimetallic alloy catalysts. Such catalysts exhibit a large number of interface sites, where second-order reaction steps can involve intermediates adsorbed at different active sites. Using different types of model reaction schemes, we show that such site-coupling reaction steps can provide bifunctional gains that allow for a bimetallic catalyst composed of two individually poor catalyst materials to approach the activity of the optimal monomaterial catalyst. However, bifunctional gains cannot result in activities higher than the activity peak of the monomaterialmore » volcano curve as long as both sites obey similar scaling relations, as is generally the case for bimetallic catalysts. These scaling-relation-imposed limitations could be overcome by combining different classes of materials such as metals and oxides.« less

Scaling-Relation-Based Analysis of Bifunctional Catalysis: The Case for Homogeneous Bimetallic Alloys

DOE PAGES

Andersen, Mie; Medford, Andrew J.; Norskov, Jens K.; ...

2017-04-14

Here, we present a generic analysis of the implications of energetic scaling relations on the possibilities for bifunctional gains at homogeneous bimetallic alloy catalysts. Such catalysts exhibit a large number of interface sites, where second-order reaction steps can involve intermediates adsorbed at different active sites. Using different types of model reaction schemes, we show that such site-coupling reaction steps can provide bifunctional gains that allow for a bimetallic catalyst composed of two individually poor catalyst materials to approach the activity of the optimal monomaterial catalyst. However, bifunctional gains cannot result in activities higher than the activity peak of the monomaterialmore » volcano curve as long as both sites obey similar scaling relations, as is generally the case for bimetallic catalysts. These scaling-relation-imposed limitations could be overcome by combining different classes of materials such as metals and oxides.« less

Water vapor and aerosol lidar measurements within an atmospheric instrumental super site to study the aerosols and the tropospheric trace gases in rome

NASA Astrophysics Data System (ADS)

Dionisi, D.; Iannarelli, A. M.; Scoccione, A.; Liberti, G. L.; Cacciani, M.; Argentini, S.; Baldini, L.; Barnaba, F.; Campanelli, M.; Casasanta, G.; Diémoz, H.; Di Liberto, L.; Gobbi, G. P.; Petenko, I.; Siani, A. M.; Von Bismarck, J.; Casadio, S.

2018-04-01

A joint instrumental Super Site, combining observation in urban ("Sapienza" University) and semi-rural (ESA-ESRIN and CNR-ISAC) environment, for atmospheric studies and satellites Cal/Val activities, has been set-up in the Rome area (Italy). Ground based active and passive remote sensing instruments located in both sites are operating in synergy, offering information for a wide range of atmospheric parameters. In this work, a comparison of aerosol and water vapor measurements derived by the Rayleigh-Mie-Raman (RMR) lidars, operating simultaneously in both experimental sites, is presented.

Aminoalcohols as Probes of the Two-subsite Active Site of Beta-D-xylosidase from Selenomonas ruminantium

USDA-ARS?s Scientific Manuscript database

Catalysis and inhibitor binding by the GH43 beta-xylosidase are governed by the protonation state of catalytic base (D14, pKa 5.0) and catalytic acid (E186, pKa 7.2) which reside in subsite -1 of the two-subsite active site. Cationic aminoalcohols are shown to bind exclusively to subsite -1 of the ...

Site-specific Interaction Mapping of Phosphorylated Ubiquitin to Uncover Parkin Activation*♦

PubMed Central

Yamano, Koji; Queliconi, Bruno B.; Koyano, Fumika; Saeki, Yasushi; Hirokawa, Takatsugu; Tanaka, Keiji; Matsuda, Noriyuki

2015-01-01

Damaged mitochondria are eliminated through autophagy machinery. A cytosolic E3 ubiquitin ligase Parkin, a gene product mutated in familial Parkinsonism, is essential for this pathway. Recent progress has revealed that phosphorylation of both Parkin and ubiquitin at Ser65 by PINK1 are crucial for activation and recruitment of Parkin to the damaged mitochondria. However, the mechanism by which phosphorylated ubiquitin associates with and activates phosphorylated Parkin E3 ligase activity remains largely unknown. Here, we analyze interactions between phosphorylated forms of both Parkin and ubiquitin at a spatial resolution of the amino acid residue by site-specific photo-crosslinking. We reveal that the in-between-RING (IBR) domain along with RING1 domain of Parkin preferentially binds to ubiquitin in a phosphorylation-dependent manner. Furthermore, another approach, the Fluoppi (fluorescent-based technology detecting protein-protein interaction) assay, also showed that pathogenic mutations in these domains blocked interactions with phosphomimetic ubiquitin in mammalian cells. Molecular modeling based on the site-specific photo-crosslinking interaction map combined with mass spectrometry strongly suggests that a novel binding mechanism between Parkin and ubiquitin leads to a Parkin conformational change with subsequent activation of Parkin E3 ligase activity. PMID:26260794

Catalytic wet air oxidation of coke-plant wastewater on ruthenium-based eggshell catalysts in a bubbling bed reactor.

PubMed

Yang, M; Sun, Y; Xu, A H; Lu, X Y; Du, H Z; Sun, C L; Li, C

2007-07-01

Catalytic wet air of coke-plant wastewater was studied in a bubbling bed reactor. Two types of supported Ru-based catalysts, eggshell and uniform catalysts, were employed. Compared with the results in the wet air oxidation of coke-plant wastewater, supported Ru uniform catalysts showed high activity for chemical oxygen demand (COD) and ammonia/ammonium compounds (NH3-N) removal at temperature of 250 degrees C and pressure of 4.8 MPa, and it has been demonstrated that the catalytic activity of uniform catalyst depended strongly on the distribution of active sites of Ru on catalyst. Compared to the corresponding uniform catalysts with the same Ru loading (0.25 wt.% and 0.1 wt.%, respectively), the eggshell catalysts showed higher activities for CODcr removal and much higher activities for NH3-N degradation. The high activity of eggshell catalyst for treatment of coke-plant wastewater can be attributed to the higher density of active Ru sites in the shell layer than that of the corresponding uniform catalyst with the same Ru loading. It has been also evidenced that the active Ru sites in the internal core of uniform catalyst have very little or no contribution to CODcr and NH3-N removal in the total oxidation of coke-plant wastewater.

Entrapment and Structure of an Extrahelical Guanine Attempting to Enter the Active Site of a Bacterial DNA Glycosylase, MutM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qi, Yan; Spong, Marie C.; Nam, Kwangho

2010-09-21

MutM, a bacterial DNA glycosylase, protects genome integrity by catalyzing glycosidic bond cleavage of 8-oxoguanine (oxoG) lesions, thereby initiating base excision DNA repair. The process of searching for and locating oxoG lesions is especially challenging, because of the close structural resemblance of oxoG to its million-fold more abundant progenitor, G. Extrusion of the target nucleobase from the DNA double helix to an extrahelical position is an essential step in lesion recognition and catalysis by MutM. Although the interactions between the extruded oxoG and the active site of MutM have been well characterized, little is known in structural detail regarding themore » interrogation of extruded normal DNA bases by MutM. Here we report the capture and structural elucidation of a complex in which MutM is attempting to present an undamaged G to its active site. The structure of this MutM-extrahelical G complex provides insights into the mechanism MutM employs to discriminate against extrahelical normal DNA bases and into the base extrusion process in general.« less

Active-site solvent replenishment observed during human carbonic anhydrase II catalysis.

PubMed

Kim, Jin Kyun; Lomelino, Carrie L; Avvaru, Balendu Sankara; Mahon, Brian P; McKenna, Robert; Park, SangYoun; Kim, Chae Un

2018-01-01

Human carbonic anhydrase II (hCA II) is a zinc metalloenzyme that catalyzes the reversible hydration/dehydration of CO 2 /HCO 3 - . Although hCA II has been extensively studied to investigate the proton-transfer process that occurs in the active site, its underlying mechanism is still not fully understood. Here, ultrahigh-resolution crystallographic structures of hCA II cryocooled under CO 2 pressures of 7.0 and 2.5 atm are presented. The structures reveal new intermediate solvent states of hCA II that provide crystallographic snapshots during the restoration of the proton-transfer water network in the active site. Specifically, a new intermediate water (W I ') is observed next to the previously observed intermediate water W I , and they are both stabilized by the five water molecules at the entrance to the active site (the entrance conduit). Based on these structures, a water network-restructuring mechanism is proposed, which takes place at the active site after the nucleophilic attack of OH - on CO 2 . This mechanism explains how the zinc-bound water (W Zn ) and W1 are replenished, which are directly responsible for the reconnection of the His64-mediated proton-transfer water network. This study provides the first 'physical' glimpse of how a water reservoir flows into the hCA II active site during its catalytic activity.

Flux-Based Site Management

EPA Science Inventory

Managing DNAPL contaminated sites continues to be among the most pressing environmental problems currently faced. In particular, the benefits of partial DNAPL mass depletion due to remedial activity are unclear. Recent work conducted by an inter-agency research team has been in...

Design, synthesis and preliminary structure-activity relationship investigation of nitrogen-containing chalcone derivatives as acetylcholinesterase and butyrylcholinesterase inhibitors: a further study based on Flavokawain B Mannich base derivatives.

PubMed

Liu, Haoran; Fan, Haoqun; Gao, Xiaohui; Huang, Xueqing; Liu, Xianjun; Liu, Linbo; Zhou, Chao; Tang, Jingjing; Wang, Qiuan; Liu, Wukun

2016-08-01

In order to study the structure-activity relationship of Flavokawain B Mannich-based derivatives as acetylcholinesterase (AChE) inhibitors in our recent investigation, 20 new nitrogen-containing chalcone derivatives (4 a-8d) were designed, synthesized, and evaluated for AChE inhibitory activity in vitro. The results suggested that amino alkyl side chain of chalcone dramatically influenced the inhibitory activity against AChE. Among them, compound 6c revealed the strongest AChE inhibitory activity (IC50 value: 0.85 μmol/L) and the highest selectivity against AChE over BuChE (ratio: 35.79). Enzyme kinetic study showed that the inhibition mechanism of compound 6c against AChE was a mixed-type inhibition. The molecular docking assay showed that this compound can both bind with the catalytic site and the peripheral site of AChE.

Units

Science.gov Websites

Maxwell Air Force Base Maxwell Air Force Base Join the Air Force Home News AF News Commentaries Services SAPR FOIA Retiree Activities Office Centennial Search Maxwell Air Force Base: Home > Units Site

A non-heme iron-mediated chemical demethylation in DNA and RNA.

PubMed

Yi, Chengqi; Yang, Cai-Guang; He, Chuan

2009-04-21

DNA methylation is arguably one of the most important chemical signals in biology. However, aberrant DNA methylation can lead to cytotoxic or mutagenic consequences. A DNA repair protein in Escherichia coli, AlkB, corrects some of the unwanted methylations of DNA bases by a unique oxidative demethylation in which the methyl carbon is liberated as formaldehyde. The enzyme also repairs exocyclic DNA lesions--that is, derivatives in which the base is augmented with an additional heterocyclic subunit--by a similar mechanism. Two proteins in humans that are homologous to AlkB, ABH2 and ABH3, repair the same spectrum of lesions; another human homologue of AlkB, FTO, is linked to obesity. In this Account, we describe our studies of AlkB, ABH2, and ABH3, including our development of a general strategy to trap homogeneous protein-DNA complexes through active-site disulfide cross-linking. AlkB uses a non-heme mononuclear iron(II) and the cofactors 2-ketoglutarate (2KG) and dioxygen to effect oxidative demethylation of the DNA base lesions 1-methyladenine (1-meA), 3-methylcytosine (3-meC), 1-methylguanine (1-meG), and 3-methylthymine (3-meT). ABH3, like AlkB, works better on single-stranded DNA (ssDNA) and is capable of repairing damaged bases in RNA. Conversely, ABH2 primarily repairs lesions in double-stranded DNA (dsDNA); it is the main housekeeping enzyme that protects the mammalian genome from 1-meA base damage. The AlkB-family proteins have moderate affinities for their substrates and bind DNA in a non-sequence-specific manner. Knowing that these proteins flip the damaged base out from the duplex DNA and insert it into the active site for further processing, we first engineered a disulfide cross-link in the active site to stabilize the Michaelis complex. Based on the detailed structural information afforded by the active-site cross-linked structures, we can readily install a cross-link away from the active site to obtain the native-like structures of these complexes. The crystal structures show a distinct base-flipping feature in AlkB and establish ABH2 as a dsDNA repair protein. They also provide a molecular framework for understanding the demethylation reaction catalyzed by these proteins and help to explain their substrate preferences. The chemical cross-linking method demonstrated here can be applied to trap other labile protein-DNA interactions and can serve as a general strategy for exploring the structural and functional aspects of base-flipping proteins.

Site-Based Decision Making Using Faculty Senates: Three Years of Experience in West Virginia.

ERIC Educational Resources Information Center

Barnette, J. Jackson; Hange, Jane

The West Virginia education reform legislation of 1988 and 1990 mandated greater involvement of school personnel, parents, and community in site-based decision making. This paper examines the operations and activities of faculty senates, which are composed of all full-time educators in each school, for the years 1990-91, 1991-92, and 1992-93. A…

Designing of Protein Kinase C β-II Inhibitors against Diabetic complications: Structure Based Drug Design, Induced Fit docking and analysis of active site conformational changes

PubMed Central

Vijayakumar, Balakrishnan; Velmurugan, Devadasan

2012-01-01

Protein Kinase C β-II (PKC β-II) is an important enzyme in the development of diabetic complications like cardiomyopathy, retinopathy, neuropathy, nephropathy and angiopathy. PKC β-II is activated in vascular tissues during diabetic vascular abnormalities. Thus, PKC β-II is considered as a potent drug target and the crystal structure of the kinase domain of PKC β-II (PDB id: 2I0E) was used to design inhibitors using Structure-Based Drug Design (SBDD) approach. Sixty inhibitors structurally similar to Staurosporine were retrieved from PubChem Compound database and High Throughput Virtual screening (HTVs) was carried out with PKC β-II. Based on the HTVs results and the nature of active site residues of PKC β-II, Staurosporine inhibitors were designed using SBDD. Induced Fit Docking (IFD) studies were carried out between kinase domain of PKC β-II and the designed inhibitors. These IFD complexes showed favorable docking score, glide energy, glide emodel and hydrogen bond and hydrophobic interactions with the active site of PKC β-II. Binding free energy was calculated for IFD complexes using Prime MM-GBSA method. The conformational changes induced by the inhibitor at the active site of PKC β-II were observed for the back bone Cα atoms and side-chain chi angles. PASS prediction tool was used to analyze the biological activities for the designed inhibitors. The various physicochemical properties were calculated for the compounds. One of the designed inhibitors successively satisfied all the in silico parameters among the others and seems to be a potent inhibitor against PKC β-II. PMID:22829732

Quality and accuracy of publicly accessible cancer-related physical activity information on the Internet: a cross-sectional assessment.

PubMed

Buote, R D; Malone, S D; Bélanger, L J; McGowan, E L

2016-09-01

In this study, we assessed the quality of publicly available cancer-related physical activity (PA) information appearing on reputable sites from Canada and other English-speaking countries. A cross-sectional Internet search was conducted on select countries (Canada, USA, Australia, New Zealand, UK) using Google to generate top 50 results per country for the keywords "'physical activity' AND 'cancer'". Top results were assessed for quality of PA information based on a coding frame. Additional searches were performed for Canadian-based sites to produce an exhaustive list. Results found that many sites offered cancer-related PA information (94.5%), but rarely defined PA (25.2%). Top 50 results from each country did not differ on any indicator examined. The exhaustive list of Canadian sites found that many sites gave information about PA for survivorship (78.3%) and prevention (70.0%), but rarely defined (6.7%) or referenced PA guidelines (28.3%). Cancer-related PA information is plentiful on the Internet but the quality needs improvement. Sites should do more than mention PA; they should provide definitions, examples and guidelines. With improvements, these websites would enable healthcare providers to effectively educate their patients about PA, and serve as a valuable resource to the general public who may be seeking cancer-related PA information. © 2016 John Wiley & Sons Ltd.

Secondary environmental impacts of remedial alternatives for sediment contaminated with hydrophobic organic contaminants.

PubMed

Choi, Yongju; Thompson, Jay M; Lin, Diana; Cho, Yeo-Myoung; Ismail, Niveen S; Hsieh, Ching-Hong; Luthy, Richard G

2016-03-05

This study evaluates secondary environmental impacts of various remedial alternatives for sediment contaminated with hydrophobic organic contaminants using life cycle assessment (LCA). Three alternatives including two conventional methods, dredge-and-fill and capping, and an innovative sediment treatment technique, in-situ activated carbon (AC) amendment, are compared for secondary environmental impacts by a case study for a site at Hunters Point Shipyard, San Francisco, CA. The LCA results show that capping generates substantially smaller impacts than dredge-and-fill and in-situ amendment using coal-based virgin AC. The secondary impacts from in-situ AC amendment can be reduced effectively by using recycled or wood-based virgin AC as production of these materials causes much smaller impacts than coal-based virgin AC. The secondary environmental impacts are highly sensitive to the dredged amount and the distance to a disposal site for dredging, the capping thickness and the distance to the cap materials for capping, and the AC dose for in-situ AC amendment. Based on the analysis, this study identifies strategies to minimize secondary impacts caused by different remediation activities: optimize the dredged amount, the capping thickness, or the AC dose by extensive site assessments, obtain source materials from local sites, and use recycled or bio-based AC. Copyright © 2015 Elsevier B.V. All rights reserved.

Single-fluorophore monitoring of DNA hybridization for investigating the effect of secondary structure on the nucleation step.

PubMed

Jo, Joon-Jung; Kim, Min-Ji; Son, Jung-Tae; Kim, Jandi; Shin, Jong-Shik

2009-07-17

Nucleic acid hybridization is one of the essential biological processes involved in storage and transmission of genetic information. Here we quantitatively determined the effect of secondary structure on the hybridization activation energy using structurally defined oligonucleotides. It turned out that activation energy is linearly proportional to the length of a single-stranded region flanking a nucleation site, generating a 0.18 kcal/mol energy barrier per nucleotide. Based on this result, we propose that the presence of single-stranded segments available for non-productive base pairing with a nucleation counterpart extends the searching process for nucleation sites to find a perfect match. This result may provide insights into rational selection of a target mRNA site for siRNA and antisense gene silencing.

Redefinition of rubisco carboxylase reaction reveals origin of water for hydration and new roles for active-site residues.

PubMed

Kannappan, Babu; Gready, Jill E

2008-11-12

Crystallographic, mutagenesis, kinetic, and computational studies on Rubisco over three decades have revealed much about its catalytic mechanism and the role played by several active-site residues. However, key questions remain unanswered. Specific details of the carboxylase and oxygenase mechanisms, required to underpin the rational re-engineering of Rubisco, are still speculative. Here we address critical gaps in knowledge with a definitive comprehensive computational investigation of the mechanism of carboxylase activity at the Rubisco active site. Density functional theory calculations (B3LYP/6-31G(d,p)) were performed on active-site fragment models of a size up to 77 atoms, not previously possible computationally. All amino acid residues suspected to play roles in the acid-base chemistry in the multistep reaction, and interacting directly with the central Mg (2+) atom and the reactive moiety of substrate and intermediates, were included. The results provide a firm basis for us to propose a novel mechanism for the entire sequence of reactions in the carboxylase catalysis and to define precise roles for the active-site residues, singly and in concert. In this mechanism, the carbamylated LYS201 plays a more limited role than previously proposed but is crucial for initiating the reaction by acting as a base in the enolization. We suggest a wider role for HIS294, with involvement in the carboxylation, hydration, and C2-C3 bond-scission steps, consistent with the suggestion of Harpel et al. (1998) but contrary to the consensus view of Cleland et al. (1998). In contrast to the common assumption that the water molecule for the hydration step comes from within the active site, we propose that the Mg-coordinated water is not dissociated at the start of the gas-addition reaction but rather remains coordinated and is used for the hydration of the C3 carbon atom. New roles are also proposed for LYS175, GLU204, and HIS294. The mechanism suggests roles in the gas-addition step for residues in three spatially distinct regions of the active site, HIS294 and LYS334 in the C-terminal domain of the large subunit (LSU), but also hitherto unsuspected roles for a cluster of three residues (ASN123, GLU60, and TYR20) in the N-terminal domain of the partner LSU of the dimer containing the active site. Our new mechanism is supported by existing experimental data, provides new convincing interpretations of previously puzzling data, and allows new insights into mutational strategies for improving Rubisco activity.

Real-Time Visualization of Active Species in a Single-Site Metal–Organic Framework Photocatalyst

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Sizhuo; Pattengale, Brian; Lee, Sungsik

In this work, we report a new single-site photocatalyst (Co-Ru-UIO- 67(bpy)) based on a metal-organic framework platform with incorporated molecular photosensitizer and catalyst. We show that this catalyst not only demonstrates exceptional activity for light-driven H2 production but also can be recycled without loss of activity. Using the combination of optical transient absorption spectroscopy and in situ X-ray absorption spectroscopy, we not only captured the key CoI intermediate species formed after ultrafast charge transfer from the incorporated photosensitizer but also identified the rate-limiting step in the catalytic cycle, providing insight into the catalysis mechanism of these single-site metal-organic framework photocatalysts.

Ventricular stimulus site influences dynamic dispersion of repolarization in the intact human heart

PubMed Central

Orini, Michele; Simon, Ron B.; Providência, Rui; Khan, Fakhar Z.; Segal, Oliver R.; Babu, Girish G.; Bradley, Richard; Rowland, Edward; Ahsan, Syed; Chow, Anthony W.; Lowe, Martin D.; Taggart, Peter

2016-01-01

The spatial variation in restitution properties in relation to varying stimulus site is poorly defined. This study aimed to investigate the effect of varying stimulus site on apicobasal and transmural activation time (AT), action potential duration (APD) and repolarization time (RT) during restitution studies in the intact human heart. Ten patients with structurally normal hearts, undergoing clinical electrophysiology studies, were enrolled. Decapolar catheters were placed apex to base in the endocardial right ventricle (RVendo) and left ventricle (LVendo), and an LV branch of the coronary sinus (LVepi) for transmural recording. S1–S2 restitution protocols were performed pacing RVendo apex, LVendo base, and LVepi base. Overall, 725 restitution curves were analyzed, 74% of slopes had a maximum slope of activation recovery interval (ARI) restitution (Smax) > 1 (P < 0.001); mean Smax = 1.76. APD was shorter in the LVepi compared with LVendo, regardless of pacing site (30-ms difference during RVendo pacing, 25-ms during LVendo, and 48-ms during LVepi; 50th quantile, P < 0.01). Basal LVepi pacing resulted in a significant transmural gradient of RT (77 ms, 50th quantile: P < 0.01), due to loss of negative transmural AT-APD coupling (mean slope 0.63 ± 0.3). No significant transmural gradient in RT was demonstrated during endocardial RV or LV pacing, with preserved negative transmural AT-APD coupling (mean slope −1.36 ± 1.9 and −0.71 ± 0.4, respectively). Steep ARI restitution slopes predominate in the normal ventricle and dynamic ARI; RT gradients exist that are modulated by the site of activation. Epicardial stimulation to initiate ventricular activation promotes significant transmural gradients of repolarization that could be proarrhythmic. PMID:27371682

Identification of B. anthracis N(5)-carboxyaminoimidazole ribonucleotide mutase (PurE) active site binding compounds via fragment library screening.

PubMed

Lei, Hao; Jones, Christopher; Zhu, Tian; Patel, Kavankumar; Wolf, Nina M; Fung, Leslie W-M; Lee, Hyun; Johnson, Michael E

2016-02-15

The de novo purine biosynthesis pathway is an attractive target for antibacterial drug design, and PurE from this pathway has been identified to be crucial for Bacillus anthracis survival in serum. In this study we adopted a fragment-based hit discovery approach, using three screening methods-saturation transfer difference nucleus magnetic resonance (STD-NMR), water-ligand observed via gradient spectroscopy (WaterLOGSY) NMR, and surface plasmon resonance (SPR), against B. anthracis PurE (BaPurE) to identify active site binding fragments by initially testing 352 compounds in a Zenobia fragment library. Competition STD NMR with the BaPurE product effectively eliminated non-active site binding hits from the primary hits, selecting active site binders only. Binding affinities (dissociation constant, KD) of these compounds varied between 234 and 301μM. Based on test results from the Zenobia compounds, we subsequently developed and applied a streamlined fragment screening strategy to screen a much larger library consisting of 3000 computationally pre-selected fragments. Thirteen final fragment hits were confirmed to exhibit binding affinities varying from 14μM to 700μM, which were categorized into five different basic scaffolds. All thirteen fragment hits have ligand efficiencies higher than 0.30. We demonstrated that at least two fragments from two different scaffolds exhibit inhibitory activity against the BaPurE enzyme. Published by Elsevier Ltd.

Long-term surveillance plan for the Bodo Canyon Disposal Site, Durango, Colorado

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1994-03-01

This long-term surveillance plan (LTSP) for the Durango, Colorado, Uranium Mill Tailings Remedial Action (UMTRA) Project disposal site describes the surveillance activities for the Durango (Bodo Canyon) disposal site, which will be referred to as the disposal site throughout this document. The US Department of Energy (DOE) will carry out these activities to ensure that the disposal site continues to function as designed. This LTSP was prepared as a requirement for acceptance under the US Nuclear Regulatory Commission (NRC) general license for custody and long-term care of residual radioactive materials (RRM). RRMs include tailings and other uranium ore processing wastesmore » still at the site, which the DOE determines to be radioactive. This LTSP is based on the DOE`s Guidance for Implementing the UMTRA Project Long-term Surveillance Program (DOE, 1992).« less

ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

PubMed Central

Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

2013-01-01

Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

Detection of Damaged DNA Bases by DNA Glycosylase Enzymes†

PubMed Central

Friedman, Joshua I.; Stivers, James T.

2010-01-01

A fundamental and shared process in all forms of life is the use of DNA glycosylase enzymes to excise rare damaged bases from genomic DNA. Without such enzymes, the highly-ordered primary sequences of genes would rapidly deteriorate. Recent structural and biophysical studies are beginning to reveal a fascinating multistep mechanism for damaged base detection that begins with short-range sliding of the glycosylase along the DNA chain in a distinct conformation we refer to as the search complex (SC). Sliding is frequently punctuated by the formation of a transient “interrogation” complex (IC) where the enzyme extrahelically inspects both normal and damaged bases in an exosite pocket that is distant from the active site. When normal bases are presented in the exosite, the IC rapidly collapses back to the SC, while a damaged base will efficiently partition forward into the active site to form the catalytically competent excision complex (EC). Here we review the unique problems associated with enzymatic detection of rare damaged DNA bases in the genome, and emphasize how each complex must have specific dynamic properties that are tuned to optimize the rate and efficiency of damage site location. PMID:20469926

Incorporating ToxCast and Tox21 datasets to rank biological activity of chemicals at Superfund sites in North Carolina.

PubMed

Tilley, Sloane K; Reif, David M; Fry, Rebecca C

2017-04-01

The Superfund program of the Environmental Protection Agency (EPA) was established in 1980 to address public health concerns posed by toxic substances released into the environment in the United States. Forty-two of the 1328 hazardous waste sites that remain on the Superfund National Priority List are located in the state of North Carolina. We set out to develop a database that contained information on both the prevalence and biological activity of chemicals present at Superfund sites in North Carolina. A chemical characterization tool, the Toxicological Priority Index (ToxPi), was used to rank the biological activity of these chemicals based on their predicted bioavailability, documented associations with biological pathways, and activity in in vitro assays of the ToxCast and Tox21 programs. The ten most prevalent chemicals found at North Carolina Superfund sites were chromium, trichloroethene, lead, tetrachloroethene, arsenic, benzene, manganese, 1,2-dichloroethane, nickel, and barium. For all chemicals found at North Carolina Superfund sites, ToxPi analysis was used to rank their biological activity. Through this data integration, residual pesticides and organic solvents were identified to be some of the most highly-ranking predicted bioactive chemicals. This study provides a novel methodology for creating state or regional databases of biological activity of contaminants at Superfund sites. These data represent a novel integrated profile of the most prevalent chemicals at North Carolina Superfund sites. This information, and the associated methodology, is useful to toxicologists, risk assessors, and the communities living in close proximity to these sites. Copyright © 2016. Published by Elsevier Ltd.

Identification of continuous interaction sites in PLA(2)-based protein complexes by peptide arrays.

PubMed

Fortes-Dias, Consuelo Latorre; Santos, Roberta Márcia Marques dos; Magro, Angelo José; Fontes, Marcos Roberto de Mattos; Chávez-Olórtegui, Carlos; Granier, Claude

2009-01-01

Crotoxin (CA.CB) is a beta-neurotoxin from Crotalus durissus terrificus snake venom that is responsible for main envenomation effects upon biting by this snake. It is a heterodimer of an acidic protein (CA) devoid of any biological activity per se and a basic, enzymatically active, PLA(2) counterpart (CB). Both lethal and enzymatic activities of crotoxin have been shown to be inhibited by CNF, a protein from the blood of C. d. terrificus snakes. CNF replaces CA in the CA.CB complex, forming a stable, non-toxic complex CNF.CB. The molecular sites involved in the tight interfacial protein-protein interactions in these PLA(2)-based complexes have not been clearly determined. To help address this question, we used the peptide arrays approach to map possible interfacial interaction sites in CA.CB and CNF.CB. Amino acid stretches putatively involved in these interactions were firstly identified in the primary structure of CB. Further analysis of the interfacial availability of these stretches in the presumed biologically active structure of CB, suggested two interaction main sites, located at the amino-terminus and beta-wing regions. Peptide segments at the carboxyl-terminus of CB were also suggested to play a secondary role in the binding of both CA and CNF.

Self-optimizing, highly surface-active layered metal dichalcogenide catalysts for hydrogen evolution

NASA Astrophysics Data System (ADS)

Liu, Yuanyue; Wu, Jingjie; Hackenberg, Ken P.; Zhang, Jing; Wang, Y. Morris; Yang, Yingchao; Keyshar, Kunttal; Gu, Jing; Ogitsu, Tadashi; Vajtai, Robert; Lou, Jun; Ajayan, Pulickel M.; Wood, Brandon C.; Yakobson, Boris I.

2017-09-01

Low-cost, layered transition-metal dichalcogenides (MX2) based on molybdenum and tungsten have attracted substantial interest as alternative catalysts for the hydrogen evolution reaction (HER). These materials have high intrinsic per-site HER activity; however, a significant challenge is the limited density of active sites, which are concentrated at the layer edges. Here we unravel electronic factors underlying catalytic activity on MX2 surfaces, and leverage the understanding to report group-5 MX2 (H-TaS2 and H-NbS2) electrocatalysts whose performance instead mainly derives from highly active basal-plane sites, as suggested by our first-principles calculations and performance comparisons with edge-active counterparts. Beyond high catalytic activity, they are found to exhibit an unusual ability to optimize their morphology for enhanced charge transfer and accessibility of active sites as the HER proceeds, offering a practical advantage for scalable processing. The catalysts reach 10 mA cm-2 current density at an overpotential of ˜50-60 mV with a loading of 10-55 μg cm-2, surpassing other reported MX2 candidates without any performance-enhancing additives.

Solid frustrated-Lewis-pair catalysts constructed by regulations on surface defects of porous nanorods of CeO2

PubMed Central

Zhang, Sai; Huang, Zheng-Qing; Ma, Yuanyuan; Gao, Wei; Li, Jing; Cao, Fangxian; Li, Lin; Chang, Chun-Ran; Qu, Yongquan

2017-01-01

Identification on catalytic sites of heterogeneous catalysts at atomic level is important to understand catalytic mechanism. Surface engineering on defects of metal oxides can construct new active sites and regulate catalytic activity and selectivity. Here we outline the strategy by controlling surface defects of nanoceria to create the solid frustrated Lewis pair (FLP) metal oxide for efficient hydrogenation of alkenes and alkynes. Porous nanorods of ceria (PN-CeO2) with a high concentration of surface defects construct new Lewis acidic sites by two adjacent surface Ce3+. The neighbouring surface lattice oxygen as Lewis base and constructed Lewis acid create solid FLP site due to the rigid lattice of ceria, which can easily dissociate H–H bond with low activation energy of 0.17 eV. PMID:28516952

Recent Experience Using Active Love Wave Techniques to Characterize Seismographic Station Sites

NASA Astrophysics Data System (ADS)

Martin, A. J.; Yong, A.; Salomone, L.

2014-12-01

Active-source Love waves recorded by the multi-channel analysis of surface wave (MASLW) technique were recently analyzed in two site characterization projects. Between 2010 and 2011, the 2009 American Recovery and Reinvestment Act (ARRA) funded GEOVision to conduct geophysical investigations at 189 seismographic stations—185 in California and 4 in the Central Eastern U.S. (CEUS). The original project plan was to utilize active and passive Rayleigh wave-based techniques to obtain shear-wave velocity (VS) profiles to a minimum depth of 30 m and the time-averaged VS of the upper 30 meters (VS30). Early in the investigation it became evident that Rayleigh wave techniques, such as multi-channel analysis of surface waves (MASRW), were not effective at characterizing all sites. Shear-wave seismic refraction and MASLW techniques were therefore applied. The MASLW technique was deployed at a total of 38 sites, in addition to other methods, and used as the primary technique to characterize 22 sites, 5 of which were also characterized using Rayleigh wave techniques. In 2012, the Electric Power Research Institute funded characterization of 33 CEUS station sites. Based on experience from the ARRA investigation, both MASRW and MASLW data were acquired by GEOVision at 24 CEUS sites—the remaining 9 sites and 2 overlapping sites were characterized by University of Texas, Austin. Of the 24 sites characterized by GEOVision, 16 were characterized using MASLW data, 4 using both MASLW and MASRW data and 4 using MASRW data. Love wave techniques were often found to perform better, or at least yield phase velocity data that could be more readily modeled using the fundamental mode assumption, at shallow rock sites, sites with steep velocity gradients, and, sites with a thin, low velocity, surficial soil layer overlying stiffer sediments. These types of velocity structure often excite dominant higher modes in Rayleigh wave data, but not in Love wave data. At such sites, it may be possible to model Rayleigh wave data using multi- or effective-mode techniques; however, in many cases extraction of adequate Rayleigh wave dispersion data for modeling was difficult. These results imply that field procedures should include careful scrutiny of Rayleigh wave-based dispersion data in order to collect Love wave data when warranted.

Spectral-analysis-based extraction of land disturbances arising from oil and gas development in diverse landscapes

NASA Astrophysics Data System (ADS)

Zhang, Ying; Lantz, Nicholas; Guindon, Bert; Jiao, Xianfen

2017-01-01

Accurate and frequent monitoring of land surface changes arising from oil and gas exploration and extraction is a key requirement for the responsible and sustainable development of these resources. Petroleum deposits typically extend over large geographic regions but much of the infrastructure required for oil and gas recovery takes the form of numerous small-scale features (e.g., well sites, access roads, etc.) scattered over the landscape. Increasing exploitation of oil and gas deposits will increase the presence of these disturbances in heavily populated regions. An object-based approach is proposed to utilize RapidEye satellite imagery to delineate well sites and related access roads in diverse complex landscapes, where land surface changes also arise from other human activities, such as forest logging and agriculture. A simplified object-based change vector approach, adaptable to operational use, is introduced to identify the disturbances on land based on red-green spectral response and spatial attributes of candidate object size and proximity to roads. Testing of the techniques has been undertaken with RapidEye multitemporal imagery in two test sites located at Alberta, Canada: one was a predominant natural forest landscape and the other landscape dominated by intensive agricultural activities. Accuracies of 84% and 73%, respectively, have been achieved for the identification of well site and access road infrastructure of the two sites based on fully automated processing. Limited manual relabeling of selected image segments can improve these accuracies to 95%.

SABER: A computational method for identifying active sites for new reactions

PubMed Central

Nosrati, Geoffrey R; Houk, K N

2012-01-01

A software suite, SABER (Selection of Active/Binding sites for Enzyme Redesign), has been developed for the analysis of atomic geometries in protein structures, using a geometric hashing algorithm (Barker and Thornton, Bioinformatics 2003;19:1644–1649). SABER is used to explore the Protein Data Bank (PDB) to locate proteins with a specific 3D arrangement of catalytic groups to identify active sites that might be redesigned to catalyze new reactions. As a proof-of-principle test, SABER was used to identify enzymes that have the same catalytic group arrangement present in o-succinyl benzoate synthase (OSBS). Among the highest-scoring scaffolds identified by the SABER search for enzymes with the same catalytic group arrangement as OSBS were l-Ala d/l-Glu epimerase (AEE) and muconate lactonizing enzyme II (MLE), both of which have been redesigned to become effective OSBS catalysts, demonstrated by experiments. Next, we used SABER to search for naturally existing active sites in the PDB with catalytic groups similar to those present in the designed Kemp elimination enzyme KE07. From over 2000 geometric matches to the KE07 active site, SABER identified 23 matches that corresponded to residues from known active sites. The best of these matches, with a 0.28 Å catalytic atom RMSD to KE07, was then redesigned to be compatible with the Kemp elimination using RosettaDesign. We also used SABER to search for potential Kemp eliminases using a theozyme predicted to provide a greater rate acceleration than the active site of KE07, and used Rosetta to create a design based on the proteins identified. PMID:22492397

Identification of the Allosteric Site for Phenylalanine in Rat Phenylalanine Hydroxylase*

PubMed Central

Zhang, Shengnan; Fitzpatrick, Paul F.

2016-01-01

Liver phenylalanine hydroxylase (PheH) is an allosteric enzyme that requires activation by phenylalanine for full activity. The location of the allosteric site for phenylalanine has not been established. NMR spectroscopy of the isolated regulatory domain (RDPheH(25–117) is the regulatory domain of PheH lacking residues 1–24) of the rat enzyme in the presence of phenylalanine is consistent with formation of a side-by-side ACT dimer. Six residues in RDPheH(25–117) were identified as being in the phenylalanine-binding site on the basis of intermolecular NOEs between unlabeled phenylalanine and isotopically labeled protein. The location of these residues is consistent with two allosteric sites per dimer, with each site containing residues from both monomers. Site-specific variants of five of the residues (E44Q, A47G, L48V, L62V, and H64N) decreased the affinity of RDPheH(25–117) for phenylalanine based on the ability to stabilize the dimer. Incorporation of the A47G, L48V, and H64N mutations into the intact protein increased the concentration of phenylalanine required for activation. The results identify the location of the allosteric site as the interface of the regulatory domain dimer formed in activated PheH. PMID:26823465

DNA damage during the G0/G1 phase triggers RNA-templated, Cockayne syndrome B-dependent homologous recombination

PubMed Central

Wei, Leizhen; Nakajima, Satoshi; Böhm, Stefanie; Bernstein, Kara A.; Shen, Zhiyuan; Tsang, Michael; Levine, Arthur S.; Lan, Li

2015-01-01

Damage repair mechanisms at transcriptionally active sites during the G0/G1 phase are largely unknown. To elucidate these mechanisms, we introduced genome site-specific oxidative DNA damage and determined the role of transcription in repair factor assembly. We find that KU and NBS1 are recruited to damage sites independent of transcription. However, assembly of RPA1, RAD51C, RAD51, and RAD52 at such sites is strictly governed by active transcription and requires both wild-type Cockayne syndrome protein B (CSB) function and the presence of RNA in the G0/G1 phase. We show that the ATPase activity of CSB is indispensable for loading and binding of the recombination factors. CSB counters radiation-induced DNA damage in both cells and zebrafish models. Taken together, our results have uncovered a novel, RNA-based recombination mechanism by which CSB protects genome stability from strand breaks at transcriptionally active sites and may provide insight into the clinical manifestations of Cockayne syndrome. PMID:26100862

Base substitutions at scissile bond sites are sufficient to alter RNA-binding and cleavage activity of RNase III.

PubMed

Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok

2011-02-01

RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

2009-06-08

The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

Radioactive liquid wastes discharged to ground in the 200 Areas during 1976

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mirabella, J.E.

An overall summary is presented giving the radioactive liquid wastes discharged to ground during 1976 and since startup (for both total and decayed depositions) within the Production and Waste Management Division control zone (200 Area plateau). Overall summaries are also presented for 200 East Area and for 200 West Area. The data contain an estimate of the radioactivity discharged to individual ponds, cribs and specific retention sites within the Production and Waste Management Division during 1976 and from startup through December 31, 1976; an estimate of the decayed activities from startup through 1976; the location and reference drawings of eachmore » disposal site; and the usage dates of each disposal site. The estimates for the radioactivity discharged and for decayed activities dicharged from startup through December 31, 1976 are based upon Item 4 of the Bibliography. The volume of liquid discharged to the ponds also includes major nonradioactive streams. The wastes discharged during 1976 to each active disposal site are detailed on a month-to-month basis, along with the monthly maximum concentration and average concentration data. An estimate of the radioactivity discharged to each active site along with the remaining decayed activities is given.« less

Crystal structure and DNA repair activities of the AP endonuclease from Leishmania major.

PubMed

Vidal, Antonio E; Harkiolaki, Maria; Gallego, Claribel; Castillo-Acosta, Victor M; Ruiz-Pérez, Luis M; Wilson, Keith; González-Pacanowska, Dolores

2007-11-02

Apurinic/apyrimidinic endonucleases initiate the repair of abasic sites produced either spontaneously, from attack of bases by reactive oxygen species or as intermediates during base excision repair. The catalytic properties and crystal structure of Leishmania major apurinic/apyrimidinic endonuclease are described and compared with those of human APE1 and bacterial exonuclease III. The purified enzyme is shown to possess apurinic/apyrimidinic endonuclease activity of the same order as eukaryotic and prokaryotic counterparts and an equally robust 3'-phosphodiesterase activity. Consistent with this, expression of the L. major endonuclease confers resistance to both methyl methane sulphonate and H2O2 in Escherichia coli repair-deficient mutants while expression of the human homologue only reverts methyl methane sulphonate sensitivity. Structural analyses and modelling of the enzyme-DNA complex demonstrates a high degree of conservation to previously characterized homologues, although subtle differences in the active site geometry might account for the high 3'-phosphodiesterase activity. Our results confirm that the L. major's enzyme is a key element in mediating repair of apurinic/apyrimidinic sites and 3'-blocked termini and therefore must play an important role in the survival of kinetoplastid parasites after exposure to the highly oxidative environment within the host macrophage.

Methods for estimating flood frequency in Montana based on data through water year 1998

USGS Publications Warehouse

Parrett, Charles; Johnson, Dave R.

2004-01-01

Annual peak discharges having recurrence intervals of 2, 5, 10, 25, 50, 100, 200, and 500 years (T-year floods) were determined for 660 gaged sites in Montana and in adjacent areas of Idaho, Wyoming, and Canada, based on data through water year 1998. The updated flood-frequency information was subsequently used in regression analyses, either ordinary or generalized least squares, to develop equations relating T-year floods to various basin and climatic characteristics, equations relating T-year floods to active-channel width, and equations relating T-year floods to bankfull width. The equations can be used to estimate flood frequency at ungaged sites. Montana was divided into eight regions, within which flood characteristics were considered to be reasonably homogeneous, and the three sets of regression equations were developed for each region. A measure of the overall reliability of the regression equations is the average standard error of prediction. The average standard errors of prediction for the equations based on basin and climatic characteristics ranged from 37.4 percent to 134.1 percent. Average standard errors of prediction for the equations based on active-channel width ranged from 57.2 percent to 141.3 percent. Average standard errors of prediction for the equations based on bankfull width ranged from 63.1 percent to 155.5 percent. In most regions, the equations based on basin and climatic characteristics generally had smaller average standard errors of prediction than equations based on active-channel or bankfull width. An exception was the Southeast Plains Region, where all equations based on active-channel width had smaller average standard errors of prediction than equations based on basin and climatic characteristics or bankfull width. Methods for weighting estimates derived from the basin- and climatic-characteristic equations and the channel-width equations also were developed. The weights were based on the cross correlation of residuals from the different methods and the average standard errors of prediction. When all three methods were combined, the average standard errors of prediction ranged from 37.4 percent to 120.2 percent. Weighting of estimates reduced the standard errors of prediction for all T-year flood estimates in four regions, reduced the standard errors of prediction for some T-year flood estimates in two regions, and provided no reduction in average standard error of prediction in two regions. A computer program for solving the regression equations, weighting estimates, and determining reliability of individual estimates was developed and placed on the USGS Montana District World Wide Web page. A new regression method, termed Region of Influence regression, also was tested. Test results indicated that the Region of Influence method was not as reliable as the regional equations based on generalized least squares regression. Two additional methods for estimating flood frequency at ungaged sites located on the same streams as gaged sites also are described. The first method, based on a drainage-area-ratio adjustment, is intended for use on streams where the ungaged site of interest is located near a gaged site. The second method, based on interpolation between gaged sites, is intended for use on streams that have two or more streamflow-gaging stations.

Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid–base catalysis

PubMed Central

Schultz, Eric P.; Vasquez, Ernesto E.; Scott, William G.

2014-01-01

The hammerhead ribozyme catalyzes RNA cleavage via acid–base catalysis. Whether it does so by general acid–base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid–base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK a of the substituted purine; in both cases inosine, which is similar to G in pK a and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential role of G12 as a general base, indicates that an alternative hammerhead cleavage mechanism involving specific base catalysis may instead explain the observed rate dependence upon purine substitutions at G12. The crystallographic results, contrary to previous assumptions, therefore cannot be interpreted to favor the general base catalysis mecahnism over the specific base catalysis mechanism. Instead, both of these mutually exclusive mechanistic alternatives must be considered in light of the current structural and biochemical data. PMID:25195740

Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid-base catalysis.

PubMed

Schultz, Eric P; Vasquez, Ernesto E; Scott, William G

2014-09-01

The hammerhead ribozyme catalyzes RNA cleavage via acid-base catalysis. Whether it does so by general acid-base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid-base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK(a) of the substituted purine; in both cases inosine, which is similar to G in pK(a) and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential role of G12 as a general base, indicates that an alternative hammerhead cleavage mechanism involving specific base catalysis may instead explain the observed rate dependence upon purine substitutions at G12. The crystallographic results, contrary to previous assumptions, therefore cannot be interpreted to favor the general base catalysis mecahnism over the specific base catalysis mechanism. Instead, both of these mutually exclusive mechanistic alternatives must be considered in light of the current structural and biochemical data.

Seasonal and spatial variation in reactive oxygen species activity of quasi-ultrafine particles (PM0.25) in the Los Angeles metropolitan area and its association with chemical composition

NASA Astrophysics Data System (ADS)

Saffari, Arian; Daher, Nancy; Shafer, Martin M.; Schauer, James J.; Sioutas, Constantinos

2013-11-01

Seasonal and spatial variation in redox activity of quasi-ultrafine particles (PM0.25) and its association with chemical species was investigated at 9 distinct sampling sites across the Los Angeles metropolitan area. Biologically reactive oxygen species (ROS) assay (generation of ROS in rat alveolar macrophage cells) was employed in order to assess the redox activity of PM0.25 samples. Seasonally, fall and summer displayed higher volume-based ROS activity (i.e. ROS activity per unit volume of air) compared to spring and winter. ROS levels were generally higher at near source and urban background sites compared to rural receptor locations, except for summer when comparable ROS activity was observed at the rural receptor sites. Univariate linear regression analysis indicated association (R > 0.7) between ROS activity and organic carbon (OC), water soluble organic carbon (WSOC) and water soluble transition metals (including Fe, V, Cr, Cd, Ni, Zn, Mn, Pb and Cu). A multivariate regression method was also used to obtain a model to predict the ROS activity of PM0.25, based on its water-soluble components. The most important species associated with ROS were Cu and La at the source site of Long Beach, and Fe and V at urban Los Angeles sites. These metals are tracers of road dust enriched with vehicular emissions (Fe and Cu) and residual oil combustion (V and La). At Riverside, a rural receptor location, WSOC and Ni (tracers of secondary organic aerosol and metal plating, respectively) were the dominant species driving the ROS activity. At Long Beach, the multivariate model was able to reconstruct the ROS activity with a high coefficient of determination (R2 = 0.82). For Los Angeles and Riverside, however, the regression models could only explain 63% and 68% of the ROS activity, respectively. The unexplained portion of the measured ROS activity is likely attributed to the nature of organic species not captured in the organic carbon (OC) measurement as well as non-linear effects, which were not included in our linear model.

Active Site Desolvation and Thermostability Trade-Offs in the Evolution of Catalytically Diverse Triazine Hydrolases.

PubMed

Sugrue, Elena; Carr, Paul D; Scott, Colin; Jackson, Colin J

2016-11-15

The desolvation of ionizable residues in the active sites of enzymes and the subsequent effects on catalysis and thermostability have been studied in model systems, yet little about how enzymes can naturally evolve to include active sites with highly reactive and desolvated charges is known. Variants of triazine hydrolase (TrzN) with significant differences in their active sites have been isolated from different bacterial strains: TrzN from Nocardioides sp. strain MTD22 contains a catalytic glutamate residue (Glu241) that is surrounded by hydrophobic and aromatic second-shell residues (Pro214 and Tyr215), whereas TrzN from Nocardioides sp. strain AN3 has a noncatalytic glutamine residue (Gln241) at an equivalent position, surrounded by hydrophilic residues (Thr214 and His215). To understand how and why these variants have evolved, a series of TrzN mutants were generated and characterized. These results show that desolvation by second-shell residues increases the pK a of Glu241, allowing it to act as a general acid at neutral pH. However, significant thermostability trade-offs are required to incorporate the ionizable Glu241 in the active site and to then enclose it in a hydrophobic microenvironment. Analysis of high-resolution crystal structures shows that there are almost no structural changes to the overall configuration of the active site due to these mutations, suggesting that the changes in activity and thermostability are purely based on the altered electrostatics. The natural evolution of these enzyme isoforms provides a unique system in which to study the fundamental process of charged residue desolvation in enzyme catalysis and its relative contribution to the creation and evolution of an enzyme active site.

The molecular basis of the effect of temperature on enzyme activity.

PubMed

Daniel, Roy M; Peterson, Michelle E; Danson, Michael J; Price, Nicholas C; Kelly, Sharon M; Monk, Colin R; Weinberg, Cristina S; Oudshoorn, Matthew L; Lee, Charles K

2009-12-23

Experimental data show that the effect of temperature on enzymes cannot be adequately explained in terms of a two-state model based on increases in activity and denaturation. The Equilibrium Model provides a quantitative explanation of enzyme thermal behaviour under reaction conditions by introducing an inactive (but not denatured) intermediate in rapid equilibrium with the active form. The temperature midpoint (Teq) of the rapid equilibration between the two forms is related to the growth temperature of the organism, and the enthalpy of the equilibrium (DeltaHeq) to its ability to function over various temperature ranges. In the present study, we show that the difference between the active and inactive forms is at the enzyme active site. The results reveal an apparently universal mechanism, independent of enzyme reaction or structure, based at or near the active site, by which enzymes lose activity as temperature rises, as opposed to denaturation which is global. Results show that activity losses below Teq may lead to significant errors in the determination of DeltaG*cat made on the basis of the two-state ('Classical') model, and the measured kcat will then not be a true indication of an enzyme's catalytic power. Overall, the results provide a molecular rationale for observations that the active site tends to be more flexible than the enzyme as a whole, and that activity losses precede denaturation, and provide a general explanation in molecular terms for the effect of temperature on enzyme activity.

The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

PubMed

Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

2003-07-05

Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

Mutational analysis of the antigenomic trans-acting delta ribozyme: the alterations of the middle nucleotides located on the P1 stem.

PubMed Central

Ananvoranich, S; Lafontaine, D A; Perreault, J P

1999-01-01

Our previous report on delta ribozyme cleavage using a trans -acting antigenomic delta ribozyme and a collection of short substrates showed that the middle nucleotides of the P1 stem, the substrate binding site, are essential for the cleavage activity. Here we have further investigated the effect of alterations in the P1 stem on the kinetic and thermodynamic parameters of delta ribozyme cleavage using various ribozyme variants carrying single base mutations at putative positions reported. The kinetic and thermodynamic values obtained in mutational studies of the two middle nucleotides of the P1 stem suggest that the binding and active sites of the delta ribozyme are uniquely formed. Firstly, the substrate and the ribozyme are engaged in the formation of a helix, known as the P1 stem, which may contain a weak hydrogen bond(s) or a bulge. Secondly, a tertiary interaction involving the base moieties in the middle of the P1 stem likely plays a role in defining the chemical environment. As a con-sequence, the active site might form simultaneously or subsequently to the binding site during later steps of the pathway. PMID:10037808

The Activity of Trypsin

ERIC Educational Resources Information Center

Russo, Salvatore F.; Holzman, Tom

1977-01-01

Describes an experiment that illustrates the following points concerning the experimental determination of trypsin activity: (1) there is a difference in basing enzyme concentration on weight, absorbance, or active sites; and (2) the method of expressing enzyme concentration determines the value of specific, molecular, and catalytic center…

Corrosion Research And Web Site Activities

NASA Technical Reports Server (NTRS)

Heidersbach, Robert H.

2001-01-01

This report covers corrosion-related activities at the NASA Kennedy Space Center during the summer of 2000. The NASA Kennedy Space Center's corrosion web site, corrosion.ksc.nasa.gov, was updated with new information based on feedback over the past two years. The methodology for a two-year atmospheric exposure testing program to study the effectiveness of commercial chemicals sold for rinsing aircraft and other equipment was developed and some preliminary laboratory chemical analyses are presented.

Corrosion Research and Web Site Activities

NASA Technical Reports Server (NTRS)

Heidersbach, Robert H.

2002-01-01

This report covers corrosion-related activities at the NASA Kennedy Space Center during the summer of 2000. The NASA Kennedy Space Center's corrosion web site, corrosion.ksc.nasa.gov, was updated with new information based on feedback over the past two years. The methodology for a two-year atmospheric exposure testing program to study the effectiveness of commercial chemicals sold for rinsing aircraft and other equipment was developed and some preliminary laboratory chemical analyses are presented.

Electrostatic channeling in P. falciparum DHFR-TS: Brownian dynamics and Smoluchowski modeling.

PubMed

Metzger, Vincent T; Eun, Changsun; Kekenes-Huskey, Peter M; Huber, Gary; McCammon, J Andrew

2014-11-18

We perform Brownian dynamics simulations and Smoluchowski continuum modeling of the bifunctional Plasmodium falciparum dihydrofolate reductase-thymidylate synthase (P. falciparum DHFR-TS) with the objective of understanding the electrostatic channeling of dihydrofolate generated at the TS active site to the DHFR active site. The results of Brownian dynamics simulations and Smoluchowski continuum modeling suggest that compared to Leishmania major DHFR-TS, P. falciparum DHFR-TS has a lower but significant electrostatic-mediated channeling efficiency (?15-25%) at physiological pH (7.0) and ionic strength (150 mM). We also find that removing the electric charges from key basic residues located between the DHFR and TS active sites significantly reduces the channeling efficiency of P. falciparum DHFR-TS. Although several protozoan DHFR-TS enzymes are known to have similar tertiary and quaternary structure, subtle differences in structure, active-site geometry, and charge distribution appear to influence both electrostatic-mediated and proximity-based substrate channeling.

Remote Sensing Mars Landing Sites: An Out-of-School Time Planetary Science Education Activity for Middle School Students

NASA Astrophysics Data System (ADS)

Anderson, R. B.; Gaither, T. A.; Edgar, L. A.; Milazzo, M. P.; Vaughan, R. G.; Rubino-Hare, L.; Clark, J.; Ryan, S.

2017-12-01

As part of the Planetary Learning that Advances the Nexus of Engineering, Technology, and Science (PLANETS) project, we have developed an out-of-school time unit for middle school students focused on planetary remote sensing. The activity is divided into two exercises, with the goal of choosing a scientifically interesting and safe landing site for a future Mars mission. Students are introduced to NASA data from several actual and proposed landing sites and must use what they learn about remote sensing to choose a site that satisfies scientific and engineering criteria. The activity also includes background information for educators, including a summary of how landing on Mars helps answer major scientific questions, brief overviews of the data sets that the students will use, summaries of the site geology, and a list of relevant vocabulary. The first exercise introduces students to the concept of reflectance spectroscopy and how it can be used to identify the "fingerprints" of different minerals on the surface of Mars. Students are provided with simplified maps of mineral spectra at the four sites, based on Compact Reconnaissance Imaging Spectrometer (CRISM) observations, as well as a reference sheet with the spectra of common minerals on Mars. They can use this information to determine which sites have hydrated minerals, mafic minerals, or both. The second exercise adds data from the Mars Orbital Laser Altimeter (MOLA), and high resolution visible data from the Context Camera (CTX) on the Mars Reconnaissance Orbiter. Students learn about laser altimetry and how to interpret topographic contours to assess whether a landing site is too rough. The CTX data allow students to study the sites at higher resolution, with annotations that indicate key landforms of interest. These data, along with the spectroscopy data, allow students to rank the sites based on science and engineering criteria. This activity was developed as a collaboration between subject matter experts at the USGS Astrogeology Science Center and education experts from the Northern Arizona University Center for Science Teaching and Learning. It works as either a stand-alone activity or as an extension of the "Worlds Apart" Engineering is Everywhere unit, also developed as part of the PLANETS project in collaboration with the Boston Museum of Science.

Catalytic conversion of syngas to mixed alcohols over Zn-Mn promoted Cu-Fe based catalyst

DOE PAGES

Lu, Yongwu; Yu, Fei; Hu, Jin; ...

2012-04-12

Zn-Mn promoted Cu-Fe based catalyst was synthesized by the co-precipitation method. Mixed alcohols synthesis from syngas was studied in a half-inch tubular reactor system after the catalyst was reduced. Zn-Mn promoted Cu-Fe based catalyst was characterized by SEM-EDS, TEM, XRD, and XPS. The liquid phase products (alcohol phase and hydrocarbon phase) were analyzed by GC-MS and the gas phase products were analyzed by GC. The results showed that Zn-Mn promoted Cu-Fe based catalyst had high catalytic activity and high alcohol selectivity. The maximal CO conversion rate was 72%, and the yield of alcohol and hydrocarbons were also very high. Cumore » (111) was the active site for mixed alcohols synthesis, Fe 2C (101) was the active site for olefin and paraffin synthesis. The reaction mechanism of mixed alcohols synthesis from syngas over Zn-Mn promoted Cu-Fe based catalyst was proposed. Here, Zn-Mn promoted Cu-Fe based catalyst can be regarded as a potential candidate for catalytic conversion of biomass-derived syngas to mixed alcohols.« less

A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches

PubMed Central

Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael

2012-01-01

Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521

The production of high efficiency Ziegler-Natta catalyst with dual active sites nature using cyclohexyl chloride as promoter with super activity and produced superior polyethylene with controllable molecular weight distribution.

PubMed

Seifali Abbas-Abadi, Mehrdad

2017-01-01

In the previous studies, the several halocarbons (HC) were tested as promoters for a Ti-based Ziegler-Natta (ZN) catalyst at different polymerization conditions. The Results showed that chloro cyclohexane has the best operation in catalyst activity, polymer particle size growth, hydrogen responsibility and wax reduction too. For the first time in this study, the effect of Al/Ti ratio on the optimum HC/Ti ratio has been considered and the results showed that the optimum HC/Ti ratio depends on the Al/Ti ratio directly. In the optimum HC/Ti ratio, the catalyst activity and hydrogen responsibility ratio of the catalyst increase up to 125 and 55% respectively. The acceptable growth of polymer powder up to 46%, lower flow rate ratio (FRR) up to 19% and decrease of wax amount up to 12%, completed the promotion results. Furthermore, in the next part of this study and as key note, a little dose of halocarbon was used in the catalyst preparation to produce the special catalysts with dual active sites. In the catalyst preparation, the concentration of each active sites depends on the halocarbon amount and it can control the molecular weight distribution of the produced polyethylene; because each active sites have different response to hydrogen. The halocarbon based catalysts showed the remarkable effect on the catalyst activity, the molecular weight and especially molecular weight distribution (MWD). The flow rate ratio and MWD could be increased up to 77 and 88% respectively as the main result of halocarbon addition during the catalyst preparation.

The production of high efficiency Ziegler–Natta catalyst with dual active sites nature using cyclohexyl chloride as promoter with super activity and produced superior polyethylene with controllable molecular weight distribution

PubMed Central

Seifali Abbas-Abadi, Mehrdad

2017-01-01

Abstract In the previous studies, the several halocarbons (HC) were tested as promoters for a Ti-based Ziegler–Natta (ZN) catalyst at different polymerization conditions. The Results showed that chloro cyclohexane has the best operation in catalyst activity, polymer particle size growth, hydrogen responsibility and wax reduction too. For the first time in this study, the effect of Al/Ti ratio on the optimum HC/Ti ratio has been considered and the results showed that the optimum HC/Ti ratio depends on the Al/Ti ratio directly. In the optimum HC/Ti ratio, the catalyst activity and hydrogen responsibility ratio of the catalyst increase up to 125 and 55% respectively. The acceptable growth of polymer powder up to 46%, lower flow rate ratio (FRR) up to 19% and decrease of wax amount up to 12%, completed the promotion results. Furthermore, in the next part of this study and as key note, a little dose of halocarbon was used in the catalyst preparation to produce the special catalysts with dual active sites. In the catalyst preparation, the concentration of each active sites depends on the halocarbon amount and it can control the molecular weight distribution of the produced polyethylene; because each active sites have different response to hydrogen. The halocarbon based catalysts showed the remarkable effect on the catalyst activity, the molecular weight and especially molecular weight distribution (MWD). The flow rate ratio and MWD could be increased up to 77 and 88% respectively as the main result of halocarbon addition during the catalyst preparation. PMID:29491824

Dynamics of active sites in biological macromolecules using a Green-function approach: An application to heme vibrational dynamics in myoglobin

NASA Astrophysics Data System (ADS)

Rai, Brajesh; Prohofsky, Earl

2003-03-01

Dynamics of functionally active regions of biological macromolecules can be studied using a Green-function technique. This approach uses the fact that in most cases one has a good set of force constants for active sites, and rather poorly defined force field parameters for other regions of the macromolecule. The Green-function method is applied to study the iron vibrational modes of the heme active site in myoglobin. In this approach, the heme active site is viewed as a system interacting with surrounding globin, which acts as an excitation bath. The normal modes of heme and globin are separately calculated using the best available force fields for the two entities. The iron vibrational spectrum of myoglobin is then obtained using the solutions of the heme and globin, and by considering physically meaningful interactions between the two units. The refinement of the Green-function calculations to the experimental data from an x-ray synchrotron-based Nuclear Resonance Vibrational Spectroscopy provides important insights into the character of iron normal modes of myoglobin.

A pharmacophore model specific to active site of CYP1A2 with a novel molecular modeling explorer and CoMFA.

PubMed

Zhang, Tao; Wei, Dong-Qing; Chou, Kuo-Chen

2012-03-01

Comparative molecular field analysis (CoMFA) is a widely used 3D-QSAR method by which we can investigate the potential relation between biological activity of compounds and their structural features. In this study, a new application of this approach is presented by combining the molecular modeling with a new developed pharmacophore model specific to CYP1A2 active site. During constructing the model, we used the molecular dynamics simulation and molecular docking method to select the sensible binding conformations for 17 CYP1A2 substrates based on the experimental data. Subsequently, the results obtained via the alignment of binding conformations of substrates were projected onto the active- site residues, upon which a simple blueprint of active site was produced. It was validated by the experimental and computational results that the model did exhibit the high degree of rationality and provide useful insights into the substrate binding. It is anticipated that our approach can be extended to investigate the protein-ligand interactions for many other enzyme-catalyzed systems as well.

Testing the applicability of rapid on-site enzymatic activity detection for surface water monitoring

NASA Astrophysics Data System (ADS)

Stadler, Philipp; Vogl, Wolfgang; Juri, Koschelnik; Markus, Epp; Maximilian, Lackner; Markus, Oismüller; Monika, Kumpan; Peter, Strauss; Regina, Sommer; Gabriela, Ryzinska-Paier; Farnleitner Andreas, H.; Matthias, Zessner

2015-04-01

On-site detection of enzymatic activities has been suggested as a rapid surrogate for microbiological pollution monitoring of water resources (e.g. using glucuronidases, galactosidases, esterases). Due to the possible short measuring intervals enzymatic methods have high potential as near-real time water quality monitoring tools. This presentation describes results from a long termed field test. For twelve months, two ColiMinder devices (Vienna Water Monitoring, Austria) for on-site determination of enzymatic activity were tested for stream water monitoring at the experimental catchment HOAL (Hydrological Open Air Laboratory, Center for Water Resource Systems, Vienna University of Technology). The devices were overall able to follow and reflect the diverse hydrological and microbiological conditions of the monitored stream during the test period. Continuous data in high temporal resolution captured the course of enzymatic activity in stream water during diverse rainfall events. The method also proofed sensitive enough to determine diurnal fluctuations of enzymatic activity in stream water during dry periods. The method was able to capture a seasonal trend of enzymatic activity in stream water that matches the results gained from Colilert18 analysis for E. coli and coliform bacteria of monthly grab samples. Furthermore the comparison of ColiMinder data with measurements gained at the same test site with devices using the same method but having different construction design (BACTcontrol, microLAN) showed consistent measuring results. Comparative analysis showed significant differences between measured enzymatic activity (modified fishman units and pmol/min/100ml) and cultivation based analyses (most probable number, colony forming unit). Methods of enzymatic activity measures are capable to detect ideally the enzymatic activity caused by all active target bacteria members, including VBNC (viable but nonculturable) while cultivation based methods cannot detect VBNC bacteria. Therefore the applicability of on-site enzymatic activity determination as a direct surrogate or proxy parameter for microbiological standard assays and quantification of fecal indicator bacteria (FIB) concentration could not be approved and further research in this field is necessary. Presently we conclude that rapid on-site detection of enzymatic activity is applicable for surface water monitoring and that it constitutes a complementary on-site monitoring parameter with high potential. Selection of the type of measured enzymatic activities has to be done on a catchment-specific basis and further work is needed to learn more about its detailed information characteristics in different habitats. The accomplishment of this method detecting continuous data of enzymatic activity in high temporal resolution caused by a target bacterial member is on the way of becoming a powerful tool for water quality monitoring, health related water quality- and early warning requirements.

Improving the neutral phytase activity from Bacillus amyloliquefaciens DSM 1061 by site-directed mutagenesis.

PubMed

Xu, Wei; Shao, Rong; Wang, Zupeng; Yan, Xiuhua

2015-03-01

Neutral phytase is used as a feed additive for degradation of anti-nutritional phytate in aquatic feed industry. Site-directed mutagenesis of Bacillus amyloliquefaciens DSM 1061 phytase was performed with an aim to increase its activity. Mutation residues were chosen based on multiple sequence alignments and structure analysis of neutral phytsaes from different microorganisms. The mutation sites on surface (D148E, S197E and N156E) and around the active site (D52E) of phytase were selected. Analysis of the phytase variants showed that the specific activities of mutants D148E and S197E remarkably increased by about 35 and 13% over a temperature range of 40-75 °C at pH 7.0, respectively. The k cat of mutants D148E and S197E were 1.50 and 1.25 times than that of the wild-type phytase, respectively. Both D148E and S197E showed much higher thermostability than that of the wild-type phytase. However, mutants N156E and D52E led to significant loss of specific activity of the enzyme. Structural analysis revealed that these mutations may affect conformation of the active site of phytase. The present mutant phytases D148E and S197E with increased activities and thermostabilities have application potential as additives in aquaculture feed.

Mapping sites of aspirin-induced acetylations in live cells by quantitative acid-cleavable activity-based protein profiling (QA-ABPP)

PubMed Central

Wang, Jigang; Zhang, Chong-Jing; Zhang, Jianbin; He, Yingke; Lee, Yew Mun; Chen, Songbi; Lim, Teck Kwang; Ng, Shukie; Shen, Han-Ming; Lin, Qingsong

2015-01-01

Target-identification and understanding of mechanism-of-action (MOA) are challenging for development of small-molecule probes and their application in biology and drug discovery. For example, although aspirin has been widely used for more than 100 years, its molecular targets have not been fully characterized. To cope with this challenge, we developed a novel technique called quantitative acid-cleavable activity-based protein profiling (QA-ABPP) with combination of the following two parts: (i) activity-based protein profiling (ABPP) and iTRAQ™ quantitative proteomics for identification of target proteins and (ii) acid-cleavable linker-based ABPP for identification of peptides with specific binding sites. It is known that reaction of aspirin with its target proteins leads to acetylation. We thus applied the above technique using aspirin-based probes in human cancer HCT116 cells. We identified 1110 target proteins and 2775 peptides with exact acetylation sites. By correlating these two sets of data, 523 proteins were identified as targets of aspirin. We used various biological assays to validate the effects of aspirin on inhibition of protein synthesis and induction of autophagy which were elicited from the pathway analysis of Aspirin target profile. This technique is widely applicable for target identification in the field of drug discovery and biology, especially for the covalent drugs. PMID:25600173

Direct Push supported geotechnical and hydrogeological characterisation of an active sinkhole area

NASA Astrophysics Data System (ADS)

Tippelt, Thomas; Vienken, Thomas; Kirsch, Reinhard; Dietrich, Peter; Werban, Ulrike

2017-04-01

Sinkholes represent a natural geologic hazard in areas where soluble layers are present in the subsurface. A detailed knowledge of the composition of the subsurface and its hydrogeological and geotechnical properties is essential for the understanding of sinkhole formation and propagation. This serves as base for risk evaluation and the development of an early warning system. However, site models often depend on data from drillings and surface geophysical surveys that in many cases cannot resolve the spatial distribution of relevant hydrogeological and geotechnical parameters sufficiently. Therefore, an active sinkhole area in Münsterdorf, Northern Germany, was investigated in detail using Direct Push technology, a minimally invasive sounding method. The obtained vertical high-resolution profiles of geotechnical and hydrogeological characteristics, in combination with Direct Push based sampling and surface geophysical measurements lead to a strong improvement of the geologic site model. The conceptual site model regarding sinkhole formation and propagation will then be tested based on the gathered data and, if necessary, adapted accordingly.

Activity-based proteomics of enzyme superfamilies: serine hydrolases as a case study.

PubMed

Simon, Gabriel M; Cravatt, Benjamin F

2010-04-09

Genome sequencing projects have uncovered thousands of uncharacterized enzymes in eukaryotic and prokaryotic organisms. Deciphering the physiological functions of enzymes requires tools to profile and perturb their activities in native biological systems. Activity-based protein profiling has emerged as a powerful chemoproteomic strategy to achieve these objectives through the use of chemical probes that target large swaths of enzymes that share active-site features. Here, we review activity-based protein profiling and its implementation to annotate the enzymatic proteome, with particular attention given to probes that target serine hydrolases, a diverse superfamily of enzymes replete with many uncharacterized members.

New Role of Flavin as a General Acid-Base Catalyst with No Redox Function in Type 2 Isopentenyl-diphosphate Isomerase*S⃞

PubMed Central

Unno, Hideaki; Yamashita, Satoshi; Ikeda, Yosuke; Sekiguchi, Shin-ya; Yoshida, Norie; Yoshimura, Tohru; Kusunoki, Masami; Nakayama, Toru; Nishino, Tokuzo; Hemmi, Hisashi

2009-01-01

Using FMN and a reducing agent such as NAD(P)H, type 2 isopentenyl-diphosphate isomerase catalyzes isomerization between isopentenyl diphosphate and dimethylallyl diphosphate, both of which are elemental units for the biosynthesis of highly diverse isoprenoid compounds. Although the flavin cofactor is expected to be integrally involved in catalysis, its exact role remains controversial. Here we report the crystal structures of the substrate-free and complex forms of type 2 isopentenyl-diphosphate isomerase from the thermoacidophilic archaeon Sulfolobus shibatae, not only in the oxidized state but also in the reduced state. Based on the active-site structures of the reduced FMN-substrate-enzyme ternary complexes, which are in the active state, and on the data from site-directed mutagenesis at highly conserved charged or polar amino acid residues around the active site, we demonstrate that only reduced FMN, not amino acid residues, can catalyze proton addition/elimination required for the isomerase reaction. This discovery is the first evidence for this long suspected, but previously unobserved, role of flavins just as a general acid-base catalyst without playing any redox roles, and thereby expands the known functions of these versatile coenzymes. PMID:19158086

New role of flavin as a general acid-base catalyst with no redox function in type 2 isopentenyl-diphosphate isomerase.

PubMed

Unno, Hideaki; Yamashita, Satoshi; Ikeda, Yosuke; Sekiguchi, Shin-Ya; Yoshida, Norie; Yoshimura, Tohru; Kusunoki, Masami; Nakayama, Toru; Nishino, Tokuzo; Hemmi, Hisashi

2009-04-03

Using FMN and a reducing agent such as NAD(P)H, type 2 isopentenyl-diphosphate isomerase catalyzes isomerization between isopentenyl diphosphate and dimethylallyl diphosphate, both of which are elemental units for the biosynthesis of highly diverse isoprenoid compounds. Although the flavin cofactor is expected to be integrally involved in catalysis, its exact role remains controversial. Here we report the crystal structures of the substrate-free and complex forms of type 2 isopentenyl-diphosphate isomerase from the thermoacidophilic archaeon Sulfolobus shibatae, not only in the oxidized state but also in the reduced state. Based on the active-site structures of the reduced FMN-substrate-enzyme ternary complexes, which are in the active state, and on the data from site-directed mutagenesis at highly conserved charged or polar amino acid residues around the active site, we demonstrate that only reduced FMN, not amino acid residues, can catalyze proton addition/elimination required for the isomerase reaction. This discovery is the first evidence for this long suspected, but previously unobserved, role of flavins just as a general acid-base catalyst without playing any redox roles, and thereby expands the known functions of these versatile coenzymes.

Experimental Observation of Redox-Induced Fe-N Switching Behavior as a Determinant Role for Oxygen Reduction Activity.

PubMed

Jia, Qingying; Ramaswamy, Nagappan; Hafiz, Hasnain; Tylus, Urszula; Strickland, Kara; Wu, Gang; Barbiellini, Bernardo; Bansil, Arun; Holby, Edward F; Zelenay, Piotr; Mukerjee, Sanjeev

2015-12-22

The commercialization of electrochemical energy conversion and storage devices relies largely upon the development of highly active catalysts based on abundant and inexpensive materials. Despite recent achievements in this respect, further progress is hindered by the poor understanding of the nature of active sites and reaction mechanisms. Herein, by characterizing representative iron-based catalysts under reactive conditions, we identify three Fe-N4-like catalytic centers with distinctly different Fe-N switching behaviors (Fe moving toward or away from the N4-plane) during the oxygen reduction reaction (ORR), and show that their ORR activities are essentially governed by the dynamic structure associated with the Fe(2+/3+) redox transition, rather than the static structure of the bare sites. Our findings reveal the structural origin of the enhanced catalytic activity of pyrolyzed Fe-based catalysts compared to nonpyrolyzed Fe-macrocycle compounds. More generally, the fundamental insights into the dynamic nature of transition-metal compounds during electron-transfer reactions will potentially guide rational design of these materials for broad applications.

Active site formation mechanism of carbon-based oxygen reduction catalysts derived from a hyperbranched iron phthalocyanine polymer.

PubMed

Hiraike, Yusuke; Saito, Makoto; Niwa, Hideharu; Kobayashi, Masaki; Harada, Yoshihisa; Oshima, Masaharu; Kim, Jaehong; Nabae, Yuta; Kakimoto, Masa-Aki

2015-01-01

Carbon-based cathode catalysts derived from a hyperbranched iron phthalocyanine polymer (HB-FePc) were characterized, and their active-site formation mechanism was studied by synchrotron-based spectroscopy. The properties of the HB-FePc catalyst are compared with those of a catalyst with high oxygen reduction reaction (ORR) activity synthesized from a mixture of iron phthalocyanine and phenolic resin (FePc/PhRs). Electrochemical measurements demonstrate that the HB-FePc catalyst does not lose its ORR activity up to 900°C, whereas that of the FePc/PhRs catalyst decreases above 700°C. Hard X-ray photoemission spectra reveal that the HB-FePc catalysts retain more nitrogen components than the FePc/PhRs catalysts between pyrolysis temperatures of 600°C and 800°C. This is because the linked structure of the HB-FePc precursor has high thermostability against nitrogen desorption. Consequently, effective doping of active nitrogen species into the sp (2) carbon network of the HB-FePc catalysts may occur up to 900°C.

A Quantitative Approach for Collocating NEON's Sensor-Based Ecological Measurements and in-situ Field Sampling and Observations

NASA Astrophysics Data System (ADS)

Zulueta, R. C.; Metzger, S.; Ayres, E.; Luo, H.; Meier, C. L.; Barnett, D.; Sanclements, M.; Elmendorf, S.

2013-12-01

The National Ecological Observatory Network (NEON) is a continental-scale research platform currently in development to assess the causes of ecological change and biological responses to change across a projected 30-year timeframe. A suite of standardized sensor-based measurements (i.e., Terrestrial Instrument System (TIS) measurements) and in-situ field sampling and observations (i.e., Terrestrial Observation System (TOS) activities) will be conducted across 20 ecoclimatic domains in the U.S. where NEON is establishing 60 terrestrial research sites. NEON's TIS measurements and TOS activities are designed to observe the temporal and spatial dynamics of key drivers and ecological processes and responses to change within each of the 60 terrestrial research sites. The TIS measurements are non-destructive and designed to provide in-situ, continuous, and areally integrated observations of the surrounding ecosystem and environment, while TOS sampling and observation activities are designed to encompass a hierarchy of measurable biological states and processes including diversity, abundance, phenology, demography, infectious disease prevalence, ecohydrology, and biogeochemistry. To establish valid relationships between these drivers and site-specific responses, two contradicting requirements must be fulfilled: (i) both types of observations shall be representative of the same ecosystem, and (ii) they shall not significantly influence one another. Here we outline the theoretical background and algorithmic process for determining areas of mutual representativeness and exclusion around NEON's TIS measurements and develop a procedure which quantitatively optimizes this trade-off through: (i) quantifying the source area distributions of TIS measurements, (ii) determining the ratio of user-defined impact threshold to effective impact area for different TOS activities, and (iii) determining the range of feasible distances between TIS locations and TOS activities. This approach provides an evidence-based and repeatable method for combining sensor-based measurements and field sampling and observations at predefined levels of disturbance and spatial representativeness. The developed approach represents a general framework which is applicable to other environmental research sites where similar collocation is desired.

Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

PubMed Central

Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

2015-01-01

The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000

Encouraging Historical Thinking at Historic Sites

ERIC Educational Resources Information Center

Baron, Christine

2010-01-01

This study seeks to contribute to our understanding of the problem of effectively encouraging historical thinking by (a) evaluating, and modifying Wineburg's heuristics for historical thinking for applicability to the problem-solving activities historians use at historic sites; (b) establishing the efficacy of a hypermedia-based education program…

Technical support for geopressured-geothermal activities in Louisiana. Final geological report, 1 November 1981-31 October 1982

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pilger, R.H.

1984-06-25

This report contains the component Site-Specific Studies-Geophysics, Diagenesis, Geochemistry. Work for Site-Specific Studies is finished, and the results presented in this report are final. Individual studies have been entered separately into the data base. (ACR)

Comparative Bioinformatic Analysis of Active Site Structures in Evolutionarily Remote Homologues of α,β-Hydrolase Superfamily Enzymes.

PubMed

Suplatov, D A; Arzhanik, V K; Svedas, V K

2011-01-01

Comparative bioinformatic analysis is the cornerstone of the study of enzymes' structure-function relationship. However, numerous enzymes that derive from a common ancestor and have undergone substantial functional alterations during natural selection appear not to have a sequence similarity acceptable for a statistically reliable comparative analysis. At the same time, their active site structures, in general, can be conserved, while other parts may largely differ. Therefore, it sounds both plausible and appealing to implement a comparative analysis of the most functionally important structural elements - the active site structures; that is, the amino acid residues involved in substrate binding and the catalytic mechanism. A computer algorithm has been developed to create a library of enzyme active site structures based on the use of the PDB database, together with programs of structural analysis and identification of functionally important amino acid residues and cavities in the enzyme structure. The proposed methodology has been used to compare some α,β-hydrolase superfamily enzymes. The insight has revealed a high structural similarity of catalytic site areas, including the conservative organization of a catalytic triad and oxyanion hole residues, despite the wide functional diversity among the remote homologues compared. The methodology can be used to compare the structural organization of the catalytic and substrate binding sites of various classes of enzymes, as well as study enzymes' evolution and to create of a databank of enzyme active site structures.

Incorporating ToxCast and Tox21 Datasets to Rank Biological Activity of Chemicals at Superfund Sites in North Carolina

PubMed Central

Tilley, Sloane K.; Reif, David M.; Fry, Rebecca C.

2017-01-01

Background The Superfund program of the Environmental Protection Agency (EPA) was established in 1980 to address public health concerns posed by toxic substances released into the environment in the United States. Forty-two of the 1328 hazardous waste sites that remain on the Superfund National Priority List are located in the state of North Carolina. Methods We set out to develop a database that contained information on both the prevalence and biological activity of chemicals present at Superfund sites in North Carolina. A chemical characterization tool, the Toxicological Priority Index (ToxPi), was used to rank the biological activity of these chemicals based on their predicted bioavailability, documented associations with biological pathways, and activity in in vitro assays of the ToxCast and Tox21 programs. Results The ten most prevalent chemicals found at North Carolina Superfund sites were chromium, trichloroethene, lead, tetrachloroethene, arsenic, benzene, manganese, 1,2-dichloroethane, nickel, and barium. For all chemicals found at North Carolina Superfund sites, ToxPi analysis was used to rank their biological activity. Through this data integration, residual pesticides and organic solvents were identified to be some of the most highly-ranking predicted bioactive chemicals. This study provides a novel methodology for creating state or regional databases of Superfund sites. Conclusions These data represent a novel integrated profile of the most prevalent chemicals at North Carolina Superfund sites. This information, and the associated methodology, is useful to toxicologists, risk assessors, and the communities living in close proximity to these sites. PMID:28153528

Advantages of active love wave techniques in geophysical characterizations of seismographic station - Case studies in California and the central and eastern United States

USGS Publications Warehouse

Martin, Antony; Yong, Alan K.; Salomone, Larry A.

2014-01-01

Active-source Love waves, recorded by the multi-channel analysis of surface wave (MASLW) technique, were recently analyzed in two site characterization projects. Between 2010 and 2012, the 2009 American Recovery and Reinvestment Act (ARRA) funded GEOVision to conduct geophysical investigations at 191 seismographic stations in California and the Central Eastern U.S. (CEUS). The original project plan was to utilize active and passive Rayleigh wave-based techniques to obtain shear-wave velocity (VS) profiles to a minimum depth of 30 m and the time-averaged VS of the upper 30 meters (VS30). Early in this investigation it became clear that Rayleigh wave techniques, such as multi-channel analysis of surface waves (MASRW), were not suited for characterizing all sites. Shear-wave seismic refraction and MASLW techniques were therefore applied. In 2012, the Electric Power Research Institute funded characterization of 33 CEUS station sites. Based on experience from the ARRA investigation, both MASRW and MASLW data were acquired by GEOVision at 24 CEUS sites. At shallow rock sites, sites with steep velocity gradients, and, sites with a thin, low velocity, surficial soil layer overlying stiffer sediments, Love wave techniques generally were found to be easier to interpret, i.e., Love wave data typically yielded unambiguous fundamental mode dispersion curves and thus, reduce uncertainty in the resultant VS model. These types of velocity structure often excite dominant higher modes in Rayleigh wave data, but not in the Love wave data. It is possible to model Rayleigh wave data using multi- or effective-mode techniques; however, extraction of Rayleigh wave dispersion data was found to be difficult in many cases. These results imply that field procedures should include careful scrutiny of Rayleigh wave-based dispersion data in order to also collect Love wave data when warranted.

DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction*

PubMed Central

Algasaier, Sana I.; Exell, Jack C.; Bennet, Ian A.; Thompson, Mark J.; Gotham, Victoria J. B.; Shaw, Steven J.; Craggs, Timothy D.; Finger, L. David; Grasby, Jane A.

2016-01-01

Human flap endonuclease-1 (hFEN1) catalyzes the essential removal of single-stranded flaps arising at DNA junctions during replication and repair processes. hFEN1 biological function must be precisely controlled, and consequently, the protein relies on a combination of protein and substrate conformational changes as a prerequisite for reaction. These include substrate bending at the duplex-duplex junction and transfer of unpaired reacting duplex end into the active site. When present, 5′-flaps are thought to thread under the helical cap, limiting reaction to flaps with free 5′-termini in vivo. Here we monitored DNA bending by FRET and DNA unpairing using 2-aminopurine exciton pair CD to determine the DNA and protein requirements for these substrate conformational changes. Binding of DNA to hFEN1 in a bent conformation occurred independently of 5′-flap accommodation and did not require active site metal ions or the presence of conserved active site residues. More stringent requirements exist for transfer of the substrate to the active site. Placement of the scissile phosphate diester in the active site required the presence of divalent metal ions, a free 5′-flap (if present), a Watson-Crick base pair at the terminus of the reacting duplex, and the intact secondary structure of the enzyme helical cap. Optimal positioning of the scissile phosphate additionally required active site conserved residues Tyr40, Asp181, and Arg100 and a reacting duplex 5′-phosphate. These studies suggest a FEN1 reaction mechanism where junctions are bound and 5′-flaps are threaded (when present), and finally the substrate is transferred onto active site metals initiating cleavage. PMID:26884332

SABER: a computational method for identifying active sites for new reactions.

PubMed

Nosrati, Geoffrey R; Houk, K N

2012-05-01

A software suite, SABER (Selection of Active/Binding sites for Enzyme Redesign), has been developed for the analysis of atomic geometries in protein structures, using a geometric hashing algorithm (Barker and Thornton, Bioinformatics 2003;19:1644-1649). SABER is used to explore the Protein Data Bank (PDB) to locate proteins with a specific 3D arrangement of catalytic groups to identify active sites that might be redesigned to catalyze new reactions. As a proof-of-principle test, SABER was used to identify enzymes that have the same catalytic group arrangement present in o-succinyl benzoate synthase (OSBS). Among the highest-scoring scaffolds identified by the SABER search for enzymes with the same catalytic group arrangement as OSBS were L-Ala D/L-Glu epimerase (AEE) and muconate lactonizing enzyme II (MLE), both of which have been redesigned to become effective OSBS catalysts, demonstrated by experiments. Next, we used SABER to search for naturally existing active sites in the PDB with catalytic groups similar to those present in the designed Kemp elimination enzyme KE07. From over 2000 geometric matches to the KE07 active site, SABER identified 23 matches that corresponded to residues from known active sites. The best of these matches, with a 0.28 Å catalytic atom RMSD to KE07, was then redesigned to be compatible with the Kemp elimination using RosettaDesign. We also used SABER to search for potential Kemp eliminases using a theozyme predicted to provide a greater rate acceleration than the active site of KE07, and used Rosetta to create a design based on the proteins identified. Copyright © 2012 The Protein Society.

Ensemble-Based Computational Approach Discriminates Functional Activity of p53 Cancer and Rescue Mutants

PubMed Central

Demir, Özlem; Baronio, Roberta; Salehi, Faezeh; Wassman, Christopher D.; Hall, Linda; Hatfield, G. Wesley; Chamberlin, Richard; Kaiser, Peter; Lathrop, Richard H.; Amaro, Rommie E.

2011-01-01

The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain (“cancer mutants”). Activity can be restored by second-site suppressor mutations (“rescue mutants”). This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD), without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC) metric was strongly correlated (r2 = 0.77) with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i) p53 cancer mutants were more flexible than wild-type protein, (ii) second-site rescue mutations decreased the flexibility of cancer mutants, and (iii) negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants. PMID:22028641

An integrated approach for identifying priority contaminant in the Great Lakes Basin - Investigations in the Lower Green Bay/Fox River and Milwaukee Estuary areas of concern.

PubMed

Li, Shibin; Villeneuve, Daniel L; Berninger, Jason P; Blackwell, Brett R; Cavallin, Jenna E; Hughes, Megan N; Jensen, Kathleen M; Jorgenson, Zachary; Kahl, Michael D; Schroeder, Anthony L; Stevens, Kyle E; Thomas, Linnea M; Weberg, Matthew A; Ankley, Gerald T

2017-02-01

Environmental assessment of complex mixtures typically requires integration of chemical and biological measurements. This study demonstrates the use of a combination of instrumental chemical analyses, effects-based monitoring, and bio-effects prediction approaches to help identify potential hazards and priority contaminants in two Great Lakes Areas of Concern (AOCs), the Lower Green Bay/Fox River located near Green Bay, WI, USA and the Milwaukee Estuary, located near Milwaukee, WI, USA. Fathead minnows were caged at four sites within each AOC (eight sites total). Following 4d of in situ exposure, tissues and biofluids were sampled and used for targeted biological effects analyses. Additionally, 4d composite water samples were collected concurrently at each caged fish site and analyzed for 132 analytes as well as evaluated for total estrogenic and androgenic activity using cell-based bioassays. Of the analytes examined, 75 were detected in composite samples from at least one site. Based on multiple analyses, one site in the East River and another site near a paper mill discharge in the Lower Green Bay/Fox River AOC, were prioritized due to their estrogenic and androgenic activity, respectively. The water samples from other sites generally did not exhibit significant estrogenic or androgenic activity, nor was there evidence for endocrine disruption in the fish exposed at these sites as indicated by the lack of alterations in ex vivo steroid production, circulating steroid concentrations, or vitellogenin mRNA expression in males. Induction of hepatic cyp1a mRNA expression was detected at several sites, suggesting the presence of chemicals that activate the aryl hydrocarbon receptor. To expand the scope beyond targeted investigation of endpoints selected a priori, several bio-effects prediction approaches were employed to identify other potentially disturbed biological pathways and related chemical constituents that may warrant future monitoring at these sites. For example, several chemicals such as diethylphthalate and naphthalene, and genes and related pathways, such as cholinergic receptor muscarinic 3 (CHRM3), estrogen receptor alpha1 (esr1), chemokine ligand 10 protein (CXCL10), tumor protein p53 (p53), and monoamine oxidase B (Maob), were identified as candidates for future assessments at these AOCs. Overall, this study demonstrates that a better prioritization of contaminants and associated hazards can be achieved through integrated evaluation of multiple lines of evidence. Such prioritization can guide more comprehensive follow-up risk assessment efforts. Copyright © 2016 Elsevier B.V. All rights reserved.

The role of an active site Mg(2+) in HDV ribozyme self-cleavage: insights from QM/MM calculations.

PubMed

Mlýnský, Vojtěch; Walter, Nils G; Šponer, Jiří; Otyepka, Michal; Banáš, Pavel

2015-01-07

The hepatitis delta virus (HDV) ribozyme is a catalytic RNA motif embedded in the human pathogenic HDV RNA. It catalyzes self-cleavage of its sugar-phosphate backbone with direct participation of the active site cytosine C75. Biochemical and structural data support a general acid role of C75. Here, we used hybrid quantum mechanical/molecular mechanical (QM/MM) calculations to probe the reaction mechanism and changes in Gibbs energy along the ribozyme's reaction pathway with an N3-protonated C75H(+) in the active site, which acts as the general acid, and a partially hydrated Mg(2+) ion with one deprotonated, inner-shell coordinated water molecule that acts as the general base. We followed eight reaction paths with a distinct position and coordination of the catalytically important active site Mg(2+) ion. For six of them, we observed feasible activation barriers ranging from 14.2 to 21.9 kcal mol(-1), indicating that the specific position of the Mg(2+) ion in the active site is predicted to strongly affect the kinetics of self-cleavage. The deprotonation of the U-1(2'-OH) nucleophile and the nucleophilic attack of the resulting U-1(2'-O(-)) on the scissile phosphodiester are found to be separate steps, as deprotonation precedes the nucleophilic attack. This sequential mechanism of the HDV ribozyme differs from the concerted nucleophilic activation and attack suggested for the hairpin ribozyme. We estimate the pKa of the U-1(2'-OH) group to range from 8.8 to 11.2, suggesting that it is lowered by several units from that of a free ribose, comparable to and most likely smaller than the pKa of the solvated active site Mg(2+) ion. Our results thus support the notion that the structure of the HDV ribozyme, and particularly the positioning of the active site Mg(2+) ion, facilitate deprotonation and activation of the 2'-OH nucleophile.

Examination of CRISPR/Cas9 design tools and the effect of target site accessibility on Cas9 activity.

PubMed

Lee, Ciaran M; Davis, Timothy H; Bao, Gang

2018-04-01

What is the topic of this review? In this review, we analyse the performance of recently described tools for CRISPR/Cas9 guide RNA design, in particular, design tools that predict CRISPR/Cas9 activity. What advances does it highlight? Recently, many tools designed to predict CRISPR/Cas9 activity have been reported. However, the majority of these tools lack experimental validation. Our analyses indicate that these tools have poor predictive power. Our preliminary results suggest that target site accessibility should be considered in order to develop better guide RNA design tools with improved predictive power. The recent adaptation of the clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system for targeted genome engineering has led to its widespread application in many fields worldwide. In order to gain a better understanding of the design rules of CRISPR/Cas9 systems, several groups have carried out large library-based screens leading to some insight into sequence preferences among highly active target sites. To facilitate CRISPR/Cas9 design, these studies have spawned a plethora of guide RNA (gRNA) design tools with algorithms based solely on direct or indirect sequence features. Here, we demonstrate that the predictive power of these tools is poor, suggesting that sequence features alone cannot accurately inform the cutting efficiency of a particular CRISPR/Cas9 gRNA design. Furthermore, we demonstrate that DNA target site accessibility influences the activity of CRISPR/Cas9. With further optimization, we hypothesize that it will be possible to increase the predictive power of gRNA design tools by including both sequence and target site accessibility metrics. © 2017 The Authors. Experimental Physiology © 2017 The Physiological Society.

Multiple active site residues are important for photochemical efficiency in the light-activated enzyme protochlorophyllide oxidoreductase (POR).

PubMed

Menon, Binuraj R K; Hardman, Samantha J O; Scrutton, Nigel S; Heyes, Derren J

2016-08-01

Protochlorophyllide oxidoreductase (POR) catalyzes the light-driven reduction of protochlorophyllide (Pchlide), an essential, regulatory step in chlorophyll biosynthesis. The unique requirement of the enzyme for light has provided the opportunity to investigate how light energy can be harnessed to power biological catalysis and enzyme dynamics. Excited state interactions between the Pchlide molecule and the protein are known to drive the subsequent reaction chemistry. However, the structural features of POR and active site residues that are important for photochemistry and catalysis are currently unknown, because there is no crystal structure for POR. Here, we have used static and time-resolved spectroscopic measurements of a number of active site variants to study the role of a number of residues, which are located in the proposed NADPH/Pchlide binding site based on previous homology models, in the reaction mechanism of POR. Our findings, which are interpreted in the context of a new improved structural model, have identified several residues that are predicted to interact with the coenzyme or substrate. Several of the POR variants have a profound effect on the photochemistry, suggesting that multiple residues are important in stabilizing the excited state required for catalysis. Our work offers insight into how the POR active site geometry is finely tuned by multiple active site residues to support enzyme-mediated photochemistry and reduction of Pchlide, both of which are crucial to the existence of life on Earth. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Structural insights into substrate and inhibitor binding sites in human indoleamine 2,3-dioxygenase 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewis-Ballester, Ariel; Pham, Khoa N.; Batabyal, Dipanwita

Human indoleamine 2,3-dioxygenase 1 (hIDO1) is an attractive cancer immunotherapeutic target owing to its role in promoting tumoral immune escape. However, drug development has been hindered by limited structural information. Here, we report the crystal structures of hIDO1 in complex with its substrate, Trp, an inhibitor, epacadostat, and/or an effector, indole ethanol (IDE). The data reveal structural features of the active site (Sa) critical for substrate activation; in addition, they disclose a new inhibitor-binding mode and a distinct small molecule binding site (Si). Structure-guided mutation of a critical residue, F270, to glycine perturbs the Si site, allowing structural determination ofmore » an inhibitory complex, where both the Sa and Si sites are occupied by Trp. The Si site offers a novel target site for allosteric inhibitors and a molecular explanation for the previously baffling substrate-inhibition behavior of the enzyme. Taken together, the data open exciting new avenues for structure-based drug design.« less

Ubiquitin C-terminal electrophiles are activity-based probes for identification and mechanistic study of ubiquitin conjugating machinery.

PubMed

Love, Kerry Routenberg; Pandya, Renuka K; Spooner, Eric; Ploegh, Hidde L

2009-04-17

Protein modification by ubiquitin (Ub) and ubiquitin-like modifiers (Ubl) requires the action of activating (E1), conjugating (E2), and ligating (E3) enzymes and is a key step in the specific destruction of proteins. Deubiquitinating enzymes (DUBs) deconjugate substrates modified with Ub/Ubl's and recycle Ub inside the cell. Genome mining based on sequence homology to proteins with known function has assigned many enzymes to this pathway without confirmation of either conjugating or DUB activity. Function-dependent methodologies are still the most useful for rapid identification or assessment of biological activity of expressed proteins from cells. Activity-based protein profiling uses chemical probes that are active-site-directed for the classification of protein activities in complex mixtures. Here we show that the design and use of an expanded set of Ub-based electrophilic probes allowed us to recover and identify members of each enzyme class in the ubiquitin-proteasome system, including E3 ligases and DUBs with previously unverified activity. We show that epitope-tagged Ub-electrophilic probes can be used as activity-based probes for E3 ligase identification by in vitro labeling and activity studies of purified enzymes identified from complex mixtures in cell lysate. Furthermore, the reactivity of our probe with the HECT domain of the E3 Ub ligase ARF-BP1 suggests that multiple cysteines may be in the vicinity of the E2-binding site and are capable of the transfer of Ub to self or to a substrate protein.

Develop high activity, low cost non-PGM fuel cell electrocatalyst and stable supports

DOE Office of Scientific and Technical Information (OSTI.GOV)

Colon-Mercado, H. R.; Elvington, M. C.; Garcia-Diaz, B. L.

2016-09-28

A unique approach has been developed to probe the non-PGM catalyst active site for the Oxygen Reduction Reaction (ORR) for PEMFC. Iron based functionalities have been engineered into Metallic Organic Framework (MOF) catalysts to evaluate their impact on activity for the ORR. A series of FePhen@MOF catalysts have been synthesized with varying [Fe] to investigate the effect on electrochemical and electrocatalytic properties. The magnitude of the Fe II/III redox couple and the electrochemical surface area are analyzed to determine if there is a correlation between [Fe] and the ORR onset potential and/or the relative number of active sites.

The activation of the [NiFe]-hydrogenase from Allochromatium vinosum. An infrared spectro-electrochemical study.

PubMed

Bleijlevens, Boris; van Broekhuizen, Fleur A; De Lacey, Antonio L; Roseboom, Winfried; Fernandez, Victor M; Albracht, Simon P J

2004-09-01

The membrane-bound [NiFe]-hydrogenase from Allochromatium vinosum can occur in several inactive or active states. This study presents the first systematic infrared characterisation of the A. vinosum enzyme, with emphasis on the spectro-electrochemical properties of the inactive/active transition. This transition involves an energy barrier, which can be overcome at elevated temperatures. The reduced Ready enzyme can exist in two different inactive states, which are in an apparent acid-base equilibrium. It is proposed that a hydroxyl ligand in a bridging position in the Ni-Fe site is protonated and that the formed water molecule is subsequently removed. This enables the active site to bind hydrogen in a bridging position, allowing the formation of the fully active state of the enzyme. It is further shown that the active site in enzyme reduced by 1 bar H(2) can occur in three different electron paramagnetic resonance (EPR)-silent states with a different degree of protonation.

Predicting Catalytic Activity of Nanoparticles by a DFT-Aided Machine-Learning Algorithm.

PubMed

Jinnouchi, Ryosuke; Asahi, Ryoji

2017-09-07

Catalytic activities are often dominated by a few specific surface sites, and designing active sites is the key to realize high-performance heterogeneous catalysts. The great triumphs of modern surface science lead to reproduce catalytic reaction rates by modeling the arrangement of surface atoms with well-defined single-crystal surfaces. However, this method has limitations in the case for highly inhomogeneous atomic configurations such as on alloy nanoparticles with atomic-scale defects, where the arrangement cannot be decomposed into single crystals. Here, we propose a universal machine-learning scheme using a local similarity kernel, which allows interrogation of catalytic activities based on local atomic configurations. We then apply it to direct NO decomposition on RhAu alloy nanoparticles. The proposed method can efficiently predict energetics of catalytic reactions on nanoparticles using DFT data on single crystals, and its combination with kinetic analysis can provide detailed information on structures of active sites and size- and composition-dependent catalytic activities.

15 CFR 922.21 - Selection of active candidates.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 15 Commerce and Foreign Trade 3 2013-01-01 2013-01-01 false Selection of active candidates. 922.21... Selection of active candidates. (a) The Secretary shall, from time to time, select a limited number of sites from the SEL for Active Candidate consideration based on a preliminary assessment of the designation...

15 CFR 922.21 - Selection of active candidates.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Selection of active candidates. 922.21... Selection of active candidates. (a) The Secretary shall, from time to time, select a limited number of sites from the SEL for Active Candidate consideration based on a preliminary assessment of the designation...

15 CFR 922.21 - Selection of active candidates.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 15 Commerce and Foreign Trade 3 2011-01-01 2011-01-01 false Selection of active candidates. 922.21... Selection of active candidates. (a) The Secretary shall, from time to time, select a limited number of sites from the SEL for Active Candidate consideration based on a preliminary assessment of the designation...

15 CFR 922.21 - Selection of active candidates.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 15 Commerce and Foreign Trade 3 2012-01-01 2012-01-01 false Selection of active candidates. 922.21... Selection of active candidates. (a) The Secretary shall, from time to time, select a limited number of sites from the SEL for Active Candidate consideration based on a preliminary assessment of the designation...

15 CFR 922.21 - Selection of active candidates.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 15 Commerce and Foreign Trade 3 2014-01-01 2014-01-01 false Selection of active candidates. 922.21... Selection of active candidates. (a) The Secretary shall, from time to time, select a limited number of sites from the SEL for Active Candidate consideration based on a preliminary assessment of the designation...

Dioxin effects on wood duck (Aix sponsa) embryos from sites near paper mills

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beeman, D.K.; Melancon, M.J.; Fleming, W.J.

Biological and biochemical variables were studied in wood duck embryos from four dioxin-contaminated sites near paper mills in the Southeastern United States and three reference sites. Sites were selected based on a history of dioxin contamination in both sediments and fish. In addition, wood duck embryos collected downstream from an Arkansas Superfund site with demonstrated dioxin-induced reproductive impairment served as positive controls. Whole clutches of eggs were collected from the wild after fifteen days of incubation and mechanically incubated. Two embryos per clutch were sacrificed at pipping and liver monooxygenase activities (BROD, EROD and MROD) were quantified. Hatching success wasmore » determined for the remainder of the nest. Preliminary results indicate no difference in monooxygenase activities across sites even though the authors have previously demonstrated induction of monooxygenase activity in wood duck embryos in laboratory studies. In addition, there were no differences in weight at pipping, liver weight and liver weight to body weight ratios. No differences were seen in hatching success or weight at hatch nor were there any gross morphological abnormalities. This may indicate that exposure of wood ducks nesting near these pulp paper mills is below those which cause elevated monooxygenase activities and reproductive impairment.« less

Chemical Safety Information, Site Security and Fuels Regulatory Relief Act: Public Distribution of Off-Site Consequence Analysis Information Fact Sheet

EPA Pesticide Factsheets

Based on assessments of increased risk of terrorist/criminal activity, EPA and DOJ have issued a rule that allows public access to OCA information in ways that are designed to minimize likelihood of chemical accidents and public harm.

Activities in the Mission Control Center during STS 41-C

NASA Image and Video Library

1984-04-13

41C-03229 (13 April 1984) --- An overall view of activity in the Mission Operations Control Room (MOCR) of the Johnson Space Center (JSC) Mission Control Center (MCC) during post-landing activity at the Challenger's landing site at Edwards Air Force Base in California.

US medical specialty global health training and the global burden of disease

PubMed Central

Kerry, Vanessa B.; Walensky, Rochelle P.; Tsai, Alexander C.; Bergmark, Regan W.; Bergmark, Brian A.; Rouse, Chaturia; Bangsberg, David R.

2013-01-01

Background Rapid growth in global health activity among US medical specialty education programs has lead to heterogeneity in types of activities and global health training models. The breadth and scope of this activity is not well chronicled. Methods Using a standardized search protocol, we examined the characteristics of US medical residency global health programs by number of programs, clinical specialty, nature of activity (elective, research, extended curriculum based field training), and geographic location across seven different clinical medical residency education specialties. We tabulated programmatic activity by clinical discipline, region and country. We calculated the Spearman's rank correlation coefficient to estimate the association between programmatic activity and country–level disease burden. Results Of the 1856 programs assessed between January and June 2011, there were 380 global health residency training programs (20%) working in 141 countries. 529 individual programmatic activities (elective–based rotations, research programs, extended curriculum–based field training, or other) occurred at 1337 specific sites. The majority of the activities consisted of elective–based rotations. At the country level, disease burden had a statistically significant association with programmatic activity (Spearman's ρ = 0.17) but only explained 3% of the total variation between countries. Conclusions There were a substantial number of US medical specialty global health programs, but a relative paucity of surgical and mental health programs. Elective–based programs were more common than programs that offer longitudinal experiences. Despite heterogeneity, there was a small but statistically significant association between program location and the global burden of disease. Areas for further study include the degree to which US–based programs develop partnerships with their program sites, the significance of this activity for training, and number and breadth of programs in medical specialty global health education in other countries around the world. PMID:24363924

Recognition of Lys48-Linked Di-ubiquitin and Deubiquitinating Activities of the SARS Coronavirus Papain-like Protease.

PubMed

Békés, Miklós; van der Heden van Noort, Gerbrand J; Ekkebus, Reggy; Ovaa, Huib; Huang, Tony T; Lima, Christopher D

2016-05-19

Deubiquitinating enzymes (DUBs) recognize and cleave linkage-specific polyubiquitin (polyUb) chains, but mechanisms underlying specificity remain elusive in many cases. The severe acute respiratory syndrome (SARS) coronavirus papain-like protease (PLpro) is a DUB that cleaves ISG15, a two-domain Ub-like protein, and Lys48-linked polyUb chains, releasing diUb(Lys48) products. To elucidate this specificity, we report the 2.85 Å crystal structure of SARS PLpro bound to a diUb(Lys48) activity-based probe. SARS PLpro binds diUb(Lys48) in an extended conformation via two contact sites, S1 and S2, which are proximal and distal to the active site, respectively. We show that specificity for polyUb(Lys48) chains is predicated on contacts in the S2 site and enhanced by an S1-S1' preference for a Lys48 linkage across the active site. In contrast, ISG15 specificity is dominated by contacts in the S1 site. Determinants revealed for polyUb(Lys48) specificity should prove useful in understanding PLpro deubiquitinating activities in coronavirus infections. Copyright © 2016 Elsevier Inc. All rights reserved.

Corrective Action Decision Document/Closure Report for Corrective Action Unit 105: Area 2 Yucca Flat Atmospheric Test Sites, Nevada National Security Site, Nevada, Revision 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matthews, Patrick

2014-01-01

The purpose of this Corrective Action Decision Document/Closure Report is to provide justification and documentation supporting the recommendation that no further corrective action is needed for CAU 105 based on the implementation of the corrective actions. Corrective action investigation (CAI) activities were performed from October 22, 2012, through May 23, 2013, as set forth in the Corrective Action Investigation Plan for Corrective Action Unit 105: Area 2 Yucca Flat Atmospheric Test Sites; and in accordance with the Soils Activity Quality Assurance Plan, which establishes requirements, technical planning, and general quality practices.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sabba, Dellilah

This report, prepared by the SLAC National Accelerator Laboratory (SLAC) for the U.S. Department of Energy (DOE), SLAC Site Office (SSO), provides a comprehensive summary of the environmental program activities at SLAC for calendar year 2015. Annual Site Environmental Reports (ASERs) are prepared for all DOE sites with significant environmental activities, and distributed to relevant external regulatory agencies and other interested organizations or individuals. To the best of my knowledge, this report accurately summarizes the results of the 2015 environmental monitoring, compliance, and restoration programs at SLAC. This assurance can be made based on SSO and SLAC review of themore » ASER, and quality assurance protocols applied to monitoring and data analyses at SLAC.« less

Modeling the heterogeneous catalytic activity of a single nanoparticle using a first passage time distribution formalism

NASA Astrophysics Data System (ADS)

Das, Anusheela; Chaudhury, Srabanti

2015-11-01

Metal nanoparticles are heterogeneous catalysts and have a multitude of non-equivalent, catalytic sites on the nanoparticle surface. The product dissociation step in such reaction schemes can follow multiple pathways. Proposed here for the first time is a completely analytical theoretical framework, based on the first passage time distribution, that incorporates the effect of heterogeneity in nanoparticle catalysis explicitly by considering multiple, non-equivalent catalytic sites on the nanoparticle surface. Our results show that in nanoparticle catalysis, the effect of dynamic disorder is manifested even at limiting substrate concentrations in contrast to an enzyme that has only one well-defined active site.

Proton Transfer in the Catalytic Cycle of [NiFe] Hydrogenases: Insight from Vibrational Spectroscopy

PubMed Central

2017-01-01

Catalysis of H2 production and oxidation reactions is critical in renewable energy systems based around H2 as a clean fuel, but the present reliance on platinum-based catalysts is not sustainable. In nature, H2 is oxidized at minimal overpotential and high turnover frequencies at [NiFe] catalytic sites in hydrogenase enzymes. Although an outline mechanism has been established for the [NiFe] hydrogenases involving heterolytic cleavage of H2 followed by a first and then second transfer of a proton and electron away from the active site, details remain vague concerning how the proton transfers are facilitated by the protein environment close to the active site. Furthermore, although [NiFe] hydrogenases from different organisms or cellular environments share a common active site, they exhibit a broad range of catalytic characteristics indicating the importance of subtle changes in the surrounding protein in controlling their behavior. Here we review recent time-resolved infrared (IR) spectroscopic studies and IR spectroelectrochemical studies carried out in situ during electrocatalytic turnover. Additionally, we re-evaluate the significant body of IR spectroscopic data on hydrogenase active site states determined through more conventional solution studies, in order to highlight mechanistic steps that seem to apply generally across the [NiFe] hydrogenases, as well as steps which so far seem limited to specific groups of these enzymes. This analysis is intended to help focus attention on the key open questions where further work is needed to assess important aspects of proton and electron transfer in the mechanism of [NiFe] hydrogenases. PMID:28413691

The New USGS Volcano Hazards Program Web Site

NASA Astrophysics Data System (ADS)

Venezky, D. Y.; Graham, S. E.; Parker, T. J.; Snedigar, S. F.

2008-12-01

The U.S. Geological Survey's (USGS) Volcano Hazard Program (VHP) has launched a revised web site that uses a map-based interface to display hazards information for U.S. volcanoes. The web site is focused on better communication of hazards and background volcano information to our varied user groups by reorganizing content based on user needs and improving data display. The Home Page provides a synoptic view of the activity level of all volcanoes for which updates are written using a custom Google® Map. Updates are accessible by clicking on one of the map icons or clicking on the volcano of interest in the adjacent color-coded list of updates. The new navigation provides rapid access to volcanic activity information, background volcano information, images and publications, volcanic hazards, information about VHP, and the USGS volcano observatories. The Volcanic Activity section was tailored for emergency managers but provides information for all our user groups. It includes a Google® Map of the volcanoes we monitor, an Elevated Activity Page, a general status page, information about our Volcano Alert Levels and Aviation Color Codes, monitoring information, and links to monitoring data from VHP's volcano observatories: Alaska Volcano Observatory (AVO), Cascades Volcano Observatory (CVO), Long Valley Observatory (LVO), Hawaiian Volcano Observatory (HVO), and Yellowstone Volcano Observatory (YVO). The YVO web site was the first to move to the new navigation system and we are working on integrating the Long Valley Observatory web site next. We are excited to continue to implement new geospatial technologies to better display our hazards and supporting volcano information.

The Remarkable Amphoteric Nature of Defective UiO‐66 in Catalytic Reactions

PubMed Central

Hajek, Julianna; Bueken, Bart; Waroquier, Michel; De Vos, Dirk

2017-01-01

Abstract One of the major requirements in solid acid and base catalyzed reactions is that the reactants, intermediates or activated complexes cooperate with several functions of catalyst support. In this work the remarkable bifunctional behavior of the defective UiO‐66(Zr) metal organic framework is shown for acid‐base pair catalysis. The active site relies on the presence of coordinatively unsaturated zirconium sites, which may be tuned by removing framework linkers and by removal of water from the inorganic bricks using a dehydration treatment. To elucidate the amphoteric nature of defective UiO‐66, the Oppenauer oxidation of primary alcohols has been theoretically investigated using density functional theory (DFT) and the periodic approach. The presence of acid and basic centers within molecular distances is shown to be crucial for determining the catalytic activity of the material. Hydrated and dehydrated bricks have a distinct influence on the acidity and basicity of the active sites. In any case both functions need to cooperate in a concerted way to enable the chemical transformation. Experimental results on UiO‐66 materials of different defectivity support the theoretical observations made in this work. PMID:28736581

Unit soil loss rate from various construction sites during a storm.

PubMed

Maniquiz, Marla C; Lee, Soyoung; Lee, Eunju; Kong, Dong-Soo; Kim, Lee-Hyung

2009-01-01

The Korean Ministry of Environment (MOE) opts to establish an ordinance having a standard specifying an allowable soil loss rate applicable to construction projects. The predicted amount of soil loss from a construction site exceeding the standard can be used to calculate the percent reduction necessary to comply with the ordinance. This research was conducted to provide a basis to establish a standard by investigating the unit soil loss rates in the three phases of development: pre-construction, active construction and post construction based from 1,036 Environmental Impact Assessment (EIA) reports within the six-year period (2000-2005). Based on the findings, several factors affect the magnitude of soil loss rates particularly storm characteristics, site slope, soil type, location from rivers, as well as the type of construction activity. In general, the unit soil loss rates during the active construction phase are extremely higher in comparison to undisturbed areas; in magnitude of 7 to 80 times larger in urban areas and 18 to 585 times in rural areas. Only between 20 to 40 percent of the soil loss rates was contributed at pre- and post- construction phases indicating that the active construction phase is the most important phase to control.

Conserved Loop Cysteines of Vitamin K Epoxide Reductase Complex Subunit 1-like 1 (VKORC1L1) Are Involved in Its Active Site Regeneration*

PubMed Central

Tie, Jian-Ke; Jin, Da-Yun; Stafford, Darrel W.

2014-01-01

Vitamin K epoxide reductase complex subunit 1 (VKORC1) reduces vitamin K epoxide in the vitamin K cycle for post-translational modification of proteins that are involved in a variety of biological functions. However, the physiological function of VKORC1-like 1 (VKORC1L1), a paralogous enzyme sharing about 50% protein identity with VKORC1, is unknown. Here we determined the structural and functional differences of these two enzymes using fluorescence protease protection (FPP) assay and an in vivo cell-based activity assay. We show that in vivo VKORC1L1 reduces vitamin K epoxide to support vitamin K-dependent carboxylation as efficiently as does VKORC1. However, FPP assays show that unlike VKORC1, VKORC1L1 is a four-transmembrane domain protein with both its termini located in the cytoplasm. Moreover, the conserved loop cysteines, which are not required for VKORC1 activity, are essential for VKORC1L1's active site regeneration. Results from domain exchanges between VKORC1L1 and VKORC1 suggest that it is VKORC1L1's overall structure that uniquely allows for active site regeneration by the conserved loop cysteines. Intermediate disulfide trapping results confirmed an intra-molecular electron transfer pathway for VKORC1L1's active site reduction. Our results allow us to propose a concerted action of the four conserved cysteines of VKORC1L1 for active site regeneration; the second loop cysteine, Cys-58, attacks the active site disulfide, forming an intermediate disulfide with Cys-139; the first loop cysteine, Cys-50, attacks the intermediate disulfide resulting in active site reduction. The different membrane topologies and reaction mechanisms between VKORC1L1 and VKORC1 suggest that these two proteins might have different physiological functions. PMID:24532791

Conserved loop cysteines of vitamin K epoxide reductase complex subunit 1-like 1 (VKORC1L1) are involved in its active site regeneration.

PubMed

Tie, Jian-Ke; Jin, Da-Yun; Stafford, Darrel W

2014-03-28

Vitamin K epoxide reductase complex subunit 1 (VKORC1) reduces vitamin K epoxide in the vitamin K cycle for post-translational modification of proteins that are involved in a variety of biological functions. However, the physiological function of VKORC1-like 1 (VKORC1L1), a paralogous enzyme sharing about 50% protein identity with VKORC1, is unknown. Here we determined the structural and functional differences of these two enzymes using fluorescence protease protection (FPP) assay and an in vivo cell-based activity assay. We show that in vivo VKORC1L1 reduces vitamin K epoxide to support vitamin K-dependent carboxylation as efficiently as does VKORC1. However, FPP assays show that unlike VKORC1, VKORC1L1 is a four-transmembrane domain protein with both its termini located in the cytoplasm. Moreover, the conserved loop cysteines, which are not required for VKORC1 activity, are essential for VKORC1L1's active site regeneration. Results from domain exchanges between VKORC1L1 and VKORC1 suggest that it is VKORC1L1's overall structure that uniquely allows for active site regeneration by the conserved loop cysteines. Intermediate disulfide trapping results confirmed an intra-molecular electron transfer pathway for VKORC1L1's active site reduction. Our results allow us to propose a concerted action of the four conserved cysteines of VKORC1L1 for active site regeneration; the second loop cysteine, Cys-58, attacks the active site disulfide, forming an intermediate disulfide with Cys-139; the first loop cysteine, Cys-50, attacks the intermediate disulfide resulting in active site reduction. The different membrane topologies and reaction mechanisms between VKORC1L1 and VKORC1 suggest that these two proteins might have different physiological functions.

Corrective Action Investigation Plan for Corrective Action Unit 541: Small Boy Nevada National Security Site and Nevada Test and Training Range, Nevada with ROTC 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matthews, Patrick

Corrective Action Unit (CAU) 541 is co-located on the boundary of Area 5 of the Nevada National Security Site and Range 65C of the Nevada Test and Training Range, approximately 65 miles northwest of Las Vegas, Nevada. CAU 541 is a grouping of sites where there has been a suspected release of contamination associated with nuclear testing. This document describes the planned investigation of CAU 541, which comprises the following corrective action sites (CASs): 05-23-04, Atmospheric Tests (6) - BFa Site; 05-45-03, Atmospheric Test Site - Small Boy. These sites are being investigated because existing information on the nature andmore » extent of potential contamination is insufficient to evaluate and recommend corrective action alternatives (CAAs). Additional information will be obtained by conducting a corrective action investigation before evaluating CAAs and selecting the appropriate corrective action for each CAS. The results of the field investigation will support a defensible evaluation of viable CAAs that will be presented in the investigation report. The sites will be investigated based on the data quality objectives (DQOs) developed on April 1, 2014, by representatives of the Nevada Division of Environmental Protection; U.S. Air Force; and the U.S. Department of Energy (DOE), National Nuclear Security Administration Nevada Field Office. The DQO process was used to identify and define the type, amount, and quality of data needed to develop and evaluate appropriate corrective actions for CAU 541. The site investigation process also will be conducted in accordance with the Soils Activity Quality Assurance Plan, which establishes requirements, technical planning, and general quality practices to be applied to this activity. The potential contamination sources associated with CASs 05-23-04 and 05-45-03 are from nuclear testing activities conducted at the Atmospheric Tests (6) - BFa Site and Atmospheric Test Site - Small Boy sites. The presence and nature of contamination at CAU 541 will be evaluated based on information collected from field investigations. Radiological contamination will be evaluated based on a comparison of the total effective dose at sample locations to the dose-based final action level. The total effective dose will be calculated as the total of separate estimates of internal and external dose. Results from the analysis of soil samples will be used to calculate internal radiological dose. Thermoluminescent dosimeters placed at the center of each sample location will be used to measure external radiological dose. Appendix A provides a detailed discussion of the DQO methodology and the DQOs specific to each CAS.« less

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

Restoration of areas degraded by alluvial sand mining: use of soil microbiological activity and plant biomass growth to assess evolution of restored riparian vegetation.

PubMed

Venson, Graziela R; Marenzi, Rosemeri C; Almeida, Tito César M; Deschamps-Schmidt, Alexandre; Testolin, Renan C; Rörig, Leonardo R; Radetski, Claudemir M

2017-03-01

River or alluvial sand mining is causing a variety of environmental problems in the Itajaí-açú river basin in Santa Catarina State (south of Brazil). When this type of commercial activity degrades areas around rivers, environmental restoration programs need to be executed. In this context, the aim of this study was to assess the evolution of a restored riparian forest based on data on the soil microbial activity and plant biomass growth. A reference site and three sites with soil degradation were studied over a 3-year period. Five campaigns were performed to determine the hydrolysis of the soil enzyme fluorescein diacetate (FDA), and the biomass productivity was determined at the end of the studied period. The variation in the enzyme activity for the different campaigns at each site was low, but this parameter did differ significantly according to the site. Well-managed sites showed the highest biomass productivity, and this, in turn, showed a strong positive correlation with soil enzyme activity. In conclusion, soil enzyme activity could form the basis for monitoring and the early prediction of the success of vegetal restoration programs, since responses at the higher level of biological organization take longer, inhibiting the assessment of the project within an acceptable time frame.

3’UTR Shortening Potentiates MicroRNA-Based Repression of Pro-differentiation Genes in Proliferating Human Cells

PubMed Central

Hoffman, Yonit; Bublik, Debora Rosa; P. Ugalde, Alejandro; Elkon, Ran; Biniashvili, Tammy; Agami, Reuven; Oren, Moshe; Pilpel, Yitzhak

2016-01-01

Most mammalian genes often feature alternative polyadenylation (APA) sites and hence diverse 3’UTR lengths. Proliferating cells were reported to favor APA sites that result in shorter 3’UTRs. One consequence of such shortening is escape of mRNAs from targeting by microRNAs (miRNAs) whose binding sites are eliminated. Such a mechanism might provide proliferation-related genes with an expression gain during normal or cancerous proliferation. Notably, miRNA sites tend to be more active when located near both ends of the 3’UTR compared to those located more centrally. Accordingly, miRNA sites located near the center of the full 3’UTR might become more active upon 3'UTR shortening. To address this conjecture we performed 3' sequencing to determine the 3' ends of all human UTRs in several cell lines. Remarkably, we found that conserved miRNA binding sites are preferentially enriched immediately upstream to APA sites, and this enrichment is more prominent in pro-differentiation/anti-proliferative genes. Binding sites of the miR17-92 cluster, upregulated in rapidly proliferating cells, are particularly enriched just upstream to APA sites, presumably conferring stronger inhibitory activity upon shortening. Thus 3’UTR shortening appears not only to enable escape from inhibition of growth promoting genes but also to potentiate repression of anti-proliferative genes. PMID:26908102

Synthetic, structural mimetics of the β-hairpin flap of HIV-1 protease inhibit enzyme function.

PubMed

Chauhan, Jay; Chen, Shen-En; Fenstermacher, Katherine J; Naser-Tavakolian, Aurash; Reingewertz, Tali; Salmo, Rosene; Lee, Christian; Williams, Emori; Raje, Mithun; Sundberg, Eric; DeStefano, Jeffrey J; Freire, Ernesto; Fletcher, Steven

2015-11-01

Small-molecule mimetics of the β-hairpin flap of HIV-1 protease (HIV-1 PR) were designed based on a 1,4-benzodiazepine scaffold as a strategy to interfere with the flap-flap protein-protein interaction, which functions as a gated mechanism to control access to the active site. Michaelis-Menten kinetics suggested our small-molecules are competitive inhibitors, which indicates the mode of inhibition is through binding the active site or sterically blocking access to the active site and preventing flap closure, as designed. More generally, a new bioactive scaffold for HIV-1PR inhibition has been discovered, with the most potent compound inhibiting the protease with a modest K(i) of 11 μM. Copyright © 2015 Elsevier Ltd. All rights reserved.

Accurate Detection of Adenylation Domain Functions in Nonribosomal Peptide Synthetases by an Enzyme-linked Immunosorbent Assay System Using Active Site-directed Probes for Adenylation Domains.

PubMed

Ishikawa, Fumihiro; Miyamoto, Kengo; Konno, Sho; Kasai, Shota; Kakeya, Hideaki

2015-12-18

A significant gap exists between protein engineering and enzymes used for the biosynthesis of natural products, largely because there is a paucity of strategies that rapidly detect active-site phenotypes of the enzymes with desired activities. Herein, we describe a proof-of-concept study of an enzyme-linked immunosorbent assay (ELISA) system for the adenylation (A) domains in nonribosomal peptide synthetases (NRPSs) using a combination of active site-directed probes coupled to a 5'-O-N-(aminoacyl)sulfamoyladenosine scaffold with a biotin functionality that immobilizes probe molecules onto a streptavidin-coated solid support. The recombinant NRPSs have a C-terminal His-tag motif that is targeted by an anti-6×His mouse antibody as the primary antibody and a horseradish peroxidase-linked goat antimouse antibody as the secondary antibody. These probes can selectively capture the cognate A domains by ligand-directed targeting. In addition, the ELISA technique detected A domains in the crude cell-free homogenates from the Escherichia coli expression systems. When coupled with a chromogenic substrate, the antibody-based ELISA technique can visualize probe-protein binding interactions, which provides accurate readouts of the A-domain functions in NRPS enzymes. To assess the ELISA-based engineering of the A domains of NRPSs, we reprogramed 2,3-dihydroxybenzoic acid (DHB)-activating enzyme EntE toward salicylic acid (Sal)-activating enzymes and investigated a correlation between binding properties for probe molecules and enzyme catalysts. We generated a mutant of EntE that displayed negligible loss in the kcat/Km value with the noncognate substrate Sal and a corresponding 48-fold decrease in the kcat/Km value with the cognate substrate DHB. The resulting 26-fold switch in substrate specificity was achieved by the replacement of a Ser residue in the active site of EntE with a Cys toward the nonribosomal codes of Sal-activating enzymes. Bringing a laboratory ELISA technique and adenylating enzymes together using a combination of active site-directed probes for the A domains in NRPSs should accelerate both the functional characterization and manipulation of the A domains in NRPSs.

A Measure of the Broad Substrate Specificity of Enzymes Based on ‘Duplicate’ Catalytic Residues

PubMed Central

Chakraborty, Sandeep; Ásgeirsson, Bjarni; Rao, Basuthkar J.

2012-01-01

The ability of an enzyme to select and act upon a specific class of compounds with unerring precision and efficiency is an essential feature of life. Simultaneously, these enzymes often catalyze the reaction of a range of similar substrates of the same class, and also have promiscuous activities on unrelated substrates. Previously, we have established a methodology to quantify promiscuous activities in a wide range of proteins. In the current work, we quantitatively characterize the active site for the ability to catalyze distinct, yet related, substrates (BRASS). A protein with known structure and active site residues provides the framework for computing ‘duplicate’ residues, each of which results in slightly modified replicas of the active site scaffold. Such spatial congruence is supplemented by Finite difference Poisson Boltzmann analysis which filters out electrostatically unfavorable configurations. The congruent configurations are used to compute an index (BrassIndex), which reflects the broad substrate profile of the active site. We identify an acetylhydrolase and a methyltransferase as having the lowest and highest BrassIndex, respectively, from a set of non-homologous proteins extracted from the Catalytic Site Atlas. The acetylhydrolase, a regulatory enzyme, is known to be highly specific for platelet-activating factor. In the methyltransferase (PDB: 1QAM), various combinations of glycine (Gly38/40/42), asparagine (Asn101/11) and glutamic acid (Glu59/36) residues having similar spatial and electrostatic profiles with the specified scaffold (Gly38, Asn101 and Glu59) exemplifies the broad substrate profile such an active site may provide. ‘Duplicate’ residues identified by relaxing the spatial and/or electrostatic constraints can be the target of directed evolution methodologies, like saturation mutagenesis, for modulating the substrate specificity of proteins. PMID:23166637

Volatile anesthetics, not intravenous anesthetic propofol bind to and attenuate the activation of platelet receptor integrin αIIbβ3.

PubMed

Yuki, Koichi; Bu, Weiming; Shimaoka, Motomu; Eckenhoff, Roderic

2013-01-01

In clinical reports, the usage of isoflurane and sevoflurane was associated with more surgical field bleeding in endoscopic sinus surgeries as compared to propofol. The activation of platelet receptor αIIbβ3 is a crucial event for platelet aggregation and clot stability. Here we studied the effect of isoflurane, sevoflurane, and propofol on the activation of αIIbβ3. The effect of anesthetics on the activation of αIIbβ3 was probed using the activation sensitive antibody PAC-1 in both cell-based (platelets and αIIbβ3 transfectants) and cell-free assays. The binding sites of isoflurane on αIIbβ3 were explored using photoactivatable isoflurane (azi-isoflurane). The functional implication of revealed isoflurane binding sites were studied using alanine-scanning mutagenesis. Isoflurane and sevoflurane diminished the binding of PAC-1 to wild-type αIIbβ3 transfectants, but not to the high-affinity mutant, β3-N305T. Both anesthetics also impaired PAC-1 binding in a cell-free assay. In contrast, propofol did not affect the activation of αIIbβ3. Residues adducted by azi-isoflurane were near the calcium binding site (an important regulatory site termed SyMBS) just outside of the ligand binding site. The mutagenesis experiments demonstrated that these adducted residues were important in regulating integrin activation. Isoflurane and sevoflurane, but not propofol, impaired the activation of αIIbβ3. Azi-isoflurane binds to the regulatory site of integrin αIIbβ3, thereby suggesting that isoflurane blocks ligand binding of αIIbβ3 in not a competitive, but an allosteric manner.

Discovery and characterization of a new family of lytic polysaccharide monooxygenases.

PubMed

Hemsworth, Glyn R; Henrissat, Bernard; Davies, Gideon J; Walton, Paul H

2014-02-01

Lytic polysaccharide monooxygenases (LPMOs) are a recently discovered class of enzymes capable of oxidizing recalcitrant polysaccharides. They are attracting considerable attention owing to their potential use in biomass conversion, notably in the production of biofuels. Previous studies have identified two discrete sequence-based families of these enzymes termed AA9 (formerly GH61) and AA10 (formerly CBM33). Here, we report the discovery of a third family of LPMOs. Using a chitin-degrading exemplar from Aspergillus oryzae, we show that the three-dimensional structure of the enzyme shares some features of the previous two classes of LPMOs, including a copper active center featuring the 'histidine brace' active site, but is distinct in terms of its active site details and its EPR spectroscopy. The newly characterized AA11 family expands the LPMO clan, potentially broadening both the range of potential substrates and the types of reactive copper-oxygen species formed at the active site of LPMOs.

Synthesis and anticholinesterase activity of coumarin-3-carboxamides bearing tryptamine moiety.

PubMed

Ghanei-Nasab, Samaneh; Khoobi, Mehdi; Hadizadeh, Farzin; Marjani, Azam; Moradi, Alireza; Nadri, Hamid; Emami, Saeed; Foroumadi, Alireza; Shafiee, Abbas

2016-10-04

A number of N-(2-(1H-indol-3-yl)ethyl)-2-oxo-2H-chromene-3-carboxamides were synthesized and tested against AChE and BuChE. The in vitro assessment of the synthesized compounds 4a-o revealed that most of them had significant activity toward AChE. The SAR study demonstrated that the introduction of benzyloxy moiety on the 7-position of coumarin scaffold can improve the anti-AChE activity. The best result was obtained with 7-(4-fluorobenzyl)oxy moiety in the case of compound 4o, displaying IC50 value of 0.16 μM. Based on the docking study of AChE, the prototype compound 4o was laid across the active site and occupied both peripheral anionic site (PAS) and catalytic anionic site (CAS). Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Inducible model for β-six-mediated site-specific recombination in mammalian cells

PubMed Central

Servert, Pilar; Garcia-Castro, Javier; Díaz, Vicente; Lucas, Daniel; Gonzalez, Manuel A.; Martínez-A, Carlos; Bernad, Antonio

2006-01-01

The prokaryotic β recombinase catalyzes site-specific recombination between two directly oriented minimal six sites in chromatin-integrated substrates. Here, we demonstrate that an enhanced green fluorescent protein (EGFP)-fused version of β recombinase (β-EGFP) is fully active, retaining most specific activity. It is used to develop a recombination-dependent activatable gene expression (RAGE) system based on the androgen receptor (AR) ligand-binding domain (LBD). Two hybrid molecules, a direct fusion of the LBD-AR to the C-terminus of β recombinase (β-AR) and a triple fusion of β-EGFP to the same ligand-binding domain (β-EGFP-AR), were engineered and their subcellular behavior, stability and catalytic activity were evaluated. Both chimeric β recombinase proteins showed in vivo inducible recombinogenic activity dependent on addition of an androgen receptor agonist, although the β-AR fusion protein demonstrated more accurate ligand-dependent translocation from cytoplasm to nucleus. PMID:16394020

Cation-exchanged zeolites for the selective oxidation of methane to methanol

DOE PAGES

Kulkarni, Ambarish R.; Zhao, Zhi-Jian; Siahrostami, Samira; ...

2017-10-19

Motivated by the increasing availability of cheap natural gas resources, considerable experimental and computational research efforts have focused on identifying selective catalysts for the direct conversion of methane to methanol. One promising class of catalysts are cation-exchanged zeolites, which have steadily increased in popularity over the past decade. Here, in this article, we first present a broad overview of this field from a conceptual perspective, and highlight the role of theory in developing a molecular-level understanding of the reaction. Next, by performing and analyzing a large database of density functional theory (DFT) calculations for a wide range of transition metalmore » cations, zeolite topologies and active site motifs, we present a unifying picture of the methane activation process in terms of active site stability, C–H bond activation and methanol extraction. Based on the trade-offs of active site stability and reactivity, we propose a framework for identifying new, promising active site motifs in these systems. Further, we show that the high methanol selectivity arises due to the strong binding nature of the C–H activation products. Lastly, using the atomistic and mechanistic insight obtained from these analyses, we summarize the key challenges and future strategies for improving the performance of cation-exchanged zeolites for this industrially relevant conversion.« less

Cation-exchanged zeolites for the selective oxidation of methane to methanol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kulkarni, Ambarish R.; Zhao, Zhi-Jian; Siahrostami, Samira

Motivated by the increasing availability of cheap natural gas resources, considerable experimental and computational research efforts have focused on identifying selective catalysts for the direct conversion of methane to methanol. One promising class of catalysts are cation-exchanged zeolites, which have steadily increased in popularity over the past decade. Here, in this article, we first present a broad overview of this field from a conceptual perspective, and highlight the role of theory in developing a molecular-level understanding of the reaction. Next, by performing and analyzing a large database of density functional theory (DFT) calculations for a wide range of transition metalmore » cations, zeolite topologies and active site motifs, we present a unifying picture of the methane activation process in terms of active site stability, C–H bond activation and methanol extraction. Based on the trade-offs of active site stability and reactivity, we propose a framework for identifying new, promising active site motifs in these systems. Further, we show that the high methanol selectivity arises due to the strong binding nature of the C–H activation products. Lastly, using the atomistic and mechanistic insight obtained from these analyses, we summarize the key challenges and future strategies for improving the performance of cation-exchanged zeolites for this industrially relevant conversion.« less

Assessment of occupational exposure to polycyclic aromatic hydrocarbons via involuntary ingestion of soil from contaminated soils in Lagos, Nigeria.

PubMed

Adetunde, Oluwatoyin T; Mills, Graham A; Olayinka, Kehinde O; Alo, Babajide I

2014-01-01

Soils from 12 sites in Lagos area, Nigeria impacted by anthropogenic activities were extracted by ultrasonication and analysed for the concentration of 16 priority polycyclic aromatic hydrocarbons (PAHs) by gas chromatograph-mass spectrometer (GC-MS). The concentration of the sum of PAHs ranged from 0.2 to 254 μg/g at these sites. The sum benzo[a]pyrene-equivalent dose (BaPeq) at the sites ranged from 0.0 (K, forest soil) to 16.7 μg/g (C, the lubricating oil depot soil). Mean daily intake (MDI) for the composite soils samples when compared that of food revealed that some of the individual PAH in samples from sites A (Dump site), C (Depot and loading point for used for black oil), F (Dump site), G(petroleum depot), H (Roadside) and L (Car park) exceeded the recommended the recommended MDI threshold for food, indicating some risk associated with activities on these sites based on this ingestion estimate exceeded value. 8.2 × 10(-6), 7.1 × 10(-7), 1.2 × 10(-4), 4.9 × 10(-7), 7.3 × 10(-7), 1.4 × 10(-5), 7.9 × 10(-5), 4.6 × 10(-6), 3.4 × 10(-7), 2.4 × 10(-7), 2.2 × 10(-7) and 1.1 × 10(-4) estimated theoretical cancer risk (ER) for an adult with a body weight of 70 kg working on sites were composite soil samples A, B, C, D, E, F, G, H, I, J, K and L respectively were sampled. The ER from occupational exposure to surface soil based on oral ingestion were all higher than the target risk of 1 × 10(-6) for normal exposure but were all within the 1 × 10(-4) for extreme exposure for most of the sites except for site C and L. The differences in concentration and risk were related to the different activities (e.g., handling of petroleum products, open burning, bush burning) undertaken at these locations. However, it should be noted here that the resultant risk could be overestimated, since these calculations were based on an exhaustive extraction technique which may be different from uptake by the human guts (bioavailability study).

Charge neutralization in the active site of the catalytic trimer of aspartate transcarbamoylase promotes diverse structural changes.

PubMed

Endrizzi, James A; Beernink, Peter T

2017-11-01

A classical model for allosteric regulation of enzyme activity posits an equilibrium between inactive and active conformations. An alternative view is that allosteric activation is achieved by increasing the potential for conformational changes that are essential for catalysis. In the present study, substitution of a basic residue in the active site of the catalytic (C) trimer of aspartate transcarbamoylase with a non-polar residue results in large interdomain hinge changes in the three chains of the trimer. One conformation is more open than the chains in both the wild-type C trimer and the catalytic chains in the holoenzyme, the second is closed similar to the bisubstrate-analog bound conformation and the third hinge angle is intermediate to the other two. The active-site 240s loop conformation is very different between the most open and closed chains, and is disordered in the third chain, as in the holoenzyme. We hypothesize that binding of anionic substrates may promote similar structural changes. Further, the ability of the three catalytic chains in the trimer to access the open and closed active-site conformations simultaneously suggests a cyclic catalytic mechanism, in which at least one of the chains is in an open conformation suitable for substrate binding whereas another chain is closed for catalytic turnover. Based on the many conformations observed for the chains in the isolated catalytic trimer to date, we propose that allosteric activation of the holoenzyme occurs by release of quaternary constraint into an ensemble of active-site conformations. © 2017 The Protein Society.

Explicit treatment of active-site waters enhances quantum mechanical/implicit solvent scoring: Inhibition of CDK2 by new pyrazolo[1,5-a]pyrimidines.

PubMed

Hylsová, Michaela; Carbain, Benoit; Fanfrlík, Jindřich; Musilová, Lenka; Haldar, Susanta; Köprülüoğlu, Cemal; Ajani, Haresh; Brahmkshatriya, Pathik S; Jorda, Radek; Kryštof, Vladimír; Hobza, Pavel; Echalier, Aude; Paruch, Kamil; Lepšík, Martin

2017-01-27

We present comprehensive testing of solvent representation in quantum mechanics (QM)-based scoring of protein-ligand affinities. To this aim, we prepared 21 new inhibitors of cyclin-dependent kinase 2 (CDK2) with the pyrazolo[1,5-a]pyrimidine core, whose activities spanned three orders of magnitude. The crystal structure of a potent inhibitor bound to the active CDK2/cyclin A complex revealed that the biphenyl substituent at position 5 of the pyrazolo[1,5-a]pyrimidine scaffold was located in a previously unexplored pocket and that six water molecules resided in the active site. Using molecular dynamics, protein-ligand interactions and active-site water H-bond networks as well as thermodynamics were probed. Thereafter, all the inhibitors were scored by the QM approach utilizing the COSMO implicit solvent model. Such a standard treatment failed to produce a correlation with the experiment (R 2  = 0.49). However, the addition of the active-site waters resulted in significant improvement (R 2  = 0.68). The activities of the compounds could thus be interpreted by taking into account their specific noncovalent interactions with CDK2 and the active-site waters. In summary, using a combination of several experimental and theoretical approaches we demonstrate that the inclusion of explicit solvent effects enhance QM/COSMO scoring to produce a reliable structure-activity relationship with physical insights. More generally, this approach is envisioned to contribute to increased accuracy of the computational design of novel inhibitors. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Identification of carbon-encapsulated iron nanoparticles as active species in non-precious metal oxygen reduction catalysts

PubMed Central

Varnell, Jason A.; Tse, Edmund C. M.; Schulz, Charles E.; Fister, Tim T.; Haasch, Richard T.; Timoshenko, Janis; Frenkel, Anatoly I.; Gewirth, Andrew A.

2016-01-01

The widespread use of fuel cells is currently limited by the lack of efficient and cost-effective catalysts for the oxygen reduction reaction. Iron-based non-precious metal catalysts exhibit promising activity and stability, as an alternative to state-of-the-art platinum catalysts. However, the identity of the active species in non-precious metal catalysts remains elusive, impeding the development of new catalysts. Here we demonstrate the reversible deactivation and reactivation of an iron-based non-precious metal oxygen reduction catalyst achieved using high-temperature gas-phase chlorine and hydrogen treatments. In addition, we observe a decrease in catalyst heterogeneity following treatment with chlorine and hydrogen, using Mössbauer and X-ray absorption spectroscopy. Our study reveals that protected sites adjacent to iron nanoparticles are responsible for the observed activity and stability of the catalyst. These findings may allow for the design and synthesis of enhanced non-precious metal oxygen reduction catalysts with a higher density of active sites. PMID:27538720

Unmasking tandem site interaction in human acetylcholinesterase. Substrate activation with a cationic acetanilide substrate.

PubMed

Johnson, Joseph L; Cusack, Bernadette; Davies, Matthew P; Fauq, Abdul; Rosenberry, Terrone L

2003-05-13

Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge, and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acyl enzyme intermediate is produced. A conformational interaction between the A- and P-sites has recently been found to modulate ligand affinities. We now demonstrate that this interaction is of functional importance by showing that the acetylation rate constant of a substrate bound to the A-site is increased by a factor a when a second molecule of substrate binds to the P-site. This demonstration became feasible through the introduction of a new acetanilide substrate analogue of acetylcholine, 3-(acetamido)-N,N,N-trimethylanilinium (ATMA), for which a = 4. This substrate has a low acetylation rate constant and equilibrates with the catalytic site, allowing a tractable algebraic solution to the rate equation for substrate hydrolysis. ATMA affinities for the A- and P-sites deduced from the kinetic analysis were confirmed by fluorescence titration with thioflavin T as a reporter ligand. Values of a >1 give rise to a hydrolysis profile called substrate activation, and the AChE site-specific mutant W86F, and to a lesser extent wild-type human AChE itself, showed substrate activation with acetylthiocholine as the substrate. Substrate activation was incorporated into a previous catalytic scheme for AChE in which a bound P-site ligand can also block product dissociation from the A-site, and two additional features of the AChE catalytic pathway were revealed. First, the ability of a bound P-site ligand to increase the substrate acetylation rate constant varied with the structure of the ligand: thioflavin T accelerated ATMA acetylation by a factor a(2) of 1.3, while propidium failed to accelerate. Second, catalytic rate constants in the initial intermediate formed during acylation (EAP, where EA is the acyl enzyme and P is the alcohol leaving group cleaved from the ester substrate) may be constrained such that the leaving group P must dissociate before hydrolytic deacylation can occur.

Mechanistic Effects of Water on the Fe-Catalyzed Hydrodeoxygenation of Phenol. The Role of Brønsted Acid Sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hensley, Alyssa J. R.; Wang, Yong; Mei, Donghai

A mechanistic understanding of the roles of water is essential for developing highly active and selective catalysts for hydrodeoxygenation (HDO) reactions since water is ubiquitous in such reaction systems. Here, we present a study for phenol HDO on Fe catalysts using density functional theory which examines the effect of water on three elementary pathways for phenol HDO using an explicit solvation model. The presence of water is found to significantly decrease activation barriers required by hydrogenation reactions via two pathways. First, the proton transfer in the hydrogen bonding network of the liquid water phase is nearly barrierless, which significantly promotesmore » the direct through space tautomerization of phenol. Second, due to the high degree of oxophilicity on Fe, liquid water molecules are found to be easily dissociated into surface hydroxyl groups that can act as Brønsted acid sites. These sites dramatically promote hydrogenation reactions on the Fe surface. As a result, the hydrogen assisted dehydroxylation becomes the dominant phenol HDO pathway. This work provides new fundamental insights into aqueous phase HDO of biomass-derived oxygenates over Fe-based catalysts; e.g., the activity of Fe-based catalysts can be optimized by tuning the surface coverage of Brønsted acid sites via surface doping.« less

Discovery of novel STAT3 small molecule inhibitors via in silico site-directed fragment-based drug design.

PubMed

Yu, Wenying; Xiao, Hui; Lin, Jiayuh; Li, Chenglong

2013-06-13

Constitutive activation of signal transducer and activator of transcription 3 (STAT3) has been validated as an attractive therapeutic target for cancer therapy. To stop both STAT3 activation and dimerization, a viable strategy is to design inhibitors blocking its SH2 domain phosphotyrosine binding site that is responsible for both actions. A new fragment-based drug design (FBDD) strategy, in silico site-directed FBDD, was applied in this study. A designed novel compound, 5,8-dioxo-6-(pyridin-3-ylamino)-5,8-dihydronaphthalene-1-sulfonamide (LY5), was confirmed to bind to STAT3 SH2 by fluorescence polarization assay. In addition, four out of the five chosen compounds have IC50 values lower than 5 μM for the U2OS cancer cells. 8 (LY5) has an IC50 range in 0.5-1.4 μM in various cancer cell lines. 8 also suppresses tumor growth in an in vivo mouse model. This study has demonstrated the utility of this approach and could be used to other drug targets in general.

Mechanism-based post-translational modification and inactivation in terpene synthases

DOE PAGES

Kersten, Roland D.; Diedrich, Jolene K.; Yates, III, John R.; ...

2015-09-17

Terpenes are ubiquitous natural chemicals with diverse biological functions spanning all three domains of life. In specialized metabolism, the active sites of terpene synthases (TPSs) evolve in shape and reactivity to direct the biosynthesis of a myriad of chemotypes for organismal fitness. As most terpene biosynthesis mechanistically involves highly reactive carbocationic intermediates, the protein surfaces catalyzing these cascade reactions possess reactive regions possibly prone to premature carbocation capture and potentially enzyme inactivation. Here, we show using proteomic and X-ray crystallographic analyses that cationic intermediates undergo capture by conserved active site residues leading to inhibitory self-alkylation. Furthermore, the level of cation-mediatedmore » inactivation increases with mutation of the active site, upon changes in the size and structure of isoprenoid diphosphate substrates, and alongside increases in reaction temperatures. TPSs that individually synthesize multiple products are less prone to self-alkylation then TPSs possessing relatively high product specificity. In total, the results presented suggest that mechanism-based alkylation represents an overlooked mechanistic pressure during the evolution of cation-derived terpene biosynthesis.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

French, Jarrod B.; Ealick, Steven E., E-mail: see3@cornell.edu

The crystal structure of 5-hydroxyisourate hydrolase from K. pneumoniae and the steady-state kinetic parameters of the native enzyme as well as several mutants provide insights into the catalytic mechanism of this enzyme and the possible roles of the active-site residues. The stereospecific oxidative degradation of uric acid to (S)-allantoin has recently been demonstrated to proceed via two unstable intermediates and requires three separate enzymatic reactions. The second step of this reaction, the conversion of 5-hydroxyisourate (HIU) to 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline, is catalyzed by HIU hydrolase (HIUH). The high-resolution crystal structure of HIUH from the opportunistic pathogen Klebsiella pneumoniae (KpHIUH) has been determined.more » KpHIUH is a homotetrameric protein that, based on sequence and structural similarity, belongs to the transthyretin-related protein family. In addition, the steady-state kinetic parameters for this enzyme and four active-site mutants have been measured. These data provide valuable insight into the functional roles of the active-site residues. Based upon the structural and kinetic data, a mechanism is proposed for the KpHIUH-catalyzed reaction.« less

The biologically active zone in upland habitats at the Hanford Site, Washington, USA: Focus on plant rooting depth and biomobilization.

PubMed

Lovtang, Sara; Delistraty, Damon; Rochette, Elizabeth

2018-07-01

We challenge the suggestion by Sample et al. (2015) that a depth of 305 cm (10 ft) exceeds the depth of biological activity in soils at the Hanford Site, Washington, USA, or similar sites. Instead, we support the standard point of compliance, identified in the Model Toxics Control Act in the state of Washington, which specifies a depth of 457 cm (15 ft) for the protection of both human and ecological receptors at the Hanford Site. Our position is based on additional information considered in our expanded review of the literature, the influence of a changing environment over time, plant community dynamics at the Hanford Site, and inherent uncertainty in the Sample et al. (2015) analysis. Integr Environ Assess Manag 2018;14:442-446. © 2018 SETAC. © 2018 SETAC.

Novel approach of fragment-based lead discovery applied to renin inhibitors.

PubMed

Tawada, Michiko; Suzuki, Shinkichi; Imaeda, Yasuhiro; Oki, Hideyuki; Snell, Gyorgy; Behnke, Craig A; Kondo, Mitsuyo; Tarui, Naoki; Tanaka, Toshimasa; Kuroita, Takanobu; Tomimoto, Masaki

2016-11-15

A novel approach was conducted for fragment-based lead discovery and applied to renin inhibitors. The biochemical screening of a fragment library against renin provided the hit fragment which showed a characteristic interaction pattern with the target protein. The hit fragment bound only to the S1, S3, and S3 SP (S3 subpocket) sites without any interactions with the catalytic aspartate residues (Asp32 and Asp215 (pepsin numbering)). Prior to making chemical modifications to the hit fragment, we first identified its essential binding sites by utilizing the hit fragment's substructures. Second, we created a new and smaller scaffold, which better occupied the identified essential S3 and S3 SP sites, by utilizing library synthesis with high-throughput chemistry. We then revisited the S1 site and efficiently explored a good building block attaching to the scaffold with library synthesis. In the library syntheses, the binding modes of each pivotal compound were determined and confirmed by X-ray crystallography and the library was strategically designed by structure-based computational approach not only to obtain a more active compound but also to obtain informative Structure Activity Relationship (SAR). As a result, we obtained a lead compound offering synthetic accessibility as well as the improved in vitro ADMET profiles. The fragments and compounds possessing a characteristic interaction pattern provided new structural insights into renin's active site and the potential to create a new generation of renin inhibitors. In addition, we demonstrated our FBDD strategy integrating highly sensitive biochemical assay, X-ray crystallography, and high-throughput synthesis and in silico library design aimed at fragment morphing at the initial stage was effective to elucidate a pocket profile and a promising lead compound. Copyright © 2016 Elsevier Ltd. All rights reserved.

Replication of a carcinogenic nitropyrene DNA lesion by human Y-family DNA polymerase

PubMed Central

Kirouac, Kevin N.; Basu, Ashis K.; Ling, Hong

2013-01-01

Nitrated polycyclic aromatic hydrocarbons are common environmental pollutants, of which many are mutagenic and carcinogenic. 1-Nitropyrene is the most abundant nitrated polycyclic aromatic hydrocarbon, which causes DNA damage and is carcinogenic in experimental animals. Error-prone translesion synthesis of 1-nitropyrene–derived DNA lesions generates mutations that likely play a role in the etiology of cancer. Here, we report two crystal structures of the human Y-family DNA polymerase iota complexed with the major 1-nitropyrene DNA lesion at the insertion stage, incorporating either dCTP or dATP nucleotide opposite the lesion. Polι maintains the adduct in its active site in two distinct conformations. dCTP forms a Watson–Crick base pair with the adducted guanine and excludes the pyrene ring from the helical DNA, which inhibits replication beyond the lesion. By contrast, the mismatched dATP stacks above the pyrene ring that is intercalated in the helix and achieves a productive conformation for misincorporation. The intra-helical bulky pyrene mimics a base pair in the active site and facilitates adenine misincorporation. By structure-based mutagenesis, we show that the restrictive active site of human polη prevents the intra-helical conformation and A-base misinsertions. This work provides one of the molecular mechanisms for G to T transversions, a signature mutation in human lung cancer. PMID:23268450

Marine molluscs and fish as biomarkers of pollution stress in littoral regions of the Red Sea, Mediterranean Sea and North Sea

NASA Astrophysics Data System (ADS)

Bresler, Vladimir; Bissinger, Vera; Abelson, Avigdor; Dizer, Halim; Sturm, Armin; Kratke, Renate; Fishelson, Lev; Hansen, Peter-Diedrich

1999-12-01

The intensive development of industry and urban structures along the seashores of the world, as well as the immense increase in marine transportation and other activities, has resulted in the deposition of thousands of new chemicals and organic compounds, endangering the existence of organisms and ecosystems. The conventional single biomarker methods used in ecological assessment studies cannot provide an adequate base for environmental health assessment, management and sustainability planning. The present study uses a set of novel biochemical, physiological, cytogenetic and morphological methods to characterize the state of health of selected molluscs and fish along the shores of the German North Sea, as well as the Israeli Mediterranean and Red Sea. The methods include measurement of activity of multixenobiotic resistance-mediated transporter (MXRtr) and the system of active transport of organic anions (SATOA) as indicators of antixenobiotic defence; glutathione S-transferase (GST) activity as an indicator of biotransformation of xenobiotics; DNA unwinding as a marker of genotoxicity; micronucleus test for clastogenicity; levels of phagocytosis for immunotoxicity; cholinesterase (ChE) activity and level of catecholamines as indicators of neurotoxicity; permeability of external epithelia to anionic hydrophilic probe, intralysosomal accumulation of cationic amphiphilic probe and activity of non-specific esterases as indicators of cell/tissue viability. Complete histopathological examination was used for diagnostics of environmental pathology. The obtained data show that the activity of the defensive pumps, MXRtr and SATOA in the studied organisms was significantly higher in the surface epithelia of molluscs from a polluted site than that of the same species from control, unpolluted stations, providing clear evidence of response to stress. Enhanced frequency of DNA lesions (alkaline and acidic DNA unwinding) and micronucleus-containing cells was significantly higher in samples from polluted sites in comparison to those from the clean sites that exhibited genotoxic and clastogenic activity of the pollutants. In all the studied molluscs a negative correlation was found between the MXRtr levels of activity and the frequency of micronucleus-containing hemocytes. The expression of this was in accordance with the level of pollution. The complete histopathological examination demonstrates significantly higher frequencies of pathological alterations in organs of animals from polluted sites. A strong negative correlation was found between the frequency of these alterations and MXRtr activity in the same specimens. In addition to these parameters, a decrease in the viability was noted in molluscs from the polluted sites, but ChE activities remained similar at most sites. The methods applied in our study unmasked numerous early cryptic responses and negative alterations of health in populations of marine biota sampled from the polluted sites. This demonstrates that genotoxic, clastogenic and pathogenic xenobiotics are present and act in the studied sites and this knowledge can provide a reliable base for consideration for sustainable development.

Transmutation of human glutathione transferase A2-2 with peroxidase activity into an efficient steroid isomerase.

PubMed

Pettersson, Par L; Johansson, Ann-Sofie; Mannervik, Bengt

2002-08-16

A major goal in protein engineering is the tailor-making of enzymes for specified chemical reactions. Successful attempts have frequently been based on directed molecular evolution involving libraries of random mutants in which variants with desired properties were identified. For the engineering of enzymes with novel functions, it would be of great value if the necessary changes of the active site could be predicted and implemented. Such attempts based on the comparison of similar structures with different substrate selectivities have previously met with limited success. However, the present work shows that the knowledge-based redesign restricted to substrate-binding residues in human glutathione transferase A2-2 can introduce high steroid double-bond isomerase activity into the enzyme originally characterized by glutathione peroxidase activity. Both the catalytic center activity (k(cat)) and catalytic efficiency (k(cat)/K(m)) match the values of the naturally evolved glutathione transferase A3-3, the most active steroid isomerase known in human tissues. The substrate selectivity of the mutated glutathione transferase was changed 7000-fold by five point mutations. This example demonstrates the functional plasticity of the glutathione transferase scaffold as well as the potential of rational active-site directed mutagenesis as a complement to DNA shuffling and other stochastic methods for the redesign of proteins with novel functions.

Activity-based probes for the ubiquitin conjugation-deconjugation machinery: new chemistries, new tools, and new insights.

PubMed

Hewings, David S; Flygare, John A; Bogyo, Matthew; Wertz, Ingrid E

2017-05-01

The reversible post-translational modification of proteins by ubiquitin and ubiquitin-like proteins regulates almost all cellular processes, by affecting protein degradation, localization, and complex formation. Deubiquitinases (DUBs) are proteases that remove ubiquitin modifications or cleave ubiquitin chains. Most DUBs are cysteine proteases, which makes them well suited for study by activity-based probes. These DUB probes report on deubiquitinase activity by reacting covalently with the active site in an enzyme-catalyzed manner. They have proven to be important tools to study DUB selectivity and proteolytic activity in different settings, to identify novel DUBs, and to characterize deubiquitinase inhibitors. Inspired by the efficacy of activity-based probes for DUBs, several groups have recently reported probes for the ubiquitin conjugation machinery (E1, E2, and E3 enzymes). Many of these enzymes, while not proteases, also posses active site cysteine residues and can be targeted by covalent probes. In this review, we will discuss how features of the probe (cysteine-reactive group, recognition element, and reporter tag) affect reactivity and suitability for certain experimental applications. We will also review the diverse applications of the current probes, and discuss the need for new probe types to study emerging aspects of ubiquitin biology. © 2017 Federation of European Biochemical Societies.

Systematic optimization model and algorithm for binding sequence selection in computational enzyme design

PubMed Central

Huang, Xiaoqiang; Han, Kehang; Zhu, Yushan

2013-01-01

A systematic optimization model for binding sequence selection in computational enzyme design was developed based on the transition state theory of enzyme catalysis and graph-theoretical modeling. The saddle point on the free energy surface of the reaction system was represented by catalytic geometrical constraints, and the binding energy between the active site and transition state was minimized to reduce the activation energy barrier. The resulting hyperscale combinatorial optimization problem was tackled using a novel heuristic global optimization algorithm, which was inspired and tested by the protein core sequence selection problem. The sequence recapitulation tests on native active sites for two enzyme catalyzed hydrolytic reactions were applied to evaluate the predictive power of the design methodology. The results of the calculation show that most of the native binding sites can be successfully identified if the catalytic geometrical constraints and the structural motifs of the substrate are taken into account. Reliably predicting active site sequences may have significant implications for the creation of novel enzymes that are capable of catalyzing targeted chemical reactions. PMID:23649589

Brownian aggregation rate of colloid particles with several active sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nekrasov, Vyacheslav M.; Yurkin, Maxim A.; Chernyshev, Andrei V., E-mail: chern@ns.kinetics.nsc.ru

2014-08-14

We theoretically analyze the aggregation kinetics of colloid particles with several active sites. Such particles (so-called “patchy particles”) are well known as chemically anisotropic reactants, but the corresponding rate constant of their aggregation has not yet been established in a convenient analytical form. Using kinematic approximation for the diffusion problem, we derived an analytical formula for the diffusion-controlled reaction rate constant between two colloid particles (or clusters) with several small active sites under the following assumptions: the relative translational motion is Brownian diffusion, and the isotropic stochastic reorientation of each particle is Markovian and arbitrarily correlated. This formula was shownmore » to produce accurate results in comparison with more sophisticated approaches. Also, to account for the case of a low number of active sites per particle we used Monte Carlo stochastic algorithm based on Gillespie method. Simulations showed that such discrete model is required when this number is less than 10. Finally, we applied the developed approach to the simulation of immunoagglutination, assuming that the formed clusters have fractal structure.« less

An Exploration of the Use of Branding to Shape Institutional Image in the Marketing Activities of Faith-Based Higher Education Institutions

ERIC Educational Resources Information Center

Tolbert, Dawn

2014-01-01

Modern higher education includes student-consumers who shop for educational opportunities and institutions that actively market themselves. This study examined the marketing of faith-based institutions to determine how faith-related missions are reflected in the printed recruitment materials, Web sites, and admissions portals of the 112 member…

Welfare Reform: Work-Site-Based Activities Can Play an Important Role in TANF Programs. Report to Congressional Requesters.

ERIC Educational Resources Information Center

Fagnoni, Cynthia M.

The General Accounting Office (GAO) examined worksite-based activities currently in place to help recipients of Temporary Assistance for Needy Families (TANF) develop the skills required for successful transition to unsubsidized employment. Data were collected from the following sources: (1) data reported by states to the Department of Health and…

Sent packing: protein engineering generates a new crystal form of Pseudomonas aeruginosa DsbA1 with increased catalytic surface accessibility

DOE Office of Scientific and Technical Information (OSTI.GOV)

McMahon, Roisin M., E-mail: r.mcmahon1@uq.edu.au; Coinçon, Mathieu; Tay, Stephanie

The crystal structure of a P. aeruginosa DsbA1 variant is more suitable for fragment-based lead discovery efforts to identify inhibitors of this antimicrobial drug target. In the reported structures the active site of the protein can simultaneously bind multiple ligands introduced in the crystallization solution or via soaking. Pseudomonas aeruginosa is an opportunistic human pathogen for which new antimicrobial drug options are urgently sought. P. aeruginosa disulfide-bond protein A1 (PaDsbA1) plays a pivotal role in catalyzing the oxidative folding of multiple virulence proteins and as such holds great promise as a drug target. As part of a fragment-based lead discoverymore » approach to PaDsbA1 inhibitor development, the identification of a crystal form of PaDsbA1 that was more suitable for fragment-soaking experiments was sought. A previously identified crystallization condition for this protein was unsuitable, as in this crystal form of PaDsbA1 the active-site surface loops are engaged in the crystal packing, occluding access to the target site. A single residue involved in crystal-packing interactions was substituted with an amino acid commonly found at this position in closely related enzymes, and this variant was successfully used to generate a new crystal form of PaDsbA1 in which the active-site surface is more accessible for soaking experiments. The PaDsbA1 variant displays identical redox character and in vitro activity to wild-type PaDsbA1 and is structurally highly similar. Two crystal structures of the PaDsbA1 variant were determined in complex with small molecules bound to the protein active site. These small molecules (MES, glycerol and ethylene glycol) were derived from the crystallization or cryoprotectant solutions and provide a proof of principle that the reported crystal form will be amenable to co-crystallization and soaking with small molecules designed to target the protein active-site surface.« less

The Russian Academy of Education's Centers for Innovative Development

ERIC Educational Resources Information Center

Martirosian, B. P.; Rubtsova, N. E.; Shapovalova, I. A.

2014-01-01

The article presents a review of the experience of practical testing (based in 385 experimental sites of the Russian Academy of Education) of current achievements of scientific academic schools that are developing the traditions of education. The organization of the innovative scientific and practical activity of the experimental sites of the…

77 FR 12081 - Comscope, Inc., Catawba Facility, A Subsidiary of the Carlyle Group Including On-Site Leased...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-28

... in activities related to the production of coaxial cable and coax products for the cable television... coaxial cable and coax products for the cable television industry. Based on these findings, the Department... On- Site Workers from Cable Transport, Inc. Catawba, NC; Amended Certification Regarding Eligibility...

Energized Learning

Science.gov Websites

Energized Learning Students Lessons Bullet Getting Started Bullet Bringing It Home Bullet Unit activities with keys to subject matter standards. As students work through one or more of the standards-based Why Use the Energized Learning Site? How will teachers and Students Use the Energized Learning Site

Tricyclic Covalent Inhibitors Selectively Target Jak3 through an Active Site Thiol*

PubMed Central

Goedken, Eric R.; Argiriadi, Maria A.; Banach, David L.; Fiamengo, Bryan A.; Foley, Sage E.; Frank, Kristine E.; George, Jonathan S.; Harris, Christopher M.; Hobson, Adrian D.; Ihle, David C.; Marcotte, Douglas; Merta, Philip J.; Michalak, Mark E.; Murdock, Sara E.; Tomlinson, Medha J.; Voss, Jeffrey W.

2015-01-01

The action of Janus kinases (JAKs) is required for multiple cytokine signaling pathways, and as such, JAK inhibitors hold promise for treatment of autoimmune disorders, including rheumatoid arthritis, inflammatory bowel disease, and psoriasis. However, due to high similarity in the active sites of the four members (Jak1, Jak2, Jak3, and Tyk2), developing selective inhibitors within this family is challenging. We have designed and characterized substituted, tricyclic Jak3 inhibitors that selectively avoid inhibition of the other JAKs. This is accomplished through a covalent interaction between an inhibitor containing a terminal electrophile and an active site cysteine (Cys-909). We found that these ATP competitive compounds are irreversible inhibitors of Jak3 enzyme activity in vitro. They possess high selectivity against other kinases and can potently (IC50 < 100 nm) inhibit Jak3 activity in cell-based assays. These results suggest irreversible inhibitors of this class may be useful selective agents, both as tools to probe Jak3 biology and potentially as therapies for autoimmune diseases. PMID:25552479

Model-based imaging of cardiac electrical function in human atria

NASA Astrophysics Data System (ADS)

Modre, Robert; Tilg, Bernhard; Fischer, Gerald; Hanser, Friedrich; Messnarz, Bernd; Schocke, Michael F. H.; Kremser, Christian; Hintringer, Florian; Roithinger, Franz

2003-05-01

Noninvasive imaging of electrical function in the human atria is attained by the combination of data from electrocardiographic (ECG) mapping and magnetic resonance imaging (MRI). An anatomical computer model of the individual patient is the basis for our computer-aided diagnosis of cardiac arrhythmias. Three patients suffering from Wolff-Parkinson-White syndrome, from paroxymal atrial fibrillation, and from atrial flutter underwent an electrophysiological study. After successful treatment of the cardiac arrhythmia with invasive catheter technique, pacing protocols with stimuli at several anatomical sites (coronary sinus, left and right pulmonary vein, posterior site of the right atrium, right atrial appendage) were performed. Reconstructed activation time (AT) maps were validated with catheter-based electroanatomical data, with invasively determined pacing sites, and with pacing at anatomical markers. The individual complex anatomical model of the atria of each patient in combination with a high-quality mesh optimization enables accurate AT imaging, resulting in a localization error for the estimated pacing sites within 1 cm. Our findings may have implications for imaging of atrial activity in patients with focal arrhythmias.

Self-assembly of protein-based biomaterials initiated by titania nanotubes.

PubMed

Forstater, Jacob H; Kleinhammes, Alfred; Wu, Yue

2013-12-03

Protein-based biomaterials are a promising strategy for creating robust highly selective biocatalysts. The assembled biomaterials must sufficiently retain the near-native structure of proteins and provide molecular access to catalytically active sites. These requirements often exclude the use of conventional assembly techniques, which rely on covalent cross-linking of proteins or entrapment within a scaffold. Here we demonstrate that titania nanotubes can initiate and template the self-assembly of enzymes, such as ribonuclease A, while maintaining their catalytic activity. Initially, the enzymes form multilayer thick ellipsoidal aggregates centered on the nanotube surface; subsequently, these nanosized entities assemble into a micrometer-sized enzyme material that has enhanced enzymatic activity and contains as little as 0.1 wt % TiO2 nanotubes. This phenomenon is uniquely associated with the active anatase (001)-like surface of titania nanotubes and does not occur on other anatase nanomaterials, which contain significantly fewer undercoordinated Ti surface sites. These findings present a nanotechnology-enabled mechanism of biomaterial growth and open a new route for creating stable protein-based biomaterials and biocatalysts without the need for chemical modification.

Crew/Robot Coordinated Planetary EVA Operations at a Lunar Base Analog Site

NASA Technical Reports Server (NTRS)

Diftler, M. A.; Ambrose, R. O.; Bluethmann, W. J.; Delgado, F. J.; Herrera, E.; Kosmo, J. J.; Janoiko, B. A.; Wilcox, B. H.; Townsend, J. A.; Matthews, J. B.;

Characterization and remediation of 91B radioactive waste sites under performance based contracts at Lackland Air Force Base, San Antonio, Texas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trujillo, P.A.; Anderson, K.D.

2007-07-01

This paper describes the challenges behind the implementation of the characterization, remediation, and the Site Closure for three 91b Radioactive Wastes under a Performance Based Contract at Lackland Air Force Base, San Antonio, Texas. The Defense Environmental Restoration Program (DERP) was established by Section 211 of the Superfund Amendments and Reauthorization Act of 1986 (SARA). A part of the DERP provides for the cleanup of hazardous substances associated with past Department of Defense (DoD) activities and is consistent with the provisions of the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA). It is the Air Force Installation Restoration Program (IRP)more » that has responsibility for the cleanup activities associated with CERCLA. Under contract to the Air Force Center for Environmental Excellence (AFCEE), the ECC Project Team, that included ECC, Cabrera Services, and Malcolm Pirnie, was responsible for the implementation of the actions at three sites. The three IRP (91b) sites included RW015, a 0.02 square kilometer (5.5 acre) site, RW017 a 0.003 square kilometer (0.9 acre) site, and RW033 an 0.356 square kilometer (88 acre) site. Adding to the complexities of the project were issues of archaeological areas of interest, jurisdictional wetlands, land open to hunting, issues of security as well as compliance to the myriad of air force base rules, regulations, and Air Force Instructions (AFI). The award of the project task order was July of 2005, the project plan phase started in July of 2005 followed by the remedy implementation that included characterization and remediation as required reached completion in June of 2006. The project closure including the development and approval final status survey reports, proposed plans, and decision documents that parallel the CERCLA process was initiated in June of 2006 and is expected to reach completion in August of 2007. This paper will focus on the issues of working to achieve radiological and chemical closure under a performance based contract vehicle and the challenges encountered while reaching this goal. (authors)« less

Revised description of index of Florida water data collection active stations and a user's guide for station or site information retrieval computer program FINDEX H578

USGS Publications Warehouse

Geiger, Linda H.

1983-01-01

The report is an update of U.S. Geological Survey Open-File Report 77-703, which described a retrieval program for administrative index of active data-collection sites in Florida. Extensive changes to the Findex system have been made since 1977 , making the previous report obsolete. A description of the data base and computer programs that are available in the Findex system are documented in this report. This system serves a vital need in the administration of the many and diverse water-data collection activities. District offices with extensive data-collection activities will benefit from the documentation of the system. Largely descriptive, the report tells how a file of computer card images has been established which contains entries for all sites in Florida at which there is currently a water-data collection activity. Entries include information such as identification number, station name, location, type of site, county, frequency of data collection, funding, and other pertinent details. The computer program FINDEX selectively retrieves entries and lists them in a format suitable for publication. The index is updated routinely. (USGS)

Superfund record of decision (EPA Region 9): Mather Air Force Base, Soil and Groundwater operable units, Sacramento, CA, June 21, 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

The decision document presents the selected remedial actions for the Soil Operable Unit (OU) Sites and Groundwater OU Plumes, at the formerly active Mather Air Force Base (AFB), Sacramento County, California. The purpose of the Record of Decision (ROD) is to decide the appropriate level of remediation necessary to protect human health and the environment, and determine what requirements are applicable or relevant and appropriate requirements (ARARs) based on the groundwater beneficial use designation and site-specific conditions. The ROD has been divided into seven sections which specifically address the range of selected remedial actions for the Soil OU sites andmore » Groundwater OU plumes.« less

The cost structure of routine infant immunization services: a systematic analysis of six countries

PubMed Central

Geng, Fangli; Suharlim, Christian; Brenzel, Logan; Resch, Stephen C; Menzies, Nicolas A

2017-01-01

Abstract Little information exists on the cost structure of routine infant immunization services in low- and middle-income settings. Using a unique dataset of routine infant immunization costs from six countries, we estimated how costs were distributed across budget categories and programmatic activities, and investigated how the cost structure of immunization sites varied by country and site characteristics. The EPIC study collected data on routine infant immunization costs from 319 sites in Benin, Ghana, Honduras, Moldova, Uganda, Zambia, using a standardized approach. For each country, we estimated the economic costs of infant immunization by administrative level, budget category, and programmatic activity from a programme perspective. We used regression models to describe how costs within each category were related to site operating characteristics and efficiency level. Site-level costs (incl. vaccines) represented 77–93% of national routine infant immunization costs. Labour and vaccine costs comprised 14–69% and 13–69% of site-level cost, respectively. The majority of site-level resources were devoted to service provision (facility-based or outreach), comprising 48–78% of site-level costs across the six countries. Based on the regression analyses, sites with the highest service volume had a greater proportion of costs devoted to vaccines, with vaccine costs per dose relatively unaffected by service volume but non-vaccine costs substantially lower with higher service volume. Across all countries, more efficient sites (compared with sites with similar characteristics) had a lower cost share devoted to labour. The cost structure of immunization services varied substantially between countries and across sites within each country, and was related to site characteristics. The substantial variation observed in this sample suggests differences in operating model for otherwise similar sites, and further understanding of these differences could reveal approaches to improve efficiency and performance of immunization sites. PMID:28575193

The pH-dependent Structures of the Manganese Binding Sites in Oxalate Decarboxylase as Revealed by High-Field Electron Paramagnetic Resonance

PubMed Central

Tabares, Leandro C.; Gätjens, Jessica; Hureau, Christelle; Burrell, Matthew R.; Bowater, Laura; Pecoraro, Vincent L.; Bornemann, Stephen; Un, Sun

2009-01-01

A high-field electron paramagnetic resonance (HFEPR) study of oxalate decarboxylase (OxdC) is reported. OxdC breaks down oxalate to carbon dioxide and formate and possesses two distinct manganese(II) binding sites, referred to as site-1 and -2. The Mn(II) zero-field interaction was used to probe the electronic state of the metal ion and to examine chemical/mechanistic roles of each of the Mn(II) centers. High magnetic-fields were exploited not only to resolve the two sites, but also to measure accurately the Mn(II) zero-field parameters of each of the sites. The spectra exhibited surprisingly complex behavior as a function of pH. Six different species were identified based on their zero-field interactions, two corresponding to site-1 and four states to site-2. The assignments were verified using a mutant that only affected site-1. The speciation data determined from the HFEPR spectra for site -2 was consistent with a simple triprotic equilibrium model, while the pH dependence of site-1 could be described by a single pKa. This pH dependence was independent of the presence of the His-tag and of whether the preparations contained 1.2 or 1.6 Mn per subunit. Possible structures of the six species are proposed based on spectroscopic data from model complexes and existing protein crystallographic structures obtained at pH 8 are discussed. Although site-1 has been identified as the active site and no role has been assigned to site-2, the pronounced changes in the electronic structure of the latter and its pH behavior, which also matches the pH-dependent activity of this enzyme, suggests that even if the conversion of oxalate to formate is carried out at site-1, site-2 likely plays a catalytically relevant role. PMID:19505123

The cost structure of routine infant immunization services: a systematic analysis of six countries.

PubMed

Geng, Fangli; Suharlim, Christian; Brenzel, Logan; Resch, Stephen C; Menzies, Nicolas A

2017-10-01

Little information exists on the cost structure of routine infant immunization services in low- and middle-income settings. Using a unique dataset of routine infant immunization costs from six countries, we estimated how costs were distributed across budget categories and programmatic activities, and investigated how the cost structure of immunization sites varied by country and site characteristics. The EPIC study collected data on routine infant immunization costs from 319 sites in Benin, Ghana, Honduras, Moldova, Uganda, Zambia, using a standardized approach. For each country, we estimated the economic costs of infant immunization by administrative level, budget category, and programmatic activity from a programme perspective. We used regression models to describe how costs within each category were related to site operating characteristics and efficiency level. Site-level costs (incl. vaccines) represented 77-93% of national routine infant immunization costs. Labour and vaccine costs comprised 14-69% and 13-69% of site-level cost, respectively. The majority of site-level resources were devoted to service provision (facility-based or outreach), comprising 48-78% of site-level costs across the six countries. Based on the regression analyses, sites with the highest service volume had a greater proportion of costs devoted to vaccines, with vaccine costs per dose relatively unaffected by service volume but non-vaccine costs substantially lower with higher service volume. Across all countries, more efficient sites (compared with sites with similar characteristics) had a lower cost share devoted to labour. The cost structure of immunization services varied substantially between countries and across sites within each country, and was related to site characteristics. The substantial variation observed in this sample suggests differences in operating model for otherwise similar sites, and further understanding of these differences could reveal approaches to improve efficiency and performance of immunization sites. © The Author 2017. Published by Oxford University Press in association with The London School of Hygiene and Tropical Medicine.

Generic protease detection technology for monitoring periodontal disease.

PubMed

Zheng, Xinwei; Cook, Joseph P; Watkinson, Michael; Yang, Shoufeng; Douglas, Ian; Rawlinson, Andrew; Krause, Steffi

2011-01-01

Periodontal diseases are inflammatory conditions that affect the supporting tissues of teeth and can lead to destruction of the bone support and ultimately tooth loss if untreated. Progression of periodontitis is usually site specific but not uniform, and currently there are no accurate clinical methods for distinguishing sites where there is active disease progression from sites that are quiescent. Consequently, unnecessary and costly treatment of periodontal sites that are not progressing may occur. Three proteases have been identified as suitable markers for distinguishing sites with active disease progression and quiescent sites: human neutrophil elastase, cathepsin G and MMP8. Generic sensor materials for the detection of these three proteases have been developed based on thin dextran hydrogel films cross-linked with peptides. Degradation of the hydrogel films was monitored using impedance measurements. The target proteases were detected in the clinically relevant range within a time frame of 3 min. Good specificity for different proteases was achieved by choosing appropriate peptide cross-linkers.

Predictive Array Design. A method for sampling combinatorial chemistry library space.

PubMed

Lipkin, M J; Rose, V S; Wood, J

2002-01-01

A method, Predictive Array Design, is presented for sampling combinatorial chemistry space and selecting a subarray for synthesis based on the experimental design method of Latin Squares. The method is appropriate for libraries with three sites of variation. Libraries with four sites of variation can be designed using the Graeco-Latin Square. Simulated annealing is used to optimise the physicochemical property profile of the sub-array. The sub-array can be used to make predictions of the activity of compounds in the all combinations array if we assume each monomer has a relatively constant contribution to activity and that the activity of a compound is composed of the sum of the activities of its constitutive monomers.

Remediation of petroleum hydrocarbon-contaminated sites by DNA diagnosis-based bioslurping technology.

PubMed

Kim, Seungjin; Krajmalnik-Brown, Rosa; Kim, Jong-Oh; Chung, Jinwook

2014-11-01

The application of effective remediation technologies can benefit from adequate preliminary testing, such as in lab-scale and Pilot-scale systems. Bioremediation technologies have demonstrated tremendous potential with regards to cost, but they cannot be used for all contaminated sites due to limitations in biological activity. The purpose of this study was to develop a DNA diagnostic method that reduces the time to select contaminated sites that are good candidates for bioremediation. We applied an oligonucleotide microarray method to detect and monitor genes that lead to aliphatic and aromatic degradation. Further, the bioremediation of a contaminated site, selected based on the results of the genetic diagnostic method, was achieved successfully by applying bioslurping in field tests. This gene-based diagnostic technique is a powerful tool to evaluate the potential for bioremediation in petroleum hydrocarbon contaminated soil. Copyright © 2014 Elsevier B.V. All rights reserved.

Century-scale records of land-based activities recorded in Mesoamerican coral cores.

PubMed

Carilli, Jessica E; Prouty, Nancy G; Hughen, Konrad A; Norris, Richard D

2009-12-01

The Mesoamerican Reef, the second-largest barrier reef in the world, is located in the western Caribbean Sea off the coasts of Mexico, Belize, Guatemala, and Honduras. Particularly in the south, the surrounding watersheds are steep and the climate is extremely wet. With development and agricultural expansion, the potential for negative impacts to the reef from land-based runoff becomes high. We constructed annually resolved century-scale records of metal/calcium ratios in coral skeletons collected from four sites experiencing a gradient of land-based runoff. Our proxy data indicate that runoff onto the reef has increased relatively steadily over time at all sites, consistent with land use trends from historical records. Sediment supply to the reef is greater in the south, and these more exposed reefs will probably benefit most immediately from management that targets runoff reduction. However, because runoff at all sites is steadily increasing, even distal sites will benefit from watershed management.

A three-dimensional model of mammalian tyrosinase active site accounting for loss of function mutations.

PubMed

Schweikardt, Thorsten; Olivares, Concepción; Solano, Francisco; Jaenicke, Elmar; García-Borrón, José Carlos; Decker, Heinz

2007-10-01

Tyrosinases are the first and rate-limiting enzymes in the synthesis of melanin pigments responsible for colouring hair, skin and eyes. Mutation of tyrosinases often decreases melanin production resulting in albinism, but the effects are not always understood at the molecular level. Homology modelling of mouse tyrosinase based on recently published crystal structures of non-mammalian tyrosinases provides an active site model accounting for loss-of-function mutations. According to the model, the copper-binding histidines are located in a helix bundle comprising four densely packed helices. A loop containing residues M374, S375 and V377 connects the CuA and CuB centres, with the peptide oxygens of M374 and V377 serving as hydrogen acceptors for the NH-groups of the imidazole rings of the copper-binding His367 and His180. Therefore, this loop is essential for the stability of the active site architecture. A double substitution (374)MS(375) --> (374)GG(375) or a single M374G mutation lead to a local perturbation of the protein matrix at the active site affecting the orientation of the H367 side chain, that may be unable to bind CuB reliably, resulting in loss of activity. The model also accounts for loss of function in two naturally occurring albino mutations, S380P and V393F. The hydroxyl group in S380 contributes to the correct orientation of M374, and the substitution of V393 for a bulkier phenylalanine sterically impedes correct side chain packing at the active site. Therefore, our model explains the mechanistic necessity for conservation of not only active site histidines but also adjacent amino acids in tyrosinase.

Systems-Oriented Workplace Learning Experiences for Early Learners: Three Models.

PubMed

O'Brien, Bridget C; Bachhuber, Melissa R; Teherani, Arianne; Iker, Theresa M; Batt, Joanne; O'Sullivan, Patricia S

2017-05-01

Early workplace learning experiences may be effective for learning systems-based practice. This study explores systems-oriented workplace learning experiences (SOWLEs) for early learners to suggest a framework for their development. The authors used a two-phase qualitative case study design. In Phase 1 (spring 2014), they prepared case write-ups based on transcribed interviews from 10 SOWLE leaders at the authors' institution and, through comparative analysis of cases, identified three SOWLE models. In Phase 2 (summer 2014), studying seven 8-week SOWLE pilots, the authors used interview and observational data collected from the seven participating medical students, two pharmacy students, and site leaders to construct case write-ups of each pilot and to verify and elaborate the models. In Model 1, students performed specific patient care activities that addressed a system gap. Some site leaders helped students connect the activities to larger systems problems and potential improvements. In Model 2, students participated in predetermined systems improvement (SI) projects, gaining experience in the improvement process. Site leaders had experience in SI and often had significant roles in the projects. In Model 3, students worked with key stakeholders to develop a project and conduct a small test of change. They experienced most elements of an improvement cycle. Site leaders often had experience with SI and knew how to guide and support students' learning. Each model could offer systems-oriented learning opportunities provided that key elements are in place including site leaders facile in SI concepts and able to guide students in SOWLE activities.

Structure-based prediction of free energy changes of binding of PTP1B inhibitors

NASA Astrophysics Data System (ADS)

Wang, Jing; Ling Chan, Shek; Ramnarayan, Kal

2003-08-01

The goals were (1) to understand the driving forces in the binding of small molecule inhibitors to the active site of PTP1B and (2) to develop a molecular mechanics-based empirical free energy function for compound potency prediction. A set of compounds with known activities was docked onto the active site. The related energy components and molecular surface areas were calculated. The bridging water molecules were identified and their contributions were considered. Linear relationships were explored between the above terms and the binding free energies of compounds derived based on experimental inhibition constants. We found that minimally three terms are required to give rise to a good correlation (0.86) with predictive power in five-group cross-validation test (q2 = 0.70). The dominant terms are the electrostatic energy and non-electrostatic energy stemming from the intra- and intermolecular interactions of solutes and from those of bridging water molecules in complexes.

Introducing practice-based learning and improvement ACGME core competencies into a family medicine residency curriculum.

PubMed

Coleman, Mary Thoesen; Nasraty, Soraya; Ostapchuk, Michael; Wheeler, Stephen; Looney, Stephen; Rhodes, Sandra

2003-05-01

The Accreditation Council for Graduate Medical Education (ACGME) recommends integrating improvement activities into residency training. A curricular change was designed at the Department of Family and Community Medicine, University of Louisville, to address selected ACGME competencies by incorporating practice-based improvement activities into the routine clinical work of family medicine residents. Teams of residents, faculty, and office staff completed clinical improvement projects at three ambulatory care training sites. Residents were given academic credit for participation in team meetings. After 6 months, residents presented results to faculty, medical students, other residents, and staff from all three training sites. Residents, staff, and faculty were recognized for their participation. Resident teams demonstrated ACGME competencies in practice-based improvement: Chart audits indicated improvement in clinical projects; quality improvement tools demonstrated analysis of root causes and understanding of the process; plan-do-study-act cycle worksheets demonstrated the change process. Improvement activities that affect patient care and demonstrate selected ACGME competencies can be successfully incorporated into the daily work of family medicine residents.

Evaluation of a community-based, family focused healthy weights initiative using the RE-AIM framework.

PubMed

Jung, Mary E; Bourne, Jessica E; Gainforth, Heather L

2018-01-26

Childhood overweight and obesity is a major public health concern. Community-based interventions have the potential to reach caregivers and children. However, the overall health impact of these programs is rarely comprehensively assessed. This study evaluated a physical activity and healthy eating family program (Healthy Together; HT) using the RE-AIM framework. Ten sites implemented the 5-week program. Thirty-nine staff members and 277 program participants (126 caregivers [M age  = 35.6] and 151 children [M age  = 13]) participated in the evaluation. Each RE-AIM dimension was assessed independently using a mixed-methods approach. Sources of data included archival records, interviews and surveys. Effectiveness outcome variables were assessed at pre- and post-intervention and 6-month follow-up. Reach: HT participants were almost entirely recruited from existing programs within sites. Effectiveness: Caregivers' nutrition related efficacy beliefs increased following HT (ps < .03). Participation in HT was not associated with significant changes in physical activity or nutrition behaviour or perceived social support (ps > .05). Knowledge surrounding healthy diets and physical activity increased in children and caregivers (ps < .05). Adoption: Thirty-five percent of sites approached to implement HT expressed interest. The 10 sites selected recruited existing staff members to implement HT. Program objectives were met 72.8% of the time and 71 adaptations were made. HT was finance- and time-dependent. Maintenance: Two sites fully implemented HT in the follow-up year and 5 sites incorporated aspects of HT into other programs. Working alongside organizations that develop community programs to conduct comprehensive, arms-length evaluations can systematically highlight areas of success and challenges. Overall HT represents a feasible community-based intervention; however further support is required in order to ensure the program is effective at positively targeting the desired outcomes. As a result of this evaluation, modifications are currently being implemented to HT.

Implementation of Policy, Systems, and Environmental Community-Based Interventions for Cardiovascular Health Through a National Not-for-Profit: A Multiple Case Study.

PubMed

Garney, Whitney R; Szucs, Leigh E; Primm, Kristin; King Hahn, Laura; Garcia, Kristen M; Martin, Emily; McLeroy, Kenneth

2018-05-01

In 2014, the Centers for Disease Control and Prevention funded the American Heart Association to implement policy, systems, and environment-focused strategies targeting access to healthy food and beverages, physical activity, and smoke-free environments. To understand factors affecting implementation and variations in success across sites, evaluators conducted a multiple case study. Based on past literature, community sites were categorized as capacity-building or implementation-ready, for comparison. A sample of six communities were selected using a systematic selection tool. Through site visits, evaluators conducted interviews with program staff and community partners and assessed action plans. Evaluators identified important implications for nationally coordinated community-based prevention programming. Differences in implementation varied by the communities' readiness, with the most notable differences in how they planned activities and defined success. Existing partner relationships (or lack thereof) played a significant role, regardless of the American Heart Association's existing presence within the communities, in the progression of initiatives and the differences observed among phases. Last, goals in capacity-building sites were tied to organizational goals while goals in implementation-ready sites were more incremental with increased community influence and buy-in. Using national organizations as a mechanism to carry out large-scale community-based prevention work is a viable option that provides coordinated, wide-scale implementation without sacrificing a community's priorities or input. In funding future initiatives, the presence of relationships and the time needed to cultivate such relationships should be accounted for in the planning and implementation processes, as well as both local and national expectations.

Structure of a Clostridium botulinum C143S thiaminase I/thiamin complex reveals active site architecture .

PubMed

Sikowitz, Megan D; Shome, Brateen; Zhang, Yang; Begley, Tadhg P; Ealick, Steven E

2013-11-05

Thiaminases are responsible for the degradation of thiamin and its metabolites. Two classes of thiaminases have been identified based on their three-dimensional structures and their requirements for a nucleophilic second substrate. Although the reactions of several thiaminases have been characterized, the physiological role of thiamin degradation is not fully understood. We have determined the three-dimensional X-ray structure of an inactive C143S mutant of Clostridium botulinum (Cb) thiaminase I with bound thiamin at 2.2 Å resolution. The C143S/thiamin complex provides atomic level details of the orientation of thiamin upon binding to Cb-thiaminase I and the identity of active site residues involved in substrate binding and catalysis. The specific roles of active site residues were probed by using site directed mutagenesis and kinetic analyses, leading to a detailed mechanism for Cb-thiaminase I. The structure of Cb-thiaminase I is also compared to the functionally similar but structurally distinct thiaminase II.

Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

PubMed Central

Suh, E R; Waring, R B

1990-01-01

It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

Prioritizing conservation activities using reserve site selection methods and population viability analysis.

PubMed

Newbold, Stephen C; Siikamäki, Juha

2009-10-01

In recent years a large literature on reserve site selection (RSS) has developed at the interface between ecology, operations research, and environmental economics. Reserve site selection models use numerical optimization techniques to select sites for a network of nature reserves for protecting biodiversity. In this paper, we develop a population viability analysis (PVA) model for salmon and incorporate it into an RSS framework for prioritizing conservation activities in upstream watersheds. We use spawner return data for three closely related salmon stocks in the upper Columbia River basin and estimates of the economic costs of watershed protection from NOAA to illustrate the framework. We compare the relative cost-effectiveness of five alternative watershed prioritization methods, based on various combinations of biological and economic information. Prioritization based on biological benefit-economic cost comparisons and accounting for spatial interdependencies among watersheds substantially outperforms other more heuristic methods. When using this best-performing prioritization method, spending 10% of the cost of protecting all upstream watersheds yields 79% of the biological benefits (increase in stock persistence) from protecting all watersheds, compared to between 20% and 64% for the alternative methods. We also find that prioritization based on either costs or benefits alone can lead to severe reductions in cost-effectiveness.

Stereospecific suppression of active site mutants by methylphosphonate substituted substrates reveals the stereochemical course of site-specific DNA recombination

PubMed Central

Rowley, Paul A.; Kachroo, Aashiq H.; Ma, Chien-Hui; Maciaszek, Anna D.; Guga, Piotr; Jayaram, Makkuni

2015-01-01

Tyrosine site-specific recombinases, which promote one class of biologically important phosphoryl transfer reactions in DNA, exemplify active site mechanisms for stabilizing the phosphate transition state. A highly conserved arginine duo (Arg-I; Arg-II) of the recombinase active site plays a crucial role in this function. Cre and Flp recombinase mutants lacking either arginine can be rescued by compensatory charge neutralization of the scissile phosphate via methylphosphonate (MeP) modification. The chemical chirality of MeP, in conjunction with mutant recombinases, reveals the stereochemical contributions of Arg-I and Arg-II. The SP preference of the native reaction is specified primarily by Arg-I. MeP reaction supported by Arg-II is nearly bias-free or RP-biased, depending on the Arg-I substituent. Positional conservation of the arginines does not translate into strict functional conservation. Charge reversal by glutamic acid substitution at Arg-I or Arg-II has opposite effects on Cre and Flp in MeP reactions. In Flp, the base immediately 5′ to the scissile MeP strongly influences the choice between the catalytic tyrosine and water as the nucleophile for strand scission, thus between productive recombination and futile hydrolysis. The recombinase active site embodies the evolutionary optimization of interactions that not only favor the normal reaction but also proscribe antithetical side reactions. PMID:25999343

Identification and characterization of the sodium-binding site of activated protein C.

PubMed

He, X; Rezaie, A R

1999-02-19

Activated protein C (APC) requires both Ca2+ and Na+ for its optimal catalytic function. In contrast to the Ca2+-binding sites, the Na+-binding site(s) of APC has not been identified. Based on a recent study with thrombin, the 221-225 loop is predicted to be a potential Na+-binding site in APC. The sequence of this loop is not conserved in trypsin. We engineered a Gla domainless form of protein C (GDPC) in which the 221-225 loop was replaced with the corresponding loop of trypsin. We found that activated GDPC (aGDPC) required Na+ (or other alkali cations) for its amidolytic activity with dissociation constant (Kd(app)) = 44.1 +/- 8.6 mM. In the presence of Ca2+, however, the requirement for Na+ by aGDPC was eliminated, and Na+ stimulated the cleavage rate 5-6-fold with Kd(app) = 2.3 +/- 0.3 mM. Both cations were required for efficient factor Va inactivation by aGDPC. In the presence of Ca2+, the catalytic function of the mutant was independent of Na+. Unlike aGDPC, the mutant did not discriminate among monovalent cations. We conclude that the 221-225 loop is a Na+-binding site in APC and that an allosteric link between the Na+ and Ca2+ binding loops modulates the structure and function of this anticoagulant enzyme.

Modeling study on the cleavage step of the self-splicing reaction in group I introns

NASA Technical Reports Server (NTRS)

Setlik, R. F.; Garduno-Juarez, R.; Manchester, J. I.; Shibata, M.; Ornstein, R. L.; Rein, R.

1993-01-01

A three-dimensional model of the Tetrahymena thermophila group I intron is used to further explore the catalytic mechanism of the transphosphorylation reaction of the cleavage step. Based on the coordinates of the catalytic core model proposed by Michel and Westhof (Michel, F., Westhof, E. J. Mol. Biol. 216, 585-610 (1990)), we first converted their ligation step model into a model of the cleavage step by the substitution of several bases and the removal of helix P9. Next, an attempt to place a trigonal bipyramidal transition state model in the active site revealed that this modified model for the cleavage step could not accommodate the transition state due to insufficient space. A lowering of P1 helix relative to surrounding helices provided the additional space required. Simultaneously, it provided a better starting geometry to model the molecular contacts proposed by Pyle et al. (Pyle, A. M., Murphy, F. L., Cech, T. R. Nature 358, 123-128. (1992)), based on mutational studies involving the J8/7 segment. Two hydrated Mg2+ complexes were placed in the active site of the ribozyme model, using the crystal structure of the functionally similar Klenow fragment (Beese, L.S., Steitz, T.A. EMBO J. 10, 25-33 (1991)) as a guide. The presence of two metal ions in the active site of the intron differs from previous models, which incorporate one metal ion in the catalytic site to fulfill the postulated roles of Mg2+ in catalysis. The reaction profile is simulated based on a trigonal bipyramidal transition state, and the role of the hydrated Mg2+ complexes in catalysis is further explored using molecular orbital calculations.

Modelling of the acid-base properties of natural and synthetic adsorbent materials used for heavy metal removal from aqueous solutions.

PubMed

Pagnanelli, Francesca; Vegliò, Francesco; Toro, Luigi

2004-02-01

In this paper a comparison about kinetic behaviour, acid-base properties and copper removal capacities was carried out between two different adsorbent materials used for heavy metal removal from aqueous solutions: an aminodiacetic chelating resin as commercial product (Lewatit TP207) and a lyophilised bacterial biomass of Sphaerotilus natans. The acid-base properties of a S. natans cell suspension were well described by simplified mechanistic models without electrostatic corrections considering two kinds of weakly acidic active sites. In particular the introduction of two-peak distribution function for the proton affinity constants allows a better representation of the experimental data reproducing the site heterogeneity. A priori knowledge about resin functional groups (aminodiacetic groups) is the base for preliminary simulations of titration curve assuming a Donnan gel structure for the resin phase considered as a concentrated aqueous solution of aminodiacetic acid (ADA). Departures from experimental and simulated data can be interpreted by considering the heterogeneity of the functional groups and the effect of ionic concentration in the resin phase. Two-site continuous model describes adequately the experimental data. Moreover the values of apparent protonation constants (as adjustable parameters found by non-linear regression) are very near to the apparent constants evaluated by a Donnan model assuming the intrinsic constants in resin phase equal to the equilibrium constants in aqueous solution of ADA and considering the amphoteric nature of active sites for the evaluation of counter-ion concentration in the resin phase. Copper removal outlined the strong affinity of the active groups of the resin for this ion in solution compared to the S. natans biomass according to the complexation constants between aminodiacetic and mono-carboxylic groups and copper ions.

Encountering a bait is necessary but insufficient to explain individual variability in vulnerability to angling in two freshwater benthivorous fish in the wild

PubMed Central

Monk, Christopher Thomas; Arlinghaus, Robert

2017-01-01

Fish personality traits, such as swimming activity, or personality related emergent behavioural properties, such as the degree of space use shown by an individual fish, should affect encounter rates between individual fish and fishing gear. Increased encounters should in turn drive vulnerability to capture by passively operated gears. However, empirical evidence documenting a relationship between activity-based behaviours and vulnerability to capture by passive fishing gear in the wild is limited. Using whole-lake acoustic telemetry, we first documented significant repeatabilities over several months in a suite of encounter rate-associated behaviours (swimming distance, activity space size, time on baited feeding sites, switching frequency among baited feeding sites, distance to the lake bottom) in two recreationally important benthivorous cyprinid species, the common carp (Cyprinus carpio) and tench (Tinca tinca). We then experimentally targeted both species using stationary angling on baited feeding sites. Individual fish regularly visited the angling sites, documenting that the fishes encountered the angling baits. When attempting to explain individual variation in vulnerability as a function of repeatable behavioural traits, we found no evidence of a significant relationship among various encounter-based behaviours and vulnerability to angling for both species. There was also no evidence for size selection or for energetically less conditioned fish to be more vulnerable. The data cumulatively suggest that fine-scale behaviours after encountering a bait (e.g., frequency of bait intake) may be ultimately decisive for determining vulnerability to angling in benthivorous fish. Based on our work, fishing-induced selection on encounter-based behaviours in recreational angling for benthivorous fish in the wild appears unlikely. PMID:28301558

The influence of calcination temperatures on the acid-based properties and catalytic activity for the 1,3-butadiene synthesis from ethanol/acetaldehyde mixture

NASA Astrophysics Data System (ADS)

Gao, Meixiang; Jiang, Haoxi; Zhang, Minhua

2018-05-01

The influences of the calcination temperature on the catalysts' acid-based properties and catalytic activity for the 1,3-butadiene synthesis from ethanol are investigated. The results show that the 2 wt% ZrO2/Nano-SiO2 calcined at 773 K shows the best performance with the selectivity of 93.18% and conversion of 58.52% when reacted at 593 K, a WHSV of 1.8 h-1 and 3.5:1 volume ratio ethanol-to-acetaldehyde in an atmospheric fixed-bed reactor. Prepared catalysts were characterized by N2 adsorption-desorption, XRD, temperature-programmed desorption of NH3 and CO2, FTIR spectroscopy of adsorbed pyridine and CO2. Based on the relationship between the catalyst activity and its properties, the fact can be presumed that the formation and strength of Zrsbnd Osbnd Si bond determines the acid-based properties of the catalyst. In addition, moderate-intensity weak acid-basic sites are more suitable for ethanol conversion to BD with the amount of acid and basic sites as close as possible.

3D Pharmacophore-Based Virtual Screening and Docking Approaches toward the Discovery of Novel HPPD Inhibitors.

PubMed

Fu, Ying; Sun, Yi-Na; Yi, Ke-Han; Li, Ming-Qiang; Cao, Hai-Feng; Li, Jia-Zhong; Ye, Fei

2017-06-09

p -Hydroxyphenylpyruvate dioxygenase (HPPD) is not only the useful molecular target in treating life-threatening tyrosinemia type I, but also an important target for chemical herbicides. A combined in silico structure-based pharmacophore and molecular docking-based virtual screening were performed to identify novel potential HPPD inhibitors. The complex-based pharmacophore model (CBP) with 0.721 of ROC used for screening compounds showed remarkable ability to retrieve known active ligands from among decoy molecules. The ChemDiv database was screened using CBP-Hypo2 as a 3D query, and the best-fit hits subjected to molecular docking with two methods of LibDock and CDOCKER in Accelrys Discovery Studio 2.5 (DS 2.5) to discern interactions with key residues at the active site of HPPD. Four compounds with top rankings in the HipHop model and well-known binding model were finally chosen as lead compounds with potential inhibitory effects on the active site of target. The results provided powerful insight into the development of novel HPPD inhibitors herbicides using computational techniques.

Implementing a Nutrition and Physical Activity Curriculum in Head Start Through an Academic-Community Partnership.

PubMed

Zahnd, Whitney E; Smith, Tracey; Ryherd, Susan J; Cleer, Melissa; Rogers, Valerie; Steward, David E

2017-06-01

Schools may be an effective avenue for interventions that prevent childhood obesity. I am Moving I am Learning/Choosy Kids © (IMIL/CK) is a curriculum recommended by Head Start (HS) for education in nutrition, physical activity, and healthy lifestyle habits. We formed an academic-community partnership (ACP), the Springfield Collaborative for Active Child Health, to promote prevention of childhood obesity, in part, to implement the IMIL/CK curriculum in local HS sites. The ACP included a medical school, HS program, public school district, and state health department. Community-based participatory research principles helped identify and organize important implementation activities: community engagement, curriculum support, professional teacher training, and evaluation. IMIL/CK was piloted in 1 school then implemented in all local HS sites. All sites were engaged in IMIL/CK professional teacher training, classroom curriculum delivery, and child physical activity assessments. Local HS policy changed to include IMIL/CK in lesson plans and additional avenues of collaboration were initiated. Furthermore, improvements in physical activity and/or maintenance or improvement of healthy weight prevalence was seen in 4 of the 5 years evaluated. An ACP is an effective vehicle to implement and evaluate childhood obesity prevention programming in HS sites. © 2017, American School Health Association.

Theoretical Investigations into Defected Graphene for Electrochemical Reduction of CO 2

DOE PAGES

Siahrostami, Samira; Jiang, Kun; Karamad, Mohammadreza; ...

2017-10-10

Here, despite numerous experimental efforts that have been dedicated to studying carbon-based materials for electrochemical reduction of CO 2, a rationalization of the associated trends in the intrinsic activity of different active motifs has so far been elusive. In the present work, we employ density functional theory calculations to examine a variety of different active sites in N-doped graphene to give a comprehensive outline of the trends in activity. We find that adsorption energies of COOH* and CO* do not follow the linear scaling relationships observed for the pure transition metals, and this unique scaling is rationalized through differences inmore » electronic structure between transition metals and defected graphene. This finding rationalizes most of the experimental observations on the carbon-based materials which present promising catalysts for the two-electron reduction of CO 2 to CO. With this simple thermodynamic analysis, we identify several active sites that are expected to exhibit a comparable or even better activity to the state-of-the-art gold catalyst, and several configurations are suggested to be selective for CO 2RR over HER.« less

Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

PubMed

Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

2010-04-01

Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

PubMed Central

Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

2010-01-01

Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

Nursing students' perception of a Web-based intervention to support learning.

PubMed

Koch, Jane; Andrew, Sharon; Salamonson, Yenna; Everett, Bronwyn; Davidson, Patricia M

2010-08-01

Tailoring information to the needs of the learner is an important strategy in contemporary education settings. Web-based learning support, informed by multimedia theory, comprising interactive quizzes, glossaries with audio, short narrated Power Point(R) presentations, animations and digitised video clips were introduced in a first year Bachelor of Nursing biological sciences subject at a university in metropolitan Sydney. All students enrolled in this unit were invited to obtain access to the site and the number of hits to the site was recorded using the student tracking facility available on WebCT, an online course delivery tool adopted widely by many educational institutions and used in this study. Eighty-five percent of students enrolled in the subject accessed the learning support site. Students' perception of the value of a learning support site was assessed using a web-based survey. The survey was completed by 123 participants, representing a response rate of 22%. Three themes emerged from the qualitative data concerning nursing students' perception of the web-based activities: 'enhances my learning', 'study at my own pace', and 'about the activities: what I really liked/disliked'. Web-based interventions, supplementing a traditionally presented nursing science course were perceived by students to be beneficial in both learning and language development. Although students value interactive, multimedia learning they were not ready to completely abandon traditional modes of learning including face-to-face lectures. The findings of this study contribute to an understanding of how web-based resources can be best used to support students' learning in bioscience. Copyright 2009 Elsevier Ltd. All rights reserved.

Ground-motion site effects from multimethod shear-wave velocity characterization at 16 seismograph stations deployed for aftershocks of the August 2011 Mineral, Virginia earthquake

USGS Publications Warehouse

Stephenson, William J.; Odum, Jackson K.; McNamara, Daniel E.; Williams, Robert A.; Angster, Stephen J

2014-01-01

We characterize shear-wave velocity versus depth (Vs profile) at 16 portable seismograph sites through the epicentral region of the 2011 Mw 5.8 Mineral (Virginia, USA) earthquake to investigate ground-motion site effects in the area. We used a multimethod acquisition and analysis approach, where active-source horizontal shear (SH) wave reflection and refraction as well as active-source multichannel analysis of surface waves (MASW) and passive-source refraction microtremor (ReMi) Rayleigh wave dispersion were interpreted separately. The time-averaged shear-wave velocity to a depth of 30 m (Vs30), interpreted bedrock depth, and site resonant frequency were estimated from the best-fit Vs profile of each method at each location for analysis. Using the median Vs30 value (270–715 m/s) as representative of a given site, we estimate that all 16 sites are National Earthquake Hazards Reduction Program (NEHRP) site class C or D. Based on a comparison of simplified mapped surface geology to median Vs30 at our sites, we do not see clear evidence for using surface geologic units as a proxy for Vs30 in the epicentral region, although this may primarily be because the units are similar in age (Paleozoic) and may have similar bulk seismic properties. We compare resonant frequencies calculated from ambient noise horizontal:vertical spectral ratios (HVSR) at available sites to predicted site frequencies (generally between 1.9 and 7.6 Hz) derived from the median bedrock depth and average Vs to bedrock. Robust linear regression of HVSR to both site frequency and Vs30 demonstrate moderate correlation to each, and thus both appear to be generally representative of site response in this region. Based on Kendall tau rank correlation testing, we find that Vs30 and the site frequency calculated from average Vs to median interpreted bedrock depth can both be considered reliable predictors of weak-motion site effects in the epicentral region.

The Role of Sodium in Tuning Product Distribution in Syngas Conversion by Rh Catalysts

DOE PAGES

Yang, Nuoya; Liu, Xinyan; Asundi, Arun S.; ...

2017-10-23

Alkali metal oxides commonly exist as impurities or promoters in syngas conversion catalysts and can significantly influence the activity and selectivity towards higher oxygenate products. In this study, we investigate the effects of sodium oxide on silica-supported Rh catalysts by experimentally introducing different amounts of sodium and monitoring the change in reactivity and CO adsorption behavior. The experimental results combined with density functional theory (DFT) calculations show that sodium selectively blocks step/defect sites on Rh surfaces, leading to reduced activity but higher C 2 oxygenate selectivity. DFT calculations also suggest that sodium present on Rh terrace sites can facilitate COmore » dissociation, potentially increasing C 2 oxygenate production. The overall activity and selectivity toward various products can be changed significantly based on the degree of site blocking by the added sodium.« less

The Role of Sodium in Tuning Product Distribution in Syngas Conversion by Rh Catalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Nuoya; Liu, Xinyan; Asundi, Arun S.

Alkali metal oxides commonly exist as impurities or promoters in syngas conversion catalysts and can significantly influence the activity and selectivity towards higher oxygenate products. In this study, we investigate the effects of sodium oxide on silica-supported Rh catalysts by experimentally introducing different amounts of sodium and monitoring the change in reactivity and CO adsorption behavior. The experimental results combined with density functional theory (DFT) calculations show that sodium selectively blocks step/defect sites on Rh surfaces, leading to reduced activity but higher C 2 oxygenate selectivity. DFT calculations also suggest that sodium present on Rh terrace sites can facilitate COmore » dissociation, potentially increasing C 2 oxygenate production. The overall activity and selectivity toward various products can be changed significantly based on the degree of site blocking by the added sodium.« less

The fish gill: site of action and model for toxic effects of environmental pollutants.

PubMed Central

Evans, D H

1987-01-01

The gill epithelium is the site of gas exchange, ionic regulation, acid-base balance, and nitrogenous waste excretion by fishes. The last three processes are controlled by passive and active transport of various solutes across the epithelium. Various environmental pollutants (e.g., heavy metals, acid rain, and organic xenobiotics) have been found to affect the morphology of the gill epithelium. Associated with these morphological pathologies, one finds alterations in blood ionic levels, as well as gill Na,K-activated ATPase activity and ionic fluxes. Such physiological disturbances may underly the toxicities of these pollutants. In addition, the epithelial transport steps which are affected in the fish gill model resemble those described in the human gut and kidney, sites of action of a variety of environmental toxins. Images FIGURE 1. a FIGURE 1. b FIGURE 3. PMID:3297663

Corrective Action Decision Document/Closure Report for Corrective Action Unit 105: Area 2 Yucca Flat Atmospheric Test Sites, Nevada National Security Site, Nevada, Revision 0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matthews, Patrick

2013-09-01

This Corrective Action Decision Document/Closure Report presents information supporting the closure of Corrective Action Unit (CAU) 105: Area 2 Yucca Flat Atmospheric Test Sites, Nevada National Security Site, Nevada. CAU 105 comprises the following five corrective action sites (CASs): -02-23-04 Atmospheric Test Site - Whitney Closure In Place -02-23-05 Atmospheric Test Site T-2A Closure In Place -02-23-06 Atmospheric Test Site T-2B Clean Closure -02-23-08 Atmospheric Test Site T-2 Closure In Place -02-23-09 Atmospheric Test Site - Turk Closure In Place The purpose of this Corrective Action Decision Document/Closure Report is to provide justification and documentation supporting the recommendation that nomore » further corrective action is needed for CAU 105 based on the implementation of the corrective actions. Corrective action investigation (CAI) activities were performed from October 22, 2012, through May 23, 2013, as set forth in the Corrective Action Investigation Plan for Corrective Action Unit 105: Area 2 Yucca Flat Atmospheric Test Sites; and in accordance with the Soils Activity Quality Assurance Plan, which establishes requirements, technical planning, and general quality practices.« less

Comparison of ground and satellite based measurements of the fraction of photosynthetically active radiation intercepted by tall-grass prairie

NASA Technical Reports Server (NTRS)

Demetriades-Shah, T. H.; Kanemasu, E. T.; Flitcroft, I.; Su, H.

1990-01-01

The fraction, of photosynthetically active radiation absorbed by vegetation, F sub ipar, is an important requirement for estimating vegetation biomass productivity and related quantities. This was an integral part of a large international effort; the First ISLSCP Field Experiment (FIFE). The main objective of FIFE was to study the effects of vegetation on the land atmosphere interactions and to determine if these interactions can be assessed from satellite spectral measurements. The specific purpose of this experiment was to find out how well measurements of F sub ipar relate to ground, helicopter, and satellite based spectral reflectance measurements. Concurrent measurements of F sub ipar and ground, helicopter, and satellite based measurements were taken at 13 tall grass prairie sites in Kansas. The sites were subjected to various combinations of burning and grazing managements.

Crystal structures of yellowtail ascites virus VP4 protease: trapping an internal cleavage site trans acyl-enzyme complex in a native Ser/Lys dyad active site.

PubMed

Chung, Ivy Yeuk Wah; Paetzel, Mark

2013-05-03

Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala(716)) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser(633) as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water.

Language Mapping with Navigated Repetitive TMS: Proof of Technique and Validation

PubMed Central

Tarapore, Phiroz E.; Findlay, Anne M.; Honma, Susanne M.; Mizuiri, Danielle; Houde, John F.; Berger, Mitchel S.; Nagarajan, Srikantan S.

2013-01-01

Objective Lesion-based mapping of speech pathways has been possible only during invasive neurosurgical procedures using direct cortical stimulation (DCS). However, navigated transcranial magnetic stimulation (nTMS) may allow for lesion-based interrogation of language pathways noninvasively. Although not lesion-based, magnetoencephalographic imaging (MEGI) is another noninvasive modality for language mapping. In this study, we compare the accuracy of nTMS and MEGI with DCS. Methods Subjects with lesions around cortical language areas underwent preoperative nTMS and MEGI for language mapping. nTMS maps were generated using a repetitive TMS protocol to deliver trains of stimulations during a picture naming task. MEGI activation maps were derived from adaptive spatial filtering of beta-band power decreases prior to overt speech during picture naming and verb generation tasks. The subjects subsequently underwent awake language mapping via intraoperative DCS. The language maps obtained from each of the 3 modalities were recorded and compared. Results nTMS and MEGI were performed on 12 subjects. nTMS yielded 21 positive language disruption sites (11 speech arrest, 5 anomia, and 5 other) while DCS yielded 10 positive sites (2 speech arrest, 5 anomia, and 3 other). MEGI isolated 32 sites of peak activation with language tasks. Positive language sites were most commonly found in the pars opercularis for all three modalities. In 9 instances the positive DCS site corresponded to a positive nTMS site, while in 1 instance it did not. In 4 instances, a positive nTMS site corresponded to a negative DCS site, while 169 instances of negative nTMS and DCS were recorded. The sensitivity of nTMS was therefore 90%, specificity was 98%, the positive predictive value was 69% and the negative predictive value was 99% as compared with intraoperative DCS. MEGI language sites for verb generation and object naming correlated with nTMS sites in 5 subjects, and with DCS sites in 2 subjects. Conclusion Maps of language function generated with nTMS correlate well with those generated by DCS. Negative nTMS mapping also correlates with negative DCS mapping. In our study, MEGI lacks the same level of correlation with intraoperative mapping; nevertheless it provides useful adjunct information in some cases. nTMS may offer a lesion-based method for noninvasively interrogating language pathways and be valuable in managing patients with peri-eloquent lesions. PMID:23702420

Crystal structures of potent thiol-based inhibitors bound to carboxypeptidase B.

PubMed

Adler, Marc; Bryant, Judi; Buckman, Brad; Islam, Imadul; Larsen, Brent; Finster, Silke; Kent, Lorraine; May, Karen; Mohan, Raju; Yuan, Shendong; Whitlow, Marc

2005-07-05

This paper presents the crystal structure of porcine pancreatic carboxypeptidase B (pp-CpB) in complex with a variety of thiol-based inhibitors that were developed as antagonists of activated thrombin-activatable fibrinolysis inhibitor (TAFIa). Recent studies have indicated that a selective inhibitor of TAFIa could enhance the efficacy of existing thrombolytic agents for the treatment of acute myocardial infarction, one of the most prevalent forms of heart attacks. Unfortunately, activated TAFIa rapidly degrades in solution and cannot be used for crystallographic studies. In contrast, porcine pancreatic CpB is stable at room temperature and is available from commercial sources. Both pancreatic CpB and TAFIa are zinc-based exopeptidases, and the proteins share a 47% sequence identity. The homology improves considerably in the active site where nearly all of the residues are conserved. The inhibitors used in this study were designed to mimic a C-terminal arginine residue, one of the natural substrates of TAFIa. The X-ray structures show that the thiol group chelates the active site zinc, the carboxylic acid forms a salt bridge to Arg145, and the guanidine group forms two hydrogen bonds to Asp255. A meta-substituted phenyl was introduced into our inhibitors to reduce conformational freedom. This modification vastly improved the selectivity of compounds against other exopeptidases that cleave basic residues. Comparisons between structures indicate that selectivity derives from the interaction between the guanidine group in the inhibitors and an acidic active site residue. The location of this acidic residue is not conserved in the various carboxypeptidases.

Crystal Structure of the Dithiol Oxidase DsbA Enzyme from Proteus Mirabilis Bound Non-covalently to an Active Site Peptide Ligand

PubMed Central

Kurth, Fabian; Duprez, Wilko; Premkumar, Lakshmanane; Schembri, Mark A.; Fairlie, David P.; Martin, Jennifer L.

2014-01-01

The disulfide bond forming DsbA enzymes and their DsbB interaction partners are attractive targets for development of antivirulence drugs because both are essential for virulence factor assembly in Gram-negative pathogens. Here we characterize PmDsbA from Proteus mirabilis, a bacterial pathogen increasingly associated with multidrug resistance. PmDsbA exhibits the characteristic properties of a DsbA, including an oxidizing potential, destabilizing disulfide, acidic active site cysteine, and dithiol oxidase catalytic activity. We evaluated a peptide, PWATCDS, derived from the partner protein DsbB and showed by thermal shift and isothermal titration calorimetry that it binds to PmDsbA. The crystal structures of PmDsbA, and the active site variant PmDsbAC30S were determined to high resolution. Analysis of these structures allows categorization of PmDsbA into the DsbA class exemplified by the archetypal Escherichia coli DsbA enzyme. We also present a crystal structure of PmDsbAC30S in complex with the peptide PWATCDS. The structure shows that the peptide binds non-covalently to the active site CXXC motif, the cis-Pro loop, and the hydrophobic groove adjacent to the active site of the enzyme. This high-resolution structural data provides a critical advance for future structure-based design of non-covalent peptidomimetic inhibitors. Such inhibitors would represent an entirely new antibacterial class that work by switching off the DSB virulence assembly machinery. PMID:24831013

Unveiling N-protonation and anion-binding effects on Fe/N/C-catalysts for O2 reduction in PEM fuel cells

PubMed Central

Herranz, Juan; Jaouen, Frédéric; Lefèvre, Michel; Kramm, Ulrike I.; Proietti, Eric; Dodelet, Jean-Pol; Bogdanoff, Peter; Fiechter, Sebastian; Abs-Wurmbach, Irmgard; Bertrand, Patrick; Arruda, Thomas M.; Mukerjee, Sanjeev

2013-01-01

The high cost of proton-exchange-membrane fuel cells would be considerably reduced if platinumbased catalysts were replaced by iron-based substitutes, which have recently demonstrated comparable activity for oxygen reduction, but whose cause of activity decay in acidic medium has been elusive. Here, we reveal that the activity of Fe/N/C-catalysts prepared through a pyrolysis in NH3 is mostly imparted by acid-resistant FeN4-sites whose turnover frequency for the O2 reduction can be regulated by fine chemical changes of the catalyst surface. We show that surface N-groups protonate at pH 1 and subsequently bind anions. This results in decreased activity for the O2 reduction. The anions can be removed chemically or thermally, which restores the activity of acid-resistant FeN4-sites. These results are interpreted as an increased turnover frequency of FeN4-sites when specific surface N-groups protonate. These unprecedented findings provide new perspective for stabilizing the most active Fe/N/C-catalysts known to date. PMID:24179561

Unveiling N-protonation and anion-binding effects on Fe/N/C-catalysts for O2 reduction in PEM fuel cells.

PubMed

Herranz, Juan; Jaouen, Frédéric; Lefèvre, Michel; Kramm, Ulrike I; Proietti, Eric; Dodelet, Jean-Pol; Bogdanoff, Peter; Fiechter, Sebastian; Abs-Wurmbach, Irmgard; Bertrand, Patrick; Arruda, Thomas M; Mukerjee, Sanjeev

2011-11-18

The high cost of proton-exchange-membrane fuel cells would be considerably reduced if platinumbased catalysts were replaced by iron-based substitutes, which have recently demonstrated comparable activity for oxygen reduction, but whose cause of activity decay in acidic medium has been elusive. Here, we reveal that the activity of Fe/N/C-catalysts prepared through a pyrolysis in NH 3 is mostly imparted by acid-resistant FeN 4 -sites whose turnover frequency for the O 2 reduction can be regulated by fine chemical changes of the catalyst surface. We show that surface N-groups protonate at pH 1 and subsequently bind anions. This results in decreased activity for the O 2 reduction. The anions can be removed chemically or thermally, which restores the activity of acid-resistant FeN 4 -sites. These results are interpreted as an increased turnover frequency of FeN 4 -sites when specific surface N-groups protonate. These unprecedented findings provide new perspective for stabilizing the most active Fe/N/C-catalysts known to date.

Convergent transmission of RNAi guide-target mismatch information across Argonaute internal allosteric network.

PubMed

Joseph, Thomas T; Osman, Roman

2012-01-01

In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand "seed region" have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways.

Convergent Transmission of RNAi Guide-Target Mismatch Information across Argonaute Internal Allosteric Network

PubMed Central

Joseph, Thomas T.; Osman, Roman

2012-01-01

In RNA interference, a guide strand derived from a short dsRNA such as a microRNA (miRNA) is loaded into Argonaute, the central protein in the RNA Induced Silencing Complex (RISC) that silences messenger RNAs on a sequence-specific basis. The positions of any mismatched base pairs in an miRNA determine which Argonaute subtype is used. Subsequently, the Argonaute-guide complex binds and silences complementary target mRNAs; certain Argonautes cleave the target. Mismatches between guide strand and the target mRNA decrease cleavage efficiency. Thus, loading and silencing both require that signals about the presence of a mismatched base pair are communicated from the mismatch site to effector sites. These effector sites include the active site, to prevent target cleavage; the binding groove, to modify nucleic acid binding affinity; and surface allosteric sites, to control recruitment of additional proteins to form the RISC. To examine how such signals may be propagated, we analyzed the network of internal allosteric pathways in Argonaute exhibited through correlations of residue-residue interactions. The emerging network can be described as a set of pathways emanating from the core of the protein near the active site, distributed into the bulk of the protein, and converging upon a distributed cluster of surface residues. Nucleotides in the guide strand “seed region” have a stronger relationship with the protein than other nucleotides, concordant with their importance in sequence selectivity. Finally, any of several seed region guide-target mismatches cause certain Argonaute residues to have modified correlations with the rest of the protein. This arises from the aggregation of relatively small interaction correlation changes distributed across a large subset of residues. These residues are in effector sites: the active site, binding groove, and surface, implying that direct functional consequences of guide-target mismatches are mediated through the cumulative effects of a large number of internal allosteric pathways. PMID:23028290

Potent Mechanism-Based Inactivation Of Cytochrome P450 2B4 By 9-Ethynylphenanthrene: Implications For Allosteric Modulation Of Cytochrome P450 Catalysis1

PubMed Central

Zhang, Haoming; Gay, Sean C.; Shah, Manish; Foroozesh, Maryam; Liu, Jiawang; Osawa, Yoichi; Zhang, Qinghai; Stout, C. David; Halpert, James R.; Hollenberg, Paul F.

2013-01-01

The mechanism-based inactivation of cytochrome P450 2B4 (CYP2B4) by 9-ethynylphenanthrene (9EP) has been investigated. The partition ratio and kinact are 0.2 and 0.25 min−1, respectively. Intriguingly, the inactivation exhibits sigmoidal kinetics with a Hill coefficient of 2.5 and S50 of 4.5 μM indicative of homotropic cooperativity. Enzyme inactivation led to an increase in mass of the apo-CYP2B4 by 218 Da as determined by ESI-LC/MS, consistent with covalent protein modification. The modified CYP2B4 was purified to homogeneity and its structure determined by X-ray crystallography. The structure showed that 9EP is covalently attached to the Oγ of Thr 302 via an ester bond, which is consistent with the increased mass of the protein. The presence of the bulky phenanthrenyl ring resulted in inward rotations of Phe 297 and Phe 206 leading to a compact active site. Thus, binding of another molecule of 9EP in the active site is prohibited. However, results from the quenching of 9EP fluorescence by unmodified or 9EP-modified CYP2B4 revealed at least two binding sites with distinct affinities, with the low affinity site being the catalytic site and the high affinity site on the protein periphery. Computer-aided docking and MD simulations with one or two ligands bound revealed that the high affinity site is situated at the entrance of a substrate access channel surrounded by the F’ helix, β1/β2 loop and β4 loop and functions as an allosteric site to enhance the efficiency of activation of the acetylenic group of 9EP and subsequent covalent modification of Thr 302. PMID:23276288

Surface-water-resources information for the Ho-Chunk Nation lands and vicinity, Wisconsin

USGS Publications Warehouse

Diebel, Matthew W.; Sullivan, Daniel J.

2003-01-01

Qualitative assessments indicate that agricultural activities are the main contributing factor to water quality and fish habitat problems in the studied areas. Index of Biotic Integrity ratings, based on fish data, were available for 5 sites on 3 streams. Hilsenhoff Biotic Index ratings, based on macroinvertebrate data, were available for 21 sites on 4 streams. This information will serve as baseline data and as a guide to ongoing study and management of these waters by the Ho-Chunk Nation.

Real-time monitoring of beta-d-glucuronidase activity in sediment laden streams: A comparison of prototypes.

PubMed

Stadler, Philipp; Blöschl, Günter; Vogl, Wolfgang; Koschelnik, Juri; Epp, Markus; Lackner, Maximilian; Oismüller, Markus; Kumpan, Monika; Nemeth, Lukas; Strauss, Peter; Sommer, Regina; Ryzinska-Paier, Gabriela; Farnleitner, Andreas H; Zessner, Matthias

2016-09-15

Detection of enzymatic activities has been proposed as a rapid surrogate for the culture-based microbiological pollution monitoring of water resources. This paper presents the results of tests on four fully automated prototype instruments for the on-site monitoring of beta-d-glucuronidase (GLUC) activity. The tests were performed on sediment-laden stream water in the Hydrological Open Air Laboratory (HOAL) during the period of March 2014 to March 2015. The dominant source of faecal pollution in the stream was swine manure applied to the fields within the catchment. The experiments indicated that instrument pairs with the same construction design yielded highly consistent results (R(2) = 0.96 and R(2) = 0.94), whereas the results between different designs were less consistent (R(2) = 0.71). Correlations between the GLUC activity measured on-site and culture-based Escherichia coli analyses over the entire study period yielded R(2) = 0.52 and R(2) = 0.47 for the two designs, respectively. The correlations tended to be higher at the event scale. The GLUC activity was less correlated with suspended sediment concentrations than with E. coli, which is interpreted in terms of indicator applicability and the time since manure application. The study shows that this rapid assay can yield consistent results over a long period of on-site operation in technically challenging habitats. Although the use of GLUC activity as a proxy for culture-based assays could not be proven for the observed habitat, the study results suggest that this biochemical indicator has high potential for implementation in early warning systems. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Experimental and model-based analysis of differences in perception of cutaneous electrical stimulation across the sole of the foot.

PubMed

Frahm, Ken Steffen; Mørch, Carsten Dahl; Grill, Warren M; Andersen, Ole Kæseler

2013-09-01

During electrocutaneous stimulations, variation in skin properties across locations can lead to differences in neural activation. However, little focus has been given to the effect of different skin thicknesses on neural activation. Electrical stimulation was applied to six sites across the sole of the foot. The intensities used were two and four times perception threshold. The subjects (n = 8) rated the perception quality and intensity using the McGill Pain Questionnaire and a visual analog scale (VAS). A finite element model was developed and combined with the activation function (AF) to estimate neural activation. Electrical stimulation was perceived as significantly less sharp at the heel compared to all other sites, except one site in the forefoot (logistic regression, p < 0.05). The VAS scores were significantly higher in the arch than at the heel (RM ANOVA, p < 0.05). The model showed that the AF was between 91 and 231 % higher at the five other sites than at the heel. The differences in perception across the sole of the foot indicated that the CNS received different inputs depending on the stimulus site. The lower AF at the heel indicated that the skin thicknesses could contribute to the perceived differences.

Remedial investigation and feasibility study Point Lonely Radar Installation, Alaska. Volume 1. Appendices a - c. Final report, January 1995-April 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1996-04-01

This report presents the findings of Remedial Investigations and Feasibility Studies at sites located at the Point Lonely radar installation in northern Alaska. The sites were characterized based on sampling and analyses conducted during Remedial Investigation activities performed during August and September 1993.

Community Indicators: A Framework for Observing and Supporting Community Activity on Cloudworks

ERIC Educational Resources Information Center

Galley, Rebecca; Conole, Gráinne; Alevizou, Panagiota

2014-01-01

Cloudworks (Cloudworks.ac.uk) is a social networking site designed for sharing, finding and discussing learning and teaching ideas and experiences. Design and development of the site has been based on an iterative analysis, development and implementation approach, underpinned by ongoing research and evaluation. To this end, we have been seeking to…

The Short Readings Project: A CALL Reading Activity Utilizing Vocabulary Recycling

ERIC Educational Resources Information Center

Johnson, Andrew; Heffernan, Neil

2006-01-01

In 2003 multimedia-based English Trailers (www.english-trailers.com) joined the vast array of web sites dedicated to language learning enabling students, either autonomously or in a CALL classroom, to study English via movie commercials. To assist students in comprehending 10 trailers found on the site, the authors created the Short Readings…

Crystal structures of 3-methyladenine DNA glycosylase MagIII and the recognition of alkylated bases

PubMed Central

Eichman, Brandt F.; O’Rourke, Eyleen J.; Radicella, J.Pablo; Ellenberger, Tom

2003-01-01

DNA glycosylases catalyze the excision of chemically modified bases from DNA. Although most glycosylases are specific to a particular base, the 3-methyladenine (m3A) DNA glycosylases include both highly specific enzymes acting on a single modified base, and enzymes with broader specificity for alkylation-damaged DNA. Our structural understanding of these different enzymatic specificities is currently limited to crystal and NMR structures of the unliganded enzymes and complexes with abasic DNA inhibitors. Presented here are high-resolution crystal structures of the m3A DNA glycosylase from Helicobacter pylori (MagIII) in the unliganded form and bound to alkylated bases 3,9-dimethyladenine and 1,N6-ethenoadenine. These are the first structures of a nucleobase bound in the active site of a m3A glycosylase belonging to the helix–hairpin–helix superfamily. MagIII achieves its specificity for positively-charged m3A not by direct interactions with purine or methyl substituent atoms, but rather by stacking the base between two aromatic side chains in a pocket that excludes 7-methylguanine. We report base excision and DNA binding activities of MagIII active site mutants, together with a structural comparison of the HhH glycosylases. PMID:14517230

Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

PubMed Central

Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

2003-01-01

Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

Carbinolamine Formation and Dehydration in a DNA Repair Enzyme Active Site

PubMed Central

Dodson, M. L.; Walker, Ross C.; Lloyd, R. Stephen

2012-01-01

In order to suggest detailed mechanistic hypotheses for the formation and dehydration of a key carbinolamine intermediate in the T4 pyrimidine dimer glycosylase (T4PDG) reaction, we have investigated these reactions using steered molecular dynamics with a coupled quantum mechanics–molecular mechanics potential (QM/MM). We carried out simulations of DNA abasic site carbinolamine formation with and without a water molecule restrained to remain within the active site quantum region. We recovered potentials of mean force (PMF) from thirty replicate reaction trajectories using Jarzynski averaging. We demonstrated feasible pathways involving water, as well as those independent of water participation. The water–independent enzyme–catalyzed reaction had a bias–corrected Jarzynski–average barrier height of approximately for the carbinolamine formation reaction and ) for the reverse reaction at this level of representation. When the proton transfer was facilitated with an intrinsic quantum water, the barrier height was approximately in the forward (formation) reaction and for the reverse. In addition, two modes of unsteered (free dynamics) carbinolamine dehydration were observed: in one, the quantum water participated as an intermediate proton transfer species, and in the other, the active site protonated glutamate hydrogen was directly transferred to the carbinolamine oxygen. Water–independent unforced proton transfer from the protonated active site glutamate carboxyl to the unprotonated N–terminal amine was also observed. In summary, complex proton transfer events, some involving water intermediates, were studied in QM/MM simulations of T4PDG bound to a DNA abasic site. Imine carbinolamine formation was characterized using steered QM/MM molecular dynamics. Dehydration of the carbinolamine intermediate to form the final imine product was observed in free, unsteered, QM/MM dynamics simulations, as was unforced acid-base transfer between the active site carboxylate and the N–terminal amine. PMID:22384015

Specific phospholipid binding to Na,K-ATPase at two distinct sites.

PubMed

Habeck, Michael; Kapri-Pardes, Einat; Sharon, Michal; Karlish, Steven J D

2017-03-14

Membrane protein function can be affected by the physical state of the lipid bilayer and specific lipid-protein interactions. For Na,K-ATPase, bilayer properties can modulate pump activity, and, as observed in crystal structures, several lipids are bound within the transmembrane domain. Furthermore, Na,K-ATPase activity depends on phosphatidylserine (PS) and cholesterol, which stabilize the protein, and polyunsaturated phosphatidylcholine (PC) or phosphatidylethanolamine (PE), known to stimulate Na,K-ATPase activity. Based on lipid structural specificity and kinetic mechanisms, specific interactions of both PS and PC/PE have been inferred. Nevertheless, specific binding sites have not been identified definitively. We address this question with native mass spectrometry (MS) and site-directed mutagenesis. Native MS shows directly that one molecule each of 18:0/18:1 PS and 18:0/20:4 PC can bind specifically to purified human Na,K-ATPase (α 1 β 1 ). By replacing lysine residues at proposed phospholipid-binding sites with glutamines, the two sites have been identified. Mutations in the cytoplasmic αL8-9 loop destabilize the protein but do not affect Na,K-ATPase activity, whereas mutations in transmembrane helices (TM), αTM2 and αTM4, abolish the stimulation of activity by 18:0/20:4 PC but do not affect stability. When these data are linked to crystal structures, the underlying mechanism of PS and PC/PE effects emerges. PS (and cholesterol) bind between αTM 8, 9, 10, near the FXYD subunit, and maintain topological integrity of the labile C terminus of the α subunit (site A). PC/PE binds between αTM2, 4, 6, and 9 and accelerates the rate-limiting E 1 P-E 2 P conformational transition (site B). We discuss the potential physiological implications.

Binding of the 3' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

PubMed Central

Lill, R; Robertson, J M; Wintermeyer, W

1989-01-01

A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120

Discovery of potent cytotoxic ortho-aryl chalcones as new scaffold targeting tubulin and mitosis with affinity-based fluorescence.

PubMed

Zhu, Cuige; Zuo, Yinglin; Wang, Ruimin; Liang, Baoxia; Yue, Xin; Wen, Gesi; Shang, Nana; Huang, Lei; Chen, Yu; Du, Jun; Bu, Xianzhang

2014-08-14

A series of new ortho-aryl chalcones have been designed and synthesized. Many of these compounds were found to exhibit significant antiproliferation activity toward a panel of cancer cell lines. Selected compounds show potent cytotoxicity against several drug resistant cell lines including paclitaxel (Taxol) resistant human ovarian carcinoma cells, vincristine resistant human ileocecum carcinoma cells, and doxorubicin resistant human breast carcinoma cells. Further investigation revealed that active analogues could inhibit the microtubule polymerization by binding to colchicine site and thus induce multipolar mitosis, G2/M phase arrest, and apoptosis of cancer cells. Furthermore, affinity-based fluorescence enhancement was observed during the binding of active compounds with tubulin, which greatly facilitated the determination of tubulin binding site of the compounds. Finally, selected compound 26 was found to exhibit obvious in vivo antitumor activity in A549 tumor xenografts model. Our systematic studies implied a new scaffold targeting tubulin and mitosis for novel antitumor drug discovery.

Effects of HIV-1 protease on cellular functions and their potential applications in antiretroviral therapy

PubMed Central

2012-01-01

Human Immunodeficiency Virus Type 1 (HIV-1) protease inhibitors (PIs) are the most potent class of drugs in antiretroviral therapies. However, viral drug resistance to PIs could emerge rapidly thus reducing the effectiveness of those drugs. Of note, all current FDA-approved PIs are competitive inhibitors, i.e., inhibitors that compete with substrates for the active enzymatic site. This common inhibitory approach increases the likelihood of developing drug resistant HIV-1 strains that are resistant to many or all current PIs. Hence, new PIs that move away from the current target of the active enzymatic site are needed. Specifically, allosteric inhibitors, inhibitors that prohibit PR enzymatic activities through non-competitive binding to PR, should be sought. Another common feature of current PIs is they were all developed based on the structure-based design. Drugs derived from a structure-based strategy may generate target specific and potent inhibitors. However, this type of drug design can only target one site at a time and drugs discovered by this method are often associated with strong side effects such as cellular toxicity, limiting its number of target choices, efficacy, and applicability. In contrast, a cell-based system may provide a useful alternative strategy that can overcome many of the inherited shortcomings associated with structure-based drug designs. For example, allosteric PIs can be sought using a cell-based system without considering the site or mechanism of inhibition. In addition, a cell-based system can eliminate those PIs that have strong cytotoxic effect. Most importantly, a simple, economical, and easy-to-maintained eukaryotic cellular system such as yeast will allow us to search for potential PIs in a large-scaled high throughput screening (HTS) system, thus increasing the chances of success. Based on our many years of experience in using fission yeast as a model system to study HIV-1 Vpr, we propose the use of fission yeast as a possible surrogate system to study the effects of HIV-1 protease on cellular functions and to explore its utility as a HTS system to search for new PIs to battle HIV-1 resistant strains. PMID:22971934

Intein-mediated site-specific synthesis of tumor-targeting protein delivery system: Turning PEG dilemma into prodrug-like feature

PubMed Central

Chen, Yingzhi; Zhang, Meng; Jin, Hongyue; Tang, Yisi; Wang, Huiyuan; Xu, Qin; Li, Yaping; Li, Feng; Huang, Yongzhuo

2017-01-01

Poor tumor-targeted and cytoplasmic delivery is a bottleneck for protein toxin-based cancer therapy. Ideally, a protein toxin drug should remain stealthy in circulation for prolonged half-life and reduced side toxicity, but turn activated at tumor. PEGylation is a solution to achieve the first goal, but creates a hurdle for the second because PEG rejects interaction between the drugs and tumor cells therein. Such PEG dilemma is an unsolved problem in protein delivery. Herein proposed is a concept of turning PEG dilemma into prodrug-like feature. A site-selectively PEGylated, gelatinase-triggered cell-penetrating trichosanthin protein delivery system is developed with three specific aims. The first is to develop an intein-based ligation method for achieving site-specific modification of protein toxins. The second is to develop a prodrug feature that renders protein toxins remaining stealthy in blood for reduced side toxicity and improved EPR effect. The third is to develop a gelatinase activatable cell-penetration strategy for enhanced tumor targeting and cytoplasmic delivery. Of note, site-specific modification is a big challenge in protein drug research, especially for such a complicated, multifunctional protein delivery system. We successfully develop a protocol for constructing a macromolecular prodrug system with intein-mediated ligation synthesis. With an on-column process of purification and intein-mediated cleavage, the site-specific PEGylation then can be readily achieved by conjugation with the activated C-terminus, thus constructing a PEG-capped, cell-penetrating trichosanthin system with a gelatinase-cleavable linker that enables tumor-specific activation of cytoplasmic delivery. It provides a promising method to address the PEG dilemma for enhanced protein drug delivery, and importantly, a facile protocol for site-specific modification of such a class of protein drugs for improving their druggability and industrial translation. PMID:27914267

Three-dimensional representations of salt-dome margins at four active strategic petroleum reserve sites.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rautman, Christopher Arthur; Stein, Joshua S.

2003-01-01

Existing paper-based site characterization models of salt domes at the four active U.S. Strategic Petroleum Reserve sites have been converted to digital format and visualized using modern computer software. The four sites are the Bayou Choctaw dome in Iberville Parish, Louisiana; the Big Hill dome in Jefferson County, Texas; the Bryan Mound dome in Brazoria County, Texas; and the West Hackberry dome in Cameron Parish, Louisiana. A new modeling algorithm has been developed to overcome limitations of many standard geological modeling software packages in order to deal with structurally overhanging salt margins that are typical of many salt domes. Thismore » algorithm, and the implementing computer program, make use of the existing interpretive modeling conducted manually using professional geological judgement and presented in two dimensions in the original site characterization reports as structure contour maps on the top of salt. The algorithm makes use of concepts of finite-element meshes of general engineering usage. Although the specific implementation of the algorithm described in this report and the resulting output files are tailored to the modeling and visualization software used to construct the figures contained herein, the algorithm itself is generic and other implementations and output formats are possible. The graphical visualizations of the salt domes at the four Strategic Petroleum Reserve sites are believed to be major improvements over the previously available two-dimensional representations of the domes via conventional geologic drawings (cross sections and contour maps). Additionally, the numerical mesh files produced by this modeling activity are available for import into and display by other software routines. The mesh data are not explicitly tabulated in this report; however an electronic version in simple ASCII format is included on a PC-based compact disk.« less

Single-Site Active Iron-Based Bifunctional Oxygen Catalyst for a Compressible and Rechargeable Zinc-Air Battery.

PubMed

Ma, Longtao; Chen, Shengmei; Pei, Zengxia; Huang, Yan; Liang, Guojin; Mo, Funian; Yang, Qi; Su, Jun; Gao, Yihua; Zapien, Juan Antonio; Zhi, Chunyi

2018-02-27

The exploitation of a high-efficient, low-cost, and stable non-noble-metal-based catalyst with oxygen reduction reaction (ORR) and oxygen evolution reaction (OER) simultaneously, as air electrode material for a rechargeable zinc-air battery is significantly crucial. Meanwhile, the compressible flexibility of a battery is the prerequisite of wearable or/and portable electronics. Herein, we present a strategy via single-site dispersion of an Fe-N x species on a two-dimensional (2D) highly graphitic porous nitrogen-doped carbon layer to implement superior catalytic activity toward ORR/OER (with a half-wave potential of 0.86 V for ORR and an overpotential of 390 mV at 10 mA·cm -2 for OER) in an alkaline medium. Furthermore, an elastic polyacrylamide hydrogel based electrolyte with the capability to retain great elasticity even under a highly corrosive alkaline environment is utilized to develop a solid-state compressible and rechargeable zinc-air battery. The creatively developed battery has a low charge-discharge voltage gap (0.78 V at 5 mA·cm -2 ) and large power density (118 mW·cm -2 ). It could be compressed up to 54% strain and bent up to 90° without charge/discharge performance and output power degradation. Our results reveal that single-site dispersion of catalytic active sites on a porous support for a bifunctional oxygen catalyst as cathode integrating a specially designed elastic electrolyte is a feasible strategy for fabricating efficient compressible and rechargeable zinc-air batteries, which could enlighten the design and development of other functional electronic devices.

Site safety plan for Lawrence Livermore National Laboratory CERCLA investigations at site 300. Revision 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kilmer, J.

Various Department of Energy Orders incorporate by reference, health and safety regulations promulgated by the Occupational Safety and Health Administration (OSHA). One of the OSHA regulations, 29 CFR 1910.120, Hazardous Waste Operations and Emergency Response, requires that site safety plans are written for activities such as those covered by work plans for Site 300 environmental investigations. Based upon available data, this Site Safety Plan (Plan) for environmental restoration has been prepared specifically for the Lawrence Livermore National Laboratory Site 300, located approximately 15 miles east of Livermore, California. As additional facts, monitoring data, or analytical data on hazards are provided,more » this Plan may need to be modified. It is the responsibility of the Environmental Restoration Program and Division (ERD) Site Safety Officer (SSO), with the assistance of Hazards Control, to evaluate data which may impact health and safety during these activities and to modify the Plan as appropriate. This Plan is not `cast-in-concrete.` The SSO shall have the authority, with the concurrence of Hazards Control, to institute any change to maintain health and safety protection for workers at Site 300.« less

Long-term surveillance plan for the Bodo Canyon Disposal Site, Durango, Colorado. Revision 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1995-11-01

This long-term surveillance plan (LTSP) for the Uranium Mill Tailings Remedial Act on (UMTRA) Project Bodo Canyon disposal site at Durango, Colorado, describes the surveillance activities for the disposal site. The US Department of Energy (DOE) will carry out these activities to ensure that the disposal call continues to function as designed This LTSP was prepared as a requirement for DOE acceptance under the US Nuclear Regulatory Commission (NRC) general license for custody and long-term care of residual radioactive materials (RRM) from processing uranium ore. This LTSP documents that the land and interests are owned by the United States andmore » details how long-term care of the disposal site will be carried out. It is based on the DOE`s Guidance for Implementing the UMTRA Project Long-term Surveillance Program (DOE, 1992a). Following the introduction, contents of this report include the following: site final condition; site drawings and photographs; permanent site surveillance features; ground water monitoring; annual site inspections; unscheduled inspections; custodial maintenance; corrective action; record keeping and reporting requirements; emergency notification and reporting; quality assurance; personal health and safety; list of contributions; and references.« less

Fall 1994 wildlife and vegetation survey, Norton Air Force Base, California

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The fall 1994 wildlife and vegetation surveys were completed October 3-7, 1994, at Norton Air Force Base (AFB), California. Two biologists from CDM Federal Programs, the U.S. Environmental Protection Agency (EPA) regional biologist and the Oak Ridge National Laboratory (ORNL) lead biologist conducted the surveys. A habitat assessment of three Installation Restoration Project (IRP) sites at Norton Air Force Base was also completed during the fall survey period. The IRP sites include: Landfill No. 2 (Site 2); the Industrial Wastewater Treatment Plant (IWTP) area; and Former Fire Training Area No. 1 (Site 5). The assessments were designed to qualitatively characterizemore » the sites of concern, identify potential ecological receptors, and provide information for Remedial Design/Remedial Action activities. A Reference Area (Santa Ana River Wash) and the base urban areas were also characterized. The reference area assessment was performed to provide a baseline for comparison with the IRP site habitats. The fall 1994 survey is the second of up to four surveys that may be completed. In order to develop a complete understanding of all plant and animal species using the base, these surveys were planned to be conducted over four seasons. Species composition can vary widely during the course of a year in Southern California, and therefore, seasonal surveys will provide the most complete and reliable data to address changes in habitat structure and wildlife use of the site. Subsequent surveys will focus on seasonal wildlife observations and a spring vegetation survey.« less

Thermodynamic Characterization of Hydration Sites from Integral Equation-Derived Free Energy Densities: Application to Protein Binding Sites and Ligand Series.

PubMed

Güssregen, Stefan; Matter, Hans; Hessler, Gerhard; Lionta, Evanthia; Heil, Jochen; Kast, Stefan M

2017-07-24

Water molecules play an essential role for mediating interactions between ligands and protein binding sites. Displacement of specific water molecules can favorably modulate the free energy of binding of protein-ligand complexes. Here, the nature of water interactions in protein binding sites is investigated by 3D RISM (three-dimensional reference interaction site model) integral equation theory to understand and exploit local thermodynamic features of water molecules by ranking their possible displacement in structure-based design. Unlike molecular dynamics-based approaches, 3D RISM theory allows for fast and noise-free calculations using the same detailed level of solute-solvent interaction description. Here we correlate molecular water entities instead of mere site density maxima with local contributions to the solvation free energy using novel algorithms. Distinct water molecules and hydration sites are investigated in multiple protein-ligand X-ray structures, namely streptavidin, factor Xa, and factor VIIa, based on 3D RISM-derived free energy density fields. Our approach allows the semiquantitative assessment of whether a given structural water molecule can potentially be targeted for replacement in structure-based design. Finally, PLS-based regression models from free energy density fields used within a 3D-QSAR approach (CARMa - comparative analysis of 3D RISM Maps) are shown to be able to extract relevant information for the interpretation of structure-activity relationship (SAR) trends, as demonstrated for a series of serine protease inhibitors.

Reliability of an fMRI Paradigm for Emotional Processing in a Multisite Longitudinal Study

PubMed Central

Gee, Dylan G.; McEwen, Sarah C.; Forsyth, Jennifer K.; Haut, Kristen M.; Bearden, Carrie E.; Addington, Jean; Goodyear, Bradley; Cadenhead, Kristin S.; Mirzakhanian, Heline; Cornblatt, Barbara A.; Olvet, Doreen; Mathalon, Daniel H.; McGlashan, Thomas H.; Perkins, Diana O.; Belger, Aysenil; Seidman, Larry J.; Thermenos, Heidi; Tsuang, Ming T.; van Erp, Theo G.M.; Walker, Elaine F.; Hamann, Stephan; Woods, Scott W.; Constable, Todd; Cannon, Tyrone D.

2015-01-01

Multisite neuroimaging studies can facilitate the investigation of brain-related changes in many contexts, including patient groups that are relatively rare in the general population. Though multisite studies have characterized the reliability of brain activation during working memory and motor functional magnetic resonance imaging tasks, emotion processing tasks, pertinent to many clinical populations, remain less explored. A traveling participants study was conducted with eight healthy volunteers scanned twice on consecutive days at each of the eight North American Longitudinal Prodrome Study sites. Tests derived from generalizability theory showed excellent reliability in the amygdala (Eρ2=0.82), inferior frontal gyrus (IFG;Eρ2=0.83), anterior cingulate cortex (ACC;Eρ2=0.76), insula (Eρ2=0.85), and fusiform gyrus (Eρ2=0.91) for maximum activation and fair to excellent reliability in the amygdala (Eρ2=0.44), IFG (Eρ2=0.48), ACC (Eρ2=0.55), insula (Eρ2=0.42), and fusiform gyrus (Eρ2=0.83) for mean activation across sites and test days. For the amygdala, habituation (Eρ2=0.71) was more stable than mean activation. In a second investigation, data from 111 healthy individuals across sites were aggregated in a voxelwise, quantitative meta-analysis. When compared with a mixed effects model controlling for site, both approaches identified robust activation in regions consistent with expected results based on prior single-site research. Overall, regions central to emotion processing showed strong reliability in the traveling participants study and robust activation in the aggregation study. These results support the reliability of blood oxygen level-dependent signal in emotion processing areas across different sites and scanners and may inform future efforts to increase efficiency and enhance knowledge of rare conditions in the population through multisite neuroimaging paradigms. PMID:25821147

Ab initio study of the binding of Trichostatin A (TSA) in the active site of histone deacetylase like protein (HDLP).

PubMed

Vanommeslaeghe, Kenno; Van Alsenoy, Christian; De Proft, Frank; Martins, José C; Tourwé, Dirk; Geerlings, Paul

2003-08-21

Histone deacetylase (HDAC) inhibitors have recently attracted considerable interest because of their therapeutic potential for the treatment of cell proliferative diseases. An X-ray structure of a very potent inhibitor, Trichostatin A (TSA), bound to HDLP (an HDAC analogue isolated from Aquifex aeolicus), is available. From this structure, an active site model (322 atoms), relevant for the binding of TSA and structural analogues, has been derived, and TSA has been minimized in this active site at HF 3-21G* level. The resulting conformation is in excellent accordance with the X-ray structure, and indicates a deprotonation of the hydroxamic acid in TSA by His 131. Also, a water molecule was minimized in the active site. In addition to a similar deprotonation, in accordance with a possible catalytic mechanism of HDAC as proposed by Finnin et al. (M. S. Finnin, J. R. Donigian, A. Cohen, V. M. Richon, R. A. Rifkind and P. A. Marks, Nature, 1999, 401, 188-193), a displacement of the resulting OH- ion in the active site was observed. Based on these results, the difference in energy of binding between TSA and water was calculated. The resulting value is realistic in respect to experimental binding affinities. Furthermore, the mechanism of action of the His 131-Asp 166 charge relay system was investigated. Although the Asp residue in this motif is known to substantially increase the basicity of the His residue, no proton transfer from His 131 to Asp 166 was observed on binding of TSA or water. However, in the empty protonated active site, this proton transfer does occur.

Site-Specific RNase A Activity Was Dramatically Reduced in Serum from Multiple Types of Cancer Patients

PubMed Central

Huang, Weiyan; Zhao, Mei; Wei, Na; Wang, Xiaoxia; Cao, Huqing; Du, Quan; Liang, Zicai

2014-01-01

Potent RNase activities were found in the serum of mammals but the physiological function of the RNases was never well illustrated, largely due to the caveats in methods of RNase activity measurement. None of the existing methods can distinguish between RNases with different target specificities. A systematic study was recently carried out in our lab to investigate the site-specificity of serum RNases on double-stranded RNA substrates, and found that serum RNases cleave double-stranded RNAs predominantly at 5′-U/A-3′ and 5′-C/A-3′ dinucleotide sites, in a manner closely resembling RNase A. Based on this finding, a FRET assay was developed in the current study to measure this site-specific serum RNase activity in human samples using a double stranded RNA substrate. We demonstrated that the method has a dynamic range of 10−5 mg/ml- 10−1 mg/ml using serial dilution of RNase A. The sera of 303 cancer patients were subjected to comparison with 128 healthy controls, and it was found that serum RNase activities visualized with this site-specific double stranded probe were found to be significantly reduced in patients with gastric cancer, liver cancer, pancreatic cancer, esophageal cancer, ovary cancer, cervical cancer, bladder cancer, kidney cancer and lung cancer, while only minor changes were found in breast and colon cancer patients. This is the first report using double stranded RNA as probe to quantify site-specific activities of RNase A in a serum. The results illustrated that RNase A might be further evaluated to determine if it can serve as a new class of biomarkers for certain cancer types. PMID:24805924

A machine-learning approach for predicting palmitoylation sites from integrated sequence-based features.

PubMed

Li, Liqi; Luo, Qifa; Xiao, Weidong; Li, Jinhui; Zhou, Shiwen; Li, Yongsheng; Zheng, Xiaoqi; Yang, Hua

2017-02-01

Palmitoylation is the covalent attachment of lipids to amino acid residues in proteins. As an important form of protein posttranslational modification, it increases the hydrophobicity of proteins, which contributes to the protein transportation, organelle localization, and functions, therefore plays an important role in a variety of cell biological processes. Identification of palmitoylation sites is necessary for understanding protein-protein interaction, protein stability, and activity. Since conventional experimental techniques to determine palmitoylation sites in proteins are both labor intensive and costly, a fast and accurate computational approach to predict palmitoylation sites from protein sequences is in urgent need. In this study, a support vector machine (SVM)-based method was proposed through integrating PSI-BLAST profile, physicochemical properties, [Formula: see text]-mer amino acid compositions (AACs), and [Formula: see text]-mer pseudo AACs into the principal feature vector. A recursive feature selection scheme was subsequently implemented to single out the most discriminative features. Finally, an SVM method was implemented to predict palmitoylation sites in proteins based on the optimal features. The proposed method achieved an accuracy of 99.41% and Matthews Correlation Coefficient of 0.9773 for a benchmark dataset. The result indicates the efficiency and accuracy of our method in prediction of palmitoylation sites based on protein sequences.

The effects of an invasive seaweed on native communities vary along a gradient of land-based human impacts

PubMed Central

Badalamenti, Fabio; Iveša, Ljiljana; Mikac, Barbara; Musco, Luigi; Jaklin, Andrej; Rattray, Alex; Vega Fernández, Tomás; Benedetti-Cecchi, Lisandro

2016-01-01

The difficulty in teasing apart the effects of biological invasions from those of other anthropogenic perturbations has hampered our understanding of the mechanisms underpinning the global biodiversity crisis. The recent elaboration of global-scale maps of cumulative human impacts provides a unique opportunity to assess how the impact of invaders varies among areas exposed to different anthropogenic activities. A recent meta-analysis has shown that the effects of invasive seaweeds on native biota tend to be more negative in relatively pristine than in human-impacted environments. Here, we tested this hypothesis through the experimental removal of the invasive green seaweed, Caulerpa cylindracea, from rocky reefs across the Mediterranean Sea. More specifically, we assessed which out of land-based and sea-based cumulative impact scores was a better predictor of the direction and magnitude of the effects of this seaweed on extant and recovering native assemblages. Approximately 15 months after the start of the experiment, the removal of C. cylindracea from extant assemblages enhanced the cover of canopy-forming macroalgae at relatively pristine sites. This did not, however, result in major changes in total cover or species richness of native assemblages. Preventing C. cylindracea re-invasion of cleared plots at pristine sites promoted the recovery of canopy-forming and encrusting macroalgae and hampered that of algal turfs, ultimately resulting in increased species richness. These effects weakened progressively with increasing levels of land-based human impacts and, indeed, shifted in sign at the upper end of the gradient investigated. Thus, at sites exposed to intense disturbance from land-based human activities, the removal of C. cylindracea fostered the cover of algal turfs and decreased that of encrusting algae, with no net effect on species richness. Our results suggests that competition from C. cylindracea is an important determinant of benthic assemblage diversity in pristine environments, but less so in species-poor assemblages found at sites exposed to intense disturbance from land-based human activities, where either adverse physical factors or lack of propagules may constrain the number of potential native colonizers. Implementing measures to reduce the establishment and spread of C. cylindracea in areas little impacted by land-based human activities should be considered a priority for preserving the biodiversity of Mediterranean shallow rocky reefs. PMID:27014513

The effects of an invasive seaweed on native communities vary along a gradient of land-based human impacts.

PubMed

Bulleri, Fabio; Badalamenti, Fabio; Iveša, Ljiljana; Mikac, Barbara; Musco, Luigi; Jaklin, Andrej; Rattray, Alex; Vega Fernández, Tomás; Benedetti-Cecchi, Lisandro

2016-01-01

The difficulty in teasing apart the effects of biological invasions from those of other anthropogenic perturbations has hampered our understanding of the mechanisms underpinning the global biodiversity crisis. The recent elaboration of global-scale maps of cumulative human impacts provides a unique opportunity to assess how the impact of invaders varies among areas exposed to different anthropogenic activities. A recent meta-analysis has shown that the effects of invasive seaweeds on native biota tend to be more negative in relatively pristine than in human-impacted environments. Here, we tested this hypothesis through the experimental removal of the invasive green seaweed, Caulerpa cylindracea, from rocky reefs across the Mediterranean Sea. More specifically, we assessed which out of land-based and sea-based cumulative impact scores was a better predictor of the direction and magnitude of the effects of this seaweed on extant and recovering native assemblages. Approximately 15 months after the start of the experiment, the removal of C. cylindracea from extant assemblages enhanced the cover of canopy-forming macroalgae at relatively pristine sites. This did not, however, result in major changes in total cover or species richness of native assemblages. Preventing C. cylindracea re-invasion of cleared plots at pristine sites promoted the recovery of canopy-forming and encrusting macroalgae and hampered that of algal turfs, ultimately resulting in increased species richness. These effects weakened progressively with increasing levels of land-based human impacts and, indeed, shifted in sign at the upper end of the gradient investigated. Thus, at sites exposed to intense disturbance from land-based human activities, the removal of C. cylindracea fostered the cover of algal turfs and decreased that of encrusting algae, with no net effect on species richness. Our results suggests that competition from C. cylindracea is an important determinant of benthic assemblage diversity in pristine environments, but less so in species-poor assemblages found at sites exposed to intense disturbance from land-based human activities, where either adverse physical factors or lack of propagules may constrain the number of potential native colonizers. Implementing measures to reduce the establishment and spread of C. cylindracea in areas little impacted by land-based human activities should be considered a priority for preserving the biodiversity of Mediterranean shallow rocky reefs.

Validation of a radiosonde-based cloud layer detection method against a ground-based remote sensing method at multiple ARM sites

NASA Astrophysics Data System (ADS)

Zhang, Jinqiang; Li, Zhanqing; Chen, Hongbin; Cribb, Maureen

2013-01-01

Cloud vertical structure is a key quantity in meteorological and climate studies, but it is also among the most difficult quantities to observe. In this study, we develop a long-term (10 years) radiosonde-based cloud profile product for the U.S. Department of Energy's Atmospheric Radiation Measurement (ARM) program Southern Great Plains (SGP), Tropical Western Pacific (TWP), and North Slope of Alaska (NSA) sites and a shorter-term product for the ARM Mobile Facility (AMF) deployed in Shouxian, Anhui Province, China (AMF-China). The AMF-China site was in operation from 14 May to 28 December 2008; the ARM sites have been collecting data for over 15 years. The Active Remote Sensing of Cloud (ARSCL) value-added product (VAP), which combines data from the 95-GHz W-band ARM Cloud Radar (WACR) and/or the 35-GHz Millimeter Microwave Cloud Radar (MMCR), is used in this study to validate the radiosonde-based cloud layer retrieval method. The performance of the radiosonde-based cloud layer retrieval method applied to data from different climate regimes is evaluated. Overall, cloud layers derived from the ARSCL VAP and radiosonde data agree very well at the SGP and AMF-China sites. At the TWP and NSA sites, the radiosonde tends to detect more cloud layers in the upper troposphere.

Cost-Effectiveness of Interventions to Improve Moderate Physical Activity: A Study in Nine UK Sites

ERIC Educational Resources Information Center

Pringle, Andy; Cooke, Carlton; Gilson, Nicholas; Marsh, Kevin; McKenna, Jim

2010-01-01

Objective: With growing concerns to establish the value for returns on public health investment, there is a need to identify cost-effective physical activity interventions. This study measured change in moderate physical activity (MPA) in seven community-based intervention types, costs and cost-effectiveness of the interventions, and possible…

The SPARK Programs: A Public Health Model of Physical Education Research and Dissemination

ERIC Educational Resources Information Center

McKenzie, Thomas L.; Sallis, James F.; Rosengard, Paul; Ballard, Kymm

2016-01-01

SPARK [Sports, Play, and Active Recreation for Kids], in its current form, is a brand that represents a collection of exemplary, research-based, physical education and physical activity programs that emphasize a highly active curriculum, on-site staff development, and follow-up support. Given its complexity (e.g., multiple school levels, inclusion…

Site Formation Processes and Hunter-Gatherers Use of Space in a Tropical Environment: A Geo-Ethnoarchaeological Approach from South India

PubMed Central

Friesem, David E.; Lavi, Noa; Madella, Marco; Ajithprasad, P.; French, Charles

2016-01-01

Hunter-gatherer societies have distinct social perceptions and practices which are expressed in unique use of space and material deposition patterns. However, the identification of archaeological evidence associated with hunter-gatherer activity is often challenging, especially in tropical environments such as rainforests. We present an integrated study combining ethnoarchaeology and geoarchaeology in order to study archaeological site formation processes related to hunter-gatherers’ ways of living in tropical forests. Ethnographic data was collected from an habitation site of contemporary hunter-gatherers in the forests of South India, aimed at studying how everyday activities and way of living dictate patterns of material deposition. Ethnoarchaeological excavations of abandoned open-air sites and a rock-shelter of the same group located deep in the forests, involved field observations and sampling of sediments from the abandoned sites and the contemporary site. Laboratory analyses included geochemical analysis (i.e., FTIR, ICP-AES), phytolith concentration analysis and soil micromorphology. The results present a dynamic spatial deposition pattern of macroscopic, microscopic and chemical materials, which stem from the distinctive ways of living and use of space by hunter-gatherers. This study shows that post-depositional processes in tropical forests result in poor preservation of archaeological materials due to acidic conditions and intensive biological activity within the sediments. Yet, the multiple laboratory-based analyses were able to trace evidence for activity surfaces and their maintenance practices as well as localized concentrations of activity remains such as the use of plants, metals, hearths and construction materials. PMID:27783683

Mechanism of RNA polymerase II bypass of oxidative cyclopurine DNA lesions

DOE PAGES

Walmacq, Celine; Wang, Lanfeng; Chong, Jenny; ...

2015-01-20

In human cells, the oxidative DNA lesion 8,5'-cyclo-2'-deoxyadenosine (CydA) induces prolonged stalling of RNA polymerase II (Pol II) followed by transcriptional bypass, generating both error-free and mutant transcripts with AMP misincorporated immediately downstream from the lesion. Here, we present biochemical and crystallographic evidence for the mechanism of CydA recognition. Pol II stalling results from impaired loading of the template base (5') next to CydA into the active site, leading to preferential AMP misincorporation. Such predominant AMP insertion, which also occurs at an abasic site, is unaffected by the identity of the 5´-templating base, indicating that it derives from nontemplated synthesismore » according to an A rule known for DNA polymerases and recently identified for Pol II bypass of pyrimidine dimers. Subsequent to AMP misincorporation, Pol II encounters a major translocation block that is slowly overcome. The translocation block combined with the poor extension of the dA.rA mispair reduce transcriptional mutagenesis. Moreover, increasing the active-site flexibility by mutation in the trigger loop, which increases the ability of Pol II to accommodate the bulky lesion, and addition of transacting factor TFIIF facilitate CydA bypass. Thus, blocking lesion entry to the active site, trans-lesion A rule synthesis, and translocation block are common features of transcription across different bulky DNA lesions.« less

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Isolation of a small molecule inhibitor of DNA base excision repair

PubMed Central

Madhusudan, Srinivasan; Smart, Fiona; Shrimpton, Paul; Parsons, Jason L.; Gardiner, Laurence; Houlbrook, Sue; Talbot, Denis C.; Hammonds, Timothy; Freemont, Paul A.; Sternberg, Michael J. E.; Dianov, Grigory L.; Hickson, Ian D.

2005-01-01

The base excision repair (BER) pathway is essential for the removal of DNA bases damaged by alkylation or oxidation. A key step in BER is the processing of an apurinic/apyrimidinic (AP) site intermediate by an AP endonuclease. The major AP endonuclease in human cells (APE1, also termed HAP1 and Ref-1) accounts for >95% of the total AP endonuclease activity, and is essential for the protection of cells against the toxic effects of several classes of DNA damaging agents. Moreover, APE1 overexpression has been linked to radio- and chemo-resistance in human tumors. Using a newly developed high-throughput screen, several chemical inhibitors of APE1 have been isolated. Amongst these, CRT0044876 was identified as a potent and selective APE1 inhibitor. CRT0044876 inhibits the AP endonuclease, 3′-phosphodiesterase and 3′-phosphatase activities of APE1 at low micromolar concentrations, and is a specific inhibitor of the exonuclease III family of enzymes to which APE1 belongs. At non-cytotoxic concentrations, CRT0044876 potentiates the cytotoxicity of several DNA base-targeting compounds. This enhancement of cytotoxicity is associated with an accumulation of unrepaired AP sites. In silico modeling studies suggest that CRT0044876 binds to the active site of APE1. These studies provide both a novel reagent for probing APE1 function in human cells, and a rational basis for the development of APE1-targeting drugs for antitumor therapy. PMID:16113242

Rational analyses of information foraging on the web.

PubMed

Pirolli, Peter

2005-05-06

This article describes rational analyses and cognitive models of Web users developed within information foraging theory. This is done by following the rational analysis methodology of (a) characterizing the problems posed by the environment, (b) developing rational analyses of behavioral solutions to those problems, and (c) developing cognitive models that approach the realization of those solutions. Navigation choice is modeled as a random utility model that uses spreading activation mechanisms that link proximal cues (information scent) that occur in Web browsers to internal user goals. Web-site leaving is modeled as an ongoing assessment by the Web user of the expected benefits of continuing at a Web site as opposed to going elsewhere. These cost-benefit assessments are also based on spreading activation models of information scent. Evaluations include a computational model of Web user behavior called Scent-Based Navigation and Information Foraging in the ACT Architecture, and the Law of Surfing, which characterizes the empirical distribution of the length of paths of visitors at a Web site. 2005 Lawrence Erlbaum Associates, Inc.

Structural insight into molecular mechanism of poly(ethylene terephthalate) degradation.

PubMed

Joo, Seongjoon; Cho, In Jin; Seo, Hogyun; Son, Hyeoncheol Francis; Sagong, Hye-Young; Shin, Tae Joo; Choi, So Young; Lee, Sang Yup; Kim, Kyung-Jin

2018-01-26

Plastics, including poly(ethylene terephthalate) (PET), possess many desirable characteristics and thus are widely used in daily life. However, non-biodegradability, once thought to be an advantage offered by plastics, is causing major environmental problem. Recently, a PET-degrading bacterium, Ideonella sakaiensis, was identified and suggested for possible use in degradation and/or recycling of PET. However, the molecular mechanism of PET degradation is not known. Here we report the crystal structure of I. sakaiensis PETase (IsPETase) at 1.5 Å resolution. IsPETase has a Ser-His-Asp catalytic triad at its active site and contains an optimal substrate binding site to accommodate four monohydroxyethyl terephthalate (MHET) moieties of PET. Based on structural and site-directed mutagenesis experiments, the detailed process of PET degradation into MHET, terephthalic acid, and ethylene glycol is suggested. Moreover, other PETase candidates potentially having high PET-degrading activities are suggested based on phylogenetic tree analysis of 69 PETase-like proteins.

Discovery and characterization of a new family of lytic polysaccharide mono-oxygenases

PubMed Central

Hemsworth, Glyn R.; Henrissat, Bernard; Davies, Gideon J.; Walton, Paul H.

2014-01-01

Lytic polysaccharide mono-oxygenases (LPMOs) are a recently discovered class of enzymes capable of oxidizing recalcitrant polysaccharides. They currently attract much attention due to their potential use in biomass conversion, notably in the production of biofuels. Past work has identified two discrete sequence-based families of these enzymes termed AA9 (formerly GH61) and AA10 (formerly CBM33). Here we report the discovery of a third family of LPMOs. Using a chitin-degrading exemplar from Aspergillus oryzae, we show that the 3-D structure of the enzyme shares some features of the previous two classes of LPMOs, including a copper active centre featuring the histidine brace active site, but is distinct in terms of its active site details and its EPR spectroscopy. The new AA11 family expands the LPMO clan with the potential to broaden both the range of potential substrates and the types of reactive copper-oxygen species formed at the active site of LPMOs. PMID:24362702

Chelating agent-free, vapor-assisted crystallization method to synthesize hierarchical microporous/mesoporous MIL-125 (Ti).

PubMed

McNamara, Nicholas D; Hicks, Jason C

2015-03-11

Titanium-based microporous heterogeneous catalysts are widely studied but are often limited by the accessibility of reactants to active sites. Metal-organic frameworks (MOFs), such as MIL-125 (Ti), exhibit enhanced surface areas due to their high intrinsic microporosity, but the pore diameters of most microporous MOFs are often too small to allow for the diffusion of larger reactants (>7 Å) relevant to petroleum and biomass upgrading. In this work, hierarchical microporous MIL-125 exhibiting significantly enhanced interparticle mesoporosity was synthesized using a chelating-free, vapor-assisted crystallization method. The resulting hierarchical MOF was examined as an active catalyst for the oxidation of dibenzothiophene (DBT) with tert-butyl hydroperoxide and outperformed the solely microporous analogue. This was attributed to greater access of the substrate to surface active sites, as the pores in the microporous analogues were of inadequate size to accommodate DBT. Moreover, thiophene adsorption studies suggested the mesoporous MOF contained larger amounts of unsaturated metal sites that could enhance the observed catalytic activity.

Copper-zinc superoxide dismutase is activated through a sulfenic acid intermediate at a copper ion entry site.

PubMed

Fetherolf, Morgan M; Boyd, Stefanie D; Taylor, Alexander B; Kim, Hee Jong; Wohlschlegel, James A; Blackburn, Ninian J; Hart, P John; Winge, Dennis R; Winkler, Duane D

2017-07-21

Metallochaperones are a diverse family of trafficking molecules that provide metal ions to protein targets for use as cofactors. The copper chaperone for superoxide dismutase (Ccs1) activates immature copper-zinc superoxide dismutase (Sod1) by delivering copper and facilitating the oxidation of the Sod1 intramolecular disulfide bond. Here, we present structural, spectroscopic, and cell-based data supporting a novel copper-induced mechanism for Sod1 activation. Ccs1 binding exposes an electropositive cavity and proposed "entry site" for copper ion delivery on immature Sod1. Copper-mediated sulfenylation leads to a sulfenic acid intermediate that eventually resolves to form the Sod1 disulfide bond with concomitant release of copper into the Sod1 active site. Sod1 is the predominant disulfide bond-requiring enzyme in the cytoplasm, and this copper-induced mechanism of disulfide bond formation obviates the need for a thiol/disulfide oxidoreductase in that compartment. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Bipyridine- and phenanthroline-based metal-organic frameworks for highly efficient and tandem catalytic organic transformations via directed C-H activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manna, Kuntal; Zhang, Teng; Greene, Francis X.

2015-02-16

We report here the synthesis of a series of robust and porous bipyridyl- and phenanthryl-based metal–organic frameworks (MOFs) of UiO topology (BPV-MOF, mBPV-MOF, and mPT-MOF) and their postsynthetic metalation to afford highly active single-site solid catalysts. While BPV-MOF was constructed from only bipyridyl-functionalized dicarboxylate linker, both mBPV- and mPT-MOF were built with a mixture of bipyridyl- or phenanthryl-functionalized and unfunctionalized dicarboxylate linkers. The postsynthetic metalation of these MOFs with [Ir(COD)(OMe)] 2 provided Ir-functionalized MOFs (BPV-MOF-Ir, mBPV-MOF-Ir, and mPT-MOF-Ir), which are highly active catalysts for tandem hydrosilylation of aryl ketones and aldehydes followed by dehydrogenative ortho-silylation of benzylicsilyl ethers as wellmore » as C–H borylation of arenes using B₂pin₂. Both mBPV-MOF-Ir and mPT-MOF-Ir catalysts displayed superior activities compared to BPV-MOF-Ir due to the presence of larger open channels in the mixed-linker MOFs. Impressively, mBPV-MOF-Ir exhibited high TONs of up to 17000 for C–H borylation reactions and was recycled more than 15 times. The mPT-MOF-Ir system is also active in catalyzing tandem dehydrosilylation/dehydrogenative cyclization of N-methylbenzyl amines to azasilolanes in the absence of a hydrogen acceptor. Importantly, MOF-Ir catalysts are significantly more active (up to 95 times) and stable than their homogeneous counterparts for all three reactions, strongly supporting the beneficial effects of active site isolation within MOFs. This work illustrates the ability to increase MOF open channel sizes by using the mixed linker approach and shows the enormous potential of developing highly active and robust single-site solid catalysts based on MOFs containing nitrogen-donor ligands for important organic transformations.« less

Identification of essential active-site residues in the cyanogenic beta-glucosidase (linamarase) from cassava (Manihot esculenta Crantz) by site-directed mutagenesis.

PubMed Central

Keresztessy, Z; Brown, K; Dunn, M A; Hughes, M A

2001-01-01

The coding sequence of the mature cyanogenic beta-glucosidase (beta-glucoside glucohydrolase, EC 3.2.1.21; linamarase) was cloned into the vector pYX243 modified to contain the SUC2 yeast secretion signal sequence and expressed in Saccharomyces cerevisiae. The recombinant enzyme is active, glycosylated and showed similar stability to the plant protein. Michaelis constants for hydrolysis of the natural substrate, linamarin (K(m)=1.06 mM) and the synthetic p-nitrophenyl beta-D-glucopyranoside (PNP-Glc; K(m)=0.36 mM), as well as apparent pK(a) values of the free enzyme and the enzyme-substrate complexes (pK(E)(1)=4.4-4.8, pK(E)(2)=6.7-7.2, pK(ES)(1)=3.9-4.4, pK(ES)(2)=8.3) were very similar to those of the plant enzyme. Site-directed mutagenesis was carried out to study the function of active-site residues based on a homology model generated for the enzyme using the MODELLER program. Changing Glu-413 to Gly destroyed enzyme activity, consistent with it being the catalytic nucleophile. The Gln-339Glu mutation also abolished activity, confirming a function in positioning the catalytic diad. The Ala-201Val mutation shifted the pK(a) of the acid/base catalyst Glu-198 from 7.22 to 7.44, reflecting a change in its hydrophobic environment. A Phe-269Asn change increased K(m) for linamarin hydrolysis 16-fold (16.1 mM) and that for PNP-Glc only 2.5-fold (0.84 mM), demonstrating that Phe-269 contributes to the cyanogenic specificity of the cassava beta-glucosidase. PMID:11139381

Lunar base siting

NASA Technical Reports Server (NTRS)

Staehle, Robert L.; Dowling, Richard

1991-01-01

As with any planetary body, the lunar surface is quite heterogeneous. There are widely dispersed sites of particular interest for known and potential resource availability, selenology, and lunar observatories. Discriminating characteristics include solar illumination, view of earth, local topography, engineering properties of the regolith and certain geological features, and local mineralogy and petrology. Space vehicle arrival and departure trajectories constitute a minor consideration. Over time, a variety of base sites will be developed serving different purposes. Resource-driven sites may see the fastest growth during the first decades of lunar development, but selection of the most favorable sites is likely to be driven by suitability for a combination of activities. As on earth, later development may be driven by geographical advantages of surface transportation routes. With the availability of near-constant sunlight for power generation, as well as permanently shadowed areas at cryogenic temperatures, polar sites are attractive because they require substantially less earth-launched mass and lower equipment complexity for an initial permanent base. Discovery of accessible volatiles reservoirs, either in the form of polar permafrost or gas reservoirs at other locations, would dramatically increase the attractiveness of any site from a logistical support and selenological point of view. Amid such speculation, no reliable evidence of such volatiles exist. More reliable evidence exists for areas of certain mineral concentrations, such as ilmenite, which could form a feedstock for some proposed resource extraction schemes. While tentative selections of advantageous base sites are made, new data from lunar polar orbiters and the Galileo polar flybys would be very helpful.

A new design for a green calcium indicator with a smaller size and a reduced number of calcium-binding sites

PubMed Central

Barykina, Natalia V.; Subach, Oksana M.; Doronin, Danila A.; Sotskov, Vladimir P.; Roshchina, Marina A.; Kunitsyna, Tatiana A.; Malyshev, Aleksey Y.; Smirnov, Ivan V.; Azieva, Asya M.; Sokolov, Ilya S.; Piatkevich, Kiryl D.; Burtsev, Mikhail S.; Varizhuk, Anna M.; Pozmogova, Galina E.; Anokhin, Konstantin V.; Subach, Fedor V.; Enikolopov, Grigori N.

2016-01-01

Genetically encoded calcium indicators (GECIs) are mainly represented by two- or one-fluorophore-based sensors. One type of two-fluorophore-based sensor, carrying Opsanus troponin C (TnC) as the Ca2+-binding moiety, has two binding sites for calcium ions, providing a linear response to calcium ions. One-fluorophore-based sensors have four Ca2+-binding sites but are better suited for in vivo experiments. Herein, we describe a novel design for a one-fluorophore-based GECI with two Ca2+-binding sites. The engineered sensor, called NTnC, uses TnC as the Ca2+-binding moiety, inserted in the mNeonGreen fluorescent protein. Monomeric NTnC has higher brightness and pH-stability in vitro compared with the standard GECI GCaMP6s. In addition, NTnC shows an inverted fluorescence response to Ca2+. Using NTnC, we have visualized Ca2+ dynamics during spontaneous activity of neuronal cultures as confirmed by control NTnC and its mutant, in which the affinity to Ca2+ is eliminated. Using whole-cell patch clamp, we have demonstrated that NTnC dynamics in neurons are similar to those of GCaMP6s and allow robust detection of single action potentials. Finally, we have used NTnC to visualize Ca2+ neuronal activity in vivo in the V1 cortical area in awake and freely moving mice using two-photon microscopy or an nVista miniaturized microscope. PMID:27677952

Sintering-resistant Single-Site Nickel Catalyst Supported by Metal-Organic Framework

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Zhanyong; Schweitzer, Neil; League, Aaron

2016-02-17

Developing supported single-site catalysts is an important goal in heterogeneous catalysis, since the well-defined active sites afford opportunities for detailed mechanistic studies, thereby facilitating the design of improved catalysts. We present herein a method for installing Ni ions uniformly and precisely on the node of a Zr-based MOF, NU-1000, in high density and large quantity (denoted as Ni-AIM) using atomic layer deposition (ALD) in a metal–organic framework (MOF) (AIM). Ni-AIM is demonstrated to be an efficient gas-phase hydrogenation catalyst upon activation. The structure of the active sites in Ni-AIM is proposed, revealing its single-site nature. More importantly, due to themore » organic linker used to construct the MOF support, the Ni ions stay isolated throughout the hydrogenation catalysis, in accord with its long-term stability. A quantum chemical characterization of the catalyst and the catalytic process complements the experimental results. With validation of computational modeling protocols, we further targeted ethylene oligomerization catalysis by Ni-AIM guided by theoretical prediction. Given the generality of the AIM methodology, this emerging class of materials should prove ripe for the discovery of new catalysts for the transformation of volatile substrates.« less

Characterization of the active site properties of CYP4F12.

PubMed

Eksterowicz, John; Rock, Dan A; Rock, Brooke M; Wienkers, Larry C; Foti, Robert S

2014-10-01

Cytochrome P450 4F12 is a drug-metabolizing enzyme that is primarily expressed in the liver, kidney, colon, small intestine, and heart. The properties of CYP4F12 that may impart an increased catalytic selectivity (decreased promiscuity) were explored through in vitro metabolite elucidation, kinetic isotope effect experiments, and computational modeling of the CYP4F12 active site. By using astemizole as a probe substrate for CYP4F12 and CYP3A4, it was observed that although CYP4F12 favored astemizole O-demethylation as the primary route of metabolism, CYP3A4 was capable of metabolizing astemizole at multiple sites on the molecule. Deuteration of astemizole at the site of O-demethylation resulted in an isotope effect of 7.1 as well as an 8.3-fold decrease in the rate of clearance for astemizole by CYP4F12. Conversely, although an isotope effect of 3.8 was observed for the formation of the O-desmethyl metabolite when deuterated astemizole was metabolized by CYP3A4, there was no decrease in the clearance of astemizole. Development of a homology model of CYP4F12 based on the crystal structure of cytochrome P450 BM3 predicted an active site volume for CYP4F12 that was approximately 76% of the active site volume of CYP3A4. As predicted, multiple favorable binding orientations were available for astemizole docked into the active site of CYP3A4, but only a single binding orientation with the site of O-demethylation oriented toward the heme was identified for CYP4F12. Overall, it appears that although CYP4F12 may be capable of binding similar ligands to other cytochrome P450 enzymes such as CYP3A4, the ability to achieve catalytically favorable orientations may be inherently more difficult because of the increased steric constraints of the CYP4F12 active site. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

Air-Based Remediation Workshop - Section 7 Sustainable Remediation And Air-Based Technologies

EPA Science Inventory

Pursuant to the EPA-AIT Implementing Arrangement 7 for Technical Environmental Collaboration, Activity 11 "Remediation of Contaminated Sites, " the USEPA Office of International Affairs Organized a Forced Air Remediation Workshop in Taipei to deliver expert training to the Enviro...

Air-Based Remediation Workshop - Section 8 Air-Based Remediation Technology Selection Logic

EPA Science Inventory

Pursuant to the EPA-AIT Implementing Arrangement 7 for Technical Environmental Collaboration, Activity 11 "Remediation of Contaminated Sites," the USEPA Office of International Affairs Organized a Forced Air Remediation Workshop in Taipei to deliver expert training to the Environ...

Identification of new allosteric sites and modulators of AChE through computational and experimental tools.

PubMed

Roca, Carlos; Requena, Carlos; Sebastián-Pérez, Víctor; Malhotra, Sony; Radoux, Chris; Pérez, Concepción; Martinez, Ana; Antonio Páez, Juan; Blundell, Tom L; Campillo, Nuria E

2018-12-01

Allosteric sites on proteins are targeted for designing more selective inhibitors of enzyme activity and to discover new functions. Acetylcholinesterase (AChE), which is most widely known for the hydrolysis of the neurotransmitter acetylcholine, has a peripheral allosteric subsite responsible for amyloidosis in Alzheimer's disease through interaction with amyloid β-peptide. However, AChE plays other non-hydrolytic functions. Here, we identify and characterise using computational tools two new allosteric sites in AChE, which have allowed us to identify allosteric inhibitors by virtual screening guided by structure-based and fragment hotspot strategies. The identified compounds were also screened for in vitro inhibition of AChE and three were observed to be active. Further experimental (kinetic) and computational (molecular dynamics) studies have been performed to verify the allosteric activity. These new compounds may be valuable pharmacological tools in the study of non-cholinergic functions of AChE.

Ebselen Reversibly Inhibits Human Glutamate Dehydrogenase at the Catalytic Site.

PubMed

Jin, Yanhong; Li, Di; Lu, Shiying; Zhao, Han; Chen, Zhao; Hou, Wei; Ruan, Benfang Helen

Human glutamate dehydrogenase (GDH) plays an important role in neurological diseases, tumor metabolism, and hyperinsulinism-hyperammonemia syndrome (HHS). However, there are very few inhibitors known for human GDH. Recently, Ebselen was reported to crosslink with Escherichia coli GDH at the active site cysteine residue (Cys321), but the sequence alignment showed that the corresponding residue is Ala329 in human GDH. To investigate whether Ebselen could be an inhibitor for human GDH, we cloned and expressed an N-terminal His-tagged human GDH in E. coli. The recombinant human GDH enzyme showed expected properties such as adenosine diphosphate activation and nicotinamide adenine dinucleotide/nicotinamide adenine dinucleotide phosphate dual recognition. Further, we developed a 2-(3-(2-methoxy-4-nitrophenyl)-2-(4-nitrophenyl)-2H-tetrazol-3-ium-5-yl) benzenesulfonate sodium salt (EZMTT)-based assay for human GDH, which was highly sensitive and is suitable for high-throughput screening for potent GDH inhibitors. In addition, ForteBio binding assays demonstrated that Ebselen is a reversible active site inhibitor for human GDH. Since Ebselen is a multifunctional organoselenium compound in Phase III clinical trials for inflammation, an Ebselen-based GDH inhibitor might be valuable for future drug discovery for HHS patients.

Recurrent patterns of atrial depolarization during atrial fibrillation assessed by recurrence plot quantification.

PubMed

Censi, F; Barbaro, V; Bartolini, P; Calcagnini, G; Michelucci, A; Gensini, G F; Cerutti, S

2000-01-01

The aim of this study was to determine the presence of organization of atrial activation processes during atrial fibrillation (AF) by assessing whether the activation sequences are wholly random or are governed by deterministic mechanisms. We performed both linear and nonlinear analyses based on the cross correlation function (CCF) and recurrence plot quantification (RPQ), respectively. Recurrence plots were quantified by three variables: percent recurrence (PR), percent determinism (PD), and entropy of recurrences (ER). We recorded bipolar intra-atrial electrograms in two atrial sites during chronic AF in 19 informed subjects, following two protocols. In one, both recording sites were in the right atrium; in the other protocol, one site was in the right atrium, the other one in the left atrium. We extracted 19 episodes of type I AF (Wells' classification). RPQ detected transient recurrent patterns in all the episodes, while CCF was significant only in ten episodes. Surrogate data analysis, based on a cross-phase randomization procedure, decreased PR, PD, and ER values. The detection of spatiotemporal recurrent patterns together with the surrogate data results indicate that during AF a certain degree of local organization exists, likely caused by deterministic mechanisms of activation.

Academic Quality Control: The Case of College Programs on Military Bases.

ERIC Educational Resources Information Center

Bailey, Stephen K.

The quality of college programs at 13 U.S. military bases and the activities of various agencies for maintaining quality control were evaluated. Based on site visits to military bases in the continental United States and Hawaii in 1978, some academic programs appeared to have few standards and practices that promote quality. It is claimed that…

Characterization of the Deoxynucleotide Triphosphate Triphosphohydrolase (dNTPase) Activity of the EF1143 Protein from Enterococcus faecalis and Crystal Structure of the Activator-Substrate Complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vorontsov, Ivan I.; Minasov, George; Kiryukhina, Olga

2012-06-19

The EF1143 protein from Enterococcus faecalis is a distant homolog of deoxynucleotide triphosphate triphosphohydrolases (dNTPases) from Escherichia coli and Thermus thermophilus. These dNTPases are important components in the regulation of the dNTP pool in bacteria. Biochemical assays of the EF1143 dNTPase activity demonstrated nonspecific hydrolysis of all canonical dNTPs in the presence of Mn{sup 2+}. In contrast, with Mg{sup 2+} hydrolysis required the presence of dGTP as an effector, activating the degradation of dATP and dCTP with dGTP also being consumed in the reaction with dATP. The crystal structure of EF1143 and dynamic light scattering measurements in solution revealed amore » tetrameric oligomer as the most probable biologically active unit. The tetramer contains four dGTP specific allosteric regulatory sites and four active sites. Examination of the active site with the dATP substrate suggests an in-line nucleophilic attack on the {alpha}-phosphate center as a possible mechanism of the hydrolysis and two highly conserved residues, His-129 and Glu-122, as an acid-base catalytic dyad. Structural differences between EF1143 apo and holo forms revealed mobility of the {alpha}3 helix that can regulate the size of the active site binding pocket and could be stabilized in the open conformation upon formation of the tetramer and dGTP effector binding.« less

Comparative study of activated carbon, natural zeolite, and green sand supports for CuOX and ZnO sites as ozone decomposition catalyst

NASA Astrophysics Data System (ADS)

Azhariyah, A. S.; Pradyasti, A.; Dianty, A. G.; Bismo, S.

2018-03-01

This research was based on ozone decomposition in industrial environment. Ozone is harmful to human. Therefore, catalysts were made as a mask filter to decompose ozone. Comparison studies of catalyst supports were done using Granular Activated Carbon (GAC), Natural Zeolite (NZ), and Green Sand (GS). GAC showed the highest catalytic activity compared to other supports with conversion of 98%. Meanwhile, the conversion using NZ was only 77% and GS had been just 27%. GAC had the highest catalytic activity because it had the largest pore volume, which is 0.478 cm3/g. So GAC was used as catalyst supports. To have a higher conversion in ozone decomposition, GAC was impregnated with metal oxide as the active site of the catalyst. Active site comparison was made using CuOX and ZnO as the active site. Morphology, composition, and crystal phase were analyzed using SEM-EDX, XRF, and XRD methods. Mask filter, which contained catalysts for ozone decomposition, was tested using a fixed bed reactor at room temperature and atmospheric pressure. The result of conversion was analyzed using iodometric method. CuOX/GAC and ZnO/GAC 2%-w showed the highest catalytic activity and conversion reached 100%. From the durability test, CuOX/GAC 2%-w was better than ZnO/GAC 2%-w because the conversion of ozone to oxygen reached 100% with the lowest conversion was 70% for over eight hours.

Dihydrofolate reductase: A potential drug target in trypanosomes and leishmania

NASA Astrophysics Data System (ADS)

Zuccotto, Fabio; Martin, Andrew C. R.; Laskowski, Roman A.; Thornton, Janet M.; Gilbert, Ian H.

1998-05-01

Dihydrofolate reductase has successfully been used as a drug target in the area of anti-cancer, anti-bacterial and anti-malarial chemotherapy. Little has been done to evaluate it as a drug target for treatment of the trypanosomiases and leishmaniasis. A crystal structure of Leishmania major dihydrofolate reductase has been published. In this paper, we describe the modelling of Trypanosoma cruzi and Trypanosoma brucei dihydrofolate reductases based on this crystal structure. These structures and models have been used in the comparison of protozoan, bacterial and human enzymes in order to highlight the different features that can be used in the design of selective anti-protozoan agents. Comparison has been made between residues present in the active site, the accessibility of these residues, charge distribution in the active site, and the shape and size of the active sites. Whilst there is a high degree of similarity between protozoan, human and bacterial dihydrofolate reductase active sites, there are differences that provide potential for selective drug design. In particular, we have identified a set of residues which may be important for selective drug design and identified a larger binding pocket in the protozoan than the human and bacterial enzymes.

Ligand-binding specificity and promiscuity of the main lignocellulolytic enzyme families as revealed by active-site architecture analysis.

PubMed

Tian, Li; Liu, Shijia; Wang, Shuai; Wang, Lushan

2016-03-24

Biomass can be converted into sugars by a series of lignocellulolytic enzymes, which belong to the glycoside hydrolase (GH) families summarized in CAZy databases. Here, using a structural bioinformatics method, we analyzed the active site architecture of the main lignocellulolytic enzyme families. The aromatic amino acids Trp/Tyr and polar amino acids Glu/Asp/Asn/Gln/Arg occurred at higher frequencies in the active site architecture than in the whole enzyme structure. And the number of potential subsites was significantly different among different families. In the cellulase and xylanase families, the conserved amino acids in the active site architecture were mostly found at the -2 to +1 subsites, while in β-glucosidase they were mainly concentrated at the -1 subsite. Families with more conserved binding amino acid residues displayed strong selectivity for their ligands, while those with fewer conserved binding amino acid residues often exhibited promiscuity when recognizing ligands. Enzymes with different activities also tended to bind different hydroxyl oxygen atoms on the ligand. These results may help us to better understand the common and unique structural bases of enzyme-ligand recognition from different families and provide a theoretical basis for the functional evolution and rational design of major lignocellulolytic enzymes.

The 3'-5' exonuclease of DNA polymerase I of Escherichia coli: contribution of each amino acid at the active site to the reaction.

PubMed Central

Derbyshire, V; Grindley, N D; Joyce, C M

1991-01-01

We have used site-directed mutagenesis to change amino acid side chains that have been shown crystallographically to be in close proximity to a DNA 3' terminus bound at the 3'-5' exonuclease active site of Klenow fragment. Exonuclease assays of the resulting mutant proteins indicate that the largest effects on exonuclease activity result from mutations in a group of carboxylate side chains (Asp355, Asp424 and Asp501) anchoring two divalent metal ions that are essential for exonuclease activity. Another carboxylate (Glu357) within this cluster seems to be less important as a metal ligand, but may play a separate role in catalysis of the exonuclease reaction. A second group of residues (Leu361, Phe473 and Tyr497), located around the terminal base and ribose positions, plays a secondary role, ensuring correct positioning of the substrate in the active site and perhaps also facilitating melting of a duplex DNA substrate by interacting with the frayed 3' terminus. The pH-dependence of the 3'-5' exonuclease reaction is consistent with a mechanism in which nucleophilic attack on the terminal phosphodiester bond is initiated by a hydroxide ion coordinated to one of the enzyme-bound metal ions. PMID:1989882

Active matrix-based collection of airborne analytes: an analyte recording chip providing exposure history and finger print.

PubMed

Fang, Jun; Park, Se-Chul; Schlag, Leslie; Stauden, Thomas; Pezoldt, Jörg; Jacobs, Heiko O

2014-12-03

In the field of sensors that target the detection of airborne analytes, Corona/lens-based-collection provides a new path to achieve a high sensitivity. An active-matrix-based analyte collection approach referred to as "airborne analyte memory chip/recorder" is demonstrated, which takes and stores airborne analytes in a matrix to provide an exposure history for off-site analysis. © 2014 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Wobble pairs of the HDV ribozyme play specific roles in stabilization of active site dynamics.

PubMed

Sripathi, Kamali N; Banáš, Pavel; Réblová, Kamila; Šponer, Jiří; Otyepka, Michal; Walter, Nils G

2015-02-28

The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5') hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5') general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5') hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs.

Wobble Pairs of the HDV Ribozyme Play Specific Roles in Stabilization of Active Site Dynamics

PubMed Central

Sripathi, Kamali N.; Banáš, Pavel; Reblova, Kamila; Šponer, Jiři; Otyepka, Michal

2015-01-01

The hepatitis delta virus (HDV) is the only known human pathogen whose genome contains a catalytic RNA motif (ribozyme). The overall architecture of the HDV ribozyme is that of a double-nested pseudoknot, with two GU pairs flanking the active site. Although extensive studies have shown that mutation of either wobble results in decreased catalytic activity, little work has focused on linking these mutations to specific structural effects on catalytic fitness. Here we use molecular dynamics simulations based on an activated structure to probe the active site dynamics as a result of wobble pair mutations. In both wild-type and mutant ribozymes, the in-line fitness of the active site (as a measure of catalytic proficiency) strongly depends on the presence of a C75(N3H3+)N1(O5′) hydrogen bond, which positions C75 as the general acid for the reaction. Our mutational analyses show that each GU wobble supports catalytically fit conformations in distinct ways; the reverse G25U20 wobble promotes high in-line fitness, high occupancy of the C75(N3H3+)G1(O5′) general-acid hydrogen bond and stabilization of the G1U37 wobble, while the G1U37 wobble acts more locally by stabilizing high in-line fitness and the C75(N3H3+)G1(O5′) hydrogen bond. We also find that stable type I A-minor and P1.1 hydrogen bonding above and below the active site, respectively, prevent local structural disorder from spreading and disrupting global conformation. Taken together, our results define specific, often redundant architectural roles for several structural motifs of the HDV ribozyme active site, expanding the known roles of these motifs within all HDV-like ribozymes and other structured RNAs. PMID:25631765

Multi-Modal Active Perception for Autonomously Selecting Landing Sites on Icy Moons

NASA Technical Reports Server (NTRS)

Arora, A.; Furlong, P. M.; Wong, U.; Fong, T.; Sukkarieh, S.

2017-01-01

Selecting suitable landing sites is fundamental to achieving many mission objectives in planetary robotic lander missions. However, due to sensing limitations, landing sites which are both safe and scientifically valuable often cannot be determined reliably from orbit, particularly, in icy moon missions where orbital sensing data is noisy and incomplete. This paper presents an active perception approach to Entry Descent and Landing (EDL) which enables the lander to autonomously plan informative descent trajectories, acquire high quality sensing data during descent and exploit this additional information to select higher utility landing sites. Our approach consists of two components: probabilistic modeling of landing site features and approximate trajectory planning using a sampling based planner. The proposed framework allows the lander to plan long horizons paths and remain robust to noisy data. Results in simulated environments show large performance improvements over alternative approaches and show promise that our approach has strong potential to improve science return of not only icy moon missions but EDL systems in general.

Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hata, Kuniki; Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195; Urushibara, Ayumi

Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield ofmore » DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems.« less

Camp NERF: methods of a theory-based nutrition education recreation and fitness program aimed at preventing unhealthy weight gain in underserved elementary children during summer months.

PubMed

Hopkins, Laura C; Fristad, Mary; Goodway, Jacqueline D; Eneli, Ihuoma; Holloman, Chris; Kennel, Julie A; Melnyk, Bernadette; Gunther, Carolyn

2016-10-26

The number of obese children in the US remains high, which is problematic due to the mental, physical, and academic effects of obesity on child health. Data indicate that school-age children, particularly underserved children, experience unhealthy gains in BMI at a rate nearly twice as fast during the summer months. Few efforts have been directed at implementing evidence-based programming to prevent excess weight gain during the summer recess. Camp NERF is an 8-week, multi-component (nutrition, physical activity, and mental health), theory-based program for underserved school-age children in grades Kindergarten - 5th coupled with the USDA Summer Food Service Program. Twelve eligible elementary school sites will be randomized to one of the three programming groups: 1) Active Control (non-nutrition, physical activity, or mental health); 2) Standard Care (nutrition and physical activity); or 3) Enhanced Care (nutrition, physical activity, and mental health) programming. Anthropometric, behavioral, and psychosocial data will be collected from child-caregiver dyads pre- and post-intervention. Site-specific characteristics and process evaluation measures will also be collected. This is the first, evidence-based intervention to address the issue of weight gain during the summer months among underserved, school-aged children. Results from this study will provide researchers, practitioners, and public health professionals with insight on evidence-based programming to aid in childhood obesity prevention during this particular window of risk. NCT02908230/09-19-2016.

Protein pharmacophore selection using hydration-site analysis

PubMed Central

Hu, Bingjie; Lill, Markus A.

2012-01-01

Virtual screening using pharmacophore models is an efficient method to identify potential lead compounds for target proteins. Pharmacophore models based on protein structures are advantageous because a priori knowledge of active ligands is not required and the models are not biased by the chemical space of previously identified actives. However, in order to capture most potential interactions between all potentially binding ligands and the protein, the size of the pharmacophore model, i.e. number of pharmacophore elements, is typically quite large and therefore reduces the efficiency of pharmacophore based screening. We have developed a new method to select important pharmacophore elements using hydration-site information. The basic premise is that ligand functional groups that replace water molecules in the apo protein contribute strongly to the overall binding affinity of the ligand, due to the additional free energy gained from releasing the water molecule into the bulk solvent. We computed the free energy of water released from the binding site for each hydration site using thermodynamic analysis of molecular dynamics (MD) simulations. Pharmacophores which are co-localized with hydration sites with estimated favorable contributions to the free energy of binding are selected to generate a reduced pharmacophore model. We constructed reduced pharmacophore models for three protein systems and demonstrated good enrichment quality combined with high efficiency. The reduction in pharmacophore model size reduces the required screening time by a factor of 200–500 compared to using all protein pharmacophore elements. We also describe a training process using a small set of known actives to reliably select the optimal set of criteria for pharmacophore selection for each protein system. PMID:22397751

Performance of Crohn's disease Clinical Trial Endpoints based upon Different Cutoffs for Patient Reported Outcomes or Endoscopic Activity: Analysis of EXTEND Data.

PubMed

Feagan, Brian; Sandborn, William J; Rutgeerts, Paul; Levesque, Barrett G; Khanna, Reena; Huang, Bidan; Zhou, Qian; Maa, Jen-Fue; Wallace, Kori; Lacerda, Ana; Thakkar, Roopal B; Robinson, Anne M

2018-04-23

Clinical trial endpoints for Crohn's disease (CD) activity correlate poorly with mucosal inflammation; to assess treatment efficacy, patient-reported outcomes and endoscopic assessments are preferred. This study assessed the impact on treatment efficacy estimations of using different definitions of clinical and endoscopic remission and endoscopic response, and of using site- or central-based endoscopy evaluation. This post hoc analysis of data fromEXTEND (extend the safety and efficacy of adalimumab through endoscopic healing), a placebo (PBO)-controlled, randomized trial of adalimumab (ADA) for mucosal healing, included adults with moderate-to-severe CD. Subsets of patients meeting specified Simplified Endoscopic Score for CD (SES-CD) inclusion criteria, according to site or central reading, and baseline stool frequency (SF) and/or abdominal pain score (AP) thresholds were evaluated. Various endpoint definitions based on the Crohn's Disease Activity Index (CDAI), its SF and AP components, SES-CD, and composite endpoints were compared between treatment groups. Increased stringency of Week 12 clinical endpoints compared to CDAI<150 to SF≤3.0/1.5&AP≤1.0 reduced PBO response rates by ≥12% and increased treatment effects by ≤10%. Amending the SES-CD endpoint from ≤4 to ≤2 reduced the treatment effect from 24% to 8%. Composite endpoints further diminished response rates and effect sizes. Site-based evaluation was associated with lower remission rates versus central reading in the PBO group and, thus, greater ADA-related treatment effects. This analysis is the first to demonstrate that increasing the stringency of clinical and endoscopic endpoint definitions in CD trials, especially lowering SF or SES-CD definitions, reduces the ability to detect treatment-related change in CD activity; focus on endpoints that reflect clinical change is warranted.

Theoretical analysis of the effect of particle size and support on the kinetics of oxygen reduction reaction on platinum nanoparticles

NASA Astrophysics Data System (ADS)

Viswanathan, Venkatasubramanian; Wang, Frank Yi-Fei

2012-07-01

We perform a first-principles based computational analysis of the effect of particle size and support material on the electrocatalytic activity of platinum nanoparticles. Using a mechanism for oxygen reduction that accounts for electric field effects and stabilization from the water layer on the (111) and (100) facets, we show that the model used agrees well with linear sweep voltammetry and rotating ring disk electrode experiments. We find that the per-site activity of the nanoparticle saturates for particles larger than 5 nm and we show that the optimal particle size is in the range of 2.5-3.5 nm, which agrees well with recent experimental work. We examine the effect of support material and show that the perimeter sites on the metal-support interface are important in determining the overall activity of the nanoparticles. We also develop simple geometric estimates for the activity which can be used for determining the activity of other particle shapes and sizes.We perform a first-principles based computational analysis of the effect of particle size and support material on the electrocatalytic activity of platinum nanoparticles. Using a mechanism for oxygen reduction that accounts for electric field effects and stabilization from the water layer on the (111) and (100) facets, we show that the model used agrees well with linear sweep voltammetry and rotating ring disk electrode experiments. We find that the per-site activity of the nanoparticle saturates for particles larger than 5 nm and we show that the optimal particle size is in the range of 2.5-3.5 nm, which agrees well with recent experimental work. We examine the effect of support material and show that the perimeter sites on the metal-support interface are important in determining the overall activity of the nanoparticles. We also develop simple geometric estimates for the activity which can be used for determining the activity of other particle shapes and sizes. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr30572k

77 FR 51535 - Agency Information Collection Activities; Submission for OMB Review; Comment Request; Extension

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-24

... following the instructions on the web- based form. If you prefer to file your comment on paper, mail or... the Web site of a vendor of personal health records; (2) offers products or services through the Web... Web site, at http://www.ftc.gov/os/publiccomments.shtm . As a matter of discretion, the Commission...

Development of Novel Non-Pt Group Metal Electrocatalysts for PEM Fuel Cell Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mukerjee, Sanjeev; Atanassov, Plamen; Barton, Scott

The objective of this multi-institutional effort was to comprehensively pursue the goal of eliminating noble metal (Pt group metals, PGM) from the cathodic oxygen reduction reaction (ORR) electrode thereby providing a quantum leap in lowering the overall PGM loading in a polymer electrolyte fuel cell (PEMFC). The overall project scope encompassed (a) comprehensive materials discovery effort, (b) a concomitant effort to scale up these materials with very high ( ±5%) reproducibility, both intra and inter, (c) understanding mass transport in porous medium both in gas diffusion and micro-porous layers for enhanced areal activity, (d) understanding mechanistic aspects of active sitemore » structure and ORR electrocatalytic pathway. Overall project milestones and metrics were (a) first phase effort based on performance in oxygen where the project’s Go/No-Go decision point milestone of 100 mA/cm 2 at 0.8 V (internal resistance-free, iR-free) at 80°C, pure H 2/O 2, with 1.5 bar total pressure was met. Subsequently, the principle objectives were to (a) transition the project from H 2/O 2 to H 2/Air with slated target of exceeding 30 mA/cm 2 @ 0.8 V, 2.5 bar total pressure and an end of the project target of 1 A/cm 2 @ 0.4 V (same total pressure), both under 100% relative humidity. The target for catalyst material scale up was to achieve 100 g batch size at the end of the program. This scale up target had a quality control milestone of less than 5% variation of activity measured with H 2/Air (2.5 bar total pressure) at 0.8 V. In addition, the project also aimed at arriving at a unified understanding of the nature of active sites in these catalysts as well as some preliminary understanding of the mechanistic pathway. Also addressed is the development of an integrated method for determination of mass transport parameters using a combination of Helox experiments and modeling of the gas diffusion media, especially the micro-porous layer on the gas diffusion electrode (GDE). Detailed aspects of technical metrics and milestones are provided in Table 1 of the final report. Besides the success in meeting the DOE milestones in areal activities for oxygen and air described above one of the key successes of this effort was in understanding the nature of the active site(s) and aspects of the ORR pathway. In this it should be noted that the materials discovery effort provided for use of unconventional approaches, some of which led to very active catalysts. This aspect is described in detail in the final report. From a mechanistic perspective, a combination spectroscopic techniques confirmed that the high activity observed for most pyrolyzed Fe-based catalysts, irrespective of the precursors materials (macrocycles or individual Fe, N, and C precursors), the synthesis method (wet chemical impregnation or SSM), and final Fe-species (with or without inorganic iron species), can mainly be attributed to a single active site: non-planar Fe-N 4 moiety embedded in distorted carbon matrix characterized by a high potential for the Fe 2+/3+ redox transition in acidic electrolyte/environment, which is likely formed via the covalent incorporation of distorted Fe-N4 moieties in the defective centers on the carbon basal plane or in armchair edges of two adjacent graphene layers. This Fe 2+-N 4 active site at 0.3 V undergoes redox transition to a pentacoordinate HO₋Fe 3+₋N 4 at 0.90 V, and the adsorption of the *OH trigged by the Fe 2+/Fe 3+ redox transition poisons the active sites, thereby providing experimental evidence of the redox mechanism. Moreover, a highly active MOF-based catalyst devoid of any Fe-N moieties was also developed, and the active sites were identified as nitrogen-doped carbon fibers with embedded iron particles that are not directly involved in the oxygen reduction pathway. The high ORR activity and durability of catalysts involving this site in fuel cells are attributed to the high density of active sites and the elimination or reduction of Fenton-type processes. The latter are initiated by hydrogen peroxide but are known to be accelerated by iron ions exposed to the surface, resulting in the formation of damaging free-radicals. We expect that the comprehensive understanding of the synthesis-products correlations, nature of active sites, and the reaction mechanisms acquired here by systematically studying a broad variety of M-N-C materials under in situ conditions will provide guidelines to rational design of this type of non-PGM catalysts.« less

7-Methoxytacrine-adamantylamine heterodimers as cholinesterase inhibitors in Alzheimer's disease treatment--synthesis, biological evaluation and molecular modeling studies.

PubMed

Spilovska, Katarina; Korabecny, Jan; Kral, Jan; Horova, Anna; Musilek, Kamil; Soukup, Ondrej; Drtinova, Lucie; Gazova, Zuzana; Siposova, Katarina; Kuca, Kamil

2013-02-20

A structural series of 7-MEOTA-adamantylamine thioureas was designed, synthesized and evaluated as inhibitors of human acetylcholinesterase (hAChE) and human butyrylcholinesterase (hBChE). The compounds were prepared based on the multi-target-directed ligand strategy with different linker lengths (n = 2-8) joining the well-known NMDA antagonist adamantine and the hAChE inhibitor 7-methoxytacrine (7-MEOTA). Based on in silico studies, these inhibitors proved dual binding site character capable of simultaneous interaction with the peripheral anionic site (PAS) of hAChE and the catalytic active site (CAS). Clearly, these structural derivatives exhibited very good inhibitory activity towards hBChE resulting in more selective inhibitors of this enzyme. The most potent cholinesterase inhibitor was found to be thiourea analogue 14 (with an IC₅₀ value of 0.47 µM for hAChE and an IC₅₀ value of 0.11 µM for hBChE, respectively). Molecule 14 is a suitable novel lead compound for further evaluation proving that the strategy of dual binding site inhibitors might be a promising direction for development of novel AD drugs.

Structure of granzyme C reveals an unusual mechanism of protease autoinhibition

PubMed Central

Kaiserman, Dion; Buckle, Ashley M.; Van Damme, Petra; Irving, James A.; Law, Ruby H. P.; Matthews, Antony Y.; Bashtannyk-Puhalovich, Tanya; Langendorf, Chris; Thompson, Philip; Vandekerckhove, Joël; Gevaert, Kris; Whisstock, James C.; Bird, Phillip I.

2009-01-01

Proteases act in important homeostatic pathways and are tightly regulated. Here, we report an unusual structural mechanism of regulation observed by the 2.5-Å X-ray crystal structure of the serine protease, granzyme C. Although the active-site triad residues adopt canonical conformations, the oxyanion hole is improperly formed, and access to the primary specificity (S1) pocket is blocked through a reversible rearrangement involving Phe-191. Specifically, a register shift in the 190-strand preceding the active-site serine leads to Phe-191 filling the S1 pocket. Mutation of a unique Glu–Glu motif at positions 192–193 unlocks the enzyme, which displays chymase activity, and proteomic analysis confirms that activity of the wild-type protease can be released through interactions with an appropriate substrate. The 2.5-Å structure of the unlocked enzyme reveals unprecedented flexibility in the 190-strand preceding the active-site serine that results in Phe-191 vacating the S1 pocket. Overall, these observations describe a broadly applicable mechanism of protease regulation that cannot be predicted by template-based modeling or bioinformatic approaches alone. PMID:19299505

Synthesis, Activity and Structural Analysis of Novel α-Hydroxytropolone Inhibitors of Human Immunodeficiency Virus Reverse Transcriptase-Associated Ribonuclease H

PubMed Central

Chung, Suhman; Himmel, Daniel M.; Jiang, Jian-Kang; Wojtak, Krzysztof; Bauman, Joseph D.; Rausch, Jason W.; Wilson, Jennifer A.; Beutler, John A.; Thomas, Craig J.; Arnold, Eddy; Le Grice, Stuart F.J.

2011-01-01

The α-hydroxytroplone, manicol (5,7-dihydroxy-2-isopropenyl-9-methyl-1,2,3,4-tetrahydro-benzocyclohepten-6-one) potently and specifically inhibits ribonuclease H (RNase H) activity of human immunodeficiency virus reverse transcriptase (HIV RT) in vitro. However, manicol was ineffective in reducing virus replication in culture. Ongoing efforts to improve the potency and specificity over the lead compound led us to synthesize 14 manicol derivatives that retain the divalent metal-chelating α-hydroxytropolone pharmacophore. These efforts were augmented by a high resolution structure of p66/p51 HIV-1 RT containing the nonnucleoside reverse transcriptase inhibitor (NNRTI), TMC278 and manicol in the DNA polymerase and RNase H active sites, respectively. We demonstrate here that several modified α-hydroxytropolones exhibit antiviral activity at non-cytotoxic concentrations. Inclusion of RNase H active site mutants indicated that manicol analogs can occupy an additional site in or around the DNA polymerase catalytic center. Collectively, our studies will promote future structure-based design of improved α-hydroxytropolones to complement the NRTI and NNRTI currently in clinical use. PMID:21568335

The archaeo-eukaryotic primase of plasmid pRN1 requires a helix bundle domain for faithful primer synthesis

PubMed Central

Beck, Kirsten; Vannini, Alessandro; Cramer, Patrick; Lipps, Georg

2010-01-01

The plasmid pRN1 encodes for a multifunctional replication protein with primase, DNA polymerase and helicase activity. The minimal region required for primase activity encompasses amino-acid residues 40–370. While the N-terminal part of that minimal region (residues 47–247) folds into the prim/pol domain and bears the active site, the structure and function of the C-terminal part (residues 248–370) is unknown. Here we show that the C-terminal part of the minimal region folds into a compact domain with six helices and is stabilized by a disulfide bond. Three helices superimpose well with the C-terminal domain of the primase of the bacterial broad host range plasmid RSF1010. Structure-based site-directed mutagenesis shows that the C-terminal helix of the helix bundle domain is required for primase activity although it is distant to the active site in the crystallized conformation. Furthermore, we identified mutants of the C-terminal domain, which are defective in template binding, dinucleotide formation and conformation change prior to DNA extension. PMID:20511586

Tricyclic Covalent Inhibitors Selectively Target Jak3 through an Active Site Thiol

DOE PAGES

Goedken, Eric R.; Argiriadi, Maria A.; Banach, David L.; ...

2014-12-31

The action of Janus kinases (JAKs) is required for multiple cytokine signaling pathways, and as such, JAK inhibitors hold promise for treatment of autoimmune disorders, including rheumatoid arthritis, inflammatory bowel disease, and psoriasis. However, due to high similarity in the active sites of the four members (Jak1, Jak2, Jak3, and Tyk2), developing selective inhibitors within this family is challenging. In this paper, we have designed and characterized substituted, tricyclic Jak3 inhibitors that selectively avoid inhibition of the other JAKs. This is accomplished through a covalent interaction between an inhibitor containing a terminal electrophile and an active site cysteine (Cys-909). Wemore » found that these ATP competitive compounds are irreversible inhibitors of Jak3 enzyme activity in vitro. They possess high selectivity against other kinases and can potently (IC 50 < 100 nM) inhibit Jak3 activity in cell-based assays. Finally, these results suggest irreversible inhibitors of this class may be useful selective agents, both as tools to probe Jak3 biology and potentially as therapies for autoimmune diseases.« less

Tricyclic Covalent Inhibitors Selectively Target Jak3 through an Active Site Thiol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goedken, Eric R.; Argiriadi, Maria A.; Banach, David L.

The action of Janus kinases (JAKs) is required for multiple cytokine signaling pathways, and as such, JAK inhibitors hold promise for treatment of autoimmune disorders, including rheumatoid arthritis, inflammatory bowel disease, and psoriasis. However, due to high similarity in the active sites of the four members (Jak1, Jak2, Jak3, and Tyk2), developing selective inhibitors within this family is challenging. In this paper, we have designed and characterized substituted, tricyclic Jak3 inhibitors that selectively avoid inhibition of the other JAKs. This is accomplished through a covalent interaction between an inhibitor containing a terminal electrophile and an active site cysteine (Cys-909). Wemore » found that these ATP competitive compounds are irreversible inhibitors of Jak3 enzyme activity in vitro. They possess high selectivity against other kinases and can potently (IC 50 < 100 nM) inhibit Jak3 activity in cell-based assays. Finally, these results suggest irreversible inhibitors of this class may be useful selective agents, both as tools to probe Jak3 biology and potentially as therapies for autoimmune diseases.« less

A Graphene Composite Material with Single Cobalt Active Sites: A Highly Efficient Counter Electrode for Dye-Sensitized Solar Cells.

PubMed

Cui, Xiaoju; Xiao, Jianping; Wu, Yihui; Du, Peipei; Si, Rui; Yang, Huaixin; Tian, Huanfang; Li, Jianqi; Zhang, Wen-Hua; Deng, Dehui; Bao, Xinhe

2016-06-01

The design of catalysts that are both highly active and stable is always challenging. Herein, we report that the incorporation of single metal active sites attached to the nitrogen atoms in the basal plane of graphene leads to composite materials with superior activity and stability when used as counter electrodes in dye-sensitized solar cells (DSSCs). A series of composite materials based on different metals (Mn, Fe, Co, Ni, and Cu) were synthesized and characterized. Electrochemical measurements revealed that CoN4 /GN is a highly active and stable counter electrode for the interconversion of the redox couple I(-) /I3 (-) . DFT calculations revealed that the superior properties of CoN4 /GN are due to the appropriate adsorption energy of iodine on the confined Co sites, leading to a good balance between adsorption and desorption processes. Its superior electrochemical performance was further confirmed by fabricating DSSCs with CoN4  /GN electrodes, which displayed a better power conversion efficiency than the Pt counterpart. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Knowledge based ranking algorithm for comparative assessment of post-closure care needs of closed landfills.

PubMed

Sizirici, Banu; Tansel, Berrin; Kumar, Vivek

2011-06-01

Post-closure care (PCC) activities at landfills include cap maintenance; water quality monitoring; maintenance and monitoring of the gas collection/control system, leachate collection system, groundwater monitoring wells, and surface water management system; and general site maintenance. The objective of this study was to develop an integrated data and knowledge based decision making tool for preliminary estimation of PCC needs at closed landfills. To develop the decision making tool, 11 categories of parameters were identified as critical areas which could affect future PCC needs. Each category was further analyzed by detailed questions which could be answered with limited data and knowledge about the site, its history, location, and site specific characteristics. Depending on the existing knowledge base, a score was assigned to each question (on a scale 1-10, as 1 being the best and 10 being the worst). Each category was also assigned a weight based on its relative importance on the site conditions and PCC needs. The overall landfill score was obtained from the total weighted sum attained. Based on the overall score, landfill conditions could be categorized as critical, acceptable, or good. Critical condition indicates that the landfill may be a threat to the human health and the environment and necessary steps should be taken. Acceptable condition indicates that the landfill is currently stable and the monitoring should be continued. Good condition indicates that the landfill is stable and the monitoring activities can be reduced in the future. The knowledge base algorithm was applied to two case study landfills for preliminary assessment of PCC performance. Copyright © 2011 Elsevier Ltd. All rights reserved.

Antibody-catalyzed benzoin oxidation as a mechanistic probe for nucleophilic catalysis by an active site lysine.

PubMed

Sklute, Genia; Oizerowich, Rachel; Shulman, Hagit; Keinan, Ehud

2004-05-03

Aldolase antibody 24H6, which was obtained by reactive immunization against a 1,3-diketone hapten, is shown to catalyze additional reactions, including H/D exchange and oxidation reactions. Comparison of the H/D exchange reaction at the alpha-position of a wide range of aldehydes and ketones by 24H6 and by other aldolase antibodies, such as 38C2, pointed at the significantly larger size of the 24H6 active site. This property allowed for the catalysis of the oxidation of substituted benzoins to benzils by potassium ferricyanide. This reaction was used as a mechanistic probe to learn about the initial steps of the 24H6-catalyzed aldol condensation reaction. The Hammett correlation (rho=4.7) of log(k(cat)) versus the substituent constant, sigma, revealed that the reaction involves rapid formation of a Schiff base intermediate from the ketone and an active site lysine residue. The rate-limiting step in this oxidation reaction is the conversion of the Schiff base to an enamine intermediate. In addition, linear correlation (rho=3.13) was found between log(K(M)) and sigma, indicating that electronic rather than steric factors are dominant in the antibody-substrate binding phenomenon and confirming that the reversible formation of a Schiff base intermediate comprises part of the substrate-binding mechanism.

Water-level altitudes 2013 and water-level changes in the Chicot, Evangeline, and Jasper aquifers and compaction 1973--2012 in the Chicot and Evangeline aquifers, Houston-Galveston region, Texas

USGS Publications Warehouse

Kasmarek, Mark C.; Johnson, Michaela R.; Ramage, Jason K.

2013-01-01

Compaction of subsurface sediments (mostly in the clay and silt layers) of the Chicot and Evangeline aquifers was recorded continuously by 13 borehole extensometers at 11 sites that were either activated or installed between 1973 and 1980. For the period of record beginning in 1973 (or later depending on activation or installation date) and ending in December 2012, cumulative measured compaction by 12 of the 13 extensometers ranged from 0.100 ft at the Texas City-Moses Lake extensometer to 3.632 ft at the Addicks extensometer (data were used from only one of two extensometers at one site). The rate of compaction varies from site to site because of differences in groundwater withdrawals near each site and differences among sites in the clay-to-sand ratio in the subsurface sediments. Therefore, it is not possible to extrapolate or infer a rate of compaction for adjacent areas based on the rate of compaction measured at a nearby extensometer.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The active site of hydroxynitrile lyase from Prunus amygdalus: Modeling studies provide new insights into the mechanism of cyanogenesis

PubMed Central

Dreveny, Ingrid; Kratky, Christoph; Gruber, Karl

2002-01-01

The FAD-dependent hydroxynitrile lyase from almond (Prunus amygdalus, PaHNL) catalyzes the cleavage of R-mandelonitrile into benzaldehyde and hydrocyanic acid. Catalysis of the reverse reaction—the enantiospecific formation of α-hydroxynitriles—is now widely utilized in organic syntheses as one of the few industrially relevant examples of enzyme-mediated C–C bond formation. Starting from the recently determined X-ray crystal structure, systematic docking calculations with the natural substrate were used to locate the active site of the enzyme and to identify amino acid residues involved in substrate binding and catalysis. Analysis of the modeled substrate complexes supports an enzymatic mechanism that includes the flavin cofactor as a mere "spectator" of the reaction and relies on general acid/base catalysis by the conserved His-497. Stabilization of the negative charge of the cyanide ion is accomplished by a pronounced positive electrostatic potential at the binding site. PaHNL activity requires the FAD cofactor to be bound in its oxidized form, and calculations of the pKa of enzyme-bound HCN showed that the observed inactivation upon cofactor reduction is largely caused by the reversal of the electrostatic potential within the active site. The suggested mechanism closely resembles the one proposed for the FAD-independent, and structurally unrelated HNL from Hevea brasiliensis. Although the actual amino acid residues involved in the catalytic cycle are completely different in the two enzymes, a common motif for the mechanism of cyanogenesis (general acid/base catalysis plus electrostatic stabilization of the cyanide ion) becomes evident. PMID:11790839

Mojo Hand, a TALEN design tool for genome editing applications.

PubMed

Neff, Kevin L; Argue, David P; Ma, Alvin C; Lee, Han B; Clark, Karl J; Ekker, Stephen C

2013-01-16

Recent studies of transcription activator-like (TAL) effector domains fused to nucleases (TALENs) demonstrate enormous potential for genome editing. Effective design of TALENs requires a combination of selecting appropriate genetic features, finding pairs of binding sites based on a consensus sequence, and, in some cases, identifying endogenous restriction sites for downstream molecular genetic applications. We present the web-based program Mojo Hand for designing TAL and TALEN constructs for genome editing applications (http://www.talendesign.org). We describe the algorithm and its implementation. The features of Mojo Hand include (1) automatic download of genomic data from the National Center for Biotechnology Information, (2) analysis of any DNA sequence to reveal pairs of binding sites based on a user-defined template, (3) selection of restriction-enzyme recognition sites in the spacer between the TAL monomer binding sites including options for the selection of restriction enzyme suppliers, and (4) output files designed for subsequent TALEN construction using the Golden Gate assembly method. Mojo Hand enables the rapid identification of TAL binding sites for use in TALEN design. The assembly of TALEN constructs, is also simplified by using the TAL-site prediction program in conjunction with a spreadsheet management aid of reagent concentrations and TALEN formulation. Mojo Hand enables scientists to more rapidly deploy TALENs for genome editing applications.

Pedagogical Strategies for Work-Based Learning. IEE Working Paper No. 12.

ERIC Educational Resources Information Center

Hughes, Katherine L.; Moore, David Thornton

Fourteen school-to-work programs characterized by strong work-based learning components and solid employer involvement were examined in a 3-year study to identify pedagogical factors associated with successful work-based learning programs. The main data collection activities were as follows: site visits to the 15 programs to interview faculty,…

EPA Region 2 SEMS_CERCLIS Sites All [R2] and SEMS_CERCLIS Sites NPL [R2] GIS Layers

EPA Pesticide Factsheets

The Region 2 SEMS_CERCLIS Sites All [R2] GIS layer contains unique Superfund Enterprise Management System (SEMS) site records. These records have the following NPL_STATUS designations: CURRENTLY ON FINAL NPL, DELETED FROM FINAL NPL, NOT ON NPL, PROPOSED FOR NPL, REMOVED FROM PROPOSED NPL, and SITE IS PART OF NPL SITE. The Region 2 SEMS_CERCLIS NPL Sites [R2] GIS layer only has SEMS records with the following NPL_STATUS designations: 'CURRENTLY ON FINAL NPL', 'DELETED FROM FINAL NPL', 'PROPOSED FOR NPL'.The Superfund Enterprise Management System (SEMS) is EPA's official record for tracking hazardous waste sites, potentially hazardous waste sites, and remedial activities performed in support of the Superfund Program across the nation. This includes sites that are on the National Priorities List (NPL) or are being considered for the NPL. SEMS represents a joint development and ongoing collaboration between Superfund's Remedial, Removal, Federal Facilities, Enforcement, and Emergency Response programs. It provides its wide audience base with a means of ongoing analysis of Superfund Program activities and informational needs at the site, regional management, and national management levels. The customers of SEMS or SEMS data are five EPA Headquarters offices and regional staff, citizens, the regulated community, other Federal agencies, States, Tribes, local agencies, and industry. SEMS stakeholders are States, Congress, other Federal agencies, industry groups, and cit

The Energy Landscape Analysis of Cancer Mutations in Protein Kinases

PubMed Central

Dixit, Anshuman; Verkhivker, Gennady M.

2011-01-01

The growing interest in quantifying the molecular basis of protein kinase activation and allosteric regulation by cancer mutations has fueled computational studies of allosteric signaling in protein kinases. In the present study, we combined computer simulations and the energy landscape analysis of protein kinases to characterize the interplay between oncogenic mutations and locally frustrated sites as important catalysts of allostetric kinase activation. While structurally rigid kinase core constitutes a minimally frustrated hub of the catalytic domain, locally frustrated residue clusters, whose interaction networks are not energetically optimized, are prone to dynamic modulation and could enable allosteric conformational transitions. The results of this study have shown that the energy landscape effect of oncogenic mutations may be allosteric eliciting global changes in the spatial distribution of highly frustrated residues. We have found that mutation-induced allosteric signaling may involve a dynamic coupling between structurally rigid (minimally frustrated) and plastic (locally frustrated) clusters of residues. The presented study has demonstrated that activation cancer mutations may affect the thermodynamic equilibrium between kinase states by allosterically altering the distribution of locally frustrated sites and increasing the local frustration in the inactive form, while eliminating locally frustrated sites and restoring structural rigidity of the active form. The energy landsape analysis of protein kinases and the proposed role of locally frustrated sites in activation mechanisms may have useful implications for bioinformatics-based screening and detection of functional sites critical for allosteric regulation in complex biomolecular systems. PMID:21998754

Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

PubMed Central

Wozniak, Christopher E.; Hughes, Kelly T.

2008-01-01

Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

Tumor suppressor genes are larger than apoptosis-effector genes and have more regions of active chromatin: Connection to a stochastic paradigm for sequential gene expression programs.

PubMed

Garcia, Marlene; Mauro, James A; Ramsamooj, Michael; Blanck, George

2015-08-03

Apoptosis- and proliferation-effector genes are substantially regulated by the same transactivators, with E2F-1 and Oct-1 being notable examples. The larger proliferation-effector genes have more binding sites for the transactivators that regulate both sets of genes, and proliferation-effector genes have more regions of active chromatin, i.e, DNase I hypersensitive and histone 3, lysine-4 trimethylation sites. Thus, the size differences between the 2 classes of genes suggest a transcriptional regulation paradigm whereby the accumulation of transcription factors that regulate both sets of genes, merely as an aspect of stochastic behavior, accumulate first on the larger proliferation-effector gene "traps," and then accumulate on the apoptosis effector genes, thereby effecting sequential activation of the 2 different gene sets. As IRF-1 and p53 levels increase, tumor suppressor proteins are first activated, followed by the activation of apoptosis-effector genes, for example during S-phase pausing for DNA repair. Tumor suppressor genes are larger than apoptosis-effector genes and have more IRF-1 and p53 binding sites, thereby likewise suggesting a paradigm for transcription sequencing based on stochastic interactions of transcription factors with different gene classes. In this report, using the ENCODE database, we determined that tumor suppressor genes have a greater number of open chromatin regions and histone 3 lysine-4 trimethylation sites, consistent with the idea that a larger gene size can facilitate earlier transcriptional activation via the inclusion of more transactivator binding sites.

Crystal structure of the dithiol oxidase DsbA enzyme from proteus mirabilis bound non-covalently to an active site peptide ligand.

PubMed

Kurth, Fabian; Duprez, Wilko; Premkumar, Lakshmanane; Schembri, Mark A; Fairlie, David P; Martin, Jennifer L

2014-07-11

The disulfide bond forming DsbA enzymes and their DsbB interaction partners are attractive targets for development of antivirulence drugs because both are essential for virulence factor assembly in Gram-negative pathogens. Here we characterize PmDsbA from Proteus mirabilis, a bacterial pathogen increasingly associated with multidrug resistance. PmDsbA exhibits the characteristic properties of a DsbA, including an oxidizing potential, destabilizing disulfide, acidic active site cysteine, and dithiol oxidase catalytic activity. We evaluated a peptide, PWATCDS, derived from the partner protein DsbB and showed by thermal shift and isothermal titration calorimetry that it binds to PmDsbA. The crystal structures of PmDsbA, and the active site variant PmDsbAC30S were determined to high resolution. Analysis of these structures allows categorization of PmDsbA into the DsbA class exemplified by the archetypal Escherichia coli DsbA enzyme. We also present a crystal structure of PmDsbAC30S in complex with the peptide PWATCDS. The structure shows that the peptide binds non-covalently to the active site CXXC motif, the cis-Pro loop, and the hydrophobic groove adjacent to the active site of the enzyme. This high-resolution structural data provides a critical advance for future structure-based design of non-covalent peptidomimetic inhibitors. Such inhibitors would represent an entirely new antibacterial class that work by switching off the DSB virulence assembly machinery. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Eurasian beaver activity increases water storage, attenuates flow and mitigates diffuse pollution from intensively-managed grasslands.

PubMed

Puttock, Alan; Graham, Hugh A; Cunliffe, Andrew M; Elliott, Mark; Brazier, Richard E

2017-01-15

Beavers are the archetypal keystone species, which can profoundly alter ecosystem structure and function through their ecosystem engineering activity, most notably the building of dams. This can have a major impact upon water resource management, flow regimes and water quality. Previous research has predominantly focused on the activities of North American beaver (Castor canadensis) located in very different environments, to the intensive lowland agricultural landscapes of the United Kingdom and elsewhere in Europe. Two Eurasian beavers (Castor fiber) were introduced to a wooded site, situated on a first order tributary, draining from intensively managed grassland. The site was monitored to understand impacts upon water storage, flow regimes and water quality. Results indicated that beaver activity, primarily via the creation of 13 dams, has increased water storage within the site (holding ca. 1000m 3 in beaver ponds) and beavers were likely to have had a significant flow attenuation impact, as determined from peak discharges (mean 30±19% reduction), total discharges (mean 34±9% reduction) and peak rainfall to peak discharge lag times (mean 29±21% increase) during storm events. Event monitoring of water entering and leaving the site showed lower concentrations of suspended sediment, nitrogen and phosphate leaving the site (e.g. for suspended sediment; average entering site: 112±72mgl -1 , average leaving site: 39±37mgl -1 ). Combined with attenuated flows, this resulted in lower diffuse pollutant loads in water downstream. Conversely, dissolved organic carbon concentrations and loads downstream were higher. These observed changes are argued to be directly attributable to beaver activity at the site which has created a diverse wetland environment, reducing downstream hydrological connectivity. Results have important implications for beaver reintroduction programs which may provide nature based solutions to the catchment-scale water resource management issues that are faced in agricultural landscapes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Estimation of radioactive contamination of soils from the "Balapan" and the "Experimental field" technical areas of the Semipalatinsk nuclear test site.

PubMed

Evseeva, T; Belykh, E; Geras'kin, S; Majstrenko, T

2012-07-01

In spite of the long history of the research, radioactive contamination of the Semipalatinsk nuclear test site (SNTS) in the Republic of Kazakhstan has not been adequately characterized. Our cartographic investigation has demonstrated highly variable radioactive contamination of the SNTS. The Cs-137, Sr-90, Eu-152, Eu-154, Co-60, and Am-241 activity concentrations in soil samples from the "Balapan" site were 42.6-17646, 96-18250, 1.05-11222, 0.6-4865, 0.23-4893, and 1.2-1037 Bq kg(-1), correspondingly. Cs-137 and Sr-90 activity concentrations in soil samples from the "Experimental field" site were varied from 87 up to 400 and from 94 up to 1000 Bq kg(-1), respectively. Activity concentrations of Co-60, Eu-152, and Eu-154 were lower than the minimum detectable activity of the method used. Concentrations of naturally occurring radionuclides (K-40, Ra-226, U-238, and Th-232) in the majority of soil samples from the "Balapan" and the "Experimental field" sites did not exceed typical for surrounding of the SNTS areas levels. Estimation of risks associated with radioactive contamination based on the IAEA clearance levels for a number of key radionuclides in solid materials shows that soils sampled from the "Balapan" and the "Experimental field" sites might be considered as radioactive wastes. Decrease in specific activity of soil from the sites studied up to safety levels due to Co-60, Cs-137, Sr-90, Eu-152, Eu-154 radioactive decay and Am-241 accumulation-decay will occur not earlier than 100 years. In contrast, soils from the "Experimental field" and the "Balapan" sites (except 0.5-2.5 km distance from the "Chagan" explosion point) cannot be regarded as the radioactive wastes according safety norms valid in Russia and Kazakhstan. Copyright © 2012 Elsevier Ltd. All rights reserved.

Developing Hypothetical Inhibition Mechanism of Novel Urea Transporter B Inhibitor

NASA Astrophysics Data System (ADS)

Li, Min; Tou, Weng Ieong; Zhou, Hong; Li, Fei; Ren, Huiwen; Chen, Calvin Yu-Chian; Yang, Baoxue

2014-07-01

Urea transporter B (UT-B) is a membrane channel protein that specifically transports urea. UT-B null mouse exhibited urea selective urine concentrating ability deficiency, which suggests the potential clinical applications of the UT-B inhibitors as novel diuretics. Primary high-throughput virtual screening (HTVS) of 50000 small-molecular drug-like compounds identified 2319 hit compounds. These 2319 compounds were screened by high-throughput screening using an erythrocyte osmotic lysis assay. Based on the pharmacological data, putative UT-B binding sites were identified by structure-based drug design and validated by ligand-based and QSAR model. Additionally, UT-B structural and functional characteristics under inhibitors treated and untreated conditions were simulated by molecular dynamics (MD). As the result, we identified four classes of compounds with UT-B inhibitory activity and predicted a human UT-B model, based on which computative binding sites were identified and validated. A novel potential mechanism of UT-B inhibitory activity was discovered by comparing UT-B from different species. Results suggest residue PHE198 in rat and mouse UT-B might block the inhibitor migration pathway. Inhibitory mechanisms of UT-B inhibitors and the functions of key residues in UT-B were proposed. The binding site analysis provides a structural basis for lead identification and optimization of UT-B inhibitors.

Measurement of Aerosolization of Asbestos from Soil Using the Releasable Asbestos Field Sampler (RAFS)

EPA Science Inventory

Releasable Asbestos Field Sampler (RAFS) was designed to provide an alternative to activity-based sampling (ABS) for determining likely asbestos exposure resulting from activities at site with low contaminant levels. This paper presents a description of the RAFS device and a comp...

Direct atomic-level insight into the active sites of a high-performance PGM-free ORR catalyst

NASA Astrophysics Data System (ADS)

Chung, Hoon T.; Cullen, David A.; Higgins, Drew; Sneed, Brian T.; Holby, Edward F.; More, Karren L.; Zelenay, Piotr

2017-08-01

Platinum group metal-free (PGM-free) metal-nitrogen-carbon catalysts have emerged as a promising alternative to their costly platinum (Pt)-based counterparts in polymer electrolyte fuel cells (PEFCs) but still face some major challenges, including (i) the identification of the most relevant catalytic site for the oxygen reduction reaction (ORR) and (ii) demonstration of competitive PEFC performance under automotive-application conditions in the hydrogen (H2)-air fuel cell. Herein, we demonstrate H2-air performance gains achieved with an iron-nitrogen-carbon catalyst synthesized with two nitrogen precursors that developed hierarchical porosity. Current densities recorded in the kinetic region of cathode operation, at fuel cell voltages greater than ~0.75 V, were the same as those obtained with a Pt cathode at a loading of 0.1 milligram of Pt per centimeter squared. The proposed catalytic active site, carbon-embedded nitrogen-coordinated iron (FeN4), was directly visualized with aberration-corrected scanning transmission electron microscopy, and the contributions of these active sites associated with specific lattice-level carbon structures were explored computationally.

PARP-1 Controls the Adipogenic Transcriptional Program by PARylating C/EBPβ and Modulating Its Transcriptional Activity.

PubMed

Luo, Xin; Ryu, Keun Woo; Kim, Dae-Seok; Nandu, Tulip; Medina, Carlos J; Gupte, Rebecca; Gibson, Bryan A; Soccio, Raymond E; Yu, Yonghao; Gupta, Rana K; Kraus, W Lee

2017-01-19

Poly(ADP-ribosyl)ation (PARylation) is a post-translational modification of proteins mediated by PARP family members, such as PARP-1. Although PARylation has been studied extensively, few examples of definitive biological roles for site-specific PARylation have been reported. Here we show that C/EBPβ, a key pro-adipogenic transcription factor, is PARylated by PARP-1 on three amino acids in a conserved regulatory domain. PARylation at these sites inhibits C/EBPβ's DNA binding and transcriptional activities and attenuates adipogenesis in various genetic and cell-based models. Interestingly, PARP-1 catalytic activity drops precipitously during the first 48 hr of differentiation, corresponding to a release of C/EBPβ from PARylation-mediated inhibition. This promotes the binding of C/EBPβ at enhancers controlling the expression of adipogenic target genes and continued differentiation. Depletion or chemical inhibition of PARP-1, or mutation of the PARylation sites on C/EBPβ, enhances these early adipogenic events. Collectively, our results provide a clear example of how site-specific PARylation drives biological outcomes. Copyright © 2017 Elsevier Inc. All rights reserved.

Entrapped Single Tungstate Site in Zeolite for Cooperative Catalysis of Olefin Metathesis with Brønsted Acid Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Pu; Ye, Lin; Sun, Zhenyu

Industrial olefin metathesis catalysts generally suffer from low reaction rates and require harsh reaction conditions for moderate activities. This is due to their inability to prevent metathesis active sites (MAS) from aggregation and their intrinsic poor adsorption and activation of olefin molecules. Here, isolated tungstate species as single molecular MAS is immobilized inside zeolite pores by Bronsted acid sites (BAS) on the inner surface. It is demonstrated for the first time that unoccupied BAS in atomic proximity to MAS enhance olefin adsorption and greatly facilitate the formation of metallocycle intermediates in a stereospecific manner. Thus, effective cooperative catalysis takes placemore » over the BAS-MAS pair. In consequence, for the cross-metathesis of ethene and trans-2-butene to propene, under the same mild reaction conditions, the propene production rate over WOx/USY is ca. 7,300 times that over the industrial WO3/SiO2 based catalyst. A propene yield up to 79% (80% selectivity) without observable deactivation was obtained over WOx/USY for a wide range of reaction conditions.« less

Novel biphenyl ester derivatives as tyrosinase inhibitors: Synthesis, crystallographic, spectral analysis and molecular docking studies.

PubMed

Kwong, Huey Chong; Chidan Kumar, C S; Mah, Siau Hui; Chia, Tze Shyang; Quah, Ching Kheng; Loh, Zi Han; Chandraju, Siddegowda; Lim, Gin Keat

2017-01-01

Biphenyl-based compounds are clinically important for the treatments of hypertension and inflammatory, while many more are under development for pharmaceutical uses. In the present study, a series of 2-([1,1'-biphenyl]-4-yl)-2-oxoethyl benzoates, 2(a-q), and 2-([1,1'-biphenyl]-4-yl)-2-oxoethyl pyridinecarboxylate, 2(r-s) were synthesized by reacting 1-([1,1'-biphenyl]-4-yl)-2-bromoethan-1-one with various carboxylic acids using potassium carbonate in dimethylformamide at ambient temperature. Single-crystal X-ray diffraction studies revealed a more closely packed crystal structure can be produced by introduction of biphenyl moiety. Five of the compounds among the reported series exhibited significant anti-tyrosinase activities, in which 2p, 2r and 2s displayed good inhibitions which are comparable to standard inhibitor kojic acid at concentrations of 100 and 250 μg/mL. The inhibitory effects of these active compounds were further confirmed by computational molecular docking studies and the results revealed the primary binding site is active-site entrance instead of inner copper binding site which acted as the secondary binding site.

Direct atomic-level insight into the active sites of a high-performance PGM-free ORR catalyst

DOE PAGES

Chung, Hoon T.; Cullen, David A.; Higgins, Drew; ...

2017-08-04

Platinum group metal–free (PGM-free) metal-nitrogen-carbon catalysts have emerged as a promising alternative to their costly platinum (Pt)–based counterparts in polymer electrolyte fuel cells (PEFCs) but still face some major challenges, including (i) the identification of the most relevant catalytic site for the oxygen reduction reaction (ORR) and (ii) demonstration of competitive PEFC performance under automotive-application conditions in the hydrogen (H 2)–air fuel cell. We demonstrate H 2-air performance gains achieved with an iron-nitrogen-carbon catalyst synthesized with two nitrogen precursors that developed hierarchical porosity. In current densities recorded in the kinetic region of cathode operation, at fuel cell voltages greater thanmore » ~0.75 V, were the same as those obtained with a Pt cathode at a loading of 0.1 milligram of Pt per centimeter squared. The catalytic active site we proposed, carbon-embedded nitrogen-coordinated iron (FeN 4), was directly visualized with aberration-corrected scanning transmission electron microscopy, and the contributions of these active sites associated with specific lattice-level carbon structures were explored computationally.« less

Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

PubMed Central

Jayasena, S D; Johnston, B H

1992-01-01

tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648

Risk based requirements for long term stewardship: A proof-of-principle analysis of an analytic method tested on selected Hanford locations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jarvis, T.T.; Andrews, W.B.; Buck, J.W.

1998-03-01

Since 1989, the Department of Energy`s (DOE) Environmental Management (EM) Program has managed the environmental legacy of US nuclear weapons production, research and testing at 137 facilities in 31 states and one US territory. The EM program has conducted several studies on the public risks posed by contaminated sites at these facilities. In Risks and the Risk Debate [DOE, 1995a], the Department analyzed the risks at sites before, during, and after remediation work by the EM program. The results indicated that aside from a few urgent risks, most hazards present little inherent risk because physical and active site management controlsmore » limit both the releases of site contaminants, and public access to these hazards. Without these controls, these sites would pose greater risks to the public. Past risk reports, however, provided little information about post-cleanup risk, primarily because of uncertainty about future site uses and site characteristics at the end of planned cleanup activities. This is of concern because in many cases current cleanup technologies, and remedies, will last a shorter period of time than the waste itself and the resulting contamination will remain hazardous.« less

Structure-based Mechanism of CMP-2-keto-3-deoxymanno-octulonic Acid Synthetase

PubMed Central

Heyes, Derren J.; Levy, Colin; Lafite, Pierre; Roberts, Ian S.; Goldrick, Marie; Stachulski, Andrew V.; Rossington, Steven B.; Stanford, Deborah; Rigby, Stephen E. J.; Scrutton, Nigel S.; Leys, David

2009-01-01

The enzyme CMP-Kdo synthetase (KdsB) catalyzes the addition of 2-keto-3-deoxymanno-octulonic acid (Kdo) to CTP to form CMP-Kdo, a key reaction in the biosynthesis of lipopolysaccharide. The reaction catalyzed by KdsB and the related CMP-acylneuraminate synthase is unique among the sugar-activating enzymes in that the respective sugars are directly coupled to a cytosine monophosphate. Using inhibition studies, in combination with isothermal calorimetry, we show the substrate analogue 2β-deoxy-Kdo to be a potent competitive inhibitor. The ligand-free Escherichia coli KdsB and ternary complex KdsB-CTP-2β-deoxy-Kdo crystal structures reveal that Kdo binding leads to active site closure and repositioning of the CTP phosphates and associated Mg2+ ion (Mg-B). Both ligands occupy conformations compatible with an Sn2-type attack on the α-phosphate by the Kdo 2-hydroxyl group. Based on strong similarity with DNA/RNA polymerases, both in terms of overall chemistry catalyzed as well as active site configuration, we postulate a second Mg2+ ion (Mg-A) is bound by the catalytically competent KdsB-CTP-Kdo ternary complex. Modeling of this complex reveals the Mg-A coordinated to the conserved Asp100 and Asp235 in addition to the CTP α-phosphate and both the Kdo carboxylic and 2-hydroxyl groups. EPR measurements on the Mn2+-substituted ternary complex support this model. We propose the KdsB/CNS sugar-activating enzymes catalyze the formation of activated sugars, such as the abundant CMP-5-N-acetylneuraminic acid, by recruitment of two Mg2+ to the active site. Although each metal ion assists in correct positioning of the substrates and activation of the α-phosphate, Mg-A is responsible for activation of the sugar-hydroxyl group. PMID:19815542

X-ray Crystal Structure of Aristolochene Synthase from Aspergillus terreus and Evolution of Templates for the Cyclization of Farnesyl Diphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shishova,E.; Di Costanzo, L.; Cane, D.

2007-01-01

Aristolochene synthase from Aspergillus terreus catalyzes the cyclization of the universal sesquiterpene precursor, farnesyl diphosphate, to form the bicyclic hydrocarbon aristolochene. The 2.2 {angstrom} resolution X-ray crystal structure of aristolochene synthase reveals a tetrameric quaternary structure in which each subunit adopts the {alpha}-helical class I terpene synthase fold with the active site in the 'open', solvent-exposed conformation. Intriguingly, the 2.15 {angstrom} resolution crystal structure of the complex with Mg{sup 2+}{sub 3}-pyrophosphate reveals ligand binding only to tetramer subunit D, which is stabilized in the 'closed' conformation required for catalysis. Tetramer assembly may hinder conformational changes required for the transition frommore » the inactive open conformation to the active closed conformation, thereby accounting for the attenuation of catalytic activity with an increase in enzyme concentration. In both conformations, but especially in the closed conformation, the active site contour is highly complementary in shape to that of aristolochene, and a catalytic function is proposed for the pyrophosphate anion based on its orientation with regard to the presumed binding mode of aristolochene. A similar active site contour is conserved in aristolochene synthase from Penicillium roqueforti despite the substantial divergent evolution of these two enzymes, while strikingly different active site contours are found in the sesquiterpene cyclases 5-epi-aristolochene synthase and trichodiene synthase. Thus, the terpenoid cyclase active site plays a critical role as a template in binding the flexible polyisoprenoid substrate in the proper conformation for catalysis. Across the greater family of terpenoid cyclases, this template is highly evolvable within a conserved {alpha}-helical fold for the synthesis of terpene natural products of diverse structure and stereochemistry.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yanli; Sheng, Gang; Juranek, Stefan

The slicer activity of the RNA-induced silencing complex is associated with argonaute, the RNase H-like PIWI domain of which catalyses guide-strand-mediated sequence-specific cleavage of target messenger RNA. Here we report on the crystal structure of Thermus thermophilus argonaute bound to a 5'-phosphorylated 21-base DNA guide strand, thereby identifying the nucleic-acid-binding channel positioned between the PAZ- and PIWI-containing lobes, as well as the pivot-like conformational changes associated with complex formation. The bound guide strand is anchored at both of its ends, with the solvent-exposed Watson-Crick edges of stacked bases 2 to 6 positioned for nucleation with the mRNA target, whereas twomore » critically positioned arginines lock bases 10 and 11 at the cleavage site into an unanticipated orthogonal alignment. Biochemical studies indicate that key amino acid residues at the active site and those lining the 5'-phosphate-binding pocket made up of the Mid domain are critical for cleavage activity, whereas alterations of residues lining the 2-nucleotide 3'-end-binding pocket made up of the PAZ domain show little effect.« less

Introduction of unnatural amino acids into chalcone isomerase.

PubMed

Bednar, R A; McCaffrey, C; Shan, K

1991-01-01

The active site cysteine residue of chalcone isomerase was rapidly and selectively modified under denaturing conditions with a variety of electrophilic reagents. These denatured and modified enzyme were renatured to produce enzyme derivatives containing a series of unnatural amino acids in the active site. Addition of methyl, ethyl, butyl, heptyl, and benzyl groups to the cysteine sulfur does not abolish catalytic activity, although the activity decreases as the steric bulk of the amino acid side-chain increases. Modification of the cysteine to introduce a charged homoglutamate or a neutral homoglutamine analogue results in retention of 22% of the catalytic activity. Addition of a methylthio group (SMe) to the cysteine residue of native chalcone isomerase preserves 85% of the catalytic activity measured with 2',4',4-trihydroxychalcone, 2',4',6',4-tetrahydroxychalcone, or 2'-hydroxy-4-methoxychalcone as substrates. The competitive inhibition constant for 4',4-dihydroxychalcone, the substrate inhibition constant for 2',4',4-trihydroxychalcone, and other steady-state kinetic parameters for the methanethiolated enzyme are very similar to those of the native enzyme. The strong binding of 4',4-dihydroxychalcone to the methanethiolated enzyme shows that there is no steric repulsion between this modified amino acid residue and the substrate analogue. This structure-activity study clearly demonstrates that the active site cysteine residue does not function as an acid-base or nucleophilic group in producing the catalysis or substrate inhibition observed with chalcone isomerase. The method presented in this paper allows for the rapid introduction of a series of unnatural amino acids into the active site as a means of probing the structure-function relationship.

MURMoT. Design and Application of Microbial Uranium Reduction Monitoring Tools

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loeffler, Frank E.

2014-12-31

Uranium (U) contamination in the subsurface is a major remediation challenge at many DOE sites. Traditional site remedies present enormous costs to DOE; hence, enhanced bioremediation technologies (i.e., biostimulation and bioaugmentation) combined with monitoring efforts are being considered as cost-effective corrective actions to address subsurface contamination. This research effort improved understanding of the microbial U reduction process and developed new tools for monitoring microbial activities. Application of these tools will promote science-based site management decisions that achieve contaminant detoxification, plume control, and long-term stewardship in the most efficient manner. The overarching hypothesis was that the design, validation and application ofmore » a suite of new molecular and biogeochemical tools advance process understanding, and improve environmental monitoring regimes to assess and predict in situ U immobilization. Accomplishments: This project (i) advanced nucleic acid-based approaches to elucidate the presence, abundance, dynamics, spatial distribution, and activity of metal- and radionuclide-detoxifying bacteria; (ii) developed proteomics workflows for detection of metal reduction biomarker proteins in laboratory cultures and contaminated site groundwater; (iii) developed and demonstrated the utility of U isotopic fractionation using high precision mass spectrometry to quantify U(VI) reduction for a range of reduction mechanisms and environmental conditions; and (iv) validated the new tools using field samples from U-contaminated IFRC sites, and demonstrated their prognostic and diagnostic capabilities in guiding decision making for environmental remediation and long-term site stewardship.« less

Enhancers Are Major Targets for Murine Leukemia Virus Vector Integration

PubMed Central

De Ravin, Suk See; Su, Ling; Theobald, Narda; Choi, Uimook; Macpherson, Janet L.; Poidinger, Michael; Symonds, Geoff; Pond, Susan M.; Ferris, Andrea L.; Hughes, Stephen H.

2014-01-01

ABSTRACT Retroviral vectors have been used in successful gene therapies. However, in some patients, insertional mutagenesis led to leukemia or myelodysplasia. Both the strong promoter/enhancer elements in the long terminal repeats (LTRs) of murine leukemia virus (MLV)-based vectors and the vector-specific integration site preferences played an important role in these adverse clinical events. MLV integration is known to prefer regions in or near transcription start sites (TSS). Recently, BET family proteins were shown to be the major cellular proteins responsible for targeting MLV integration. Although MLV integration sites are significantly enriched at TSS, only a small fraction of the MLV integration sites (<15%) occur in this region. To resolve this apparent discrepancy, we created a high-resolution genome-wide integration map of more than one million integration sites from CD34+ hematopoietic stem cells transduced with a clinically relevant MLV-based vector. The integration sites form ∼60,000 tight clusters. These clusters comprise ∼1.9% of the genome. The vast majority (87%) of the integration sites are located within histone H3K4me1 islands, a hallmark of enhancers. The majority of these clusters also have H3K27ac histone modifications, which mark active enhancers. The enhancers of some oncogenes, including LMO2, are highly preferred targets for integration without in vivo selection. IMPORTANCE We show that active enhancer regions are the major targets for MLV integration; this means that MLV preferentially integrates in regions that are favorable for viral gene expression in a variety of cell types. The results provide insights for MLV integration target site selection and also explain the high risk of insertional mutagenesis that is associated with gene therapy trials using MLV vectors. PMID:24501411

Synthesis, QSAR, and Molecular Dynamics Simulation of Amidino-substituted Benzimidazoles as Dipeptidyl Peptidase III Inhibitors.

PubMed

Rastija, Vesna; Agić, Dejan; Tomiš, Sanja; Nikolič, Sonja; Hranjec, Marijana; Grace, Karminski-Zamola; Abramić, Marija

2015-01-01

A molecular modeling study is performed on series of benzimidazol-based inhibitors of human dipeptidyl peptidase III (DPP III). An eight novel compounds were synthesized in excellent yields using green chemistry approach. This study is aimed to elucidate the structural features of benzimidazole derivatives required for antagonism of human DPP III activity using Quantitative Structure-Activity Relationship (QSAR) analysis, and to understand the mechanism of one of the most potent inhibitor binding into the active site of this enzyme, by molecular dynamics (MD) simulations. The best model obtained includes S3K and RDF045m descriptors which have explained 89.4 % of inhibitory activity. Depicted moiety for strong inhibition activity matches to the structure of most potent compound. MD simulation has revealed importance of imidazolinyl and phenyl groups in the mechanism of binding into the active site of human DPP III.

Design, synthesis and evaluation of rivastigmine and curcumin hybrids as site-activated multitarget-directed ligands for Alzheimer's disease therapy.

PubMed

Li, Yujie; Peng, Peng; Tang, Li; Hu, Yunzhen; Hu, Yongzhou; Sheng, Rong

2014-09-01

A series of novel 2-methoxy-phenyl dimethyl-carbamate derivatives were designed, synthesized and evaluated as site-activated MTDLs based on rivastigmine and curcumin. Most of them exhibited good to excellent AChE and BuChE inhibitory activities with sub-micromolar IC50 values. Among all the compounds, 6a demonstrated the most potent AChE inhibition with IC50 value of 0.097μM, which is about 20-fold than that of rivastigmine. In addition, the three selected compounds 5a, 6a and 6e demonstrated inhibitory activity against Aβ self-aggregation similar to cucurmin in TEM assay, which is obviously different from the weak activity of rivastigmine. Moreover, the hydrolysate of 6a (compound 7) also showed potent ABTS(+) scavenging and moderate copper ion chelating activity in vitro. Copyright © 2014 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanki, Aditya K.; Boucau, Julie; Umesiri, Francis E.

Peptide-based 1,2-dicarbonyl compounds have emerged as potent inhibitors for serine proteases. Herein, we have designed and synthesized D-arabinose and D-trehalose-based esters, {alpha}-ketoesters and {alpha}-ketoamides, and evaluated their inhibitory activity against Mycobacterium tuberculosis (Mtb) antigen 85C (ag85C), an acyltransferase in the serine hydrolase superfamily. In addition the compounds were evaluated for the ability to inhibit the growth of Mycobacterium smegmatis ATCC 14468, a non-pathogenic surrogate for Mtb. Among the synthetic analogs evaluated only the methyl ester1 derived from D-arabinose was found to inhibit the acyltransferase activity of ag85C (IC{sub 50} = 25 mM). Based on this weak inhibitory activity it wasmore » not surprising that none of the compounds inhibits the growth of M. smegmatis. In spite of the weak inhibitory activity of 1, X-ray crystallography on crystals of ag85C soaked with 1 suggested the formation of a covalent ester adduct between 1 and the Ser124 side chain hydroxyl moiety found within the catalytic site of ag85C; however, some of the active site electron density appears to result from bound glycerol. The lack of activity associated with the {alpha}-ketoester and {alpha}-ketoamide derivatives of D-trehalose may be the result of intramolecular cyclization of the {alpha}-keto moiety with the nearby C-4/4' hydroxyls leading to the formation of stable bicyclo-ester and amide derivatives.« less

Active site densities, oxygen activation and adsorbed reactive oxygen in alcohol activation on npAu catalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lu-Cun; Friend, C. M.; Fushimi, Rebecca

The activation of molecular O 2as well as the reactivity of adsorbed oxygen species is of central importance in aerobic selective oxidation chemistry on Au-based catalysts. Herein, we address the issue of O 2activation on unsupported nanoporous gold (npAu) catalysts by applying a transient pressure technique, a temporal analysis of products (TAP) reactor, to measure the saturation coverage of atomic oxygen, its collisional dissociation probability, the activation barrier for O 2dissociation, and the facility with which adsorbed O species activate methanol, the initial step in the catalytic cycle of esterification. The results from these experiments indicate that molecular O 2dissociationmore » is associated with surface silver, that the density of reactive sites is quite low, that adsorbed oxygen atoms do not spill over from the sites of activation onto the surrounding surface, and that methanol reacts quite facilely with the adsorbed oxygen atoms. In addition, the O species from O 2dissociation exhibits reactivity for the selective oxidation of methanol but not for CO. The TAP experiments also revealed that the surface of the npAu catalyst is saturated with adsorbed O under steady state reaction conditions, at least for the pulse reaction.« less

Active site densities, oxygen activation and adsorbed reactive oxygen in alcohol activation on npAu catalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lu-Cun; Friend, C. M.; Fushimi, Rebecca

2016-01-01

The activation of molecular O 2as well as the reactivity of adsorbed oxygen species is of central importance in aerobic selective oxidation chemistry on Au-based catalysts. Herein, we address the issue of O 2activation on unsupported nanoporous gold (npAu) catalysts by applying a transient pressure technique, a temporal analysis of products (TAP) reactor, to measure the saturation coverage of atomic oxygen, its collisional dissociation probability, the activation barrier for O 2dissociation, and the facility with which adsorbed O species activate methanol, the initial step in the catalytic cycle of esterification. The results from these experiments indicate that molecular O 2dissociationmore » is associated with surface silver, that the density of reactive sites is quite low, that adsorbed oxygen atoms do not spill over from the sites of activation onto the surrounding surface, and that methanol reacts quite facilely with the adsorbed oxygen atoms. In addition, the O species from O 2dissociation exhibits reactivity for the selective oxidation of methanol but not for CO. The TAP experiments also revealed that the surface of the npAu catalyst is saturated with adsorbed O under steady state reaction conditions, at least for the pulse reaction.« less

Analysis of stakeholders networks of infant and young child nutrition programmes in Sri Lanka, India, Nepal, Bangladesh and Pakistan.

PubMed

Uddin, Shahadat; Mahmood, Hana; Senarath, Upul; Zahiruddin, Quazi; Karn, Sumit; Rasheed, Sabrina; Dibley, Michael

2017-06-13

Effective public policies are needed to support appropriate infant and young child feeding (IYCF) to ensure adequate child growth and development, especially in low and middle income countries. The aim of this study was to: (i) capture stakeholder networks in relation to funding and technical support for IYCF policy across five countries in South Asia (i.e. Sri Lanka, India, Nepal, Bangladesh and Pakistan); and (ii) understand how stakeholder networks differed between countries, and identify common actors and their patterns in network engagement across the region. The Net-Map method, which is an interview-based mapping technique to visualise and capture connections among different stakeholders that collaborate towards achieving a focused goal, has been used to map funding and technical support networks in all study sites. Our study was conducted at the national level in Bangladesh, India, Nepal, and Sri Lanka, as well as in selected states or provinces in India and Pakistan during 2013-2014. We analysed the network data using a social network analysis software (NodeXL). The number of stakeholders identified as providing technical support was higher than the number of stakeholders providing funding support, across all study sites. India (New Delhi site - national level) site had the highest number of influential stakeholders for both funding (43) and technical support (86) activities. Among all nine study sites, India (New Delhi - national level) and Sri Lanka had the highest number of participating government stakeholders (22) in their respective funding networks. Sri Lanka also had the highest number of participating government stakeholders for technical support (34) among all the study sites. Government stakeholders are more engaged in technical support activities compared with their involvement in funding activities. The United Nations Children's Emergency Fund (UNICEF) and the World Health Organization (WHO) were highly engaged stakeholders for both funding and technical support activities across all study sites. International stakeholders were highly involved in both the funding and technical support activities related to IYCF practices across these nine study sites. Government stakeholders received more support for funding and technical support activities from other stakeholders compared with the support that they offered. Stakeholders were, in general, more engaged for technical support activities compared with the funding activities.

Automated extraction of temporal motor activity signals from video recordings of neonatal seizures based on adaptive block matching.

PubMed

Karayiannis, Nicolaos B; Sami, Abdul; Frost, James D; Wise, Merrill S; Mizrahi, Eli M

2005-04-01

This paper presents an automated procedure developed to extract quantitative information from video recordings of neonatal seizures in the form of motor activity signals. This procedure relies on optical flow computation to select anatomical sites located on the infants' body parts. Motor activity signals are extracted by tracking selected anatomical sites during the seizure using adaptive block matching. A block of pixels is tracked throughout a sequence of frames by searching for the most similar block of pixels in subsequent frames; this search is facilitated by employing various update strategies to account for the changing appearance of the block. The proposed procedure is used to extract temporal motor activity signals from video recordings of neonatal seizures and other events not associated with seizures.

The heterodimeric sweet taste receptor has multiple potential ligand binding sites.

PubMed

Cui, Meng; Jiang, Peihua; Maillet, Emeline; Max, Marianna; Margolskee, Robert F; Osman, Roman

2006-01-01

The sweet taste receptor is a heterodimer of two G protein coupled receptors, T1R2 and T1R3. This discovery has increased our understanding at the molecular level of the mechanisms underlying sweet taste. Previous experimental studies using sweet receptor chimeras and mutants show that there are at least three potential binding sites in this heterodimeric receptor. Receptor activity toward the artificial sweeteners aspartame and neotame depends on residues in the amino terminal domain of human T1R2. In contrast, receptor activity toward the sweetener cyclamate and the sweet taste inhibitor lactisole depends on residues within the transmembrane domain of human T1R3. Furthermore, receptor activity toward the sweet protein brazzein depends on the cysteine rich domain of human T1R3. Although crystal structures are not available for the sweet taste receptor, useful homology models can be developed based on appropriate templates. The amino terminal domain, cysteine rich domain and transmembrane helix domain of T1R2 and T1R3 have been modeled based on the crystal structures of metabotropic glutamate receptor type 1, tumor necrosis factor receptor, and bovine rhodopsin, respectively. We have used homology models of the sweet taste receptors, molecular docking of sweet ligands to the receptors, and site-directed mutagenesis of the receptors to identify potential ligand binding sites of the sweet taste receptor. These studies have led to a better understanding of the structure and function of this heterodimeric receptor, and can act as a guide for rational structure-based design of novel non-caloric sweeteners, which can be used in the fighting against obesity and diabetes.

Anthropogenic disturbance homogenizes seagrass fish communities.

PubMed

Iacarella, Josephine C; Adamczyk, Emily; Bowen, Dan; Chalifour, Lia; Eger, Aaron; Heath, William; Helms, Sibylla; Hessing-Lewis, Margot; Hunt, Brian P V; MacInnis, Andrew; O'Connor, Mary I; Robinson, Clifford L K; Yakimishyn, Jennifer; Baum, Julia K

2018-05-01

Anthropogenic activities have led to the biotic homogenization of many ecological communities, yet in coastal systems this phenomenon remains understudied. In particular, activities that locally affect marine habitat-forming foundation species may perturb habitat and promote species with generalist, opportunistic traits, in turn affecting spatial patterns of biodiversity. Here, we quantified fish diversity in seagrass communities across 89 sites spanning 6° latitude along the Pacific coast of Canada, to test the hypothesis that anthropogenic disturbances homogenize (i.e., lower beta-diversity) assemblages within coastal ecosystems. We test for patterns of biotic homogenization at sites within different anthropogenic disturbance categories (low, medium, and high) at two spatial scales (within and across regions) using both abundance- and incidence-based beta-diversity metrics. Our models provide clear evidence that fish communities in high anthropogenic disturbance seagrass areas are homogenized relative to those in low disturbance areas. These results were consistent across within-region comparisons using abundance- and incidence-based measures of beta-diversity, and in across-region comparisons using incidence-based measures. Physical and biotic characteristics of seagrass meadows also influenced fish beta-diversity. Biotic habitat characteristics including seagrass biomass and shoot density were more differentiated among high disturbance sites, potentially indicative of a perturbed environment. Indicator species and trait analyses revealed fishes associated with low disturbance sites had characteristics including stenotopy, lower swimming ability, and egg guarding behavior. Our study is the first to show biotic homogenization of fishes across seagrass meadows within areas of relatively high human impact. These results support the importance of targeting conservation efforts in low anthropogenic disturbance areas across land- and seascapes, as well as managing anthropogenic impacts in high activity areas. © 2018 John Wiley & Sons Ltd.

Mechanistic studies of copper(II)-aminoglycoside mediated DNA damage and magnesium catalyzed nuclease activity of hammerhead ribozyme

NASA Astrophysics Data System (ADS)

Patwardhan, Anjali A.

The antibacterial activity of aminoglycosides stems from their high affinity binding to the 16S rRNA in bacteria resulting in inhibition of protein synthesis. Used to treat acute bacterial infections these antibiotics have limited applications due to their high dosage requirements and the emergence of resistant strains. We have synthesized and characterized Cu(II) derivatives of the aminoglycosides, kanamycin A, tobramycin, neamine, kanamycin B, neomycin B, and paromomycin. The first three exhibit preferential and tight binding to Cu(II) as against neomycin B and kanamycin B and paromomycin. EPR of frozen solutions and UV-visible spectroscopy suggest a change in geometry around the Cu(II) but the stabilities of the complexes in water differ. These copper derivatives efficiently cleave plasmid DNA at micromolar concentrations (hydrolytic) and at nanomolar concentrations in the presence co-reactants like hydrogen peroxide or ascorbic acid. Hydrolysis is multi turnover and exhibits Michelis-Menten kinetics with enzyme-like behavior whereas oxidative cleavage is highly specific with C-4' H abstraction resulting in characteristic base propenal and nucleotide base products. Hydroxyl radicals generated are copper based and are generated in close proximity of the substrate. Hammerhead ribozymes are selectively hydrolyzed in the presence of divalent ions with Mg2+ being the metal ion of choice in vivo . Our studies with complex ions like cobalt hexaammine and fac-triamminetriaquochromium(III) establish outer sphere interactions of Mg2+ with the hammerhead in the catalytic site. There are two sets of sites, one structural and one catalytic. Complex ions in the catalytic site and divalent ions in the structural site result in a slow but active hammerhead ribozyme suggesting that the complex ions are not inhibitory, contrary to what was suggested previously.

Bioremediation in oil-contaminated sites: bacteria and surfactant accelerated remediation

NASA Astrophysics Data System (ADS)

Strong-Gunderson, Janet M.; Guzman, Francisco

1996-11-01

In Mexico, there are several environmental issues which are being addressed under the current governmental legislation. One important issue is restoring sites belonging to Petroleos Mexicanos (PEMEX). PEMEX is a large government owned oil company that regulates and manages the oil reserves. These sites are primarily contaminated with weathered hydrocarbons which are a consequence of extracting millions of barrels of oil. Within the southern regions of Mexico there are sites which were contaminated by activities and spills that have occurred during the past 30 years. PEMEX has taken the leadership in correcting environmental problems and is very concerned about cleaning up the contaminated sites as quickly as possible. The most significant contaminated sites are located to the north of Veracruz and south of Tabasco. These sites areas are close to refineries or locations of oil exploration. The primary category of contaminants are hydrocarbons, among them asphaltens, aromatic and other contaminants. The concentration of the contaminants varies depending on the location of the sites, but it can reach as high as 500,000 ppm. PEMEX has been searching for appropriate, and cost- effective technologies to clean up these sites. Biologically based remediation activities are of primary interest to PEMEX. However, other treatment technologies such as chemical-physical methods, encapsulation and incineration are also being considered. The present report summarizes preliminary experiments that measured the feasibility of bioremediation for a contaminated site in southern Mexico.

Development of Preliminary Remediation Goals for Indoor Dust at the Colonie FUSRAP Site - 12273

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watters, David J.; Opdyke, Clifford P.; Moore, James T.

2012-07-01

The Colonie FUSRAP Site is located in the Town of Colonie, Albany County, New York. The U.S. Army Corps of Engineers is currently addressing environmental contamination associated with the Site under the Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) process as part of the Formerly Utilized Sites Remedial Action Program (FUSRAP). Soil remediation activities have been substantially completed at the Colonie FUSRAP Site and its vicinity properties under the FUSRAP. A study unrelated to FUSRAP was recently performed by an independent party to establish the distribution of DU contamination in various media in the environs of the Site. Asmore » part of this study, dust samples were collected in residencies and businesses in the immediate vicinity of the Site. These samples were collected in non-living areas such as basement window sills and garages. Many of these samples tested positive for DU. An assessment was performed to establish preliminary remediation goals (PRGs) for indoor dust in non-living areas of residential homes and businesses in the vicinity of the Site. The results of this assessment provide estimates of dose-based, carcinogenic risk-based, and noncarcinogenic-based PRGs derived from a hypothetical exposure scenario with reasonable levels of conservatism. Ultimately, the PRGs will be compared to results of dust sampling and analyses in residences and businesses in proximity of the Site to determine whether a response action is appropriate. This assessment estimates PRGs for DU contaminated dust in non-living areas of residences in the vicinity of the Colonie FUSRAP site based on a reasonably conservative exposure scenario. Estimated PRGs based on residential receptors are considered to be conservatively representative of workers in nearby businesses based on the considerably longer exposure duration of residents relative to workers. This assessment provides reasonably conservative estimates of PRGs for DU contaminated dust in non-living areas within residences in the vicinity of the Site. It should be noted that the PRGs include hypothetical exposures resulting from activities in both the living areas and non-living areas of a residence. The PRGs are derived and presented in terms of DU dust concentration in non-living areas to facilitate comparison to results of a planned Site Investigation that will characterize concentrations of DU in dust in non-living areas. It is important to recognize that the exposure assumptions used to derive these PRGs are based on average dust DU concentrations in non-living areas. It is inappropriate to compare these PRGs to the dust DU concentration in an isolated small area. The ongoing Site Investigation addresses this consideration and is designed to provide reasonable estimates of average dust DU concentrations in non-living areas of vicinity properties. In order to accomplish this, sampling is conducted in accordance with EPA Guidance for the Sampling and Analysis of Lead in Indoor Residential Dust for Use in the Integrated Exposure Uptake Biokinetic (IEUBK) Model, (EPA 2008), which specifically addresses estimating average contaminant concentrations in dust. Four (4) large-area samples are collected from each VP in accordance with this guidance. It is anticipated that the results of the Site Investigation will be used in conjunction with the results of this assessment, and/or subsequent assessments, to establish whether or not a response action is appropriate. (authors)« less

Air-Based Remediation Workshop - Section 1 Sampling And Analysis Revelant To Air-Based Remediation Technologies

EPA Science Inventory

Pursant to the EPA-AIT Implementing Arrangement 7 for Technical Environmental Collaboration, Activity 11 "Remediation of Contaminated Sites," the USEPA Office of International Affairs Organized a Force Air Remediation Workshop in Taipei to deliver expert training to the Environme...

Archaeology: site studies, activation analysis, preservation, and remote sensing. 1978-November 1979 (citations from the NTIS Data Base). Report for 1978-November 1979

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1981-01-01

This bibliography contains general studies as well as chemical analysis of archaeological specimens. The chemical analysis is mainly activation analysis of articles such as metals, pottery, coins, paintings, soils, glass and paper from Medieval, Grecian, Egyptian, Mayan, and prehistoric times. The general studies include results of excavation from the United States. Also covered is work on preservation of artifacts and remote sensing for the site location. (This updated bibliography contains 237 citations, none of which are new entries to the previous edition.)

Mapping DNA cleavage by the Type ISP restriction-modification enzymes following long-range communication between DNA sites in different orientations

PubMed Central

van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D.

2015-01-01

The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1–2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp. PMID:26507855

Trends in major-ion constituents and properties for selected sampling sites in the Tongue and Powder River watersheds, Montana and Wyoming, based on data collected during water years 1980-2010

USGS Publications Warehouse

Sando, Steven K.; Vecchia, Aldo V.; Barnhart, Elliott P.; Sando, Thomas R.; Clark, Melanie L.; Lorenz, David L.

2014-01-01

The primary purpose of this report is to present information relating to flow-adjusted temporal trends in major-ion constituents and properties for 16 sampling sites in the Tongue and Powder River watersheds based on data collected during 1980–2010. In association with this primary purpose, the report presents background information on major-ion characteristics (including specific conductance, calcium, magnesium, potassium, sodium adsorption ratio, sodium, alkalinity, chloride, fluoride, dissolved sulfate, and dissolved solids) of the sampling sites and coal-bed methane (CBM) produced water (groundwater pumped from coal seams) in the site watersheds, trend analysis methods, streamflow conditions, and factors that affect trend results. The Tongue and Powder River watersheds overlie the Powder River structural basin (PRB) in northeastern Wyoming and southeastern Montana. Limited extraction of coal-bed methane (CBM) from the PRB began in the early 1990’s, and increased dramatically during the late 1990’s and early 2000’s. CBM-extraction activities produce discharges of water with high concentrations of dissolved solids (particularly sodium and bicarbonate ions) relative to most stream water in the Tongue and Powder River watersheds. Water-quality of CBM produced water is of concern because of potential effects of sodium on agricultural soils and potential effects of bicarbonate on aquatic biota. Two parametric trend-analysis methods were used in this study: the time-series model (TSM) and ordinary least squares regression (OLS) on time, streamflow, and season. The TSM was used to analyze trends for 11 of the 16 study sites. For five sites, data requirements of the TSM were not met and OLS was used to analyze trends. Two primary 10-year trend-analysis periods were selected. Trend-analysis period 1 (water years 1986–95; hereinafter referred to as period 1) was selected to represent variability in major-ion concentrations in the Tongue and Powder River watersheds before potential effects of CBM-extraction activities. Trend analysis period 2 (water years 2001–10; hereinafter referred to as period 2) was selected because it encompassed substantial CBM-extraction activities and therefore might indicate potential effects of CBM-extraction activities on water quality of receiving streams in the Tongue and Powder River watersheds. For sites that did not satisfy data requirements for the TSM, OLS was used to analyze trends for period 2 (if complete data were available) or a 6-year period (2005–10). Flow-rate characteristics of CBM-produced water were estimated to allow general comparisons with streamflow characteristics of the sampling sites. The information on flow-rate characteristics of CBM-produced water in relation to streamflow does not account for effects of disposal, treatment, or other remediation activities on the potential quantitative effects of CBM-produced water on receiving streams. In many places, CBM-produced water is discharged into impoundments or channels in upper reaches of tributary watersheds where water infiltrates and does not directly contribute to streamflow. For Tongue River at State line (site 4) mean annual pumping rate of CBM-produced water during water years 2001–10 (hereinafter referred to as mean CBM pumping rate) was 6 percent of the mean of annual median streamflows during water years 2001–10 (hereinafter referred to as 2001–10 median streamflow). For main-stem Tongue River sites 5, 7, and 10, mean CBM pumping rate was 8–12 percent of 2001–10 median streamflow. For main-stem Powder River sites (sites 12, 13, and 16), mean CBM pumping rates were 26, 28, and 34 percent of 2001–10 median streamflows, respectively. For main-stem Tongue River sites analyzed by using the TSM and downstream from substantial CBM-extraction activities [Tongue River at State line (site 4), Tongue River at Tongue River Dam (site 5), Tongue River at Birney Day School (site 7), and Tongue River at Miles City (site 10)], generally small significant or nonsignificant decreases in most constituents are indicated for period 1. For period 2 for these sites, the TSM trend results do not allow confident conclusions concerning detection of effects of CBM-extraction activities on stream water quality. Detection of significant trends in major-ion constituents and properties for period 2 generally was infrequent, and direction, magnitudes, and significance of fitted trends were not strongly consistent with relative differences in water quality between stream water and CBM-produced water. The TSM indicated significant or generally large magnitude increases in median values of sodium adsorption ratio (SAR), sodium, and alkalinity for period 2 for sites 5 and 7, which might indicate potential effects of CBM-extraction activities on stream water. However, other factors, including operations of Tongue River Reservoir, irrigation activities, contributions of saline groundwater, and operations of the Decker coal mine, confound confident determination of causes of detected significant trends for sites 5 and 7. For all mainstem Tongue River sites, trends for period 2 generally are within ranges of those for period 1 before substantial CBM-extraction activities. For main-stem Powder River sites analyzed by using the TSM [Powder River at Sussex (site 11), Powder River at Arvada (site 12), Powder River at Moorhead (site 13), and Powder River near Locate (site 16)], significant or generally large magnitude decreases in median values of SAR, sodium, estimated alkalinity, chloride, fluoride, specific conductance, and dissolved solids are indicated for period 1. Patterns in trend results for period 1 for main-stem Powder River sites are consistent with effects of Salt Creek oil-brine reinjection that started in 1990. Trend results for all main-stem Powder River sites downstream from substantial CBM-extraction activities (sites 12, 13, and 16) indicate evidence of potential effects of CBM-extraction activities on stream water quality, although evidence is stronger for sites 12 and 13 than for site 16. Evidence in support of potential CBM effects includes significant increases in median values of SAR, sodium, and estimated alkalinity for period 2 for sites 12, 13, and 16 that are consistent with relative differences between stream water and CBM-produced water. Significant increases in median values of these constituents for period 2 are not indicated for Powder River at Sussex (site 11) upstream from substantial CBM-extraction activities. In interpreting the trend results, it is notable that the fitted trends evaluate changes in median concentrations and also notable that changes in median concentrations that might be attributed to CBM-extraction activities probably are more strongly evident during low to median streamflow conditions than during mean to high streamflow conditions. This observation is relevant in assessing trend results in relation to specific water-quality concerns, including effects of water-quality changes on irrigators and effects on stream biota and ecology.

Variability in goethite surface site density: evidence from proton and carbonate sorption.

PubMed

Villalobos, Mario; Trotz, Maya A; Leckie, James O

2003-12-15

Goethite is a representative iron oxide in natural environments due to its abundance and thermodynamic stability and may be responsible for many surface-mediated processes, including ion retention and mobility in aqueous settings. A large variability in morphologies and specific surface areas of goethite crystals exists but little work has been done to compare surface reactivity between them. The present work offers experimental evidence for the existence of an inverse relationship between sorption capacity for protons and carbonate ions and specific surface area of goethite for three synthetic goethite preparations spanning surface area differences by a factor of 2. An explanation for this was found by assuming a variable reactive site density between preparations in direct relationship to their sorption capacity based on congruency of carbonate sorption computed on a per-site basis. Previous evidence of maximum sorption capacities supports this explanation, and site density ratios between the goethites studied here were obtained. Triple layer surface complexation modeling was successful in describing adsorption data for all goethite preparations using equal stoichiometries. A new formulation of standard state for activities of surface species based on a 1.0 mole fraction of sites on the solid allowed transformation of the conventional molar concentration-based affinity constants to values based on site occupancy. In this fashion, by applying the appropriate site density ratios, a single set of affinity constant values was found that described accurately the adsorption data for all preparations.

Les Chansons de la Francophonie Web Site and Its Two Web-Usage-Tracking Systems in an Advanced Listening Comprehension Course

ERIC Educational Resources Information Center

Weinberg, Alysse

2005-01-01

The "Les Chansons de la francophonie" web site is based on French songs and was developed using HTML and JavaScript for the advanced French Comprehension Course at the Second Language Institute of the University of Ottawa. These interactive listening activities include true-false and multiple-choice questions, fill in the blanks,…

United States Air Force 611th Air Support Group/Civil Engineering Squadron, Elmendorf AFB, Alaska. Remedial investigation and feasibility study: Oliktok Point Radar Installation, Alaska. Volume 1. (Includes appendices a - b)

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1996-04-15

This report presents the findings of Remedial Investigations and Feasibility Studies at sites located at the Oliktok Point radar installation in northern Alaska. The sites were characterized based on sampling and analyses conducted during Remedial Investigation activities performed during August and September 1993.

Experimental Civilian Personnel Office Project (EXPO): Final Report for Nonappropriated Fund Sites

DTIC Science & Technology

1991-07-01

existing data bases; budgetary data; and other documents provided by the test sites. The results indicate that EXPO initiatives had a positive impact on...EXPO has had a positive impact on NAF operations and profitability of revenue-generating activities has remained stable. Important findings include...appropriate education and training resources are available. v viii VllI CONTENTS INTRO DU CTIO N

An Introduction to "My Environmental Education Evaluation Resource Assistant" (MEERA), a Web-Based Resource for Self-Directed Learning about Environmental Education Program Evaluation

ERIC Educational Resources Information Center

Zint, Michaela

2010-01-01

My Environmental Education Evaluation Resource Assistant or "MEERA" is a web-site designed to support environmental educators' program evaluation activities. MEERA has several characteristics that set it apart from other self-directed learning evaluation resources. Readers are encouraged to explore the site and to reflect on the role that…

Evolution of Active Sites in Pt-Based Nanoalloy Catalysts for the Oxidation of Carbonaceous Species by Combined in Situ Infrared Spectroscopy and Total X-ray Scattering.

PubMed

Petkov, Valeri; Maswadeh, Yazan; Lu, Aolin; Shan, Shiyao; Kareem, Haval; Zhao, Yinguang; Luo, Jin; Zhong, Chuan-Jian; Beyer, Kevin; Chapman, Karena

2018-04-04

We present results from combined in situ infrared spectroscopy and total X-ray scattering studies on the evolution of catalytically active sites in exemplary binary and ternary Pt-based nanoalloys during a sequence of CO oxidation-reactivation-CO oxidation reactions. We find that when within a particular compositional range, the fresh nanoalloys may exhibit high catalytic activity for low-temperature CO oxidation. Using surface-specific atomic pair distribution functions (PDFs) extracted from the in situ total X-ray scattering data, we find that, regardless of their chemical composition and initial catalytic activity, the fresh nanoalloys suffer a significant surface structural disorder during CO oxidation. Upon reactivation in oxygen atmosphere, the surface of used nanoalloy catalysts both partially oxidizes and orders. Remarkably, it largely retains its structural state when the nanoalloys are reused as CO oxidation catalysts. The seemingly inverse structural changes of studied nanoalloy catalysts occurring under CO oxidation and reactivation conditions affect the active sites on their surface significantly. In particular, through different mechanisms, both appear to reduce the CO binding strength to the nanoalloy's surface and thus increase the catalytic stability of the nanoalloys. The findings provide clues for further optimization of nanoalloy catalysts for the oxidation of carbonaceous species through optimizing their composition, activation, and reactivation. Besides, the findings demonstrate the usefulness of combined in situ infrared spectroscopy and total X-ray scattering coupled to surface-specific atomic PDF analysis to the ongoing effort to produce advanced catalysts for environmentally and technologically important applications.

Cross-sectional analysis of self-efficacy and social capital in a community-based healthy village project in Santa Cruz, Bolivia.

PubMed

Yuasa, Motoyuki; Shirayama, Yoshihisa; Osato, Keiichi; Miranda, Cesar; Condore, Julia; Siles, Roxana

2015-06-20

An assessment of self-efficacy and social capital may have the potential to detect an effect of dynamic, complex and comprehensive collective actions in community-based health promotion. In 2003, a healthy village project was launched in Santa Cruz, Bolivia with technical assistance from the Japan International Cooperation Agency (JICA). The originally developed FORSA (Fortalecimiento de Redes de Salud) model accounted for participatory processes in which people could improve their health and well-being through individual behavioral changes and family/community-driven activities. This study aimed to examine the extent of self-efficacy and social capital obtained via project activities by a cross-sectional analysis. We randomly selected 340 subjects from the healthy village project site and 113 subjects from a control area. Both groups were interviewed using the same structured questionnaire. Self-efficacy was assessed with a General Self-Efficacy Scale (GSES), while social capital was measured as the frequency of formal group participation in community meetings during the past three months, perceived social solidarity, and general trust. The study results showed that the participants in the project site had higher self-efficacy and social capital compared to those in the control site. The number of times a subject participated in the health committee activities was positively associated with the self-efficacy scale. Regarding social capital, females and lower-educated people were more likely to have had more frequent participation in formal groups; males and higher-educated participants showed less formal group participation, but more generosity to contribute money for the community. The main perceived benefit of participation in formal group activities varied among individuals. The findings suggest that people in the healthy village project site have higher self-efficacy, especially those with active participation in the health committee activities. To recruit more participants in future healthy village projects, we should consider the gender and level of education, and match the perceived benefits of participants accordingly.

Towards an integrative soil health assessment strategy: a three tier (integrative biomarker response) approach with Eisenia fetida applied to soils subjected to chronic metal pollution.

PubMed

Asensio, Vega; Rodríguez-Ruiz, Amaia; Garmendia, Larraitz; Andre, Jane; Kille, Peter; Morgan, Andrew John; Soto, Manu; Marigómez, Ionan

2013-01-01

This is a pilot study for assessing soil ecosystem health in chronically polluted sites on the basis of a 3-tier approach (screening+scoring+understanding) designed to be cost-effective and scientifically based, and to provide straightforward advice and support to managers and stakeholders involved in environmental protection. For the initial screening (Tier 1), the use of a highly sensitive, low-cost biomarker such as neutral red uptake (NRU) in earthworm coelomocytes is proposed. In sites where an alteration in NRU has been established, the stress level may be further assessed by utilising a suite of low-cost and rapid biomarkers of effect integrated in an integrative biological response (IBR) index to obtain an objective (scored) assessment of the induced stress syndrome (Tier 2). The IBR/n index is based on the integration of biomarkers at different levels of biological organisation. Acyl-CoA oxidase activity (AOX), catalase activity (CAT), lipofuscin optical density (LOD%), NRU and the mean epithelial thickness (MET) have been used to calculate the IBR/n index. Biomarkers are determined in earthworms, Eisenia fetida, exposed ex situ to real soils (three mining sites and a reference) for 3, 10 and 17d. The 3d NRU (Tier 1) provided signal of stress. After 3d, PCA, based on the suite of biomarkers (Tier 2), discriminated reference and polluted sites according to toxicity profiles and at 17d, the most polluted site is segregated from less polluted and reference sites. Soils were classified as harmful, unhealthy (not apparently toxic) or healthy. Soils were investigated by microarray transcriptomics (Tier 3), to understand the causes (aetiology) and consequences (prognosis) of health impairment. Tier 3 discriminates, according to stress syndrome traits, soils that did not fall into the category of highly stressed and revealed the main agent causing toxicity at each site by identifying the toxicity mechanisms and biological responses. Copyright © 2012 Elsevier B.V. All rights reserved.

Disseminated sinus histiocytosis with massive lymphadenopathy: its pathologic aspects.

PubMed

Buchino, J J; Byrd, R P; Kmetz, D R

1982-01-01

Sinus histiocytosis with massive lymphadenopathy (SHML) is generally regarded as a benign, self-limited, pseudolymphomatous process requiring little or no therapy. We studied a 13-year-old black boy with a ten-year clinical course of SHML that had varying, intermittent sites of extranodal involvement, including bone, submandibular gland, trachea, eye, and spinal cord. At the time of death, which was attributed to SHML, additional extranodal sites of involvement included thymus, kidney, heart, liver, and base of brain. Microscopic examination of the SHML lesions at the time of autopsy revealed varying stages of development, from proliferation to involution. This case illustrates that SHML may involve multiple organ systems, can kill, and that histologic evaluation of disease activity at one site cannot be used as an indicator of activity at another.

The glycoprotein character of multiple forms of Aspergillus polygalacturonase.

PubMed

Stratilová, E; Mislovicová, D; Kacuráková, M; Machová, E; Kolarová, N; Markovic, O; Jörnvall, H

1998-02-01

Comparisons of known primary structures of polygalacturonases show that extent and localization of potential N-glycosylation sites differ. Some sites are similar in position and adjacent to strictly conserved residues at the potential active site. The presence of N-acetylglucosamine and mannose in the molecules of two homogeneous, major Aspergillus sp. polygalacturonase forms was confirmed by IR spectroscopy. The purification method, based on interaction of the carbohydrate part with concanavalin A immobilized on chlorotriazine bead cellulose, was optimized. Deglycosylation with N-glycosidase F under denaturating and nondenaturating conditions led to molecular mass decreases followed by complete inactivation of the polygalacturonase enzyme activity. These results show the importance of glycosylation in these protein forms, while the comparative patterns establish both variability and some similarities in overall glycosylation architectures.

Validation of SMAP Surface Soil Moisture Products with Core Validation Sites

NASA Technical Reports Server (NTRS)

Colliander, A.; Jackson, T. J.; Bindlish, R.; Chan, S.; Das, N.; Kim, S. B.; Cosh, M. H.; Dunbar, R. S.; Dang, L.; Pashaian, L.;

Silica-supported isolated gallium sites as highly active, selective and stable propane dehydrogenation catalysts† †Electronic supplementary information (ESI) available: Experimental details, material characterization data, catalytic measurement details and crystallographic details. CCDC 1499756. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c6sc05178b Click here for additional data file. Click here for additional data file.

PubMed Central

Searles, Keith; Siddiqi, Georges; Safonova, Olga V.

2017-01-01

Single-site gallium centers on the surface of silica are prepared via grafting of [Ga(OSi(OtBu)3)3(THF)] on SiO2–700 followed by a thermolysis step. The resulting surface species corresponds to well-defined tetra-coordinate gallium single-sites, [( 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 SiO)3Ga(XOSi)] (X = –H or Si) according to IR, X-ray absorption near-edge structure and extended X-ray absorption fine structure analysis. These gallium sites show high activity, selectivity and stability for propane dehydrogenation with an initial turnover frequency of 20 per h per gallium center, propylene selectivity of ≥93% and remarkable stability over 20 h. The stability of the catalyst probably results from site-isolation of the active site on a non-reducible support such as silica, diminishing facile reduction typical of Ga2O3-based catalysts. PMID:28553501

Advantages of a distant cellulase catalytic base.

PubMed

Burgin, Tucker; Ståhlberg, Jerry; Mayes, Heather B

2018-03-30

The inverting glycoside hydrolase Trichoderma reesei ( Hypocrea jecorina ) Cel6A is a promising candidate for protein engineering for more economical production of biofuels. Until recently, its catalytic mechanism had been uncertain: The best candidate residue to serve as a catalytic base, Asp-175, is farther from the glycosidic cleavage site than in other glycoside hydrolase enzymes. Recent unbiased transition path sampling simulations revealed the hydrolytic mechanism for this more distant base, employing a water wire; however, it is not clear why the enzyme employs a more distant catalytic base, a highly conserved feature among homologs across different kingdoms. In this work, we describe molecular dynamics simulations designed to uncover how a base with a longer side chain, as in a D175E mutant, affects procession and active site alignment in the Michaelis complex. We show that the hydrogen bond network is tuned to the shorter aspartate side chain, and that a longer glutamate side chain inhibits procession as well as being less likely to adopt a catalytically productive conformation. Furthermore, we draw comparisons between the active site in Trichoderma reesei Cel6A and another inverting, processive cellulase to deduce the contribution of the water wire to the overall enzyme function, revealing that the more distant catalytic base enhances product release. Our results can inform efforts in the study and design of enzymes by demonstrating how counterintuitive sacrifices in chemical reactivity can have worthwhile benefits for other steps in the catalytic cycle. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Structure of the catalytic sites in Fe/N/C-catalysts for O2-reduction in PEM fuel cells.

PubMed

Kramm, Ulrike I; Herranz, Juan; Larouche, Nicholas; Arruda, Thomas M; Lefèvre, Michel; Jaouen, Frédéric; Bogdanoff, Peter; Fiechter, Sebastian; Abs-Wurmbach, Irmgard; Mukerjee, Sanjeev; Dodelet, Jean-Pol

2012-09-07

Fe-based catalytic sites for the reduction of oxygen in acidic medium have been identified by (57)Fe Mössbauer spectroscopy of Fe/N/C catalysts containing 0.03 to 1.55 wt% Fe, which were prepared by impregnation of iron acetate on carbon black followed by heat-treatment in NH(3) at 950 °C. Four different Fe-species were detected at all iron concentrations: three doublets assigned to molecular FeN(4)-like sites with their ferrous ions in a low (D1), intermediate (D2) or high (D3) spin state, and two other doublets assigned to a single Fe-species (D4 and D5) consisting of surface oxidized nitride nanoparticles (Fe(x)N, with x≤ 2.1). A fifth Fe-species appears only in those catalysts with Fe-contents ≥0.27 wt%. It is characterized by a very broad singlet, which has been assigned to incomplete FeN(4)-like sites that quickly dissolve in contact with an acid. Among the five Fe-species identified in these catalysts, only D1 and D3 display catalytic activity for the oxygen reduction reaction (ORR) in the acid medium, with D3 featuring a composite structure with a protonated neighbour basic nitrogen and being by far the most active species, with an estimated turn over frequency for the ORR of 11.4 e(-) per site per s at 0.8 V vs. RHE. Moreover, all D1 sites and between 1/2 and 2/3 of the D3 sites are acid-resistant. A scheme for the mechanism of site formation upon heat-treatment is also proposed. This identification of the ORR-active sites in these catalysts is of crucial importance to design strategies to improve the catalytic activity and stability of these materials.

Who's on base? Revealing the catalytic mechanism of inverting family 6 glycoside hydrolases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mayes, Heather B.; Knott, Brandon C.; Crowley, Michael F.

In several important classes of inverting carbohydrate-active enzymes, the identity of the catalytic base remains elusive, including in family 6 Glycoside Hydrolase (GH6) enzymes, which are key components of cellulase cocktails for cellulose depolymerization. Despite many structural and kinetic studies with both wild-type and mutant enzymes, especially on the Trichoderma reesei (Hypocrea jecorina) GH6 cellulase ( TrCel6A), the catalytic base in the single displacement inverting mechanism has not been definitively identified in the GH6 family. Here, we employ transition path sampling to gain insight into the catalytic mechanism, which provides unbiased atomic-level understanding of key order parameters involved in cleavingmore » the strong glycosidic bond. Our hybrid quantum mechanics and molecular mechanics (QM/MM) simulations reveal a network of hydrogen bonding that aligns two active site water molecules that play key roles in hydrolysis: one water molecule drives the reaction by nucleophilic attack on the substrate and a second shuttles a proton to the putative base (D175) via a short water wire. We also investigated the case where the putative base is mutated to an alanine, an enzyme that is experimentally still partially active. The simulations predict that proton hopping along a water wire via a Grotthuss mechanism provides a mechanism of catalytic rescue. Further simulations reveal that substrate processive motion is 'driven' by strong electrostatic interactions with the protein at the product sites and that the -1 sugar adopts a 2S O ring configuration as it reaches its binding site. Lastly, this work thus elucidates previously elusive steps in the processive catalytic mechanism of this important class of enzymes.« less

Who's on base? Revealing the catalytic mechanism of inverting family 6 glycoside hydrolases

DOE PAGES

Mayes, Heather B.; Knott, Brandon C.; Crowley, Michael F.; ...

2016-06-01

In several important classes of inverting carbohydrate-active enzymes, the identity of the catalytic base remains elusive, including in family 6 Glycoside Hydrolase (GH6) enzymes, which are key components of cellulase cocktails for cellulose depolymerization. Despite many structural and kinetic studies with both wild-type and mutant enzymes, especially on the Trichoderma reesei (Hypocrea jecorina) GH6 cellulase ( TrCel6A), the catalytic base in the single displacement inverting mechanism has not been definitively identified in the GH6 family. Here, we employ transition path sampling to gain insight into the catalytic mechanism, which provides unbiased atomic-level understanding of key order parameters involved in cleavingmore » the strong glycosidic bond. Our hybrid quantum mechanics and molecular mechanics (QM/MM) simulations reveal a network of hydrogen bonding that aligns two active site water molecules that play key roles in hydrolysis: one water molecule drives the reaction by nucleophilic attack on the substrate and a second shuttles a proton to the putative base (D175) via a short water wire. We also investigated the case where the putative base is mutated to an alanine, an enzyme that is experimentally still partially active. The simulations predict that proton hopping along a water wire via a Grotthuss mechanism provides a mechanism of catalytic rescue. Further simulations reveal that substrate processive motion is 'driven' by strong electrostatic interactions with the protein at the product sites and that the -1 sugar adopts a 2S O ring configuration as it reaches its binding site. Lastly, this work thus elucidates previously elusive steps in the processive catalytic mechanism of this important class of enzymes.« less

Dynamic modes of the flipped-out cytosine during HhaI methyltransferase-DNA interactions in solution.

PubMed Central

Klimasauskas, S; Szyperski, T; Serva, S; Wüthrich, K

1998-01-01

Flipping of a nucleotide out of a B-DNA helix into the active site of an enzyme has been observed for the HhaI and HaeIII cytosine-5 methyltransferases (M.HhaI and M.HaeIII) and for numerous DNA repair enzymes. Here we studied the base flipping motions in the binary M. HhaI-DNA and the ternary M.HhaI-DNA-cofactor systems in solution. Two 5-fluorocytosines were introduced into the DNA in the places of the target cytosine and, as an internal control, a cytosine positioned two nucleotides upstream of the recognition sequence 5'-GCGC-3'. The 19F NMR spectra combined with gel mobility data show that interaction with the enzyme induces partition of the target base among three states, i.e. stacked in the B-DNA, an ensemble of flipped-out forms and the flipped-out form locked in the enzyme active site. Addition of the cofactor analogue S-adenosyl-L-homocysteine greatly enhances the trapping of the target cytosine in the catalytic site. Distinct dynamic modes of the target cytosine have thus been identified along the reaction pathway, which includes novel base-flipping intermediates that were not observed in previous X-ray structures. The new data indicate that flipping of the target base out of the DNA helix is not dependent on binding of the cytosine in the catalytic pocket of M.HhaI, and suggest an active role of the enzyme in the opening of the DNA duplex. PMID:9427765

Sharing for Health: A Study of Chinese Adolescents' Experiences and Perspectives on Using Social Network Sites to Share Health Information.

PubMed

Zhang, Ni; Teti, Michele; Stanfield, Kellie; Campo, Shelly

2017-07-01

This exploratory qualitative study examines Chinese adolescents' health information sharing habits on social network sites. Ten focus group meetings with 76 adolescents, ages 12 to 17 years, were conducted at community-based organizations in Chicago's Chinatown. The research team transcribed the recording and analyzed the transcripts using ATLAS.ti. Chinese adolescents are using different social network sites for various topics of health information including food, physical activity, and so on. Adolescents would share useful and/or interesting health information. Many adolescents raised credibility concerns regarding health information and suggested evaluating the information based on self-experience or intuition, word-of-mouth, or information online. The findings shed lights on future intervention using social network sites to promote health among Chinese adolescents in the United States. Future interventions should provide adolescents with interesting and culturally sensitive health information and educate them to critically evaluate health information on social network sites.

Effect of conformational mobility and hydrogen-bonding interactions on the selectivity of some guanidinoaryl-substituted mechanism-based inhibitors of trypsin-like serine proteases.

PubMed

Rai, R; Katzenellenbogen, J A

1992-11-13

Previously, we have reported that some guanidino-substituted alpha- and beta-aryl enol lactones I and II behaved as selective, mechanism-based inhibitors of some trypsin-like proteases (Rai, R.; Katzenellenbogen, J.A. J. Med. Chem., submitted). In this study, we describe the synthesis and kinetic evaluation of some related, guanidino-substituted enol lactones having greater conformational mobility and affording additional hydrogen-bonding sites at the active site. The alpha-aryl-substituted lactones 1 and 2, which have greater conformational mobility in the guanidinoaryl linkage than I, selectively inhibited the trypsin-like enzymes, and they were relatively poor inactivators of alpha-chymotrypsin and human neutrophil elastase (HNE). The iodo enol lactone 2 permanently inactivated trypsin, urokinase, tissue plasminogen activator, and plasmin, showing exceptionally high specificity in its interaction with trypsin and urokinase. The selectivity pattern exhibited by the closely related, conformationally less mobile alpha-aryl-substituted iodo lactone Ib, which was previously shown to be a selective suicide substrate of urokinase and plasmin, provides an interesting comparison. The alpha-benzamido-substituted lactones 3 and 4, which afford an additional site for active-site hydrogen bonding, were found to be very potent alternate substrate inhibitors of trypsin and urokinase. In addition, the iodo lactone 4 permanently inactivated alpha-chymotrypsin. The importance of secondary interactions in increasing the specificities in the case of alpha-chymotrypsin is discussed.

Discovery of small molecule inhibitors of ubiquitin-like poxvirus proteinase I7L using homology modeling and covalent docking approaches

NASA Astrophysics Data System (ADS)

Katritch, Vsevolod; Byrd, Chelsea M.; Tseitin, Vladimir; Dai, Dongcheng; Raush, Eugene; Totrov, Maxim; Abagyan, Ruben; Jordan, Robert; Hruby, Dennis E.

2007-10-01

Essential for viral replication and highly conserved among poxviridae, the vaccinia virus I7L ubiquitin-like proteinase (ULP) is an attractive target for development of smallpox antiviral drugs. At the same time, the I7L proteinase exemplifies several interesting challenges from the rational drug design perspective. In the absence of a published I7L X-ray structure, we have built a detailed 3D model of the I7L ligand binding site (S2-S2' pocket) based on exceptionally high structural conservation of this site in proteases of the ULP family. The accuracy and limitations of this model were assessed through comparative analysis of available X-ray structures of ULPs, as well as energy based conformational modeling. The 3D model of the I7L ligand binding site was used to perform covalent docking and VLS of a comprehensive library of about 230,000 available ketone and aldehyde compounds. Out of 456 predicted ligands, 97 inhibitors of I7L proteinase activity were confirmed in biochemical assays (˜20% overall hit rate). These experimental results both validate our I7L ligand binding model and provide initial leads for rational optimization of poxvirus I7L proteinase inhibitors. Thus, fragments predicted to bind in the prime portion of the active site can be combined with fragments on non-prime side to yield compounds with improved activity and specificity.

Structure-Based Alteration of Substrate Specificity and Catalytic Activity of Sulfite Oxidase from Sulfite Oxidation to Nitrate Reduction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, James A.; Wilson, Heather L.; Rajagopalan, K.V.

Eukaryotic sulfite oxidase is a dimeric protein that contains the molybdenum cofactor and catalyzes the metabolically essential conversion of sulfite to sulfate as the terminal step in the metabolism of cysteine and methionine. Nitrate reductase is an evolutionarily related molybdoprotein in lower organisms that is essential for growth on nitrate. In this study, we describe human and chicken sulfite oxidase variants in which the active site has been modified to alter substrate specificity and activity from sulfite oxidation to nitrate reduction. On the basis of sequence alignments and the known crystal structure of chicken sulfite oxidase, two residues are conservedmore » in nitrate reductases that align with residues in the active site of sulfite oxidase. On the basis of the crystal structure of yeast nitrate reductase, both positions were mutated in human sulfite oxidase and chicken sulfite oxidase. The resulting double-mutant variants demonstrated a marked decrease in sulfite oxidase activity but gained nitrate reductase activity. An additional methionine residue in the active site was proposed to be important in nitrate catalysis, and therefore, the triple variant was also produced. The nitrate reducing ability of the human sulfite oxidase triple mutant was nearly 3-fold greater than that of the double mutant. To obtain detailed structural data for the active site of these variants, we introduced the analogous mutations into chicken sulfite oxidase to perform crystallographic analysis. The crystal structures of the Mo domains of the double and triple mutants were determined to 2.4 and 2.1 {angstrom} resolution, respectively.« less

Electronic Modulation of Electrocatalytically Active Center of Cu7S4 Nanodisks by Cobalt-Doping for Highly Efficient Oxygen Evolution Reaction.

PubMed

Li, Qun; Wang, Xianfu; Tang, Kai; Wang, Mengfan; Wang, Chao; Yan, Chenglin

2017-12-26

Cu-based electrocatalysts have seldom been studied for water oxidation because of their inferior activity and poor stability regardless of their low cost and environmentally benign nature. Therefore, exploring an efficient way to improve the activity of Cu-based electrocatalysts is very important for their practical application. Modifying electronic structure of the electrocatalytically active center of electrocatalysts by metal doping to favor the electron transfer between catalyst active sites and electrode is an important approach to optimize hydrogen and oxygen species adsorption energy, thus leading to the enhanced intrinsic electrocatalytic activity. Herein, Co-doped Cu 7 S 4 nanodisks were synthesized and investigated as highly efficient electrocatalyst for oxygen evolution reaction (OER) due to the optimized electronic structure of the active center. Density-functional theory (DFT) calculations reveal that Co-engineered Cu 7 S 4 could accelerate electron transfer between Co and Cu sites, thus decrease the energy barriers of intermediates and products during OER, which are crucial for enhanced catalytic properties. As expected, Co-engineered Cu 7 S 4 nanodisks exhibit a low overpotential of 270 mV to achieve current density of 10 mA cm -2 as well as decreased Tafel slope and enhanced turnover frequencies as compared to bare Cu 7 S 4 . This discovery not only provides low-cost and efficient Cu-based electrocatalyst by Co doping, but also exhibits an in-depth insight into the mechanism of the enhanced OER properties.

Community Involvement as an Effective Institutional Control at the Weldon Spring Site, a U.S. Department of Energy Office of Legacy Management Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deyo, Y.E.; Pauling, T.

2006-07-01

The U.S. Department of Energy (DOE) Weldon Spring Site Remedial Action Project (WSSRAP) was conducted for the purpose of remediating a portion of a former trinitrotoluene and dinitrotoluene production plant that was operational from 1941 to 1945 and a former uranium refinery that was operational from 1957 to 1966. Surface remediation activities concluded in 2001 with the completion of a 45-acre (.18 square kilometer) on-site engineered disposal facility. Long-term surveillance and maintenance activities at the site were officially transferred to the DOE Office of Legacy Management in 2003. The Weldon Spring Site is located within the St. Louis, Missouri, metropolitanmore » area (population 3 million). DOE's close relationship with surrounding land owners created a need for innovative solutions to long-term surveillance and maintenance issues at the site. Through a Secretarial proclamation, a plan was established for development of a comprehensive public involvement and education program. This program would act as an institutional control to communicate the historical legacy of the site and would make information available about contamination present at the site to guide people in making decisions about appropriate site activities. In August 2002, the Weldon Spring Site Interpretive Center opened to the public with exhibits about the history of the area, the remediation work that was completed, and a site information repository that is available to visitors. In addition, the Hamburg Trail for hiking and biking was constructed as a joint DOE/MDC effort. The 8-mile trail travels through both DOE and MDC property; a series of historical markers posted along its length to communicate the history of the area and the remediation work that was done as part of WSSRAP activities. A ramp and viewing platform with informational plaques were constructed on the disposal cell to provide an additional mechanism for public education. With a basic marketing program, site visitor-ship has been steadily increasing. In 2005, approximately 15,400 visitors were associated with Interpretive Center operations and outreach activities. Science-oriented educational programs that directly relate to past remediation activities and present long-term surveillance and maintenance issues have been developed and are presented to St. Louis area school groups and other community-based organizations. Other innovative programs have been developed to address daily maintenance issues at the site and to promote beneficial community re-use of the property. Approximately 30,000 square feet of the former Administration Building has been transferred through a use-permit to Lindenwood University, a local institution with a total enrollment of about 12,000 students. Lindenwood is establishing a satellite college campus in the building in exchange for providing basic maintenance and payment of utilities for both the Administration Building and Interpretive Center. A volunteer program developed to address maintenance of the native plant gardens that surround the Interpretive Center has a current enrollment of approximately 25 volunteers. Another volunteer group of prairie ecosystem experts has been meeting regularly for the last 3 years to assist the site in long-term management of the established prairie surrounding the disposal cell. Public support of these community involvement activities at the site is strong. DOE has worked closely with the Weldon Spring Citizens Commission in developing the concepts for this approach and the Commission has helped promote these activities within the community. It is expected that continued public education in this manner will only serve to strengthen the institutional control commitments at the Weldon Spring Site. (authors)« less

Reduced repair capacity of a DNA clustered damage site comprised of 8-oxo-7,8-dihydro-2'-deoxyguanosine and 2-deoxyribonolactone results in an increased mutagenic potential of these lesions

DOE PAGES

Cunniffe, Siobhan; O’Neill, Peter; Greenberg, Marc M.; ...

2014-04-01

A signature of ionizing radiation is the induction of DNA clustered damaged sites. Non-double strand break (DSB) clustered damage has been shown to compromise the base excision repair pathway, extending the lifetimes of the lesions within the cluster, compared to isolated lesions. This increases the likelihood the lesions persist to replication and thus increasing the mutagenic potential of the lesions within the cluster. Lesions formed by ionizing radiation include 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) and 2-deoxyribonolactone (dL). dL poses an additional challenge to the cell as it is not repaired by the short-patch base excision repair pathway. Here we show recalcitrant dL repairmore » is reflected in mutations observed when DNA containing it and a proximal 8-oxodGuo is replicated in Escherichia coli. 8-oxodGuo in close proximity to dL on the opposing DNA strand results in an enhanced frequency of mutation of the lesions within the cluster and a 20 base sequence flanking the clustered damage site in an E. coli based plasmid assay. In vitro repair of a dL lesion is reduced when compared to the repair of an abasic (AP) site and a tetrahydrofuran (THF), and this is due mainly to a reduction in the activity of polymerase β, leading to retarded FEN1 and ligase 1 activities. This study has given insights in to the biological effects of clusters containing dL.« less

Human cells contain a factor that facilitates the DNA glycosylase-mediated excision of oxidized bases from occluded sites in nucleosomes.

PubMed

Maher, R L; Marsden, C G; Averill, A M; Wallace, S S; Sweasy, J B; Pederson, D S

2017-09-01

Reactive oxygen species generate some 20,000 base lesions per human cell per day. The vast majority of these potentially mutagenic or cytotoxic lesions are subject to base excision repair (BER). Although chromatin remodelers have been shown to enhance the excision of oxidized bases from nucleosomes in vitro, it is not clear that they are recruited to and act at sites of BER in vivo. To test the hypothesis that cells possess factors that enhance BER in chromatin, we assessed the capacity of nuclear extracts from human cells to excise thymine glycol (Tg) lesions from exogenously added, model nucleosomes. The DNA glycosylase NTHL1 in these extracts was able to excise Tg from both naked DNA and sites in nucleosomes that earlier studies had shown to be sterically accessible. However, the same extracts were able to excise lesions from sterically-occluded sites in nucleosomes only after the addition of Mg 2+ /ATP. Gel mobility shift assays indicated that nucleosomes remain largely intact following the Mg 2+ /ATP -dependent excision reaction. Size exclusion chromatography indicated that the NTHL1-stimulating activity has a relatively low molecular weight, close to that of NTHL1 and other BER glycosylases; column fractions that contained the very large chromatin remodeling complexes did not exhibit this same stimulatory activity. These results indicate that cells possess a factor(s) that promotes the initiation of BER in chromatin, but differs from most known chromatin remodeling complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

Efficacy of a Pilot Internet-Based Weight Management Program (H.E.A.L.T.H.) and Longitudinal Physical Fitness Data in Army Reserve Soldiers

PubMed Central

Newton, Robert L; Han, Hongmei; Stewart, Tiffany M; Ryan, Donna H; Williamson, Donald A

2011-01-01

Background The primary aims of this article are to describe the utilization of an Internet-based weight management Web site [Healthy Eating, Activity, and Lifestyle Training Headquarters (H.E.A.L.T.H.)] over a 12–27 month period and to describe concurrent weight and fitness changes in Army Reserve soldiers. Methods The H.E.A.L.T.H. Web site was marketed to Army Reserve soldiers via a Web site promotion program for 27 months (phase I) and its continued usage was observed over a subsequent 12-month period (phase II). Web site usage was obtained from the H.E.A.L.T.H. Web site. Weight and fitness data were extracted from the Regional Level Application Software (RLAS). Results A total of 1499 Army Reserve soldiers registered on the H.E.A.L.T.H. Web site. There were 118 soldiers who returned to the H.E.A.L.T.H. Web site more than once. Registration rate reduced significantly following the removal of the Web site promotion program. During phase I, 778 Army Reserve soldiers had longitudinal weight and fitness data in RLAS. Men exceeding the screening table weight gained less weight compared with men below it (p < .007). Percentage change in body weight was inversely associated with change in fitness scores. Conclusions The Web site promotion program resulted in 52% of available Army Reserve soldiers registering onto the H.E.A.L.T.H. Web site, and 7.9% used the Web site more than once. The H.E.A.L.T.H. Web site may be a viable population-based weight and fitness management tool for soldier use. PMID:22027327

U.S. Tank Platoon Training for the 1987 Canadian Army Trophy (CAT) competition Using a Simulation Networking (SIMNET) System

DTIC Science & Technology

1987-10-01

will be addressed as the Testbed is constructed: 0. (1) How can a large cluster of simulators be networked at a singie " site ? [For example, a battalion... network and its subject LAN sites networked with Lt-N technology. *-" m-artter were based umDn technical and military There will be 324 simulators in all...If all sites "Cori consicerations. were active at one time, 1,400 troops would be involved- The technical assessment was that a local area network

Structure based drug design: development of potent and selective factor IXa (FIXa) inhibitors.

PubMed

Wang, Shouming; Beck, Richard; Burd, Andrew; Blench, Toby; Marlin, Frederic; Ayele, Tenagne; Buxton, Stuart; Dagostin, Claudio; Malic, Maja; Joshi, Rina; Barry, John; Sajad, Mohammed; Cheung, Chiming; Shaikh, Shaheda; Chahwala, Suresh; Chander, Chaman; Baumgartner, Christine; Holthoff, Hans-Peter; Murray, Elizabeth; Blackney, Michael; Giddings, Amanda

2010-02-25

On the basis of our understanding on the binding interactions of the benzothiophene template within the FIXa active site by X-ray crystallography and molecular modeling studies, we developed our SAR strategy by targeting the 4-position of the template to access the S1 beta and S2-S4 sites. A number of highly selective and potent factor Xa (FXa) and FIXa inhibitors were identified by simple switch of functional groups with conformational changes toward the S2-S4 sites.

United States Air Force 611th Air Support Group/Civil Engineering Squadron, Elmendorf AFB, Alaska. Decision document for no further response action planned Oliktok Point Radar Installation, Alaska. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karmi, S.

1996-06-03

This Decision Document discusses the selection of no further action as the recommended action for four sites located at the Oliktok Point radar installation. The United States Air Force (Air Force) completed a Remedial Investigation/Feasibility Study and a Risk Assessment for the eight sites located at the Oliktok Point installation (U.S. Air Force 1996a,b). Based on the findings of these activities, four sites are recommended for no further action.

Investigation of prototypal MOFs consisting of polyhedral cages with accessible Lewis-acid sites for quinoline synthesis.

PubMed

Gao, Wen-Yang; Leng, Kunyue; Cash, Lindsay; Chrzanowski, Matthew; Stackhouse, Chavis A; Sun, Yinyong; Ma, Shengqian

2015-03-21

A series of prototypal metal-organic frameworks (MOFs) consisting of polyhedral cages with accessible Lewis-acid sites, have been systematically investigated for Friedländer annulation reaction, a straightforward approach to synthesizing quinoline and its derivatives. Amongst them MMCF-2 demonstrates significantly enhanced catalytic activity compared with the benchmark MOFs, HKUST-1 and MOF-505, as a result of a high-density of accessible Cu(II) Lewis acid sites and large window size in the cuboctahedral cage-based nanoreactor of MMCF-2.

Incentives and barriers to physical activity for working women.

PubMed

Jaffee, L; Lutter, J M; Rex, J; Hawkes, C; Bucaccio, P

1999-01-01

A questionnaire was completed by 393 working women to examine incentives and barriers to physical activity based on the stages of change from the transtheoretical model. Using Chi Square tests, differences were found across the five stages suggesting that work site programs be designed and tailored for women at different stages of readiness.

An Evaluation of Diet and Physical Activity Messaging in African American Churches

ERIC Educational Resources Information Center

Harmon, Brook E.; Blake, Christine E.; Thrasher, James F.; Hébert, James R.

2014-01-01

The use of faith-based organizations as sites to deliver diet and physical activity interventions is increasing. Methods to assess the messaging environment within churches are limited. Our research aimed to develop and test an objective assessment methodology to characterize health messages, particularly those related to diet and physical…

Teaching Science Methods Courses with Web-Enhanced Activities.

ERIC Educational Resources Information Center

Bodzin, Alec M.

Learning science in today's classroom does not have to be restricted to text-based curricular resources. Web sites present learners with a wide range of science activities in various formats ranging from text-only information to providing authentic real-time data sets and interactive simulations. This paper discusses reasons for using the Internet…

Literature Ladders: Linking Books and Internet Resources.

ERIC Educational Resources Information Center

Lamb, Annette

2001-01-01

Describes Literature Learning Ladders, a project that uses books for children and young adults as the focal point for technology-rich thematic activities. Explains the use of Internet Web sites to find book information as well as sties that demonstrate how resources can be used as part of technology-based classroom activities. (LRW)

Modulation of amylose content by structure-based modification of OsGBSS1 activity in rice (Oryza sativa L.).

PubMed

Liu, Derui; Wang, Wei; Cai, Xiuling

2014-12-01

The rice Waxy (Wx) gene encodes granule-bound starch synthase 1 (EC 2.4.1.242), OsGBSS1, which is responsible for amylose synthesis in rice seed endosperm. In this study, we determined the functional contribution of eight amino acids on the activity of OsGBSS1 by introducing site-directed mutated Wx gene constructs into the wx mutant glutinous rice. The eight amino acid residues are suspected to play roles in OsGBSS1 structure maintenance or function based on homologous enzyme sequence alignment and homology modelling. Both OsGBSS1 activity and amylose content were analysed in homozygous transgenic lines carrying the mutated OsGBSS1 (Wx) genes. Our results indicate that mutations at diverse sites in OsGBSS1 reduces its activity by affecting its starch-binding capacity, its ADP-glucose-binding capability or its protein stability. Our results shed new light on the structural basis of OsGBSS1 activity and the mechanisms of OsGBSS1 activity on amylose synthesis in vivo. This study also demonstrates that it is feasible to finely modulate amylose content in rice grains by modifying the OsGBSS1 activity. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

ROLE OF HCL IN ADSORPTION OF ELEMENTAL MERCURY VAPOR BY CALCIUM-BASED SORBENTS

EPA Science Inventory

The paper gives results of a study to identify active sites and surface functional groups that may contribute to the adsorption of elemental mercury (Hg?) by relatively inexpensive calcium (Ca)-based sorbents. (NOTE: Hg? capture has been mostly investigated using high-surface-ar...

Constraints and Approach for Selecting the Mars Surveyor '01 Landing Site

NASA Technical Reports Server (NTRS)

Golombek, M.; Bridges, N.; Gilmore, M.; Haldemann, A.; Parker, T.; Saunders, R.; Spencer, D.; Smith, J.; Weitz, C.

1999-01-01

There are many similarities between the Mars Surveyor '01 (MS '01) landing site selection process and that of Mars Pathfinder. The selection process includes two parallel activities in which engineers define and refine the capabilities of the spacecraft through design, testing and modeling and scientists define a set of landing site constraints based on the spacecraft design and landing scenario. As for Pathfinder, the safety of the site is without question the single most important factor, for the simple reason that failure to land safely yields no science and exposes the mission and program to considerable risk. The selection process must be thorough and defensible and capable of surviving multiple withering reviews similar to the Pathfinder decision. On Pathfinder, this was accomplished by attempting to understand the surface properties of sites using available remote sensing data sets and models based on them. Science objectives are factored into the selection process only after the safety of the site is validated. Finally, as for Pathfinder, the selection process is being done in an open environment with multiple opportunities for community involvement including open workshops, with education and outreach opportunities.

Constraints, Approach and Present Status for Selecting the Mars Surveyor 2001 Landing Site

NASA Technical Reports Server (NTRS)

Golombek, M.; Anderson, F.; Bridges, N.; Briggs, G.; Gilmore, M.; Gulick, V.; Haldemann, A.; Parker, T.; Saunders, R.; Spencer, D.;

Are the Viking Lander sites representative of the surface of Mars?

NASA Technical Reports Server (NTRS)

Jakosky, B. M.; Christensen, P. R.

1986-01-01

Global remote sensing data of the Martian surface, collected by earth- and satellite-based instruments, are compared with data from the two Viking Landers to determine if the Lander data are representative of the Martian surface. The landing sites are boulder-strewn and feature abundant fine material and evidence of strong eolian forces. One site (VL-1) is in a plains-covered basin which is associated with volcanic activity; the VL-2 site is in the northern plains. Thermal IR, broadband albedo, color imaging and radar remote sensing has been carried out of the global Martian surface. The VL-1 data do not fit a general correlation observed between increases in 70-cm radar cross-sections and thermal inertia. A better fit is found with 12.5-cm cross sections, implying the presence of a thinner or discontinuous duricrust at the VL-1 site, compared to other higher-inertia regions. A thin dust layer is also present at the VL-2 site, based on the Lander reflectance data. The Lander sites are concluded to be among the three observed regions of anomalous reflectivity, which can be expected in low regions selected for the landings. Recommendations are furnished for landing sites of future surface probes in order to choose sites more typical of the global Martian surface.

Closure Report for Corrective Action Unit 536: Area 3 Release Site, Nevada Test Site, Nevada

DOE Office of Scientific and Technical Information (OSTI.GOV)

NSTec Environmental Restoration

Corrective Action Unit (CAU) 536 is located in Area 3 of the Nevada Test Site. CAU 536 is listed in the Federal Facility Agreement and Consent Order of 1996 as Area 3 Release Site, and comprises a single Corrective Action Site (CAS): {sm_bullet} CAS 03-44-02, Steam Jenny Discharge The Nevada Division of Environmental Protection (NDEP)-approved corrective action alternative for CAS 03-44-02 is clean closure. Closure activities included removing and disposing of total petroleum hydrocarbon (TPH)- and polyaromatic hydrocarbon (PAH)-impacted soil, soil impacted with plutonium (Pu)-239, and concrete pad debris. CAU 536 was closed in accordance with the NDEP-approved CAU 536more » Corrective Action Plan (CAP), with minor deviations as approved by NDEP. The closure activities specified in the CAP were based on the recommendations presented in the CAU 536 Corrective Action Decision Document (U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office, 2004). This Closure Report documents CAU 536 closure activities. During closure activities, approximately 1,000 cubic yards (yd3) of hydrocarbon waste in the form of TPH- and PAH-impacted soil and debris, approximately 8 yd3 of Pu-239-impacted soil, and approximately 100 yd3 of concrete debris were generated, managed, and disposed of appropriately. Additionally, a previously uncharacterized, buried drum was excavated, removed, and disposed of as hydrocarbon waste as a best management practice. Waste minimization techniques, such as the utilization of laboratory analysis to characterize and classify waste streams, were employed during the performance of closure« less

An isoleucine to leucine mutation that switches the cofactor requirement of the EcoRV restriction endonuclease from magnesium to manganese.

PubMed

Vipond, I B; Moon, B J; Halford, S E

1996-02-13

The EcoRV restriction endonuclease cleaves DNA at its recognition sequence more readily with Mg2+ as the cofactor than with Mn2+ but, at noncognate sequences that differ from the EcoRV site by one base pair, Mn2+ gives higher rates than Mg2+. A mutant of EcoRV, in which an isoleucine near the active site was replaced by leucine, showed the opposite behavior. It had low activity with Mg2+, but, in the presence of Mn2+ ions, it cleaved the recognition site faster than wild-type EcoRV with either Mn2+ or Mg2+. The mutant was also more specific for the recognition sequence than the native enzyme: the noncognate DNA cleavages by wild-type EcoRV and Mn2+ were not detected with the mutant. Further mutagenesis showed that the protein required the same acidic residues at its active site as wild-type EcoRV. The Ile-->Leu mutation seems to perturb the configuration of the metal-binding ligands at the active site so that the protein has virtually no affinity for Mg2+ yet it can still bind Mn2+ ions, though the latter only occurs when the protein is at the recognition site. This contrasts to wild-type EcoRV, where Mn2+ ions bind readily to complexes with either cognate and noncognate DNA and only Mg2+ shows the discrimination between the complexes. The structural perturbation is a specific consequence of leucine in place of isoleucine, since mutants with valine or alanine were similar to wild-type EcoRV.

Crystal Structure and Functional Analysis of Homocitrate Synthase, an Essential Enzyme in Lysine Biosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bulfer, Stacie L.; Scott, Erin M.; Couture, Jean-François

2010-01-12

Homocitrate synthase (HCS) catalyzes the first and committed step in lysine biosynthesis in many fungi and certain Archaea and is a potential target for antifungal drugs. Here we report the crystal structure of the HCS apoenzyme from Schizosaccharomyces pombe and two distinct structures of the enzyme in complex with the substrate 2-oxoglutarate (2-OG). The structures reveal that HCS forms an intertwined homodimer stabilized by domain-swapping between the N- and C-terminal domains of each monomer. The N-terminal catalytic domain is composed of a TIM barrel fold in which 2-OG binds via hydrogen bonds and coordination to the active site divalent metalmore » ion, whereas the C-terminal domain is composed of mixed {alpha}/{beta} topology. In the structures of the HCS apoenzyme and one of the 2-OG binary complexes, a lid motif from the C-terminal domain occludes the entrance to the active site of the neighboring monomer, whereas in the second 2-OG complex the lid is disordered, suggesting that it regulates substrate access to the active site through its apparent flexibility. Mutations of the active site residues involved in 2-OG binding or implicated in acid-base catalysis impair or abolish activity in vitro and in vivo. Together, these results yield new insights into the structure and catalytic mechanism of HCSs and furnish a platform for developing HCS-selective inhibitors.« less

Rapid urease test (RUT) for evaluation of urease activity in oral bacteria in vitro and in supragingival dental plaque ex vivo.

PubMed

Dahlén, Gunnar; Hassan, Haidar; Blomqvist, Susanne; Carlén, Anette

2018-05-18

Urease is an enzyme produced by plaque bacteria hydrolysing urea from saliva and gingival exudate into ammonia in order to regulate the pH in the dental biofilm. The aim of this study was to assess the urease activity among oral bacterial species by using the rapid urease test (RUT) in a micro-plate format and to examine whether this test could be used for measuring the urease activity in site-specific supragingival dental plaque samples ex vivo. The RUT test is based on 2% urea in peptone broth solution and with phenol red at pH 6.0. Oral bacterial species were tested for their urease activity using 100 μl of RUT test solution in the well of a micro-plate to which a 1 μl amount of cells collected after growth on blood agar plates or in broth, were added. The color change was determined after 15, 30 min, and 1 and 2 h. The reaction was graded in a 4-graded scale (none, weak, medium, strong). Ex vivo evaluation of dental plaque urease activity was tested in supragingival 1 μl plaque samples collected from 4 interproximal sites of front teeth and molars in 18 adult volunteers. The color reaction was read after 1 h in room temperature and scored as in the in vitro test. The strongest activity was registered for Staphylococcus epidermidis, Helicobacter pylori, Campylobacter ureolyticus and some strains of Haemophilus parainfluenzae, while known ureolytic species such as Streptococcus salivarius and Actinomyces naeslundii showed a weaker, variable and strain-dependent activity. Temperature had minor influence on the RUT reaction. The interproximal supragingival dental plaque between the lower central incisors (site 31/41) showed significantly higher scores compared to between the upper central incisors (site 11/21), between the upper left first molar and second premolar (site 26/25) and between the lower right second premolar and molar (site 45/46). The rapid urease test (RUT) in a micro-plate format can be used as a simple and rapid method to test urease activity in bacterial strains in vitro and as a chair-side method for testing urease activity in site-specific supragingival plaque samples ex vivo.

Analysis of streamflow-gaging network for monitoring stormwater in small streams in the Puget Sound Basin, Washington

USGS Publications Warehouse

Konrad, Christopher P.; Voss, Frank D.

2012-01-01

The streamflow-gaging network in the Puget Sound basin was analyzed for its capacity to monitor stormwater in small streams. The analysis consisted of an inventory of active and inactive gages and an evaluation of the coverage and resolution of the gaging network with an emphasis on lowland areas. The active gaging network covers much of the Puget Lowland largely by gages located at sites on larger streams and rivers. Assessments of stormwater impacts and management will likely require streamflow information with higher spatial resolution than provided by the current gaging network. Monitoring that emphasizes small streams in combination with approaches for estimating streamflow at ungaged sites provides an alternative to expanding the current gaging network that can improve the spatial resolution of streamflow information in the region. The highest priority gaps in the gaging network are low elevation basins close to the Puget Sound shoreline and sites that share less than 10 percent of the drainage area of an active gage. Although small, lowland sites with long records of streamflow are particularly valuable to maintain in the region, other criteria for prioritizing sites in the gaging network should be based on the specific questions that stormwater managers need to answer.

Site Safety Plan for Lawrence Livermore National Laboratory CERCLA investigations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bainer, R.; Duarte, J.

1993-07-01

The safety policy of LLNL is to take every reasonable precaution in the performance of work to protect the environment and the health and safety of employees and the public, and to prevent property damage. With respect to hazardous agents, this protection is provided by limiting human exposures, releases to the environment, and contamination of property to levels that are as low as reasonably achievable (ALARA). It is the intent of this Plan to supply the broad outline for completing environmental investigations within ALARA guidelines. It may not be possible to determine actual working conditions in advance of the work;more » therefore, planning must allow the opportunity to provide a range of protection based upon actual working conditions. Requirements will be the least restrictive possible for a given set of circumstances, such that work can be completed in an efficient and timely fashion. Due to the relatively large size of the LLNL Site and the different types of activities underway, site-specific Operational Safety Procedures (OSPs) will be prepared to supplement activities not covered by this Plan. These site-specific OSPs provide the detailed information for each specific activity and act as an addendum to this Plan, which provides the general plan for LLNL Main Site operation.« less

Allosteric modulation of ATP-gated P2X receptor channels

PubMed Central

Coddou, Claudio; Stojilkovic, Stanko S.; Huidobro-Toro, J. Pablo

2013-01-01

Seven mammalian purinergic receptor subunits, denoted P2X1 to P2X7, and several spliced forms of these subunits have been cloned. When heterologously expressed, these cDNAs encode ATP-gated non-selective cation channels organized as trimers. All activated receptors produce cell depolarization and promote Ca2+ influx through their pores and indirectly by activating voltage-gated calcium channels. However, the biophysical and pharmacological properties of these receptors differ considerably, and the majority of these subunits are also capable of forming heterotrimers with other members of the P2X receptor family, which confers further different properties. These channels have three ATP binding domains, presumably located between neighboring subunits, and occupancy of at least two binding sites is needed for their activation. In addition to the orthosteric binding sites for ATP, these receptors have additional allosteric sites that modulate the agonist action at receptors, including sites for trace metals, protons, neurosteroids, reactive oxygen species and phosphoinositides. The allosteric regulation of P2X receptors is frequently receptor-specific and could be a useful tool to identify P2X members in native tissues and their roles in signaling. The focus of this review is on common and receptor-specific allosteric modulation of P2X receptors and the molecular base accounting for allosteric binding sites. PMID:21639805

Illumina Amplicon Sequencing of 16S rRNA Tag Reveals Bacterial Community Development in the Rhizosphere of Apple Nurseries at a Replant Disease Site and a New Planting Site

PubMed Central

Sun, Jian; Zhang, Qiang; Zhou, Jia; Wei, Qinping

2014-01-01

We used a next-generation, Illumina-based sequencing approach to characterize the bacterial community development of apple rhizosphere soil in a replant site (RePlant) and a new planting site (NewPlant) in Beijing. Dwarfing apple nurseries of ‘Fuji’/SH6/Pingyitiancha trees were planted in the spring of 2013. Before planting, soil from the apple rhizosphere of the replant site (ReSoil) and from the new planting site (NewSoil) was sampled for analysis on the Illumina MiSeq platform. In late September, the rhizosphere soil from both sites was resampled (RePlant and NewPlant). More than 16,000 valid reads were obtained for each replicate, and the community was composed of five dominant groups (Proteobacteria, Acidobacteria, Bacteroidetes, Gemmatimonadetes and Actinobacteria). The bacterial diversity decreased after apple planting. Principal component analyses revealed that the rhizosphere samples were significantly different among treatments. Apple nursery planting showed a large impact on the soil bacterial community, and the community development was significantly different between the replanted and newly planted soils. Verrucomicrobia were less abundant in RePlant soil, while Pseudomonas and Lysobacter were increased in RePlant compared with ReSoil and NewPlant. Both RePlant and ReSoil showed relatively higher invertase and cellulase activities than NewPlant and NewSoil, but only NewPlant soil showed higher urease activity, and this soil also had the higher plant growth. Our experimental results suggest that planting apple nurseries has a significant impact on soil bacterial community development at both replant and new planting sites, and planting on new site resulted in significantly higher soil urease activity and a different bacterial community composition. PMID:25360786

Dynamics of current-use pesticides in the agricultural model basin

NASA Astrophysics Data System (ADS)

Perez, Debora; Okada, Elena; Menone, Mirta; Aparicio, Virginia; Costa, Jose Luis

2017-04-01

The southeast of the Pampas plains is a zone with intensive agricultural activities; this zone is highly irrigated by wetlands, rivers and many streams. The stream flow dynamics are strongly related to the regional humidity, mainly given by runoff water and phreatic surface level, and can change dramatically during storm events. In this sense, it is important to study the fluctuations in the loads and mass of current-use pesticide (CUPs) to examine the influence of hydrologic and seasonal variability on the response of pesticide levels. The objective of this work was to determine the maximum loads reached of ∑CUPs and mass of CUPs associated with the flow dynamic in surface waters of "El Crespo" stream. "El Crespo" stream is only influenced by farming activities, with intensive crop systems upstream (US) and extensive livestock production downstream (DS). It is an optimal site for pesticide monitoring studies since there are no urban or industrial inputs into the system. Water samples were collected monthly from October 2014 to October 2015 in the UP and DN sites using 1 L polypropylene bottles and stored at -20°C until analysis. The samples were analyzed using liquid chromatography coupled to a tandem mass spectrometer (UPLC-MS/MS). The stream flow was measured during the sampling times in both sites, covering low base-flow and high base-flow periods. The most frequently detected residues (>40%) were glyphosate and its metabolite AMPA, atrazine, acetochlor, metolachlor, 2,4-D, metsulfuron methyl, fluorocloridone, imidacloprid, tebuconazole and epoxiconazole. The mean concentrations of ∑CUPs during the sampling period were 1.62µg/L and 1.66µg/L in UP site and DN site, respectively. The highest levels of ∑CUPs were 4.03 µg/L in UP site during spring 2014 and 2.53 µg/L in DN site during winter 2014. The mass of ∑CUPs showed a direct relation between low base flow and high base flow periods. During high base flow during spring 2014, the stream discharge showed peak of 6.16 mt3/s and 6.77 mt3/s, in UP and DN site, respectively; where the total loads of ∑CUPs were 3.7 µg/L and 2.88 µg/L and the associated mass were 22.74 and 19.54 µg/s, in UP and DN site, respectively. During low base flow the discharge were lower than 1 mt3/s and the total loads of ∑CUPs were variable between 1-3 µg/L, but the mass never were higher than 3 µg/s. The intensive rain during the spring 2014, were the mainly factor that influence the stream flow and pesticide dynamics in the model basin

Source-based neurofeedback methods using EEG recordings: training altered brain activity in a functional brain source derived from blind source separation

PubMed Central

White, David J.; Congedo, Marco; Ciorciari, Joseph

2014-01-01

A developing literature explores the use of neurofeedback in the treatment of a range of clinical conditions, particularly ADHD and epilepsy, whilst neurofeedback also provides an experimental tool for studying the functional significance of endogenous brain activity. A critical component of any neurofeedback method is the underlying physiological signal which forms the basis for the feedback. While the past decade has seen the emergence of fMRI-based protocols training spatially confined BOLD activity, traditional neurofeedback has utilized a small number of electrode sites on the scalp. As scalp EEG at a given electrode site reflects a linear mixture of activity from multiple brain sources and artifacts, efforts to successfully acquire some level of control over the signal may be confounded by these extraneous sources. Further, in the event of successful training, these traditional neurofeedback methods are likely influencing multiple brain regions and processes. The present work describes the use of source-based signal processing methods in EEG neurofeedback. The feasibility and potential utility of such methods were explored in an experiment training increased theta oscillatory activity in a source derived from Blind Source Separation (BSS) of EEG data obtained during completion of a complex cognitive task (spatial navigation). Learned increases in theta activity were observed in two of the four participants to complete 20 sessions of neurofeedback targeting this individually defined functional brain source. Source-based EEG neurofeedback methods using BSS may offer important advantages over traditional neurofeedback, by targeting the desired physiological signal in a more functionally and spatially specific manner. Having provided preliminary evidence of the feasibility of these methods, future work may study a range of clinically and experimentally relevant brain processes where individual brain sources may be targeted by source-based EEG neurofeedback. PMID:25374520